dsRNA, its preparation method and use

Abstract

dsRNA, its preparation method and use. Pharmaceutical composition, cells or reagent kits containing said dsRNA. The dsRNA can interfere with the expression of HBV genes and prevent and / or treat related diseases.

Description

[Technical field]

[0001] This disclosure claims priority to Chinese patent application No. 202111542797.4, filed on December 16, 2021, the entire text of which is incorporated herein by reference.

[0002] The present disclosure relates to dsRNA that can be delivered to cells in a targeted manner to play a role in RNA interference.The present disclosure also relates to the preparation method and use of dsRNA. [Background technology]

[0003] RNA interference (RNAi) is an efficient method of silencing gene expression. Statistics show that more than 80% of disease-related proteins in the human body cannot currently be targeted by conventional small molecule drugs and large biological molecule drugs, and therefore belong to the undruggable proteins. With RNA interference technology, appropriate siRNA can be designed according to the mRNAs encoding these proteins, and the target mRNA can be specifically targeted and degraded to achieve inhibition of the production of the relevant protein. Therefore, siRNA has great potential for drug development. However, in order to achieve therapeutic RNA interference effects in the body, it is necessary to deliver siRNA molecules to specific cells in the body.

[0004] Adopting targeting ligand-complexed siRNA and using the targeting ligand to bind receptor molecules on the cell membrane surface and endocytosis is an effective drug delivery method. For example, asialoglycoprotein receptor (ASGPR) is a hepatocyte-specific receptor that has high abundance on the hepatocyte surface and is characterized by rapid intracellular and extracellular turnover. Monosaccharide and polysaccharide molecules such as galactose, galactosamine, and N-acetylgalactosamine have high affinity for ASGPR. According to the literature (10.16476 / j.pibb.2015.0028), aminogalactose molecular clusters (GalNAc) can be used to efficiently deliver siRNA to hepatocytes, and GalNAc molecules designed as trivalent or tetravalent molecular clusters can significantly increase the ability of monovalent or divalent GalNAc molecules to target hepatocytes.

[0005] Different molecular cluster structures and different linking modes to RNA obviously affect the activity of siRNA in the body, and higher activity means better therapeutic effect or lower dosage. With the same efficacy, lower dosage means lower toxic response. Summary of the Invention

[0006] dsRNA In a first aspect, the present disclosure provides a dsRNA comprising an siRNA and one or more ligands conjugated thereto, said siRNA comprising a sense strand and an antisense strand, said antisense strand comprising a chemical modification as shown in formula (I), a tautomer modification thereof, or a pharma- ceutically acceptable salt thereof, at at least one nucleotide position 2 to 8 from its 5' end; [ka] wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; J2 is H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) P R6, wherein R6 is selected from OH, halogen, a methoxy group, an ethoxy group, N3, a C2-C6 alkenyl group, and a C2-C6 alkynyl group, and p=1, 2, or 3; Q1 is [ka] , Q2 is R2, or Q1 is R2, Q2 is [ka] and Among them, R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; J1 is H or a C1-C6 alkyl group; R2 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is a base, The chemical modification as shown in the above formula (I), its tautomer or its pharma- ceutically acceptable salt modification, [ka] Instead, The ligand is a compound of formula (II) or a pharma- ceutically acceptable salt thereof, [ka] Of these, L1 is C1-C 30 C1-C which is an alkyl chain or is interrupted by one or more oxygen, sulfur, nitrogen atoms or C=O. 30 Contains an alkyl chain, R 11 and R 12 are independently chemical bonds, NR 16 , C=O or -OC(=O)-, Q3 is, [ka] and [ka] is a single bond or a double bond, and [ka] is a single bond, R 13 is independently CR 17 R 18 , N.R. 16 , O or S; [ka] If is a double bond, R 13 is independently CR 19 or N, R 14 is independently CR 19 or N, Ring A is a cycloalkyl group, a heterocycloalkyl group, an aryl group, or a heteroaryl group, which may or may not be present, and when Ring A is present, R 15 is independently CR 19or N, and when ring A is absent, R 15 is independently CR 17 R 18 , N.R. 16 or O, R 16 and R 19 are independently hydrogen, deuterium, an alkyl group, an alkoxy group, a cycloalkyl group, a heterocycloalkyl group, an aryl group, a heteroaryl group, SR', S(=O)R', S(=O)2R', S(=O)2NR'(R"), NR'(R"), C(=O)R', C(=O)OR' or C(=O)NR'(R"), wherein the alkyl group, alkoxy group, cycloalkyl group, heterocycloalkyl group, aryl group or heteroaryl group is optionally selected from the group consisting of halogen, hydroxyl group, oxo, nitro group, cyano group, C 1-6 Alkyl group, C 1-6 Alkoxy group, C 3-7 substituted with one or more groups selected from a cycloalkyl group, a 3- to 12-membered heterocycloalkyl group, a 6- to 12-membered aryl group, a 5- to 12-membered heteroaryl group, SR', S(=O)R', S(=O)2R', S(=O)2NR'(R"), NR'(R"), C(=O)R', C(=O)OR' and C(=O)NR'(R"); R 17 and R 18 are independently hydrogen, deuterium, an alkyl group, an alkoxy group, a cycloalkyl group, a heterocycloalkyl group, an aryl group, a heteroaryl group, SR', S(=O)R', S(=O)2R', S(=O)2NR'(R"), NR'(R"), C(=O)R', C(=O)OR' or C(=O)NR'(R"), wherein the alkyl group, alkoxy group, cycloalkyl group, heterocycloalkyl group, aryl group or heteroaryl group is optionally selected from the group consisting of halogen, hydroxyl group, oxo, nitro group, cyano group, C 1-6 Alkyl group, C 1-6 Alkoxy group, C 3-7substituted with one or more groups selected from a cycloalkyl group, a 3- to 12-membered heterocycloalkyl group, a 6- to 12-membered aryl group, a 5- to 12-membered heteroaryl group, SR', S(=O)R', S(=O)2R', S(=O)2NR'(R"), NR'(R"), C(=O)R', C(=O)OR' and C(=O)NR'(R"); R' and R'' are independently hydrogen, deuterium, a hydroxyl group, an alkyl group, an alkoxy group, a cycloalkyl group, a heterocycloalkyl group, an aryl group, or a heteroaryl group, wherein the alkyl group, the alkoxy group, the cycloalkyl group, the heterocycloalkyl group, the aryl group, or the heteroaryl group is optionally substituted with one or more substituents selected from a halogen, a hydroxyl group, an oxo group, a nitro group, and a cyano group; m1, n1, p1 and q1 are independently 0, 1, 2, 3 or 4; B1 is, [ka] and R b1 , R b2 , R b3 , R b4 , R b5 , R b6 and R b7 are independently -C(=O)-, -NHC(=O)-, -C(=O)O-, -C(=O)-(CH2) z8 -O- or -NHC(=O)-(CH2) z9 -O-, z1, z2, z3, z4, z5, z6, z7, z8, and z9 are independently an integer of 0 to 10; L2 is C1-C 30 C1-C which is an alkyl chain or is interrupted by one or more oxygen, sulfur, nitrogen atoms or C=O. 30 Contains an alkyl chain, r1 is an integer from 1 to 10.

[0007] In some embodiments, when X is NH-CO, R1 is not H.

[0008] In some embodiments, the chemical modification according to formula (I) is a chemical modification according to formula (I-1): [ka] wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; Each J1, J2 is independently H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) P R6, wherein R6 is selected from OH, halogen, a methoxy group, an ethoxy group, N3, a C2-C6 alkenyl group, and a C2-C6 alkynyl group, and p=1, 2, or 3; R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; R2 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I).

[0009] In some embodiments of Formula (I-1), B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0010] In some embodiments of formula (I-1), B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0011] In some embodiments of Formula (I-1), B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0012] In some embodiments of formula (I-1), B is the same as the base when the nucleotide at that position in the antisense strand is unmodified.

[0013] In some embodiments, the chemical modification according to formula (I) is a chemical modification according to formula (I-2): [ka] wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each J1, J2 is independently H or a C1-C6 alkyl group; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) P R6, wherein R6 is selected from OH, halogen, a methoxy group, an ethoxy group, N3, a C2-C6 alkenyl group, and a C2-C6 alkynyl group, and p=1, 2, or 3; R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; R2 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, S-CH3, NCH3(CH3), OCH2CH2OCH3, an -O-alkylamino group, and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I).

[0014] In some embodiments of Formula (I-2), B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0015] In some embodiments of formula (I-2), B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0016] In some embodiments of Formula (I-2), B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0017] In some embodiments of formula (I-2), B is the same as the base when the nucleotide at that position in the antisense strand is unmodified.

[0018] In some embodiments, each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C3 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each J1 and J2 is independently H or a C1-C3 alkyl group; R3 is H, OH, halogen, NH2, C1-C3 alkyl group, C1-C3 alkoxy group, C2-C4 alkenyl group, C2-C4 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) p R6, wherein R6 is selected from OH, halogen, a methoxy group, an ethoxy group, N3, a C2-C6 alkenyl group, and a C2-C6 alkynyl group, and p=1, 2, or 3; R1 is H, a C1-C3 alkyl group, a C1-C3 alkoxy group, a C2-C4 alkenyl group, a C2-C4 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C4 alkenyl and C2-C4 alkynyl, and q=1, 2 or 3; R2 is H, OH, halogen, NH2, C1-C3 alkyl group, C1-C3 alkoxy group, C2-C4 alkenyl group, C2-C4 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C4 alkenyl and C2-C4 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I).

[0019] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0020] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0021] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0022] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0023] In some embodiments, each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H, a methyl group, an ethyl group, an n-propyl group, or an isopropyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each of J1 and J2 is independently H or a methyl group; R3 is H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-methylamino, -O-ethylamino, and (CH2). p R6, wherein R6 is selected from OH, F, Cl, a methoxy group, an ethoxy group, N3, a vinyl group, an allyl group, an ethynyl group, and a propargyl group, and p=1 or 2; R1 is H, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, or (CH2) q R7, wherein R7 is selected from OH, F, Cl, a methoxy group, an ethoxy group, N3, a vinyl group, an allyl group, an ethynyl group, and a propargyl group, and q=1 or 2; R2 is H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-methylamino, -O-ethylamino, and (CH2). rR8, wherein R8 is selected from OH, F, Cl, methoxy, ethoxy, N3, vinyl, allyl, ethynyl and propargyl, and r=1 or 2; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I).

[0024] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0025] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0026] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0027] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0028] In some embodiments, Y is O or NH; and each X is independently selected from NH—CO, CH, and NH; n=0 or 1, m=0 or 1, s=0 or 1, Each J1 and J2 is independently H; R1 is selected from H, a methyl group, and CH2OH; R2 is selected from H, OH, NH2, a methyl group, and CH2OH; R3 is selected from H, OH, NH2, a methyl group, and CH2OH; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I).

[0029] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0030] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0031] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0032] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0033] In some embodiments, Y is O or NH; and each X is independently selected from NH—CO, CH, and NH; n=0 or 1, m=0 or 1, s=0 or 1, Each J1 and J2 is independently H; R1 is selected from H, a methyl group, and CH2OH; R2 is selected from H, a methyl group, and CH2OH; R3 is selected from H, OH, NH2, a methyl group, and CH2OH; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I).

[0034] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0035] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0036] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0037] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0038] In some embodiments, Y is O or NH; each X is independently selected from CR4(R4'), NR5, and NH-CO, where R4, R4', and R5 are each independently H or a C1-C6 alkyl group; J2 is H or a C1-C6 alkyl group; n=0 or 1, m=0 or 1, s=0 or 1, R3 is H, OH, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, and (CH2) p R6, where R6 is selected from OH, a methoxy group and an ethoxy group, and p=1, 2 or 3; Q1 is [ka] , Q2 is R2, or Q1 is R2, Q2 is [ka] and R1 is H, OH, C1-C6 alkyl group, C1-C6 alkoxy group, and (CH2) q R7, where R7 is selected from OH, a methoxy group and an ethoxy group, and q=1, 2 or 3; J1 is H or a C1-C6 alkyl group; R2 is H, OH, C1-C6 alkyl group, C1-C6 alkoxy group, and (CH2) r R8, where R8 is selected from OH, methoxy and ethoxy groups, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a 3- to 6-membered ring; B is a base, The chemical modification as shown in the above formula (I), its tautomer or its pharma- ceutically acceptable salt modification, [ka] isn't it.

[0039] In some embodiments, X is independently selected from CR4(R4') and NH-CO.

[0040] In some embodiments, X is independently selected from CR4(R4').

[0041] In some embodiments, R3 is H, a C1-C6 alkyl group, or (CH2) p Selected from R6.

[0042] In some embodiments, R3 is selected from H and a C1-C6 alkyl group.

[0043] In some embodiments, R1 is H, a C1-C6 alkyl group, or (CH2) q Selected from R7.

[0044] In some embodiments, R1 is selected from H and a C1-C6 alkyl group.

[0045] In some embodiments, R2 is H, OH, a C1-C6 alkyl group, or (CH2) r Selected from R8.

[0046] In some embodiments, R2 is H, a C1-C6 alkyl group, or (CH2) r Selected from R8.

[0047] In some embodiments, Y is O, each X is independently selected from CR4(R4') and NH-CO, where R4 and R4' are each independently H or a C1-C6 alkyl group; J2 is H or a C1-C6 alkyl group; R3 is H, C1-C6 alkyl group and (CH2) p R6 is selected from OH, and p=1, 2 or 3; Q1 is [ka] , Q2 is R2, or Q1 is R2, Q2 is [ka] and R1 is H, C1-C6 alkyl group and (CH2) q R7, R7 is selected from OH, and q=1, 2 or 3; J1 is H or a C1-C6 alkyl group; R2 is H, OH, C1-C6 alkyl group and (CH2) rR8, R8 being selected from OH, r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a 5- or 6-membered ring; B is a base.

[0048] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0049] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0050] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0051] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0052] In some embodiments, Y is O, Each X is independently selected from CR(R'), where R and R' are each independently H or a C-C alkyl group; J2 is H, R3 is selected from H and C1-C6 alkyl groups; Q1 is [ka] , Q2 is R2, or Q1 is R2, Q2 is [ka] and R1 is selected from H and C1-C6 alkyl groups; J1 is H or a C1-C6 alkyl group; R2 is H, C1-C6 alkyl group and (CH2) r R8 is selected from OH, and R=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a 5- or 6-membered ring; B is a base.

[0053] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0054] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0055] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0056] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0057] In some embodiments, Y is O.

[0058] In some embodiments, X is independently selected from CR4(R4'), NR5, and NH-CO, and R4, R4', and R5 are each independently H, a methyl group, an ethyl group, an n-propyl group, or an isopropyl group. In some embodiments, X is independently selected from NH-CO, CH2, and NH. In some embodiments, X is independently selected from NH-CO and CH2. In some embodiments, X is CH2.

[0059] In some embodiments, J2 is H or a methyl group. In some embodiments, J2 is H.

[0060] In some embodiments, R3 is H, OH, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, and (CH2) p R6 is selected from OH, methoxy and ethoxy, and p=1 or 2. In some embodiments, R3 is selected from H, methyl, ethyl, n-propyl, isopropyl and (CH2) p R6 is selected from OH, and p=1 or 2. In some embodiments, R3 is selected from H and a methyl group.

[0061] In some embodiments, R1 is H, OH, a methyl group, an ethyl group, a n-propyl group, an isopropyl group, a methoxy group, an ethoxy group, a n-propoxy group, an isopropoxy group, and (CH2) q R7, where R7 is selected from OH and q=1 or 2. In some embodiments, R1 is selected from H, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, and (CH2) q R7, R7 is selected from OH, and q=1 or 2. In some embodiments, R1 is selected from H and a methyl group.

[0062] In some embodiments, R2 is H, OH, a methyl group, an ethyl group, a n-propyl group, an isopropyl group, a methoxy group, an ethoxy group, a n-propoxy group, an isopropoxy group, and (CH2) r R8 is selected from OH, and r=1 or 2. In some embodiments, R2 is selected from H, OH, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, and (CH2) r R8 is selected from OH, and r=1 or 2. In some embodiments, R2 is selected from H, a methyl group, and CH2OH.

[0063] In some embodiments, R1 and R2 are directly linked to form a 5- to 6-membered ring. In some embodiments, R1 and R2 are directly linked to form a 3- to 6-membered cycloalkyl group. In some embodiments, R1 and R2 are directly linked to form a cyclopentyl group or a cyclohexyl group.

[0064] In some embodiments, the chemical modification shown in formula (I) above is [ka] [ka] The structure is selected from any of the following: Wherein, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole and 3-nitropyrrole.

[0065] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0066] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0067] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0068] In some embodiments, the chemical modification shown in formula (I) above is [ka] The structure is selected from any of the following: Wherein, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole and 3-nitropyrrole.

[0069] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0070] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0071] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0072] In some embodiments, the chemical modification shown in formula (I) above is [ka] The structure is selected from any of the following: Wherein, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole and 3-nitropyrrole.

[0073] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0074] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0075] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0076] In some embodiments, the chemical modification shown in formula (I) above is [ka] The structure is selected from any of the following: Wherein, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole and 3-nitropyrrole.

[0077] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0078] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0079] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0080] In some embodiments, the nucleotide comprising the chemical modification as shown in formula (I), a tautomer thereof, or a pharma- ceutically acceptable salt thereof is a nucleotide comprising the chemical modification as shown in formula (I'), a tautomer thereof, or a pharma- ceutically acceptable salt thereof: [ka] wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; J2 is H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) P R6, wherein R6 is selected from OH, halogen, a methoxy group, an ethoxy group, N3, a C2-C6 alkenyl group, and a C2-C6 alkynyl group, and p=1, 2, or 3; Q 1’ teeth [ka] , Q 2’ is R2, or Q 1’ R2, Q 2’ teeth [ka] and Among them, R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; J1 is H or a C1-C6 alkyl group; R2 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is a base, M is O or S; The chemical modification shown in the above formula (I'), its tautomer or its pharma- ceutically acceptable salt is [ka] isn't it.

[0081] In some embodiments, when X is NH-CO, R1 is not H.

[0082] In some embodiments, the chemical modification according to formula (I') is a chemical modification according to formula (I'-1): [ka] wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; Each J1, J2 is independently H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) P R6, wherein R6 is selected from OH, halogen, a methoxy group, an ethoxy group, N3, a C2-C6 alkenyl group, and a C2-C6 alkynyl group, and p=1, 2, or 3; R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; R2 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; M is O or S; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I').

[0083] In some embodiments of formula (I'-1), B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0084] In some embodiments of formula (I'-1), B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0085] In some embodiments of formula (I'-1), B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0086] In some embodiments of formula (I'-1), B is the same as the base when the nucleotide at that position in the antisense strand is unmodified.

[0087] In some embodiments, the chemical modification according to formula (I') is a chemical modification according to formula (I'-2): [ka] wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each J1, J2 is independently H or a C1-C6 alkyl group; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) P R6, wherein R6 is selected from OH, halogen, a methoxy group, an ethoxy group, N3, a C2-C6 alkenyl group, and a C2-C6 alkynyl group, and p=1, 2, or 3; R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; R2 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, S-CH3, NCH3(CH3), OCH2CH2OCH3, an -O-alkylamino group, and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; M is O or S; B is as defined in formula (I').

[0088] In some embodiments of formula (I'-2), B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0089] In some embodiments of formula (I'-2), B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0090] In some embodiments of formula (I'-2), B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0091] In some embodiments of Formula (I'-2), B is the same as the base when the nucleotide at that position in the antisense strand is unmodified.

[0092] In some embodiments, each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C3 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each J1 and J2 is independently H or a C1-C3 alkyl group; R3 is H, OH, halogen, NH2, C1-C3 alkyl group, C1-C3 alkoxy group, C2-C4 alkenyl group, C2-C4 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2)p R6, wherein R6 is selected from OH, halogen, a methoxy group, an ethoxy group, N3, a C2-C6 alkenyl group, and a C2-C6 alkynyl group, and p=1, 2, or 3; R1 is H, a C1-C3 alkyl group, a C1-C3 alkoxy group, a C2-C4 alkenyl group, a C2-C4 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C4 alkenyl and C2-C4 alkynyl, and q=1, 2 or 3; R2 is H, OH, halogen, NH2, C1-C3 alkyl group, C1-C3 alkoxy group, C2-C4 alkenyl group, C2-C4 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C4 alkenyl and C2-C4 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I').

[0093] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0094] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0095] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0096] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0097] In some embodiments, each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H, a methyl group, an ethyl group, an n-propyl group, or an isopropyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each of J1 and J2 is independently H or a methyl group; R3 is H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-methylamino, -O-ethylamino, and (CH2). p R6, wherein R6 is selected from OH, F, Cl, a methoxy group, an ethoxy group, N3, a vinyl group, an allyl group, an ethynyl group, and a propargyl group, and p=1 or 2; R1 is H, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, or (CH2) q R7, wherein R7 is selected from OH, F, Cl, a methoxy group, an ethoxy group, N3, a vinyl group, an allyl group, an ethynyl group, and a propargyl group, and q=1 or 2; R2 is H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-methylamino, -O-ethylamino, and (CH2). r R8, wherein R8 is selected from OH, F, Cl, methoxy, ethoxy, N3, vinyl, allyl, ethynyl and propargyl, and r=1 or 2; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I').

[0098] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0099] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0100] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0101] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0102] In some embodiments, Y is O or NH; and each X is independently selected from NH—CO, CH, and NH; n=0 or 1, m=0 or 1, s=0 or 1, Each J1 and J2 is independently H; R1 is selected from H, a methyl group, and CH2OH; R2 is selected from H, OH, NH2, a methyl group, and CH2OH; R3 is selected from H, OH, NH2, a methyl group, and CH2OH; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I').

[0103] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0104] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0105] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0106] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0107] In some embodiments, Y is O or NH, and each X is independently selected from NH—CO, CH, and NH; n=0 or 1, m=0 or 1, s=0 or 1, Each J1 and J2 is independently H; R1 is selected from H, a methyl group, and CH2OH; R2 is selected from H, a methyl group, and CH2OH; R3 is selected from H, OH, NH2, a methyl group, and CH2OH; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I').

[0108] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0109] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0110] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0111] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0112] In some embodiments, Y is O or NH; each X is independently selected from CR4(R4'), NR5, and NH-CO, where R4, R4', and R5 are each independently H or a C1-C6 alkyl group; J2 is H or a C1-C6 alkyl group; n=0 or 1, m=0 or 1, s=0 or 1, R3 is H, OH, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, and (CH2) p R6, where R6 is selected from OH, a methoxy group and an ethoxy group, and p=1, 2 or 3; Q 1’ teeth [ka] , Q 2’ is R2, or Q 1’ R2, Q 2’ teeth [ka] and R1 is H, OH, C1-C6 alkyl group, C1-C6 alkoxy group, and (CH2) q R7, where R7 is selected from OH, a methoxy group and an ethoxy group, and q=1, 2 or 3; J1 is H or a C1-C6 alkyl group; R2 is H, OH, C1-C6 alkyl group, C1-C6 alkoxy group, and (CH2) r R8, where R8 is selected from OH, methoxy and ethoxy groups, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a 3- to 6-membered ring; M is O or S; B is a base, The chemical modification shown in the above formula (I'), its tautomer or its pharma- ceutically acceptable salt is [ka] isn't it.

[0113] In some embodiments, X is independently selected from CR4(R4') and NH-CO.

[0114] In some embodiments, X is independently selected from CR4(R4').

[0115] In some embodiments, R3 is H, a C1-C6 alkyl group, or (CH2) p Selected from R6.

[0116] In some embodiments, R3 is selected from H and a C1-C6 alkyl group.

[0117] In some embodiments, R1 is H, a C1-C6 alkyl group, or (CH2) q Selected from R7.

[0118] In some embodiments, R1 is selected from H and a C1-C6 alkyl group.

[0119] In some embodiments, R2 is H, OH, a C1-C6 alkyl group, or (CH2) r Selected from R8.

[0120] In some embodiments, R2 is H, a C1-C6 alkyl group, or (CH2) r Selected from R8.

[0121] In some embodiments, Y is O, each X is independently selected from CR4(R4') and NH-CO, where R4 and R4' are each independently H or a C1-C6 alkyl group; J2 is H or a C1-C6 alkyl group; R3 is H, C1-C6 alkyl group and (CH2) p R6 is selected from OH, and p=1, 2 or 3; Q 1’ teeth [ka] , Q 2’ is R2, or Q 1’ R2, Q 2’ teeth [ka] and R1 is H, C1-C6 alkyl group and (CH2) q R7, R7 is selected from OH, and q=1, 2 or 3; J1 is H or a C1-C6 alkyl group; R2 is H, OH, C1-C6 alkyl group and (CH2) r R8, R8 being selected from OH, r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a 5- or 6-membered ring; M is O or S; B is a base.

[0122] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0123] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0124] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0125] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0126] In some embodiments, Y is O, Each X is independently selected from CR(R'), where R and R' are each independently H or a C-C alkyl group; J2 is H, R3 is selected from H and C1-C6 alkyl groups; Q 1’ teeth [ka] , Q 2’ is R2, or Q 1’ R2, Q 2’ teeth [ka] and R1 is selected from H and C1-C6 alkyl groups; J1 is H or a C1-C6 alkyl group; R2 is H, C1-C6 alkyl group and (CH2) r R8 is selected from OH, and R=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a 5- or 6-membered ring; M is O or S; B is a base.

[0127] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0128] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0129] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0130] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0131] In some embodiments, Y is O.

[0132] In some embodiments, X is independently selected from CR4(R4'), NR5, and NH-CO, and R4, R4', and R5 are each independently H, a methyl group, an ethyl group, an n-propyl group, or an isopropyl group. In some embodiments, X is independently selected from NH-CO, CH2, and NH. In some embodiments, X is independently selected from NH-CO and CH2. In some embodiments, X is CH2.

[0133] In some embodiments, J2 is H or a methyl group. In some embodiments, J2 is H.

[0134] In some embodiments, R3 is H, OH, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, and (CH2)p R6 is selected from OH, methoxy and ethoxy, and p=1 or 2. In some embodiments, R3 is selected from H, methyl, ethyl, n-propyl, isopropyl and (CH2) p R6 is selected from OH, and p=1 or 2. In some embodiments, R3 is selected from H and a methyl group.

[0135] In some embodiments, R1 is H, OH, a methyl group, an ethyl group, a n-propyl group, an isopropyl group, a methoxy group, an ethoxy group, a n-propoxy group, an isopropoxy group, and (CH2) q R7, where R7 is selected from OH and q=1 or 2. In some embodiments, R1 is selected from H, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, and (CH2) q R7, R7 is selected from OH, and q=1 or 2. In some embodiments, R1 is selected from H and a methyl group.

[0136] In some embodiments, R2 is H, OH, a methyl group, an ethyl group, a n-propyl group, an isopropyl group, a methoxy group, an ethoxy group, a n-propoxy group, an isopropoxy group, and (CH2) r R8 is selected from OH, and r=1 or 2. In some embodiments, R2 is selected from H, OH, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, and (CH2) r R8 is selected from OH, and r=1 or 2. In some embodiments, R2 is selected from H, a methyl group, and CH2OH.

[0137] In some embodiments, R1 and R2 are directly linked to form a 5- to 6-membered ring. In some embodiments, R1 and R2 are directly linked to form a 3- to 6-membered cycloalkyl group. In some embodiments, R1 and R2 are directly linked to form a cyclopentyl group or a cyclohexyl group.

[0138] In some embodiments, the chemical modification shown in formula (I') above is [ka] [ka] The structure is selected from any of the following: In which M is O or S; B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0139] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0140] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0141] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0142] In some embodiments, the chemical modification shown in formula (I') above is [ka] The structure is selected from any of the following: In which M is O or S; B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0143] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0144] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0145] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0146] In some embodiments, the chemical modification shown in formula (I') above is [ka] The structure is selected from any of the following: In which M is O or S; B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0147] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0148] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0149] In some embodiments, B is the same as the base if the nucleotide at that position in the antisense strand is unmodified.

[0150] In some embodiments, the chemical modification shown in formula (I') above is [ka] [ka] and those in which the adenine is replaced by guanine, cytosine, uracil or thymine.

[0151] In some embodiments, B is selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0152] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0153] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0154] In some embodiments, B is the same as the base when the nucleotide at that position in the antisense strand is unmodified.

[0155] In some embodiments, the ligand is a compound of formula (II) or a pharma- ceutically acceptable salt thereof: [ka] Among them, L1 is C1-C 30 C1-C which is an alkyl chain or is interrupted by one or more oxygen, sulfur, nitrogen atoms or C=O. 30 Contains an alkyl chain, R 11 and R 12 are independently chemical bonds, NR 16 or C=O, Q3 is [ka] and R 13 is CR 17 R 18 , N.R.16 , O or S; R 14 is CR 19 and R 15 is independently CR 17 R 18 , N.R. 16 or O, R 16 ~R 19 are independently hydrogen, deuterium, or an alkyl group; m1, p1 and q1 are independently 0, 1, 2, 3 or 4; B1 is [ka] and R b5 , R b6 and R b7 are independently -C(=O)-, -NHC(=O)-, -C(=O)O-, -C(=O)-(CH2) z8 -O- or -NHC(=O)-(CH2) z9 -O-, z5, z6, z7, z8, and z9 are independently an integer of 0 to 10; L2 is C1-C 30 C1-C which is an alkyl chain or is interrupted by one or more oxygen, sulfur, nitrogen atoms or C=O. 30 Contains an alkyl chain, r1 is an integer from 1 to 10.

[0156] In some embodiments, L1 is -(CH2) j11 -C(=O)-(CH2) j12 - and R 11 and R 12 are independently chemical bonds, NR 16 or C=O, R 16 is hydrogen or C 1-6 is an alkyl group, Q3 is [ka] and R 13 is CR 17 R 18 or O, R 14 is CR 19 and R 15 is independently CR 17 R 18 or O, R 16 ~R 19 are independently hydrogen or an alkyl group; m1, p1 and q1 are independently 0 or 1; B1 is [ka] and R b5 , R b6 and R b7 are independently -C(=O)-(CH2) z8 -O- or -NHC(=O)-(CH2) z9 -O-, z8 and z9 are independently an integer from 0 to 10; L2 is -(CH2) j15 -(OCH2CH2) 1-4 -(CH2) j16 -or [ka] and j15 and j16 are independently an integer of 0 to 4; r1 is 3, 4, 5 or 6.

[0157] In some embodiments, L1 is L3 or L3-R 110 -R 111 -L3, wherein L3 is independently C1-C 12 Alkyl chain, -(CH2) j11 -C(=O)-(CH2) j12 -or-(CH2) j13 -(CH2CH2O) 1-4 -(CH2) j14- and R 110 and R 111 are independently chemical bonds, -NR 112 -, -C(=O)- or -OC(=O)-, R 112 is hydrogen or C1-C 12 An alkyl group, and j11, j12, j13, and j14 are independently an integer of 0 to 10. In some embodiments, j11, j12, j13, and j14 are independently an integer of 0 to 2 or 4 to 10. In some embodiments, j11, j12, j13, and j14 are independently 0, 1, 2, 6, 7, 8, 9, or 10.

[0158] In some embodiments, L1 is -(CH2) j11 -C(=O)-(CH2) j12 -, and the definitions of j11 and j12 are as described in any one of the above forms.

[0159] In some embodiments, L1 is [ka] The definition of j12 is as described in any one of the above embodiments, wherein the a1 end is linked to B1 and the b1 end is R 11 Concatenate to.

[0160] In some embodiments, L1 is [ka] wherein the a1 end is linked to B1 and the b1 end is linked to R 11 Concatenate to.

[0161] In some embodiments, R 11 may be a chemical bond, and R 12 may be C=O.

[0162] In some embodiments, R 11 may be a chemical bond, and R 12is NR 16 R may be 16 is as defined in any one of the above forms.

[0163] In some embodiments, R 11 may be a chemical bond, and R 12 may be -OC(=O)-.

[0164] In some embodiments, R 11 is NR 16 and R 12 may be C=O, R 16 is as defined in any one of the above forms.

[0165] In some embodiments, R is NR 16 and R 12 may be -OC(=O)-, R 16 is as defined in any one of the above forms.

[0166] In some embodiments, R 12 is NR 16 and R 11 may be C=O, R 16 is as defined in any one of the above forms.

[0167] In some embodiments, R 12 is NR 16 and R 11 may be -OC(=O)-, R 16 is as defined in any one of the above forms.

[0168] In some embodiments, R 11 may be NH, and R 12 may be C=O.

[0169] In some embodiments, R 12may be NH, and R 11 may be C=O.

[0170] In some embodiments, R 16 is hydrogen or C 1-6 It may be an alkyl group.

[0171] In some embodiments, R 16 may be hydrogen, a methyl group, an ethyl group, a propyl group, or an isopropyl group.

[0172] In some embodiments, R 16 may be hydrogen.

[0173] In some embodiments, R 17 and R 18 may be hydrogen.

[0174] In some embodiments, R 19 may be hydrogen.

[0175] In some embodiments, when ring A is present, ring A is C 6-12 It may be an aryl group.

[0176] In some embodiments, ring A can be a phenyl group.

[0177] In some embodiments, m1 may be 0 or 1.

[0178] In some embodiments, m1 may be 3.

[0179] In some embodiments, n1 may be 0 or 1.

[0180] In some embodiments, p1 and q1 are independently 0 or 1.

[0181] In some embodiments, p1=1 and q1=1.

[0182] In some embodiments, p1=1 and q1=0.

[0183] In some embodiments, p1=0 and q1=1.

[0184] In some embodiments, p1=0 and q1=0.

[0185] In some embodiments, z1, z2, z3, z4, z5, z6, z7, z8, and z9 may independently be an integer from 0 to 4. In some embodiments, z1, z2, z3, z4, z5, z6, z7, z8, and z9 may independently be 0, 1, or 2.

[0186] In some embodiments, B1 is [ka] R may be b1 , R b2 , R b3 and R b4 are independently -C(=O)- or -NHC(=O)-, the N atom is linked to L1, and the definitions of z1, z2, z3 and z4 are as described in any one of the above forms.

[0187] In some embodiments, B1 is [ka] R may be b1 , R b2 , R b3 and R b4 are independently -C(=O)- or -NHC(=O)-, the N atom is connected to L1, and R b1 , R b3 and R b4 are the same, and the definitions of z1, z2, z3, and z4 are as described in any one of the above forms.

[0188] In some embodiments, B1 is [ka] may be also possible.

[0189] In some embodiments, B1 is [ka] may be also possible.

[0190] In some embodiments, B1 is [ka] R may be b5 , R b6 and R b7 are independently -C(=O)-(CH2) z8 -O- or -NHC(=O)-(CH2) z9 -O-, the N atom is linked to L1, and the definitions of z5, z6, z7, z8 and z9 are as described in any one of the above forms.

[0191] In some embodiments, B1 is [ka] R may be b5 , R b6 and R b7 are independently -C(=O)-(CH2) z8 -O- or -NHC(=O)-(CH2) z9 -O-, the N atom is linked to L1, and R b5 , R b6 and R b7 are the same, and the definitions of z5, z6, z7, z8, and z9 are as described in any one of the above forms.

[0192] In some embodiments, B1 is [ka] may be also possible.

[0193] In some embodiments, L2 is L4 or L4-R 13 -R 14 -L4, wherein L4 is independently C1-C 12 Alkyl chain or -(CH2) j15 -(OCH2CH2) 1-4 -(CH2) j16 - and R 13 and R 14 are independently chemical bonds, -NR 115 -, -C(=O)- or -OC(=O)-, R 115 are independently hydrogen or C1-C 12 An alkyl group, and j15 and j16 are independently an integer from 0 to 10. In some embodiments, j15 and j16 are independently an integer from 0 to 6. In some embodiments, j15 and j16 are independently 0, 1, 2, 3, or 4.

[0194] In some embodiments, L2 is -(CH2) j15 -(OCH2CH2) 1-4 -(CH2) j16 -, and the definitions of j15 and j16 are as described in any one of the above forms.

[0195] In some embodiments, L2 is [ka] In some embodiments, L2 may be [ka] wherein one side is linked to the O atom and the other side is linked to B1.

[0196] In some embodiments, L2 is C1-C 12 It may also be an alkyl chain.

[0197] In some embodiments, L2 is [ka] may be also possible.

[0198] In some embodiments, L2 is [ka] In some embodiments, L2 may be [ka] In some embodiments, L2 may be [ka] In some embodiments, L2 may be [ka] wherein the a3 end is linked to an O atom and the b3 end is linked to B1.

[0199] In some embodiments, L2 is [ka] wherein the a3 end is linked to an O atom and the b3 end is linked to B1.

[0200] In some embodiments, r1 can be 3, 4, 5, or 6. In some embodiments, r1 can be 3.

[0201] In some embodiments, Q3 is [ka] In some embodiments, Q3 may be: [ka] Among them, R 13 , R 14 , R 15 and n1 is as defined in any one of the above forms.

[0202] In some embodiments, [ka] teeth, [ka] In addition, R 13 , R 14 , R 15 , p1 and q1 are as defined in any one of the above forms.

[0203] In some embodiments, [ka] teeth, [ka] In addition, R 13 , R 14 , R 15 , p1 and q1 are as defined in any one of the above forms.

[0204] In some embodiments, [ka] teeth, [ka] In some embodiments, [ka] teeth, [ka] In some embodiments, [ka] teeth, [ka] The definitions of p1 and q1 are as described in any one of the above forms.

[0205] In some embodiments, [ka] teeth, [ka] In some embodiments, [ka] teeth, [ka] In some embodiments, [ka] teeth, [ka] The definitions of p1 and q1 are as described in any one of the above forms.

[0206] In some embodiments, [ka] teeth, [ka] In addition, R 13 , R 14, n1, p1 and q1 are as defined in any one of the above forms.

[0207] In some embodiments, [ka] teeth, [ka] In addition, R 13 , R 14 , n1, p1 and q1 are as defined in any one of the above forms.

[0208] In some embodiments, [ka] teeth, [ka] In some embodiments, [ka] teeth, [ka] The definitions of n1, p1, and q1 are as described in any one of the above forms.

[0209] In some embodiments, [ka] teeth, [ka] wherein the definitions of n1, p1, and q1 are as described in any one of the above forms.

[0210] In some embodiments, the ligand is: [ka] [ka] [ka] [ka] or a pharma- ceutically acceptable salt thereof.

[0211] In some embodiments, the ligand is: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] or a pharma- ceutically acceptable salt thereof.

[0212] In some embodiments, the ligand is: [ka] or a pharma- ceutically acceptable salt thereof.

[0213] In some embodiments, the chemical modification shown in formula (I) above is [ka] and B is selected from guanine, adenine, cytosine and uracil, and the ligand is [ka] [ka] or a pharma- ceutically acceptable salt thereof.

[0214] In some embodiments, the chemical modification shown in formula (I) above is [ka] and B is selected from guanine, adenine, cytosine and uracil, and the ligand is [ka] or a pharma- ceutically acceptable salt thereof.

[0215] In some embodiments, the chemical modification shown in formula (I) above is [ka] and B is selected from guanine, adenine, cytosine and uracil, and the ligand is [ka] or a pharma- ceutically acceptable salt thereof.

[0216] In some embodiments, the N-acetyl-galactosamine moiety in the ligand can be substituted with N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, or N-isobutyrylgalactosamine.

[0217] In some embodiments, the siRNA is covalently or non-covalently linked to the ligand.

[0218] In some embodiments, the 3' and / or 5' end of the sense strand is conjugated to the ligand.

[0219] In some embodiments, the 3' end of the sense strand is conjugated to the ligand.

[0220] In some embodiments, the ligand is linked to the siRNA terminus via a phosphate or thiophosphate group.

[0221] In some embodiments, the ligand is linked to the siRNA terminus via a phosphodiester or thiophosphodiester group.

[0222] In some embodiments, the ligand is linked to the siRNA terminus via a phosphodiester group.

[0223] In some embodiments, the ligand is indirectly linked to the siRNA terminus via a phosphate or thiophosphate group.

[0224] In some embodiments, the ligand is linked directly to the siRNA terminus via a phosphate or thiophosphate group.

[0225] In some embodiments, the ligand is linked directly to the 3' end of the sense strand of the siRNA via a phosphate or thiophosphate group.

[0226] In some embodiments, the phosphate group is a phosphomonoester or a phosphodiester group. In some embodiments, the phosphate group is a phosphodiester group.

[0227] In some embodiments, the phosphorothioate group is a thiophosphomonoester or thiophosphodiester group. In some embodiments, the phosphorothioate group is a thiophosphodiester group.

[0228] In some embodiments, the dsRNA comprises: [ka] or a pharma- ceutically acceptable salt thereof, wherein Z is an siRNA, and the 3' end of the sense strand of the siRNA is directly linked to a ligand via a thiophosphodiester group, and the siRNA is as defined herein.

[0229] In some embodiments, the dsRNA comprises: [ka] or a pharma- ceutically acceptable salt thereof; wherein Z is an siRNA, the 3' end of the sense strand of said siRNA is directly linked to a ligand via a phosphodiester group, and said siRNA is as defined in the present disclosure.

[0230] In some embodiments, the dsRNA comprises: [ka] or a pharma- ceutically acceptable salt thereof; wherein Z is an siRNA, the 3' end of the sense strand of said siRNA is directly linked to a ligand via a phosphodiester group, and said siRNA is as defined in the present disclosure.

[0231] In some embodiments, in order to promote the entry of siRNA into cells, a lipophilic group such as cholesterol can be introduced at the end of the siRNA sense strand, and the lipophilic group is bound to the siRNA by a covalent bond, for example, by introducing cholesterol, lipoprotein, vitamin E, etc. at the end, which contributes to the interaction with intracellular mRNA through a cell membrane consisting of a lipid bilayer. In addition, the siRNA may be modified by a non-covalent bond, for example, by binding to a phospholipid molecule, a polypeptide, a cationic polymer, etc. by a hydrophobic bond or an ionic bond to improve stability and biological activity.

[0232] In some embodiments, the nucleotide comprising the chemical modification shown in Formula (I), a tautomer thereof, or a pharma- ceutically acceptable salt thereof is located at position 5, 6, or 7 from the 5' end of the antisense strand.

[0233] In some embodiments, the nucleotide comprising the chemical modification shown in Formula (I), a tautomer thereof, or a pharma- ceutically acceptable salt thereof is located at position 7 of the 5' end of the antisense strand.

[0234] In some embodiments, when the chemical modification shown in formula (I), or a tautomer or a pharma- ceutically acceptable salt thereof, is at the 5 position from the 5' end, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0235] In some embodiments, when the chemical modification shown in formula (I), or a tautomer or a pharma- ceutically acceptable salt thereof, is at the 6 position from the 5' end, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0236] In some embodiments, when the chemical modification shown in formula (I), or a tautomer or a pharma- ceutically acceptable salt thereof, is at the 7-position from the 5'-terminus, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0237] In some embodiments, when the chemical modification shown in Formula (I), or a tautomer or a pharma- ceutically acceptable salt thereof, is at the 8th position from the 5' end, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0238] In some embodiments, B is the same as the base when the nucleotide 5 from the 5' end of the antisense strand is unmodified.

[0239] In some embodiments, B is the same as the base when the nucleotide at position 6 from the 5' end of the antisense strand is unmodified.

[0240] In some embodiments, B is the same as the base when the nucleotide at position 7 from the 5' end of the antisense strand is unmodified.

[0241] In some embodiments, B is the same as the base when the nucleotide at position 8 from the 5' end of the antisense strand is unmodified.

[0242] In some embodiments, at the remaining positions that contain a chemical modification as shown in Formula (I), at least one other nucleotide in the sense strand and / or antisense strand is a modified nucleotide.

[0243] In some embodiments, the modified nucleotide is selected from 2'-methoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy nucleotides, 2'-deoxy-2'-fluoro modified nucleotides, 3'-deoxy-thymine nucleotides, isonucleotides, LNA, ENA, cET, UNA, and GNA. In some embodiments, the modified nucleotides are independently selected from 2'-methoxy modified nucleotides or 2'-fluoro modified nucleotides.

[0244] In some embodiments, the sense strand comprises three consecutive nucleotides with the same modification.

[0245] In some embodiments, the three nucleotides having the same modification are 2'-fluoro modified nucleotides.

[0246] In some embodiments, in the 5' to 3' direction, the nucleotides at positions 2, 4, 6, 10, 12, 14, 16, and 18 of the antisense strand are each independently a 2'-fluoro modified nucleotide.

[0247] In some embodiments, the antisense strand is at least partially reverse-complementary to the target sequence. In some embodiments, there are 5 or less, 4 or less, 3 or less, 2 or less, or 1 or less mismatches between the antisense strand and the target sequence. In some embodiments, the antisense strand is completely reverse-complementary to the target sequence.

[0248] In some embodiments, the sense strand is at least partially reverse-complementary to the antisense strand to form a double-stranded region.In some embodiments, there are 5 or less, 4 or less, 3 or less, 2 or less, or 1 or less mismatches between the sense strand and the antisense strand.In some embodiments, the sense strand is completely reverse-complementary to the antisense strand.

[0249] In some embodiments, the sense strand and the antisense strand each independently have 16 to 35, 16 to 34, 17 to 34, 17 to 33, 18 to 33, 18 to 32, 18 to 31, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, or 19 to 23 nucleotides (e.g., 19, 20, 21, 22, or 23 nucleotides).

[0250] In some embodiments, the sense strand and antisense strand are the same or different in length, the sense strand is 19 to 23 nucleotides in length (e.g., 19, 20, 21, 22, 23 nucleotides in length) and the antisense strand is 19 to 26 nucleotides in length. The length ratio of the sense strand to the antisense strand of the dsRNA provided by the present disclosure may be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 19, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand is 19 / 21, 21 / 23, or 23 / 25. In some embodiments, the length ratio of the sense strand to the antisense strand is 19 / 21.

[0251] In some embodiments, the siRNA comprises one or two blunt ends.

[0252] In some specific embodiments, each strand of the siRNA independently contains 1 to 2 unpaired nucleotides forming an overhanging end.

[0253] In some embodiments, the siRNA comprises an overhang located at the 3' end of the antisense strand.

[0254] In some embodiments, in the sense strand of the siRNA, three consecutive nucleotides located at positions 7 to 9 of the 5' end are 2'-fluoro modified nucleotides.

[0255] In some embodiments, the sense strand comprises the nucleotide sequence (5'-3') shown in the formula below:

[0256] N a N a N a N a XN a N b N b N b N a N a N a N a N a N a N a N a N a N a Of which, each X is independently N a Or N b and N a is a nucleotide modified with a 2'-methoxy group, and N b is a 2'-fluoro modified nucleotide.

[0257] In some embodiments, the sense strand comprises nucleotides as shown in the formula:

[0258] 5'-N a N a N a N a N a N a N b N b N b N a N a N a N a N a N a N a N a N a N a -3', or 5'-N a N a N a N a N b N a N b N b N b N a N a N a N a Na N a N a N a N a N a -3', Of these, N a is a nucleotide modified with a 2'-methoxy group, and N b is a 2'-fluoro modified nucleotide.

[0259] In some embodiments, the antisense strand comprises nucleotides as shown in the following formula:

[0260] 5'-N a 'N b 'N a 'N b 'N a 'N b 'W'N a 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N a 'N a '-3', Of these, N a ' is a nucleotide modified with a 2'-methoxy group, and N b ' is a 2'-fluoro modified nucleotide, and W' is a 2'-methoxy modified nucleotide or a nucleotide containing a chemical modification as shown in formula (I), or a tautomer thereof, or a pharma- ceutically acceptable salt thereof.

[0261] In some specific embodiments, W' represents a nucleotide comprising a chemical modification as shown in formula (I), a tautomer thereof, or a pharma- ceutically acceptable salt thereof.

[0262] In some specific embodiments, the chemical modification shown in formula (I) is [ka] wherein B is selected from guanine, adenine, cytosine, or uracil. In some specific embodiments, B is the same as the base when the 7th nucleotide from the 5' end of the antisense strand is unmodified.

[0263] In some specific embodiments, the chemical modification shown in formula (I) is [ka] wherein M is O or S, and wherein B is selected from guanine, adenine, cytosine, or uracil. In some specific embodiments, B is the same as the base when the 7th nucleotide from the 5' end of the antisense strand is unmodified.

[0264] In some specific embodiments, M is S. In some specific embodiments, M is O.

[0265] In some embodiments, at least one phosphate group in the sense strand and / or antisense strand is a phosphate group having a modification group.The modification group allows the siRNA to have improved stability in biological samples or environments.In some embodiments, the phosphate group having a modification group is a thiophosphate group.In some embodiments, the phosphate group having a modification group is a thiophosphodiester group.

[0266] In some embodiments, the thiophosphodiester group is Between the first and second nucleotides of the 5' end of the sense strand, Between the second and third nucleotides of the 5' end of the sense strand, Between the first and second nucleotides of the 5' end of the antisense strand, Between the second and third nucleotides of the 5' end of the antisense strand, Between the first and second nucleotides at the 3' end of the antisense strand, and Between the second and third nucleotides of the 3' end of the antisense strand, It is present in at least one position selected from the positions:

[0267] In some embodiments, the sense strand and / or the antisense strand comprises a plurality of thiophosphodiester groups, the thiophosphodiester groups being: Between the first and second nucleotides of the 5' end of the sense strand, Between the second and third nucleotides of the 5' end of the sense strand, Between the first and second nucleotides of the 5' end of the antisense strand, Between the second and third nucleotides of the 5' end of the antisense strand, Between the first and second nucleotides at the 3' end of the antisense strand, and Between the second and third nucleotides of the 3' end of the antisense strand, It is present in at least one position selected from the positions:

[0268] In some embodiments, the sense strand comprises the nucleotide sequence shown in the formula: 5'-NmsNmsNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNm-3', or 5'-NmsNmsNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm-3', Wherein, Nm represents any nucleotide modified with a 2'-methoxy group, for example, C, G, U, A modified with a 2'-methoxy group, Nf represents any nucleotide modified with a 2'-fluoro group, for example, C, G, U, A modified with a 2'-fluoro group, The lower case letter s indicates that the two adjacent nucleotides on the left and right sides of the letter s are linked by a thiophosphate group, and when the lower case letter s is at the first position of the 3' end, it indicates that the end of one nucleotide adjacent to the upstream (5' direction) of the letter s is a thiophosphodiester group.

[0269] In some embodiments, the antisense strand comprises the nucleotide sequence shown in the formula: 5'-Nm'sNf'sNm'Nf'Nm'Nf'W'Nm'Nm'Nf'Nm'Nf'Nm'Nf'Nm'Nf'Nm'Nf'Nm'sNm'sNm'-3', Wherein, Nm' represents any nucleotide modified with a 2'-methoxy group, for example, C, G, U, A modified with a 2'-methoxy group, Nf' represents any nucleotide modified with a 2'-fluoro group, for example, C, G, U, A modified with a 2'-fluoro group, The lowercase letter s indicates that the two adjacent nucleotides on the left and right sides of the letter s are linked together by a thiophosphodiester group. When the lowercase letter s is at the first position of the 3' end, it indicates that the end of one nucleotide adjacent to the upstream side of the letter s is a thiophosphodiester group. W' represents a nucleotide modified with a 2'-methoxy group or a nucleotide containing the chemical modification shown in formula (I), or a tautomer thereof, or a pharma- ceutically acceptable salt thereof.

[0270] In some embodiments, the chemical modification according to formula (I) is [ka] wherein B is selected from guanine, adenine, cytosine, or uracil. In some embodiments, B is the same as the base when the nucleotide at the 7th position from the 5' end of the antisense strand is unmodified.

[0271] In some embodiments, the chemical modification according to formula (I) is [ka] wherein M is O or S, and wherein B is selected from guanine, adenine, cytosine, or uracil. In some specific embodiments, B is the same as the base when the 7th nucleotide from the 5' end of the antisense strand is unmodified.

[0272] In some embodiments, M is S. In some specific embodiments, M is O.

[0273] HBV-targeting dsRNA In some embodiments, the siRNA is an siRNA targeting a Hepatitis B virus (HBV) gene.

[0274] In some embodiments, the siRNA is an siRNA targeting HBV-S.

[0275] In some specific embodiments, the sense and antisense strands of the siRNA targeting HBV-S are The nucleotide sequence of the sense strand comprises SEQ ID NO:2, and the nucleotide sequence of the antisense strand comprises SEQ ID NO:6.

[0276] In some embodiments, the siRNA is an siRNA targeting HBV-X.

[0277] In some specific embodiments, the sense and antisense strands of the siRNA targeting HBV-X are the nucleotide sequence of the sense strand comprises SEQ ID NO:1 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:5; the nucleotide sequence of the sense strand comprises SEQ ID NO:4 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:5; The nucleotide sequence of the sense strand comprises SEQ ID NO:1, and the nucleotide sequence of the antisense strand comprises SEQ ID NO:8.

[0278] In some embodiments, the sense strand of the siRNA comprises a sequence that differs from any of SEQ ID NOs: 1 to 4 by 3 or less nucleotides, which comprises at least 15 (in some embodiments, at least 19) consecutive nucleotides; and / or The antisense strand comprises a sequence that differs from any of the nucleotide sequences of SEQ ID NO:5 to SEQ ID NO:8 by three or less nucleotides, and which comprises at least 19 (in some embodiments, at least 21) consecutive nucleotides.

[0279] In some embodiments, the nucleotide sequence of the sense strand of the siRNA comprises any one of SEQ ID NOs: 1 to 4, and / or the nucleotide sequence of the antisense strand comprises any one of SEQ ID NOs: 5 to 8, In some embodiments, the sense and antisense strands of the siRNA are the nucleotide sequence of the sense strand comprises SEQ ID NO:1 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:5; the nucleotide sequence of the sense strand comprises SEQ ID NO:2 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:6; the nucleotide sequence of the sense strand comprises SEQ ID NO:3 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:7; the nucleotide sequence of the sense strand comprises SEQ ID NO:4 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:5; The nucleotide sequence of the sense strand comprises SEQ ID NO:1, and the nucleotide sequence of the antisense strand comprises SEQ ID NO:8.

[0280] In some embodiments, the sense and antisense strands of the siRNA are The nucleotide sequence of the sense strand is SEQ ID NO:1 and the nucleotide sequence of the antisense strand is SEQ ID NO:5; The nucleotide sequence of the sense strand is SEQ ID NO:2 and the nucleotide sequence of the antisense strand is SEQ ID NO:6; The nucleotide sequence of the sense strand is SEQ ID NO:3 and the nucleotide sequence of the antisense strand is SEQ ID NO:7; The nucleotide sequence of the sense strand is SEQ ID NO:4 and the nucleotide sequence of the antisense strand is SEQ ID NO:5; the nucleotide sequence of the sense strand is SEQ ID NO:1, and the nucleotide sequence of the antisense strand is SEQ ID NO:8.

[0281] In the present disclosure, according to the 5'-3' direction, SEQ ID NO:1 is GUGUGCACUUCGCUUCACC, SEQ ID NO:2 is CUUUUGUCUUUGGGUAUAU, SEQ ID NO:3 is UUACCAAUUUUCUUUUGUU, SEQ ID NO:4 is GUGUGCACUUCGCUUCACU, SEQ ID NO:5 is AGUGAAGCGGAAGUGCACACGG, SEQ ID NO:6 is AUAUACCCAAAGACAAAAGAA, SEQ ID NO:7 is AACAAAAGAAAAUUGGUAACA, Sequence number 8 is IGUGAAGCGGAAGUGCACACGG.

[0282] In some embodiments, the siRNA is TJR100381 and TJR100382.

[0283] In some embodiments, the sense strand of the dsRNA described herein comprises any one of SEQ ID NOs: 9 to 15, and / or The nucleotide sequence of the antisense strand includes any one of SEQ ID NO:17 to SEQ ID NO:20.

[0284] In some embodiments, the dsRNA comprises: a dsRNA in which the sense strand comprises SEQ ID NO:9 and the antisense strand comprises SEQ ID NO:17; a dsRNA in which the sense strand comprises SEQ ID NO:11 and the antisense strand comprises SEQ ID NO:18; a dsRNA in which the sense strand comprises SEQ ID NO: 13 and the antisense strand comprises SEQ ID NO: 19; a dsRNA in which the sense strand comprises SEQ ID NO: 10 and the antisense strand comprises SEQ ID NO: 17; a dsRNA in which the sense strand comprises SEQ ID NO: 12 and the antisense strand comprises SEQ ID NO: 18; a dsRNA in which the sense strand comprises SEQ ID NO: 14 and the antisense strand comprises SEQ ID NO: 19; a dsRNA in which the sense strand comprises SEQ ID NO:9 and the antisense strand comprises SEQ ID NO:20; the sense strand comprises SEQ ID NO:15, and the antisense strand comprises SEQ ID NO:17.

[0285] In some embodiments, the dsRNA comprises: a dsRNA in which the sense strand is SEQ ID NO: 9 and the antisense strand is SEQ ID NO: 17; a dsRNA in which the sense strand is SEQ ID NO: 11 and the antisense strand is SEQ ID NO: 18; a dsRNA in which the sense strand is SEQ ID NO: 13 and the antisense strand is SEQ ID NO: 19; a dsRNA in which the sense strand is SEQ ID NO: 10 and the antisense strand is SEQ ID NO: 17; a dsRNA in which the sense strand is SEQ ID NO: 12 and the antisense strand is SEQ ID NO: 18; a dsRNA in which the sense strand is SEQ ID NO: 14 and the antisense strand is SEQ ID NO: 19; a dsRNA in which the sense strand is SEQ ID NO: 9 and the antisense strand is SEQ ID NO: 20; The present invention is any one of the embodiments, wherein the sense strand is SEQ ID NO:15 and the antisense strand is SEQ ID NO:17.

[0286] In some embodiments, the dsRNA comprises: dsRNA comprising SEQ ID NO: 9 and SEQ ID NO: 17; dsRNA comprising SEQ ID NO: 11 and SEQ ID NO: 18; dsRNA comprising SEQ ID NO: 13 and SEQ ID NO: 19; dsRNA comprising SEQ ID NO: 10 and SEQ ID NO: 17; dsRNA comprising SEQ ID NO: 12 and SEQ ID NO: 18; dsRNA comprising SEQ ID NO: 14 and SEQ ID NO: 19; dsRNA comprising SEQ ID NO: 9 and SEQ ID NO: 20; dsRNA comprising SEQ ID NO:15 and SEQ ID NO:17.

[0287] In some embodiments, the dsRNA comprises: dsRNAs having SEQ ID NO: 9 and SEQ ID NO: 17; dsRNAs having SEQ ID NO: 11 and SEQ ID NO: 18; dsRNAs having SEQ ID NO: 13 and SEQ ID NO: 19; dsRNAs having SEQ ID NO: 10 and SEQ ID NO: 17; dsRNAs having SEQ ID NO: 12 and SEQ ID NO: 18; dsRNAs having SEQ ID NO: 14 and SEQ ID NO: 19; dsRNAs having SEQ ID NO: 9 and SEQ ID NO: 20; The present invention relates to any one of the embodiments, in which the dsRNA is SEQ ID NO: 15 or SEQ ID NO: 17.

[0288] In some embodiments, the dsRNA comprises: A dsRNA comprising or selected from the sense strand shown in SEQ ID NO: 9 and the antisense strand shown in SEQ ID NO: 17; A dsRNA comprising or selected from the sense strand shown in SEQ ID NO: 9 and the antisense strand shown in SEQ ID NO: 20; A dsRNA comprising or selected from the sense strand shown in SEQ ID NO: 11 and the antisense strand shown in SEQ ID NO: 18; A dsRNA comprising or selected from the sense strand shown in SEQ ID NO: 13 and the antisense strand shown in SEQ ID NO: 19; A dsRNA comprising or selected from the sense strand shown in SEQ ID NO: 10 and the antisense strand shown in SEQ ID NO: 17; A dsRNA comprising or selected from the sense strand shown in SEQ ID NO: 12 and the antisense strand shown in SEQ ID NO: 18; A dsRNA comprising or selected from the sense strand shown in SEQ ID NO: 14 and the antisense strand shown in SEQ ID NO: 19; a dsRNA comprising or selected from the sense strand shown in SEQ ID NO:15 and the antisense strand shown in SEQ ID NO:17.

[0289] In some specific embodiments, the dsRNA targeting HBV-X is dsRNAs having SEQ ID NO: 9 and SEQ ID NO: 17; dsRNAs having SEQ ID NO: 10 and SEQ ID NO: 17; dsRNAs having SEQ ID NO: 9 and SEQ ID NO: 20; The present invention relates to any one of the embodiments, in which the dsRNA is SEQ ID NO: 15 or SEQ ID NO: 17.

[0290] In some specific embodiments, the dsRNA targeting HBV-S is dsRNAs having SEQ ID NO: 11 and SEQ ID NO: 18; dsRNAs having SEQ ID NO: 13 and SEQ ID NO: 19; dsRNAs having SEQ ID NO: 12 and SEQ ID NO: 18; The present invention relates to any one of the above embodiments, in which the dsRNA is SEQ ID NO:14 or SEQ ID NO:19.

[0291] In the present disclosure, according to the 5'-3' direction, SEQ ID NO:9 is GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmCm-NAG0052', SEQ ID NO:10 is GmsUmsGmUmGfCmAfCfUfUmCmGmCmUmUmCmAmCmCm-NAG0052', SEQ ID NO:11 is CmsUmsUmUmUfGmUfCfUfUmUmGmGmGmUmAmUmAmUm-NAG0052', SEQ ID NO:12 is CmsUmsUmUmUmGmUfCfUfUmUmGmGmGmUmAmUmAmUm-NAG0052', SEQ ID NO:13 is UmsUmsAmCmCfAmAfUfUfUmUmCmUmUmUmUmGmUmUm-NAG0052', SEQ ID NO:14 is UmsUmsAmCmCmAmAfUfUfUmUmCmUmUmUmUmGmUmUm-NAG0052', SEQ ID NO:15 is GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmUm-NAG0052', SEQ ID NO:17 is AmsGfsUmGfAmAf(-)hmpNA(G)CmGmAfAmGfUmGfCmAfCmAfCmsGmsGm, SEQ ID NO:18 is AmsUfsAmUfAmCf(-)hmpNA(C)CmAmAfAmGfAmCfAmAfAmAfGmsAmsAm, SEQ ID NO:19 is AmsAfsCmAfAmAf(-)hmpNA(A)GmAmAfAmAfUmUfGmGfUmAfAmsCmsAm, SEQ ID NO:20 is ImsGfsUmGfAmAf(-)hmpNA(G)CmGmAfAmGfUmGfCmAfCmAfCmsGmsGm, Among them, Af = adenine 2'-F ribonucleoside, Cf = cytosine 2'-F ribonucleoside, Uf = uracil 2'-F ribonucleoside, Gf = guanine 2'-F ribonucleoside, Am = adenine 2'-OMe ribonucleoside, Cm = cytosine 2'-OMe ribonucleoside, Gm = guanine 2'-OMe ribonucleoside. Um = uracil 2'-OMe ribonucleoside, Im = hypoxanthine 2'-OMe ribonucleoside, s represents that the two adjacent nucleotides on the left and right sides of the letter s are linked by a thiophosphodiester group; NAG0052' is [ka] represents (-)hmpNA(G) [ka] (-)hmpNA(C) [ka] represents (-)hmpNA(A) [ka] Represents.

[0292] In some embodiments, the dsRNA comprises: [ka] [ka] or a pharma- ceutically acceptable salt thereof; Among them, Af = adenine 2'-F ribonucleoside, Cf = cytosine 2'-F ribonucleoside, Gf = guanine 2'-F ribonucleoside, Uf = uracil 2'-F ribonucleoside; Am = adenine 2'-OMe ribonucleoside, Cm = cytosine 2'-OMe ribonucleoside, Gm = guanine 2'-OMe ribonucleoside, Um = uracil 2'-OMe ribonucleoside; Im = hypoxanthine 2'-OMe ribonucleoside, [ka] represents a thiophosphodiester group, [ka] represents a phosphodiester group, NAG0052' is [ka] represents NAG1 is [ka] represents (-)hmpNA(G) [ka] (-)hmpNA(C) [ka] represents (-)hmpNA(A) [ka] Represents.

[0293] In some embodiments, the pharma- ceutically acceptable salt may be any salt conventional in the art, including, but not limited to, sodium salts, potassium salts, ammonium salts, amine salts, and the like.

[0294] In some specific embodiments, the dsRNA is selected from TRD007970, TRD007994, TRD007995, TRD007970-1, TRD007994-1, TRD007995-1, TJR100259, or TJR100260.

[0295] In some embodiments, the dsRNA is TRD007970, the structure of which is as follows:

[0296] [ka] .

[0297] In some embodiments, the dsRNA is TRD007994, the structure of which is as follows:

[0298] [ka] .

[0299] In some embodiments, the dsRNA is TRD007995, the structure of which is as follows:

[0300] [ka] .

[0301] In some embodiments, the dsRNA is TRD007970-1, the structure of which is as follows:

[0302] [ka] .

[0303] In some embodiments, the dsRNA is TRD007994-1, the structure of which is as follows:

[0304] [ka] .

[0305] In some embodiments, the dsRNA is TRD007995-1, the structure of which is as follows:

[0306] [ka] .

[0307] In some embodiments, the dsRNA is TJR100259, the structure of which is as follows:

[0308] [ka] .

[0309] In some embodiments, the dsRNA is TJR100260, the structure of which is as follows:

[0310] [ka] .

[0311] In some embodiments, the dsRNA is TJR100410, the structure of which is as follows:

[0312] [ka] Among them, Af = adenine 2'-F ribonucleoside, Cf = cytosine 2'-F ribonucleoside, Gf = guanine 2'-F ribonucleoside, Uf = uracil 2'-F ribonucleoside, Am = adenine 2'-OMe ribonucleoside, Cm = cytosine 2'-OMe ribonucleoside, Gm = guanine 2'-OMe ribonucleoside, Um = uracil 2'-OMe ribonucleoside, Im = hypoxanthine 2'-OMe ribonucleoside.

[0313] [ka] represents a thiophosphodiester group, [ka] represents a phosphodiester group, NAG0052' is [ka] represents NAG1 is [ka] represents (-)hmpNA(G) [ka] (-)hmpNA(C) [ka] represents (-)hmpNA(A) [ka] Represents.

[0314] In some embodiments, the pharma- ceutically acceptable salt may be any salt conventional in the art, including, but not limited to, sodium salts, potassium salts, ammonium salts, amine salts, and the like.

[0315] In another aspect, the present disclosure provides a dsRNA comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand and the antisense strand comprising: the nucleotide sequence of the sense strand comprises SEQ ID NO:1 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:5; the nucleotide sequence of the sense strand comprises SEQ ID NO:2 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:6; the nucleotide sequence of the sense strand comprises SEQ ID NO:3 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:7; the nucleotide sequence of the sense strand comprises SEQ ID NO:4 and the nucleotide sequence of the antisense strand comprises SEQ ID NO:5; The nucleotide sequence of the sense strand comprises SEQ ID NO:1, and the nucleotide sequence of the antisense strand comprises SEQ ID NO:8.

[0316] In some embodiments, the sense and antisense strands of the dsRNA are The nucleotide sequence of the sense strand is SEQ ID NO:1 and the nucleotide sequence of the antisense strand is SEQ ID NO:5; The nucleotide sequence of the sense strand is SEQ ID NO:2 and the nucleotide sequence of the antisense strand is SEQ ID NO:6; The nucleotide sequence of the sense strand is SEQ ID NO:3 and the nucleotide sequence of the antisense strand is SEQ ID NO:7; The nucleotide sequence of the sense strand is SEQ ID NO:4 and the nucleotide sequence of the antisense strand is SEQ ID NO:5; the nucleotide sequence of the sense strand is SEQ ID NO:1, and the nucleotide sequence of the antisense strand is SEQ ID NO:8.

[0317] The siRNAs, dsRNAs described in this disclosure are selected from those of synthetic origin or prepared in vitro.

[0318] Pharmaceutical Compositions In another aspect, the present disclosure provides a synthetically derived or in vitro prepared compound selected from the dsRNAs described in this disclosure.

[0319] In another aspect, the present disclosure provides a pharmaceutical composition comprising the above-described dsRNA.

[0320] In some embodiments, the pharmaceutical composition further comprises one or more pharma- ceutically acceptable excipients.

[0321] In some embodiments, the pharmaceutical composition further comprises one or more other therapeutic agents.

[0322] In some embodiments, the pharmaceutical compositions comprise a dsRNA described in this disclosure and one or more other therapeutic agents as active ingredients.

[0323] In some embodiments, the dsRNA of the pharmaceutical composition is used in combination with one or more other therapeutic agents.

[0324] In some specific embodiments, the other therapeutic agent is selected from antiviral agents, reverse transcriptase inhibitors, immunostimulants, therapeutic vaccines, viral entry inhibitors, oligonucleotides that inhibit secretion or release of HbsAg, capsid inhibitors, and covalently closed circular (ccc) HBV DNA inhibitors.

[0325] A variety of drug delivery systems are known and may be applicable to the dsRNA or pharmaceutical compositions of the present disclosure, such as packaging in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated cellular endocytosis, construction of a nucleic acid that is part of a reverse transcribing virus or other vector.

[0326] In some embodiments, the dsRNA or pharmaceutical compositions described herein are administered conventionally, either locally (e.g., by direct injection or implantation) or systemically, or by oral, rectal or parenteral routes, including, but not limited to, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, inhalation (e.g., aerosol), mucosal (e.g., sublingual, intranasal), intracranial, and the like.

[0327] In some embodiments, a dsRNA or pharmaceutical composition provided by this disclosure may be administered by injection, for example, intravenous, intramuscular, intradermal, subcutaneous, intraduodenal or intraperitoneal injection.

[0328] In some embodiments, a dsRNA or pharmaceutical composition provided by this disclosure can be packaged into a reagent kit.

[0329] Methods of Use and Treatment In another aspect, the present disclosure provides the use of a dsRNA or a pharmaceutical composition according to the present disclosure in the preparation of a medicament.

[0330] In some embodiments, the medicament is used for the prevention and / or treatment of Hepatitis B virus (HBV) infection in a subject.

[0331] In some embodiments, the medicament is used for the prevention and / or treatment of a disease associated with Hepatitis B. In some embodiments, the disease associated with Hepatitis B is chronic hepatitis, and the subject is HBeAg positive or HBeAg negative.

[0332] In some embodiments, the Hepatitis B virus related disease is acute hepatitis B, chronic hepatitis B, hepatitis D virus infection, hepatitis D, liver fibrosis, progressive liver disease and hepatocellular carcinoma.

[0333] In some embodiments, the effective amount or effective dose of the dsRNA or pharmaceutical composition is about 0.001 mg / kg body weight to about 200 mg / kg body weight, about 0.01 mg / kg body weight to about 100 mg / kg body weight, or about 0.5 mg / kg body weight to about 50 mg / kg body weight.

[0334] In another aspect, the present disclosure provides a method for preventing and / or treating a disease, comprising administering to a subject an effective amount or dose of a dsRNA or pharmaceutical composition described in this disclosure.

[0335] In some embodiments, the disease is selected from Hepatitis B virus (HBV) infection. In some embodiments, the disease is selected from Hepatitis B virus-related diseases. In some embodiments, the Hepatitis B virus-related disease is chronic hepatitis, and the subject is HBeAg positive or HBeAg negative.

[0336] In some embodiments, the Hepatitis B virus-related disease is acute hepatitis B, chronic hepatitis B, hepatitis D virus infection, hepatitis D, liver fibrosis, progressive liver disease, and hepatocellular carcinoma. In some embodiments, the method of the present disclosure further comprises administering to the subject another therapeutic agent.

[0337] In some embodiments, the additional therapeutic agent is selected from an antiviral agent, a reverse transcriptase inhibitor, an immunostimulant, a therapeutic vaccine, a viral entry inhibitor, an oligonucleotide that inhibits secretion or release of HbsAg, a capsid inhibitor, a cccDNA inhibitor, and any combination of the foregoing.

[0338] In some embodiments, the effective amount or effective dose of the dsRNA or pharmaceutical composition is about 0.001 mg / kg body weight to about 200 mg / kg body weight, about 0.01 mg / kg body weight to about 100 mg / kg body weight, or about 0.5 mg / kg body weight to about 50 mg / kg body weight. In another aspect, the present disclosure provides a method for silencing a target gene or its mRNA in a cell in vivo or in vitro, comprising introducing the dsRNA or the pharmaceutical composition into the cell.

[0339] In some embodiments, the target genes include, but are not limited to, genes that target HBV (eg, HBV-S, HBV-X).

[0340] Methods for suppressing targeted genes In another aspect, the present disclosure provides a method for inhibiting expression of a target gene or its mRNA, comprising administering to a subject an effective amount or dose of a dsRNA described herein or a pharmaceutical composition described herein.

[0341] In some embodiments, the target gene includes, but is not limited to, HBV (e.g., HBV-S, HBV-X).

[0342] In some embodiments, the subject has previously been identified as having a pathological upregulation of the target gene or its mRNA in the targeted cell, cell population, tissue or subject.

[0343] The present disclosure further provides a method for inhibiting the replication of Hepatitis B virus (HBV) in a cell, comprising contacting the cell with the dsRNA and / or pharmaceutical composition of the present disclosure, thereby inhibiting the replication of HBV in the cell. In some embodiments, the cell is in the subject's body. In some embodiments, the cell is in vitro.

[0344] The present disclosure further provides a method for reducing the level of Hepatitis B virus (HBV) antigen in a subject infected with HBV, comprising administering to the subject a therapeutically effective amount of a dsRNA and / or pharmaceutical composition of the present disclosure, thereby reducing the level of HBV antigen in the subject. In some embodiments, the HBV antigen is HBsAg. In some embodiments, the HBV antigen is HBeAg. In some embodiments, the subject is HBeAg positive. In some embodiments, the subject is HBeAg negative.

[0345] Delivery method In another aspect, the disclosure provides a method of delivering an oligonucleotide to the liver, comprising administering to a subject an effective amount or an effective amount of the dsRNA or the pharmaceutical composition.

[0346] In some embodiments, the effective amount or effective dose of the dsRNA or pharmaceutical composition is about 0.001 mg / kg body weight to about 200 mg / kg body weight, about 0.01 mg / kg body weight to about 100 mg / kg body weight, or about 0.5 mg / kg body weight to about 50 mg / kg body weight.

[0347] In another aspect, the present disclosure provides an RNAi (RNA interference) agent comprising the above dsRNA or the above pharmaceutical composition.

[0348] In some embodiments, the effective amount or effective dose of the dsRNA or pharmaceutical composition is about 0.001 mg / kg body weight to about 200 mg / kg body weight, about 0.01 mg / kg body weight to about 100 mg / kg body weight, or about 0.5 mg / kg body weight to about 50 mg / kg body weight.

[0349] In another aspect, the disclosure further provides a cell comprising said dsRNA or said pharmaceutical composition.

[0350] In another aspect, the present disclosure further provides a reagent kit or a kit comprising the above-mentioned dsRNA or the above-mentioned pharmaceutical composition.

[0351] In the present disclosure, when the dsRNA or pharmaceutical composition is contacted with a cell expressing a target gene, the dsRNA or pharmaceutical composition will inhibit expression of the target gene by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% as measured (e.g., by psiCHECK activity screening, luciferase reporter gene detection, PCR or branched DNA (bDNA) based methods, or protein based methods such as immunofluorescence analysis, Western Blot, or flow cytometry).

[0352] In the present disclosure, when the dsRNA or pharmaceutical composition is contacted with a cell expressing a target gene, the percentage overexpression of the target gene mRNA by the dsRNA or pharmaceutical composition is 99% or less, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, or 10% or less as measured (e.g., by psiCHECK activity screening, luciferase reporter gene detection, PCR or branched DNA (bDNA) based methods, or protein based methods such as immunofluorescence analysis, Western Blot, or flow cytometry).

[0353] In the present disclosure, when the dsRNA or pharmaceutical composition is contacted with a cell expressing a target gene, the dsRNA maintains on-target activity while reducing off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% or at least 75% as measured (e.g., by psiCHECK activity screening, luciferase reporter gene detection, PCR or branched DNA (bDNA) based methods, or protein based methods such as immunofluorescence analysis, Western Blot, or flow cytometry).

[0354] In the present disclosure, when the dsRNA or pharmaceutical composition is contacted with a cell expressing a target gene, the dsRNA reduces on-target activity by at most 20%, at most 19%, at most 15%, at most 10%, at most 5%, or at most 1%, and reduces off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, as measured (e.g., by psiCHECK activity screening, luciferase reporter gene detection, PCR or branched DNA (bDNA) based methods, or protein based methods such as immunofluorescence analysis, Western Blot, or flow cytometry).

[0355] In the present disclosure, when the dsRNA or pharmaceutical composition is contacted with a cell expressing a target gene, the dsRNA or pharmaceutical composition increases on-target activity by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%, and reduces off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, as measured (e.g., by psiCHECK activity screening and luciferase reporter gene detection, PCR or branched DNA (bDNA) based methods, or protein based methods such as immunofluorescence analysis, Western Blot, or flow cytometry, etc.).

[0356] The present disclosure further provides a method for preparing a dsRNA or pharmaceutical composition comprising synthesizing a ligand, siRNA, dsRNA or pharmaceutical composition described in this disclosure.

[0357] Explanation of terms In order that the present disclosure may be more readily understood, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art.

[0358] The compounds of the present disclosure may have particular geometric or stereoisomeric forms. The present disclosure includes cis-trans isomers, (-)- and (+)-enantiomers, (R)- and (S)-enantiomers, diastereomers, (D)-isomers, (L)-isomers, and all such compounds, including racemic and other mixtures thereof, such as mixtures enriched in enantiomers or diastereomers, are intended to be within the scope of the present disclosure. Substituents such as alkyl groups may have other asymmetric carbon atoms. All such isomers and mixtures thereof are within the scope of the present disclosure. Compounds containing asymmetric carbon atoms of the present disclosure can be isolated in optically pure or racemic form. Optically pure forms may be resolved from racemic mixtures or synthesized using chiral starting materials or chiral reagents.

[0359] Optically active (R)- and (S)-isomers and D- and L-isomers can be prepared by chiral synthesis or chiral reagents or other conventional techniques. To obtain one enantiomer of a compound of the present disclosure, it can be prepared by asymmetric synthesis or derivatization with chiral auxiliaries, where the resulting diastereomeric mixture is isolated and the required enantiomer is purified by cleavage of the auxiliaries. Alternatively, if the molecule contains a basic (e.g., amino) or acidic (e.g., carboxy) functional group, the diastereomeric salt can be formed with an appropriate optically active acid or base, and the diastereomeric separation can be carried out by conventional methods well known in the art, followed by recovery to obtain the enantiomer in pure form. It should be noted that the separation of enantiomers and diastereomers is generally accomplished by the use of chromatography, which employs a chiral stationary phase and is optionally combined with a chemical derivatization method (e.g., forming a carbamate from an amine).

[0360] In the chemical structures of the compounds described in this disclosure, [ka] " bond indicates that no configuration is specified, i.e., if chiral isomers are present in the chemical structure, [ka] " is a bond like " [ka] " or " [ka] " or " [ka] " and " [ka] In the chemical structures of the compounds described in the present disclosure, [ka] " bond has no specified configuration, i.e., " [ka] The configuration of the bond "" may be the E configuration or the Z configuration, or may include both E and Z configurations simultaneously.

[0361] In the chemical structure of the present disclosure, [ka] ", [ka] " or " [ka] " may be attached to any one or more groups in accordance with the scope of the invention described herein, and the asterisk "*" represents a chiral center.

[0362] Unless a configuration is specified, the compounds and intermediates of the present disclosure may exist in different tautomeric forms, and all such forms are included within the scope of the present disclosure. The term "tautomer" or "tautomeric form" refers to structural isomers of different energies that are interconvertible by a low energy barrier. For example, proton tautomers (also called protolytic tautomers) include interconversions by protolysis, such as keto-enol and imine-enamine, lactam-lactim isomerization, etc. An example of lactam-lactim equilibrium is between A and B as shown below.

[0363] [ka] All of the compounds in this disclosure can be depicted in Form A or Form B. All tautomeric forms are within the scope of the invention. The naming of a compound does not exclude any tautomeric form.

[0364] The present disclosure further includes certain isotopically labeled compounds of the present disclosure that are the same as those described herein, but in which one or more atoms are replaced with an atom having an atomic mass or mass number different from the atomic mass or mass number normally found in nature. Illustrative examples of isotopes that can be attached to the compounds of the present disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, e.g., 2 H, 3 H, 11 C. 13 C. 14 C. 13 N, 15 N, 15 O. 17 O. 18 O. 31 P, 32 P, 35 S, 18 F, 123 I, 125 I and 36 Cl, etc.

[0365] Unless otherwise stated, when a position is specifically designated as deuterium (D), it should be understood that the position is deuterium (i.e., at least 10% deuterium incorporated) with an abundance at least 1000 times greater than the natural abundance of deuterium (which is 0.015%). In the example compounds, having an abundance greater than the natural abundance of deuterium may be at least 1000 times greater abundance of deuterium, at least 2000 times greater abundance of deuterium, at least 3000 times greater abundance of deuterium, at least 4000 times greater abundance of deuterium, at least 5000 times greater abundance of deuterium, at least 6000 times greater abundance of deuterium, or greater abundance of deuterium. The present disclosure further includes various deuterated forms of the compounds of formula (I), formula (I'), and formula (II). Each available hydrogen atom connected to a carbon atom may be independently replaced with a deuterium atom. Those skilled in the art can synthesize deuterated forms of the compounds of formula (I), formula (I'), and formula (II) by referring to the relevant literature. Deuterated forms of the compounds of formula (I), formula (I') and formula (II) may be prepared using commercially available deuterated starting materials or may be synthesized by conventional techniques with deuterated reagents including, but not limited to, borane deuteride, borane tritide in tetrahydrofuran, lithium aluminum deuteride, deuterated iodoethane and deuterated iodomethane.

[0366] Unless otherwise specified, "optionally," "optionally," "optionally," or "alternatively" means that the subsequently described event or circumstance may or may not occur, and the description includes cases where the event or circumstance occurs and cases where it does not occur. For example, "optionally, R1 and R2 are directly linked to form a ring" means that R1 and R2 may be directly linked to form a ring, but are not required to be present, and the description includes cases where R1 and R2 are directly linked to form a ring and cases where R1 and R2 do not form a ring.

[0367] The term "about" or "approximately" means that a numerical value is within an acceptable error range of a specific value as measured by one of ordinary skill in the art, as determined by how the numerical portion is measured (i.e., the limitations of the measurement system). For example, "about" may mean within a standard deviation. Alternatively, "about" or "essentially including" may mean a variation of at most 20%, for example, between 1% and 15%, between 1% and 10%, between 1% and 5%, between 0.5% and 5%, between 0.5% and 1%, and in this disclosure, any instance where the term "about" precedes a number or range of values ​​includes a given number of embodiments. Unless otherwise stated, when a specific value appears in the present application and claims, the meaning of "about" or "essentially including" should be assumed to be within an acceptable error range of the specific value.

[0368] In this disclosure, the term "comprising" may be substituted with "consisting of."

[0369] Unless otherwise specified, any of the "compounds," "chemical modifications," "ligands," "dsRNA," "nucleic acids," and "RNAi" disclosed herein can independently exist in the form of a salt, a mixed salt, or a non-salt (e.g., free acid or free base). If present in the form of a salt or mixed salt, it may be a pharma- ceutically acceptable salt.

[0370] A "pharmaceutically acceptable salt" may be selected from an inorganic salt or an organic salt, and may also include pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

[0371] "Pharmaceutically acceptable acid addition salt" refers to a salt formed with an inorganic or organic acid that is capable of retaining the bioavailability of the free base without other adverse effects. Inorganic acid salts include, but are not limited to, hydrochloride, hydrobromide, sulfate, nitrate, phosphate, etc., and organic acid salts include, but are not limited to, formate, acetate, 2,2-dichloroacetate, trifluoroacetate, propionate, caproate, octanoate, decanoate, undecylenate, glycolate, gluconate, lactate, sebacate, adipate, glutarate, malonate, oxalate, maleate, succinate, fumarate, tartrate, citrate, palmitate, stearate, oleate, cinnamate, laurate, malate, glutamate, pyroglutamate, aspartate, benzoate, mesylate, benzenesulfonate, p-toluenesulfonate, alginate, ascorbate, salicylate, 4-aminosalicylate, naphthalenedisulfonate, etc. These salts can be prepared by methods known in the art.

[0372] "Pharmaceutically acceptable base addition salt" refers to a salt formed with an inorganic or organic base that can retain the bioavailability of the free acid without other side effects. Salts derived from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, etc. Preferred inorganic salts are ammonium salts, sodium salts, potassium salts, calcium salts and magnesium salts, with sodium salts being preferred. Salts derived from organic bases include, but are not limited to, the following salts: primary amines, secondary amines, and tertiary amines, substituted amines including natural substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethylethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, choline, glycine betaine, ethylenediamine, glucosamine, methylglucosamine, theobromine, purine, piperazine, piperidine, N-ethylpiperidine, polyamide resins, and the like. Preferred organic bases include isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. These salts can be prepared by methods known in the art.

[0373] An "alkyl group" refers to, for example, straight-chain and branched-chain groups containing 1 to 30 carbon atoms (C1-C 30By "alkyl" is meant a saturated aliphatic hydrocarbon group, for example an alkyl group having 1 to 6 carbon atoms (C1-C6 alkyl group), or an alkyl group having 1 to 3 carbon atoms (C1-C3 alkyl group). Non-limiting examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, and various branched chain isomers thereof.

[0374] The term "alkenyl group" refers to a hydrocarbon group containing at least one double bond. Non-limiting examples of alkenyl groups include, but are not limited to, vinyl, 1-propenyl, 2-propenyl, 1-butenyl, or 2-butenyl groups and their various branched chain isomers.

[0375] The term "alkynyl group" refers to a hydrocarbon group containing at least one triple bond. Non-limiting examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, or 2-butynyl groups and their various branched chain isomers.

[0376] The term "alkoxy" refers to an -O-(alkyl group), where alkyl is defined above. Non-limiting examples of alkoxy groups include methoxy, ethoxy, propoxy, and butoxy groups.

[0377] "Cycloalkyl group" refers to a saturated or partially unsaturated monocyclic or polycyclic cyclic hydrocarbon substituent, where the cycloalkyl ring contains 3 to 20 carbon atoms, preferably 3 to 6 carbon atoms, and more preferably 5 to 6 carbon atoms. Non-limiting examples of monocyclic cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, and the like, and polycyclic cycloalkyl groups include spiro, fused, and bridged ring cycloalkyl groups.

[0378] A "heterocycloalkyl group" is a saturated or partially unsaturated monocyclic or polycyclic cyclic hydrocarbon substituent containing 3 to 20 ring atoms, one or more of which is nitrogen, oxygen, or S(O). m (wherein m is an integer of 0 to 2), but does not include the ring moiety of -OO-, -OS- or -SS-, and the remaining ring atoms are carbon. It preferably contains 3 to 12 ring atoms, of which 1 to 4 are heteroatoms, and more preferably contains 3 to 7 ring atoms. Non-limiting examples of "heterocycloalkyl groups" are: [ka] etc.

[0379] The heterocycloalkyl ring may be fused to an aryl or heteroaryl group, in which the ring connected to the parent structure is a heterocycloalkyl group, non-limiting examples of which are: [ka] etc.

[0380] "Aryl group" refers to a 6-14 membered all-carbon monocyclic or fused polycyclic (i.e. rings sharing adjacent pairs of carbon atoms) group having a conjugated pi-electron system, preferably 6-12 membered, such as phenyl and naphthyl. The aryl ring may be fused to a heteroaryl, heterocycloalkyl or cycloalkyl ring, in which the ring connected to the parent structure is an aryl ring, non-limiting examples of which are: [ka] Includes.

[0381] "Heteroaryl group" refers to a heteroaromatic system containing 1 to 4 heteroatoms and 5 to 14 ring atoms, where the heteroatoms are selected from oxygen, sulfur and nitrogen. The heteroaryl group is preferably 6 to 12 membered, more preferably 5 or 6 membered. Non-limiting examples thereof include imidazolyl group, furyl group, thienyl group, thiazolyl group, pyrazolyl group, oxazolyl group, isoxazolyl group, pyrrolyl group, tetrazolyl group, pyridyl group, pyrimidinyl group, thiadiazolyl group, pyrazinyl group, triazolyl group, indazolyl group, benzimidazolyl group, [ka] etc.

[0382] The heteroaryl ring may be fused to an aryl, heterocycloalkyl or cycloalkyl ring, of which the ring connected to the parent structure is a heteroaryl ring, non-limiting examples of which are: [ka] Includes.

[0383] The term "hydroxy" refers to an -OH group.

[0384] The term "halogen" refers to fluorine, chlorine, bromine or iodine.

[0385] The term "cyano" refers to -CN.

[0386] The term "amino group" refers to -NH2.

[0387] The term "nitro group" refers to --NO.sub.2.

[0388] The term "oxo" refers to a ═O substituent.

[0389] In the present disclosure, a "phosphate group" may be a phosphomonoester, phosphodiester or phosphotriester group, preferably a phosphodiester group.

[0390] As used herein, a thiophosphodiester group refers to a phosphodiester group modified by replacing one of the non-bridging oxygen atoms with a sulfur atom; [ka] is used interchangeably with

[0391] "Substituted" refers to one or more hydrogen atoms in a group, preferably up to 5, more preferably 1 to 3 hydrogen atoms, being independently replaced with a corresponding number of substituents. When a substituent is a ketone or oxo (i.e., =O), two (2) hydrogens on the atom are replaced.

[0392] In the context of this disclosure: [ka] Based on [ka] can be substituted with any group capable of linking to an adjacent nucleotide.

[0393] The term "linked," when referring to a connection between two molecules, refers to whether the two molecules are joined by a covalent bond or whether the two molecules are joined by a non-covalent bond (e.g., a hydrogen bond or an ionic bond), and includes a direct link and an indirect link.

[0394] The term "directly linked" refers to a connection between a first compound or group and a second compound or group without any intervening atoms or groups.

[0395] The term "indirectly linked" refers to a connection between a first compound or group and a second compound or group through an intermediate group, compound or molecule (eg, a linking group).

[0396] "Pharmaceutical composition" means a mixture of one or more compounds described herein or physiologically acceptable salts or prodrugs thereof with other chemical components, and other components such as physiologically acceptable vectors and excipients, etc. The pharmaceutical composition is intended to facilitate administration to the living body and contribute to the absorption of the active ingredients to further exert biological activity.

[0397] A "pharmaceutically acceptable excipient" includes, but is not limited to, any auxiliary agent, vector, glidant, sweetener, diluent, preservative, dye / colorant, flavoring agent, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonicity agent, buffer, solvent, or emulsifier that is approved and acceptable for use in humans or domestic animals.

[0398] As used herein, the term "inhibition" can be used interchangeably with "reduction," "silencing," "downregulation," "suppression," and other similar terms, and includes any level of inhibition. Inhibition can be assessed by a reduction in the absolute or relative level of one or more of these variables as compared to a control level. The control level can be any type of control level used in the art, such as a pre-administration baseline level or a level determined from a similar untreated or control (e.g., buffer control or inactive agent only) treated subject, cell, or sample. For example, the mRNA overexpression level can indicate the degree of inhibition of target gene expression by siRNA (or dsRNA), for example, the mRNA overexpression level can be 99% or less, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, or 10% or less. The inhibition rate of target gene expression was detected using the Dual-Glo (registered trademark) Luciferase Assay System, and the Firefly chemiluminescence value and the Renilla chemiluminescence value were read, and the relative value Ratio = Ren / Fir, inhibition rate (%) = 1 - (Ratio + siRNA / reporter gene only) × 100%, was calculated. In the present disclosure, the excess mRNA expression ratio (or excess activity %) = 100% - inhibition rate (%).

[0399] The term "effective amount" or "effective dosage" includes an amount sufficient to ameliorate or prevent the symptoms or condition of a medical condition. Effective amount also refers to an amount sufficient to permit or facilitate diagnosis. The effective amount used in a particular patient or veterinary subject can vary depending on factors such as the condition being treated, the overall health of the patient, the route and dosage of administration, and the severity of side effects. An effective amount may be the maximum dosage or dosing regimen in which significant side effects or toxic effects are avoided.

[0400] As used herein, the terms "subject," "patient," "subject" or "individual" can be used interchangeably and include a human or a non-human animal, such as a mammal, for example a human or a monkey.

[0401] As used herein, the sense strand (also referred to as SS, SS strand, or sense strand) refers to the strand that contains a sequence identical or substantially identical to a target mRNA sequence, and the antisense strand (also referred to as AS or AS strand) refers to the strand that has a sequence complementary to a target mRNA sequence.

[0402] In the present disclosure, the "5' region" or "5' end" of the sense strand or antisense strand is used interchangeably. For example, nucleotides 2 to 8 of the 5' region of the antisense strand may be substituted with nucleotides 2 to 8 of the 5' end of the antisense strand. Similarly, the "3' region", "3' end" and "3' end" of the sense strand or antisense strand are also used interchangeably.

[0403] In the context of describing the siRNA sense strand described herein, the term "a sequence that differs by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NO:1 to SEQ ID NO:4, and that comprises at least 15 consecutive nucleotides" is intended to indicate that the siRNA sense strand described herein comprises at least 15 consecutive nucleotides of the sense strand of any one of SEQ ID NO:1 to SEQ ID NO:4, or a sequence that differs by no more than 3 nucleotides from the at least 15 consecutive nucleotides of the sense strand of any one of SEQ ID NO:1 to SEQ ID NO:4 (optionally, a sequence that differs by no more than 2 nucleotides, optionally, a sequence that differs by no more than 1 nucleotide). Optionally, the siRNA sense strand described herein comprises at least 16 consecutive nucleotides of the sense strand of any one of SEQ ID NO:1 to SEQ ID NO:4, or a sequence that differs by no more than 3 nucleotides from the at least 16 consecutive nucleotides of the sense strand of any one of SEQ ID NO:1 to SEQ ID NO:4 (optionally, a sequence that differs by no more than 2 nucleotides, optionally, a sequence that differs by no more than 1 nucleotide).

[0404] In the context of describing the siRNA antisense strand described herein, the term "a sequence that differs by no more than 3 nucleotides from the antisense strand of any one of SEQ ID NO:5 to SEQ ID NO:8, and that contains at least 15 consecutive nucleotides" is intended to indicate that the siRNA antisense strand described herein contains at least 15 consecutive nucleotides of the antisense strand of any one of SEQ ID NO:5 to SEQ ID NO:8, or a sequence that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides of the antisense strand of any one of SEQ ID NO:5 to SEQ ID NO:8 (optionally, a sequence that differs by no more than 2 nucleotides, optionally, a sequence that differs by no more than 1 nucleotide).

[0405] Unless otherwise indicated, in the context of this disclosure, "G", "C", "A", "T" and "U" refer to nucleotides containing the bases guanine, cytosine, adenine, thymidine and uracil, respectively. In the context of this disclosure, I corresponds to a nucleotide containing the nucleobase hypoxanthine. In some embodiments, the term inosine as used in this disclosure corresponds to a nucleoside comprising hypoxanthine and a sugar or modified sugar.

[0406] Unless otherwise specified, in the context of the present disclosure, a lowercase letter d indicates that one nucleotide adjacent to the downstream side of the letter d is a deoxyribonucleotide, a lowercase letter m indicates that one nucleotide adjacent to the upstream side of the letter m is a nucleotide modified with a 2'-methoxy group, a lowercase letter f indicates that one nucleotide adjacent to the upstream side of the letter f is a nucleotide modified with a 2'-fluoro group, and a lowercase letter s indicates that the two nucleotides adjacent to the left and right of the letter s are linked by a thiophosphodiester group.

[0407] As used herein, the term "2'-fluoro (2'-F) modified nucleotide" refers to a nucleotide formed by replacing the hydroxy group at the 2' position of the ribosyl group of a nucleotide with a fluoro, and "non-fluoro modified nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the hydroxy group at the 2' position of the ribosyl group of a nucleotide with a non-fluoro group.

[0408] As used in this disclosure, the term "2'-methoxy (2'-OMe) modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxy group of a ribosyl group with a methoxy group.

[0409] In the context of this disclosure, a "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the type of nucleotide base at the same position in the former is changed compared to the latter, for example, if one nucleotide base in the latter is A and the corresponding nucleotide base at the same position in the former is U, C, G or T, then it is considered that there is a nucleotide difference at that position between the two nucleotide sequences. In some embodiments, a nucleotide difference at a position is considered to occur if the nucleotide at the original position is replaced with an abasic nucleotide or its equivalent.

[0410] As used herein, the terms "complementary" or "reverse complementary" can be used interchangeably and have the meaning known to those skilled in the art that in a double-stranded nucleic acid molecule, bases in one strand pair with bases in another strand in a complementary manner. In DNA, the purine base adenine always pairs with the pyrimidine base thymine (or uracil in RNA), and the purine base guanine always pairs with the pyrimidine base cytosine. Each base pair contains one purine and one pyrimidine. If adenine in one strand always pairs with thymine (or uracil) in the other strand, and guanine always pairs with cytosine, the two strands are said to be complementary to each other, and the sequence of the strand can be deduced from the sequence of its complementary strand. Accordingly, "mismatch" is used in the art to mean that bases at corresponding positions in a double-stranded nucleic acid are not present paired in a complementary manner.

[0411] The term "chemical modification" or "modification" includes any alteration of a nucleotide by chemical means, such as the addition or removal of a chemical moiety, or the substitution of one chemical moiety for another.

[0412] The term "dsRNA" refers to a double-stranded RNA molecule containing a sense and an antisense strand capable of RNA interference.

[0413] The term "base" includes any known DNA and RNA base, base analogs, such as purines and pyrimidines, as well as the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs. A base analog may be a universal base.

[0414] The terms "flat-ended" or "blunt-ended" are used interchangeably to mean the absence of unpaired nucleotides or nucleotide analogs at a given end of the siRNA, i.e., the absence of nucleotide overhangs. In most cases, siRNAs with two blunt ends are double-stranded throughout their entire length.

[0415] The siRNA provided by the present disclosure can be obtained by conventional preparation methods in this field (for example, solid-phase synthesis and liquid-phase synthesis methods). Among them, solid-phase synthesis has already been commercialized as a customization service. The modified nucleotide group can be introduced into the siRNA described in the present disclosure by the nucleoside monomer having the corresponding modification, and the method of preparing the nucleoside monomer having the corresponding modification and the method of introducing the modified nucleotide group into the siRNA are also well known to those skilled in the art.

[0416] The terms "combination" and "use in combination" as used herein refer to a method of administration in which at least one dose of dsRNA and at least one dose of another therapeutic agent are administered within a certain period of time, in which both of the administered agents exhibit a pharmacological effect. The dsRNA can be administered simultaneously or sequentially with the other therapeutic agent. Such a period includes treatment in which the dsRNA and the other therapeutic agent are administered by the same or different administration routes. The combination administration method as described herein can be selected from simultaneous administration, separate preparation and co-administration, or separate preparation and successive administration. [Brief description of the drawings]

[0417] [Figure 1] This shows the excess expression of TTR mRNA on day 7 after administration of TRD002218 and TRD007205. [Diagram 2] This shows the excess expression of TTR mRNA on day 28 after administration of TRD002218 and TRD007205. [Diagram 3] 1 shows the results of a gel electrophoresis experiment of exonuclease stability. [Figure 4] Experimental quantification of 5' exonuclease stability. [Diagram 5] 4 shows experimental quantification of 3' exonuclease stability. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0418] The present disclosure will be further described below in conjunction with examples, but these examples are not intended to limit the scope of the present disclosure. Experimental methods for which specific conditions are not specified in the examples of the present disclosure generally follow normal conditions or conditions recommended by the manufacturers of raw materials or products. For reagents for which a specific source is not specified, the reagents can be obtained from any molecular biology reagent supplier with quality / purity for molecular biology use.

[0419] Example 1: Preparation of Chemical Modifications 1.1 Synthesis of Compound 1-1a and Compound 1-1b [ka] Compound 1 (500mg, 3.42mmol) and triethylamine (Et3N, 692mg, 6.84mmol, 0.95mL) were dissolved in dichloromethane (DCM, 10mL), and a solution of 4-toluenesulfonyl chloride (TsCl, 717mg, 3.76mmol) in dichloromethane (10mL) was added dropwise under ice bath. After the addition was completed, the mixture was reacted with stirring at room temperature overnight. After the reaction was completed, the mixture was quenched with water, and the aqueous phase was extracted three times with dichloromethane (15mL). The combined organic phase was first washed with saturated aqueous sodium bicarbonate solution (10mL), then washed with saturated saline (20mL), and the solvent was evaporated to dryness under reduced pressure to obtain crude product 2 (820mg, 80%), which was used directly in the next reaction. MS m / z:C 14 H 21 O5S, [M+H] + Theoretical: 301.10, Actual: 301.2.

[0420] [ka] Compound 3 (239 mg, 1.22 mmol) was dissolved in dimethylformamide (DMF, 10 mL), and NaH (60% dissolved in mineral oil, 93 mg, 2.33 mmol) solution was added under ice bath, and the reaction was carried out with stirring for 30 minutes. Compound 2 (350 mg, 1.16 mmol) was then added dropwise, and after the addition was completed, the reaction was carried out with stirring at 60° C. for 5 hours. After the reaction was completed, water was added to quench the reaction, and the aqueous phase was extracted three times with ethyl acetate (15 mL). The combined organic phase was first washed three times with water (10 mL), and then washed with saturated saline (10 mL), and the solvent was evaporated to dryness under reduced pressure, and the mixture was analyzed by reversed-phase preparative HPLC (C 18 (Conditions: 5%-50% (A: HO, B: CHCN), flow rate: 70 mL / min) and freeze-drying to give 220 mg of compound 4. MS m / z: C 19 H 21 N5O3Na, [M+Na] + Theoretical: 390.16, Actual: 390.3.

[0421] [ka] Compound 4 (1.50 g, 4.08 mmol) was dissolved in 20 mL of a mixture of acetic acid and water (4:1) at room temperature and stirred at 60 °C for 30 min. After the reaction was completed, the solvent was evaporated to dryness under reduced pressure and the resulting mixture was analyzed by reverse phase preparative HPLC (C 18 (Conditions: 5%-25% (A: HO, B: CHCN), flow rate: 70 mL / min) and freeze-drying to give 1.10 g of compound 5. MS m / z: C 16 H 18 N5O3, [M+H] + Theoretical: 328.13, Actual: 328.4.

[0422] [ka] Compound 5 (1.00 g, 3.05 mmol) was dissolved in pyridine (Py, 10 mL), and a solution of 4,4'-dimethoxytrityl chloride (DMTrCl, 1.50 g, 4.58 mmol) in pyridine (5 mL) was added dropwise in an ice bath. After the addition was completed, the reaction was allowed to proceed overnight at room temperature with stirring. After the reaction was completed, the reaction was quenched with water, the solvent was evaporated to dryness under reduced pressure, and the reaction mixture was analyzed by reverse phase preparative HPLC (C 18 (Conditions: 5%-80% (A: HO, B: CHCN), flow rate: 70 mL / min) and freeze-drying to give 1.00 g of compound 6. MS m / z: C 37 H 36 N5O5, [MH] + Theoretical: 630.26, Found: 630.5. Racemic compound 6 was resolved by chiral column (Daicel CHIRALPAK® IE 250mm*4.6mm, 5μm, A: n-hexane, B: ethanol) to give 410mg of 6A(-) and 435mg of 6B(+).

[0423] [ka] Compound 6A(-) (200 mg, 0.32 mmol), tetrazolium (11 mg, 0.16 mmol), N-methylimidazole (5 mg, 0.06 mmol), and 3A molecular sieves (500 mg) were dissolved in 10 mL of acetonitrile, and compound 7 (144 mg, 0.48 mmol) was added at room temperature and stirred at room temperature overnight. After the reaction was completed, the molecular sieves were removed by filtration, dichloromethane (30 mL) was added, and the mixture was washed three times with saturated aqueous sodium bicarbonate solution (10 mL), and then with saturated saline (20 mL). The filtrate was rotovapped and then analyzed by reverse phase preparative HPLC (C 18 (Conditions: 5% to 100% (A: water, B: CH3CN), flow rate: 70 mL / min) and freeze-drying to obtain 200 mg of compound 1-1a. MS m / z: C 40 H 39 N6O7P, [M-Diisopropyl+OH] +Theory: 747.26, Actual measurement: 747.6. 1H NMR (400 MHz, acetonitrile-d3) δ 7.56, 7.54 (2s, 1H), 7.36-7.27 (m, 2H), 7.24-7.21 (m, 7H), 6.83-6.80 (m, 4H), 4.12-4.10 (m, 2H), 3.75-3.68 (m, 10H), 3.20-2.80 (m, 2H), 2.68-2.54 (m, 4H), 1.22-1.04 (m, 18H).

[0424] [ka] Compound 6B(+) (200 mg, 0.32 mmol), tetrazolium (11 mg, 0.16 mmol), N-methylimidazole (5 mg, 0.06 mmol), and 3A molecular sieves (500 mg) were dissolved in 10 mL of acetonitrile, and compound 7 (144 mg, 0.48 mmol) was added at room temperature and stirred overnight at room temperature. After the reaction was completed, the molecular sieves were removed by filtration, dichloromethane (30 mL) was added, and the mixture was washed three times with saturated aqueous sodium bicarbonate solution (10 mL), and then with saturated saline (20 mL). The filtrate was rotovapped and then analyzed by reverse phase preparative HPLC (C 18 (Conditions: 5% to 100% (A: water, B: CH3CN), flow rate: 70 mL / min) and freeze-drying to obtain 200 mg of compound 1-1b. MS m / z: C 40 H 39 N6O7P, [M-Diisopropyl+OH] + Theoretical: 747.26, Actual: 747.5.

[0425] 1.2 Synthesis of Compound 1-6a [ka] Compound 1 (10 g, 68.404 mmol), compound 2 (15 g, 62.186 mmol) and triphenylphosphine (32.62 g, 124.371 mmol) were dissolved in anhydrous THF (30 mL), and DIAD (24.656 mL, 124.371 mmol) was slowly added dropwise at 0°C. The reaction solution was reacted at 25°C for 12 h, and LCMS showed that the reaction was complete. The reaction solution was extracted with ethyl acetate (200 mL) and water (200 mL), the organic phase was dried, and the filtrate was concentrated, and the resulting residue was purified by normal phase column (DCM / MeOH=10 / 1) to obtain the target product 3 (20 g).

[0426] [ka] Compound 3 (20 g, 28.585 mmol) was dissolved in acetic acid (24 mL, 426.016 mmol) and HO (12 mL) and stirred at 60 °C for 1 h. The reaction was then rotovapped and THF (12 mL) and HO (12 mL) were added and stirred at 80 °C for 7 h. LCMS showed the reaction was complete. The reaction was extracted with ethyl acetate (200 mL) and water (100 mL), and solid sodium carbonate was added to the aqueous phase until a large amount of solid precipitated in the aqueous phase. The solid was filtered, washed with water, and the filter cake was dried by oil pump to give target compound 5 (9 g).

[0427] [ka] Under nitrogen gas protection, compound 5 (6.8 g, 18.581 mmol) was dissolved in pyridine (80 mL), and TMSCl (14.250 mL, 111.489 mmol) was added slowly at 0 °C, and stirred for 2 h. Then, isobutyryl chloride (2.044 mL, 19.511 mmol) was added at 0 °C, and stirred at 25 °C for 1 h, and LCMS showed that the reaction was complete. After extraction with dichloromethane (200 mL) and water (200 mL), the organic phase was spun dry, and the sample was mixed and purified by normal phase column (DCM:MeOH = 10:1) and column, and a peak was observed at 4.8%, to obtain yellow oily compound 6 (12 g).

[0428] [ka] Under nitrogen gas protection, compound 6 (5.5g, 12.392mmol) was dissolved in pyridine (30mL), MOLECULAR SIEVE 4A 1 / 16 (7g, 12.392mmol) was added, and then DMTrCl (5.04g, 14.870mmol) solid was added in several portions at 0℃, and the reaction was carried out at 25℃ for 2h, and TLC (PE:EtOAc=1:1, Rf=0.69) showed that the reaction was already completed. The reaction solution was treated together with TJN200879-040-P1. The reaction solution was extracted with ethyl acetate (200mL) and water (200mL), and the organic phase was spun dry, after which the sample was mixed and purified with a normal phase column (PE:EtOAc was applied to the column, and a peak was obtained at 84%) to obtain a yellow oily compound 7 (12g).

[0429] [ka] Compound 7 (12 g, 15.389 mmol) was dissolved in EtOAc (140 mL), and wet palladium / carbon (Pd / C) (7 g, 15.389 mmol) was added, and the reaction solution was reacted at 25° C. under hydrogen gas (15 Psi) for 2 h. TLC (PE:EtOAc=0:1, Rf=0.09) showed that the reaction was already completed. The reaction solution was filtered, and the filter cake was washed with ethyl acetate (30 mL) three times, and the filtrate was collected. After the filtrate was spun dry, 50 mL of dichloromethane and 2 mL of triethylamine were added, and the sample was mixed and purified by normal phase column (DCM:MeOH=10:1, column, 0.5% peak), to obtain 9 g (yellow foamy solid), and the obtained racemic compound was separated by SFC to obtain the product target compound 7A(-) (3.9 g) and target compound 7B(+) (3.8 g).

[0430] [ka] Compound 7A(-) (3.30g, 5.40mmol), tetrazolium (190mg, 2.70mmol), 1-methylimidazole (90mg, 1.10mmol), 3A molecular sieve (500mg) were dissolved in 30mL of acetonitrile, and compound 8 (2.50g, 8.10mmol) was added at room temperature and stirred at room temperature for 2h. After the reaction was completed, the molecular sieve was filtered off, washed with DCM (150mL), saturated aqueous sodium bicarbonate (30mL x 3), and further washed with saturated saline (30mL), the filtrate was spun dry, and then passed through reverse phase preparative HPLC (C18, conditions: 5%-100% (A: water, B: CH3CN), flow rate: 70mL / min) to obtain 1-6a (2.9g, 66%) after lyophilization. MS m / z:C43H55N7O7P [M+H]+, theoretical: 812.38, measured: 812.5. 1H NMR (400 MHz, acetonitrile-d3) δ 7.56, 7.54 (2s, 1H), 7.36-7.27 (m, 2H), 7.24-7.21 (m, 7H), 6.83-6.80 (m, 4H), 4.12-4.10 (m, 2H), 3.75-3.68 (m, 10H), 3.20-2.80 (m, 2H), 2.68-2.54 (m, 4H), 1.22-1.04 (m, 18H).

[0431] 1.3 Synthesis of Compound 1-7a [ka] Under nitrogen gas protection, compound 1 (5 g, 23.1272 mmol), compound 2 (6.76 g, 46.254 mmol) and triphenylphosphine (7.28 g, 27.753 mmol) were dissolved in 30 mL of dioxane, and DEAD (5.502 mL, 27.753 mmol) was slowly added dropwise at 0 ° C. After the addition was completed, the reaction was gradually warmed to 25 ° C. and continued to react for 1 h. The reaction was extracted with 100 mL of H2O and 100 mL of EtOAc, the organic phase was combined, dried, filtered and concentrated, and the sample was mixed and applied to a column and purified by normal phase column (PE: EtOAc = 1: 1 applied to the column) to obtain the target product (4 g).

[0432] [ka] Compound 3 (3.3 g) was dissolved in HOAc (16 mL) and HO (4 mL), heated in an oil bath at 60 °C for 0.5 h, and the reaction solution was rotovapped. The resulting residue was purified by normal phase column chromatography (PE:EtOAc = 0:1) to give the target product 4 (3 g).

[0433] [ka] Compound 4 (3 g, 8.873 mmol) was dissolved in 5 mL of pyridine and 10 mL of DMTrCl (3.91 g, 11.535 mmol) was slowly added dropwise at 0°C under nitrogen gas protection. After the addition was complete, the reaction was warmed to 25°C and allowed to react for 1 h. The reaction was extracted with 50 mL of water and 100 mL of ethyl acetate. The aqueous phase was further extracted three times with 100 mL of ethyl acetate, and the combined organic phase was dried, filtered, concentrated, and purified on a normal phase column (PE:EtOAc = 2:1). The target product 5 (4 g) was obtained.

[0434] [ka] Compound 5 (4 g, 5.769 mmol) was dissolved in methanol (10 mL), and saturated NH3 methanol solution (40 mL) was added and reacted at 0 °C for 6 h. The reaction solution was rotary evaporated and purified by normal phase column (PE: EtOAc = 0: 1) to obtain 2.4 g of racemic compound, which was separated by SFC to obtain target product 6A (750 mg, 100% purity) and target product 6B (400 mg, 99.16% purity).

[0435] [ka] Compound 6A(-) (700 mg, 1.40 mmol), tetrazolium (50 mg, 0.70 mmol), 1-methylimidazole (23 mg, 0.28 mmol), and 3A molecular sieves (500 mg) were dissolved in 10 mL of acetonitrile, and compound 7 (630 mg, 2.10 mmol) was added at room temperature and stirred at room temperature for 2 h. After the reaction was completed, the molecular sieves were filtered off, and washed with DCM (50 mL) and saturated aqueous sodium bicarbonate (10 mL x 3), and further washed with saturated saline (20 mL). The filtrate was spun dry and passed through reverse phase preparative HPLC (C18, conditions: 5% to 100% (A: water, B: CH3CN), flow rate: 70 mL / min), and then lyophilized to obtain 1-7a (700 mg, 72%). MS m / z: C38H47N4O7PNa[M+Na]+, theoretical: 725.32, observed: 725.5.

[0436] 1.4 Synthesis of Compound 1-8a [ka] Compound 1 (8.5 g, 76.508 mmol) and compound 2 (30.64 g, 91.809 mmol) were dissolved in DMF (150 mL), and CS2CO3 (29.91 g, 91.809 mmol) was added, and the reaction was reacted at 90 °C for 12 h under nitrogen gas protection. The reaction was detected to be complete by LCMS. The reaction solution was filtered, rotary dried with an oil pump, and purified by normal phase column separation (80 g, DCM / MeOH = 10 / 1 to 5 / 1) to obtain the target product 3 (13.5 g, 80% purity).

[0437] [ka] Compound 3 (10.5 g, 35.105 mmol) was dissolved in pyridine (65 mL) and CH3CN (65 mL), BzCl (4.894 mL, 42.126 mmol) was added dropwise to the solution, and the mixture was reacted at 25 ° C for 2 h. LCMS detected the completion of the reaction of most of the raw materials, and the mixture was quenched by adding H2O (100 mL), extracted with EtOAc (100 mL × 3), dried by rotation, separated by column (combined with TJN200872-101) and purified (80 g, PE / EtOAc = 10 / 1 to 0 / 1, DCM / MeOH = 10 / 1) to obtain the target product 4 (14 g, 90% purity).

[0438] [ka] Compound 4 (14g, 36.694mmol) was dissolved in HOAc (56mL, 314.796mmol) and HO (14mL) and reacted at 60℃ for 2h, LCMS showed the reaction was complete. It was concentrated by oil pump and separated by normal phase column (40g, DCM / MeOH=1 / 0~5 / 1) to give the target product 5 (8.4g, 90% purity & 2.4g, 80% purity).

[0439] [ka] Compound 5 (7.4g, 21.957mmol), DMAP (0.54g, 4.391mmol), MOLECULAR SIEVE 4A (11.1g, 2.967mmol) were dissolved in pyridine (60mL) and stirred for 10min under ice bath, then DMTrCl (8.93g, 26.348mmol) was added and reacted with stirring for 1.8h, and it was detected by LCMS that about 19% of the raw material remained and about 60% of the target was MS. It was purified together with (TJN200872-105&106). The reaction solution was added with HO (50 mL), extracted with DCM (50 mL × 3), dried, rotovapped, and separated by column (120 g, PE / (EA:DCM:TEA=1:1:0.05)=1 / 0~0 / 1 to DCM / MeOH=10 / 1) to obtain the target compound 6 (11 g, 89% purity, TJN200872-105&106&107), and the raw material (3.0 g, 70% purity) was recovered.

[0440] [ka] Compound 6 (15 g, 22.041 mmol) was separated by SFC (DAICEL CHIRALPAK AD (250 mm × 50 mm, 10 μm), 0.1% NH3HO EtOH, B: 45% to 45%, 200 mL / min) to give target product 6A (5.33 g, 94.29% purity), target product 6B (6.14 g, 97.91% purity), and 1.0 g of compound 6 was recovered.

[0441] [ka] Compound 6B(-) (5.4 g, 8.92 mmol), tetrazolium (312 mg, 4.46 mmol), 1-methylimidazole (146 mg, 1.78 mmol), and 3A molecular sieves (500 mg) were dissolved in 40 mL of acetonitrile, and compound 7 (4 g, 13.4 mmol) was added at room temperature and stirred at room temperature for 2 h. After the reaction was completed, the molecular sieves were filtered off, and washed with DCM (200 mL) and saturated aqueous sodium bicarbonate (30 mL x 3), and further washed with saturated saline (50 mL). The filtrate was spun dry and passed through reverse phase preparative HPLC (C18, conditions: 5% to 100% (A: water, B: CH3CN), flow rate: 70 mL / min), and then lyophilized to obtain 1-8a (5.8 g, 80%). MS m / z: C45H51N5O7P, [M+H]+, theoretical: 804.36, measured: 804.4.

[0442] Example 2. Synthesis of siRNA The synthesis of dsRNA was the same as that of the conventional phosphoramidite solid-phase synthesis method. When synthesizing the 7-position modified nucleotide of the 5' AS strand, the parent sequence original nucleotide was replaced with the above synthesized phosphoramidite monomer. The synthesis process is briefly described below. Starting with the Universal CPG vector, nucleoside phosphoramidite monomers were linked one by one by the synthesis program in the Dr. Oligo48 synthesizer (Biolytic). Except for the 7-position nucleoside phosphoramidite monomer of the 5' AS strand described above, other nucleoside monomer raw materials such as 2'-F RNA and 2'-O-methyl RNA were purchased from Shanghai Jiaowei or Suzhou Jima. 5-Ethylthio-1H-tetrazole (ETT) was employed as the activator (0.6 M in acetonitrile), a 0.22 M solution of PADS in a 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Cortex) was used as the vulcanization reagent, and an iodopyridine / water solution (Cortex) was used as the oxidizing agent.

[0443] After the solid-phase synthesis was completed, the oligoribonucleotides were dissolved from the solid support and soaked in a 3:1 solution of 28% aqueous ammonia and ethanol at 50°C for 16h. After centrifugation, the supernatant was transferred to another centrifuge tube, concentrated and evaporated to dryness, and purified by C18 reversed-phase chromatography using a mobile phase of 0.1M TEAA and acetonitrile, and 3% trifluoroacetic acid solution to remove DMTr. The target oligonucleotides were collected, lyophilized, and identified as the target products by LC-MS and quantified by UV (260nm).

[0444] The resulting single-stranded oligonucleotides were complementarily paired and annealed in an equimolar ratio, and the resulting double-stranded dsRNA was dissolved in 1×PBS and adjusted to the concentration required for the experiment before use.

[0445] Example 3. psiCHECK Activity Screening Experiments The synthesis of dsRNA samples was as described above, and plasmids were from Shanghai Biotechnology Co., Ltd. The psiCHECK experimental consumables are shown in Table 1.

[0446] [Table 1]

[0447] Experimental procedure: The cells were plated and transfected, of which the specific preparation amount of the transfection complex is as shown in Table 2.

[0448] [Table 2] Note: Lipo: 0.2 μL / well, Plasmid: 0.05 μL / well, Opti-MEM: 10 μL / well.

[0449] According to Table 3, it was diluted to different concentrations according to different experimental needs, and prepared immediately before use as working fluid. After 24 hours of transfection, it was detected according to the experimental operation plan of Dual-Glo® Luciferase Assay System detection reagent kit. The relative value Ratio=Ren / Fir (Renilla / Firefly ratio) was calculated, and the inhibition rate 1-(Ratio+dsRNA / reporter gene only)×100%=inhibition rate (%) was calculated, and in this disclosure, excess activity % (also referred to as mRNA excess expression amount % or mRNA excess expression ratio)=100%-inhibition rate (%).

[0450] [Table 3]

[0451] Example 4: Characterization of different chemical modifications [ka] Among them, the nucleotide synthesized using 2-hydroxymethyl-1,3-propanediol as the starting material is defined as hmpNA. (+)hmpNA(A) is obtained by solid-phase synthesis from the nucleoside phosphoramidite monomer 1-1b in Example 1.1, and has the absolute configuration (S)-hmpNA(A); (-)hmpNA(A) is obtained by solid-phase synthesis from the nucleoside phosphoramidite monomer 1-1a in Example 1.1, and has the absolute configuration (R)-hmpNA(A); Similarly, the base types of hmpNA were substituted and the following structures were obtained by solid phase synthesis and the absolute configurations were confirmed: (+)hmpNA(G) has the absolute configuration of (S)-hmpNA(G), (-)hmpNA(G) has the absolute configuration of (R)-hmpNA(G); (+)hmpNA(C) has the absolute configuration of (S)-hmpNA(C); (-)hmpNA(C) has the absolute configuration of (R)-hmpNA(C); (+)hmpNA(U) has the absolute configuration of (R)-hmpNA(U), (-)hmpNA(U) has the absolute configuration of (S)-hmpNA(U), The absolute configurations of (S)-hmpNA(G), (R)-hmpNA(G), (S)-hmpNA(C), (R)-hmpNA(C), (S)-hmpNA(U) and (R)-hmpNA(U) were confirmed by X-Ray diffraction from their intermediates or derivatives.

[0452] The structure of the intermediate or derivative is as follows:

[0453] [ka] TJ-NA067: The detection crystal is a colorless block (0.30 mm 3 ×0.10mm 3 ×0.04mm 3) in the monoclinic P21 space group. The cell parameters are a = 16.0496(5) Å, b = 4.86260(10) Å, c = 16.4686(5) Å, α = 90°, β = 118.015(4)°, γ = 90°, V = 1134.65(7) Å3, and Z = 4. Calculated density Dc = 1.389 g / cm 3 , the number of electrons in the unit cell F (000) = 504.0, the linear absorption coefficient of the unit cell μ(Cu Kα) = 0.840 mm-1, and the diffraction experiment temperature T = 150.00(11)K.

[0454] [ka] 6A(+): The detection crystal is a colorless block (0.30 mm 3 ×0.20mm 3 ×0.10mm 3 ) in the monoclinic P21 space group. The cell parameters are a = 22.6688(7) Å, b = 8.5595(2) Å, c = 23.3578(5) Å, α = 90°, β = 113.876(3)°, γ = 90°, V = 4144.3(2) Å3, and Z = 2. The calculated density is Dc = 0.999 g / cm. 3 , the number of electrons in the unit cell F (000) = 1318.0, linear absorption coefficient of the unit cell μ(Cu Kα) = 0.570 mm-1, and diffraction experiment temperature T = 100.01(18) K.

[0455] [ka] TJ-NA048: The detection crystal is colorless and needle-shaped (0.30 mm 3 ×0.04mm 3 ×0.04mm 3 ) in the monoclinic P1 space group. The cell parameters are a = 7.6165(4) Å, b = 11.3423(5) Å, c = 17.3991(8) Å, α = 85.007(4)°, β = 88.052(4)°, γ = 70.532(4)°, V = 1411.75(12) Å3, and Z = 2. Calculated density Dc = 1.366 g / cm 3, the number of electrons in the unit cell F(000) = 620.0, the linear absorption coefficient of the unit cell μ(Cu Kα) = 0.856 mm−1, and the diffraction experiment temperature T = 150.00(13) K.

[0456] [ka] TJ-NA092: The detection crystal is a colorless rectangular column (0.30 mm 3 ×0.10mm 3 ×0.10mm 3 ) in the monoclinic P1 space group. The cell parameters are a = 5.17960(10) Å, b = 8.0667(2) Å, c = 12.4077(2) Å, α = 93.146(2)°, β = 101.266(2)°, γ = 96.134(2)°, V = 503.993(18) Å3, and Z = 2. Calculated density Dc = 1.412 g / cm 3 , the number of electrons in the unit cell F(000) = 228.0, the linear absorption coefficient of the unit cell μ(Cu Kα) = 0.945 mm−1, and the diffraction experiment temperature T = 100.00(10) K.

[0457] Example 5: Sequence-dependent experiments of siRNAs containing different chemical modifications Abasic modification is known to be dsRNA sequence dependent, therefore, the present inventors tested the chemical modification of the present disclosure in several different sequences. Using siRNAs (sequences shown in Table 4) targeting three different genes (ANGPTL3, HBV-S, HBV-X) mRNA, the compounds (+)hmpNA(A) and (-)hmpNA(A) of Example 1 and GNA as a control were used. (A) The 7th position at the 5' end of the AS chain (sequence is as shown in Table 5) was modified with a compound, and the on-target activity and off-target activity were compared with those of the parent sequence.

[0458] [Table 4] In the above table, capital letters G, A, C, and U represent nucleotides containing guanine, adenine, cytosine, and uracil, respectively; lower case letter m represents a 2'-methoxy modification; lower case letter f represents a 2'-fluoro modification; lower case letter s indicates that the two adjacent nucleotides on the left and right of the letter s are linked by a thiophosphodiester group, and so on.

[0459] [Table 5]

[0460] The results of the on-target activity experiments are shown in Table 6. (A) shows significant sequence dependency, and the on-target activities of different sequences are obviously different. The experimental compounds according to the present disclosure do not show obvious sequence dependency, and have stronger general applicability.

[0461] The experimental results of off-target activity can be seen in Table 7, which shows that the experimental compounds of the present disclosure clearly reduce the off-target activity of siRNA compared to the parent sequence.

[0462] [Table 6] [Table 7]

[0463] Example 6: Preparation of Ligands (NAG0052, L96) Compounds NAG0024 and NAG0026 were purchased from Tianjin Yaoming Kangde New Drug Development Co., Ltd. Unless otherwise stated, all reagents used in the following examples are commercially available products.

[0464] Synthesis of compound NAG0052 The starting material, compound 1, was purchased from Jiangsu Power Pharmaceutical Technology Co., Ltd.

[0465] [ka]

[0466] compound 2 At 0°C and under nitrogen gas protection, NaH (12.2 g, 304 mmol, 60% purity) was added in portions to a solution of compound 1 (12.3 mL, 101 mmol) in THF (300 mL). The mixture was stirred at 20°C for 1 h, then cooled to 0°C again, and benzyl bromide (36.3 mL, 304 mmol) was added dropwise to the system, and stirred at 20°C for 12 h. The reaction solution was quenched with H2O (100 mL) and extracted with EtOAc (200 mL x 2). The combined organic phase was washed with saturated brine (100 mL), dried over Na2SO4, filtered, and concentrated to obtain a residue that was separated by silica gel column chromatography to obtain the target compound 2 (20.0 g, 51.8 mmol, 51% yield). LCMS: t R = 2.615 and 2.820 min in 30-90AB_7 min_220&254_Shimadzu.lcm (Xtimate C18, 3um, 2.1*30mm), MS (ESI) m / z = 351.2 [M+Na] + . 1 H NMR: (400 MHz, CDCl3) δ ppm 7.35-7.12 (m, 10H), 5.06-4.95 (m, 1H), 4.51-4.39 (m, 4H), 4.24-3.87 (m, 2H), 3.50-3.40 (m, 2H), 3.38-3.20 (m, 3H), 2.20-1.91 (m, 2H).

[0467] Compound 3 and Compound 4 At 20°C and nitrogen gas protection, TMSCN (13.5mL, 101mmol) was added in one portion to a solution of compound 2 (13.0g, 33.6mmol) in DCM (300mL), and then TMSOTf (9.14mL, 50.5mmol) in DCM (30mL) was added dropwise. The reaction solution was stirred at 20°C for 15h. After the reaction was completed, the system was quenched with saturated aqueous NaHCO3 (80mL) and extracted with DCM (150mL x 2). The combined organic phase was washed with saturated brine (80mL), dried over Na2SO4, filtered and concentrated, and separated by silica gel column chromatography to obtain the target compound 3 (3.30g, 9.18mmol, 27% yield) and pale yellow oily liquid compound 4 (8.50g, 9.18mmol, 70% yield).

[0468] compound 3 1 H NMR: (400 MHz, CDCl3) δ ppm 7.42-7.29 (m, 10H), 4.81 (t, J = 7.8 Hz, 1H), 4.65-4.49 (m, 4H), 4.30-4.21 (m, 2H), 3.65-3.57 (m, 1H), 3.57-3.49 (m, 1H), 2.49-2.40 (m, 2H).

[0469] compound 4 1H NMR: (400 MHz, CDCl3) δ ppm 7.42-7.26 (m, 10H), 4.93-4.87 (m, 1H), 4.65-4.48 (m, 4H), 4.43-4.38 (m, 1H), 4.21-4.17 (m, 1H), 3.79-3.70 (m, 1H), 3.54 (d, J = 4.0 Hz, 1H), 2.45-2.37 (m, 2H).

[0470] compound 5 At 0°C and nitrogen gas protection, a solution of compound 4 (3.00 g, 9.28 mmol) in THF (15 mL) was added dropwise to a solution of LiAlH4 (0.79 g, 20.9 mmol) in THF (15 mL), and after the completion of the addition, the system was reacted at 0°C for 1 h. The complete disappearance of the raw material was monitored by TLC (PE: EtOAc = 3: 1). Sodium sulfate decahydrate was gradually added to the reaction solution until no foaming occurred. The reaction solution was then filtered, and the filter cake was washed three times with dichloromethane (60 mL), after which the filtrate was collected and spun to dryness to obtain the target compound 5 (3.00 g, 90% yield). 1 H NMR: (400 MHz, DMSO-d6) δ ppm 7.40-7.14 (m, 10H), 4.54-4.38 (m, 4H), 4.06-3.99 (m, 2H), 3.91 (q, J = 6.4 Hz, 1H), 3.48-3.37 (m, 2H), 2.67-2.52 (m, 2H), 2.21-2.18 (m, 1H), 1.77-1.73 (m, 1H).

[0471] compound 6 Under nitrogen gas protection, compound 5 (3.00 g, 8.25 mmol) was dissolved in DCM (30 mL), TEA (3.44 mL, 24.7 mmol) and CbzCl (1.76 mL, 12.4 mmol) were added, and the mixture was reacted at 20 °C for 2 h. LCMS showed the reaction was complete. The reaction solution was extracted with dichloromethane (30 mL) and water (60 mL). The organic phase was washed three times with water (60 mL x 3), dried over anhydrous sodium sulfate, concentrated, and purified by normal phase column (PE: EtOAc = 1: 1) to give the target compound 6 (2.5 g, 90% yield). LCMS: t R = 0.810 min in 5-95AB_1min, MS (ESI) m / z =462.2 [M+H] + . 1H NMR: (400 MHz, CDCl3) δ ppm 7.39-7.29 (m, 15H), 5.35 (s, 1H), 5.15-5.01 (m, 2H), 4.72 (d, J = 6.0 Hz, 1H), 4.54-4.40 (m, 3H), 4.26 (s, 1H), 4.23-4.18 (m, 1H), 4.11-4.04 (m, 1H), 3.54-3.41 (m, 3H), 3.37-3.25 (m, 1H), 2.34-2.23 (m, 1H), 1.85-1.79 (m, 1H).

[0472] compound 7 Under nitrogen gas protection, compound 6 (2.00 g, 3.90 mmol) was dissolved in DCM (5 mL), and a solution of BCl3 in THF (1 M, 27.3 mL) was added at -78 °C and reacted for 1 h. The complete disappearance of the raw material was monitored by TLC (DCM:MeOH = 10:1). The reaction solution was quenched by adding methanol (20 mL) at -78 °C, concentrated, and purified by forward column (DCM:MeOH = 10:1) to obtain the target compound 7 (2.00 g, 60% yield). 1 H NMR: (400 MHz, CD3OD) δ ppm 7.41-7.23 (m, 5H), 5.08 (s, 2H), 4.25-4.07 (m, 2H), 3.85-3.75 (m, 1H), 3.63-3.56 (m, 1H), 3.54-3.48 (m, 1H), 3.30-3.27 (m, 2H), 2.34-2.21 (m, 1H), 1.71-1.64 (m, 1H).

[0473] compound 8 Under nitrogen gas protection, compound 7 (0.50 g, 1.78 mmol) was dissolved in pyridine (5 mL), and 4A molecular sieves (500 mg) and DMTrCl (0.66 mL, 2.13 mmol) were added at 0 ° C., and then the temperature was raised to 20 ° C. and reacted for 1.5 h. TLC (PE: EtOAc = 2: 1) was used to monitor the complete disappearance of the raw material. The reaction solution was added to ethyl acetate (60 mL) and water (60 mL) for extraction, and the organic phase was washed three times with water (60 mL × 3), dried over anhydrous sodium sulfate, concentrated, and purified by forward column (PE: EtOAc = 1: 1) to obtain the target compound 8 (800 mg, yield 90%). 1 H NMR: (400 MHz, CDCl3) δ ppm 7.44 (d, J = 7.6 Hz, 2H), 7.37-7.23 (m, 11H), 7.22-7.15 (m, 1H), 6.84 (d, J = 8.8 Hz, 4H), 5.09 (s, 2H), 4.31-4.17 (m, 2H), 4.02-3.91 (m, 1H), 3.84-3.73 (m, 6H), 3.33 (s, 1H), 3.28 (s, 1H), 3.19-3.01 (m, 2H), 2.34-2.25 (m, 1H), 1.70-1.62 (m, 1H).

[0474] compound 9 Compound 8 (800 mg, 1.234 mmol) was dissolved in EtOAc (5 mL), Pd / C 10% (800 mg, 7.517 mmol) was added, and the reaction was run under H2 conditions (15 Psi) at 20°C for 1 h. LCMS showed that the reaction was already complete. The reaction was filtered, and the filter cake was washed with dichloromethane (100 mL) and methanol (100 mL) three times, concentrated, and separated through a reverse phase column to give compound 9 (300 mg, 54%). LCMS: t R = 2.586 min in 10-80CD_3min MS (ESI) m / z = 450.2 [M+H] + .

[0475] compound 11 Compound 10 (435 mg, 1.780 mmol) was dissolved in DCM (10 mL), DIEA (0.441 mL, 2.67 mmol) and HATU (677 mg, 1.78 mmol) were added, and compound 9 (400 mg, 0.890 mmol) was further added and reacted at 20 ° C for 1 h. The reaction was monitored to be complete by TLC (DCM: MeOH = 10: 1). The reaction solution was extracted with dichloromethane (60 mL) and water (60 mL), and the organic phase was washed three times with water (60 mL × 3), dried over anhydrous sodium sulfate, concentrated, and purified by normal phase column (PE: EtOAc = 0: 1 was applied to the column, and the product peak appeared at 100%) to obtain the target compound 11 (600 mg, yield 90%). LCMS: t R = 2.745 min in 30-90CD_3min, MS (ESI) m / z =698.4 [M+Na] + . 1 H NMR: (400 MHz, CD3OD) δ ppm 7.46-7.38 (m, 2H), 7.35-7.24 (m, 6H), 7.22-7.16 (m, 1H), 6.90-6.78 (m, 4H), 4.29-4.21 (m, 2H), 4.02-3.95 (m, 1H), 3.77 (s, 6H), 3.66-3.62 (m, 3H), 3.41 (s, 1H), 3.18-3.04 (m, 2H), 2.36-2.17 (m, 5H), 1.71-1.50 (m, 5H), 1.39-1.25 (m, 14H).

[0476] compound 12 Compound 11 (600 mg, 0.799 mmol) was dissolved in THF (3 mL) and HO (1 mL), LiOH.HO (134 mg, 3.20 mmol) was added, and the mixture was allowed to react at 20 °C for 12 h. TLC (DCM:MeOH = 10:1) showed the reaction was complete. The reaction solution was spun dry, dissolved in water (5 mL) and methanol (5 mL), and purified by reverse phase column (HO:CHCN = 1:1, peak at about 35%) to give the target compound 12 (460 mg, 100% yield, lithium salt). LCMS: tR = 1.346 min in 10-80CD_3min, MS (ESI) m / z =684.3 [M+Na] + . HPLC: R = 1.879 min in 10-80CD_6min. 1 H NMR: (400 MHz, CD3OD) δ ppm 7.47-7.39 (m, 2H), 7.35-7.24 (m, 6H), 7.22-7.15 (m, 1H), 6.91-6.79 (m, 4H), 4.31-4.18 (m, 2H), 4.02-3.95 (m, 1H), 3.78 (s, 6H), 3.44-3.33 (m, 2H), 3.18-3.04 (m, 2H), 2.35-2.27 (m, 1H), 2.24-2.10 (m, 4H), 1.70-1.51 (m, 5H), 1.31-1.23 (m, 12H).

[0477] compound 13 At room temperature and under nitrogen gas protection, compound NAG0024 (271 mg, 0.151 mmol) was dissolved in anhydrous THF (2 mL) and anhydrous DMF (4 mL), 3A molecular sieves were added, and compound 12 (100 mg, 0.151 mmol), HOBt (25 mg, 0.181 mmol), DCC (38 mg, 0.181 mmol) and DIEA (39 mg, 0.302 mmol) were added in sequence. The reaction solution was reacted at 45 ° C for 16 h, and after LC-MS showed that the reaction was complete, it was quenched by adding water and filtered. The filtrate was concentrated and then purified through a C18 reverse phase column (H2O / MeCN) to obtain compound 13 (210 mg, 57% yield).

[0478] Compound NAG0052 Compound 13 (230 mg, 0.094 mmol) was dissolved in pyridine (5 mL) at room temperature, and molecular sieves were added. DMAP (12 mg, 0.283 mmol) and succinic anhydride (28 mg, 0.283 mmol) were added. The mixture was stirred at 50 °C for 16 h under nitrogen gas protection. The reaction was completed by LCMS, filtered and rotovapped. After purification by C18 reverse phase column, the target compound NAG0052 (123 mg, 0.048 mmol, 51% yield) was obtained by secondary purification using preparative HPLC. MS(ESI)m / z=2535.3[M-1] - . Theory:2536.2. 1 H NMR (400 MHz, acetonitrile-d3)δ 7.48-7.43(m, 2H), 7.37-7.12(m, 11H), 7.00-6.85(m, 10H), 6.66(s, 1H), 5.31(dd, J=3.4, 1.1 Hz, 3H), 5.20-5.13(m, 1H), 5.05(dd, J=11.3, 3.4 Hz, 3H), 4.56(d, J=8.5 Hz, 3H), 4.30(dd, J=7.7, 5.3 Hz, 1H), 4.18-3.93(m, 14H), 3.79(s, 10H), 3.65(q, J=4.7, 3.6 Hz, 13H), 3.56-3.07(m, 24H), 2.56(s, 6H), 2.37 (t, J=5.8 Hz, 10H), 2.17 (t, J=7.5 Hz, 9H), 2.02-1.96(m, 20H), 1.88(s, 8H), 1.82-1.73(m, 2H), 1.60(dt, J=15.0, 7.3Hz, 16H), 1.27(s, 13H)s. Compound NAG0052 was linked to the sequence by solid-phase synthesis and further subjected to aminolysis, after which some functional groups were removed from the structure of NAG0052 to give NAG0052'.

[0479] Synthesis of L96 [ka] It may be prepared according to the method described in patent application WO2014025805A1.

[0480] Example 7: Synthesis of dsRNA 1. Homemade vector-conjugated resin The compound NAG0052 (157 mg, 0.062 mmol) containing a carboxylic acid group was dissolved in anhydrous DMF (3 mL). After the substrate was completely dissolved, anhydrous acetonitrile (4 mL), DIEA (0.03 mL, 0.154 mmol, 2.5 eq) and HBTU (35 mg, 0.093 mmol, 1.5 eq) were added in sequence. After the reaction solution was mixed uniformly, macroporous aminomethyl resin (476 mg, blank loading 0.41 mmol / g, target loading 0.1 mmol / g) was further added. The reaction solution was placed in a shaker (temperature: 25° C., rotation speed: 200 rpm) and shaken overnight. The reaction solution was filtered, and the filter cake was washed with DCM and anhydrous acetonitrile in sequence, respectively, and the solid was collected and dried in vacuum overnight.

[0481] The solid from the previous step was dispersed in anhydrous acetonitrile (5 mL), and pyridine (0.18 mL), DMAP (3 mg), NMI (0.12 mL), and CapB1 (2.68 mL) were added in that order. The reaction solution was placed in a shaker (temperature: 25 °C, rotation speed: 200 rpm) and shaken for 2 h. The reaction solution was filtered, the filter cake was washed with anhydrous acetonitrile, and the solid was collected and dried in vacuum overnight to obtain the vector-attached resin. The loading was measured to be 0.1 mmol / g.

[0482] 2. NAG0052 already linked to resin was linked to nucleoside monomers one by one starting from the resin in the 3'-5' direction according to the nucleotide sequence order. Linking to one nucleoside monomer involves four steps of deprotection, coupling, capping, and oxidation or sulfurization. The procedure was common in the art. The prepared dsRNA had the sense and antisense strands shown in Tables 8 and 9-1.

[0483] [Table 8]

[0484] [Table 9] The structure of the above dsRNA is as follows: [Table 10]

[0485] Among them, TRD002218 was taken as the reference positive compound.

[0486] Example 8: Inhibition of the expression level of target gene mRNA in vivo by dsRNA This experiment investigated the inhibitory efficiency of the dsRNA of the present disclosure complexed with different structures on the expression level of target gene mRNA in vivo.

[0487] Male 6- to 8-week-old C57BL / 6 mice were randomly assigned to groups, with 6 mice in each group, 3 mice per time point, and mice in each group were administered TRD007205, the reference positive TRD002218, or PBS, respectively.

[0488] All animals were administered a single dose by subcutaneous injection, with the dosage calculated according to body weight, the dosage of dsRNA (as siRNA without ligand) was 1 mg / kg, and the administration volume was 5 mL / kg. After 7 and 28 days of administration, the mice were sacrificed, the livers were collected and preserved with RNA later (Sigma Aldrich), and then the liver tissue was homogenized with a tissue homogenizer, and total liver tissue RNA was extracted using a tissue RNA extraction reagent kit (Fanzhi Medical Technology, FG0412) according to the operation steps described in the instruction manual. The total RNA was reverse transcribed into cDNA, and the expression level of TTR mRNA in the liver tissue was detected by real-time fluorescent quantitative PCR. In the fluorescent quantitative PCR, the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as an internal reference gene, and the mRNA expression levels of TTR and GAPDH were detected by Taqman probe primers for TTR and GAPDH, respectively.

[0489] [Table 11] The sequences of the detector primers are shown in Table 11: [Table 12]

[0490] The expression level of TTR mRNA was calculated according to the following equation. TTR mRNA expression level = [(TTR mRNA expression level in test group / GAPDH mRNA expression level in test group) / (TTR mRNA expression level in control group / GAPDH mRNA expression level in control group)] × 100%.

[0491] The inhibitory efficiencies of dsRNA complexed with different structures on the expression level of target gene mRNA in vivo after 7 and 28 days of administration are shown in Figure 1 and Figure 2, respectively. As can be seen from the results in Figure 1, TRD007205 showed good effects on the inhibition of TTR mRNA expression after 7 days of administration. As can be seen from Figure 2, the inhibitory effect of TRD007205 on the expression level of target gene mRNA after 28 days of administration was superior to that of TRD002218.

[0492] Example 9: Synthesis of dsRNA 1. Homemade vector-conjugated resin The specific procedure was the same as in Example 7.

[0493] 2. Starting with the resin with NAG0052, nucleoside monomers were linked one by one from the 3'-5' direction according to the nucleotide sequence order. Linking with one nucleoside monomer involves four steps of reactions: deprotection, coupling, capping, and oxidation or sulfurization. Specifically, the synthesis method in Example 2 was referred to.

[0494] The prepared dsRNA had the sense and antisense strands shown in Tables 12 and 14.

[0495] [Table 13] Note: TRD007970, TRD007970-1, TJR100259, and TJR100260 target HBV-X; TRD007994, TRD007995, TRD007994-1, and TRD007995-1 target HBV-S.

[0496] [Table 14] [Table 15]

[0497] Of these, the structures of (-)hmpNA(A), (-)hmpNA(G), (-)hmpNA(C), and (-)hmpNA(U) were as described in Example 4.

[0498] The structure of NAG0052' is [ka] It is.

[0499] Example 10: On-target activity of dsRNA against HBV The positive control compounds are shown in Table 15.

[0500] [Table 16] Among them, AD81890 was prepared with reference to CN201980053789.8, and the L96 structure is [ka] It is.

[0501] In HEK293A cells, in vitro molecular level simulations and on-target activity screening were performed for the dsRNA sequences in Tables 14 and 15 using 11 concentration gradients.

[0502] An on-target sequence corresponding to dsRNA was constructed in the HBV gene and inserted into the psiCHECK-2 plasmid. The plasmid contained Renilla luciferase gene and firefly luciferase gene. As a dual reporter gene system, the target sequence of dsRNA was inserted into the 3'UTR region of Renilla luciferase gene, and the activity of dsRNA against the target sequence could be reflected by detecting the expression status of Renilla luciferase calibrated with firefly luciferase, and the Dual-Luciferase Reporter Assay System (Promega, E2940) was used for detection.

[0503] HEK293A cells were cultured in DMEM high glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. 24 h before transfection, HEK293A cells were seeded into a 96-well plate and 8 × 10 3 Cells were seeded at a density of 100 μL medium in each well.

[0504] The cells were co-transfected with dsRNA and the corresponding plasmids by Lipofectamine2000 (ThermoFisher, 11668019) according to the instruction manual, and 0.2 μL of Lipofectamine2000 was used for each well. The transfection amount of the plasmid was 20 ng for each well. For the on-target sequence plasmid, the dsRNA was set to a final concentration of 20 nM at the highest concentration point, and a total of 11 concentration points were set, including 20 nM, 6.6667 nM, 2.2222 nM, 0.7407 nM, 0.2469 nM, 0.0823 nM, 0.0274 nM, 0.0091 nM, 0.0030 nM, 0.0010 nM, and 0.0003 nM, with a 3-fold gradient dilution. 24 h after transfection, on-target levels were detected using the Dual-Luciferase Reporter Assay System (Promega, E2940).

[0505] The psiCHECK activity screening experimental procedure is specifically as follows: The on-target activity of dsRNA sequences was screened by performing psi-CHECK in HEK293A cell line. The experimental materials and equipment are detailed in Tables 16 and 17.

[0506] The Psi-CHECK plasmid was purchased from Shanghai Biotechnology Co., Ltd.

[0507] [Table 17] [Table 18] [Table 19]

[0508] psiCHECK Experimental Procedure: (1) Cell seeding 1. Experimental Preparation: 1.1 Preparation of HEK293A cells: They should be purchased from Nanjing Kebai and counted after the anchorage-dependent cell digestion is completed. If the cell activity rate is 95% or higher, it can be used.

[0509] 1.2 DMEM complete medium (DMEM + 10% FBS) was stored at 4°C and equilibrated to room temperature before the experiment.

[0510] 1.3 96-well cell plates.

[0511] 2. Cell Seeding 18 h before transfection, HEK293A cells were seeded into a 96-well plate, with 8 × 10 3 Cells were seeded at a density of 100 μL medium in each well, 2.1 Place the medium in a 37℃ water bath and incubate for 20 minutes to prepare for use. 2.2 Aspirate 100 μL of homogenous cell suspension, mix with 5 μL of cell counting dye, and statically stain for 1 min. Aspirate 15 μL of suspension and inject into cell counting plate to calculate the amount of live cells (green), and the cell viability is 98.7%. 2.3 Depending on the cell count result, add an appropriate volume of medium to obtain a cell volume of 8 × 10 3 100 μL was dispensed into a 96-well plate so as to give cells / well, and cultured in a 37° C., 5% CO 2 incubator.

[0512] (2) Cell transfection experiments 1. Experimental Preparation: 1.1 Preparation of dsRNA samples and plasmids: dsRNA samples were quantified to 20 μM, and psi-CHECK plasmids were measured for their concentration and stored at -20°C for use, requiring a brief centrifugation before use. 1.2 Store the transfection reagent Lipofectamine 2000 at 4℃. 1.3 PCR 96-well plate tubes and 8-strip PCR tubes, 1.4 Opti-MEM medium.

[0513] 2. Cell Transfection Experiments 2.1 Prior to transfection, pre-warm Opti-MEM medium and replace Opti-MEM medium in cell plates, resulting in 80 μL medium / well.

[0514] 2.2 Prepare transfection complex: Prepare two parallel wells for each concentration, and the specific preparation amount of transfection complex is shown in Table 18. Transfection complex components: [Table 20]

[0515] Dispense 22 μL of the prepared plasmid into the corresponding 8-tube tubes, and name them Tube A. 2.3 Fluid replacement: The H-DMEM complete medium containing 10% FBS in the wells was aspirated and replaced with 80 μL of Opti-MEM, and starvation treatment was performed for 1.5 hours.

[0516] 2.4 Diluted dsRNA: dsRNA was thawed from -20℃, mixed evenly, and diluted to different concentrations according to the needs of different experiments according to Table 19, ready to be used as working solution, prepared immediately before use.

[0517] [Table 21] 2.5 Add the diluted dsRNA to the corresponding 8 tube strips of Tube A at 2.2 μL / tube, prepared immediately before use. 2.6 Preparation of Lipofectamine2000 Mix: Lipofectamine2000 was diluted with Opti-MEM and allowed to stand for 5 minutes. The specific preparation amount of Lipo Mix is ​​shown in Table 19. 2.7 The prepared Lipo Mix was then dispensed into 8 tubes corresponding to Tube A, and mixed uniformly by pipetting at 22 μL per tube (without generating bubbles), and then incubated at room temperature for 20 minutes.

[0518] 2.8 Add 20 μL of the above Tube A mixture to each well of cells at 20 μL / well, and add the original 80 μL of Opti-MEM to make the final volume 100 μL. After culturing in the incubator for 4 h, add 100 μL of H-DMEM medium containing 20% ​​FBS to each well.

[0519] 2.9 The cells were cultured at 37℃ in a CO2 incubator for 24 hours.

[0520] (3) Dual-Glo® Luciferase Assay System Detection 1. Experimental Preparation: 1.1 Dual luciferase reporter gene assay kit (Promega, cat. E2940) Ingredients and preparation method: Dual-Glo® Luciferase Buffer and vial Dual-Glo® Luciferase Substrate (lyophilized) were premixed and then aliquoted into 15 mL centrifuge tubes at 7.5 mL per tube. Dual-Glo® Stop&Glo® Buffer was pre-aliquoted into 12 mL per tube. The premixed Dual-Glo® Luciferase was redissolved and equilibrated to room temperature before the test, and then 7.5 mL of DMEM was added to each tube and prepared immediately before use. Dual-Glo® Stop&Glo® Buffer was redissolved and equilibrated to room temperature, and then mixed with Dual-Glo® Stop&Glo® Substrate at 100:1 and prepared immediately before use.

[0521] 2. Signal collection 2.1 Aspiration: Aspirate the original medium from the 96-well culture plate. 2.2 Add substrate (Dual-Glo® Luciferase): Add 150 μL of LARII substrate to each well and shake on a shaker for 10 min. 2.3 Pipetting: Take 120 μL of substrate (Dual-Glo® Luciferase Mix) and transfer to 96-well plate, read Firefly chemiluminescence value; 2.4 Add substrate (Dual-Glo Stop&Glo): Add 60 μL of Dual-Glo Stop&Glo substrate to each well, shake on a shaker for 10 min, and read the Renilla chemiluminescence value. 2.5 Calculate the relative value Ratio=Ren / Fir (Renilla / Firefly ratio) 2.6 Calculate the inhibition rate 1-(Ratio+dsRNA / reporter gene only)×100%=inhibition rate (%). In the present disclosure, excess activity % (also referred to as mRNA excess expression % or mRNA excess expression ratio) = 100% - inhibition rate (%).

[0522] 2.7 Plotted using Graphpad prism5.

[0523] The results are shown in Table 20.

[0524] [Table 22] [Table 23]

[0525] The above results demonstrated that TRD007970, TRD007994, and TRD007995 had high levels of on-target inhibitory activity against HBV genes in the psiCHECK system, compared to the control compound AD81890.

[0526] The results of another batch are shown in Table 21.

[0527] [Table 24]

[0528] The above results demonstrated that TRD007970, TJR100259, and TJR100260 of the present disclosure have higher levels of on-target inhibitory activity against HBV genes in the psiCHECK system compared to the control AD81890.

[0529] Example 11: Evaluating the in vitro anti-HBV activity of dsRNA using HepG2.2.15 cells In HepG2.2.15 cells, in vitro anti-HBV activity was evaluated against dsRNA using eight concentration gradients.

[0530] On the first day, HepG2.2.15 cells were seeded into a 96-well plate, with 20,000 cells in each well. Along with seeding the cells, different concentrations of dsRNA were transferred to HepG2.2.15 cells by RNAiMax, and on the fourth day, the cell culture supernatant was collected and HBsAg was detected by ELISA (the remaining supernatant was frozen and stored for use). Finally, the cells were collected, intracellular RNA was extracted, and total HBV RNA (including 3.5kb+2.4kb+2.1kb+0.7kb RNA) and 3.5kb HBV RNA (including pgRNA+preCore RNA) were detected by RT-PCR, respectively, with GAPDH gene RNA as an internal standard. There were eight concentration points of compounds waiting to be measured, and two parallel wells were measured in parallel. The final concentration of DMSO in the culture medium was 0.5%.

[0531] The formula for calculating the percentage of inhibition is as follows:

[0532] %HBsAg suppression rate = (1 - HBsAg content in sample / HBsAg content in DMSO control group) x 100 % HBV RNA suppression rate = (1 - HBV RNA content in sample / HBV RNA content in DMSO control group) x 100 % Cell Viability = (Sample absorbance value - Media control absorbance value) / (DMSO control absorbance value - Media control absorbance value) x 100.

[0533] EC was calculated using Graphpad Prism software (four parameter logistic equations). 50 values ​​were calculated.

[0534] The results are shown in Table 22, with reference to the control AD81890, the overall antiviral activity detection index, tests TRD007970, TRD007994 and TRD007995 showed excellent antiviral activity in HepG2.2.15 cells.

[0535] [Table 25]

[0536] Example 12: Evaluation of different modifications at positions 9 and 10 of the AS chain 1. Synthesis of aminogalactose compound 1-t linked to a solid phase vector: [ka] .

[0537] The synthetic route is as follows:

[0538] 1) Synthesis route of compound 1-g [ka] 2) Synthetic route to compound 1-h [ka] 3) Synthesis route of compound 1-l [ka] 4) Synthesis of compound 1-q [ka] 5) Synthesis of aminogalactose compound 1-t linked to a solid-phase vector [ka] .

[0539] Step 1 The raw material 1-a (297 g, 763 mmol) and the raw material 1-b (160 g, 636 mmol) were dissolved in 960 mL of DCE, and Sc(OTf)3 (15.6 g, 31.8 mmol) was added under the condition of 15 ° C. Then, the reaction temperature was raised to 85 ° C. and the reaction was allowed to proceed with stirring for 2 h. After the reaction was completed, 1.5 L of saturated NaHCO3 was added to stop the reaction, the organic phase was separated, and further washed with 1.5 L of saturated saline solution. The organic phase was dried with anhydrous Na2SO4, and the filtered solution was distilled under reduced pressure and then purified by silica gel column chromatography (petroleum ether: ethyl acetate 5: 1 to 0: 1) to obtain the target product 1-c (328 g, 544 mmol, yield 85.5%, purity 96.4%). 1 HNMR:(400 MHz, CDCl3) δ 7.44-7.29 (m, 5H), 5.83 (d, J = 8.8 Hz, 1H), 5.40-5.23 (m, 2H), 5.18-5.06 (m, 2H), 4.86 (s, 1H), 4.66 (d, J = 8.4 Hz, 1H), 4.21-4.07 (m, 2H), 4.04-3.77 (m, 3H), 3.51-3.45 (m, 1H), 3.31-3.11 (m, 2H), 2.18 (d, J = 2.0 Hz, 1H), 2.14 (s, 3H), 2.06 (s, 3H), 2.03-1.99 (m, 3H), 1.95 (s, 3H), 1.64-1.46 (m, 4H), 1.43-1.29 (m, 4H). M.S., C. 28 H 40 N2O 11 , measured M + 581.3.

[0540] Step 2 The compound obtained in step 1 was carried out in two parallel portions: each reaction included adding compound 1-c (72.0 g, 124 mmol) to 432 mL of THF, adding Pd / C (20.0 g, 10% purity) under argon gas protection, and then adding TFA (14.1 g, 124 mmol, 9.18 mL), passing hydrogen gas through the reaction solution, keeping the gas pressure at 30 Psi, heating to 30 °C and reacting with stirring for 16 h. After the reaction was completed, the two parallel reactions were combined, filtered, and the filtrate was concentrated under reduced pressure. The residue was diluted with dichloromethane and repeatedly concentrated under reduced pressure, which was repeated three times. After drying under reduced pressure, the target compound 1-d (139 g) was obtained. 1 HNMR(400 MHz, DMSO-d6)δ 7.85 (d, J = 9.2 Hz, 1H), 7.74 (s, 3H), 5.21 (d, J = 3.6 Hz, 1H), 4.97 (dd, J = 2.8, 10.8 Hz, 1H), 4.48 (d, J = 8.8 Hz, 1H), 4.06-3.98 (m, 3H), 3.93-3.82 (m, 1H), 3.73-3.68 (m, 1H), 3.63-3.56 (m, 1H), 3.43-3.38 (m, 1H), 2.82-2.71 (m, 2H), 2.13-2.09 (m, 3H), 2.01-1.97 (m, 3H), 1.91-1.87 (m, 3H), 1.77 (s, 3H), 1.76-1.73 (m, 1H), 1.52-1.44 (m, 4H), 1.28 (s, 4H).

[0541] Step 3 Compound 1-d (139 g, 247 mmol) and compound 1-e (75.3 g, 223 mmol) were added to a DMF solution (834 mL), and DIPEA (41.6 g, 322 mmol, 56.1 mL), HOBt (36.8 g, 272 mmol) and EDCI (52.2 g, 272 mmol) were added at 0 ° C., and the mixture was stirred for 16 h at 15 ° C. After the reaction was completed, the reaction solution was diluted with dichloromethane (400 mL), and then washed with saturated ammonium chloride solution (1 L), saturated NaHCO3 (1.00 L), and saturated saline in sequence. The organic phase was separated and dried over anhydrous sodium sulfate, filtered, and the solvent was removed by distillation under reduced pressure. The residue was purified by silica gel column chromatography (petroleum ether: ethyl acetate = 5: 1 to 0: 1) to obtain the target compound 1-f (108 g, yield 56.8%). 1 HNMR(40 (400 MHz, DMSO-d6) δ 7.89-7.78 (m, 2H), 7.41-7.27 (m, 6H), 5.21 (d, J = 3.2 Hz, 1H), 5.08-4.92 (m, 3H), 4.48 (d, J = 8.4 Hz, 1H), 4.07-3.99 (m, 3H), 3.97-3.81 (m, 2H), 3.75-3.64 (m, 1H), 3.42-3.37 (m, 1H), 3.13-2.93 (m, 2H), 2.20 (t, J = 8.0 Hz, 2H), 2.10 (s, 3H), 1.99 (s, 3H), 1.89 (s, 3H), 1.87-1.79 (m, 1H), 1.76 (s, 3H), 1.74-1.64 (m, 1H), 1.48-1.41 (m, 2H), 1.38 (s, 12H), 1.29-1.20 (m, 4H), 1.19-1.14 (m, 1H). M.S., C. 37 H 55 N3O 14 , measured value M + 766.4.

[0542] Step 4 Compound 1-f obtained above was carried out in two parallel portions: each reaction included adding compound 6 (47.0 g, 61.3 mmol) to 280 mL of THF, adding Pd / C (15.0 g, 10% purity) under argon gas protection, and then adding TFA (7.00 g, 61.3 mmol, 4.54 mL), passing hydrogen gas through the reaction solution, keeping the gas pressure at 30 Psi, heating to 30° C. and reacting with stirring for 16 h. After the reaction was completed, the two parallel reactions were combined, filtered, and the filtrate was concentrated under reduced pressure. The residue was diluted with dichloromethane and repeatedly concentrated under reduced pressure, which was repeated three times. After drying under reduced pressure, the target compound 1-g (94.0 g, crude product) was obtained. 1 HNMR(400 MHz, DMSO-d6)δ 8.38 (s, 1H), 8.10 (s, 3H), 7.83 (d, J = 9.2 Hz, 1H), 5.21 (d, J = 3.2 Hz, 1H), 4.96 (dd, J = 3.6, 11.2 Hz, 1H), 4.47 (d, J = 8.4 Hz, 1H), 4.06-3.98 (m, 3H), 3.92-3.82 (m, 1H), 3.75-3.67 (m, 2H), 3.60 (s, 1H), 3.43-3.37 (m, 1H), 3.18-3.04 (m, 2H), 2.30-2.24 (m, 2H), 2.10 (s, 3H), 2.00 (s, 3H), 1.95-1.90 (m, 2H), 1.89 (s, 3H), 1.78-1.75 (m, 3H), 1.49-1.41 (m, 3H), 1.40 (s, 9H), 1.26 (s, 4H).

[0543] Step 5 Compound 1-f obtained above was divided into two parts in parallel: each reaction involved adding compound 1-f (46.0 g, 60 mmol) to HCl-EtOAc (2.00 M, 276 mL) and reacting under stirring at 15° C. for 16 h. After the reaction was completed, the two reaction solutions were combined and concentrated by distillation under reduced pressure, and the residue was diluted with dichloromethane and repeatedly concentrated under reduced pressure, which was repeated three times. After drying under reduced pressure, the target compound 1-h (91.0 g, crude product) was obtained. 1 HNMR(400 MHz, DMSO-d6)δ 7.91-7.80 (m, 2H), 7.42-7.26 (m, 6H), 5.21 (d, J = 3.2 Hz, 1H), 5.07-4.92 (m, 4H), 4.48 (d, J = 8.4 Hz, 1H), 4.06-3.98 (m, 3H), 3.98-3.82 (m, 3H), 3.73-3.65 (m, 1H), 3.44-3.35 (m, 1H), 3.12-2.94 (m, 2H), 2.22 (t, J = 8.0 Hz, 2H), 2.10 (s, 3H), 2.01-1.97 (m, 4H), 1.94-1.90 (m, 1H), 1.89 (s, 3H), 1.87-1.79 (m, 2H), 1.76 (s, 3H), 1.74-1.67 (m, 1H), 1.49-1.40 (m, 2H), 1.40-1.32 (m, 2H), 1.24 (d, J = 4.0 Hz, 4H), 1.19-1.13 (m, 1H). M.S., C. 33 H 47 N3O 14 , measured M + 710.3.

[0544] Step 6 Two parallel reactions were carried out: each reaction included compound 1-g (45.0 g, 60.3 mmol) and compound 1-h (38.5 g, 54.3 mmol) in 270 mL of DMF, followed by DIPEA (10.1 g, 78.4 mmol, 13.6 mL) at 0 °C, followed by HOBt (8.97 g, 66.3 mmol) and EDCI (12.7 g, 66.3 mmol). The reaction was stirred at 15 °C for 16 h. After completion of the reaction, the two reaction solutions were combined and diluted with 300 mL of DCM, washed successively with saturated ammonium chloride (800 mL), saturated NaHCO3 (800 mL) and saturated brine (800 mL), and the organic phase was dried over anhydrous Na2SO4. After filtration, the mixture was concentrated by evaporation under pressure, and the residue was purified by silica gel column chromatography (petroleum ether:ethyl acetate=5:1 to 0:1) to obtain the target compound 1-i (66.0 g, 47.4 mmol, yield 39.3%, purity 95.1%). 1 HNMR(400 MHz, DMSO-d6) δ 7.96-7.78 (m, 5H), 7.41-7.25 (m, 6H), 5.21 (d, J = 3.6 Hz, 2H), 5.05-4.92 (m, 4H), 4.48 (d, J = 8.8 Hz, 2H), 4.22-4.12 (m, 1H), 4.02 (s, 6H), 3.94-3.80 (m, 3H), 3.74-3.64 (m, 2H), 3.45-3.35 (m, 2H), 3.11-2.92 (m, 4H), 2.20-2.12 (m, 4H), 2.10 (s, 6H), 1.99 (s, 6H), 1.89 (s, 6H), 1.82-1.79 (m, 2H), 1.76 (s, 6H), 1.74-1.63 (m, 2H), 1.44 (d, J = 6.0 Hz, 4H), 1.37 (s, 12H), 1.24 (s, 9H). MS:C 62 H 94 NO 25 , measured value m / z 1323.8.

[0545] Step 7 The reaction was divided into 11 reactions: Compound 1-i (5.00 g, 3.78 mmol) and toluene (300 mL) were added to each reaction, and silica gel (45.0 g) was added. The reaction was stirred at 100 ° C for 40 h, and after the reaction was completed, the 11 reaction mixtures were combined. After the solvent was distilled off under reduced pressure, isopropanol and dichloromethane were added to the residue and stirred for 20 min. The insoluble matter was removed by filtration, and the filter cake was washed with isopropanol until the product was not eluted. The solvent was removed from the resulting solution and the target compound 1-j (43.2 g, 34.0 mmol, yield 82.0%) was obtained after suction drying. 1 HNMR: (400 MHz, DMSO-d6)δ 8.01 (d, J = 7.6 Hz, 1H), 7.93-7.79 (m, 2H), 7.39-7.27 (m, 3H), 5.21 (d, J = 3.2 Hz, 1H), 5.06-4.91 (m, 2H), 4.48 (d, J = 8.0 Hz, 1H), 4.07-3.97 (m, 3H), 3.94-3.82 (m, 2H), 3.73-3.65 (m, 1H), 3.45-3.36 (m, 2H), 3.10-2.94 (m, 2H), 2.15 (d, J = 7.6 Hz, 2H), 2.10 (s, 3H), 1.99 (s, 3H), 1.89 (s, 3H), 1.86-1.79 (m, 1H), 1.77 (s, 3H), 1.74-1.65 (m, 1H), 1.44 (s, 2H), 1.37 (d, J = 5.2 Hz, 2H), 1.24 (s, 4H). MS:C 58 H 86 NO 25 , actual m / z=1267.8.

[0546] Step 8 This step was carried out in two parallel reactions: each reaction included compound 1-d (11.8 g, 21.0 mmol) and compound 1-j (21.3 g, 16.8 mmol) in 70 mL of DMF, followed by DIPEA (3.54 g, 27.3 mmol, 4.77 mL), HOBt (3.13 g, 23.1 mmol), and EDCI (4.44 g, 23.1 mmol) at 0 °C. The reaction was stirred at 15 °C for 16 h. After the reaction was completed, the two reaction solutions were combined and diluted with 500 mL of DCM, washed successively with saturated ammonium chloride (1.5 L), saturated NaHCO3 (1.5 mL), and saturated brine (1.5 mL), and the organic phase was dried over anhydrous Na2SO4. After filtration, the mixture was concentrated by evaporation under pressure, and the residue was purified by silica gel column chromatography (dichloromethane:methanol=50:1 to 10:1) to obtain the target compound 1-k (54.0 g, 31.8 mmol, yield 75.6%). 1 HNMR(400 MHz, DMSO-d6) δ 7.91 (d, J = 7.6 Hz, 1H), 7.87-7.78 (m, 5H), 7.73 (t, J = 5.2 Hz, 1H), 7.42-7.24 (m, 6H), 5.21 (d, J = 3.6 Hz, 3H), 5.06-4.92 (m, 5H), 4.48 (d, J = 8.4 Hz, 3H), 4.19-4.09 (m, 2H), 4.07-3.97 (m, 10H), 3.94-3.80 (m, 4H), 3.76-3.64 (m, 3H), 3.42-3.37 (m, 4H), 3.08-2.94 (m, 6H), 2.20-2.12 (m, 2H), 2.10 (s, 9H), 2.08-2.01 (m, 2H), 1.99 (s, 9H), 1.89 (s, 9H), 1.87-1.79 (m, 2H), 1.77 (s, 9H), 1.74-1.63 (m, 2H), 1.44 (d, J = 5.6 Hz, 6H), 1.40-1.31 (m, 6H), 1.24 (s, 13H). MS:C 78 H 118 N8O 33, measured value m / z=1696.1.

[0547] Step 9 This step was carried out in three parallel reactions: Compound 1-k (17.0 g, 10.0 mmol) and THF (100 mL) were added to each reaction, Pd / C (5.0 g, 10% purity) was added under argon gas protection, and TFA (1.14 g, 10.0 mmol, 742 μL) was added. Hydrogen gas was passed through the reaction solution, and the gas pressure was kept at 15 Psi, and the reaction was heated to 30 °C and stirred for 4 h. After the reaction was completed, the three parallel reactions were combined, filtered, and the filtrate was concentrated under reduced pressure. The residue was diluted with dichloromethane and repeatedly concentrated under reduced pressure, and this was repeated three times. The residue was purified by preparative liquid chromatography (C18, mobile phase A: 0.1% TFA-water, mobile phase B: 10%-40% CAN, 20 min) to give the target compound 1-l (17.3 g, 10.2 mmol, yield 34.0%). 1 HNMR: (400 MHz, DMSO-d6) δ 8.45 (t, J = 5.2 Hz, 1H), 8.14 (d, J = 5.2 Hz, 3H), 7.97 (t, J = 5.2 Hz, 1H), 7.90-7.77 (m, 4H), 5.21 (d, J = 2.8 Hz, 3H), 4.96 (dd, J = 3.2, 11.6 Hz, 3H), 4.47 (d, J = 8.4 Hz, 3H), 4.20-4.10 (m, 1H), 4.02 (s, 8H), 3.87 (q, J = 9.6 Hz, 3H), 3.75-3.61 (m, 4H), 3.46-3.34 (m, 3H), 3.21-2.93 (m, 6H), 2.21 (s, 2H), 2.14-2.02 (m, 11H), 1.99 (s, 9H), 1.96-1.82 (m, 12H), 1.80-1.65 (m, 10H), 1.44 (d, J = 5.6 Hz, 8H), 1.36 (d, J = 6.4 Hz, 4H), 1.30-1.17 (m, 12H) MS:C 70 H 112 N8O31 , the measured value m / 2z=781.8.

[0548] Step 10 Compound 1-m (2 g, 12.64 mmol) was dissolved in pyridine (10 mL), and a solution of DMTrCl (4.71 g, 13.90 mmol) in pyridine (10 mL) was added dropwise at room temperature, and the mixture was reacted under stirring at room temperature for 5 hours. After the reaction was completed, the mixture was quenched with methanol and concentrated under reduced pressure to obtain the crude product, which was purified by silica gel (eluted with petroleum ether: ethyl acetate = 10:1). The product eluate was collected, and the solvent was evaporated to dryness under reduced pressure to obtain 4 g of compound 1-n. MS m / z:C 29 H 32 O5, [M+H] + Actual measurement: 461.3.

[0549] Step 11 Compound 1-n (2 g, 4.34 mmol), N,N-diisopropylethylamine (DIEA, 1.43 mL, 8.68 mmol) and HATU (2.47 g, 6.51 mmol) were dissolved in DMF (10 mL), and a solution of compound 1-o in DMF (5 mL) was added at room temperature. The reaction was carried out at room temperature for 8 hours with stirring. After the reaction was completed, water was added to quench the reaction, the aqueous phase was extracted with ethyl acetate, and the combined organic phase was washed first with water and then with saturated saline (20 mL), after which the solvent was evaporated to dryness under reduced pressure, and the mixture was analyzed by reverse phase preparative HPLC (Column: Boston Green ODS 150 mm x 30 mm x 5 μm, Conditions: 25% to 80% (A: water, 0.075% NH3 . H2O, B: CH3CN, flow rate: 55 mL / min), and then lyophilization gave 2.4 g of compound 1-p. MS m / z:C 33 H 39 NO7, [M+H] + Actual measurement: 562.4.

[0550] Step 12 Compound 1-p (2.4 g, 4.27 mmol) was dissolved in 15 mL of a mixed solution of methanol and water (2:1), LiOH (0.36 g, 8.54 mmol) was added at room temperature, and the mixture was stirred overnight. After the reaction was completed, the solvent was evaporated to dryness under reduced pressure, and the residue was analyzed by reverse phase preparative HPLC (Column: Boston Green ODS 150 mm x 30 mm x 5 μm, Conditions: 25% to 75% (A: water, 0.075% NH3 . H2O, B: CH3CN, flow rate: 55 mL / min), and then lyophilized to obtain 2 g of compound 1-q. MS m / z:C 32 H 37 NO7, [M+H] + Actual measurement: 548.6.

[0551] Step 13 Compound 1-q (0.37 g, 0.69 mmol), DIEA (0.19 mL, 1.15 mmol) and HATU (0.32 g, 0.86 mmol) were dissolved in 2 mL of DMF, and a solution of compound 1-l (0.9 g, 0.69 mmol) in DMF (2 mL) was added at room temperature and stirred overnight at room temperature. After the reaction was completed, the reaction solution was diluted with dichloromethane (10 mL) and washed with saturated NaHCO3 (20 mL) and saturated saline (20 mL) in sequence. The organic phase was dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. Reverse phase preparative HPLC (Column: Boston Green ODS 150 mm * 30 mm * 5 μm, Conditions: 25% ~ 65% (A: water 0.075% NH3 . H2O, B: CH3CN, flow rate: 45 mL / min) and lyophilization to obtain 0.5 g of compound 1-r. MS m / z:C 102 H 147 N9O 37 , [MH] + Actual measurement: 2088.5.

[0552] Step 14 Compound 1-r (300 mg, 0.14 mmol) and succinic anhydride (28.70 mg, 0.28 mmol) were dissolved in tetrahydrofuran, and DMAP (3.50 mg, 0.028 mmol) was added to the reaction solution and stirred at 40 ° C overnight. After the reaction was completed, methanol (18.8 mg) was added and the reaction was stirred for 10 min. The reaction solution was then diluted with dichloromethane (3 mL) and washed twice with saturated NaHCO3 (5 mL). The organic phase was concentrated under reduced pressure to dryness and purified by reverse phase preparative HPLC (Column: Boston Green ODS 150 mm * 30 mm * 5 μm, Conditions: 25% ~ 65% (A: water 0.075% NH3 . H2O, B: CH3CN, flow rate: 35 mL / min) and lyophilization to give 140 mg of compound 1-s. MS m / z:C 106 H 151 N9O 40 , [MH] + Actual measurement: 2189.4.

[0553] Step 15 Compound 1-r (140 mg, 64 μmmol) obtained in the previous step was added to acetonitrile (5 mL), followed by HBTU (48.7 mg, 128 μmol), a solid support with a surface modified with amino groups (CPG-NH2, 2.3 g), and DIEA (41.5 mg, 320 μmol, 55 μL), and the mixture was left at 30 °C and reacted with shaking for 16 h. After the reaction was completed, it was filtered and washed in turn with methanol (8 mL x 4) and dichloromethane (8 mL x 4). The solid was then added to pyridine:acetic anhydride (v:v = 4:1, 10.0 mL), and the mixture was left at 30 °C and reacted with shaking for 16 h. After the reaction was completed, it was filtered and washed in turn with methanol (8 mL x 4) and dichloromethane (8 mL x 4). 2.1 g of compound 1-t linked to the solid vector was obtained.

[0554] 2. Synthesis of dsRNA The dsRNAs in Table 23 were synthesized by phosphoramidite solid phase synthesis.

[0555] 3. Testing This experiment investigated the inhibitory efficiency of dsRNA modified with 2'-fluoro at different sites of the present disclosure on target gene mRNA expression in vivo. Male 6-8 week old C57BL / 6 mice were randomly divided into groups, with a total of 6 mice per group, 3 mice per time point, and mice in each group were administered test samples (2, TRD007047 and TRD006870), comparison sample (TRD002218) and PBS, respectively. All animals were administered a single dose by subcutaneous injection, with the dose calculated according to body weight, the dose of dsRNA (as siRNA without ligand) was 1 mg / kg, and the administration volume was 5 mL / kg. Seven days after administration, the mice were sacrificed, the livers were collected and preserved with RNA later (Sigma Aldrich), then the liver tissue was homogenized with a tissue homogenizer, and total liver tissue RNA was extracted using a tissue RNA extraction reagent kit (Fanzhi Medical Technology, FG0412) according to the operation steps described in the instruction manual. The total RNA was reverse transcribed into cDNA, and the expression level of TTR mRNA in the liver tissue was detected by real-time fluorescent quantitative PCR. In the fluorescent quantitative PCR, the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as an internal reference gene, and the mRNA expression levels of TTR and GAPDH were detected by Taqman probe primers for TTR and GAPDH, respectively. The compound information is shown in Table 23, and the grouping information of the experimental compounds in the mouse body is shown in Table 24, and the primers were the same as those in Table 11.

[0556] [Table 26] Here, the structure of NAG1 is [ka] It is.

[0557] [Table 27]

[0558] After 28 days of administration, the inhibition efficiency of the dsRNA modified with 2'-fluoro at different sites of the present disclosure on the expression level of target gene mRNA in vivo is shown in Table 25. With reference to the positive control TRD002218, the dsRNA modified with 2'-fluoro at different sites has a higher inhibition of TTR mRNA expression than the reference positive compound after 28 days of administration, and both of the two modification methods show high inhibition efficiency and no significant difference, suggesting that the two modification methods can mediate more efficient inhibition efficiency.

[0559] [Table 28] [Table 29]

[0560] The expression level of TTR mRNA was calculated according to the following equation.

[0561] TTR mRNA expression level = [(TTR mRNA expression level in test group / GAPDH mRNA expression level in test group) / (TTR mRNA expression level in control group / GAPDH mRNA expression level in control group)] × 100%.

[0562] Example 13: In vitro anti-HBV activity of dsRNA (ad libitum) was evaluated using PHH cells In vitro anti-HBV activity evaluation was performed for TRD007970, TJR100259 and AD81890, respectively.

[0563] On day 0, dsRNA was first diluted in PBS to seven concentrations (100, 25, 6.25, 1.563, 0.391, 0.098, 0.024 nM) and added to a 48-well plate. Cryopreserved PHHs were resuscitated, and then seeded into a 48-well plate. Test compounds were allowed to be freely uptaken by the cells while seeding.

[0564] On day 1, the medium without dsRNA was replaced and HBV-infected PHH were added.

[0565] On days 2, 4 and 6, fresh medium was replaced without dsRNA.

[0566] Supernatants were collected on day 8 and the collected cell supernatants were subjected to ELISA for HBsAg and HBeAg detection and qPCR for HBV DNA levels. The results of the experiment are shown in Table 26.

[0567] [Table 30] The results showed that TRD007970 and TJR100259 had better antiviral activity in PHH compared to the control AD81890.

[0568] Example 14: Evaluation of dsRNA stability by exonuclease stability experiments Exonuclease stability evaluation was performed for the original siRNA sequences TJR100381 and TJR100382 of TRD007970 and TJR100259 (see Table 27), and the corresponding reaction solutions were prepared according to the reaction system of the experiment to perform the experiment (see Table 28).

[0569] [Table 31] [Table 32] [Table 33]

[0570] The final concentration of 5' exonuclease (PDII, Worthington, cat#LS003602) was 500U / mL, and the final concentration of 3' exonuclease (SVPD, Worthington, cat#LS003926) was 0.5U / mL. After preparation, the mixture was dispensed into 8 different tubes (16μL per well) at 5 time points: 0h, 1.5h, 2h, 3h, and 4h, and incubated at 37℃. Immediately after the time points were reached, the reaction solution was removed, and loading buffer containing 9M urea (32μL per well) was added, and the mixture was stored in a refrigerator at -80℃ for use. Then, electrophoresis was performed using a 20% (7M urea) PAGE gel. After electrophoresis, the gel was immersed in gelred dye, shaker stained for 10min, and gel imaging (312nm UV) observation and photography were performed. The experimental results are shown in Figure 3 (gel electrophoresis results), Figure 4 (5' exonuclease quantification results) and Figure 5 (3' exonuclease quantification results), and the results showed that the stability of TJR100382 was significantly superior to that of TJR100381.

[0571] Example 15: Liver S9 metabolic stability analysis Cynomolgus monkey liver S9 (Cynomolgus monkey liver S9, male, supplied by Xenotech, lot number 1510192) was subjected to TRD007970, TJR100259 and AD81890, respectively, and metabolic stability analysis of dsRNA was performed as follows: Eight 96-well sample plates were prepared, designated as 1, T0, T60, T120, T240, T360, T1440, T2880 and blank.

[0572] 2. 190 μL / well S9 suspension (or blank buffer) was added to each plate, then incubated at 37° C. for about 10 minutes.

[0573] 3. In addition to the substrate pores, each plate (T0, T60, T120, T240, T360, T1440, T2880) was added 10 μL of sample or blank buffer to each well.

[0574] 4. In addition to TO, TRD007970, TJR100259 and AD81890 samples at each time point (60, 120, 240, 360, 1440, 2880 min) were all incubated in a 37°C water bath.

[0575] 5. At the end of each time point, 200 μL (100 mM NH4Ac pH 10.0, 1 mM EDTA and 750 ng / mL internal standard in water) was added and shaken on a vortex mixer for 60 seconds.

[0576] 6. 200 μL of PCI (phenol / chloroform / isopentanol (25:24:1)) reagent and 400 μL of dichloromethane were added to each well, and the wells were shaken in a vortex mixer for 10 minutes and then centrifuged (4° C., 3220 g, 20 minutes) to obtain the supernatant.

[0577] 7. The supernatant was transferred to a new plate and stored at 4°C before LC-MS analysis.

[0578] 8. The excess percentages of single stranded AS and SS strands were detected, respectively, thereby characterizing the excess amounts of TRD007970, TJR100259, and AD81890.

[0579] 9, calculated using the following formula: % Surplus = Peak area ratio of analyte to internal standard at each time point / Peak area ratio of analyte to internal standard at T0 × 100% C t =C0*e -ke*t T 1 / 2 =Ln2 / k e =0.693 / k e Cl int (S9)=0.693 / in vitro T 1 / 2 *1 / (S9 protein in mg / mL reaction system) Cl int (liver)=Cl int (S9) × (mg S9) / g liver × g liver / (kg body weight).

[0580] The experimental results are shown in Table 30. The results show that after 48h incubation of cynomolgus liver S9, 93.8% of TJR100259 antisense strand remained, 70.2% of AD81890 antisense strand remained, and 61.0% of TRD007970 antisense strand remained. The data shows that after 48h incubation of cynomolgus liver S9, the antisense strand in TJR100259 is more stable than the antisense strand in AD81890 and the antisense strand in TRD007970.

[0581] Cynomolgus liver S9 was incubated for 48 h, and 21.0% of the TJR100259 sense strand remained, 12.2% of the AD81890 sense strand remained, and 8.9% of the TRD007970 sense strand remained. The data showed that, after incubation of cynomolgus liver S9 for 48 h, the sense strand in TJR100259 was more stable than the sense strand in AD81890 and the sense strand in TRD007970.

[0582] The single-stranded excess rate can reflect the stability of dsRNA, and the higher the excess rate, the better the stability. Therefore, TJR100259 is more stable than AD81890 and TRD007970 under the cynomolgus liver S9 metabolic stability experiment conditions.

[0583] [Table 34] [Table 35]

[0584] Example 16: Tissue distribution experiments Using TRD007970, TJR100410 and TJR100259, tissue distribution experiments were carried out as follows: Seventy-two male C56BL / 6J mice (7-8w, Beijing Jingweitong Lihua Laboratory Animal Technology Co., Ltd.) were acclimated for about one week and divided into three groups of 24 mice each. The doses of TRD007970, TJR100259 and TJR100410 were all 10 mg / kg, and samples were collected 0.5 h, 1 h, 2 h, 4 h, 8 h, 24 h, 72 h and 168 h (n=3) after administration. After euthanasia, the heart was bled, the left kidney and the largest lobe of the left side of the liver were harvested, and the harvested organs were washed with saline. After pretreatment of the liver and kidney samples, the AS chain concentrations in the liver and kidney were analyzed using high-resolution mass spectrometry to characterize the concentrations of TRD007970, TJR100259 and TJR100410.

[0585] The results of the experiment are shown in Table 31. As a result, the liver to kidney exposure ratios of TRD007970, TJR100259 and TJR100410 antisense strands in the C56BL / 6J mouse tissue distribution experiment were 9.44, 29.38 and 3.49, respectively. A high liver to kidney exposure ratio indicates a high concentration in the target organ (liver) and a low concentration in the non-target organ (kidney). Therefore, at the same dose, TJR100259 shows a higher liver to kidney ratio than TRD007970, TRD007970 shows a higher liver to kidney ratio than TJR100410, TJR100259 shows a lower risk of renal toxicity than TRD007970, and TRD007970 shows a lower risk of renal toxicity than TJR100410.

[0586] [Table 36]

[0587] Example 17: Liver homogenate stability TJR100410 and TJR100259 were subjected to liver homogenate stability analysis as follows: 1. Cynomolgus monkey liver homogenate (provided by the Experimental Unit Pharmaceutical Co., Ltd.) was added at 190 μL / well using an Apricot, and the plate was incubated at 37° C. for approximately 30 minutes.

[0588] 2. For each plate, except for the substrate wells, add 10 μL of dsRNA or control buffer to each well (T0, T1, T2, T4, T6, T24, T48, Table 32) and start timing.

[0589] [Table 37]

[0590] 2.1. Sample preparation (1) 200 μL of dsRNA was added to the designated wells. (2) 1000 μL of Clarify OTX lysis buffer was added. (3) Shake at 800 rpm for 5 minutes.

[0591] 2.2 SPE (1) Conditions: Phenomenex Clarity OTX SPE plate (8e-s103-cga) washed with 600 μL of MeOH. (2) Equilibration: The SPE plate was washed with 600 μL of equilibration buffer (containing 50 mM NH4Ac at pH 5.5, 0.0025% Triton X-100, and 0.01 mg / mL cysteine). (3) Loading: The sample from 2.1 was washed onto the SPE plate. (4) Wash 1: After washing the solid-phase extraction plate with 600 μL of wash buffer 1 (25 mM NH4Ac pH 5.5), the above steps were repeated again. (5) Wash 2: After washing the solid phase extraction plate with 600 μL of wash buffer 2 (25 mM NH4Ac pH 5.5, 50% CAN), the above steps were repeated again. (6) Elution: The sample was eluted with 150 μL of elution buffer (100 mM NH4HCO3, 1 mM TCEP pH 9.5 containing 40% ACN and 10% THF) and this step was repeated. (7) The samples were dried using a N2 evaporator at 45°C (approximately 2 hours). (8) Combine the sample with 70 μL of mobile phase A. (9) Before LC-MS / MS analysis, the mixture was gently shaken at 800 rpm for 0.5 h. (10) Calculated using the following formula. C t =C0*e -ke*t C t =1 / 2C0T 1 / 2 =Ln2 / (-k e )=0.693 / (-k e ).

[0592] Among them, TJR100410 is a control dsRNA, the sense strand of which is GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmCm-NAG1 (SEQ ID NO: 53); The antisense strand is AmsGfsUmGfAmAf(-)hmpNA(G)CmGmAfAmGfUmGfCmAfCmAfCmsGmsGm (SEQ ID NO:54); The structure of NAG1 is [ka] It was.

[0593] The results of the experiment are shown in Table 33.

[0594] The results showed that after 48 h incubation of cynomolgus monkey liver homogenate, 94.6% of the antisense strand in TJR100259 remained, 42.7% of the antisense strand in TJR100410 remained, 18.3% of the sense strand in TJR100259 remained, and 4.3% of the sense strand in TJR100410 remained. The data showed that after 48 h incubation of cynomolgus monkey liver homogenate, the antisense strand in TJR100259 was more stable than the antisense strand in TJR100410, and the sense strand in TJR100259 was more stable than the sense strand in TJR100410.

[0595] The single-stranded excess rate can reflect the stability of dsRNA, and the higher the excess rate, the better the stability. Therefore, TJR100259 is more stable than TJR100410 under the cynomolgus monkey liver homogenate stability experiment conditions.

[0596] [Table 38]

Claims

1. dsRNA, siRNA and and one or more ligands conjugated thereto; the siRNA comprises a sense strand and an antisense strand; the antisense strand comprises a chemical modification represented by formula (I), a tautomer thereof, or a pharmaceutically acceptable salt thereof at at least one nucleotide position from the 2nd to 8th positions from the 5'-end thereof; The chemical modification shown in formula (I) is 【Chemistry 1】 and B is a base; The ligand is a ligand represented by the following structural formula or a pharmaceutically acceptable salt thereof: 【Chemistry 2】 The siRNA targets hepatitis B virus. dsRNA.

2. the sense strand comprises a sequence that differs by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1 to 4, which comprises at least 15 consecutive nucleotides; and / or the antisense strand comprises a sequence that differs from any one of SEQ ID NOs: 5 to 8 by no more than 3 nucleotides, and that comprises at least 19 consecutive nucleotides; Preferably, the sense strand comprises a nucleotide sequence set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 4, and / or the antisense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 5 to 8; More preferably, the sense strand and the antisense strand are the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 1, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 5; the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 1, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 8; the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:2, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:6; the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:3, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:7; the sense strand comprises the nucleotide sequence set forth in SEQ ID NO: 4, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 5; The dsRNA of claim 1.

3. The 3' end of the sense strand is conjugated to the ligand. The dsRNA of claim 1.

4. The ligand is linked to the siRNA terminus via a phosphate or thiophosphate group, preferably via a phosphodiester or thiophosphodiester group, more preferably via a phosphodiester group. The dsRNA of claim 1.

5. The antisense strand comprises a chemical modification represented by formula (I), a tautomer thereof or a pharmaceutically acceptable salt thereof at the 5, 6 or 7 position from the 5' end thereof, preferably at the 7 position. The dsRNA of claim 1.

6. At least one other nucleotide in the sense strand and / or antisense strand is a modified nucleotide at the remaining positions other than the positions containing the chemical modification shown in formula (I). The dsRNA of claim 1.

7. The sense strand comprises a nucleotide sequence shown in the formula: 5'-N ａ N ａ N ａ N ａ N ａ N ａ N ｂ N ｂ N ｂ N ａ N ａ N ａ N ａ N ａ N ａ N ａ N ａ N ａ N ａ -3', or, 5’-N ａ N ａ N ａ N ａ N ｂ N ａ N ｂ N ｂ N ｂ N ａ N ａ N ａ N ａ N ａ N ａ N ａ N ａ N ａ N ａ -3’、 Among them, N ａ is a nucleotide modified with a 2'-methoxy group, and N ｂ is a 2'-fluoro modified nucleotide, The dsRNA of claim 1.

8. The antisense strand is 5’-N ａ ’N ｂ ’N ａ ’N ｂ ’N ａ ’N ｂ ’W’N ａ ’N ａ ’N ｂ ’N ａ ’N ｂ ’N ａ ’N ｂ ’N ａ ’N ｂ ’N ａ ’N ｂ ’N ａ ’N ａ ’N ａ ’-3’、 wherein each X' is independently N ａ ' or N ｂ ' and Y' is N ａ ' or N ｂ ' and N ａ ' is a nucleotide modified with a 2'-methoxy group, and N ｂ ' is a 2'-fluoro modified nucleotide, W′ represents a nucleotide containing a chemical modification represented by formula (I), a tautomer thereof, or a pharmaceutically acceptable salt thereof, wherein the formula (I) is 【Transformation 3】 wherein B is the same as the base when the nucleotide at the 7th position from the 5' end of the antisense strand is unmodified; The dsRNA of claim 1.

9. At least one phosphate group of the sense strand and / or the antisense strand is a phosphate group having a modified group, preferably, the phosphate group having a modified group is a thiophosphodiester group. The dsRNA of claim 1.

10. The thiophosphodiester group is Between the first and second nucleotides at the 5' end of the sense strand, Between the second and third nucleotides at the 5' end of the sense strand, Between the first and second nucleotides at the 5' end of the antisense strand, between the second and third nucleotides at the 5' end of the antisense strand; Between the first and second nucleotides at the 3' end of the antisense strand, and between the second and third nucleotides at the 3' end of the antisense strand; and Preferably, The sense strand and / or the antisense strand comprises a plurality of thiophosphodiester groups, the thiophosphodiester groups being: Between the first and second nucleotides at the 5' end of the sense strand, Between the second and third nucleotides at the 5' end of the sense strand, Between the first and second nucleotides at the 5' end of the antisense strand, between the second and third nucleotides at the 5' end of the antisense strand; Between the first and second nucleotides at the 3' end of the antisense strand, and between the second and third nucleotides at the 3' end of the antisense strand; exists in The dsRNA of claim 9.

11. dsRNA, wherein: The dsRNA is a dsRNA comprising a sense strand shown in SEQ ID NO: 9 and an antisense strand shown in SEQ ID NO: 17; a dsRNA comprising a sense strand shown in SEQ ID NO: 9 and an antisense strand shown in SEQ ID NO: 20; a dsRNA comprising a sense strand shown in SEQ ID NO: 11 and an antisense strand shown in SEQ ID NO: 18; a dsRNA comprising a sense strand shown in SEQ ID NO: 13 and an antisense strand shown in SEQ ID NO: 19; a dsRNA comprising a sense strand shown in SEQ ID NO: 10 and an antisense strand shown in SEQ ID NO: 17; a dsRNA comprising a sense strand shown in SEQ ID NO: 12 and an antisense strand shown in SEQ ID NO: 18; a dsRNA comprising a sense strand shown in SEQ ID NO: 14 and an antisense strand shown in SEQ ID NO: 19; a dsRNA comprising a sense strand represented by SEQ ID NO: 15 and an antisense strand represented by SEQ ID NO: 17; dsRNA.

12. The dsRNA is selected from the following structures or pharmaceutically acceptable salts thereof: 【Chemistry 4】 Among them, Af = adenine 2'-F ribonucleoside, Cf = cytosine 2'-F ribonucleoside, Gf = guanine 2'-F ribonucleoside, Uf = uracil 2'-F ribonucleoside, Am = adenine 2'-OMe ribonucleoside, Cm = cytosine 2'-OMe ribonucleoside, Gm = guanine 2'-OMe ribonucleoside, Um = uracil 2'-OMe ribonucleoside, Im = hypoxanthine 2'-OMe ribonucleoside, 【Transformation 5】 represents a thiophosphodiester group, 【Transformation 6】 represents a phosphodiester group, NAG0052' is 【Transformation 7】 represents (-)hmpNA(G) 【Transformation 8】 (-)hmpNA(C) represents 【Chemistry 9】 represents (-)hmpNA(A) 【Chemistry 10】 Represents, The dsRNA of claim 1.

13. 1. An siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand and the antisense strand are the sense strand comprises SEQ ID NO: 1 and the antisense strand comprises SEQ ID NO: 8; the sense strand comprises SEQ ID NO: 4 and the antisense strand comprises SEQ ID NO: 5; siRNA.

14. The dsRNA or siRNA is selected from those of synthetic origin or prepared in vitro; dsRNA according to claim 1 or siRNA according to claim 13.

15. 1. A pharmaceutical composition comprising: dsRNA according to any one of claims 1 to 12 or siRNA according to claim 13, and optionally containing one or more pharmaceutically acceptable excipients; Pharmaceutical compositions.

16. further comprising another therapeutic agent, 16. The pharmaceutical composition of claim 15.

17. Use of the dsRNA according to any one of claims 1 to 12 in the preparation of a medicament, comprising: The medicament is used for preventing and / or treating hepatitis B virus infection or hepatitis B virus-related disease, Preferably, the hepatitis B virus-related disease is selected from chronic hepatitis, acute hepatitis B, chronic hepatitis B, hepatitis D virus infection, hepatitis D, liver fibrosis, progressive liver disease, and hepatocellular carcinoma; the subject with hepatitis B virus infection or the subject with hepatitis B virus-related disease is HBeAg positive or HBeAg negative; use.

18. 1. A method for inhibiting expression of an HBV target gene or its mRNA, comprising: Administering an effective amount or an effective dose of the dsRNA of any one of claims 1 to 12 to a subject; method.

19. The dsRNA is administered in combination with another therapeutic agent.

20. The method of claim 18.

20. 1. A method for delivering oligonucleotides to the liver, comprising: Administering an effective amount or an effective dose of the dsRNA of any one of claims 1 to 12 to a subject; method.

21. The siRNA of claim 13, cell.

22. The dsRNA according to any one of claims 1 to 12 or the siRNA according to claim 13, vector.

23. The method comprises the steps of: (a) administering to a patient a dsRNA containing one or more containers each containing a dsRNA according to any one of claims 1 to 12; Reagent kit or kit.

24. The method comprises synthesizing the dsRNA according to any one of claims 1 to 12. Methods for preparing dsRNA.

Images