Modified butyrophilins and butyrophilin complexes

Abstract

The present disclosure relates to modified butyrophilin 2A and 3A, and butyrophilin 2A-3A complexes, and their use to induce or enhance TCR activation.

Description

[Technical field]

[0001] The present disclosure relates to modified butyrophilins 2A and 3A, and butyrophilin 2A-3A complexes, and methods of use. [Background technology]

[0002] Most alpha-beta (αβ) T cells become activated after recognition of peptide fragments complexed with major histocompatibility complex molecules (pMHC), which are sensed in a one-receptor-one-ligand manner by somatically rearranged T cell receptors (αβTCRs). In contrast, gamma-delta (γδ) T cells are a distinct lineage of MHC-unrestricted T cells that express rearranged antigen (Ag) receptors derived from the TCRγ (TRG) and TCRδ (TRD) loci. These cells play important roles in the priming and effector phases of immunity against infectious diseases, as well as in tissue surveillance.

[0003] In humans, the majority of circulating γδ T cells express the semi-invariant Vγ9Vδ2+ (TRGV9-TRGV2) γδ TCR that confers reactivity to a distinct class of non-peptide Ags termed phosphoantigens (pAgs), metabolic intermediates in the biosynthesis of isoprenoids. There are two classes of pAgs: those derived from the non-mevalonate pathway, such as 4-hydroxy-3-methylbut-2-enyl pyrophosphate (HMBPP), found in bacteria and apicomplexan parasites, and those derived from the mevalonate pathway, such as isopentenyl pyrophosphate (IPP), found in vertebrates. Both exogenous and self-pAgs are stimulatory to different degrees for γδ T cells, promoting potent antimicrobial and antitumor immunity, respectively.

[0004] Butyrophilin (BTN) and butyrophilin-like (BTNL) molecules are a family of surface-expressed transmembrane proteins that are typically composed of extracellular immunoglobulin superfamily variable (IgV) and constant (IgC)-like domains, and intracellular B30.2 domains. In certain combination pairs, BTN and BTNL molecules support the activation of γδ T cell subsets. For example, BTNL3 and BTNL8 are expressed by the intestinal epithelium and cooperate to promote the activation of Vγ4+ γδ T cells. Similarly, in mice, Btnl1 and Btnl6 promote the activation of gut-resident Vγ7+74 γδ T cells, and Btnl family members Skint1 and Skint2 are important for the development and function of skin-resident Vγ5Vδ1+ dendritic epidermal T cells (DETCs).

[0005] In humans, BTN member 3A1 (BTN3A1) sequesters pAg via a positively charged pocket within its intracellular B30.2 domain, which is an essential step in the initiation of Vγ9Vδ2+ T cell activation. Together with BTN member 2A1 (BTN2A1), BTN2A1 and BTN3A1 mediate the response of γδ T cells to pAg. Thus, BTN molecules have emerged as key regulators of γδ T cell-mediated immunity, and do so as heteromeric pairs. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984) [Non-Patent Document 2] J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989) [Non-Patent Document 3] In T. A. Brown (ed.), Essential Molecular Biology: A Practical Approach, volumes 1 and 2, IRL Press (1991). [Non-Patent Document 4] In DM Glover and BD Hames (eds.), DNA Cloning: A Practical Approach, volumes 1-4, IRL Press (1995 and 1996) [Non-Patent Document 5] FM Ausubel et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all current updates) [Non-Patent Document 6] Ed Harlow and David Lane (eds.), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988) [Non-Patent Document 7] JE Coligan et al. (eds.), Current Protocols in Immunology, John Wiley & Sons (including all updates to date) [Non-Patent Document 8] Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402 [Non-Patent Document 9] Altschul et al. (1990) J. Mol. Biol. 215:403-410 [Non-Patent Document 10] Smith et al. (1981) J. Mol. Biol. 147:195-197 [Non-Patent Document 11] Kouzarides, T. and Ziff, E., "Leucine zippers of fos, jun and GCN4 dictate dimerization specificity and thereby control DNA binding", Nature 340, pp. 568~571 (1989). https: / / doi.org / 10.1038 / 340568a0

Non-patent document 12

Non-patent document 13

Non-patent document 14

Non-patent document 15

Non-patent document 16

Non-patent document 17

Non-patent document 18

Non-patent document 19

Non-patent document 20

Non-patent document 21

Non-patent document 22

Non-patent document 23

Non-patent document 24

Non-patent document 25

Non-patent document 26

Non-patent document 27

Non-patent document 28

Non-patent document 29

Non-patent document 30

Non-patent document 31

Non-patent document 32

Non-patent document 33

Non-patent document 34

Non-patent document 35

Non-patent document 36

Non-patent document 37

Non-patent document 38

Non-patent document 39

Non-patent document 50

Non-patent document 51

Non-patent document 52

Non-patent document 53

Non-patent document 54

Non-patent document 55

[0007] However, there remains a need to better understand the mechanisms governing pAg recognition in order to provide new immunotherapies and drugs capable of inducing γδ T cell responses, for example in cancer patients, or in patients with chronic infections, or in patients with autoimmune or inflammatory diseases. [Means for solving the problem]

[0008] The inventors surprisingly found that the BTN3 IgV domain interacts with BTN2 and that the BTN2-BTN3 complex and modified BTN3 bind to Vγ9Vδ2 + We have demonstrated that modified BTN2 can react with TCR to promote γδ T cell-mediated immunity. We also surprisingly found that the BTN2-BTN3 complex is capable of targeting Vγ9Vδ2 + They also demonstrated that it could enhance the ability to react with TCR.

[0009] Thus, the present disclosure provides a recombinant BTN2-BTN3 heteromeric complex, comprising: + TCR (e.g., Vγ9Vδ2 +In some embodiments, the BTN2-BTN3 heteromeric complex binds to V52 TCR. + Induce or enhance TCR activation. Any means of complexing BTN2 and BTN3 known in the art (e.g., means that form heterodimerization domains) can be used.

[0010] In some embodiments, the BTN2-BTN3 heteromeric complex of the invention comprises two polypeptide chains, a first polypeptide comprises the IgV-like domain of BTN2 or a Vy9+ TCR binding portion thereof, and a second polypeptide comprises the IgV-like domain of BTN3 or a V52+ TCR binding portion thereof and a linker. In some embodiments, the heteromeric protein comprises two separate polypeptide chains that self-associate. In other embodiments, the heteromeric protein comprises two separate polypeptide chains that are induced to associate.

[0011] In one embodiment, the BTN2-BTN3 heteromeric complex comprises (i) a first polypeptide comprising the IgV-like domain of BTN2 or a Vγ9+ TCR binding portion thereof; (ii) a second polypeptide comprising an IgV-like domain of BTN3 or a V52+ TCR-binding portion thereof and a second heterologous C-terminal dimerization peptide. wherein the first and second polypeptides are BTN2-BTN3 heteromeric complexes, + Binds to TCR.

[0012] In another embodiment, the BTN2-BTN3 heteromeric complex is (i) a first polypeptide comprising an IgV-like domain of BTN2 or a Vγ9+ TCR binding portion thereof and a first heterologous C-terminal dimerization peptide; (ii) a second polypeptide comprising an IgV-like domain of BTN3 or a V52+ TCR binding portion thereof and a second heterologous C-terminal dimerization peptide that specifically dimerizes with the first heterologous C-terminal dimerization peptide to form a heterodimerization domain. Including, The BTN2-BTN3 heteromeric complex binds to Vγ9Vδ2+ TCRs.

[0013] In some embodiments, the heterodimerization domain comprises a charge-polarized core domain. For example, the first and second heterologous C-terminal dimerization peptides comprise positively or negatively charged amino acid residues. In another example, the first and second heterologous C-terminal dimerization peptides comprise polar residues capable of H-bonding or non-polar residues capable of forming van der Waals contacts.

[0014] In one embodiment, the first heterologous C-terminal dimerization peptide comprises positively charged amino acids, optionally linked to the first polypeptide by a linker, and the second heterologous C-terminal dimerization peptide comprises negatively charged amino acids, optionally linked to the second polypeptide by a linker.

[0015] In another embodiment, the first heterologous C-terminal dimerization peptide comprises negatively charged amino acids, optionally linked to the first polypeptide by a linker, and the second heterologous C-terminal dimerization peptide comprises positively charged amino acids, optionally linked to the second polypeptide by a linker.

[0016] In some embodiments, the formation of a BTN2-BTN3 heteromeric complex is driven by electrostatic interactions between positively and negatively charged amino acid residues in the first and second dimerization peptides.

[0017] Furthermore, the formation of homodimeric proteins is inhibited by repulsion between positively or negatively charged amino acid residues in the first or second dimerization peptide.

[0018] In some embodiments, the dimerization peptide is about 2 to about 50 amino acids in length. For example, the dimerization peptide can be about 50, about 45, about 40, about 35, about 30, about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, or about 2 amino acids in length.

[0019] In some embodiments, the dimerization peptide may comprise one or more positively charged amino acids selected from His, Lys, and Arg, hi other embodiments, the dimerization peptide may comprise one or more negatively charged amino acids selected from Asp and Glu.

[0020] In some embodiments, the first and second dimerization peptides have a reduced affinity for themselves.

[0021] In one embodiment, the heterodimerization domain is a coiled-coil domain. For example, the dimerization peptide is an acidic and basic zipper, e.g., fos and jun dimerization peptides, such as c-jun and c-fos dimerization peptides.

[0022] In some embodiments, the first or second dimerization peptide comprises an amino acid sequence set forth in SEQ ID NO: 49, 50, 51, 52, or an amino acid sequence having at least 90%, or 93%, or 95%, or 97%, or 98%, or 99% identity thereto.

[0023] In some embodiments, the dimerization peptide is linked to the C-terminus of BTN2 and BTN3 via a linker, optionally including a spacer amino acid such as serine or glycine. The linker can be a short C-terminal linker (e.g., 3-5 residues long, e.g., SGG, SEQ ID NO: 49) or a long C-terminal linker (e.g., 5-15 residues long). The linker can include a cleavage site, for example, to allow cleavage of the heterodimerization domain from the BTN2-BTN3 heteromeric complex (e.g., SGGLTPRGVRLGG, SEQ ID NO: 50).

[0024] In one or further embodiments, the heterodimerization domain comprises a disulfide bond. For example, the dimerization peptide comprises one or more cysteine ​​(Cys) residues. In some embodiments, the dimerization peptide comprises one or more Cys residues to promote disulfide bonding between electrostatically charged amino acids as an additional method for stabilizing the BTN2-BTN3 heteromeric complex.

[0025] In one embodiment, the heterodimerization domain comprises an Fc domain of an antibody (e.g., of the IgG, IgA, IgD, and IgE subclasses (e.g., IgG1, IgG2, IgG3, and IgG4, and IgA1 and IgA2)). In some embodiments, the dimerization peptide comprises an Fc-derived binding pair. For example, the hinge-CH2-CH3 Fc binding pair is derived from, for example, a human IgG1 or IgG4 antibody.

[0026] In some embodiments, the Fc domain exhibits increased affinity and enhanced binding to the neonatal Fc receptor (FcRn). In some embodiments, the Fc domain comprises one or more mutations that increase affinity and enhance binding to FcRn. Without wishing to be bound by theory, it is believed that the increased affinity and enhanced binding to FcRn increases the in vivo half-life of the heteromeric complexes of the invention.

[0027] In some embodiments, the Fc domain comprises one or more amino acid substitutions at amino acid residues 250, 252, 254, 256, 308, 309, 311, 428, 433, or 434 (according to Kabat numbering), or an equivalent thereof.

[0028] In one embodiment, the amino acid substitution at amino acid residue 250 is a substitution with glutamine.

[0029] In one embodiment, the amino acid substitution at amino acid residue 252 is a substitution with tyrosine, phenylalanine, tryptophan, or threonine.

[0030] In one embodiment, the amino acid substitution at amino acid residue 254 is a substitution with threonine.

[0031] In one embodiment, the amino acid substitution at amino acid residue 256 is a substitution with serine, arginine, glutamine, glutamic acid, aspartic acid, or threonine.

[0032] In one embodiment, the amino acid substitution at amino acid residue 308 is a substitution with threonine.

[0033] In one embodiment, the amino acid substitution at amino acid residue 309 is a substitution with a proline.

[0034] In one embodiment, the amino acid substitution at amino acid residue 311 is a substitution with serine.

[0035] In one embodiment, the amino acid substitution at amino acid residue 385 is with arginine, aspartic acid, serine, threonine, histidine, lysine, alanine, or glycine.

[0036] In one embodiment, the amino acid substitution at amino acid residue 386 is a substitution with threonine, proline, aspartic acid, serine, lysine, arginine, isoleucine, or methionine.

[0037] In one embodiment, the amino acid substitution at amino acid residue 387 is a substitution with arginine, proline, histidine, serine, threonine, or alanine.

[0038] In one embodiment, the amino acid substitution at amino acid residue 389 is a substitution with a proline, serine, or asparagine.

[0039] In one embodiment, the amino acid substitution at amino acid residue 428 is a substitution with leucine.

[0040] In one embodiment, the amino acid substitution at amino acid residue 433 is a substitution with arginine, serine, isoleucine, proline, or glutamine.

[0041] In one embodiment, the amino acid substitution at amino acid residue 434 is a substitution with histidine, phenylalanine, or tyrosine.

[0042] In some embodiments, the Fc domain (eg, comprising an IgG constant region) comprises one or more mutations, eg, substitutions at amino acid residues 252, 254, 256, 433, 434, or 436 (according to Kabat numbering).

[0043] In one embodiment, the IgG constant region comprises a M252Y / S254T / T256E triple mutation or a YTE mutation.

[0044] In another embodiment, the IgG constant region comprises a H433K / N434F / Y436H triple mutation or a KFH mutation.

[0045] In a further embodiment, the IgG constant region comprises a combination of YTE and KFH mutations.

[0046] In another embodiment, the BTN2-BTN3 heteromeric complex is (i) a first polypeptide comprising the IgV-like domain of BTN2 or a Vγ9+ TCR binding portion thereof; (ii) a second polypeptide comprising the IgV-like domain of BTN3 or a V52+ TCR-binding portion thereof; and (iii) a linker that links the first and second polypeptides into a single-chain polypeptide. Including, The BTN2-BTN3 heteromeric complex is Vγ9Vδ2 + Binds to TCR.

[0047] In some embodiments, the first polypeptide is at the N-terminus and the second polypeptide is at the C-terminus of the polypeptide chain, in other embodiments, the first polypeptide is at the C-terminus and the second polypeptide is at the N-terminus of the polypeptide chain.

[0048] In some embodiments, the linker is a peptide or polypeptide linker, hi some embodiments, the linker is less than about 500 amino acids in length, less than about 450 amino acids in length, less than about 400 amino acids in length, less than about 350 amino acids in length, less than about 300 amino acids in length, less than about 250 amino acids in length, less than about 200 amino acids in length, less than about 150 amino acids in length, or less than about 100 amino acids in length. For example, a linker can be less than about 100 amino acids, less than about 95 amino acids, less than about 90 amino acids, less than about 85 amino acids, less than about 80 amino acids, less than about 75 amino acids, less than about 70 amino acids, less than about 65 amino acids, less than about 60 amino acids, less than about 55 amino acids, less than about 50 amino acids, less than about 45 amino acids, less than about 40 amino acids, less than about 35 amino acids, less than about 30 amino acids, less than about 25 amino acids, less than about 20 amino acids, less than about 19 amino acids, less than about 18 amino acids, less than about 17 amino acids, less than about 16 amino acids, less than about 15 amino acids, less than about 14 amino acids, less than about 13 amino acids, less than about 12 amino acids, less than about 11 amino acids, less than about 10 amino acids, less than about 9 amino acids, less than about 8 amino acids, less than about 7 amino acids, less than about 6 amino acids, less than about 5 amino acids, less than about 4 amino acids, less than about 3 amino acids, or less than about 2 amino acids in length.

[0049] In one embodiment, the linker comprises about 50-150 amino acids, for example, about 100-150 amino acids.

[0050] The linker can be flexible or rigid.

[0051] In various embodiments, the linker is substantially composed of glycine (Gly) and serine (Ser) residues (e.g., about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or about 97% Gly and Ser). Gly / Ser-rich linkers are typically flexible.

[0052] In one embodiment, the linker does not contain any proline (Pro) residues.

[0053] In other embodiments, the linker is substantially free of glycine and serine residues and can be rigid. In some embodiments, the linker is a hinge region of an antibody (e.g., of the IgG, IgA, IgD, and IgE, including subclasses (e.g., IgG1, IgG2, IgG3, and IgG4, and IgA1 and IgA2). Hinge regions found in antibodies of the IgG, IgA, IgD, and IgE classes typically act as flexible spacers.

[0054] In some embodiments, the linker comprises an Fc domain of an antibody (e.g., of IgG, IgA, IgD, and IgE, including subclasses (e.g., IgG1, IgG2, IgG3, and IgG4, as well as IgA1 and IgA2). In various embodiments, the linker comprises a hinge-CH2-CH3 Fc domain derived from a human IgG4 antibody. In some embodiments, the linker comprises a hinge-CH2-CH3 Fc domain derived from a human IgG1 antibody. In some embodiments, the Fc domain exhibits increased affinity and enhanced binding to the neonatal Fc receptor (FcRn). In some embodiments, the Fc domain comprises one or more mutations that increase affinity and enhance binding to FcRn. Without wishing to be bound by theory, it is believed that increased affinity and enhanced binding to FcRn extends the in vivo half-life of the heterodimeric protein.

[0055] In some embodiments, the Fc domain comprises one or more amino acid substitutions at amino acid residues 250, 252, 254, 256, 308, 309, 311, 428, 433, or 434 (according to Kabat numbering), or an equivalent thereof.

[0056] In one embodiment, the amino acid substitution at amino acid residue 250 is a substitution with glutamine.

[0057] In one embodiment, the amino acid substitution at amino acid residue 252 is a substitution with tyrosine, phenylalanine, tryptophan, or threonine.

[0058] In one embodiment, the amino acid substitution at amino acid residue 254 is a substitution with threonine.

[0059] In one embodiment, the amino acid substitution at amino acid residue 256 is a substitution with serine, arginine, glutamine, glutamic acid, aspartic acid, or threonine.

[0060] In one embodiment, the amino acid substitution at amino acid residue 308 is a substitution with threonine.

[0061] In one embodiment, the amino acid substitution at amino acid residue 309 is a substitution with a proline.

[0062] In one embodiment, the amino acid substitution at amino acid residue 311 is a substitution with serine.

[0063] In one embodiment, the amino acid substitution at amino acid residue 385 is with arginine, aspartic acid, serine, threonine, histidine, lysine, alanine, or glycine.

[0064] In one embodiment, the amino acid substitution at amino acid residue 386 is a substitution with threonine, proline, aspartic acid, serine, lysine, arginine, isoleucine, or methionine.

[0065] In one embodiment, the amino acid substitution at amino acid residue 387 is a substitution with arginine, proline, histidine, serine, threonine, or alanine.

[0066] In one embodiment, the amino acid substitution at amino acid residue 389 is a substitution with a proline, serine, or asparagine.

[0067] In one embodiment, the amino acid substitution at amino acid residue 428 is a substitution with leucine.

[0068] In one embodiment, the amino acid substitution at amino acid residue 433 is a substitution with arginine, serine, isoleucine, proline, or glutamine.

[0069] In one embodiment, the amino acid substitution at amino acid residue 434 is a substitution with histidine, phenylalanine, or tyrosine.

[0070] In some embodiments, the Fc domain (eg, comprising an IgG constant region) comprises one or more mutations, eg, substitutions at amino acid residues 252, 254, 256, 433, 434, or 436 (according to Kabat numbering).

[0071] In one embodiment, the IgG constant region comprises a M252Y / S254T / T256E triple mutation or a YTE mutation.

[0072] In another embodiment, the IgG constant region comprises a H433K / N434F / Y436H triple mutation or a KFH mutation.

[0073] In a further embodiment, the IgG constant region comprises a combination of YTE and KFH mutations.

[0074] Dimerization of BTN2 and BTN3 converts the BTN molecule from an inactive, “latent” state to a state in which the BTN2-BTN3 complex binds Vγ9Vδ2. +BTN2 and BTN3 can induce a conformational change that switches them to an active "altered open" state that allows them to react with the TCR and promote γδ T cell-mediated immunity. Dimerization of BTN2 and BTN3 can occur concomitantly with homodimerization of BTN2 and / or BTN3, such that the BTN2-BTN3 complex consists of an association between a BTN2 homodimer paired with a BTN3 homodimer, or an association between a BTN2 monomer and a BTN3 homodimer, or an association between a BTN2 dimer and a BTN3 monomer, or an association between a BTN2 monomer and a BTN3 monomer.

[0075] In some embodiments, BTN2 and BTN3 are not in a cis conformation. In other or further embodiments, BTN2 and BTN3 do not interact through the CFG faces of their IgV domains. In other or further embodiments, BTN2 and BTN3 do not form a W-type heteromer.

[0076] In some embodiments, the BTN2-BTN3 heteromeric complex binds Vy9V52 via two spatially distinct epitopes. + They bind to the TCR. For example, BTN2 engages the lateral surface of Vγ9 and BTN3 binds to the apical surface.

[0077] In some embodiments, BTN2 binds to the Vγ9 of the TCR via the CFG face of its IgV domain. + Binds to the chain.

[0078] In some embodiments, one or more of the CC' loop, the F strand, and the G strand of BTN2 are Vy9V52 + Binds to TCR, e.g. Vγ9 + In some embodiments, the CC' loop of BTN2 comprises one or more of the amino acids corresponding to Ser41, Gln42, Phe43, and Ser44 of the BTN2 polypeptide sequence set forth in SEQ ID NO: 1. In some embodiments, one or more of these residues are located in the Vy9V52 polypeptide. +In some embodiments, these residues bind to the TCR, e.g., bind to the Vγ9+ chain. + It is important for T cell activation.

[0079] In some or further embodiments, BTN2 binds to the side of the gamma chain and binds to the Vγ9-encoded IgV domain, e.g., the BTN2 binding site on Vγ9 is distal to both the CDRs and the HV4 loop.

[0080] In some or further embodiments, BTN2 comprises one or more of the amino acids corresponding to Phe43, Tyr98, and Tyr105, and optionally one or more of the amino acids corresponding to Ser41, Gln42, Ser44 of the BTN2 polypeptide sequence set forth in SEQ ID NO:1.

[0081] In some or further embodiments, BTN2 comprises one or more of the amino acids corresponding to Tyr105, Asp106, and Glu107 of the BTN2 polypeptide sequence set forth in SEQ ID NO:1, and optionally one or more of the amino acids corresponding to Ser41, Gln42, Phe43, Ser44.

[0082] In some embodiments, one or more of these residues is Vy9V52 + Binds to TCR, e.g. Vγ9 + In some embodiments, these residues are linked to the Vγ9 chain. + It is important for T cell activation.

[0083] In some or further embodiments, BTN2 comprises one or more of the amino acids corresponding to amino acids Phe43, Gln100, Tyr105 of the BTN2 polypeptide sequence set forth in SEQ ID NO: 1. For example, the aromatic side chain of Phe43 may lie planar relative to the guanidinium moiety of the Arg20γ side chain, promoting a cation-π interaction with a predicted electrostatic binding energy of -4.6 kcal / mol. Arg20γ can also form a water-mediated H-bond with Gln100 of BTN2A1, along with a backbone-mediated H-bond to the Tyr105 side chain hydroxyl group, providing a structural basis for the importance of Arg20γ in BTN2A1 binding and pAg reactivity.

[0084] In some or further embodiments, BTN2 comprises one or more of the amino acids corresponding to amino acids Phe43, Ser44, Gln42, Phe43, Tyr105, Asp106, Glu107, and Arg96 of the BTN2 polypeptide sequence shown in SEQ ID NO: 1. For example, Glu70γ and His85γ, connected by intrachain H-bonds, can bind to BTN2A1, with Glu70γ H-bonding to the Phe43 and Ser44 backbone and His85γ making van der Waals (VDW) contacts with Ser41, Gln42, and Phe43 on BTN2A1. Further contacts can be made by Lys13γ in the A chain of Vγ9, which H-bonds to Tyr105, and Lys17γ in the B chain of Vγ9, which forms a salt bridge with Asp106. The adjacent Thr18γ can H-bond to Glu107, and Ser16γ can H-bond to the side chain of Arg96.

[0085] In some or further embodiments, BTN2 comprises an intracellular domain. In some embodiments, the intracellular domain (e.g., in the C-terminal cytoplasmic tail) comprises one or both of the amino acids corresponding to amino acids Thr482 and Leu488 of the BTN2 polypeptide sequence set forth in SEQ ID NO:9. In some or further embodiments, the intracellular domain (e.g., in the B30.2 domain) comprises an amino acid corresponding to amino acid Arg449 of the BTN2 polypeptide sequence set forth in SEQ ID NO:9. In some embodiments, these residues correspond to Vγ9 + It is important for T cell activation.

[0086] In some embodiments, BTN3 is Vy9V52 + Binding to the TCR, e.g., Vδ2 via the CFG face of its IgV domain + Binds to the chain.

[0087] In some or further embodiments, BTN3 comprises one or more of the amino acids corresponding to Val39, Arg44, His85, Tyr98, Phe104 and Tyr105, and optionally one or more of the amino acids corresponding to Phe26, Lys37, Ser42 and Leu96 of the BTN3 polypeptide sequence set forth in SEQ ID NO: 2. In some embodiments, one or more of these residues are Vy9V52. + Binds to TCR, e.g., Vδ2 + In some embodiments, these residues bind to the V52 chain. + It is important for T cell activation.

[0088] In one embodiment, the BTN2-BTN3 heteromeric complex binds to a Vy9V52+ TCR independent of phosphoantigen.

[0089] In one embodiment, the BTN2-BTN3 heteromeric complex exhibits enhanced binding to Vy9V52 compared to BTN2 or BTN3 alone. + Binds to TCR.

[0090] In some embodiments, the BTN2-BTN3 heteromeric complex is Vy9V52 + Induce or enhance TCR activation.

[0091] In some embodiments, the BTN2-BTN3 heteromeric complex can include amino acid sequences encoding BTN2 and BTN3 with one or more amino acid modifications compared to any of the known protein sequences. In some embodiments, the one or more amino acid modifications can be independently selected from substitutions, insertions, deletions, and truncations. In some embodiments, the amino acid mutations are amino acid substitutions, which can include conservative and / or non-conservative substitutions. For example, amino acid substitutions can be made that desirably or advantageously alter the properties of the BTN chain or complex. In one embodiment, modifications can be made that prevent degradation of the BTN chain or BTN.

[0092] In some embodiments, the first polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO: 1. For example, the first polypeptide comprises the amino acid sequence set forth in SEQ ID NO:96.

[0093] In some or further embodiments, the second polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO: 2. For example, the second polypeptide comprises the amino acid sequence set forth in SEQ ID NO: 4.

[0094] In some embodiments, the first polypeptide comprises the amino acid sequence set forth in SEQ ID NO:96 and the second polypeptide comprises the amino acid sequence set forth in SEQ ID NO:4.

[0095] In other embodiments, the first polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:9.

[0096] In some or further embodiments, the second polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:15.

[0097] In other embodiments, the first polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:29.

[0098] In some or further embodiments, the second polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:30.

[0099] In other embodiments, the first polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:33.

[0100] In some or further embodiments, the second polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:34.

[0101] In other embodiments, the first polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:37.

[0102] In some or further embodiments, the second polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:38.

[0103] In other embodiments, the first polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:45.

[0104] In some or further embodiments, the second polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:46.

[0105] In one or further embodiments, the first or second polypeptide comprises one or more Cys residues. In one embodiment, the one or more Cys residues are not incorporated into the IgV-like domain of BTN2 and / or BTN3. For example, the Cys residue is added to the C-terminus of the IgV-like domain. In some embodiments, BTN and / or BTN3 comprises a C-terminal Ig-C-like domain and one or more Cys residues are added within or to the C-terminus of this domain.

[0106] In one embodiment, the BTN2-BTN3 heteromeric complex is soluble. In some embodiments, the first and second polypeptides lack functional transmembrane and cytoplasmic domains.

[0107] In some embodiments, one or both of the first and second polypeptides comprises one or a modified amino acid residue selected from the group consisting of a glycosylated amino acid, a PEGylated amino acid, a farnesylated amino acid, an acetylated amino acid, a biotinylated amino acid, and an amino acid conjugated to a lipid moiety.

[0108] In one embodiment, one or both of the first and second polypeptides further comprise one or more purification sequences optionally selected from the group consisting of an epitope tag, a FLAG tag, a polyhistidine sequence, and a GDT fusion.

[0109] In one embodiment, one or both of the first and second polypeptides are glycosylated and have a glycosylation pattern available from a cell line of Expi293 cells.

[0110] In one embodiment, the BTN2-BTN3 heteromeric complex binds to activin, such as activin A.

[0111] The present disclosure also provides multivalent BTN2-BTN3 complexes comprising two or more linked BTN2-BTN3 heteromeric complexes of the present disclosure. In some embodiments, the multimers do not form W-type multimers. In some embodiments, the multimers form M-type multimers.

[0112] The present disclosure also provides a modified BTN3 or a V52+ TCR-binding fragment thereof, wherein the modified BTN3 comprises an IgV-like domain, and the IgV-like domain comprises a modification at a position corresponding to glutamic acid (E) 106 of the amino acid sequence set forth in SEQ ID NO:2.

[0113] The modification may be an amino acid substitution, insertion, deletion, or truncation.

[0114] In one embodiment, the modification is: glutamic acid (E) to alanine (A), glutamic acid (E) to arginine (R), glutamic acid (E) to aspartic acid (D), glutamic acid (E) to asparagine (N), glutamic acid (E) to cysteine ​​(C), glutamic acid (E) to glutamine (Q), glutamic acid (E) to lysine (K), glutamic acid (E) to glycine (G), glutamic acid (E) to histidine (H), glutamic acid (E) to isoleucine (I), glutamic acid (E) to leucine (L), glutamic acid (E) to methionine (H), (M), glutamic acid (E) to ornithine, glutamic acid (E) to phenylalanine (F), glutamic acid (E) to serine (S), glutamic acid (E) to threonine (T), glutamic acid (E) to tryptophan (W), glutamic acid (E) to tyrosine (Y), or glutamic acid (E) to valine (V), glutamic acid (E) to proline (P), glutamic acid (E) to α-aminobutyric acid (Abu), glutamic acid (E) to norleucine (Nle), glutamic acid (E) to norvaline (Nva), or artificial amino acid substitutions.

[0115] In another embodiment, the modification is glutamic acid (E) to alanine (A), glutamic acid (E) to glycine (G), glutamic acid (E) to isoleucine (I), glutamic acid (E) to leucine (L), glutamic acid (E) to methionine (M), glutamic acid (E) to phenylalanine (F), glutamic acid (E) to proline (P), glutamic acid (E) to tryptophan (W), or glutamic acid (E) to valine (V), or an artificial amino acid substitution.

[0116] In one embodiment, the modification is a substitution of glutamic acid (E) at position 106 with alanine (A).

[0117] In one embodiment, the IgV-like domain comprises an amino acid sequence having at least 70% identity to SEQ ID NO:2.

[0118] In some embodiments, the modified BTN3 binds to V52+ TCRs in a phosphoantigen-independent manner.

[0119] In some embodiments, the modified BTN3 binds to the V52+ TCR with enhanced binding, for example, the modifications enhance binding to the TCR by at least about 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 2.1-fold, at least about 2.2-fold, at least about 2.3-fold, at least about 2.4-fold, at least about 2.5-fold, preferably at least about 2-fold, compared to binding of BTN3 that does not contain the modifications.

[0120] In some or further embodiments, the modified BTN3 is V52 + Induce or enhance TCR activation.

[0121] The present disclosure also provides a modified BTN2 or a Vγ9+ TCR-binding fragment thereof, wherein the modified BTN2 comprises an IgV-like domain, and the IgV-like domain comprises a modification at a position corresponding to serine (S) 44 of the amino acid sequence set forth in SEQ ID NO:1.

[0122] The modification may be an amino acid substitution, insertion, deletion, or truncation.

[0123] In one embodiment, the modification is serine (S) to alanine (A), serine (S) to arginine (R), serine (S) to aspartic acid (D), serine (S) to asparagine (N), serine (S) to cysteine ​​(C), serine (S) to glutamine (Q), serine (S) to lysine (K), serine (S) to glycine (G), serine (S) to histidine (H), serine (S) to isoleucine (I), serine (S) to leucine (L), serine (S) to methionine (M), to ornithine, serine (S) to phenylalanine (F), serine (S) to glutamic acid (E), serine (S) to threonine (T), serine (S) to tryptophan (W), serine (S) to tyrosine (Y), or serine (S) to valine (V), serine (S) to proline (P), serine (S) to α-aminobutyric acid (Abu), serine (S) to norleucine (Nle), serine (S) to norvaline (Nva), or artificial amino acid substitutions.

[0124] In one embodiment, the modification is a substitution of serine (S) at position 44 with arginine (R).

[0125] In one embodiment, the IgV-like domain comprises an amino acid sequence having at least 70% identity to SEQ ID NO:1.

[0126] In some embodiments, the modified BTN2 binds to a Vγ9+ TCR independent of phosphoantigen.

[0127] In some embodiments, the modified BTN2 binds to a Vy9+ TCR with enhanced binding, e.g., when complexed with BTN3 (e.g., a modified BTN3 of the present disclosure). For example, the modification enhances binding to the TCR by at least about 1.5-fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9-fold, at least about 2-fold, at least about 2.1-fold, at least about 2.2-fold, at least about 2.3-fold, at least about 2.4-fold, at least about 2.5-fold, at least about 3-fold, preferably at least about 2-fold, and more preferably at least about 3-fold, compared to binding of a BTN2 (or a BTN2-BTN3 complex) that does not include the BTN2 Ser44 modification.

[0128] In some or further embodiments, the modified BTN2 induces or enhances Vγ9+ TCR activation, for example, when complexed with BTN3 (e.g., a modified BTN3 of the present disclosure).

[0129] The present disclosure also provides one or more nucleic acids encoding a BTN2-BTN3 heteromeric complex of this disclosure, a multivalent BTN2-BTN3 complex of this disclosure, a modified BTN3 of this disclosure, or a modified BTN2.

[0130] In one embodiment, the one or more nucleic acids are i) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 5, 31, 35, 39, or 47, and / or ii) a nucleic acid sequence having at least 70% identity to SEQ ID NO: 6, 32, 36, 40, or 48 Includes.

[0131] The disclosure also provides one or more vectors comprising one or more nucleic acids encoding a BTN2-BTN3 heteromeric complex of this disclosure, or a multivalent BTN2-BTN3 complex of this disclosure, a modified BTN3 of this disclosure, or a modified BTN2 of this disclosure.

[0132] The present disclosure also provides a host cell comprising a BTN2-BTN3 heteromeric complex of this disclosure, a multivalent BTN2-BTN3 complex of this disclosure, a modified BTN3 of this disclosure, a modified BTN2 of this disclosure, one or more nucleic acids of this disclosure, or one or more vectors of this disclosure.

[0133] The present disclosure also provides (i) a BTN2-BTN3 heteromeric complex of the present disclosure; (ii) a multivalent BTN2-BTN3 complex of the present disclosure; (iii) the modified BTN3 of the present disclosure; (iv) the modified BTN2 of the present disclosure; (v) one or more nucleic acids of the disclosure; (vi) one or more vectors of the present disclosure, and (vii) a cell of the present disclosure, and (viii) optionally, one or more pharma- ceutically acceptable excipients; Also provided are compositions comprising one or more of:

[0134] The present disclosure also provides a method for modifying a cell, comprising: (i) providing a cell; and (ii) introducing one or more nucleic acids of the disclosure, or one or more vectors of the disclosure, into the cell; and (iii) optionally culturing the cells; Also provided is a method comprising:

[0135] The present disclosure also provides cells obtainable by the methods.

[0136] The present disclosure also provides δ2 +Provided are methods for activating γδ T cells expressing a TCR, comprising contacting the cells with a BTN2-BTN3 heteromeric complex of the disclosure, a multivalent BTN2-BTN3 complex of the disclosure, or an engineered BTN3 of the disclosure, and optionally administering the activated γδ T cells to a subject in need thereof. In some embodiments, the BTN3 or BTN2-BTN3 complex of the disclosure is immobilized (e.g., by electrostatic forces, e.g., on a tissue culture plate) and a sample containing γδ T cells (e.g., a peripheral blood sample such as a PBMC sample) is contacted with the plate-bound BTN3 or BTN2-BTN3 complex for a sufficient period of time, e.g., 48 hours, to activate the γδ T cells. The activated γδ T cells can then be isolated and, if desired, administered to a subject in need thereof.

[0137] The present disclosure also provides the use of a modified TCR or a binding fragment thereof, such as a soluble TCR, one or more nucleic acids of the present disclosure, one or more vectors of the present disclosure, a cell of the present disclosure, or a composition of the present disclosure, as a medicament.

[0138] The present disclosure also provides for the use of a BTN2-BTN3 heteromeric complex of this disclosure, a multivalent BTN2-BTN3 complex of this disclosure, a modified BTN3 of this disclosure, one or more nucleic acids of this disclosure, one or more vectors of this disclosure, a cell of this disclosure, or a composition of this disclosure as a medicament for use in the detection, diagnosis, prognosis, prevention and / or treatment of cancer or an infectious disease.

[0139] The present disclosure also provides a method of preventing, treating, slowing the progression of, preventing the recurrence of, or alleviating a symptom of cancer or an infectious disease, comprising administering to a subject in need thereof a BTN2-BTN3 heteromeric complex of this disclosure, a multivalent BTN2-BTN3 complex of this disclosure, a modified BTN3 of this disclosure, one or more nucleic acids of this disclosure, one or more vectors of this disclosure, a cell of this disclosure, or a composition of this disclosure.

[0140] The present disclosure also provides a method of detecting T cells in a subject, comprising: (i) providing a sample from a subject; and (ii) contacting the sample with a BTN2-BTN3 heteromeric complex of the disclosure, a multivalent BTN2-BTN3 complex of the disclosure, or an engineered BTN3 of the disclosure to form a complex with a TCR (e.g., a V52+ TCR); and (iii) detecting the complex Also provided is a method comprising:

[0141] The present disclosure also provides an in vitro method for detecting the presence of cancer or an infectious disease in a subject, comprising: (i) providing a sample from a subject; and (ii) contacting the sample with a BTN2-BTN3 heteromeric complex of the disclosure, a multivalent BTN2-BTN3 complex of the disclosure, or a modified BTN3 of the disclosure to form a complex; and (iii) detecting the complex, wherein detection of the complex indicates the presence of cancer or an infectious disease in the subject. Also provided is a method comprising:

[0142] In some embodiments, the sample is a peripheral blood sample. The sample can be further processed, for example, γδ T cells can be purified from the peripheral blood sample using any purification method known in the art, for example, positive or negative enrichment using magnetic beads, and / or cell sorting. The sample can be contacted with a BTN3 or BTN2-BTN3 complex of the present disclosure, preferably labeled with a detectable tag (e.g., phycoerythrin (PE) for flow cytometry), and the complex of BTN3 or BTN2-BTN3 with V52+ TCR can be detected, for example, by flow cytometry.

[0143] In other embodiments, the sample is a lymph node or tissue sample (e.g., a tumor tissue sample). In some embodiments, BTN3 or BTN2-BTN3 complexes of the present disclosure, preferably labeled with a detectable tag (e.g., an AlexaFluor dye for microscopic imaging such as AF647), can be used to detect and / or quantitate infiltration of V52+ cells (e.g., γδ T cells) into the tumor microenvironment.

[0144] The present disclosure also provides the use of one or more nucleic acids of the present disclosure, or one or more vectors of the present disclosure, to generate modified cells, such as antigen-presenting cells.

[0145] The present disclosure also provides for the use of a BTN2-BTN3 heteromeric complex of this disclosure, a multivalent BTN2-BTN3 complex of this disclosure, a modified BTN3 of this disclosure, one or more nucleic acids of this disclosure, one or more vectors of this disclosure, a cell of this disclosure, or a composition of this disclosure for use in the prevention and / or treatment of an autoimmune disease, transplant rejection, graft-versus-host disease, or graft-versus-tumor effect.

[0146] The present disclosure also provides a method of preventing, treating, delaying the progression of, preventing the recurrence of, or alleviating a symptom of an autoimmune disease, transplant rejection, graft-versus-host disease, or graft-versus-tumor effect, comprising administering to a subject in need thereof a BTN2-BTN3 heteromeric complex of this disclosure, a multivalent BTN2-BTN3 complex of this disclosure, a modified BTN3 of this disclosure, one or more nucleic acids of this disclosure, one or more vectors of this disclosure, a cell of this disclosure, or a composition of this disclosure. [Brief description of the drawings]

[0147] [Figure 1](A) Size-exclusion (S200 16 / 600) gel filtration chromatography of BTN2A1 (black) and BTN3A1 (grey) ectodomains produced in MGAT1-deficient Expi293F cells. Higher elution volumes indicate smaller protein size. (B) Overlay of the BTN2A1 V-dimer from the apo structure with the BTN3A1 V-dimer structure (PDB code 4F80). (C) Surface representation of BTN2A1 with the head-to-tail dimer interface depicted in light grey and the V-dimer interface depicted in dark grey. Glycans depicted as sticks. (D) Overlay of the BTN2A1 head-to-tail dimer from the apo BTN2A1 and γδTCR-BTN2A1 (unliganded copy of BTN2A1) crystal structures. (E) Overlay of the BTN2A1 V-dimer structures from the apo and γδTCR ligand-bound crystal structures. (F) Schematic of BTN2A1 depicting the CFG face of the IgV domain and the ABED face of the IgV domain. (G) Surface representation of BTN2A1 and G115 Vy9V52 TCR depicting the interface from the γδTCR-BTN2A1 complex. (H) Schematic overlay of apo and ligand-bound BTN2A1 depicting the conformational changes to residues involved in binding to Vy9V52+ TCR (shown as sticks). [Diagram 2]TN2A1 engages the flank of Vγ9. (A) Surface and schematic representation of the apo-BTN2A1 crystal structure. (B) BTN2A1 V-dimer (left) and cis (middle) or trans (right) interpretation of the head-to-tail homodimer. (C) Surface and schematic representation of the BTN2A1-Vγ9Vδ2+ TCR clone G115 crystal structure: G115 TCRδ, G115 TCRγ, liganded BTN2A1, and unliganded BTN2A1. (D) Comparison with a representative pHLA class I-αβ TCR (left, PDB code 1QSE (35)) and CD1d-α-GalCer clone 9C2 Vγ5Vδ1+ TCR (right, PDB code 4LHU (36)). Molecular contacts between Vγ9Vδ+ clone G115 TCR and the BTN2A1 ectodomain, showing (E) Arg20γ, (F) Glu70γ and His85γ, (G) Lys13γ and Lys17γ, (H) Ser16γ and Thr18γ side chains and / or main chains and their BTN2A1 contacts as sticks. H-bonds and salt bridges, grey is VDW and cation-π, black is 2mFo-DFc electron density map contoured at 1σ. [Figure 3A] BTN2A1 tetramer, BTN3A1 tetramer, control mouse CD1d tetramer, or SAv-PE staining of human HEK293T cells transfected with plasmids co-encoding GFP and either G115 Vγ9Vδ2+ or control 9C2 Vγ5Vδ1+ γδ TCR. Plots gated on GFP+ cells. Data from 1 out of 10 independent experiments. Inset - Median Fluorescence Intensity (MFI) of PE parameters. [Figure 3B] γδTCR tetramer or SAv control staining of HEK293T BTN2A.BTN3AKO cells transfected with plasmids co-encoding GFP and either BTN2A1, BTN3A1 or control BTNL3, pre-incubated with anti-BTN3A mAb 20.1 or isotype control (mouse IgG1,κ) antibody. Plots gated on GFP+ cells. Inset - MFI of PE parameters of mAb 20.1 treated cells within a representative GFP+ gate. Representative of one of two independent experiments. [Figure 3C-3D]MFI of gated chimeric γδ TCR tetramer staining of (C) GFP+ BTN2A1-transfected or (D) GFP+ BTN3A1-transfected NIH-3T3 cells. Inset plot shows gating of parental cells. Graphs are shown as mean ± SEM. N > 3, each point represents an independent experiment. [Fig. 3E-3F] MFI of G115 γδTCR tetramer staining of NIH-3T3 cells transfected with (E) GFP+ BTN2A1 or (F) GFP+ BTN3A1. Graphs show mean ± SEM. N > 3, each point represents an independent experiment. [Figure 3G] GFP+ BTN2A1-transfected or GFP+ BTN3A1-transfected NIH-3T3 cells were stained with streptavidin (SAv)-PE control, Vγ9Vδ2+ 'G115 WT', 'G115 Lys53δ-Ala', 'TCR 6 WT' or 'TCR 6 Lys53δ-Ala' TCR tetramers. One representative of two independent experiments. [Figure 3H] NIH-3T3 cells transfected with GFP+ BTN2A1 or transfected with GFP+ BTN3A1 were stained with isotype control (MOPC21)-AF647 or anti-BTN3A(20.1)-AF647 antibodies followed by control SAv-PE, Vγ9Vδ2 'G115 WT' or 'G115 Lys53δ-Ala' TCR tetramer-PE staining. Cells were examined for FRET by flow cytometry in the YG 670 / 30 channel. [Figure 4]BTN3A1 supports binding of Vy9V52+ γδ TCR to the apical surface. (A) Vy9V52+ TCR tetramer-PE (clones TCR3, TCR6, TCR7 and G115) or streptavidin (SAv.) control staining of murine NIH-3T3 cells transfected with BTN2A1, BTN3A1 or no DNA after pre-incubation with anti-BTN3A mAb clones 20.1 (grey) or 103.2 (dark grey) or isotype control (IgG1, κ, black). (B) Staining of NIH-3T3 cells transfected with BTN2A1, BTN3A1 or control BTNL3 with chimeric γδ TCR tetramers composed of TCR6, TCR7 or G115 pAg-reactive γ chain plus pAg-reactive Vδ2+ or 9C2 Vδ1+ δ chain ± anti-BTN3A mAb 20.1 (grey) or isotype control (IgG1,κ, black). Median fluorescence intensity (MFI) of PE for cells treated with mAb 20.1 (grey numbers) or BTN3A1+ cells treated with isotype control (IgG1,κ) (black numbers) is shown within the delineated GFP+ gate. (C) Wild-type or mutant G115 Vγ9Vδ2+ TCR tetramer staining of NIH-3T3 cells transfected as in (B) ± anti-BTN3A mAb clone 20.1 (grey) or isotype control (IgG1,κ, black), or control mouse CD1d-α-GalCer (mCD1d tet.) or streptavidin alone (SAv) staining. The triple γ mutant contains Arg20γ-Ala / Glu70γ-Ala / His85γ-Ala mutations. Schematic inset shows the location of the BTN2A1-epitope (dark grey star) and ligand-2 epitope (light grey star). Representative of one of three independent experiments. MFI of PE for cells treated with mAb 20.1 (red numbers) or BTN3A1+ cells treated with isotype control (IgG1, κ) (black numbers) shown within the delineated GFP+ gate. [Diagram 5](A) and (B) CD69-PE expression on G115 WT or mutant Vy9V52+, 9C2 Vy5V51+ γδTCR or parental (TCR-) J.RT3-T3.5 Jurkat cells after overnight co-culture with LM-MEL-75 APCs in the presence or absence of 40 μM zoledronate. Graphs are shown as mean ± SEM. N=2, each point represents an independent experiment. (C) Surface display of G115 Vy9V52+ TCR depicting interacting residues and gatekeeper or non-involved residues based on Jurkat activation assay. [Figure 6A] Representation of the BTN2A1 BTN3A1 zipper complex. [Figure 6B-6C] (B-C) (LHS) BTN2A1 BTN3A1 complex was expressed in Expi293F cells and purified by (B) affinity (NiNTA) and (C) size exclusion (S200) chromatography. (RHS) Box-purified proteins were run on SDS-PAGE to confirm identity. MM-molecular weight marker; 2A1-BTN2A1-acidic zipper (AZ)-His6; 3A1-BTN3A1-basic zipper (BZ)-biotin ligase tag. [Figure 6D] Reactivity by ELISA of anti-BTN2A1 (clone 259), anti-BTN3A (clone 103.2), mouse IgG2a isotype control (clone BM4-2a), or mouse IgG1 isotype control (clone MOPC-21) to immobilized BTN1A1, BTN2A1, BTN3A1, or BTN2A1-BTN3A1-zipper ectodomain. [Figure 6E] The BTN2A1-BTN3A1-zipper complex was crystallized, redissolved, and run on SDS-PAGE with crystal wash buffer and input BTN2A1-BTN3A1-zipper complex. MM-molecular weight marker; 2A1-BTN2A1-AZ-His6; 3A1-BTN3A1-BZ-biotin ligase tag. [Figure 6F]BTN2A1-, BTN3A1-, BTN2A1-BTN3A1 complexes or control mouse CD1d ectodomain tetramers, or control streptavidin-PE (SAv) staining of HEK293T cells co-transfected with G115 Vy9V52+ TCR wild-type, His85γ-Ala, Glu52δ-Ala, Lys53δ-Ala or control 9C2 Vy5V51+ TCR on CD3. N≧5 independent experiments. *P<0.05, **P<0.01; binding of BTN2A1-BTN3A1 complexes to Vy9V52+ TCR was determined by Kruskal-Wallis test with the two-step step-up multiple correction method of Benjamini, Krieger and Yekutieli. [Figure 7] BTN3A1 is a ligand for the γδ TCR. (A) Anti-CD3 staining of HEK293T cells co-transfected with BTN2A1-, BTN3A1-, BTN2A1-BTN3A1 complex or control mouse CD1d ectodomain tetramer, or streptavidin alone (SAv) versus G115 Vγ9Vδ2+ TCR wild type, His85γ-Ala, Glu52δ-Ala, Lys53δ-Ala or control 9C2 Vγ5Vδ1+ TCR on CD3. Schematic inset shows the relative position of the BTN2A1 epitope mutants or ligand-2 epitope mutants. Representative of one of three independent experiments. Inset - median fluorescence for PE parameters. (B) Sensorgrams (left) and saturation plots (right) showing binding of soluble G115 Vγ9Vδ2+ TCR wild type (302-4.2 μM), His85γ-Ala (410-1.6 μM), Glu52δ-Ala (370-5.8 μM), and Lys53δ-Ala (295-4.6 μM) to immobilized BTN2A1 ectodomain homodimer, BTN2A1 ectodomain homodimer, and BTN2A1-BTN3A1 ectodomain complexes as measured by surface plasmon resonance. KDs, dissociation constants calculated at equilibrium ± SEM, derived from the mean of n=2 (WT and His85γ) or n=3 (Glu52δ and Lys53δ) independent experiments. [Figure 8]BTN2A1 and BTN3A1 directly associate to form heteromers. (A) Sensorgrams (left) and saturation plots (right) showing binding of soluble monomeric BTN2A1 ectodomain (top row, 890-28 μM), homodimeric BTN3A1 ectodomain (middle row, 1,520-24 μM), or monomeric BTN3A1 IgV domain (bottom row, 1,590-25 μM) to immobilized BTN2A1 ectodomain homodimers (red) or BTN3A1 ectodomain homodimers (blue) as measured by surface plasmon resonance. Inset graphs show Scatchard plots. KD, dissociation constants calculated at equilibrium ± SEM, derived from the mean of n=2 independent experiments and shown as dotted and broken lines on the saturation plots, respectively. (B) Crystal structure of the BTN2A1-BTN3A1 ectodomain complex, showing the asymmetric unit as a surface and the V dimer as a schematic. (C) Surface and schematic representation of the BTN2A1 V dimer-BTN3A1 V dimer repeat unit within the crystal structure. (D) Molecular contacts between BTN2A1 and the BTN3A1 ectodomain, showing as sticks the BTN2A1 Arg56 and Glu35, (E) Phe43 and Glu107, (F) Phe43 N atom and Ser44, (G) Glu35, Lys51 and Gln100 side chains, and / or the main chain and their BTN3A1 contacts. H-bonds and salt bridges, grey is cation-π, black. (H) Association between BTN2A1 and BTN3A1 ectodomains on the cell surface of mouse NIH-3T3 fibroblasts co-expressing wild-type BTN2A1 and individual BTN3A1 mutants as determined by the mean percentage of FRET+ cells ± SEM between anti-BTN2A1-AF647 (clone 259) and anti-BTN3A-PE (clone 103.2). Controls (right) show FRET between CD80 and PD-L1 or between BTN2A1 and PD-L1. n=6 except for controls where n=3, each point represents an individual experiment. NA, not applicable as BTN3A surface expression was too low to measure FRET. [Figure 9](A) Comparison of the apo BTN3A1 homodimer (PDB code 4F80) with the BTN3A1 homodimer from the BTN2A1-BTN3A1-zipper complex, and comparison of the apo BTN2A1 homodimer with the BTN2A1 homodimer from the BTN2A1-BTN3A1-zipper complex. (B) Surface representation of BTN2A1 and BTN3A1 showing the regions that contact each other. [Figure 10] Summary of the effect of single residue mutations within the (A) IgV or (B) IgC domains of BTN3A1 on anti-BTN3A reactivity (mAb clones 103.2 and 20.1) and cis-binding to BTN2A1 and G115 γδ TCR tetramer as measured by FRET. (C) Förster resonance energy transfer (FRET) between anti-BTN2A1 (clone 259) and anti-BTN3A (clone 103.2) mAb staining on gated BTN2A1+BTN3A1+NIH-3T3 cells 48 hours after co-transfection of WT BTN2A1 plus the indicated BTN3A1 mutants, or BTN2A1 plus PD-L2 or BTN3A1 plus CD80 as irrelevant controls. Mutants in dark grey were excluded from the analysis due to reduced BTN3A1 staining. Mutants in light grey are mutants with reduced FRET levels. (D) Surface representation of the BTN3A1 V dimer showing residue side chains whose mutations abrogated BTN3A1 association with BTN2A1 (gray) or did not affect its interaction with BTN2A1 (black) as determined by FRET assays (left). The BTN3A1 surface on the right shows atoms in contact with BTN2A1 based on the crystal structure (reproduced from fig. S5B). [Figure 11](A) G115 tetramer-PE staining of NIH-3T3 cells transfected with BTN3A1 WT or mutants after preincubation with anti-BTN3A-AF647 (mAb clone 20.1). Grey mutants were excluded from analysis due to reduced BTN3A1 mAb 20.1 staining. Light grey mutants are mutants with impaired G115 tetramer staining. Representative of 1 of 3 independent experiments. (B) CD25-PE expression in purified pre-expanded Vδ2+ γδ T cells after 24 h coculture with NIH-3T3 cells co-transfected with BTN2A1 plus the indicated BTN3A1 mutants or alternatively control BTNL3 plus BTNL8 ± zoledronate (5 μM). Data are from 1 of 3 independent experiments, each from 2 donors. (C) The surface of the BTN2A1 V dimer showing residues that contact BTN3A1 based on the BTN2A1-BTN3A1 crystal structure, residues that contact the Vγ9Vδ2+ TCR based on the G115 TCR-BTN2A1 crystal structure, and overlapping residues that contact both. [Figure 12]BTN3A1 IgV domains interact with Vγ9Vδ2+ TCR. (A) G115 Vγ9Vδ2+ TCR tetramer-PE staining of mouse NIH-3T3 fibroblasts transfected with either wild-type BTN3A1 or the indicated mutants after pretreatment with anti-BTN3A1-AF647 (clone 20.1) antibody. SAv, streptavidin-PE control staining of wild-type BTN3A1+ cells. Bar graphs show median fluorescence intensity (MFI) ± SEM. Dotted lines represent 90-98% and >98% reduction in MFI. Inset: Surface display of BTN3A1 V-dimers with mutations to residues that resulted in abrogation of anti-BTN3A antibody (20.1)-dependent G115 tetramer interaction colored dark gray (>98% reduction), light gray (90-98% reduction), or gray (<90% reduction). n=3, each point represents an independent experiment. NA, not applicable as surface expression of BTN3A was too low to measure G115 tetramer staining. (B) Changes in CD25 expression in purified in vitro expanded Vδ2+ γδ T cells co-cultured for 24 h with 5 μM zoledronate and mouse NIH-3T3 fibroblast APCs transfected with wild-type BTN2A1 and individual BTN3A1 mutants (normalized to unstimulated control for each sample). Bars show mean ± SEM. Dotted lines indicate >50% reduction in activation compared to BTN2A1-BTN3A1 WT. NA=not applicable as BTN3A1 concentration was too low to induce zoledronate-dependent γδ T cell activation. Data are from 2-3 independent experiments with n=1-2 different donors, respectively. **P<0.01, ***P<0.001, ****P<0.0001 by two-way ANOVA with Sidak's multiple comparison correction. Inset: Surface representation of the BTN3A1 V dimer with mutations to residues in grey that conferred abrogation of zoledronate-dependent Vδ2+ γδ T cell activation or in dark grey that had no effect on Vδ2+ γδ T cell activation. [Figure 13]BTN2A1 and BTN3A1 must be dislodged to bind Vγ9Vδ2+ TCR. (A) Anti-CD3 staining of HEK293T cells co-transfected with BTN2A1 tetramer, BTN2A1-BTN3A1 WT complex tetramer, BTN2A1-BTN3A1 Glu135-Ala complex tetramer, or control streptavidin alone (SAv) versus CD3 plus G115 Vγ9Vδ2+ TCR wild type, Glu52δ-Ala, or control 9C2 Vγ5Vδ1+ TCR. Inset - Median fluorescence intensity (MFI) of PE parameters. Representative of 1 of 6 independent experiments. (B) Sensorgrams (top) and saturation plots (bottom) showing binding of soluble G115 Vγ9Vδ2+ TCR wild-type (181-2.8 μM), Glu52δ-Ala (243-3.8 μM), and Lys53δ-Ala (139-2.2 μM) to immobilized BTN2A1-BTN3A1 wild-type complex (left), BTN2A1-BTN3A1 Glu135-Ala complex (middle), or BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys complex (right). KD, dissociation constant calculated at equilibrium ± SEM, derived from the mean of two independent experiments. (C) G115 Vy9V52+ TCR tetramer-PE or control streptavidin-PE (SAv) staining of mouse NIH-3T3 fibroblasts co-transfected with the indicated combinations of BTN2A1 and BTN3A1 wild type or cysteine ​​mutants. Representative of one of two independent experiments. (D) G115 Vy9V52+ TCR tetramer-PE or control streptavidin-PE (SAv) staining of mouse NIH-3T3 fibroblasts co-transfected with the indicated BTN2A1 and BTN3A1 cysteine ​​mutant pairs or control BTNL3 plus BTNL8 after pre-treatment of cells with graded concentrations of dithiothreitol (DTT). Inset - MFI of PE parameters. Representative of one of four independent experiments. [Figure 14](A) Structure of BTN2A1-BTN3A1 showing the positions of the two cysteine ​​mutant pairs. (B) G115 tetramer-PE staining of NIH-3T3 fibroblasts co-transfected with either WT or Cys mutant BTN2A1 plus BTN3A1 or control BTNL3 plus BTNL8 after preincubating cells with the indicated concentrations of DTT. Graphs are shown as mean ± SEM. Data pooled from 3-4 separate experiments. (C) Predicted structure of the BTN2A1-BTN3A1 complex containing a disulfide bond between the BTN2A1 and BTN3A1 molecules based on the crystal structure of the BTN2A1-BTN3A1 ectodomain complex. (D) 2D class average of the staining-negative soluble BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys ectodomain complex. (E) HEK293T cells transfected with either G115 Vy9V52+ or control 9C2 Vy5V51+γδ TCR were stained with BTN2A1 tetramers, BTN2A1-BTN3A1 complex tetramers, BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys complex tetramers, or control tetramers (mouse CD1d) or SAv.-PE alone. Where indicated, BTN molecules were pretreated with 5 mM DTT before tetramerization with SAv-PE. One representative of one or four independent experiments. (F) SDS-PAGE of BTN monomers treated with DTT as in (E). [Figure 15] Proposed model of Vγ9Vδ2+ TCR interacting with the latent BTN2A1-BTN3A1 complex on APCs following anti-BTN3A mAb 20.1 antibody treatment. Created with BioRender.com. [Figure 16](A) Surface BTN2A1 expression on HEK293T BTN2AKO.BTN3AKO cells transfected with BTN2A1 WT or the indicated BTN2A1 intracellular domain mutants, or control BTNL3 (clone 259). Representative from one of two experiments. (B) Representative plot and (C) Mean ± SEM of CD25-PE expression on purified pre-expanded Vδ2+ γδ T cells after 24 h co-culture with HEK293T BTN2AKO.BTN3AKO cells co-transfected with BTN3A1 plus the indicated BTN2A1 mutants, or alternatively with control BTNL3 alone or BTN3A1 alone ± zoledronate (5 μM). Replicates with low transfection efficiency (<10% GFP+) were excluded from analysis. Data are from three independent experiments with n=2 different donors each. **p<0.01 by two-way ANOVA with Sidak's multiple comparison correction. Inset, molecular model of the BTN2A1 B30.2 intracellular domain generated by AlphaFold v2, with functionally important residues in red. [Figure 17] Introduction of the Glu106-Ala mutation into BTN3A1 induces reactivity of the BTN2A1-BTN3A1 complex against V52+ T cells. Purified primary V52+ cells from healthy blood donors after nucleofection under the indicated conditions were stained with (A) BTN2A1-BTN3A1-zipper complex tetramer-PE, or (B) BTN2A1-BTN3A1 Glu106-Ala-zipper complex tetramer-PE, or (C) BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys-zipper complex tetramer-PE, versus anti-CD3-APC. RNP, ribonucleoprotein; guide1 and guide2, sgRNAs targeting the V52 CDR2δ region; template, single-stranded DNA repair template encoding the Lys53δ-Ala mutation. [Figure 18] Plate-bound BTN2A1+BTN3A1 ectodomain activates V52+ γδ T cells in vitro. CD25 expression on expanded pre-enriched V52+ γδ T cells after overnight culture on plates coated with the indicated proteins. [Figure 19] Engineered C-terminal linker and zipper domains promote BTN2A1 association with BTN3A1 and responsiveness to γδ TCR. NIH-3T3 cells were transfected with either Vγ9Vδ2+ TCR clone G115, or control 9C2 TCR, and stained with PE-conjugated tetramers of depicted BTN molecules, or control streptavidin (SAv) or mouse CD1d-α-GalCer (mCD1d). (A) BTN2A1-BTN3A1 ectodomain complex tetramers tethered by a C-terminal high affinity leucine (acidic / basic) zipper fused to the BTN ectodomain using a "long" (13mer) or "short" (3mer) glycine / serine-rich linker. (B) BTN2A1-BTN3A1 ectodomain complex tetramers tethered by a C-terminal high-affinity leucine (acidic / basic) zipper with a "long" glycine / serine-rich linker (as in A) or a C-terminal low-affinity leucine (acidic / basic) zipper with a "long" glycine / serine-rich linker. [Figure 20] Schematic diagram of the various BTN2A1-BTN3A1 constructs that were generated. [Figure 21] Introduction of the Ser44-Arg mutation in BTN2A1 induces the interaction of the BTN2A1-BTN3A1 complex with the Vγ9Vδ2+ TCR. (A) G115 Vγ9Vδ2 TCR tetramer (left), G115 His85γ-Ala Vγ9Vδ2 TCR tetramer (middle), streptavidin-phycoerythrin (PE) control (right) staining vs. GFP on mouse NIH-3T3 cells transfected with the indicated full-length BTN genes. The black gate depicts TCR tetramer staining dependent on BTN2A1-BTN3A1 co-expression. (B) G115 His85γ-Ala Vγ9Vδ2 TCR tetramer vs. GFP on NIH-3T3 cells co-transfected with full-length BTN2A1 and BTN3A1 genes ± zoledronate (100 μM). Numbers on each plot represent the mean fluorescence intensity of TCR tetramers on cells within the black gate. Data are from one of two representative experiments.

[0148] Description of sequence listing SEQ ID NO:1 is the amino acid sequence of the variable region of BTN2A1 isoform 1. SEQ ID NO:2 is the amino acid sequence of the variable region of BTN3A1 isoform 1. SEQ ID NO:3 is the amino acid sequence of the mutated (Glu106-Ala) variable region of BTN3A1 isoform 1. SEQ ID NO:4 is the amino acid sequence of BTN3A1 isoform 1 mutated (Glu106-Ala). SEQ ID NO:5 is the nucleic acid sequence of the variable region of BTN2A1 isoform 1. SEQ ID NO:6 is the nucleic acid sequence of the variable region of BTN3A1 isoform 1. SEQ ID NO:7 is the nucleic acid sequence of the mutated (Glu106-Ala) variable region of BTN3A1 isoform 1. SEQ ID NO:8 is the nucleic acid sequence of mutated (Glu106-Ala) BTN3A1 isoform 1. SEQ ID NO:9 is the amino acid sequence of human BTN2A1 isoform 1. SEQ ID NO:10 is the amino acid sequence of human BTN2A1 isoform 2. SEQ ID NO:11 is the amino acid sequence of human BTN2A1 isoform 3. SEQ ID NO:12 is the amino acid sequence of human BTN2A1 isoform 4. SEQ ID NO: 13 is the amino acid sequence of human BTN2A1 isoform 5. SEQ ID NO: 14 is the amino acid sequence of human BTN2A1 isoform 6. SEQ ID NO:15 is the amino acid sequence of human BTN3A1 isoform 1. SEQ ID NO: 16 is the amino acid sequence of human BTN3A1 isoform 2. SEQ ID NO:17 is the amino acid sequence of human BTN3A1 isoform 3. SEQ ID NO:18 is the amino acid sequence of human BTN3A1 isoform 4. SEQ ID NO:19 is the nucleic acid sequence of human BTN2A1 isoform 1. SEQ ID NO:20 is the nucleic acid sequence of human BTN2A1 isoform 2. SEQ ID NO:21 is the nucleic acid sequence of human BTN2A1 isoform 3. SEQ ID NO:22 is the nucleic acid sequence of human BTN2A1 isoform 4. SEQ ID NO:23 is the nucleic acid sequence of human BTN2A1 isoform 5. SEQ ID NO:24 is the nucleic acid sequence of human BTN2A1 isoform 6. SEQ ID NO:25 is the nucleic acid sequence of human BTN3A1 isoform 1. SEQ ID NO:26 is the nucleic acid sequence of human BTN3A1 isoform 2. SEQ ID NO:27 is the nucleic acid sequence of human BTN3A1 isoform 3. SEQ ID NO:28 is the nucleic acid sequence of human BTN3A1 isoform 4. SEQ ID NO:29 is the amino acid sequence of BTN2A1 in construct #1 (long linker version with high affinity zipper). SEQ ID NO:30 is the amino acid sequence of BTN3A1 in construct #1 (long linker version with high affinity zipper). SEQ ID NO:31 is the nucleic acid sequence of BTN2A1 in construct #1 (long linker version with high affinity zipper). SEQ ID NO:32 is the nucleic acid sequence of BTN3A1 in construct #1 (long linker version with high affinity zipper). SEQ ID NO:33 is the amino acid sequence of BTN2A1 in construct #2 (short linker version). SEQ ID NO:34 is the amino acid sequence of BTN3A1 in construct #2 (short linker version). SEQ ID NO:35 is the nucleic acid sequence of BTN2A1 in construct #2 (short linker version). SEQ ID NO:36 is the nucleic acid sequence of BTN3A1 in construct #2 (short linker version). SEQ ID NO:37 is the amino acid sequence of BTN2A1 in construct #3 (long linker version with affinity reducing zipper). SEQ ID NO:38 is the amino acid sequence of BTN3A1 in construct #3 (long linker version with affinity reducing zipper). SEQ ID NO:39 is the nucleic acid sequence of BTN2A1 in construct #3 (long linker version with affinity reducing zipper). SEQ ID NO:40 is the nucleic acid sequence of BTN3A1 in construct #3 (long linker version with affinity reducing zipper). SEQ ID NO:41 is the amino acid sequence of BTN2A1 of construct #4 (BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys-zipper). SEQ ID NO:42 is the amino acid sequence of BTN3A1 of construct #4 (BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys-zipper). SEQ ID NO:43 is the nucleic acid sequence of BTN2A1 for construct #4 (BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys-zipper). SEQ ID NO:44 is the nucleic acid sequence of BTN3A1 of construct #4 (BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys-zipper). SEQ ID NO:45 is the amino acid sequence of BTN2A1 of construct #5 (BTN2A1-BTN3A1 Glu106-Ala-zipper). SEQ ID NO:46 is the amino acid sequence of BTN3A1 of construct #5 (BTN2A1-BTN3A1 Glu106-Ala-zipper). SEQ ID NO:47 is the nucleic acid sequence of BTN2A1 for construct #5 (BTN2A1-BTN3A1 Glu106-Ala-zipper with long linker). SEQ ID NO:48 is the nucleic acid sequence of BTN3A1 for construct #5 (BTN2A1-BTN3A1 Glu106-Ala-zipper with long linker). SEQ ID NO: 49: Acid zipper SEQ ID NO:50: Basic zipper SEQ ID NO:51: Acid zipper low affinity SEQ ID NO:52: Basic zipper low affinity SEQ ID NO:53: Short linker SEQ ID NO: 54: Long linker with thrombin cleavage site SEQ ID NOs: 55 to 56: Guide RNA SEQ ID NOs: 57 to 92: primers SEQ ID NO: 93-94: Guide RNA SEQ ID NO: 95: Alt-R HDR oligonucleotide sequence SEQ ID NO: 96 is the amino acid sequence of the mutated (Ser44-Arg) variable region of BTN2A1 isoform 1. SEQ ID NO: 97 is the amino acid sequence of BTN2A1 isoform 1 mutated (Ser44-Arg). SEQ ID NO:98 is the nucleic acid sequence of the mutated (Ser44-Arg) variable region of BTN2A1 isoform 1. SEQ ID NO: 99 is the nucleic acid sequence of mutated (Ser44-Arg) BTN2A1 isoform 1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0149] Overview Throughout this specification, unless otherwise stated or required by context, references to a single step, composition of matter, group of steps, or group of compositions of matter should be interpreted as covering both one and more (i.e., one or more) of that step, composition of matter, group of steps, or group of compositions of matter.

[0150] Those skilled in the art will understand that the present disclosure is subject to variations and modifications other than those specifically described. The present disclosure should be understood to include all such variations and modifications. The present disclosure also includes all of the steps, features, compositions and compounds referred to or shown herein, individually or collectively, and any and all combinations of the steps or features, or any two or more of the above.

[0151] The present disclosure should not be limited in scope by the specific examples described herein, which are intended for the purposes of illustration only. Functionally equivalent products, compositions and methods are clearly within the scope of the present disclosure.

[0152] Any example of the present disclosure herein is understood to apply mutatis mutandis to any other example of the present disclosure, unless otherwise stated. In other words, any specific example of the present disclosure can be combined with any other specific example of the present disclosure (except where mutually exclusive).

[0153] Any instance in this disclosure disclosing a specific feature or group of features or methods or method steps is to be construed as providing explicit support for disclaiming that specific feature or group of features or methods or method steps.

[0154] Unless specifically defined otherwise, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0155] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in this disclosure are standard procedures, well known to those skilled in the art. These techniques are described in J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984); J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989); TA Brown (ed.), Essential Molecular Biology: A Practical Approach, vols. 1 and 2, IRL Press (1991); DM Glover and BD Hames (eds.), DNA Cloning: A Practical Approach, vols. 1-4, IRL Press (1995 and 1996); FM Ausubel et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, with all updates to date); Ed Harlow and David Lane (eds.), Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory (1988); and JE Coligan et al. (eds.), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1998). These are described and explained throughout the literature in sources such as Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0156] The term "and / or," e.g., "X and / or Y," is understood to mean either "X and Y" or "X or Y," and is interpreted as providing explicit support for both meanings or either meaning.

[0157] Throughout this specification the word "comprise" or variations such as "comprises" or "comprising" will be understood to mean the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not to the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0158] As used herein, the term "derived from" shall be interpreted as indicating that the specified integer may be obtained from a particular source, although not necessarily directly from that source.

[0159] Selected Definitions The term "T cell receptor" or "TCR" as used herein refers to a receptor capable of specifically interacting with a target antigen, and includes full-length TCRs and antigen-binding fragments or portions thereof, naturally occurring TCRs, and TCR variants, fragments, and constructs. The TCRs of the present disclosure can be isolated, or synthetically or recombinantly produced. The term includes, for example, heterodimers comprising TCR delta and gamma chains, as well as multimeric and single chain constructs, optionally including additional domains and / or portions.

[0160] A TCR is generally considered to comprise two chains, e.g., a gamma chain and a delta chain, each chain comprising a variable region (e.g., Vgamma and Vdelta) and, optionally, one or more of a diversity (D) region, a joining (J) region and a constant region (e.g., Cgamma and / or Cdelta).

[0161] The variable region can be further subdivided into regions of hypervariability called complementarity determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). For example, the variable region includes three CDRs and three or four FRs (e.g., FR1, FR2, FR3, and optionally FR4). Each variable region includes a binding domain that interacts with an antigen. One or more of the CDRs on each chain may be involved in antigen binding. CDR3 is highly variable due to V(D)J combinatorial diversity and non-template nucleotide modifications, and often forms part of the primary antigen binding region. CDR3γ is semi-invariant in length and composition, and the lysine at position 108 in CDR3γ, encoded by TRGJP, is important for γδ T cell-mediated responses to phosphoantigens.

[0162] As used herein, the term "TCR" further refers to a TCR expressed on the surface of a cell, including a T cell or a cell other than a T cell, or to an isolated or soluble TCR.

[0163] Unless expressly stated, and unless the context indicates otherwise, the term "TCR" also includes antigen-binding fragments or portions of any TCR disclosed herein, including monovalent and bivalent fragments or portions, soluble TCRs, and single chain TCRs. The term "TCR" is not limited to naturally occurring TCRs bound to the surface of a T cell.

[0164] "Antigen-binding fragment" or "antigen-binding portion" refers to any portion of a TCR smaller than the whole that retains antigen binding. An "antigen-binding fragment" or "antigen-binding portion" may include antigen complementarity determining regions (CDRs).

[0165] "Antigen" refers to any molecule, e.g., a (poly)peptide, that can be bound by a TCR or a binding fragment thereof. In the context of the present invention, the term "binding domain" refers in particular to the region of a TCR that interacts with a BTN3 molecule (e.g., BTN3A1) or a BTN2 / BTN3 complex (e.g., BTN2A1 / BTN3A1) of the present disclosure, e.g., the variable region of the TCR δ chain or the variable regions of the TCR δ chain and the TCR γ chain.

[0166] The term "epitope" generally refers to a site on an antigen, typically a (poly)peptide, that a binding domain recognizes. The term "binding domain" refers to an "antigen binding site" in its broadest sense, i.e. characterizes a domain that binds / interacts with a specific epitope on an antigen target. An antigen target may contain a single epitope or may contain at least two epitopes, and may contain any number of epitopes depending on the size, conformation and type of antigen. The term "epitope" generally includes linear epitopes and conformational epitopes. A linear epitope is a continuous epitope contained in a primary amino acid sequence, typically comprising at least two or more amino acids. A conformational epitope is formed by non-contiguous amino acids juxtaposed by folding of a target antigen, particularly a target (poly)peptide.

[0167] The term "γδ T cell" refers to a cell that expresses γ and δ chains as part of the T cell receptor (TCR) complex. γδ TCRs are composed of γ and δ chains, each of which contains a variable and a constant Ig domain. The domains are formed by genetic recombination of variable (V), diversity (D) (only in the case of TCRδ), joining (J), and constant (C) genes within the TCRδ and γ loci. The variable domain of each chain contains three solvent-exposed loops that typically contact the ligand, known as the CDR1, CDR2, and CDR3 regions, the latter of which is highly diverse in composition due to VDJ combinatorial diversity and non-templated nucleotide changes (additions and deletions) at the VD and DJ recombination sites.

[0168] Human γδ T cells can be divided into four main populations based on TCR δ chain expression (δ1, δ2, δ3, δ5). Furthermore, different TCR δ and TCR γ chains combine together to form different γδ T cell types. For example, γδ T cells expressing a TCR containing γ chain variable region 9 (Vγ9) and δ chain variable region 2 (Vδ2) are referred to as Vγ9Vδ2+ T cells, and these cells represent the majority of γδ T cells in peripheral blood. In humans, Vγ2, Vγ3, Vγ4, Vγ5, Vγ8, Vγ9, and Vγ11 rearrangements of γ chains are found.

[0169] In humans, γδ T cells can be further divided into 'Vδ2' and 'non-Vδ2' cells, the latter consisting mostly of Vδ1 chain-expressing cells, and rarely Vδ3 or Vδ5 chain-expressing cells, with Vδ4, Vδ6, Vδ7 and Vδ8 also described.

[0170] γδ T cells can mediate antibody-dependent cell-mediated cytotoxicity (ADCC) and phagocytosis, and can rapidly respond to pathogen-specific antigens without prior differentiation or expansion. γδ T cells are not MHC-restricted, as they respond directly to protein and non-peptide antigens. At least some γδ T cell-specific antigens represent evolutionarily conserved molecular patterns found in microbial pathogens and induced self-antigens, and are upregulated by cellular stress, infection, and transformation. Such antigens are generally referred to herein as "phosphoantigens" or pAgs. γδ T cells can also respond to other antigens and ligands via the TCR and (co)receptors.

[0171] In addition, γδ T cells can be further classified into a series of multiple functional populations: IFN-γ-producing γδ T cells, IL-17A-producing γδ T cells, antigen-presenting γδ T cells, follicular B helper γδ T cells, and regulatory γδ T cells. γδ T cells can promote immune responses resulting in direct cytotoxicity, cytokine production, and indirect immune responses. For example, the IFN-γ-producing phenotype is characterized by increased CD56 expression and enhanced cytolytic responses. Some γδ T cell subsets can contribute to disease progression by promoting inflammation and / or immunosuppression. For example, IL-17A-producing γδ T cells are widely involved in inflammatory responses and have pathogenic roles in infections and autoimmune diseases.

[0172] The terms "butyrophilin (BTN)" and "butyrophilin-like (BTNL)" molecules refer to regulators of immune responses that belong to the immunoglobulin (Ig) superfamily of transmembrane proteins. They are structurally related to the B7 family of costimulatory molecules and have similar immunoregulatory functions. BTNs are involved in the regulation of T cell development, activation and inhibition, as well as T cell interactions with antigen-presenting cells and epithelial cells. Certain BTNs are genetically associated with autoimmune and inflammatory diseases. The human butyrophilin family contains seven members that are subdivided into three subfamilies: BTN1, BTN2 and BTN3. The BTN1 subfamily contains only the prototypic single copy BTN1A1 gene, whereas the BTN2 and BTN3 subfamilies contain three genes, BTN2A1, BTN2A2 and BTN2A3, and BTN3A1, BTN3A2 and BTN3A3, respectively. The BTNL protein has a high degree of homology with BTN family members. The human genome contains four BTNL genes: BTNL2, 3, 8 and 9. As used herein, the terms "butyrophilin (BTN)" and "butyrophilin-like (BTNL)" molecules refer to isoforms of the BTN and BTNL molecules.

[0173] Butyrophilin and BTNL molecules typically contain two immunoglobulin-like domains: an N-terminal Ig-V-like (referred to herein as "IgV") and a C-terminal Ig-C-like domain (referred to herein as "IgC"). BTNL2 contains an additional Ig domain at the N-terminus. In some embodiments, butyrophilin family proteins and BTNL molecules contain a V-type domain and / or a B30.2 domain.

[0174] For purposes of nomenclature only and not limitation, the amino acid sequence of BTN2A1 is taught in NCBI RefSeq NP_008980.1, NP_510961.1, NP_001184162.1 or NP_001184163.1 and / or SEQ ID NOs: 9 to 14. In one example, the BTN2A1 is human BTN2A1.

[0175] For purposes of nomenclature only and not limitation, the amino acid sequence of BTN3A1 is taught in NCBI RefSeq NP_008979.3, NP_919423.1, NP_001138480.1, NP_001138481.1, XP_005248890.1, XP_005248891.1, XP_006715046.1 and / or SEQ ID NOs: 15-18. In one example, the BTN3A1 is human BTN3A1.

[0176] The terms BTN2 and BTN3 as used herein refer to any of BTN2A1, BTN2A2 and BTN2A3, and BTN3A1, BTN3A2 and BTN3A3, respectively, which interact with the TCR, and include full-length BTN and TCR-binding fragments or portions thereof, native BTN, and BTN isomers, mutants, fragments and constructs.

[0177] Unless expressly stated, and unless the context indicates otherwise, the terms "BTN2" and "BTN3" also include any TCR-binding fragment or portion of BTN2 and BTN3 disclosed herein.

[0178] "TCR binding fragment" or "TCR binding portion" refers to any portion of less than the entire BTN2 or BTN3 molecule that retains TCR binding.

[0179] The term "variant" as used herein refers to a BTN that has substantial or significant sequence identity or similarity to a parent BTN, its variable region or its TCR binding region, and has in common its biological activity, i.e., its ability to specifically bind to a TCR binding region with the same degree of specificity as the parent BTN, or with the same or even greater degree of specificity.

[0180] The term "construct" includes, for example, proteins or polypeptides that contain at least one binding domain of a native BTN, but do not necessarily have in common the basic structure of a native BTN. BTN constructs and fragments are typically obtained by routine methods of genetic engineering, and are often artificially constructed to contain additional functional protein or polypeptide domains.

[0181] The term "BTN construct" also relates to a fusion protein or polypeptide comprising at least one antigen-binding domain of BTN and one or more fusion components. Useful components include an Ig-derived hinge domain, an Fc receptor, an Fc domain (from IgA, IgD, IgG, IgE, and IgM), a cytokine (such as IL-2 or IL-15), a toxin, an antibody or antigen-binding fragment thereof (such as an anti-CD3, anti-CD28, anti-CD5, anti-CD16, or anti-CD56 antibody or antigen-binding fragment thereof), CD247 (CD3-zeta), CD28, CD137, CD134 or other co-stimulatory domain, or any combination thereof. In some embodiments, the BTN construct comprises an antibody or antigen-binding fragment thereof that targets one or more of CD19, PSMA, GD2, PSCA, BCMA, CD123, B7-H3, CD20, CD30, CD33, CD38, CEA, CLEC12A, DLL3, EGFRvIII, EpCAM, CD307, FLT3, GPC3, gpA33, HER2, MUC16, P-cadherin, SSTR2, and mesothelin.

[0182] As used herein, the term "label" or "labeling group" refers to any detectable label.

[0183] The term "position" as used herein means either the position of an amino acid in an amino acid sequence disclosed herein or the position of a nucleotide in a nucleic acid sequence disclosed herein. The term "corresponding" as used herein also includes that the position is not only determined by the number of preceding amino acids / nucleotides, but should also be viewed from the context of the surrounding portion of the sequence. Thus, the position of a given amino acid or nucleotide according to the present disclosure may change depending on the deletion or addition of amino acids or nucleotides elsewhere in the sequence. Thus, when a position is referred to as a "corresponding position" according to the present disclosure, it is understood that the amino acids / nucleotides may differ with respect to the designated number but still have similar adjacent amino acids / nucleotides. To determine whether an amino acid residue or nucleotide in a given sequence corresponds to a particular position in an amino acid or nucleotide sequence of a "parent" amino acid / nucleotide sequence, the skilled artisan can use means and methods well known in the art, such as sequence alignment, either manually or by using a computer program.

[0184] As used herein, the term "binding" with respect to the interaction of a V52+ TCR or a V-9V52+ TCR with a modified BTN3 molecule of the disclosure (e.g., BTN3A1) or a BTN2 / BTN3 complex means that the interaction is dependent on the presence of a particular structure (e.g., an epitope) on the BTN3 molecule or the BTN2 / BTN3 complex. For example, the V52+ chain of the TCR may bind to one or more of the extracellular domains of the BTN3 molecule (e.g., IgV and / or IgC). The Vy9+ chain of the TCR may bind to one or more of the extracellular domains of the BTN2 molecule (e.g., IgV and / or IgC).

[0185] As used herein, the term "specifically binds" means that the binding interaction between the TCR of the present disclosure and the modified BTN3 molecule or BTN2 / BTN3 complex is dependent on the presence of an antigenic determinant or epitope. The binding region of the TCR preferentially binds to or recognizes a particular antigenic determinant or epitope, even when present in a mixture of other molecules or cells expressing it. In one example, the binding region reacts or associates with a specific antigenic determinant or epitope more frequently, more rapidly, with a longer duration, and / or with greater affinity than with alternative antigenic determinants or cells expressing it. It is also understood by reading this definition that, for example, a binding region that specifically binds to a particular antigenic determinant or epitope may or may not specifically bind to a second antigenic determinant or epitope. Thus, "specific binding" does not necessarily require exclusive or undetectable binding to another antigen. The term "specifically binds" may be used interchangeably herein with "selectively binds." Generally, references to binding herein mean specific binding, with each term being understood to provide clear support for the other term. Methods for determining specific binding will be apparent to one of skill in the art. In one example, "specific binding" of a TCR to a modified BTN3 molecule or BTN2 / BTN3 complex of the present disclosure is 10,000 μM or less, 9,000 μM or less, 8,000 μM or less, 7,000 μM or less, 6,000 μM or less, 5,000 μM or less, 4,000 μM or less, 3,000 μM or less, 2,000 μM or less, 1,000 μM or less, such as 900 μM or less, 800 μM or less, 700 μM or less, 600 μM or less. By this reference is meant binding with an equilibrium constant (KD) of 500 μM or less, 400 μM or less, 300 μM or less, 200 μM or less, or 100 μM or less, such as 90 μM or less, for example 85 μM or less, such as 50 μM or less, for example 45 μM or less, for example between 10 μM and 1000 μM, between 10 μM and 500 μM, between 10 μM and 100 μM, between 40 μM and 90 μM, or between 45 μM and 85 μM.

[0186] As used herein, the term "enhances binding" with respect to the interaction of a TCR with i) a modified BTN3 molecule, or ii) a BTN2 / BTN3 complex means that the TCR reacts or associates with i) a modified BTN3 molecule of the present disclosure, or ii) a BTN2 / BTN3 complex, more frequently, more rapidly, with a longer duration, and / or with greater affinity than with i) an unmodified BTN3 counterpart having a glutamic acid (E) at a position corresponding to amino acid 106 of the amino acid sequence set forth in SEQ ID NO:2, or ii) BTN2 or BTN3 alone, respectively. In one example, "enhanced binding" to an engineered BTN3 molecule or BTN2 / BTN3 complex of the present disclosure or a cell expressing same means that the TCR binds with an equilibrium constant (KD) of 100 μM or less, 50 μM or less, 40 μM or less, 30 μM or less, or 20 μM or less, or 10 μM or less, e.g., between 10 μM and 100 μM, between 20 μM and 50 μM, between 30 μM and 50 μM, between 40 μM and 50 μM, e.g., about 45 μM. Binding of the TCR to an engineered BTN3 molecule or BTN2 / BTN3 complex of the present disclosure can induce or enhance V52+ TCR activation. The TCR can induce or enhance V52+Vγ9+ and / or V52Vγ9- γδ TCR activation. For example, the TCR can induce or enhance V52+ γδTCR activation, including but not limited to V52+Vγ9+ and / or V52+Vγ1 / 2 / 3 / 4 / 5 / 8 / 10 / 11 γδTCR activation. Activation can be phosphoantigen-independent or phosphoantigen-dependent. For example, without being bound by theory or motivation, binding of the TCR to an engineered BTN3 or BTN2 / BTN3 complex of the present disclosure can be independent of antigen (e.g., pAg) activation. Binding of the TCR to an engineered BTN3 or BTN2 / BTN3 complex of the present disclosure can be stimulatory to the γδ T cell and may activate one or more of cytolytic function, cytokine production of one or more cytokines, or proliferation of the γδ T cell.

[0187] As used herein, the term "BTN2 / BTN3 complex" refers to a complex of BTN2 and BTN3 molecules, e.g., a complex of BTN2A1 and BTN3A1. The complex may be present on the surface of a cell, e.g., a tumor cell, a monocyte, a macrophage, a dendritic cell, a parenchymal cell, and / or a natural killer (NK) cell. Alternatively, the complex may be an isolated or soluble BTN2 / BTN3 complex. The BTN2 / BTN3 complex may be a heteromeric or multimeric complex. The complex may include one or more BTN2 molecules, such as BTN2A1 and / or BTN2A2 and / or BTN2A3, and / or one or more BTN3 molecules, such as BTN3A1 and BTN3A2, and / or other proteins, such as ATP-binding cassette transporter A1 (ABCA1). The BTN2 and / or BTN3 molecules may exist in monomeric or dimeric form.

[0188] In some embodiments, the BTN2 / BTN3 complex of the present disclosure comprises a heterodimerization domain. As used herein, "heterodimerization domain" refers to a domain formed upon dimerization of a BTN2 molecule and a BTN3 molecule. For example, a BTN2 molecule comprises a first heterologous C-terminal dimerization peptide that preferentially interacts or associates with another dimerization peptide (a second heterologous C-terminal dimerization peptide) linked at its C-terminus to a BTN3 molecule. The interaction of the dimerization peptides substantially contributes to or efficiently promotes heterodimerization (i.e., the formation of a dimer between BTN2 and BTN3, also referred to herein as a heterodimer or heteromeric complex). Exemplary heterodimerization peptides of the present disclosure include C-fos and C-jun.

[0189] In some embodiments, the BTN2 / BTN3 heteromeric complex of the disclosure is expressed as a single-chain fusion protein.

[0190] As used herein, a "soluble BTN2 / BTN3 complex" refers to a BTN2 / BTN3 complex that consists of a BTN chain, but at a minimum does not include the transmembrane region of the full-length BTN chain, or includes a mutated BTN chain, such that the BTN chain is not associated with a membrane when expressed by a cell. Most typically, the soluble complex consists only of the extracellular domain of the native BTN chain (i.e., the BTN chain lacks the transmembrane and cytoplasmic domains).

[0191] As used herein, the term "cancer" refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell proliferation. Hyperproliferative and neoplastic disease states can be classified as pathological, i.e., characterizing or constituting a disease state, or non-pathological, i.e., deviations from normal but not associated with a disease state. The term is meant to include all types of cancerous growths or carcinogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasiveness.

[0192] The term "protein" is intended to include a single polypeptide chain, i.e., a series of consecutive amino acids linked by peptide bonds, or a series of polypeptide chains linked to each other covalently or non-covalently (i.e., a polypeptide complex). For example, a series of polypeptide chains may be covalently linked using suitable chemicals or disulfide bonds. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, van der Waals forces, and hydrophobic interactions.

[0193] It will be understood from the previous paragraph that the term "polypeptide" or "polypeptide chain" means a series of consecutive amino acids linked by peptide bonds.

[0194] As used herein, the term "disease," "disorder," or "condition" refers to a disruption of or interference with normal function, and includes a disease or disorder, without being limited to any particular condition.

[0195] As used herein, a subject "at risk" of developing or having a disease or condition or its recurrence may or may not have detectable disease or symptoms of disease, and may or may not exhibit detectable disease or symptoms of disease prior to treatment according to the present disclosure. "At risk" refers to the subject having one or more risk factors, which are measurable parameters that correlate with the development of a disease or condition, as known in the art and / or described herein.

[0196] As used herein, the terms "treating," "treat," or "treatment" include administering a BTN or BTN complex, nucleic acid, vector, cell, or composition described herein, thereby reducing or eliminating at least one symptom of a particular disease or condition, or slowing the progression of the disease or condition.

[0197] As used herein, the terms "preventing," "prevent" or "prevention" include providing prophylaxis with respect to the occurrence or recurrence of a particular disease or condition, where an individual is predisposed to or at risk of developing the disease or disease recurrence, but has not yet been diagnosed with the disease or disease recurrence.

[0198] An "effective amount" refers to an amount that is at least effective to achieve a desired result, at the dosage and for the period of time required. For example, the desired result may be a therapeutic or prophylactic result. An effective amount may be provided in one or more administrations. In some examples of the present disclosure, the term "effective amount" refers to an amount necessary to effect treatment of a disease or condition as described herein. In some examples of the present disclosure, the term "effective amount" refers to an amount necessary to effect activation of V52+ TCRγδ T cells (e.g., Vγ9δ2+ TCRγδ T cells). In some examples of the present disclosure, the term "effective amount" refers to an amount necessary to effect one or more of cytolytic function, cytokine production of one or more cytokines, or proliferation of γδ T cells. An effective amount may vary depending on the disease or condition being treated or the factor being modified, and may also vary depending on the weight, age, racial background, sex, health and / or physical condition, and other factors associated with the mammal being treated. Typically, an effective amount will be within a relatively broad range (e.g., a "dosage" range) that can be determined through routine testing and experimentation by a physician. Thus, the term should not be construed to limit the disclosure to a specific amount, such as weight or number of binding proteins. An effective amount can be administered in a single dose, or in one or more repeated doses over a treatment period.

[0199] A "therapeutically effective amount" is at least the minimum concentration required to produce a measurable improvement in a particular disease or condition. The therapeutically effective amount herein can vary depending on factors such as the disease state, age, sex, and weight of the patient, and the ability of the antibody or antigen-binding fragment thereof to induce a desired response in an individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of BTN or a BTN complex or a binding fragment thereof are outweighed by the therapeutically beneficial effects.

[0200] As used herein, the term "prophylactically effective amount" shall be interpreted to mean an amount sufficient to prevent or inhibit or delay the onset of one or more detectable symptoms of a disease or condition, or complications thereof.

[0201] As used herein, the term "subject" shall be taken to mean any animal, e.g., a mammal, including a human. Exemplary subjects include, but are not limited to, humans and non-human primates. For example, the subject is a human.

[0202] BTN2 / BTN3 complex The inventors surprisingly found that the BTN3A1 IgV domain interacts with BTN2A1 and that the BTN2A1-BTN3A1 complex and modified BTN3A1 bind to Vγ9Vδ2 + We have demonstrated that modified BTN2 can react with TCR to promote γδ T cell-mediated immunity. We also surprisingly found that the BTN2-BTN3 complex is capable of targeting Vγ9Vδ2 + It has been demonstrated that the ability of the antibody to interact with TCR can be enhanced.

[0203] BTN2 and BTN3 chains The disclosure provides a complex of BTN2 and BTN3. In some embodiments, the BTN2 chain comprises or consists of the amino acid sequence set forth in any one of SEQ ID NOs: 1, or 9-14, or 29, 33, 37, 45, 96, or 97, and the BTN3 chain comprises or consists of the amino acid sequence set forth in any one of SEQ ID NOs: 2, 3, 4, or 15-18, or 30, 34, 38, or 46.

[0204] A BTN2 chain comprising an amino acid sequence having at least 70% sequence identity, at least 80% sequence identity, more preferably at least 85% sequence identity, more preferably 90% or 95% sequence identity to any one of SEQ ID NOs: 1, or 9-14, or 29, 33, 37, 45, 96, or 97, and a BTN3 chain comprising an amino acid sequence having at least 70% sequence identity, at least 80% sequence identity, more preferably at least 85% sequence identity, more preferably 90% or 95% sequence identity to any one of SEQ ID NOs: 2, 3, 4, or 15-18, or 30, 34, 38, or 46 may be used, provided that the BTN2 / BTN3 complex retains the advantageous capabilities of the complex as assessed in the accompanying examples, i.e., binds to Vγ9Vδ2 to the same extent, the same or even to a greater extent than either BTN2 or BTN3 alone. + The condition is that it binds to TCR.

[0205] As used herein, the term "sequence identity" refers to the degree to which two (amino acid or nucleotide) sequences have identical residues at the same positions in an alignment, which is often expressed as a percentage. Preferably, identity is determined over the entire length of the sequences being compared. Thus, two copies of an identical sequence will have 100% identity, while sequences that are not highly conserved and have deletions, additions, or substitutions may have a lower degree of identity. Those skilled in the art will recognize that several algorithms are available for determining sequence identity using standard parameters, e.g., Blast (Altschul et al., (1997) Nucleic Acids Res. 25:3389-3402), Blast2 (Altschul et al., (1990) J. Mol. Biol. 215:403-410), Smith-Waterman (Smith et al., (1981) J. Mol. Biol. 147:195-197), and ClustalW. Thus, the amino acid sequences of SEQ ID NOs: 1 and 2, for example, can serve as "subject sequences" or "reference sequences."

[0206] The BTN2 and / or BTN3 chains of the BTN2 / BTN3 complex of the present disclosure may include one or more amino acid modifications. Amino acid modifications can be introduced into the Ig-V-like domain (referred to herein as "IgV") or Ig-C-like domain (referred to herein as "IgC") of BTN2 and / or BTN3 and can serve to modulate properties such as binding strength and specificity, post-translational processing (e.g., glycosylation), thermodynamic stability, solubility, surface expression, or BTN2 / BTN3 complex assembly. Amino acid modifications include, for example, deletions from, and / or insertions into, and / or substitutions of residues within the amino acid sequences of native BTN2 and / or BTN3 chains.

[0207] Exemplary substitution variants include amino acid substitutions in the variable, framework or constant regions of the BTN chain. Particularly contemplated herein are conservative amino acid substitutions.

[0208] "Conservative substitutions" can be made, for example, on the basis of similarity in polarity, charge, size, solubility, hydrophobicity, hydrophilicity, and / or amphipathicity of the amino acid residues involved. The 20 naturally occurring amino acids can be divided into six standard amino acid groups: (1) hydrophobic: Met, Ala, Val, Leu, Ile, (2) neutral hydrophilic: Cys, Ser, Thr; Asn, Gln, (3) acidic: Asp, Glu, (4) basic: His, Lys, Arg, (5) residues that affect chain orientation: Gly, Pro, and (6) aromatic: Trp, Tyr, Phe.

[0209] As used herein, a "non-conservative substitution" is defined as the replacement of an amino acid with another amino acid listed in a different group of the six standard amino acid groups (1) to (6) shown above.

[0210] In some embodiments, substitutions may also include non-classical amino acids (e.g., selenocysteine, pyrrolidine, N'-formylmethionine β-alanine, GABA and δ-aminolevulinic acid, 4-aminobenzoic acid (PABA), D-isomers of common amino acids, 2,4-diaminobutyric acid, α-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, γ-Abu, ε-Ahx, 6-aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, Cα-methyl amino acids, Nα-methyl amino acids, and common amino acid analogs). Mutations can also be made to the nucleotide sequence of the heterodimeric protein by reference to the genetic code, including taking into account codon degeneracy.

[0211] The BTN2 and / or BTN3 chains of the BTN2 / BTN3 complex of the present disclosure may further comprise an immunoglobulin constant-like (IgC) region. The constant region may be a human constant region or may be derived from another species, resulting in a "chimeric" molecule.

[0212] One or more cysteine ​​bonds may be added to the BTN constant region. The addition of disulfide bonds in the constant region may promote correct pairing of the BTN chains. In addition to additional cysteine ​​bridges, other useful modifications include, for example, adding leucine zippers and / or ribosome skipping sequences, such as sequence 2A from picornaviruses, to increase folding, expression and / or pairing of the BTN chains.

[0213] The BTN2 / BTN3 complexes of the present disclosure include heterodimers and multimers in which at least one BTN2 chain and at least one BTN3 chain are linked to each other. In its simplest form, a multivalent BTN2 / BTN3 complex according to the present disclosure comprises a multimer of two or three or four or more BTN2 / BTN3 complexes that are associated with each other (e.g., covalently or otherwise linked), preferably via a linker molecule. In some embodiments, a BTN2 / BTN3 complex can be formed due to the interaction of a BTN2 dimer (e.g., a BTN2A1 dimer) with a BTN3 dimer (e.g., a BTN3A1 dimer).

[0214] Suitable linker molecules include, but are not limited to, multivalent adhesion molecules such as avidin, streptavidin, neutravidin and extravidin, each of which has four binding sites for biotin. Thus, biotinylated BTN2 / BTN3 complexes can be formed as multimers with multiple TCR binding sites. The number of BTN2 / BTN3 complexes in a multimer depends on the amount of BTN2 / BTN3 complexes relative to the amount of linker molecules used to make the multimer, and also on the presence or absence of any other biotinylated molecules. Exemplary multimers are dimers, trimers, tetramers or pentamers, or higher multimeric BTN2 / BTN3 complexes. The multimers of the present disclosure may also include additional functional entities such as labels or drugs or (solid) supports.

[0215] The BTN2 / BTN3 complexes of the present disclosure can be linked via a suitable linker to spheres, preferably uniform beads, more preferably polystyrene beads, most preferably biocompatible polystyrene beads. A given fluorescent dye can be incorporated into the beads.

[0216] The BTN2 / BTN3 complexes of the present disclosure can be fused to one or more fusion components, including antibodies and antibody fragments. Exemplary antibody fragments that can be used include fragments of full-length antibodies, such as (s)dAb, Fv, Fd, Fab, Fab', F(ab')2 or "r IgG" ("half antibodies"), modified antibody fragments, such as scFv, di-scFv or bi(s)-scFv, scFv-Fc, scFv-zipper, scFab, Fab2, Fab3, diabodies, single chain diabodies, tandem diabodies (Tandab's), tandem di-scFv, tandem tri-scFv, minibodies, multibodies, such as triabodies or tetrabodies, and single domain antibodies, such as nanobodies, or single variable domain antibodies that comprise only one variable domain, which can be a VHH, VH or VL.

[0217] The BTN2 / BTN3 complexes of the invention can be fused to one or more antibodies or antibody fragments to produce monovalent, bivalent and polyvalent / multivalent constructs, thus producing monospecific constructs that specifically bind to only one target antigen, as well as bispecific and polyspecific / multispecific constructs that specifically bind to more than one target antigen, e.g., two, three or more, through separate antigen binding sites.

[0218] If necessary, a linker can be introduced between one or more of the domains or regions of the BTN2 / BTN3 complex of the present disclosure and / or one or more of the fusion components described herein. Linkers are known in the art. In general, linkers include flexible, cleavable and rigid linkers, and are selected depending on the type of construct and the intended use / application. For example, in therapeutic applications, non-immunogenic flexible linkers are often preferred to ensure some flexibility or interaction between domains while reducing the risk of adverse immunogenic reactions. Such linkers are generally composed of small non-polar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids, including the "GS" linker, which consists of a chain of Gly and Ser residues. The linker may also be, for example, synthetic (e.g., PEG) or may be the hinge region of an antibody (e.g., of the IgG, IgA, IgD, and IgE, including subclasses (e.g., IgG1, IgG2, IgG3, and IgG4, as well as IgA1 and IgA2)) or may comprise the Fc domain of an antibody (e.g., of the IgG, IgA, IgD, and IgE, including subclasses (e.g., IgG1, IgG2, IgG3, and IgG4, as well as IgA1 and IgA2)).

[0219] Particularly useful BTN2 / BTN3 constructs are those that comprise at least one BTN2 chain and at least one BTN3 chain, optionally linked to each other, optionally via a linker, fused to at least one antibody or antibody fragment (e.g., single-chain antibody fragment (scFv)) directed to a surface antigen or epitope. The constructs can generally have any structure, so long as the "BTN portion" retains its ability to recognize the antigen target as defined herein, and the "antibody portion" binds to the desired surface antigen or epitope, thereby recruiting and targeting the BTN2 / BTN3 complex or a cell expressing it to the target cell. Such constructs can advantageously serve as "adapters" linking together antigen-presenting cells and lymphocytes (such as cytotoxic T cells or NK cells). One example of such a fusion protein is a construct engineered according to the bispecific T cell engager (BiTE®) principle, consisting of two single-chain variable fragments (scFv) of different antibodies on a single peptide chain of about 55 kilodaltons (kD). Thus, the BTN2 / BTN3 constructs of the disclosure can include at least one TCR antigen binding domain as described herein (e.g., the BTN2A1 chain and the BTN3A chain complexed together) linked to an scFv (or other binding domain) with a desired binding specificity, such as, for example, CD3 or CD56. The scFv (or other binding domain) binds to CD3 for T cell activation, or to CD56 for NK cell activation. Also contemplated herein are tribodies that include at least one TCR antigen binding domain as described herein, an scFv (or other binding domain), and an additional domain (e.g., an Fc domain) for targeting the construct, for example, to a site of action in the body.

[0220] The BTN2 / BTN3 complex of the present disclosure can be provided in "isolated" or "substantially pure" form. "Isolated" or "substantially pure" as used herein means that BTN2 and / or BTN3 have been isolated and / or recovered from components of their production environment such that the "isolated" BTN2 / BTN3 complex is free or substantially free of other contaminating components from its production environment that may interfere with its therapeutic or diagnostic use. Contaminating components include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. Thus, an "isolated" BTN2 / BTN3 complex is prepared by at least one purification step that removes or substantially removes these contaminating components. The foregoing definition is equally applicable, mutatis mutandis, to an "isolated" polynucleotide / nucleic acid.

[0221] The BTN2 / BTN3 complexes of the present disclosure may include one or more additional modifications as described below. The modifications described below are typically covalent modifications and can be achieved using standard techniques known in the art. In some circumstances, amino acid modifications in the BTN2 / BTN3 complex may be required to facilitate the introduction of the modifications.

[0222] The BTN2 / BTN3 complexes of the invention, particularly soluble BTN2 / BTN3 complexes, can be labeled. Useful labels are known in the art and can be coupled to the BTN2 or BTN3 chains, or to the BTN2 / BTN3 complex, optionally via linkers of various lengths, using routine methods. Generally, labels are divided into various classes depending on the assay in which they are detected, examples of which include, but are not limited to: isotopic labels, which may be radioactive or heavy isotopes such as radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 89Zr, 90Y, 99Tc, 111ln, 125l, 131l); magnetic labels (e.g., magnetic particles); redox-active moieties; optical dyes (including, but not limited to, chromophores, phosphors and fluorophores), such as fluorescent groups (e.g., FITC, rhodamine, lanthanide phosphors), chemiluminescent groups, and fluorophores, which may be either small molecule fluorophores or proteinaceous fluorophores; enzymatic groups (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase); biotinylated groups; or a predetermined polypeptide epitope recognized by a secondary reporter (e.g., a leucine zipper pair sequence, a binding site for a secondary antibody, a metal binding domain, an epitope tag, etc.). Labeling is particularly contemplated when the BTN2 / BTN3 complex, or particularly a soluble BTN2 / BTN3 complex construct, is intended for diagnostic use.

[0223] The BTN2 / BTN3 complexes of the disclosure, particularly soluble BTN2 / BTN3 complexes, can be modified by attachment of additional functional moieties, for example, to reduce immunogenicity, increase hydrodynamic size (size in solution), solubility and / or stability (e.g., by providing increased protection against proteolytic degradation), and / or increase serum half-life.

[0224] Exemplary functional moieties for use in accordance with the present disclosure include peptides or protein domains that bind to other proteins in the human body (e.g., serum albumin, immunoglobulin Fc (IgFc) regions, or neonatal Fc receptors), FcRn polypeptide chains of various lengths (e.g., XTEN technology or PASylation®), various polyols such as polyethylene glycol (PEGylation), polypropylene glycol, polyalkylenes, or copolymers of polyethylene glycol and polypropylene glycol, or non-proteinaceous polymers including, but not limited to, carbohydrates such as hydroxyethyl starch (e.g., HESylation®) or polysialic acid (e.g., PolyXen® technology). In some embodiments, the BTN2 chain and / or BTN3 of the BTN2 / BTN3 complex of the present disclosure are fused to human serum albumin or IgFc, or engineered variants thereof that have altered binding affinity for FcRn.

[0225] Other useful functional moieties include "suicide switches" or "safety switches" that can be used to shut off host cells containing the BTN2 / BTN3 complex of the present disclosure in a patient. One example is the inducible caspase 9 (iCasp9) "safety switch." Briefly, host cells are engineered by known methods to express a caspase 9 domain whose dimerization is dependent on a small molecule dimerizer such as AP1903 / CIP, resulting in rapid induction of apoptosis in the engineered cells. Other examples of "suicide switches" or "safety switches" are known in the art, including, for example, herpes simplex virus thymidine kinase (HSV-TK), expression of CD20 followed by depletion using anti-CD20 antibodies or myc tags.

[0226] BTN2 / BTN3 complexes that have undergone post-translational modifications, such as phosphorylation, glycosylation, ubiquitination, nitrosylation, methylation, acetylation, lipidation patterns, and the like, are also contemplated herein. As is known in the art, glycosylation patterns can depend on the amino acid sequence (e.g., the presence or absence of specific glycosylated amino acid residues, as discussed below) and / or the host cell or organism in which the protein is produced. Glycosylation of polypeptides is typically either N-linked or O-linked. N-linked refers to the attachment of the carbohydrate moiety to the side chain of an asparagine residue. Addition of N-linked glycosylation sites to the binding molecule is conveniently accomplished by altering the amino acid sequence to include one or more tripeptide sequences selected from asparagine-X-serine and asparagine-X-threonine, where X is any amino acid except proline. O-linked glycosylation sites can be introduced by the addition or substitution of one or more serine or threonine residues to the starting sequence.

[0227] Another means of glycosylation of the BTN2 / BTN3 complex is by chemical or enzymatic coupling of glycosides to the protein. Depending on the coupling mode used, sugars can be attached to (a) arginine and histidine, (b) free carboxyl groups, (c) free sulfhydryl groups, e.g., cysteine, (d) free hydroxyl groups, e.g., serine, threonine, or hydroxyproline, (e) aromatic residues, e.g., phenylalanine, tyrosine, or tryptophan, or (f) amide groups of glutamine. Similarly, deglycosylation (i.e., removal of carbohydrate moieties present on the binding molecule) can be accomplished chemically, e.g., by exposing the TCR to trifluoromethanesulfonic acid, or enzymatically, e.g., by using endo- and exo-glycosidases.

[0228] It is also contemplated that drugs such as small molecule compounds may be attached to the BTN2 / BTN3 complexes of the present disclosure, particularly soluble BTN2 / BTN3 complexes. Linkage can be achieved through covalent or non-covalent interactions, such as by electrostatic forces. A variety of linkers known in the art can be used to form drug conjugates. Such complexes could target cytotoxic drugs (e.g., PBDs) to V52+ T cells to specifically kill this T cell subset, for example, in the treatment of autoimmune disease, transplant rejection, graft-versus-host disease, or graft-versus-tumor effects.

[0229] The BTN2 / BTN3 complexes of the present disclosure, particularly soluble BTN2 / BTN3 complexes, can be modified to introduce additional domains that aid in the identification, tracking, purification, and / or isolation of each molecule (tags). Non-limiting examples of such tags include peptide motifs known as Myc tags, HAT tags, HA tags, TAP tags, GST tags, chitin binding domains (CBD tags), maltose binding protein (MBP tags), Flag tags, Strep tags and variants thereof (e.g., Strep II tags), His tags, CD20, Her2 / neu tags, myc tags, FLAG tags, T7 tags, SpyCatcher or GFP tags, or other fluorescent or luminescent tags known in the art.

[0230] Epitope tags are useful examples of tags that can be incorporated into the BTN2 / BTN3 complexes of the present disclosure. Epitope tags are short stretches of amino acids that allow for the binding of specific antibodies and therefore the identification and tracking of the binding and translocation of soluble TCRs or host cells in a patient or cultured host cells. Detection of epitope tags, and thus tagged BTN2 / BTN3 complexes, can be achieved using many different techniques. Examples of such techniques include: immunohistochemistry, immunoprecipitation, flow cytometry, immunofluorescence microscopy, ELISA, immunoblotting ("Western"), and affinity chromatography. Epitope tags can have a length of, for example, 6 to 15 amino acids, particularly 9 to 11 amino acids. It is also possible to include more than one epitope tag in the TCRs of the present disclosure.

[0231] The tag can further be used to stimulate and grow host cells that contain the BTN2 / BTN3 complex of the disclosure by culturing the cells in the presence of a binding molecule (antibody) specific for the tag.

[0232] Modified BTN2 The present disclosure also provides modified BTN2. In a preferred embodiment, the modified BTN2 is complexed with a BTN3 molecule. The modified BTN2 of the present disclosure comprises a modification (e.g., a substitution, deletion, or insertion) at a position corresponding to serine (S) 44 of the amino acid sequence set forth in SEQ ID NO:1, which enhances binding of the BTN2-BTN3 complex to a Vy9V52+ TCR. In one example, the BTN2 of the present disclosure comprises an arginine at a position corresponding to serine (S) 44 of the amino acid sequence set forth in SEQ ID NO:1. One of skill in the art will appreciate that the description of BTN2 variants, constructs, and fragments provided above in relation to the BTN2 / BTN3 complex of the present disclosure also applies to the modified BTN2 molecule of the present disclosure.

[0233] The above description of the BTN2 chains in relation to the BTN2 / BTN3 complex of the present disclosure is equally applicable, mutatis mutandis, to the modified BTN2 molecules of the present disclosure.Variants, constructs, and fragments of the modified BTN2 molecules, as well as fusions, dimers, multimers, and soluble forms thereof, are intended to be covered.

[0234] Modified BTN3 The present disclosure also provides a modified BTN3 that can be used alone or in a complex with a BTN2 molecule. The modified BTN3 of the present disclosure comprises a modification (e.g., a substitution, deletion, or insertion) at a position corresponding to glutamic acid (E) 106 of the amino acid sequence set forth in SEQ ID NO:2, the modification being at the V52 site of BTN3. + enhances binding to the TCR. In one example, the BTN3 of the present disclosure contains an alanine at a position corresponding to glutamic acid (E) 106 of the amino acid sequence set forth in SEQ ID NO: 2. One of skill in the art will understand that the descriptions of BTN3 variants, constructs, and fragments provided above in connection with the BTN2 / BTN3 complex of the present disclosure also apply to the modified BTN3 molecules of the present disclosure.

[0235] The above description of the BTN3 chains in relation to the BTN2 / BTN3 complex of the present disclosure is equally applicable, mutatis mutandis, to the modified BTN3 molecules of the present disclosure.Variants, constructs and fragments of the modified BTN3 molecule, as well as fusions, dimers, multimers and soluble forms thereof, are intended to be covered.

[0236] Heterodimerization domain In some embodiments, the heterodimerization domain of the BTN2 / BTN3 complex according to the present disclosure is a so-called "coiled coil" or "leucine zipper." These terms are used to describe a pair of helical peptides that interact with each other in a specific manner to form a heterodimer. The interaction occurs due to the presence of complementary hydrophobic residues along one side of each zipper peptide. The properties of the peptides are such that the formation of heterodimers is greatly favored over the formation of helical homodimers.

[0237] Coiled coils are common domains in many transcription factors. An example of such a structure is the leucine zipper of the GCN4 transcription factor (Kouzarides, T. and Ziff, E., "Leucine zippers of fos, jun and GCN4 dictate dimerization specificity and thereby control DNA binding", Nature 340, 568-571 (1989). https: / / doi.org / 10.1038 / 340568a0). Other basic leucine zippers include TF6, CREB1, C / EBPα, Fos, or Jun, the viral fusion proteins influenza hemagglutinin or HIV gp41, or other coiled coil domains APC or ProP. Compilations of known coiled-coil dimerization domains are provided at http: / / coiledcoils.chm.bris.ac.uk / ccplus / search / and http: / / www.chm.bris.ac.uk / org / woolfson / oli.html. These coiled coils are also described in Testa OD, Moutevelis E, and Woolfson DN, 2009, "CC+: a relational database of coiled-coil structure", Nucleic Acid Research, Vol. 37, Database issue, pp. D315-D322, and Moutevelis E and Woolfson, DN, 2009, "A periodic table of coiled-coil protein structures", Journal of Molecular Biology 385(3): pp. 726-732.

[0238] Leucine zippers may be synthetic or naturally occurring. Synthetic leucines can be designed to have much higher binding affinity than naturally occurring leucine zippers, but this is not necessarily an advantage. Indeed, preferred leucine zippers for use in the present disclosure are naturally occurring leucine zippers or leucine zippers with comparable binding affinity. The leucine zippers from c-jun and c-fos proteins are examples of leucine zippers with suitable binding affinity. Other suitable leucine zippers include those from myc and max proteins (B. Amati et al., Nature 359(6394), 423-6 (1992)). Other leucine zippers with suitable properties can be readily designed (EK O'Shea et al., Curr. Biol. 3, 658-667 (1993)). For example, those with acidic and basic amino acid moieties, such as glutamic acid and arginine.

[0239] The BTN2 / BTN3 complex of the disclosure preferably has an approximately 40 amino acid leucine zipper fusion corresponding to the heterodimerization domains from c-jun (a chain) and c-fos (p chain) (EK O'Shea et al., Science 245(4918), 646-8 (1989); EK O'Shea et al., Cell 68(4), 699-708 (1992); J. N Glover and SC Harrison Nature 373(6511), 257-61 (1995)).

[0240] Longer leucine zippers can also be used. Similar advantages may be obtained with shorter c-jun and c-fos fragments, since heterodimerization specificity appears to be retained even in very short fragments of some leucine zipper domains (EK O'Shea et al., Cell 68(4), 699-708 (1992)). Such shorter fragments may have, for example, as few as eight amino acids. Thus, leucine zipper domains may range in length from 8 to 60 amino acids.

[0241] The molecular basis of specificity in leucine zipper pairing has been well characterized (WH Landschulz et al., Science 240(4860), 175964 (1988)) and one skilled in the art can design and engineer leucine zippers to form homodimeric, heterodimeric or trimeric complexes (KJ Lumb and PS Kim, Biochemistry 34(27), 8642-8 (1995); S. Nautiyal et al., Biochemistry 34(37), 11645-51 (1995); JA Boice et al., Biochemistry 35(46), 14480-5 (1996); H. Chao et al., Biochemistry 35(37), 12175-85 (1996)). Higher affinity engineered leucine zippers or other heterodimerization domains than the c-jun and c-fos leucine zippers may be beneficial for expression of the BTN2-BTN3 complex in some systems. However, as mentioned in more detail below, when the BTN2-BTN3 complex undergoes folding in vitro, it is preferred that a solubilizing agent be included in the folding buffer to reduce the formation of non-productive protein aggregates.

[0242] One interpretation of this phenomenon is that the folding kinetics of the leucine zipper domain is faster than that of the BTN2 and BTN3 chains, leading to dimerization of the unfolded BTN2 and BTN3 chains and subsequent protein aggregation. By slowing the folding process and inhibiting aggregation by including a solubilizing agent, the protein can be kept in solution until folding of both fusion domains is complete. Thus, heterodimerization domains with higher affinity than the c-fos and c-jun leucine zippers may require higher concentrations of solubilizing agent to achieve yields of BTN2-BTN3 complexes comparable to those of c-jun and c-fos.

[0243] Various biological systems use different methods to form stable homo- and heterodimers of proteins, and each of these methods in principle offers the option to engineer dimerization domains into genetically engineered proteins. The leucine zipper (T. Kouzarides and E. Ziff, Nature 340(6234), 568-71 (1989)) is perhaps the best-known dimerization module and is widely used to generate genetically designed dimeric proteins. Therefore, the leucine zipper of GCN4, a transcriptional activator protein from the yeast Saccharomyces cerevisiae, has been used to direct the homodimerization of several heterologous proteins (JC Hu et al., Protein Sci. 2(7), 1072-84 (1993); NJ Greenfield et al., Biochemistry 37(21), 7834-43 (1998)). A preferred strategy is to use a zipper that directs the formation of a heterodimeric complex, such as the Jun / Fos leucine zipper pair (J. de Kruif and T. Logtenberg, J. Biol. Chem. 271(13), 7630-4 (1996); L. G Riley et al., Protein Eng. 9(2), 223-30 (1996) [erratum published in Protein Eng. 9(9), 831 (1996)]).

[0244] The heterodimerization domain of the BTN2 / BTN3 complex of the present disclosure is not limited to leucine zippers. It can therefore be provided by disulfide bridge forming elements. Alternatively, it can be provided by SH3 domains and hydrophobic / proline-rich counter domains that are responsible for protein-protein interactions found in proteins involved in signal transduction (reviewed by Schlessinger (J. Schlessinger, Curr. Opin. Genet. Dev. 4(1), pp. 25-30 (1994))). Other natural protein-protein interactions found in proteins involved in signal transduction cascades rely on the association of post-translationally modified amino acids with protein modules that specifically recognize such modified residues.

[0245] Such post-translationally modified amino acids and protein modules can form the heterodimerization domain of the BTN2-BTN31 complex of the present disclosure. An example of this type of protein pair is provided by a tyrosine phosphorylated receptor, such as the epidermal growth factor receptor or the platelet-derived growth factor receptor, and the SH2 domain of GRB2 (EJ Lowenstein et al., Cell 70(3), 431-42 (1992); L. Buday and J. Downward. Cell 73(3), 611-20 (1993)). Methods for engineering completely artificial modules have also been developed (ZA Zhang et al., Curr. Biol. 9(8), 417-20 (1999)).

[0246] The heterodimerization domain can be formed from portions of a nuclear receptor, an estrogen receptor, an androgen receptor, a glucocorticoid receptor, a basic helix-loop-helix MyoD or c-Myc, a helix-turn-helix LuxR, TetR, or cI, or a transmembrane region of an integrin α and β subunit, glycophorin A, a tyrosine kinase, or a transmembrane region of a GPCR; or a G protein βγ complex from a heterotrimeric G protein complex, TIM, ADH5, 14-3-3 protein, or their binding partners Bad or Bax; or any other protein dimer.

[0247] In some embodiments, the heterodimerization domain comprises an Fc domain of an antibody, e.g., of an antibody (e.g., of the IgG, IgA, IgD, and IgE subclasses (e.g., IgG1, IgG2, IgG3, and IgG4, and IgA1 and IgA2)) or variants thereof, e.g., to improve in vivo half-life.

[0248] In some embodiments, the heterodimerization domain uses a heterodimeric Fc variant (so-called "knob-into-hole (KiH)" Fc). A "knob" can be introduced into one CH3 domain (CH3A) by replacement of a small residue with a bulky residue (e.g., T366WCH3A in EU numbering). To accommodate the "knob", a complementary "hole" surface is created on the other CH3 domain (CH3B) by replacing the adjacent residues closest to the knob with smaller residues (e.g., T366S / L368A / Y407VCH3B). The "hole" mutations can be optimized by structure-guided phage library screening. Heterodimerization is thermodynamically favored by hydrophobic interactions driven by steric complementarity at the CH3 interdomain core interface, whereas the knob-knob and hole-hole interfaces do not favor homodimerization due to steric hindrance and disruption of favorable interactions, respectively. KiH Fc can be further engineered to improve purity and stability by introducing an additional CH3 interdomain disulfide bond pair, e.g., S354CCH3A-Y349CCH3B, to create a KiHS-S Fc variant. This can increase the yield of heterodimerization (about 95%) and improve the thermal melting (Tm) of the CH3 domain by 6°C to about 78°C.

[0249] Heterodimerization can also be formed by binding molecules such as antibodies or nanobodies that have affinity for the C-terminal portions of the first and second BTN2 and BTN3 polypeptide chains. Antibodies and nanobodies can form both homodimers and heterodimers depending on the specificity of the antigen-binding region. Preferably, bispecific binding molecules are used to form heterodimers. Alternatively, two antibodies with different specificities for the first or second polypeptide can be used and linked, for example, by a secondary antibody (M. Spaargaren et al., Antibody-induced dimerization activates the epidermal growth factor receptor tyrosine kinase, J. Biol. Chem. 266: 1733-9 (1991)).

[0250] Glutathione S-transferase (GST) can also be used to form dimers. GST can be added to the C-terminus of a protein to promote dimerization with other GST-tagged proteins (Y. Maru et al., The Dimerization Property of Glutathione S-Transferase Partially Reactivates Bcr-Abl Lacking the Oligomerization Domain, J. Biol. Chem. 271(26): 15353-15357 (1996)). However, GST-tagged polypeptides do not preferentially form heterodimers, but rather appear to form homodimers or heterodimers in a stochastic manner.

[0251] Rapamycin, which contains an FKBP-binding moiety and an FRB-binding moiety, can act as an intermediate for forming heterodimers. BTN and BTN3 polypeptides can be fused with FKBP and FRB to form fusion proteins that are subsequently dimerized by rapamycin (VM Rivera et al., A humanized system for pharmacologic control of gene expression. Nat. Med. 2: 1028-32 (1996)).

[0252] Gibberellins are a family of over 100 related plant hormones that bind to their cognate receptors. Once bound, the receptor changes conformation to allow interaction with a secondary receptor. Thus, to form a heterodimer, one subunit of the heteromeric complex is bound to the hormone receptor and the other subunit is bound to the secondary receptor. Gibberellin is then added to induce dimerization of the two subunits into a heterodimer (T. Miyamoto et al., Rapid and orthogonal logic gating with a gibberellin-induced dimerization system, Nat. Chem. Biol. 8: 465-470 (2012)). Similarly, the plant hormone abscisic acid can be used in a similar manner (KI Miyazono et al., Structural basis of abscisic acid signalling, Nature. 462: 609-14 (2009)).

[0253] FK506, which interacts with FKBR, can be fused to dexamethasone or cyclosporin-A to form a dimerization intermediate (PJ Belshaw et al., Controlling protein association and subcellular localization with a synthetic ligand that induces heterodimerization of proteins, Proc. Natl. Acad. Sci. USA 93: 4604-7 (1996)). In this context, and with FKBR fused to cyclosporin-A, one subunit in the heteromeric complex would contain a C-terminal FKBR as the dimerization peptide, while the other dimerization peptide would contain a C-terminal cyclophilin A. The two subunits are then exposed to FKBR-cyclosporin-A to form heterodimers. FKBR fused to dexamethasone can also be used in the same manner, but with the glucocorticoid receptor (which interacts with dexamethasone) as the dimerization peptide on the second subunit.

[0254] Semi-covalently induced chemical dimerization can be induced by combining the SNAP tag ligand O6-benzylguanine (BG) with methotrexate, which forms a covalent link with the SNAP tag-binding HAGT and a non-covalent interaction with the methotrexate-binding DHFR (S. Gendreizig et al., Induced protein dimerization in vivo through covalent labelling, J. Am. Chem. Soc. 125: 14970-14971 (2003)). The first subunit of the heteromeric complex is believed to contain HAGT and the second subunit contains DHFR. These two subunits are then dimerized by the inclusion of a SNAP tag. A modified version of the SNAP tag, the CLIP tag, has been engineered to react with benzylcytosine derivatives instead of BG and can be used in a manner equivalent to the NSAP tag to dimerize proteins (Erdmann et al., Labeling Strategies Matter for Super-Resolution Microscopy: A Comparison between HaloTags and SNAP-tags. Cell Chemical Biology (2019)).

[0255] An alternative approach to inducible dimerization is light-induced dimerization. These approaches include photoreactive chemical dimerization pRap, cRB-A, PhAP and MeNV-HaXS (AV Karginov et al., Light Regulation of Protein Dimerization and Kinase Activity in Living Cells Using Photocaged Rapamycin and Engineered FKBP. J. Am. Chem. Soc. 420-423 (2010); NT Umeda et al., A photocleavable rapamycin conjugate for spatiotemporal control of small GTPase activity. J. Am. Chem. Soc. 133:12-4 (2011); SJ Ahmed et al., Photocleavable dimerizer for the rapid reversal of molecular trap antagonists. J. Biol. Chem. 289: 4546-52 (2014); and D. Erhart et al., Chemical development of intracellular protein heterodimerizers. Chem. Biol. 20: 549-57 (2013). These light-induced dimerization molecules function by binding to a dimerization domain only after exposure to light of a specific wavelength. Subsequent interaction with the dimerization domain triggers a conformational change that allows coupling with a binding partner, thereby dimerizing any linked peptides.

[0256] Oligomerization of multiple polypeptides can also be achieved by crosslinking non-canonical amino acids (I. Coin, Application of non-canonical crosslinking amino acids to study protein-protein interactions in live cells, Curr. Op. in Chem. Biol. 46: 156-163 (2018)). Non-canonical amino acids bearing chemical groups not present in the 20 standard amino acids can be incorporated at the C-terminus of the first and second subunits of the heteromeric complex, for example, by techniques such as amber stop codon suppression. Chemical groups on the non-canonical amino acids, such as benzophenones, diazirines, and aromatic azides, can then be crosslinked by irradiation with light at specific wavelengths that result in C-terminal dimerization (JE Hoffmann, Bifunctional Non-Canonical Amino Acids: Combining Photo-Crosslinking with Click Chemistry. Biomolecules. 10: 578 (2020)).

[0257] Alternatively, "click chemistry" can be used to prepare dimerized polypeptides. A first and a second peptide can be synthesized with azidohexanoic acid on the C-terminus of one polypeptide and aza-dibenzocyclooctyne (DIBAC) on the C-terminus of the other polypeptide. These two polypeptides are then dimerized with azido-modified ubiquitin and ubiquitin with cyclooctyne (MD Witte et al., Preparation of unnatural N-to-N and C-to-C protein fusions, Proc. Nat. Acad. Sci. 109(30): 11993-11998 (2012)).

[0258] In some embodiments, the heteromeric complex comprises at least a trimer comprising at least a homodimer paired with a heteromeric monomer subunit, or two homodimers can pair to form a tetramer.

[0259] Foldon is an example of a trimerization domain that can be used in the present invention. Foldon consists of a 27 amino acid domain that constitutes the C-terminus of the fibritin protein from bacteriophage T4. This domain is the oligomerization domain of T4 fibritin and has been shown to oligomerize monomeric peptides into trimers (S. Guthe et al., Very fast folding and association of a trimerization domain from bacteriophage T4 fibritin, J. Mol. Biol., 337(4): 905-915 (2004)). Refolding of the BTN2 and BTN3 chains of the complex occurs in vitro under suitable refolding conditions. In a particular embodiment, recombinant BTN2 / BTN3 complexes with the correct conformation are achieved by refolding the solubilized BTN2 and BTN3 chains in a refolding buffer containing a solubilizing agent, such as urea. Advantageously, urea can be present at a concentration of at least 0.1 M, or at least 1 M, or at least 2.5 M, or about 5 M. An alternative solubilizing agent that can be used is guanidine at a concentration between 0.1 M and 8 M, preferably at least 1 M or at least 2.5 M. Prior to refolding, a reducing agent can be used to ensure complete reduction of cysteine ​​residues. Further denaturants, such as DTT and guanidine, may be used as necessary. Various denaturants and reducing agents (e.g. urea, β-mercaptoethanol) can also be used prior to the refolding step. Alternative redox couples, such as cystamine / cysteamine redox couples, DTT or β-mercaptoethanol / atmospheric oxygen, oxidized and reduced glutathione, and reduced and oxidized cysteine, can also be used during refolding.

[0260] nucleic acid The disclosure further provides nucleic acids encoding BTN or variants or fragments thereof, or BTN constructs, or BTN complexes, or single chain fusion polypeptides described herein, such as polynucleotides encoding the BTN2 (e.g., BTN2A1) or BTN3 (e.g., BTN3A1) chains, and BTN variants, constructs, and fragments thereof.

[0261] The term "polynucleotide" or "nucleic acid" as used herein includes sequences of polyribonucleotides and polydeoxyribonucleotides, such as modified or unmodified RNA or DNA, each in single-stranded and / or double-stranded form, linear or circular, or mixtures thereof, including hybrid molecules. Thus, nucleic acids according to the present disclosure include DNA (dsDNA, ssDNA, cDNA, etc.), RNA (dsRNA, ssRNA, mRNA, VfRNA, etc.), combinations thereof, or derivatives thereof (such as PNA).

[0262] The polynucleotides may contain traditional phosphodiester bonds or non-traditional bonds (e.g., amide bonds as found in peptide nucleic acids (PNAs)). The polynucleotides of the disclosure may also contain one or more modified bases, e.g., tritylated bases and unusual bases such as inosine. Other modifications, including chemical, enzymatic, or metabolic modifications, are contemplated, so long as the binding molecules of the invention can be expressed from the polynucleotide. The polynucleotides may be provided in an isolated form as defined elsewhere herein. The polynucleotides may contain regulatory sequences, such as transcriptional control elements (including promoters, enhancers, operators, repressors, and transcription termination signals), ribosomal binding sites, introns, and the like.

[0263] In particular, the present invention provides polynucleotides comprising or consisting of a nucleic acid that is at least about 70%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% identical to a reference polynucleotide sequence selected from the group consisting of SEQ ID NOs: 5-8, or 19-28, or 31, 32, 35, 36, 39, 40, 47, 48, 98, or 99.

[0264] The above polynucleotides may or may not contain additional or altered nucleotide sequences encoding, for example, altered amino acid residues, a signal peptide directing secretion of the encoded BTN, a constant region, or other heterologous polypeptides described herein. Thus, such polynucleotides can encode fusion polypeptides, fragments, variants, and other derivatives of the binding molecules described herein.

[0265] The invention also includes compositions comprising one or more of the above polynucleotides. Also provided herein are compositions comprising a first polynucleotide and a second polynucleotide, wherein the first polynucleotide encodes a BTN2 chain (e.g., a BTN2A1 chain) and the second polynucleotide encodes a BTN3 chain (e.g., a BTN3A1 chain).

[0266] The nucleic acid sequence of the present invention can be codon-optimized for optimal expression in desired host cells, such as human dendritic cells, macrophages, Langerhans cells or B cells, or for expression in bacterial cells, yeast cells or insect cells, which are particularly envisaged for the expression of the soluble BTN of the present invention. Codon optimization refers to the replacement of codons in a sequence of interest that are generally rare in highly expressed genes of a given species with codons that are generally frequent in highly expressed genes of such species, and such codons code for the same amino acid as the replaced codon. Thus, the selection of optimal codons depends on the codon usage frequency of the host genome, as well as the presence of several desirable and undesirable sequence motifs.

[0267] vector Further provided herein is a vector comprising one or more of the polynucleotides described herein. A "vector" is a nucleic acid molecule used as a vehicle to transfer (foreign) genetic material into a host cell, e.g., where it can be replicated and / or expressed.

[0268] The term "vector" encompasses, but is not limited to, plasmids, viral vectors (including retroviral vectors, lentiviral vectors, adenoviral vectors, vaccinia viral vectors, polyoma viral vectors, and adeno-associated viral vectors (AAV)), phages, phagemids, cosmids, and artificial chromosomes (including BACs and YACs). A vector is generally itself a nucleotide sequence, typically a DNA sequence that contains an insert (transgene) and a longer sequence that serves as the "backbone" of the vector.

[0269] Engineered vectors typically contain an origin for autonomous replication in a host cell (if stable expression of the polynucleotide is desired), a selectable marker, and a restriction enzyme cleavage site (e.g., a multiple cloning site, MCS).

[0270] The vector may further comprise a promoter, a genetic marker, a reporter gene, a targeting sequence, and / or a protein purification tag. Suitable vectors are known to those of skill in the art and many are commercially available.

[0271] Targeting vectors can be used to integrate polynucleotides into host cell chromosomes by methods known in the art. Briefly, suitable means include homologous recombination or the use of hybrid recombinases that specifically target the sequence of the integration site. Targeting vectors are typically circular and are linearized before being used for homologous recombination. As an alternative, the foreign polynucleotides can be DNA fragments linked by fusion or synthetically constructed DNA fragments that are then recombined into host cells. It is also possible to use non-homologous recombination, which results in random or non-targeted integration.

[0272] The vector of the present disclosure can also be an expression vector. An "expression vector" or "expression construct" can be used to transcribe heterologous polynucleotide sequences, such as those encoding the TCR of the present disclosure, in a suitable host cell, and translate their mRNA. This process is also referred to herein as "expressing" the TCR of the present disclosure. In addition to an origin of replication, a selection marker, and a restriction enzyme cleavage site, an expression vector typically contains one or more control sequences operably linked to the heterologous polynucleotide to be expressed.

[0273] The term "control sequences" refers to nucleic acid sequences necessary for the expression of an operably linked coding sequence of a (heterologous) polynucleotide in a particular host organism or host cell, and thus includes transcriptional and translational control sequences. Typically, control sequences necessary for the expression of a heterologous polynucleotide sequence in prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site. In eukaryotes, a promoter, a polyadenylation signal, an enhancer, and optionally a splice signal are typically required. In addition, specific initiation and secretion signals can also be introduced into the vector to allow the secretion of the desired polypeptide into the culture medium.

[0274] A nucleic acid is "operably linked" when it is placed in a functional relationship with another nucleic acid sequence, particularly on the same polynucleotide molecule. For example, a promoter is operably linked to a coding sequence of a heterologous gene when it is capable of affecting the expression of the coding sequence of the heterologous gene. A promoter is typically placed upstream of a gene encoding a polypeptide of interest to regulate the expression of said gene.

[0275] Exemplary control sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and / or enhancers derived from cytomegalovirus (CMV) (such as the CMV promoter / enhancer), promoters and / or enhancers derived from simian virus 40 (SV40) (such as the SV40 promoter / enhancer), promoters and / or enhancers derived from adenovirus (e.g., the adenovirus major late promoter (AdMLP)), and promoters and / or enhancers derived from polyoma. Expression vectors can also include an origin of replication and a selectable marker.

[0276] Suitable selection markers for use in eukaryotic host cells include, but are not limited to, herpes simplex virus thymidine kinase (tk) gene, hypoxanthine-guanine phosphoribosyltransferase (hgprt) gene, and adenine phosphoribosyltransferase (aprt) gene. Other genes include dhfr (methotrexate resistance), gpt (mycophenolic acid resistance), neo (G-418 resistance), and hygro (hygromycin resistance). Vector amplification can be used to increase expression levels. In general, the selection marker gene can be either directly linked to the polynucleotide sequence to be expressed, or introduced into the same host cell by co-transformation.

[0277] Thus, in view of the above, the present disclosure further provides for one or more of the nucleotide sequences described herein to be inserted into (i.e., contained in) a vector. Specifically, the present invention provides a (replicable) vector comprising a nucleotide sequence encoding BTN or a variant or fragment thereof, or a BTN construct, or a BTN complex, or a single-chain fusion polypeptide, or a BTN2 (e.g., BTN2A1) or BTN3 chain (e.g., BTN3A1) thereof, of the present disclosure, operably linked to a promoter.

[0278] A person skilled in the art will be able to easily select a suitable expression vector based on, for example, the host cell in which BTN expression is intended. Examples of suitable expression vectors are viral vectors such as retroviral vectors, e.g., MP71 vectors or retroviral SIN vectors, and lentiviral vectors or lentiviral SIN vectors. A viral vector containing a polynucleotide encoding BTN of the present disclosure can, for example, infect lymphocytes, which will then express the heterologous TCR. Another example of a suitable expression vector is the Sleeping Beauty (SB) transposon transposase DNA plasmid system, SB DNA plasmid. The nucleic acids and / or particularly the expression constructs of the present disclosure can also be transferred into cells by transient RNA transfection. For example, a viral vector can link the BTN2 and BTN3 chain genes in one vector with either an internal ribosome entry site (IRES) sequence or a self-cleaving peptide (e.g., the 2A peptide sequence from the porcine teschovirus) to provide expression of a single messenger RNA (mRNA) molecule under the control of a viral promoter in the transduced cell.

[0279] host cell The disclosure further provides a host cell comprising a TCR, nucleic acid or vector described herein.

[0280] A variety of host cells can be used in accordance with the present disclosure. As used herein, the term "host cell" encompasses a cell that can be or has been a recipient of a polynucleotide or vector described herein and / or that expresses (and optionally secretes) BTN or a variant or fragment thereof, or a BTN construct, or a BTN complex, or a single-chain fusion polypeptide of the present disclosure.

[0281] The terms "cell" and "cell culture" are used interchangeably to denote the source of BTN, unless expressly specified otherwise. The term "host cell" also includes "host cell line."

[0282] In general, the term "host cell" includes prokaryotic or eukaryotic cells, including, but not limited to, bacteria, yeast cells, fungal cells, plant cells, and animal cells, such as insect cells and mammalian cells, e.g., mouse cells, rat cells, macaque cells, or human cells.

[0283] Thus, in view of the above, the present disclosure provides, inter alia, a host cell comprising a polynucleotide or vector, e.g., an expression vector comprising a nucleotide sequence encoding BTN or a variant or fragment thereof, or a BTN construct, or a BTN single-chain fusion polypeptide, as described herein.

[0284] The polynucleotides and / or vectors of the disclosure can be introduced into a host cell by, for example, transfection, transformation, etc. using conventional methods known in the art.

[0285] "Transfection" is the process of deliberately introducing a nucleic acid molecule or polynucleotide (including a vector) into a target cell. One example is RNA transfection, the process of introducing RNA (such as in vitro transcribed RNA, ivtRNA) into a host cell. The term is primarily used for non-viral methods in eukaryotic cells.

[0286] The term "transduction" is often used to describe viral-mediated transfer of a nucleic acid molecule or polynucleotide.

[0287] Transfection of animal cells typically involves opening temporary pores or "holes" in the cell membrane to allow uptake of the substance. Transfection can be performed using calcium phosphate, by electroporation, by cell squeezing, or by mixing cationic lipids with the substance to generate liposomes that fuse with the cell membrane and release their cargo internally. Exemplary techniques for transfection of eukaryotic host cells include lipid vesicle-mediated uptake, heat shock-mediated uptake, calcium phosphate-mediated transfection (calcium phosphate / DNA co-precipitation), microinjection, and electroporation.

[0288] The term "transformation" is used to describe the non-viral transfer of nucleic acid molecules or polynucleotides (including vectors) into bacteria and into non-animal eukaryotic cells, including plant cells. Transformation is therefore the genetic alteration of a bacterial cell or a non-animal eukaryotic cell, which occurs by the direct uptake and subsequent incorporation of exogenous genetic material (nucleic acid molecules) from its surroundings through the cell membrane.

[0289] Transformation can occur by artificial means. For transformation to occur, cells or bacteria must be in a state of transformation receptivity, which can occur as a time-limited response to environmental conditions such as starvation or cell density. For prokaryotic transformation, techniques can include heat shock-mediated uptake, bacterial protoplast fusion with intact cells, microinjection and electroporation. Techniques for plant transformation include Agrobacterium-mediated transfer, e.g., with A. tumefaciens, high-velocity bombardment of tungsten or gold particles, electroporation, microinjection and polyethylene glycol-mediated uptake.

[0290] Accordingly, in view of the above, the present disclosure further provides a host cell comprising at least one polynucleotide sequence and / or vector as described herein.

[0291] For expression of the BTN or variants or fragments thereof, or BTN constructs, or BTN complexes, or single-chain fusion polypeptides of the present disclosure, a host cell can be selected that modulates the expression of the inserted polynucleotide sequence and / or modifies and processes the gene product (i.e., RNA and / or protein) as desired. Such modification (e.g., glycosylation) and processing (e.g., cleavage) of the gene product can be important for the function of the TCR. Different host cells have characteristic and specific mechanisms for post-translational processing and modification of gene products. To ensure correct modification and processing of the product, a suitable cell line or host system can be selected. For this purpose, eukaryotic host cells can be used that possess the cellular machinery for proper processing of the primary transcript, glycosylation and phosphorylation of the gene product.

[0292] It is contemplated herein to provide (a) a host cell ("production host cell") for expressing and obtaining the BTN or variant or fragment thereof, or the BTN construct, or the BTN complex, or the single-chain fusion polypeptide of the present disclosure, particularly in soluble form, and (b) a host cell with effector function ("effector host cell") that expresses the BTN or variant or fragment thereof, or the BTN construct, or the BTN complex, or the single-chain fusion polypeptide of the present disclosure. Such "effector host cells" are particularly useful for therapeutic applications and are contemplated for administration to a subject in need thereof. Preferred "effector host cells" include antigen-presenting cells, such as dendritic cells, macrophages, Langerhans cells, and B cells.

[0293] Production host cells A "production host cell" used to express a soluble BTN or variant or fragment thereof, a BTN construct, or a BTN complex, or a BTN single-chain fusion polypeptide of the present disclosure is preferably capable of expressing large amounts of recombinant protein.

[0294] Exemplary mammalian host cells that can be used as "production host cells" include Chinese hamster ovary (CHO cells), including DHFR minus CHO cells such as DG44 and DUXBI 1, NSO cells, COS cells (a derivative of CVI with SV40 T antigen), HEK293 (human kidney) cells, Expi293 cells, and SP2 (mouse myeloma) cells. Other exemplary host cell lines include, but are not limited to, HELA (human cervical carcinoma), CVI (monkey kidney line), VERY, BHK (baby hamster kidney), MDCK, 293, WI38, R1610 (Chinese hamster fibroblast), BALBC / 3T3 (mouse fibroblast), HAK (hamster kidney line), P3x63-Ag3.653 (mouse myeloma), BFA-IcIBPT (bovine endothelial cells), and RAJI (human lymphocytes). Host cell lines are typically available from commercial services, the American Tissue Culture Collection (ATCC), or from published literature.

[0295] Non-mammalian cells such as bacteria, yeast, insect or plant cells are also readily available and can be used as "production host cells" as described above. Exemplary bacterial host cells include Enterobacteriaceae such as Escherichia coli, Salmonella, Bacillaceae such as Bacillus subtilis, Pneumococcus, Streptococcus, and Haemophilus influenza. Other host cells include yeast cells such as Saccharomyces cerevisiae and Pichia pastoris. Insect cells include, but are not limited to, Spodoptera frugiperda cells. In accordance with the foregoing, possible expression systems (i.e. host cells comprising an expression vector as described above) include microorganisms such as bacteria (e.g. E. coli, B. subtilis) transformed with recombinant bacteriophage, plasmid or cosmid DNA expression vectors, yeast (e.g. Saccharomyces, Pichia) transformed with recombinant yeast expression vectors, insect cell lines infected with recombinant viral expression vectors (e.g. Baculovirus), plant cell lines infected with recombinant viral expression vectors (e.g. Cauliflower Mosaic Virus, CaMV, Tobacco Mosaic Virus, TMV) or transformed with recombinant plasmid expression vectors (e.g. Ti plasmid). Mammalian expression systems, having recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., the metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter, the vaccinia virus 7.5K promoter, the cytomegalovirus (CMV) major immediate early promoter (MIEP) promoter), are often preferred.Suitable mammalian host cells can be selected from known cell lines (eg, COS, CHO, BLK, 293, 3T3 cells), although it is also contemplated that dendritic cells, macrophages, Langerhans cells and B cells may be used.

[0296] In accordance with the foregoing, the present disclosure also provides a method for producing and obtaining BTN or a variant or fragment thereof, or a BTN construct, or a BTN complex, or a single-chain fusion polypeptide as described herein, comprising (i) culturing a host cell (i.e., a production host cell) under conditions that cause expression of said BTN or a variant or fragment thereof, or a BTN construct, or a BTN complex, or a single-chain fusion polypeptide, and (ii) purifying said BTN or a variant or fragment thereof, or a BTN construct, or a BTN complex, or a single-chain fusion polypeptide. In some embodiments, the method also comprises refolding two or more BTNs to form a complex, e.g., refolding BTN2 with a C-terminal dimerization peptide and BTN3 with a C-terminal dimerization peptide to provide a BTN2 / BTN3 heterodimeric complex.

[0297] Any purification method known in the art can be used, for example, by chromatography (e.g., ion exchange chromatography (e.g., hydroxyapatite chromatography), affinity chromatography, particularly protein A, protein G or lectin affinity chromatography, size exclusion column chromatography), centrifugation, differential solubility, hydrophobic interaction chromatography, or any other standard technique for the purification of proteins. One skilled in the art can readily select a suitable purification method based on the individual characteristics of the BTN or variant or fragment thereof, or BTN construct, or BTN complex, or single-chain fusion polypeptide to be recovered.

[0298] Effector host cells The present disclosure also provides an "effector host cell" comprising a nucleotide sequence, vector, or BTN or BTN complex of the present disclosure. It is envisioned that the effector host cell has been modified using conventional methods to include a nucleic acid sequence encoding the BTN or variant or fragment thereof, or a BTN construct, or a BTN complex, or a single-chain fusion polypeptide of the present disclosure, and expresses the BTN or BTN complex described herein, particularly on the cell surface. For the purposes of the present disclosure, an "modified host cell expressing a BTN or BTN complex of the present disclosure" generally refers to a host cell that has been engineered or modified (target or production) to express a BTN or BTN complex according to the present disclosure, for example, by RNA transfection of a nucleic acid or vector of the present disclosure. Other methods of modification or transfection or transduction, as described elsewhere herein, are also envisioned. Thus, the term "modified host cell" includes "transfected," "transduced," and "engineered" host cells that preferably express a BTN or BTN complex of the present disclosure.

[0299] Preferably, such host cells (especially "modified antigen-presenting cells") are capable of mediating T cell effector functions upon binding of BTNs to T cells. Such T cell effector functions include, for example, release of perforin (which creates holes in the target cell membrane), release of granzymes (proteases that act intracellularly to induce apoptosis), expression of Fas ligand (which activates apoptosis in Fas-bearing target cells), and release of cytokines, preferably Th1 / Tc1 cytokines such as IFN-γ, IL-2, and TNF-α. Cytolysis of target cells can be assessed, for example, using a CTL fluorescent killing assay that detects the disappearance of fluorescently labeled target cells during co-culture with T cells.

[0300] Effector host cells, particularly antigen-presenting cells, such as dendritic cells, macrophages, Langerhans cells and B cells, can be autologous host cells obtained from the subject to be treated and transformed or transduced to express the BTN or BTN complex of the present disclosure. Typically, recombinant expression of the BTN or BTN complex is achieved by using a viral vector. Techniques for obtaining and isolating cells from patients are known in the art.

[0301] It is particularly envisaged that the effector host cells provided herein are for therapeutic use.Further genetic modification of the host cells may be desirable to improve therapeutic efficacy, for example, when using autologous dendritic cells, macrophages, Langerhans cells and B cells as "effector host cells", suitable further modifications include downregulation of endogenous BTN expression and / or amplification of other BTN molecules, costimulatory molecules such as ApoAI, RhoB, ABCA1 and / or periplakin.Means and methods for achieving the aforementioned genetic modifications are described in the art. Methods for targeted genomic engineering of host cells are known in the art and include, in addition to gene knockdown by siRNA, the use of so-called "programmable nucleases", including, for example, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided engineered nucleases (RGENs) derived from the bacterial clustered regularly interspaced short repeats palindromic repeat (CRISPR)-Cas (CRISPR-associated) system. For example, programmable nucleases such as TALENs can be used to cleave DNA regions encoding "undesirable" proteins such as endogenous BTN2 or BTN3, thereby reducing their expression. When dendritic cells, macrophages, Langerhans cells and B cells are used as (effector) host cells, downregulation of endogenous BTN has the advantage of reducing undesirable "mis-pairing" of endogenous and exogenous BTN chains.

[0302] Soluble BTN and the BTN2 / BTN3 complex In one example, the modified BTN or BTN complex of the present disclosure is a soluble BTN or BTN complex.

[0303] Soluble BTN complexes useful in the present disclosure are typically heterodimers comprising a BTN2 chain (e.g., BTN2A1) and a BTN3 chain (e.g., BTN3A1 chain), although multimers (e.g., tetramers) comprising two different heterodimers or two identical heterodimers are also contemplated for use in the present disclosure.

[0304] The soluble BTN or BTN complex of the disclosure can be provided in a substantially pure form or as a purified or isolated preparation, e.g., it can be provided in a form that is substantially free of other proteins.

[0305] A plurality of soluble BTNs or BTN complexes of the present disclosure may be provided in the form of a multivalent complex. Thus, in one aspect, the present disclosure provides a multivalent BTN complex comprising a plurality of soluble BTNs as described herein.

[0306] In its simplest form, a multivalent BTN complex according to the invention comprises a multimer of two or three or four or more BTNs associated with each other (e.g., covalently or otherwise linked), preferably via a linker molecule. Suitable linker molecules include, but are not limited to, multivalent adhesion molecules such as avidin, streptavidin, neutravidin and extravidin, each of which has four binding sites for biotin. Thus, biotinylated BTN molecules can be formed as multimers of BTNs with multiple BTN binding sites. The number of BTN molecules in a multimer depends on the amount of BTN relative to the amount of linker molecules used to make the multimer, and also on the presence or absence of any other biotinylated molecules. Preferred multimers are dimeric, trimeric or tetrameric BTN complexes.

[0307] BTNs can be complexed into structures for use. Suitable structures for forming complexes with one or more TCRs include membrane structures such as liposomes, and solid structures, preferably particles such as beads, e.g., latex beads. Other structures that can be externally coated with BTNs are also suitable. Preferably, the structures are coated with BTN multimers rather than individual BTNs.

[0308] In the case of liposomes, BTN or its multimers may be membrane bound or otherwise associated with the membrane, techniques for this being well known to those skilled in the art.

[0309] A label or another moiety, such as a toxic or therapeutic moiety, may be included in the multivalent BTN complex of the present disclosure. For example, the label or other moiety may be included in a mixed molecule multimer. Such a mixed molecule may include any combination of molecules, so long as steric hindrance does not impair or significantly impair the desired function of the molecule. The configuration of the binding sites on the streptavidin molecule is suitable for a mixed tetramer, as steric hindrance is unlikely to occur.

[0310] In particular, soluble BTN or multivalent BTN complexes are + It can be used to activate cells expressing a TCR (e.g., γδ T cells), which may be useful in many situations, particularly to activate γδ Tc ex vivo prior to administration to a patient, for example to prevent, treat, delay the progression of, prevent the recurrence of, or alleviate the symptoms of, cancer or an infectious disease.

[0311] Soluble BTN and BTN complexes of the present disclosure can be produced by any suitable method known to those of skill in the art, and are most typically produced recombinantly. According to the present disclosure, recombinant nucleic acid molecules useful for producing soluble BTN or BTN single-chain fusion proteins typically include a recombinant vector and a nucleic acid sequence encoding one or more BTNs.

[0312] According to the present disclosure, a recombinant vector is an engineered (i.e., artificially created) nucleic acid molecule used as a tool for manipulating a selected nucleic acid sequence and / or for introducing such a nucleic acid sequence into a host cell. Thus, a recombinant vector is suitable for use in cloning, sequencing, and / or otherwise manipulating a selected nucleic acid sequence, such as by expressing the selected nucleic acid sequence and / or delivering it into a host cell to form a recombinant cell. Such vectors typically contain heterologous nucleic acid sequences, i.e., nucleic acid sequences that are not naturally found adjacent to the nucleic acid sequence being cloned or delivered, but vectors may also contain regulatory nucleic acid sequences (e.g., promoters, untranslated regions) that are naturally found adjacent to the nucleic acid sequence encoding the protein of interest or that are useful for expression of the nucleic acid molecule. Vectors can be either RNA or DNA, either prokaryotic or eukaryotic, and are typically plasmids.

[0313] Typically, a recombinant nucleic acid molecule comprises at least one nucleic acid molecule of the invention operably linked to one or more transcription control sequences. As used herein, the phrase "recombinant molecule" or "recombinant nucleic acid molecule" refers primarily to a nucleic acid molecule or nucleic acid sequence operably linked to a transcription control sequence, but may be used interchangeably with the phrase "nucleic acid molecule" when such a nucleic acid molecule is a recombinant molecule as discussed herein. According to the present disclosure, the phrase "operably linked" refers to linking a nucleic acid molecule to a transcription control sequence in such a manner that the molecule can be expressed when transfected (i.e., transformed, transduced, transfected, conjugated, or conduced) into a host cell. Transcription control sequences are sequences that control the initiation, elongation, or termination of transcription. Particularly important transcription control sequences are those that control transcription initiation, such as promoter, enhancer, operator, and repressor sequences. Suitable transcription control sequences include any transcription control sequence that can function in a host cell or organism into which a recombinant nucleic acid molecule is introduced.

[0314] One or more recombinant molecules of the invention can be used to produce the encoded product (e.g., soluble BTN2 / BTN3 complex) of the present disclosure. In one embodiment, the encoded product is produced by expressing a nucleic acid molecule described herein under conditions effective to produce the protein. One preferred method for producing the encoded protein is by transfecting a host cell with one or more recombinant molecules to form a recombinant cell. Suitable host cells for transfection include, but are not limited to, any bacterial cell, fungal (e.g., yeast), insect cell, plant cell, or animal cell that can be transfected. The host cell can be either an untransfected cell or a cell that has already been transfected with at least one other recombinant nucleic acid molecule. The resulting protein of the invention can either remain within the recombinant cell, be secreted into the medium, be secreted into the space between two cell membranes, or be retained on the outer surface of the cell membrane. The phrase "recovering the protein" refers to recovering the entire medium containing the protein and does not necessarily imply further steps of separation or purification. Proteins produced according to the present disclosure can be purified using a variety of standard protein purification techniques, including, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing, and differential solubilization. Proteins produced according to the present disclosure are preferably recovered in "substantially pure" form. As used herein, "substantially pure" refers to a purity that allows for the effective use of soluble BTN or BTN complexes in the compositions and methods of the present disclosure.

[0315] By way of example, recombinant constructs containing the relevant BTN2 and BTN3 genes (e.g., nucleic acid sequences encoding the desired portions of the BTN2 and BTN3 chains of the BTN2 / BTN3 complex) can be synthesized de novo or produced by PCR of BTN cDNA from a cellular source, such as an antigen-presenting cell, that expresses the desired BTN. PCR amplification of the desired BTN2 and BTN3 genes can be designed to remove the transmembrane and cytoplasmic domains of the chains (i.e., creating a soluble complex). In addition, if desired, sequences encoding selectable markers for purification or labeling of the product or construct can be added to the construct. The amplified BTN2 and BTN3 cDNA pairs are then cloned, sequence verified, and introduced into a suitable vector.

[0316] The soluble BTN2 / BTN3 DNA construct is then co-transfected into a suitable host cell (e.g., a suitable insect host cell in the case of a baculovirus vector, or a suitable mammalian host cell in the case of a mammalian expression vector) that expresses and secretes the recombinant receptor into the supernatant. The culture supernatant containing the soluble BTN2 / BTN3 can then be purified using various affinity columns, such as a nickel nitrilotriacetic acid affinity column. The product can be concentrated and stored. It will be apparent to one of skill in the art that other methods and protocols can be used to produce soluble BTN or BTN complexes for use in the present disclosure, and such methods are expressly contemplated for use herein.

[0317] In one example, the BTN complex of the present disclosure is a single-chain fusion polypeptide.

[0318] Single-chain fusion polypeptides useful in this disclosure are typically heterodimers comprising a BTN2 chain (e.g., BTN2A1) fused to a BTN3 chain (e.g., BTN3A1 chain). In some embodiments, the BTN2 and BTN3 chains are separated by a peptide linker.

[0319] Linkers useful in the fusion polypeptides of the present disclosure serve to connect the BTN chains and can also maintain cooperative inter-domain interactions or retain biological activity.

[0320] The linker may be about 25-275 amino acid residues in length. The linker may be about 50-250 amino acids in length, about 75-225 amino acids in length, about 100-200 amino acids in length, about 125-175 amino acids in length, about 25-100 amino acids in length, about 50-150 amino acids in length, about 150-250 amino acids in length, or about 5-25 amino acids in length. In some embodiments, the linker is a polypeptide having a sequence about 5 amino acids in length, about 10 amino acids in length, about 15 amino acids in length, about 20 amino acids in length, or about 25 amino acids in length.

[0321] In some embodiments, the linker comprises (e.g., at least about 50% of the amino acids are) polar, uncharged, or charged residues, such as one or more of threonine (Thr), serine (Ser), proline (Pro), glycine (Gly), aspartic acid (Asp), lysine (Lys), glutamine (Gln), asparagine (Asn), and alanine (Ala), or one or more of Pro, arginine (Arg), phenylalanine (Phe), threonine (Thr), glutamic acid (Glu), and glutamine (Gln).

[0322] In some embodiments, the linker comprises proline (Pro), threonine (Thr), and / or glutamine (Gln) residues, for example, about 50% of the amino acids are composed of proline (Pro), threonine (Thr), and / or glutamine (Gln) residues. Among them, Pro is a unique amino acid with a cyclic side chain that gives rise to a very restricted conformation. The absence of amide hydrogen on Pro prevents the formation of hydrogen bonds with other amino acids, thus reducing the interaction between the linker and the protein domain. As a result, the inclusion of Pro residues may increase the rigidity and structural independence of the linker. Small polar amino acids such as Thr, or Ser and Gly, can provide good flexibility due to their small size, and also help maintain the stability of the linker structure in aqueous solvents through the formation of hydrogen bonds with water.

[0323] In some embodiments, the linker adopts a helix, a beta strand, or a coil / bend secondary structure. The linker may be helical or non-helical. The linker may form an α-helix. Some α-helical conformations are formed quickly during folding, allowing the correct folding of the connected protein domains without non-native interactions with the linker. The linker in an α-helical structure may also function as a rigid spacer to effectively separate the protein domains and reduce their unfavorable interactions. On the other hand, in the absence of an inherent rigid structure, the non-helical linker may be Pro-rich, which may increase the rigidity of the linker. Thus, the non-helical linker with a Pro-rich sequence may exhibit a relatively rigid structure and may help reduce inter-domain interference.

[0324] In some embodiments, flexible linkers are used. Flexible linkers are usually applied when the linked domains require some degree of movement or interaction. They are generally composed of small non-polar amino acids (e.g., Gly) or polar amino acids (e.g., Ser or Thr). The small size of these amino acids provides flexibility and allows the mobility of the connecting functional domains. The incorporation of Ser or Thr can maintain the stability of the linker in aqueous solution by forming hydrogen bonds with water molecules, thus reducing unfavorable interactions between the linker and the protein moiety.

[0325] The most commonly used flexible linkers have a sequence consisting mainly of a chain of Gly and Ser residues ("GS" linker). An example of the most widely used flexible linker has the sequence (Gly-Gly-Gly-Gly-Ser)n. By adjusting the copy number "n", the length of this GS linker can be optimized to achieve proper separation of functional domains or maintain the necessary inter-domain interactions. In addition to the GS linker, many other flexible linkers have been designed for recombinant fusion proteins. These flexible linkers are also rich in small or polar amino acids such as Gly and Ser, but may contain additional amino acids such as Thr and Ala to maintain flexibility, and polar amino acids such as Lys and Glu to improve solubility.

[0326] In some embodiments, rigid linkers can also be used, for example, to provide a fixed distance between domains and maintain their independent functions. For example, alpha-helix-forming linkers with the sequence (EAAAK)n have been applied in the construction of many recombinant fusion proteins. Another type of rigid linker useful in the single-chain fusion polypeptide of the present disclosure has a Pro-rich sequence, (XP)n, where X represents any amino acid, preferably Ala, Lys, or Glu.

[0327] In some embodiments, the linkers are stable peptide sequences that covalently link the functional domains together, allowing them to act as one molecule.

[0328] In other embodiments, the linker may be cleavable. Such linkers may be cleaved under certain conditions, such as in the presence of reducing agents or proteases. This type of linker may reduce steric hindrance, improve biological activity, or achieve independent action / metabolism of the individual domains of the recombinant fusion protein after linker cleavage.

[0329] Suitable linkers can be designed by computational methods and computational graphics.

[0330] The single-chain fusion polypeptide may further comprise an N-terminal signal peptide domain allowing processing in a suitable host cell, e.g. extracellular secretion. Preferably, the N-terminal signal peptide domain comprises a protease cleavage site, e.g. a signal peptidase cleavage site, and can therefore be removed after or during expression to obtain the mature protein. Furthermore, the fusion protein may further comprise a C-terminal element having a length of e.g. 1-50, preferably 10-30 amino acids, which may comprise or be connected to a recognition / purification domain, e.g. a FLAG domain, a Strep-tag or a Strep-tagII domain and / or a poly-His domain.

[0331] Furthermore, the fusion polypeptide may further comprise additional domains at the N-terminus and / or C-terminus, for example targeting domains such as single chain antibody or antibody fragment domains. Suitable examples of other targeting molecules are cytokines such as interleukins.

[0332] A functional measure of γδ T cell immune responses This disclosure relates to δ2 + TCR (e.g., Vγ9Vδ2 +The present invention relates to modified BTNs or BTN complexes capable of activating T cells expressing a TCR (T cell receptor) to enhance cytolytic function, cytokine production of one or more cytokines, and / or proliferation of said T cells. In some embodiments, the T cells are γδ T cells, e.g., Vδ1+ or Vδ2+ T cells. In other embodiments, the T cells are αβ T cells, e.g., CD4+ or CD8+ T cells. The number and function of T cells can be monitored by assays that detect T cells by activities such as cytokine production, proliferation, or cytotoxicity. Such activities can correlate with clinical outcomes. For example, activation of cytolytic activity can result in lysis of tumor targets or infected cells. Activation and increased cytokine production can lead to cytokine-induced cell death of tumors or other targets.

[0333] Enhancement of the cytolytic function of T cells refers to an increase in the cytotoxicity of T cells, i.e., an increase in the specific lysis of target cells by T cells. The cytolytic function of T cells can be measured, for example, by a direct cytotoxicity assay. A cytotoxicity assay typically involves subjecting a sample containing effector cells to 51 This involves mixing the cells with Cr or Europium-loaded targets (e.g., K562 cells) and measuring the release of Cr or Europium after lysis of the target cells. Surrogate targets, such as tumor cell lines, are often used. The targets can be loaded with antigens, e.g., pAg. The percentage of lysis of the target after about 4 hours of incubation is calculated by comparing it to the maximum achievable lysis of the target. Cytotoxicity assays can be used to monitor the activity of passively delivered effector cells and active immunotherapy approaches.

[0334] Activation of cytokine production of one or more cytokines by T cells refers to an increase in total cytokine production of one or more particular cytokines (e.g., IFN-γ, TNF-α, GM-CSF, IL-2, IL-6, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, or IL-17A) by γδ T cells. Cytokine secretion by T cells can be detected by measuring either bulk cytokine production (by ELISA), bead-based assays (e.g., Luminex), or enumeration of individual cytokine-producing T cells (by ELISPOT assay).

[0335] In an ELISA assay, effector cells are incubated with or without target cells, and after a given time, supernatants from the cultures are harvested and added to microtiter plates coated with antibodies against cytokines of interest. Antibodies linked to detectable labels or reporter molecules are added, the plates are washed and read. Typically, a single cytokine is measured in each well, although up to 15 cytokines can be measured in a single sample. Antibodies against cytokines of interest can be covalently attached to microspheres that carry a uniform and unique ratio of fluorescent dyes. Detection antibodies conjugated to fluorescent reporter dyes are then added, and flow cytometry is performed. By gating on the specific fluorescence indicative of a particular cytokine of interest, it is possible to quantify the amount of cytokine that is proportional to the amount of reporter fluorescence.

[0336] In a bead-based assay like Luminex, the sample is usually added to a mixture of color-coded beads that are pre-coated with a capture antibody specific for the analyte. The antibody binds to the analyte of interest. A biotinylated detection antibody specific for the analyte of interest is added, forming an antibody-antigen sandwich. Fluorophore-conjugated streptavidin is added and binds to the biotinylated detection antibody. The beads are read with a flow-based detection device. One laser sorts the beads and determines the analyte detected. A second laser determines the magnitude of the fluorophore-derived signal, which is directly proportional to the amount of analyte bound.

[0337] ELISPOT assays typically involve coating 96-well microtiter plates with purified cytokine-specific antibodies, blocking the plates to prevent nonspecific absorption of random proteins, incubating cytokine-secreting T cells with stimulator cells at several different dilutions, lysing the cells with detergent, adding a labeled secondary antibody, and detecting the antibody-cytokine complexes. The end product is usually an enzyme / substrate reaction that produces a colored product that can be quantified microscopically, visually, or electronically. Each spot represents one single cell secreting the cytokine of interest.

[0338] Cytokine production of one or more cytokines by γδ T cells can also be detected by multiparameter flow cytometry. Here, cytokine secretion in γδ T cells is blocked with Brefeldin A or Monensin (both protein trafficking inhibitors act on the Golgi apparatus in different ways, but which one is best depends on the cytokine being studied) for 4-24 hours, after which the cells are surface stained for the cytokine of interest, followed by fixation and permeabilization followed by intracellular staining using a fluorophore-conjugated antibody targeting the cytokine of interest. The cells can then be analyzed by flow cytometry. It is possible to monitor immune responses in humans by characterizing the cytokine secretion patterns of T cells in peripheral blood, lymph nodes, or tissues by flow cytometry. This can be done ex vivo without BFA or monensin treatment.

[0339] Activation of γδ T cell proliferation means an increase in the number of γδ T cells. Proliferation can be measured using a lymphoproliferative assay. A sample of effector cells is mixed with various dilutions of stimulator cells. After 72-120 hours, [ 3 DNA synthesis (as a measure of proliferation) can be quantified by adding [H]thymidine and measuring the amount of radiolabeled thymidine incorporated into DNA using a gamma counter.

[0340] Indications The present disclosure relates to modified BTN or BTN complexes that can be used to prevent, treat, slow the progression of, prevent the recurrence of, or alleviate the symptoms of a disease or condition.

[0341] Methods for the treatment of disease relate to therapeutic uses of the modified BTN or BTN complexes, vectors, or effector cells of the present disclosure. In this regard, modified BTN or BTN complexes, vectors encoding BTN or BTN complexes, or effector cells containing BTN or BTN complexes can be administered to a subject to prevent, treat, slow the progression of, prevent the recurrence of, or alleviate the symptoms of a disease or condition.

[0342] In some embodiments, the methods include isolating cells from a donor (allogeneic) or patient (autologous), preparing, treating, culturing, and / or manipulating them as described herein (to provide effector cells), and introducing or reintroducing them into the patient, before or after cryopreservation.

[0343] Alternatively, effector cells may be derived by ex vivo differentiation of inducible or embryonic precursor cells into lineage-specific cells.

[0344] The modified BTN or BTN complexes, vectors, or effector cells of the present disclosure can be used to prevent, treat, delay the progression of, prevent the recurrence of, or alleviate the symptoms of cancer.

[0345] The modified BTN or BTN complexes, vectors or effector cells can also be used to prevent, treat, slow the progression of, prevent the recurrence of, or alleviate the symptoms of an infectious disease.

[0346] The BTN or BTN complexes, vectors or effector cells can be used to prevent, treat, delay the progression of, prevent the recurrence of, or alleviate the symptoms of an autoimmune disease, hi one embodiment, the modified BTN or BTN complexes are used to deliver a cytotoxic agent to a γδ T cell.

[0347] The BTN or BTN complexes, vectors, or effector cells of the present disclosure can optionally be used in combination with other immunosuppressants and chemotherapeutic agents, such as, but not limited to, prednisone, azathioprine, cyclosporine, methotrexate, and cyclophosphamide.

[0348] BTN or BTN complexes, vectors or effector cells can be administered intravenously, intramuscularly, subcutaneously, transdermally, intraperitoneally, intrathecally, parenterally, intrathecally, intracavitary, intraventricularly, intraarterially, or via the cerebrospinal fluid, or by any implantable or semi-implantable, permanent or degradable device. Appropriate dosages can be determined based on the type of disease to be treated, the severity and course of the disease, the clinical condition of the individual, the individual's medical history and response to treatment, and the discretion of the attending physician.

[0349] Intratumoral injection, or injection into the tumor vasculature, is contemplated, particularly for discrete, solid, accessible tumors. Local, regional or systemic administration may also be appropriate.

[0350] Pharmaceutical Compositions Suitably, in compositions or methods for administration of a BTN or BTN complex, vector, or effector cell to a subject, the BTN or BTN complex, vector, or effector cell is combined with a pharma- ceutically acceptable carrier, as understood in the art. Thus, one example of the disclosure provides a composition (e.g., a pharmaceutical composition) that includes a BTN or BTN complex, vector, or effector cell combined with a pharma- ceutically acceptable carrier.

[0351] In general terms, a "carrier" refers to a solid or liquid filler, binder, diluent, encapsulating substance, emulsifier, wetting agent, solvent, suspending agent, coating, or lubricant that can be safely administered to any subject, e.g., a human. Depending on the particular route of administration, a variety of acceptable carriers known in the art can be used, e.g., as described in Remington's Pharmaceutical Sciences (Mack Publishing Co. NJ USA, 1991).

[0352] In one example, the BTN or BTN complex, vector, or effector cell is administered parenterally, such as subcutaneously or intravenously. For example, the BTN or BTN complex, vector, or effector cell is administered intravenously. In some examples, the BTN or BTN complex, vector, or effector cell is administered intratumorally.

[0353] The formulation of BTN or BTN complexes, vectors, or effector cells to be administered will vary depending on the route of administration and formulation (e.g., solution, emulsion, capsule) selected. A suitable pharmaceutical composition containing BTN or BTN complexes, vectors, or effector cells to be administered can be prepared in a physiologically acceptable carrier. In the case of a solution or emulsion, suitable carriers include, for example, aqueous or alcoholic / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Parenteral vehicles may include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. A variety of suitable aqueous carriers are known to those skilled in the art, including water, buffered water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), dextrose solution, and glycine. Intravenous vehicles may include various additives, preservatives, or fluid, nutrient, or electrolyte replenishers (see generally Remington's Pharmaceutical Science, 16th ed., Mack, Ed. 1980). The compositions may contain, as necessary, pharma- ceutically acceptable auxiliary substances required to approximate physiological conditions, such as pH adjusting and buffering agents and toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, and sodium lactate.

[0354] The BTN or BTN complexes, vectors or effector cells can be stored in liquid phase or lyophilized for storage and reconstituted in a suitable carrier prior to use according to lyophilization and reconstitution procedures known in the art. EXAMPLES

[0355] To understand the molecular mode of BTN engagement by the γδ TCR, we obtained crystal structures of the BTN2A1 ectodomain, either alone ("apo") or in combination with Vγ9 Vδ2, which diffract to 3.6 Å and 2.1 Å resolution, respectively. +We elucidated the complex between the γδ TCR and either of them (Table 1).

[0356] [Table 1A]

[0357] [Table 1B]

[0358] BTN2A1 has been reported to exist on the cell surface primarily as a homodimer stabilized by a membrane-proximal interchain disulfide bond (MM Karunakaran et al., Butyrophilin-2A1 Directly Binds Germline-Encoded Regions of the Vgamma9Vdelta2 TCR and Is Essential for Phosphoantigen Sensing. Immunity 52, 487-498 e486 (2020)). The exemplified BTN2A1 construct lacked the terminal Cys residue involved in this disulfide bond and, as a result, appeared to exist as a free monomer in solution (Figure 1A). Nevertheless, the apo form of BTN2A1 contained five copies in the asymmetric unit, arranged as two head-to-tail V-shaped homodimers ("V-dimers") (Figure 2A), with the fifth copy also forming a V-dimer via crystallographic symmetry. This V-dimer was broadly reminiscent of the BTN3A1 V-dimer (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012)), but the BTN2A1 V dimer formed at an angle of 59°, which was significantly wider than the BTN3A1 V dimer (49°), and the BTN2A1 V dimer was also twisted by 25° compared to the BTN3A1 V dimer (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012)) (Figure 2B and Figure 1B). The V-dimer is characterized by a small interface governed by a limited array of primarily nonpolar interactions, including three π-mediated interactions, with a surface area of ​​approximately 430 Å per molecule. 2The buried surface area (BSA) of the graft was 1.0 mm (Fig. 1C and Table 2).

[0359] [Table 2]

[0360] A head-to-tail dimer of BTN2A1 was observed in both the apo structure (Fig. 2B) and in the BTN2A1-γδ TCR complex (Fig. 1D), although the latter involved only the unliganded BTN2A1 copy via crystallographic symmetry, as the head-to-tail footprint overlaps with the γδ TCR binding site. The head-to-tail dimer is approximately 1180 Å thick per molecule compared to the V dimer. 2 (Fig. 1C and Table 3), which could form following either cis or trans interactions, similar to what has been termed the BTN3A1 head-to-tail homodimer (Fig. 2B) (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012)).

[0361] [Table 3A]

[0362] [Table 3B]

[0363] The asymmetric unit of the complex contained two copies of BTN2A1 arranged as a V dimer similar to the apoBTN2A1 V dimer (Fig. 1E), with one copy of BTN2A1 liganded to the γδ TCR while the other remained unliganded (Fig. 2C). BTN2A1 engaged the side of the γ chain and bound to the Vγ9-encoded IgV domain, projecting at an angle of approximately 54°, in stark contrast to αβ TCR engagement of pMHC or γδ TCR recognition of CD1d (Fig. 2D). Previous studies have suggested that the hypervariable region 4 (HV4) loop, also known as the DE loop of Vγ9, and the CDR3δ loop are involved in the binding of BTN molecules (MM Karunakaran et al., Butyrophilin-2A1 Directly Binds Germline-Encoded Regions of the Vgamma9Vdelta2 TCR and Is Essential for Phosphoantigen Sensing. Immunity 52, pp. 487-498 e486 (2020); CR Willcox et al., Butyrophilin-like 3 Directly Binds a Human Vgamma4(+) T Cell Receptor Using a Modality Distinct from Clonally-Restricted Antigen. Immunity 51, pp. 813-825 e814 (2019); A. Vyborova et al., gamma9delta2T cell diversity and the receptor interface with tumor cells. 130, pp. 4637-4651 (2020)).

[0364] The crystal structure revealed that the BTN2A1 binding site on Vγ9 is distal from both the CDRs and HV4 loop (>7 Å and >9 Å, respectively) and instead exposes the entire apical face of the γδ TCR solvent (Fig. 2C). The outer face of the Vγ9 germline-encoded β-sheet formed by the A, B, D, and E β-strands (ABED face) mediates binding to the β-sheet encoded by the C, F, and G β-strands (CFG face) of the BTN2A1 IgV domain (Fig. 1F), with energetic contributions from all these chains (Fig. 1G). The γδ TCR extends 468 Å upon ligation. 2 , and BTN2A1 is 477 Å 2 (BSA of all interfaces = 945Å 2 ) (Fig. 1G), which is roughly half of a typical αβTCR-pMHC complex, with the molecules tethered to each other by 14 H-bonds or salt bridges (Table 4).

[0365] [Table 4]

[0366] In the γδ TCR, the B-, D-, and E-strands of Vγ9 contributed 57%, 17%, and 11% of the BSA, respectively, and the CC'-loop, F-, and G-strands of BTN2A1 contributed 35%, 15%, and 44%, respectively. Within the BTN2A1 interface, aromatic residues Phe43, Tyr98, and Tyr105 contributed energetically with minimal conformational changes between the apo and ligand-bound states, indicating a lock-and-key mode of binding (Figure 1H). Ser41, Gln42, Phe43, and Ser44 form a CC' loop (Figure 1F), and their involvement is consistent with the overrepresentation of this loop in other IgV-mediated interfaces (SV Kundapura, UA Ramagopal, The CC' loop of IgV domains of the immune checkpoint receptors, plays a key role in receptor:ligand affinity modulation. Sci Rep 9, 19191 (2019)). Notably, the aromatic side chain of Phe43 is planar to the guanidinium moiety of the Arg20γ side chain (Figure 2E), facilitating a cation-π interaction with a predicted electrostatic binding energy of -4.6 kcal / mol.

[0367] Arg20γ also forms a water-mediated H-bond with Gln100 of BTN2A1 along with a main-chain mediated H-bond to the Tyr105 side chain hydroxyl group (Figure 2E), providing a structural basis for the importance of Arg20γ in BTN2A1 binding and pAg reactivity (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020)). Similarly, mutations to Glu70γ and His85γ abrogated BTN2A1 reactivity (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020)), which are connected by intrachain H-bonds and also bind to BTN2A1, with Glu70γ H-bonding to the main chain of Phe43 and Ser44, and His85γ forming van der Waals (VDW) contacts with Ser41, Gln42, and Phe43 on BTN2A1 (Figure 2F). In addition, Lys13γ in the A strand of Vγ9, which is H-bonded to Tyr105, and Lys17γ in the B strand of Vγ9, which forms a salt bridge with Asp106, contacted each other (Figure 2G). The adjacent Thr18γ is hydrogen bonded to Glu107, and Ser16γ is hydrogen bonded to the side chain of Arg96 (Figure 2H). Thus, BTN engagement by γδ TCRs is a fundamentally unique mode of ligand recognition by the immune system.

[0368] BTN3A1 is Vγ9 Vδ2 + Modulating TCR tetramer reactivity Vγ9 Vδ2 when liganded to BTN2A1 + Given the high bioavailability of the apical surface of the TCR, we chose Vγ9 Vδ2 +They hypothesized that the TCR co-engages a second ligand. Because the BTN3A1 intracellular domain binds pAg (C. Harly et al., Key implication of CD277 / butyrophilin-3 (BTN3A) in cellular stress sensing by a major human gammadelta T-cell subset. Blood 120, 2269-2279 (2012); A. Sandstrom et al., The intracellular B30.2 domain of butyrophilin 3A1 binds phosphoantigens to mediate activation of human Vgamma9Vdelta2 T cells. Immunity 40, 490-500 (2014)), they first tested whether the soluble BTN3A1 ectodomain could directly bind to the γδ TCR in a Vγ9 Vδ2 T cell subset lacking endogenous BTN2A1, 2A2, 2A3p, 3A1, 3A2, and 3A3. + TCR-transfected BTN2A KO .BTN3A KO HEK293T cells were probed with BTN3A1 ectodomain tetramers. Consistent with previous reports (A. Sandstrom et al., The intracellular B30.2 domain of butyrophilin 3A1 binds phosphoantigens to mediate activation of human Vgamma9Vdelta2 T cells. Immunity 40, 490-500 (2014)), no reactivity was detected (Figure 3A). We next investigated the effect of pAg-induced Vγ9 Vδ2 T cells lacking human BTN or BTNL molecules. + Murine NIH-3T3 fibroblasts transfected with full-length human BTN3A1, which are essentially unable to mediate T cell activation, downregulate Vγ9 Vδ2 + We tested whether all Vγ9 Vδ2 TCR tetramers could bind to the TCR tetramer. + BTN2A1 binds to the TCR tetramer (clones TCR3, TCR6, TCR7, and G115) +Compared with NIH-3T3 cells, BTN3A1 + The cells showed little, if any, staining (Figure 4A, black plots). Previous studies have demonstrated that by crosslinking BTN3A1 on the APC surface with anti-BTN3A antibody (mAb clone 20.1), BTN3A1 binds Vγ9 Vδ2 in a manner that mimics pAg loading. + It has been shown that BTN3A is converted into a stimulatory form capable of activating T cells (14, 15). Conversely, another anti-BTN3A mAb (clone 103.2) inhibits Vγ9 Vδ2 pAg. + It is a potent antagonist of T cell reactivity (14, 15). + Cross-linking of cells with agonist mAb clone 20.1 inhibited Vγ9 Vδ2 + Clear staining of TCR tetramers was induced, especially clones TCR3, TCR7 and G115 (Figure 4A, light grey plots). + This is in contrast to the antagonist anti-BTN3A mAb clone 103.2, which did not induce TCR tetramer staining, nor did mAb 20.1 treatment of untransfected or BTNL3-transfected cells (Fig. 4A, dark grey plots, and Fig. 4B). KO .BTN3A KO mAb 20.1-induced BTN3A1-dependent Vγ9 Vδ2 expression was detected using HEK293T cells + A similar pattern of TCR staining was obtained (Figure 3B). + pAg-reactive Vγ9 paired with δ chain + The chimeric TCR tetramer composed of the γ chain is BTN2A1 + Reactivity to cells was maintained, but mAb 20.1 cross-linked BTN3A1 +Reactivity to BTN3A1-transfected cells did not persist, indicating that BTN3A1 reactivity, unlike BTN2A1 reactivity, is dependent on V52 and / or the CDR3δ loop (Figure 4B, Figure 3C, and Figure 3D). Thus, mAb 20.1 pretreatment of BTN3A1-transfected cells inhibits Vγ9 V52 through recognition of a second ligand, designated herein as "ligand-2." + Ligand-2 reactivity could be induced by mAb 20.1 cross-linking of BTN3A1 in both human and mouse cell lines, and unlike BTN2A1 reactivity, this binding appeared to be dependent on the V52 domain and / or the CDR3 loop, hereafter referred to as "epitope-2" (Figure 4C, schematic inset).

[0369] Lys53δ regulates the interaction with ligand-2 Since the ABED β-sheet of Vγ9 mediates binding to BTN2A1 (Figure 2C), we asked whether the symmetrically equivalent ABED β-sheet of Vδ2 is also important for pAg sensing. Jurkat cells expressing an Ala mutant in the Vδ2-encoded ABED β-sheet did not have impaired responsiveness to zoledronate (an aminobisphosphonate that increases intracellular IPP pAg), suggesting that there is no equivalent Vδ2-encoded ABED binding interface for the BTN2A1-binding domain on Vγ9 (Figures 5A, 5B, and 5C). Since pAg-mediated γδ T cell responses depend on Arg51δ and Glu52δ, both located within the CDR2δ loop ((10, 18) and Figure 5C, grey residues), we screened two additional mutations in this loop: Lys53δ-Ala and Asp54δ-Ala. Asp54δ-Ala had no obvious effect on the response to zoledronate, whereas G115 Vγ9 Vδ2 harboring the Lys53δ-Ala mutation + Jurkat cells expressing the TCR showed spontaneous activation, suggesting that this residue may play a role in dampening γδ T cell responsiveness to TCR stimulation (FIGS. 5A, 5B, and 5C).

[0370] These observations were compared with those of BTN3A1 + mAb 20.1-induced Vγ9 Vδ2 in cells + To match the TCR tetramer staining, we also stained G115 Vγ9 Vδ2 with the corresponding Ala substitution. + We generated a TCR tetramer (hereafter referred to as G115 tetramer). As expected, the wild-type G115 tetramer did not express BTN2A1 + BTN3A1 interacting with NIH-3T3 fibroblasts and pretreated with mAb 20.1 + G115 tetramers carrying mutations in the BTN2A1 binding site ("epitope 1"), particularly the His85γ-Ala and Arg20γ-Ala / Glu70γ-Ala / His85γ-Ala triple mutants, also interacted with BTN2A1 cells (Figures 4C, 3E, and 3F). + We were unable to stain cells pretreated with mAb 20.1, but BTN3A1 + The G115 tetramers carrying the "epitope 2" Arg51δ-Ala or Glu52δ-Ala mutations still retained the ability to interact with cells (Figures 4C, 3E, and 3F). Conversely, the G115 tetramers carrying the "epitope 2" Arg51δ-Ala or Glu52δ-Ala mutations still retained the ability to interact with cells (Figures 4C, 3E, and 3F). + Cells were readily stained, but BTN3A1 pretreated with mAb 20.1 + Lys108γ-Ala, located within CDR3γ and close to CDR2δ (5–8 Å apart), also lost its ability to react with cells after pretreatment with mAb 20.1 (Figure 4C, Figure 3E, and Figure 3F). + The G115 tetramer, which has a Lys53δ-Ala substitution, showed reduced association with cells but not with BTN2A1 (Fig. 4C, Fig. 3E, and Fig. 3F). Strikingly, the G115 tetramer, which has a Lys53δ-Ala substitution, was the mutant that autoactivated in functional assays (Fig. 5A and Fig. 5B), and was associated with BTN2A1. + Although the absence of mAb 20.1 cross-linking did not affect reactivity to BTN3A1 cells, + Cells were stained (FIGS. 4C, 3E, and 3F). Indeed, mAb 20.1 pretreatment significantly inhibited the BTN3A1 +The reactivity of the Lys53δ-Ala G115 tetramer with BTN3A1 cells was only slightly enhanced above this spontaneous interaction level (Figure 4C and Figure 3F). + The strong interaction with cells was greater than that of other Vγ9 Vδ2 antibodies tested. + This was also true for TCR clones (Figure 3G), where the Lys53δ-Ala mutation was found to be predominant in Vγ9 Vδ2 TCR clones, regardless of CDR3 sequence heterogeneity. + This was further demonstrated by genetic modification of Lys53δ-Ala in polyclonal Vγ9 Vδ2+ T cells, resulting in the majority of Vγ9Vδ2 + This resulted in enhanced binding to BTN2A1-BTN3A1 heteromers by cells (Figure 17A). The G115 tetramer, which has a compound mutation of His85γ-Ala (in epitope 1) and Glu52δ-Ala (in epitope 2), inhibited BTN2A1 + Cells and BTN3A1 pretreated with mAb 20.1 + Vγ9 Vδ2 lost the ability to interact with both Vγ9 and Vδ2 cells (Figure 4C, Figure 3E, and Figure 3F). + To further support the observation that TCR tightly associates with BTN3A1 following anti-BTN3A mAb 20.1 pretreatment, BTN3A1- or BTN2A1-expressing cells were co-stained with control SAv-PE or Vγ9 Vδ2 TCR-PE tetramers together with isotype control-AF647 (MOPC21) or anti-BTN3A-AF647 (20.1) mAb (Figure 3H). + When cells were co-stained with Vγ9 Vδ2 TCR-PE tetramer and anti-BTN3A-AF647 Ab, Förster resonance energy transfer (FRET) was observed, suggesting close proximity (<10 nm) upon co-binding to BTN3A1 transfected cells. Taken together, these data suggest that "ligand-2," either BTN3A1 itself or a closely associated molecule, binds Vγ9 Vδ2 + Vγ9 Vδ2 via “epitope 2”, which is located on the apical surface of the TCR and incorporates residues within the CDR2δ and CDR3γ loops +Within epitope 2, Lys53δ appears to act as a gatekeeper residue for accessibility to ligand-2, suggesting that cross-linking of BTN3A1 with the agonist mAb 20.1 induces a conformational change toward ligand-2 that partially circumvents this steric barrier.

[0371] BTN3A1 is Vγ9 Vδ2 + Direct ligand for TCR We next tested the hypothesis that ligand-2 is BTN3A1 and that BTN2A1 stabilizes BTN3A1 binding to the γδ TCR. To test this, we generated soluble BTN3A1-BTN2A1 ectodomain heteromeric complexes (FIG. 6A), linked them with a C-terminal leucine zipper, and showed that they bind to the Vγ9 Vδ2 TCR. + We measured whether BTN2A1-BTN3A1 could bind to epitope 2, the ligand-2 binding site on the TCR. The BTN2A1-BTN3A1 heteromeric complex retained staining with anti-BTN2A1 and anti-BTN3A1 mAbs by ELISA (Figure 6D), and consisted of two chains after purification (BTN2A1 and BTN3A1, Figures 6B-C) and crystallization (Figure 6E), suggesting the correct three-dimensional structure.

[0372] Consistent with the BTN2A1-γδ TCR docking mode (FIG. 2C), the BTN2A1 tetramer docked with the G115 TCR as well as the G115 mutants located in epitope 2, namely Glu52δ-Ala and Lys53δ-Ala. + The soluble BTN3A1 ectodomain tetramer readily stained WT cells, but not the epitope 1 mutant His85γ-Ala (FIGS. 7A and 6F). +The BTN2A1-BTN3A1 complex tetramer also failed to interact with the G115 TCR (Figure 7A and (A. Sandstrom et al., The intracellular B30.2 domain of butyrophilin 3A1 binds phosphoantigens to mediate activation of human Vgamma9Vdelta2 T cells. Immunity 40, 490-500 (2014)). + BTN2A1-BTN3A1 tetramers bound to WT cells, but at slightly lower levels than BTN2A1 tetramers (Figure 7A and Figure 6F). Similar to BTN2A1 tetramers, His85γ-Ala mutation completely abolished the interaction with BTN2A1-BTN3A1 tetramers, indicating a strong dependency on BTN2A1. However, unlike BTN2A1 tetramers, BTN2A1-BTN3A1 tetramer binding was greatly modulated by mutations to epitope 2. Here, Glu52δ-Ala, which was essential for G115 tetramer staining in BTN3A1-transfected cells (Figure 4C), slightly reduced reactivity to BTN2A1-BTN3A1 compared to G115 WT TCR, whereas the gatekeeper residue mutant Lys53δ-Ala led to a clear increase in BTN2A1-BTN3A1 staining intensity (Figure 7A and Figure 6F). These data demonstrate that the soluble BTN2A1-BTN3A1 ectodomain complex can bind to the γδ TCR, but unlike BTN2A1 alone, binding of the BTN2A1-BTN3A1 complex is co-dependent on epitopes 1 and 2.

[0373] We next demonstrated that the BTN2A1-BTN3A1 complex mediates Vγ9Vδ2 expression in cell-free assays. + We investigated whether the soluble G115 WT γδ TCR could co-bind epitopes 1 and 2 of the BTN2A1 TCR by using surface plasmon resonance (FIG. 7B). D= 99μM, which is in line with the K in previous studies (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020); MM Karunakaran et al., Butyrophilin-2A1 Directly Binds Germline-Encoded Regions of the Vgamma9Vdelta2 TCR and Is Essential for Phosphoantigen Sensing. Immunity 52, 487-498 e486 (2020)). D = 40-50 μM) but did not bind to immobilized BTN3A1 (K D (K > 4,000 μM). Consistent with a role for epitope 1 but not epitope 2 in binding to BTN2A1, soluble G115 TCR with a His85γ-Ala substitution abrogated reactivity to BTN2A1, whereas Glu52δ-Ala and Lys53δ-Ala had no effect. Interestingly, the gatekeeper mutant Lys53δ-Ala showed low levels of binding to BTN3A1 at the highest concentrations, although the predicted affinity was very weak (K D The G115 WT γδ TCR has a similar affinity to BTN2A1 (K D = 79 μM and 99 μM) to the immobilized BTN2A1-BTN3A1 complex. However, in contrast to the binding of G115 TCR to BTN2A1, Lys53δ-Ala increased the affinity (K D = 46 μM), whereas Glu52δ-Ala slightly decreased the affinity (K D = 140 μM), binding of the G115 TCR to BTN2A1-BTN3A1 was modulated by mutations within epitope 2 of the γδ TCR. Furthermore, unlike BTN2A1, the BTN2A1-BTN3A1 complex also reacted weakly with the G115 His85γ-Ala TCR (K D = 740 μM, Figure 7B). Therefore, Vγ9Vδ2 +The pattern of ligand-2 reactivity to the TCR can be recapitulated using soluble BTN2A1-BTN3A1 complexes in both cell surface staining-based and cell-free biophysical-based assays. Together, these data demonstrate that BTN3A1, along with BTN2A1, is necessary and sufficient to engage the γδ TCR via epitopes 1 and 2.

[0374] The BTN3A1 IgV domain is the same as BTN2A1 and Vγ9Vδ2 + Interacts with both TCRs BTN2A1 and BTN3A1 are located within 10 nm of each other in cis on the cell surface (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020)), but it is unclear whether they directly interact. Using surface plasmon resonance, the full-length BTN3A1 ectodomain (IgV IgC) binds to K D = 500 μM to immobilized disulfide-linked BTN2A1 homodimers, but not to immobilized BTN3A1 homodimers. In contrast, the full-length BTN2A1 ectodomain bound weakly to immobilized BTN3A1 homodimers (K D The IgV domain bound to immobilized BTN2A1 homodimers (K ∼1800 μM) and did not bind to immobilized BTN2A1 homodimers (FIG. 8A), indicating that the BTN2A1 and BTN3A1 ectodomains can directly interact, albeit with low affinity. Because the BTN3A1 ectodomain exists as a homodimer and may therefore show enhanced binding due to increased avidity in SPR assays, we also examined the monomeric BTN3A1 IgV domain, which retains specific binding to BTN2A1 (K D = 1,100 μM, FIG. 8A). To understand the molecular nature of this interaction, we crystallized the BTN2A1-BTN3A1 zipper complex ectodomain.

[0375] The crystal diffracted anisotropically to 5.6 Å resolution and had a single copy of each of the BTN2A1 and BTN3A1 monomers in the asymmetric unit, forming an interface through their IgV domains with a docking angle of about 29° (Figure 8B and Table 1). The C-terminal zipper domains are flexible and were not modeled, but there was space for them in the asymmetric unit below the IgC domain. V-type homodimers of both BTN2A1 and BTN3A1 were also present in crystallographic symmetry (Figure 8B), but were twisted by about 10° and about 16°, respectively, compared to the apoV-dimer (Figure 9A). The BTN2A1 and BTN3A1 V-dimers, respectively, were twisted by 613 Å. 2 and 678 Å 2 The total BSA is approximately 1,300 Å. 2 The BTN2A1 and BTN3A1 V dimers bind at a planar angle of approximately 80° to form a distorted W-shaped heterotetramer (Figure 8B), which can be further extended through crystallographic symmetry to the composition [BTN2A1 ホモ二量体 BTN3A1 ホモ二量体 ] n A linear polymer of the formula (Figure 8C) was obtained.

[0376] The BTN2A1-BTN3A1 intermolecular contacts were determined based on a model fitting the high-resolution apo-BTN2A1 and BTN3A1 structures to a low-resolution composite electron density map. Assuming no significant side-chain movements, there was a network of intermolecular salt bridges involving BTN2A1-Arg56 to BTN3A1-Glu106, BTN2A1-Glu35 to BTN3A1-Lys107, BTN2A1-Glu62 to BTN3A1-Lys94, and BTN2A1-Glu107 to BTN3A1-Arg44 (Figure 8D and Figure 8E, Table 5). Furthermore, in the BTN2A1-γδ TCR structure (Figure 2E), BTN2A1-Phe43, which formed a cation-π interface with Arg20 of the TCR γ chain, also formed a cation-π interface with the Arg44 side chain of BTN3A1 (electrostatic binding energy -4.7 kcal / mol, Figure 8E). There were seven additional H-bonds mediated primarily by the C-strand, CC'-loop, and C'-strand of BTN2A1 (Table 4), including the BTN2A1-Ser44 N and O atoms contacting Ser41-O and Oγ, respectively (Figure 8F). Tyr105 of BTN3A1 also made extensive contacts with BTN2A1, including a cation-π interface with the terminal amine of BTN2A1-Lys51 (binding energy -5.4 kcal / mol), and H-bonds to the BTN2A1-Glu35 and Gln100 side chains (Figure 8G).

[0377] [Table 5]

[0378] We next tested whether the same BTN3A1 residues that engaged with BTN2A1 in the W-type complex correlated with those responsible for the reported cis-association between BTN2A1 and BTN3A1 at the cell surface (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020)). Of a panel of 45 BTN3A1 Ala ectodomain mutants that included residues in both the IgV and IgC domains, 40 retained cell surface expression and reactivity with the anti-BTN3A mAb clone 103.2 (Figures 10A and 10B). Mutations to five residues: Arg44-Ala, Leu96-Ala, Tyr98-Ala (and even Tyr98-Phe), Tyr105-Ala and Glu106-Ala abrogated Förster resonance energy transfer (FRET) between anti-BTN2A and anti-BTN3A mAbs (Figure 8H and Figure 10C). These residues were mapped to the CFG face of BTN3A1 and correlated closely with the crystal structure interface (Figure 10D), thereby confirming this binding mode. Thus, BTN2A1 and BTN3A1 interact through the CFG faces of their IgV domains to form W-shaped heterodimers and / or hetero-oligomers.

[0379] Using this panel of BTN3A1 Ala mutants, we determined which residues are involved in Vγ9Vδ2 + Thirty-four of the 45 mutants in the panel retained reactivity to the anti-BTN3A mAb clone 20.1 mAb (Figures 10A and 11A). Of these, six retained reactivity to the BTN3A1 mAb pretreated with mAb 20.1. +The BTN3A1 Ala mutants completely abrogated G115 tetramer staining in cells: Val39, Arg44, His85, Tyr98, Phe104 and Tyr105, and four residues that reduced G115 tetramer staining by more than 90%: Phe26, Lys37, Ser42 and Leu96 (Figure 12A and Figure 11A). Next, the panel of BTN3A1 Ala mutants was co-expressed with BTN2A1 (WT) in NIH-3T3 cells and used to activate V52+ T cells in the presence of zoledronate. All six BTN3A1 residue Ala mutants that abrogated G115 tetramer reactivity-Val39, Arg44, His85, Tyr98, Phe104 and Tyr105-also abrogated V52+ T cell activation, similar to Leu96 (Figure 12B and Figure 11B). With the exception of His85, which was mapped to the ABED face, all other residues were mapped to the CFG face. These data build on previous reports that the CFG face of the BTN3A1 IgV domain is functionally important (CR Willcox et al., Butyrophilin-like 3 Directly Binds a Human Vgamma4(+) T Cell Receptor Using a Modality Distinct from Clonally-Restricted Antigen. Immunity 51, 813-825 e814 (2019)), and further suggest that these residues are important for the Vγ9Vδ2 + It is thought to be involved in binding to TCR.

[0380] BTN2A1 and BTN3A1 bind to each other using the same epitope and bind to Vγ9Vδ2 + Binds to TCR Paradoxically, Vγ9Vδ2 +Four of the seven BTN3A1 residue Ala mutants that were important for binding to the TCR (Arg44, Leu96, Tyr98, and Tyr105) were also important for binding to BTN2A1 (Figures 8H, 9A, and 10D). Similarly, many of the residues within the BTN2A1 IgV domain that contact the γδ TCR also mediated binding to BTN3A1, including Phe43, Ser44, and Glu107 (Tables 4 and 5, Figure 11C). The overlap between BTN2A1 and the γδ TCR binding domains on BTN3A1, and conversely, the overlap between BTN3A1 and the γδ TCR binding domains on BTN2A1, provides insight into how BTN2A1 and BTN3A1 interact with each other and with Vγ9Vδ2. + This raised the important question of whether BTN2A1-γδ TCR and BTN2A1-BTN3A1 crystal structures could simultaneously co-bind to the Vγ9Vδ2 TCR. Indeed, superposition of the BTN2A1-γδ TCR and BTN2A1-BTN3A1 crystal structures identified a significant steric clash (>15 Å) between BTN3A1 and the γδ TCR, suggesting that co-binding in this manner as a ternary complex is not possible (Figure ​(Figure11D). 11D). This suggests that BTN2A1 and BTN3A1 are co-ligands for each other, but not Vγ9Vδ2 TCR. + This means that they must dissociate or undergo large conformational changes before they can co-bind to the TCR.

[0381] We tested this hypothesis using BTN2A1-BTN3A1 zipper ectodomain complex tetramers containing the BTN3A1 Glu106-Ala mutant, which largely disrupts the BTN2A1-BTN3A1 ectodomain complex by FRET measurements, but has no detrimental effect on G115 tetramer reactivity to BTN3A1 (Figure 8H and Figure 12A, respectively). Compared to the BTN2A1-BTN3A1 WT tetramer, the BTN2A1 WT-BTN3A1 Glu106-Ala tetramer stained HEK-293T cells transfected with the G115 WT γδ TCR more intensely, indicating increased affinity (Figure 13A). The Glu52δ-Ala G115 γδ TCR mutant, which abrogates binding to BTN3A1, also stained strongly with the BTN2A1-BTN3A1 Glu106-Ala tetramer, suggesting that binding to the BTN2A1 "epitope 1" on the γδ TCR is enhanced by the BTN3A1 Glu106-Ala mutation. The BTN2A1 WT-BTN3A1 Glu106-Ala tetramer stained G115 WT more strongly than the BTN2A1 tetramer, but not G115 Glu52δ-Ala γδ TCR+ cells, further suggesting that the BTN2A1 WT-BTN3A1 Glu106-Ala complex may exhibit even higher affinity than the BTN2A1 tetramer. To directly measure binding affinity, we performed SPR (Figure 13B). Consistent with tetramer staining of cell lines, the G115 WT γδ TCR binds with higher affinity than the BTN2A1-BTN3A1 WT complex (K 85 μM compared to 85 μM, respectively). D = 37 μM) bound to the immobilized BTN2A1-BTN3A1 Glu106-Ala complex, and the BTN3A1 Glu106-Ala mutation inhibited Vγ9Vδ2 + These results suggest that γδ TCR affinity for the BTN2A1-BTN3A1 Glu106-Ala complex is higher than that for the G115 γδ TCR BTN2A1 interaction (K of 99 μM). D= 37 μM), supporting a model in which the presence of both BTN ligands in an accessible conformation results in enhanced affinity mediated by a simultaneous co-binding event. Thus, BTN2A1 and BTN3A1 each bind to Vγ9Vδ2 + Containing epitopes that react with distinct determinants on the TCR, these BTN epitopes are tethered to each other at the cell surface, preventing efficient TCR engagement. For example, upon conformational changes in BTN3A1, such as those mediated by the agonist clone 20.1 mAb, the BTN ectodomain becomes dissociated from Vγ9Vδ2 + They acquire the ability to simultaneously co-bind to TCRs.

[0382] To further explore this model, we lock the BTN2A1 and BTN3A1 ectodomains together in their W-shaped conformation, thereby isolating Vγ9Vδ2 + We reasoned that their reactivity to the TCR would be abrogated. To this end, we introduced cysteine ​​(Cys) residues into the CFG face of the BTN2A1 and BTN3A1 IgV domains that were optimally spaced for the formation of interchain disulfide bonds. Using the structure of the BTN2A1-BTN3A1 complex as a guide, we identified two distinct Cys pairs: BTN2A1 Gly102-Cys and BTN3A1 Asp103-Cys, and BTN2A1 Ser44-Cys and BTN3A1 Ser41-Cys (Figure 14A). Cells co-transfected with BTN2A1 Ser44-Cys and BTN3A1 Ser41-Cys, or BTN2A1 Gly102-Cys and BTN3A1 Asp103-Cys, respectively, showed a strong reduction or complete loss of G115 tetramer reactivity. However, co-expression of these Cys mutants with the corresponding WT molecules (e.g., BTN2A1 Gly102-Cys and BTN3A1 WT, or vice versa) resulted in Vγ9Vδ2 + Reactivity to TCR is preserved, and the interchain disulfide bond is Vγ9Vδ2 + This was shown to be responsible for the loss of TCR reactivity (Figure 13C).+ BTN3A1-Cys + Treatment of the cells with graded doses of the reducing agent dithiothreitol (DTT) partially restored the ability of G115 tetramers to stain these cells (FIGS. 13D and 14B).

[0383] Based on the crystal structure of BTN2A1-BTN3A1, we predicted that the soluble BTN2A1 Gly102-Cys BTN3A1 Asp103-Cys ectodomain complex, with the C-terminal zipper removed, would take the form of an M-type tetramer consisting of a core BTN3A1 V-dimer and two ectocopies of BTN2A1, each linked to BTN3A1 via disulfide bonds (Figure 14C). 2D class averages of negative stain micrographs of the soluble BTN2A1 Gly102-Cys BTN3A1 Asp103-Cys complex indeed revealed the presence of M-type particles, further supporting this notion (Figure 14D). Fluorescently labeled tetrameric forms of BTN2A1 Gly102-Cys BTN3A1 Asp103-Cys heteromers were unable to stain HEK-293T cells transfected with G115γδ TCR, but pretreatment of these soluble tetrameric complexes with DTT immediately prior to staining reduced the disulfide bonds and enhanced the staining of G115γδ TCR. + Reactivity to Vγ9Vδ2 cells was restored (Figures 14E and 14F). Thus, covalent disulfide locking of BTN2A1 and BTN3A1 inhibits Vγ9Vδ2 + Disrupting this binding prevents TCR engagement and inhibits Vγ9Vδ2 + TCR reactivity is restored.

[0384] Taken together, these findings support the idea that Vγ9Vδ2 +It was found that TCRs co-bind to BTN2A1 and BTN3A1 through two spatially distinct epitopes, with BTN2A1 engaging the side of Vγ9 and BTN3A1 binding to the apical surface. BTN2A1 and BTN3A1 also interact in cis to form W-type multimers, but in so doing are unable to engage γδ TCRs. We propose that pAg sequestration by the intracellular domain of BTN3A1 induces remodeling or multimerization of the intracellular B30.2 domains, which in turn promotes allosteric changes to the ectodomains, converting them from an inactive "latent" state to an active "open change" state. The activated BTN2A1-BTN3A1 complex binds Vγ9Vδ2 + It can react with the TCR to promote γδ T cell-mediated immunity (FIG. 15).

[0385] Analogous to pMHC recognition by αβTCR, BTN molecules have emerged as important γδ TCR ligands, although their molecular recognition modes have not been fully elucidated. + The exact mechanism by which T cells recognize pAg remains unclear. Herein, we report the first structure of a TCR engaging a non-MHC or MHC-like ligand, namely BTN2A1, which engages the flank of Vγ9 to bind Vγ9Vδ2. + We also show that a second ligand, BTN3A1, binds the apical Vγ9Vδ2 TCR, leaving the apical surface of the TCR exposed. + Binding to the TCR surface is also demonstrated.

[0386] Vγ9Vδ2 +The ability of TCRs to co-bind two ligands contrasts with the recognition of MHC and MHC-like molecules by αβ T cells, which bind one-to-one stoichiometrically. Thus, γδ TCRs appear to be able to distinguish dual from single ligand binding events. As Vγ9 is often incorporated into non-pAg-reactive Vγ9 Vδ1+ TCRs, it is possible that other non-BTN γδ T cell ligands, such as MICA, CD1, or MR1, may also co-bind with BTN2A1. Similarly, BTNL3 binds Vγ4 in a manner similar to Vγ9 and BTN2A1. + It has been determined whether BTNL8 can also co-bind with gamma delta TCRs (D. Melandri et al., The gamma delta TCR combines innate immunity with adaptive immunity by utilizing spatially distinct regions for agonist selection and antigen responsiveness. 19, pp. 1352-1365 (2018); CR Willcox et al., Butyrophilin-like 3 Directly Binds a Human Vgamma4(+) T Cell Receptor Using a Modality Distinct from Clonally-Restricted Antigen. Immunity 51, pp. 813-825 e814 (2019)).

[0387] Unlike αβTCR and BCR, which directly sense exogenous Ag, pAg-reactive γδ TCR is activated by inside-out signaling via a conformational change in BTN. Therefore, additional regulatory mechanisms may be required to maintain self-tolerance of γδ T cells. To this end, we investigated two important molecular checkpoints: Vγ9Vδ2, which suppresses BTN3A1 binding, and Vγ9Vδ2, which suppresses BTN3A1 binding. + Lys53 in the CDR2 delta loop of TCR and Vγ9Vδ2 of BTN2A1 and BTN3A1 +We identified a second mechanism by which TCR-binding epitopes partner with each other in cis on the cell surface of APCs. + The ability to induce T cell autoactivation and increased BTN3A1 reactivity suggests that by avoiding the Lys53δ side chain, BTN3A1 may be able to engage adjacent epitopes such as those incorporating Arg51δ, Glu52δ and / or Lys108γ. Both BTN2A1 and BTN3A1 bind Vγ9Vδ2 + As they are ligands for the TCR but directly interact with each other, this is thought to ensure that both ligands remain in the off state but are in close proximity to each other so that conversion of the complex to its stimulatory form upon pAg triggering is rapid and efficient. The importance of the BTN2A1 V and head-to-tail dimers remains to be explored, but they are reminiscent of the reported BTN3A1 V and head-to-tail dimers (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012); S. Gu et al., Phosphoantigen-induced conformational change of butyrophilin 3A1 (BTN3A1) and its implication on Vgamma9Vdelta2 T cell activation. Proceedings of the National Academy of Sciences of the United States of America 114, E7311-E7320 (2017)). The stoichiometry of the stimulatory BTN2A1 and BTN3A1 complexes, as well as the role of pAg, need to be addressed in future studies.

[0388] Data show that BTN3A1 is Vγ9Vδ2 +We provide three lines of evidence that BTN3A1 is a direct ligand of the TCR. First, treatment of BTN3A1-transfected (but not parental) human or mouse APCs with the agonist BTN3A mAb clone 20.1 resulted in the upregulation of Vγ9Vδ2 + Vγ9Vδ2 binds to the TCR tetramer, which is distinct from BTN2A1 binding + Second, the recombinant BTN2A1-BTN3A1 complex mediates Vγ9Vδ2 TCR epitopes in a codependent manner via these same dual epitopes. + Finally, co-binding by the BTN2A1-BTN3A1 complex was reproduced in biophysical assays, suggesting that Vγ9Vδ2 + A role for alternative ligands in TCR binding was ruled out. Taken together, these observations suggest that membrane-bound full-length BTN3A1 mediates the binding of Vγ9Vδ2 + We show that the soluble BTN3A1 ectodomain can bind to the TCR, but cannot do so unless BTN2A1 is also present, presumably because a conformational change is required. It is unclear whether BTN2A1 induces a conformational change in BTN3A1 or vice versa. Recombinant BTN2A1-BTN3A1 ectodomain complexes bind Vγ9Vδ2 with similar affinity to BTN2A1 alone. + The results suggest that the energetic penalty of co-liganding BTN2A1 and BTN3A1 with each other is offset by the increased affinity achieved by having two complementary ligands. Indeed, the enhanced binding affinity of the BTN2A1-BTN3A1 Glu106 complex supports this conclusion, and furthermore, the Vγ9Vδ2 + It also suggests that a single molecule of TCR can co-bind both ligands simultaneously.

[0389] The intracellular domains of BTN2A1 and BTN3A1 both express pAg-induced Vγ9Vδ2 +It is required for T cell activation (M. Rigau et al., Butyrophilin 2A1 is essential for phosphoantigen reactivity by gammadelta T cells. Science 367 (2020); C.E. Cano et al., BTN2A1, an immune checkpoint targeting Vgamma9Vdelta2 T cell cytotoxicity against malignant cells. Cell Rep 36, 109359 (2021)), and the BTN2A1-BTN3A1 interaction is enhanced by pAg, an immune checkpoint that targets Vgamma9Vdelta2 T cell cytotoxicity against malignant cells (C.E. Cano et al., BTN2A1, an immune checkpoint targeting Vgamma9Vdelta2 T cell cytotoxicity against malignant cells. Cell Rep 36, 109359 (2021)). One interpretation of these findings is that pAg induces an association between the intracellular domains of BTN3A1 and BTN2A1. In support of this hypothesis, we show that Vγ9Vδ2 + We identified three residues within the BTN2A1 intracellular domain that are important for T cell activation: two in the C-terminal cytoplasmic tail (Thr482 and Leu488) and one in the B30.2 domain (Arg449) (Figure 16). Association of the intracellular domains provides a torsional force that may propagate through the rigid coiled-coil domain towards the ectodomain of the BTN complex. This allows the Vγ9Vδ2 TCR to initially engage BTN2A1 with high affinity, followed by Vδ2 / Vγ9 binding to BTN3A1 to communicate the presence of pAg. Taken together, our findings reveal a fundamentally different mode of immune activation and associated regulatory mechanisms that underpin γδ T cell immunity compared to αβ T cells.

[0390] The BTN2A1-BTN3A1 (Glu106-Ala) zipper binds to Vδ2+ cells To determine whether the BTN2A1-BTN3A1 complex could bind primary V52+ cells, V52+ cells purified from blood of healthy donors and pre-expanded with anti-CD3 and anti-CD28 mAbs were stained with BTN2A1-BTN3A1 complex tetramers. The BTN2A1-BTN3A1-zipper complex (high affinity zipper with long linker) reacted with a minor subset of V52+ cells (Figure 17A), but this reactivity was enhanced by genetic modification of V52+ cells to induce the Lys53δ-Ala mutation. However, the BTN2A1-BTN3A1 Glu106-Ala-zipper complex reacted very strongly with all V52+ cells, even those containing the parent Lys 53δ-residue (Figure 17B). This indicates that the BTN2A1-BTN3A1 complex, in which BTN3A1 contains the Glu106-Ala mutation, induces binding to the γδ TCR. In contrast, the BTN2A1 Gly102-Cys-BTN3A1 Asp103-Cys-zipper complex is unable to react with Vδ2+ cells (Figure 17C), indicating that the "locked" or closed conformation of the BTN2A1-BTN3A1 complex is unable to bind to the γδ TCR. Thus, although the BTN2A1-BTN3A1 complex shows some reactivity to Vδ2+ cells, this reactivity is enhanced by the Glu106-Ala mutation in BTN3A1. Notably, the BTN2A1(WT)-BTN3A1 Glu106-Ala-zipper was significantly associated with disruption of the association between the IgV domains of BTN2A1 and BTN3A1 (Figure 8H), thus implying that this mutation alters the structure of the BTN2A1-BTN3A1 complex in a manner that enhances its responsiveness to the γδ TCR.

[0391] Phosphoantigen-independent binding To determine whether BTN2A1 and BTN3A1 ectodomains can induce V52 T cell activation in the absence of phosphoantigen, immobilized ectodomains were tested for their ability to activate V52 cells in vitro. Immobilized BTN2A1 and BTN3A1, respectively, resulted in little or no activation of V52+ cells, whereas the combination of BTN2A1+BTN3A1 induced clear activation. Furthermore, tethered BTN2A1-BTN3A1 ectodomains with a C-terminal zipper were also stimulatory in the same assay, but cleavage of the zipper abrogated or reduced their stimulatory effect. Thus, BTN2A1+BTN3A1 is necessary and sufficient to mediate activation of V52+ cells, obviating the need for the addition of exogenous phosphoantigen.

[0392] To determine whether the BTN2A1-BTN3A1 complex tethered together with a zipper connected via a shorter C-terminal linker retained reactivity to the γδ TCR compared to the original 13-mer Gly / Ser-rich linker, we generated a BTN2A1-BTN3A1 complex in which the zipper domain was fused to the C-terminus of the BTN molecule with a short linker that was 3 residues long (sequence: SGG). This BTN2A1-BTN3A1 "short linker" complex reacted with surface-expressed Vγ9Vδ2 TCR expressed on NIH-3T3 cells. + TCR (Figure 19A), suggesting that the changes to the linker motif do not impair the reactivity of the BTN2A1-BTN3A1 complex to the Vy9V52+ TCR.

[0393] The zipper motif was then engineered to reduce or eliminate homodimerization but still retain the ability to heterodimerize (J.R. Moll et al., Designed heterodimerizing leucine zippers with a ranger of pIs and stabilities up to 10(-15) M. Protein Sci 10, 649-655 (2001)). + TCR reactivity was not impaired (Figure 19B). + These data suggest that the zipper fusion motif can be significantly altered without abrogating the reactivity of the BTN2A1-BTN3A1 complex to the TCR. These data suggest that the BTN2A1 and BTN3A1 molecules, tethered to each other in several different ways, are involved in the Vγ9Vδ2 + This indicates that it is capable of binding to the TCR.

[0394] Mutation of either BTN2A1 Ser44-Arg or BTN3A1 Glu106-Ala enhances binding of Vγ9Vδ2 TCR to the BTN2A1-BTN3A1 complex We next tested whether mutations to either BTN2A1 or BTN3A1 could affect binding of Vy9V52 TCR to the BTN2A1-BTN3A1 complex expressed on the cell surface. Because Vy9V52 TCR tetramers can bind to surface-expressed BTN2A1 independently of BTN3A1 (Figure 3), we devised a strategy to circumvent the overwhelming influence of BTN2A1. Here, rather than staining BTN-expressing cells with WT Vy9V52+ TCR tetramers, we instead used G115 Vy9V52+ TCR tetramers, which carry a His85γ-Ala mutation that greatly reduces TCR interaction with BTN2A1 (Figure 4C). Using this strategy, co-expression of BTN2A1 and BTN3A1 promoted binding of the His85γ-Ala Vy9V52+ TCR tetramer, but not either molecule alone. Thus, His85γ-Ala Vγ9Vδ2+ TCRs interact with the BTN2A1-BTN3A1 complex in a manner that is dependent on the presence of both BTN2A1 and BTN3A1 on the cell surface (Figure 21A).

[0395] We found that a mutation in BTN3A1, Glu106-Ala, enhanced the ability of the soluble BTN2A1-BTN3A1 complex to interact with Vy9V52+ TCR (Figure 17). Consistent with this notion, murine NIH-3T3 cells co-transfected with genes encoding BTN2A1(WT) and BTN3A1(Glu106-Ala) interacted more strongly with His85γ-Ala Vy9V52+ TCR tetramers than cells co-transfected with BTN2A1(WT) and BTN3A1(WT) (Figure 21B). This equated to an 11±0.1-fold increase in TCR tetramer binding to GFP+ cells, on average across two independent experiments. Surprisingly, we also found that mutation of Ser44-Arg in BTN2A1 had a similar effect, with cells co-transfected with BTN2A1(Ser44-Arg) and BTN3A1(WT) interacting with Vy9V52+ TCR tetramers more strongly than cells co-transfected with BTN2A1(WT) and BTN3A1(WT) (Figure 21B). This equated to a 14±3-fold increase in TCR tetramer binding to GFP+ cells. Cells co-expressing both mutants, i.e. BTN2A1(Ser44-Arg) and BTN3A1(Glu106-Ala), showed a 14±4-fold increase in TCR tetramer binding to GFP+ cells compared to the WT control (Figure 21B). Thus, mutations within or near the BTN2A1-BTN3A1 binding interface located on their IgV domains can promote enhanced interaction with Vy9V52+ TCR. In addition, treatment of cells with the aminobisphosphonate zoledronate further enhanced the interaction between the BTN2A1-BTN3A1 complex and the His85γ-Ala Vy9V52+ TCR tetramer, indicating that increasing intracellular phosphoantigen increases the affinity of the interaction between the BTN2A1-BTN3A1 complex and the Ala Vy9V52+ TCR (Figure 21B).

[0396] method Human samples Human peripheral blood cells (PBMCs) derived from healthy donor blood from male and female donors were obtained from the Australian Red Cross Blood Service under ethics approval 17-08VIC-16 or 16-12VIC-03 ​​with ethical approval from the University of Melbourne Human Ethics Sub-Committee (1035100) and isolated via density gradient centrifugation (Ficoll-Paque PLUS GE Health care) and red blood cell lysis (ACK buffer, manufactured in-house).

[0397] cell line Jurkat (JR3-T3.5), LM-MEL-75, HEK293T and NIH-3T3 cells were maintained in RPMI-1640 (Invitrogen) supplemented with 10% (v / v) FCS (JRH Biosciences), penicillin (100 U / ml), streptomycin (100 μg / ml), Glutamax (2 mM), sodium pyruvate (1 mM), non-essential amino acids (0.1 mM) and HEPES buffer (15 mM), pH 7.2-7.5 (all from Invitrogen Life Technologies), plus 50 μM 2-mercaptoethanol (Sigma-Aldrich) (complete RMPI). Expi293F cells were purchased from ThermoFisher (cat. no. A14527) and maintained in Expi293 expression medium (ThermoFisher, A1435101).

[0398] Isolation and expansion of γδ T cells In some experiments, γδ T cells were enriched by MACS using either anti-γδ TCR-PECy7, followed by anti-phycoerythrin-mediated magnetic bead purification. + Vδ2 +γδ T cells were further purified by sorting using an Aria III (BD). Enriched γδ T cells were stimulated in vitro for 48 h with plate-bound anti-CD3ε (OKT3, 10 μg / ml, Bio-X-Cell), soluble anti-CD28 (CD28.2, 1 μg / ml, BD Pharmingen), phytohemagglutinin (0.5 μg / ml, Sigma), and recombinant human IL-2 (100 U / ml, PeproTech), and then maintained with IL-2 for 14–21 days. Cells were cultured in complete medium consisting of a 50:50 (v / v) mixture of AIM-V (Thermo Fisher) and RPMI-1640 supplemented with 10% (v / v) FCS, penicillin (100 U / ml), streptomycin (100 μg / ml), Glutamax (2 mM), sodium pyruvate (1 mM), non-essential amino acids (0.1 mM) and HEPES buffer (15 mM), pH 7.2–7.5, and 50 μM 2-mercaptoethanol.

[0399] Flow cytometry To examine the ability of γδ TCR tetramers to bind BTN molecules, NIH-3T3 cells were transfected with BTN2A1, BTN3A1, or control BTNL3 in pMIG (kindly provided by D. Vignali (Addgene, plasmid #52107) (21)) using ViaFect® (Promega) in OptiMEM™ (Gibco, Thermo-Fisher). Forty-eight hours after transfection, cells were harvested with trypsin, filtered through a 30 or 70 μm cell strainer, and incubated with anti-BTN3A antibody (clone 20.1) or IgG1, kappa isotype control (clone MOPC-21, BioLegend, or BM4-1, kindly provided by CSL Limited) at 5 μg / mL for 15 min at room temperature. Cells were then stained with PE-labeled γδ TCR tetramer (in-house produced, see below) or control PE-conjugated streptavidin at 5 μg / mL for 30 min at room temperature. The median fluorescence intensity (MFI) of γδ TCR tetramer interacting with BTN protein was calculated using the gated GFP +Cells were examined by flow cytometry. For γδ TCR tetramer staining, data were excluded if BTN3A1 mutant protein levels were more than 2-fold lower than wild-type BTN3A1 as determined by anti-BTN3A mAb staining. To examine the ability of BTN tetramers to bind to γδ TCR, HEK293T cells were co-transfected with γδ TCR gene in pMIG using FuGENE® HD (Promega) in OptiMEM™ and 2A-linked CD3εδγζ in pMIG. 48 hours after transfection, cells were harvested by pipetting, filtered through a 30 or 70 μm cell strainer, and stained with anti-CD3ε antibody for 15 min at 4°C. In some experiments, zoledronate was added overnight before cell harvest. Cells were then stained with anti-γδ TCR, anti-TCR Vδ2, as well as PE-labeled BTN tetramers (produced in-house, see below), PE-labeled control mouse CD1d ectodomain tetramers (loaded with α-GalCer, produced in-house, see below), or control PE-conjugated streptavidin (BD) for 30 min at 4°C. Gated CD3 + GFP + The MFI of BTN tetramers on cells was measured by flow cytometry. In other assays, human peripheral blood derived cells were stained with various combinations of antibodies against CD3ε, γδ TCR, TCR Vδ2, CD45, CD25, CD69, and / or isotype control (IgG1, κ clone MOPC-2) in addition to 7-aminoactinomycin D (7-AAD, Sigma) or LIVE / DEAD® viability markers (ThermoFisher) (Table 6). All data were acquired on an LSRFortessa™ II (BD) and analyzed using FACSDiva and FlowJo (BD) software. All samples were gated using time, forward scatter area vs. height, and viability dye parameters, respectively, to exclude unstable events, doublets, and dead cells.

[0400] [Table 6]

[0401] Generation of BTN2A.BTN3A knockout cells HEK293T cells were nucleofected with the Cas9 / RNP complex and two guide RNAs, one targeting the intronic region immediately upstream of BTN3A2 (5'-AACTTTCACCTACAAACCGC; SEQ ID NO: 55) and the other targeting the intronic region downstream of BTN2A1 (5'-GAACCCTGACTGAAACGATC; SEQ ID NO: 56). The guides were designed using the Broad Institute's CRISPick web tool (HK Kim et al., Deep learning improves prediction of CRISPR-Cpf1 guide RNA activity. Nat Biotechnol 36, 239-241 (2018)). After 7 days of culture, RNP+ cells were bulk sorted (FACS Aria III) and single cells were sorted after another round of culture. To confirm excision of the BTN locus, expanded clones were genotyped using PCR primers targeting BTN3A2, BTN2A1 and the excised locus (Table 7).

[0402] [Table 7]

[0403] Jurkat assay 2.5 x 10 per well of a 96-well plate 4 APC (LM-MEL-75) cells were plated and incubated overnight, followed by 2 × 10 4 G115 mutant-expressing J.RT3-T3.5 (Jurkat) cells were treated with ±zoledronate (40 μM) for 20 hours. GFP + CD69 expression on Jurkat cells was measured by flow cytometry. +A panel of 15 single residue alanine (Ala) mutants within the Vδ2 domain of G115 TCR was generated by either site-directed mutagenesis using the primers listed in Table 5 or by cloning gene fragments (IDT). After phosphorylation (PNK, NEB) of the primers (IDT), 25 cycles of PCR were performed using G115 WT TCR in pMIG as template using KAPA HiFi Master Mix (KAPA Biosystems), and PCR products were digested with DpnI (NEB) and, in some cases, ligated with T4 DNA ligase (NEB). The sequences of the constructs were confirmed by Sanger sequencing before use.

[0404] γδ T cell functional assay For co-culture assays, NIH-3T3 cells were transfected with BTN2A1 in combination with wild-type or mutant BTN3A1, or separately with control BTNL3 and BTNL8 in pMIG using ViaFect® in OptiMEM™. 48 hours after transfection, NIH-3T3 cells (3×10 4 ) were harvested and transferred to a 96-well plate, and purified and in vitro expanded Vδ2 + γδ T cells (2 × 10 4 The cells were incubated with 100 μM IgG1 + zoledronate (5 μM) and 100 μM IgG1 + ...

[0405] Detection of Förster resonance energy transfer NIH-3T3 cells were transfected with BTN2A1 in combination with wild-type or mutant BTN3A1, or control BTN2A1 transfected with PDL2 / BTN3A1 transfected with CD80 in pMIG containing ViaFect® in OptiMEM™. 48 hours after transfection, NIH-3T3 cells (3×104 Cells (100 cells) were harvested with trypsin, filtered through a 30-70 μm cell strainer, and stained with anti-BTN2A1-AlexaFluor 647 (clone 259) and BTN3A-PE (clone 103.2) or isotype controls (clones BM4-2a and MOPC-21, respectively) for 30 min at 4 °C. + The frequency of cells identified as GFP-gated + AlexaFluor647 + PE + NIH-3T3 cells were probed. For FRET experiments, data were excluded if BTN3A1 mutant protein levels were more than 2-fold lower than BTN3A1 WT, as determined by anti-BTN3A (clone 103.2) mAb staining.

[0406] Preparation of soluble proteins and tetramers Soluble human BTN2A1-BTN3A1 ectodomains, including those containing "short" or "long" C-terminal linkers, "high" and "low" affinity C-terminal zippers, BTN3A1 Glu106-Ala mutations or those containing BTN2A1 Gly102-Cys / BTN3A1 Asp103-Cys mutations, or alternatively BTN2A1 ectodomains containing a C-terminal Cys (Cys247) and an acidic or basic leucine zipper, along with soluble γδ TCR, BTN1A1, BTN2A1 lacking Cys247, BTN3A1, BTN3A1 IgV domain, and mouse CD1d ectodomain, all using ExpiFectamine or PEI, respectively, along with pHL-sec vector DNA encoding constructs with a C-terminal biotin ligase (AviTag™) and His6 tag. null(GNTI) Expression was achieved by transient transfection of HEK-293S cells (DNA ratio 1:1 when the two constructs were cotransfected) (AR Aricescu et al., A time- and cost-efficient system for high-level protein production in mammalian cells. Acta Crystallogr D Biol Crystallogr 62, 1243-1250 (2006)). Proteins were purified from culture supernatants using immobilized metal affinity chromatography (IMAC) and gel filtration and enzymatically biotinylated using BirA (in-house production). Proteins were repurified by size-exclusion chromatography and stored at -80°C. Biotinylated proteins were tetramerized with streptavidin-PE (BD) at a molar ratio of 4:1.

[0407] Structure determination BTN2A1 and G115 γδ TCR (WT or Lys53δ-Ala) were mixed at a 1:1 molar ratio (15 mg / ml in Tris-buffered saline pH 8) and crystallized in 20% polyethylene glycol (PEG) 3350 / 0.2 M sodium malonate / malonic acid pH 7.0 at 20 °C, apoBTN2A1 (10 mg / ml in Tris-buffered saline pH 8) was crystallized in 1.65 M ammonium sulfate / 2% (v / v) PEG 400 / 0.1 M HEPES pH 8 at 20 °C, and the BTN2A1-BTN3A1 zippered complex (1 mg / ml in Tris-buffered saline pH 8) was crystallized in 6% (w / v) PEG 6000 / 0.1 M magnesium sulfate / 0.1 M HEPES pH 6 at 20 °C by dropwise vapour diffusion (C3 facility, CSIRO, Crystallization was performed using the MX2 (3ID1) beamline at Australian Synchrotron. Crystals of BTN2A1-G115 γδTCR, apo-BTN2A1, and the BTN2A1-BTN3A1 zippered complex were flash frozen in mother liquor containing 27.5% (w / v) PEG / 0.2 M sodium malonate, 1.8 M ammonium sulfate / 2% (v / v) PEG 400 / 15% (v / v) glycerol, or in well liquor containing 20% ​​(v / v) glycerol, respectively. Data were collected at 100K using the MX2 (3ID1) beamline at Australian Synchrotron equipped with an Eiger detector operating at 100Hz.Data were integrated using iMosflm version 7.3.0 (T.G. Battye, L. Kontogiannis, O. Johnson, H.R. Powell, A.G. Leslie. iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM. Acta Crystallogr D Biol Crystallogr 67, 271-281 (2011)) and anisotropy correction was applied to the data, processed using the Aimless package in CCP4 for BTN2A1-G115 γδTCR, and submitted to the STARANISO Server (Global Phasing Ltd.) (staraniso.globalphasing.org / cgi-bin / staraniso.cgi) for apoBTN2A1 and the BTN2A1-BTN3A1 zippered complex with anisotropy cutoff.ApoBTN2A1 was analyzed by molecular replacement using the IgV and IgC domains of bovine BTN1A1 as separate search ensembles (PDB code 4HH8 (A. Eichinger, I. Neumaier, A. Skerra. The extracellular region of bovine milk butyrophilin exhibits closer structural similarity to human myelin oligodendrocyte glycoprotein than to immunological BTN family receptors. Biol Chem, (2021))), and BTN2A1-G115 γδTCR was identified as the G115 TCR (PDB code 1 HXM (TJ Allison, CC Winter, JJ Fournie, M. Bonneville, DN Garboczi. Structure of a human gammadelta T-cell antigen receptor. Nature 411, 820-824 (2001))) and monomeric BTN2A1, and the BTN2A1-BTN3A1 zippered complex was analyzed using monomeric BTN2A1 and BTN3A1 (from PDB code 4F80 (A. Palakodeti et al., The molecular basis for modulation of human Vgamma9Vdelta2 T cell responses by CD277 / butyrophilin-3 (BTN3A)-specific antibodies. 287, 32780-32790 (2012)) with Phaser (P.D. Adams et al., PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66, 213-221 (2010)).Refinement of the BTN2A1-G115 γδTCR was performed by iterative rounds of model building to the experimental map in Coot and refinement with Buster version 2.10.4 (Global Phasing) using non-crystallographic symmetry (NCS) restraints applied to BTN2A1, except for residues at the TCR binding interface (OS Smart et al., Exploiting structure similarity in refinement: automated NCS and target-structure restraints in BUSTER. Acta Crystallogr D Biol Crystallogr 68, 368-380 (2012)). Refinement of apoBTN2A1 and the BTN2A1-BTN3A1 zippered complex were similarly restrained against unliganded copies of BTN2A1 from the BTN2A1-G115 γδTCR or BTN3A1 from 4F80, except for residues at the interface. Structural models were solved using the CCP4 suite version 7.1 (M. D. Winn et al., Overview of the CCP4 suite and current developments. Acta Crystallogr D Biol Crystallogr 67, 235-242 (2011)). Molecular diagrams were created using PyMOL (Schrodinger). Cation-π interactions were determined as described (32). Angles were calculated between the centers of mass of the Ig domains or, in some cases, the intersection of two planes defined by three points each. Modeling of Figure S10 was done using AlphaFold 2.0 (J. Jumper et al., Highly accurate protein structure prediction with AlphaFold. Nature 596, 583-589 (2021)).

[0408] Surface plasmon resonance SPR experiments were performed at 25 °C on a Biacore T200 instrument (GE Healthcare) using 10 mM HEPES-HCl (pH 7.4), 150 mM NaCl, 3 mM EDTA, and 0.05% Tween 20 buffer. Biotinylated BTN ectodomain was immobilized at 1,500-2,000 resonance units (RU) on a Biacore sensor chip SA pre-immobilized with streptavidin. Soluble BTN molecules or G115 γδ TCR were serially diluted 2-fold and injected simultaneously over the test and control surfaces at a rate of 30 μl / min. After subtraction of data from a control flow cell (BTN1A1) and blank injections, interactions were analyzed using Biacore T200 evaluation software (GE Healthcare), Scrubber (Biologic) and Prism version 9 (GraphPad) to derive equilibrium dissociation constants at equilibrium.

[0409] Electron microscope Soluble BTN2A1 Gly130-Cys BTN3A1 Asp132-Cys complexes were enzymatically digested with thrombin to remove the C-terminal leucine zipper, repurified by size-exclusion and anion-exchange chromatography, and spotted onto glow-discharged 400-mesh thin carbon-coated copper grids for 30 s in 380 μg / ml TBS, followed by negative staining with 2% w / v uranyl acetate. Grids were viewed at a nominal magnification of 52,000x on an FEI Tecnai F30 (Eindhoven, NL) 300 kV transmission electron microscope. Seventeen micrographs were acquired with a CETA (Thermofisher, USA) camera with a pixel size of 3.7 Å. Particles were sampled using blob sampling followed by 2D class averaging in cryoSPARC (A. Punjani, JL Rubinstein, DJ Fleet, MA Brubaker, cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods 14, 290-296 (2017)), with 10,238 particles contributing to the final set of 2D class averages.

[0410] statistical analysis γδ T cell functional assays were analyzed by two-way ANOVA with Sidak's correction when comparing γδ T cell activation (CD25+) across different BTN variants with and without treatment. All independent data points are biological replicates.

[0411] Germline modification of Vδ2 in purified γδ T cells Primary V52+ T cells were enriched from PBMCs using anti-PE magnetic beads (Miltenyl) after staining with anti-PE-cy7 γδ TCR mAb (clone: ​​11F2 at 1:20 dilution). Cells were stimulated on plates coated with anti-CD3 (clone: ​​UCHT1, at 5 μg / mL) and soluble anti-CD 28 (clone: ​​T44, at 10 μg / mL) in medium containing 10 U / mL IL-2. Three days later, cells were nucleofected with guide RNAs targeting the CDR2δ region proximal to Lys53 of the Vδ2 chain (guide RNA#1: GACTTTCATATACCGAGAAA (SEQ ID NO: 93); guide RNA#2 GGCCATAGATGTCCTTTTCT (SEQ ID NO: 94) plus a HDR single-stranded oligonucleotide template encoding the Lys53δ-Ala point mutation (Alt-R HDR oligonucleotide sequence: A*C*CTT GGA AAT TGT CTT TGA AAC CAG GGC CAT AGA TGT CCG CCT CTC GGT ATA TGA AAG TCA TTG TGT TAC CTT GGG TCT T*C*C, where * represents a phosphorothioate linkage (SEQ ID NO: 95) Integrated DNA Technologies). Cells were maintained for an additional 7 days, at which point they were screened by flow cytometry. Tumor killing assays were performed 10 days after nucleofection.

[0412] Activation of Vδ2 T cells in the absence of phosphoantigen BTN2A1, BTN3A1, or BTN2A1-BTN3A1 zipper complex, or control protein, were immobilized at 10 μg / mL on 96-well tissue culture plates overnight at 4° C. In one group, the BTN2A1-BTN3A1 zipper complex was preincubated overnight with thrombin to cleave the zipper. The plates were washed to remove unbound ligand, and purified pre-expanded V52 + Cells were added and CD25 expression was measured in gated cells after overnight co-culture.

Claims

1. (i) a first polypeptide comprising an IgV-like domain of BTN2 or a Vγ9+ TCR binding portion thereof and a first heterologous C-terminal dimerization peptide; and (ii) a second polypeptide comprising an IgV-like domain of BTN3 or a V52+ TCR binding portion thereof and a second heterologous C-terminal dimerization peptide that specifically dimerizes with the first heterologous C-terminal dimerization peptide to form a heterodimerization domain. Including, Vγ9Vδ2 + BTN2-BTN3 heteromeric complex that binds to the TCR.

2. 2. The BTN2-BTN3 heteromeric complex of claim 1, wherein the heterodimerization domain is a coiled-coil domain.

3. The BTN2-BTN3 heteromeric complex of claim 2, wherein the dimerization peptides are c-jun and c-fos dimerization peptides.

4. 2. The BTN2-BTN3 heteromeric complex of claim 1, wherein the heterodimerization domain comprises a disulfide bond.

5. 5. The BTN2-BTN3 heteromeric complex of claim 4, wherein the dimerization peptide comprises a Cys residue.

6. (i) a first polypeptide comprising the IgV-like domain of BTN2 or a Vγ9+ TCR binding portion thereof; (ii) a second polypeptide comprising the IgV-like domain of BTN3 or a V52+ TCR-binding portion thereof; and (iii) a peptide linker that links the first and second polypeptides into a single-chain polypeptide. Including, The BTN2-BTN3 heteromeric complex binds to Vγ9Vδ2+ TCRs.

7. 7. The BTN2-BTN3 heteromeric complex of claim 6, wherein the single-chain linker comprises about 15 to 40 amino acids.

8. 7. The BTN2-BTN3 heteromeric complex of claim 6, wherein the single-chain linker comprises about 50 to 150 amino acids.

9. 9. The BTN2-BTN3 heteromeric complex of any one of claims 6 to 8, wherein at least about 80% of the residues in the linker are glycine or serine residues.

10. The BTN2-BTN3 heteromeric complex of claim 6, wherein the linker does not contain a proline residue.

11. The BTN2-BTN3 heteromeric complex of claim 1, which binds to Vγ9Vδ2+ TCR independent of phosphoantigen.

12. The BTN2-BTN3 heteromeric complex of claim 1, which binds to a Vy9V52+ TCR with enhanced binding compared to BTN2 or BTN3 alone.

13. Vγ9Vδ2 + 2. The BTN2-BTN3 heteromeric complex of claim 1, which induces or enhances TCR activation.

14. 2. The BTN2-BTN3 heteromeric complex of claim 1, wherein the first polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:

1.

15. 2. The BTN2-BTN3 heteromeric complex of claim 1, wherein the second polypeptide comprises an amino acid sequence that is at least 70% identical to the sequence set forth in SEQ ID NO:

2.

16. The BTN2-BTN3 heteromeric complex of claim 1 which is soluble.

17. 17. The BTN2-BTN3 heteromeric complex of claim 16, wherein the first and second polypeptides lack functional transmembrane and cytoplasmic domains.

18. 2. The BTN2-BTN3 heteromeric complex of claim 1, wherein one or both of the first and second polypeptides comprises one or a modified amino acid residue selected from the group consisting of glycosylated amino acids, PEGylated amino acids, farnesylated amino acids, acetylated amino acids, biotinylated amino acids, and amino acids conjugated to a lipid moiety.

19. 2. The BTN2-BTN3 heteromeric complex of claim 1, wherein one or both of the first and second polypeptides further comprise one or more purification sequences optionally selected from the group consisting of an epitope tag, a FLAG tag, a polyhistidine sequence, and a GDT fusion.

20. 2. The BTN2-BTN3 heteromeric complex of claim 1, wherein one or both of the first and second polypeptides are glycosylated and have a glycosylation pattern accessible from Expi293 cells.

21. 2. The BTN2-BTN3 heteromeric complex of claim 1 which binds to activin.

22. 2. The BTN2-BTN3 heteromeric complex of claim 1, which binds to activin A.

23. A multivalent BTN2-BTN3 complex comprising two or more linked BTN2-BTN3 heteromeric complexes of claim 1.

24. A modified BTN3 or its Vδ2, wherein the modified BTN3 comprises an IgV-like domain, and the IgV-like domain comprises an alteration at a position corresponding to glutamic acid (E) 106 in the amino acid sequence shown in SEQ ID NO:

2. + TCR-binding fragment.

25. 25. The modified BTN3 or V52 thereof of claim 24, wherein the modification is a substitution of glutamic acid (E) to alanine (A) at position 106. + TCR-binding fragment.

26. 25. The modified BTN3 or V52 thereof of claim 24, wherein the IgV-like domain comprises an amino acid sequence having at least 70% identity to SEQ ID NO:

2. + TCR-binding fragment.

27. The modified BTN3 or its V52 of claim 24, wherein the modified BTN3 binds to V52+ TCR independently of phosphoantigen. + TCR-binding fragment.

28. Modified BTN3 binds Vδ2 with enhanced binding + The modified BTN3 or V52 thereof of claim 24, which binds to TCR. + TCR-binding fragment.

29. The modified BTN3 is Vδ2 + The modified BTN3 or V52 thereof of claim 24, which induces or enhances TCR activation. + TCR-binding fragment.

30. A modified BTN2 or its Vγ9 domain, wherein the modified BTN2 comprises an IgV-like domain, the IgV-like domain comprising a modification at a position corresponding to serine (S) 44 in the amino acid sequence shown in SEQ ID NO:

1. + TCR-binding fragment.

31. 31. The modified BTN2 or Vγ9 thereof of claim 30, wherein the modification is a substitution of serine (S) at position 44 with arginine (R). + TCR-binding fragment.

32. 31. The modified BTN2 or Vγ9 thereof of claim 30, wherein the IgV-like domain comprises an amino acid sequence having at least 70% identity to SEQ ID NO:

1. + TCR-binding fragment.

33. Modified BTN2 inhibits Vγ9 expression in a phosphoantigen-independent manner + The modified BTN2 or Vγ9 thereof of claim 30, which binds to TCR. + TCR-binding fragment.

34. The modified BTN2 or its Vγ9+ TCR binding fragment described in claim 30, wherein the modified BTN2 binds to Vγ9Vδ2+ TCR with enhanced binding when complexed with BTN3.

35. The modified BTN2 or its V52 of claim 30, wherein the modified BTN2 induces or enhances Vy9V52+ TCR activation when complexed with BTN3. + TCR-binding fragment.

36. 30. One or more nucleic acids encoding the BTN2-BTN3 heteromeric complex of claim 1, the multivalent BTN2-BTN3 complex of claim 23, the modified BTN3 of claim 24, or the modified BTN2 of claim 30.

37. i) a nucleic acid sequence having at least 70% identity to SEQ ID NO:5, and / or ii) a nucleic acid sequence having at least 70% identity to SEQ ID NO:6 37. The one or more nucleic acids of claim 36, comprising:

38. 30. One or more vectors comprising one or more nucleic acids encoding the BTN2-BTN3 heteromeric complex of claim 1, or the multivalent BTN2-BTN3 complex of claim 23, the modified BTN3 of claim 24, or the modified BTN2 of claim 30.

39. 38. A host cell comprising the BTN2-BTN3 heteromeric complex of claim 1, the multivalent BTN2-BTN3 complex of claim 23, the modified BTN3 of claim 24, or the modified BTN2 of claim 30, one or more nucleic acids of claim 36, or one or more vectors of claim 38.

40. δ2 + 25. A method for activating a γδ T cell expressing a TCR, comprising contacting the cell with a BTN2-BTN3 heteromeric complex of claim 1, a multivalent BTN2-BTN3 complex of claim 23, or an engineered BTN3 of claim 24, and optionally administering the activated γδ T cell to a subject in need thereof.

Images