Sestrin-MAPK complex inhibitors

Abstract

The present invention provides cyclic polypeptides, derivatives or analogs thereof, comprising or consisting of an amino acid sequence derived from Sestrin or a truncation thereof, which can be used in treating, preventing or ameliorating infectious diseases (viral and bacterial) and age-related conditions, such as cancer and neurodegenerative disorders, particularly conditions associated with or caused by impaired T-cell mediated immune system responses.

Description

[Technical field]

[0001] The present invention relates to inhibitors of the Sestrin-MAPK complex (sMAC), also referred to herein as disruptors of sMAC (i.e., "DOS"), particularly, but not exclusively, to cyclic polypeptide (DOS) inhibitors of sMAC. The invention also relates to the use of these DOS compounds in treating, preventing, or ameliorating infectious diseases (viral, bacterial, and protozoan) and age-related conditions, such as cancer and neurodegenerative disorders. The invention particularly relates to treating conditions associated with or caused by ageing, or impaired immune system responses mediated by T cells. The invention also extends to pharmaceutical compositions comprising the DOS compounds, and to methods of making such DOS compounds. [Background technology]

[0002] Demographics around the world continue to shift toward an older population, with the geriatric population expected to reach over 2 billion by 2050 (Lutz et al., 2008). One challenge to healthy aging is immunosenescence, which predisposes older individuals to increased risk of cancer, neurodegenerative and infectious diseases, such as influenza and other life-threatening outbreaks, such as the most recent coronavirus pandemic (Akbar et al., 2016; Dorshkind et al., 2009). Vaccination is an efficient way to boost immunity in younger people, but the efficacy of any vaccination strategy in the elderly and immunocompromised is highly compromised, resulting in increased hospitalizations and associated with high morbidity and mortality (Goronzy and Weyand, 2013; Levin, 2012; Yousefzadeh et al., 2021). Currently, strategies to restore long-lasting immune defenses in elderly people are lacking, especially approaches aimed at rejuvenating the immune system and halting the transmission of infection among vaccinated individuals.Therefore, there is an urgent need to implement new strategies to improve the quality of life in aging.

[0003] Immune cells that display features of senescence increase during aging (Weng et al., 2009). Indeed, in older individuals, more than 50% of immune cells are senescent. As T cells progress to senescence, there is a progressive loss of the costimulatory receptors CD27 and CD28. Early CD4+ T cells are CD27+ CD28+, those at intermediate stages are CD27- CD28+, and the senescent CD4+ T cell population is CD27- CD28- (Lanna et al., 2014).

[0004] Stress molecules known as sestrins are encoded in humans by the Sesn1, Sesn2, and Sesn3 genes. Sestrins accumulate in T cells and bind to and activate AMP-responsive protein kinase (AMPK) (Lanna et al., 2017). AMPK is a heterotrimeric protein consisting of a catalytic α subunit and regulatory β and γ subunits that is activated in response to increased intracellular AMP / ATP ratios. AMPK activation then coordinates global (ERK, JNK, p38) mitogen-activated protein kinase (MAPK) activation through autophosphorylation (see Figure 1).

[0005] Three major subgroups of MAPKs have been identified, including extracellular-regulated protein kinase (ERK), c-Jun N-terminal kinase (JNK), and p38 (Johnson and Lapadat, 2002). MAPK signaling enzymes are involved in diverse aspects of mammalian physiology, including senescence, aging, and metabolism. For example, as shown in Figure 1, JNK inhibits TCR-CD28 signaling, p38 inhibits telomerase activity, and ERK increases DNA damage, all contributing to the accumulation of senescent T cells during aging (Lanna et al., 2017). Summary of the Invention

[0006] The inventors have previously shown that a large complex of immunoinhibitory proteins, the Sestrin-MAPK complex (sMAC), accumulates in immunological cells (e.g., T cells) during aging, leading to a senescent dysfunctional state (Lanna et al, Nature Immunology, 2014 and 2017; WO 2018 / 100410). Thus, the inventors hypothesized that targeted inhibition of Sestrin could disrupt Sestrin-dependent sMAC activation, thereby preventing, delaying, or reversing immunosenescence.

[0007] Currently, there are no known drugs that actively target and inhibit sMAC. Certain experimental approaches, such as sustained administration of mTOR inhibitors, have been proposed to combat immunosenescence and improve vaccination efficacy in the elderly, but these approaches have only shown modest efficacy (Mannick et al., 2014). For example, such approaches have not exceeded a 20% increase in antibody titers after vaccination (Mannick et al., 2014). Additionally, these approaches entail high costs and difficult adherence, as they must be administered daily for 8 weeks before vaccination protocols can begin (Mannick et al., 2014). Other experimental approaches in senolytics are far from ideal, as killing senescent immune cells to achieve rejuvenation can result in severe immune deficiency due to age-progressive thymic involution (Carpenter et al., 2021). Additionally, targeting Sestrin with small molecule inhibitors to prevent sMAC activation is further complicated by the fact that Sestrin lacks enzymatic activity and has no obvious catalytic domain to target ( Budanov et al., 2010 ).

[0008] Therefore, there is a great need for improved therapies that can directly target and prevent Sestrin-dependent sMAC activation and immunosenescence, thereby revitalizing immunity during ageing.

[0009] As described in the Examples, the inventors have generated novel inhibitors of sMAC, named DOS compounds (disruptors of sMAC). These DOS compounds are (in most embodiments) pentameric cyclic peptides that inhibit sMAC at nanomolar doses by directly targeting sestrins for proteasomal degradation. Surprisingly, the inventors have observed that these novel DOS compounds can confer long-term immune protection at a single dose, both in the presence and absence of a vaccine, which was highly unexpected in the absence of a vaccine. This is particularly advantageous compared to mTORC1 inhibitors or AMPK activators, which either require pre-administration (several weeks before immunization) with a vaccine (mTORC1 inhibitors) (Mannick et al., 2014) or need to be timed when a memory immune response is generated (AMPK activators) (Pearce et al., 2009). DOS compounds do not induce cell death, but instead can reprogram the aged immune system, effectively "rejuvenating" it. Advantageously, being able to rejuvenate senescent cells rather than kill them could preserve immunity in the elderly and further extend human life span.

[0010] Thus, according to a first aspect of the present invention there is provided a cyclic polypeptide comprising or consisting of an amino acid sequence derived from a sestrin, or a truncation thereof, a derivative or analogue thereof.

[0011] Sestrins are stress-inducible metabolic proteins, and humans express three sestrin proteins, sestrin1, sestrin2, and sestrin3 (Lee et al., 2013), each encoded by the genes Sesn1, Sesn2, and Sesn3, respectively.

[0012] Thus, in one embodiment the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from Sestrin 1 or a truncation thereof.

[0013] The protein sequence of one isoform of human Sestrin1 (Gen Bank:27244) is 492 amino acids in length and is provided herein as SEQ ID NO:1, as follows:

[0014] [ka]

[0015] The protein sequence of another isoform of human Sestrin1 (Gen Bank:27244) is 551 amino acids long and is provided herein as SEQ ID NO:2, as follows:

[0016] [ka]

[0017] The protein sequence of another isoform of human Sestrin1 (Gen Bank:27244) is 426 amino acids long and is provided herein as SEQ ID NO:3, as follows:

[0018] [ka]

[0019] Thus, preferably, the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from Sestrin 1 or a truncation thereof, wherein Sestrin 1 has an amino acid sequence substantially as set forth in SEQ ID NO: 1, 2 or 3, or a variant or fragment thereof.

[0020] Alternatively, in another embodiment, the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from Sestrin 2 or a truncation thereof.

[0021] The protein sequence of one isoform of Sestrin2 (Gen Bank:83667) is 480 amino acids long and is provided herein as SEQ ID NO:4, as follows:

[0022] [ka]

[0023] Thus, preferably, the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from Sestrin 2 or a truncation thereof, wherein Sestrin 2 has an amino acid sequence substantially as set forth in SEQ ID NO: 4 or a variant or fragment thereof.

[0024] Alternatively, in another embodiment, the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from Sestrin 3 or a truncation thereof.

[0025] The protein sequence of one isoform of human Sestrin3 (Gen Bank:143686) is 492 amino acids in length and is provided herein as SEQ ID NO:5, as follows:

[0026] [ka]

[0027] The protein sequence of another embodiment of human Sestrin3 (Gen Bank:143686) is 321 amino acids in length and is provided herein as SEQ ID NO:6, as follows:

[0028] [ka]

[0029] The protein sequence of another embodiment of human Sestrin3 (Gen Bank:143686) is 353 amino acids in length and is provided herein as SEQ ID NO:7, as follows:

[0030] [ka]

[0031] Thus, preferably, the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from Sestrin 3 or a truncation thereof, wherein Sestrin 3 has an amino acid sequence substantially as set forth in SEQ ID NO: 5, 6 or 7, or a variant or fragment thereof.

[0032] Preferably, however, the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from Sestrin 2 or a truncation thereof.

[0033] A cyclic polypeptide is a peptide chain in which the N-terminus and C-terminus are linked together and to themselves by peptide bonds forming a cyclic chain of amino acids (Joo, 2012), and to date no cyclic peptides have been developed that contain an amino acid sequence derived from any of Sestrin 1, 2, or 3 (preferably Sestrin 2) or truncations thereof.

[0034] The term "derivative or analog thereof" may refer to a polypeptide in which an amino acid residue is replaced by a residue having similar side chain or peptide backbone properties, whether natural amino acid, unnatural amino acid, or amino acid mimetic. Additionally, the termini of such peptides may be protected by N- and / or C-terminal protecting groups having properties similar to acetyl or amide groups.

[0035] Derivatives and analogs of the polypeptides according to the present invention can also include those that increase the half-life of the peptide in vivo. For example, derivatives or analogs of the peptides of the present invention can include peptoid and retropeptoid derivatives of the peptides, peptide-peptoid hybrids of the peptides, and D-amino acid derivatives of the peptides.

[0036] Peptoids or poly-N-substituted glycines are a class of peptoid mimics in which the side chains are attached to the nitrogen atoms of the peptide backbone, rather than to the alpha-carbon as in amino acids. Peptoid derivatives of the peptides of the invention can be easily designed from knowledge of the structure of the peptide. Retropeptoids (in which all amino acids are replaced by peptoid residues in reverse order) are also suitable derivatives according to the invention. Retropeptoids are expected to bind in the opposite orientation in the ligand-binding groove compared to peptides or peptoid-peptide hybrids containing one peptoid residue. As a result, the side chains of the peptoid residues can point in the same direction as the side chains in the original peptide. D-amino acid (rather than L-amino acid) derivatives of peptides reduce undesired degradation of the peptide by proteases. The term "derived from" can refer to an amino acid sequence that is a derivative or modification of an amino acid sequence present in or forming Sestrin 1, 2, or 3 (preferably Sestrin 2) and portions thereof.

[0037] The term "truncations thereof" may mean that a cyclic polypeptide derived from Sestrin 1, 2, or 3 (preferably Sestrin 2) has been reduced in size by the removal of amino acids. The reduction in amino acids may be achieved by removal of residues from the C-terminus and / or N-terminus of the peptide prior to cyclization into a cyclic polypeptide of the invention, or may be achieved by deletion of one or more amino acids from within the core of the peptide prior to cyclization.

[0038] Preferably, the cyclic polypeptide is purified and / or isolated, ie, it is not found in nature, and even more preferably, is synthesized de novo, as described below.

[0039] It has been shown that the first 160 amino acid residues of Sestrin2 (SEQ ID NO: 4) are thought to be involved in Sestrin-AMPK interaction (Budanov and Karin, 2008). Thus, the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from the first 160 amino acids forming Sestrin2 or a truncation thereof, preferably wherein Sestrin2 comprises an amino acid sequence substantially as set out in SEQ ID NO: 4 or a variant or fragment thereof.

[0040] Alternatively, in another embodiment, the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from the first 160 amino acids forming Sestrin 1 or a truncation thereof, preferably wherein Sestrin 1 comprises an amino acid sequence substantially as set forth in SEQ ID NO: 1, 2 or 3, or a variant or fragment thereof.

[0041] Alternatively, in another embodiment, the cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence derived from the first 160 amino acids forming Sestrin 3 or a truncation thereof, preferably Sestrin 3 comprises an amino acid sequence substantially as set out in SEQ ID NO: 5, 6 or 7, or a variant or fragment thereof. Most preferably, Sestrin 3 comprises an amino acid sequence substantially as set out in SEQ ID NO: 5.

[0042] As discussed in the Examples and shown in FIG. 27, the inventors found that DOS compounds likely bind within domain A of Sestrin2, at the interface with domains B and C, and importantly, far from the double aspartic acid (D406 / D407) GATOR / mTORC1 regulatory site (Kim et al., 2015). Indeed, biotinylated compounds were found to bind to sMAC but not elements of the gator / mTORC1 complex in T cells (FIG. 8D). Thus, it is preferred that the cyclic polypeptide, derivative or analogue thereof is configured to bind to domain A of Sestrin2. Even more preferably, the cyclic polypeptide, derivative or analogue thereof is configured to bind to domain A of Sestrin2 at the interface with domains B and C of Sestrin2. Preferably, the cyclic polypeptide, derivative or analogue thereof is configured to bind away from (i.e., do not bind to) the dual aspartic acid (D406 / D407) GATOR / mTORC1 regulatory site of Sestrin2.

[0043] Additionally, the DOS compounds are also expected to bind within domain A of Sestrin 1 and 3. Thus, the cyclic polypeptide, derivative or analog thereof is preferably configured to bind to domain A of Sestrin 1 and / or Sestrin 3. Even more preferably, the cyclic polypeptide, derivative or analog thereof is configured to bind at the interface between domain A of Sestrin 1 and / or Sestrin 3 and domain B and domain C of Sestrin 1 and / or Sestrin 3. Preferably, the cyclic polypeptide, derivative or analog thereof is configured to bind away from (i.e., not bind to) the GATOR / mTORC1 regulatory site of Sestrin 1 and / or Sestrin 3. It should be noted that the regulatory sites in Sestrin 1 and Sestrin 3 are not necessarily identical, particularly since it has been found that in Sestrin 3, its interaction with GATOR is constitutive (e.g., insensitive to leucine deprivation) (Wolfson et al., 2016).

[0044] Preferably, the cyclic polypeptide, derivative or analogue thereof comprises or consists of 2 to 20 amino acid residues, more preferably 2 to 15 amino acid residues, more preferably 2 to 10 amino acid residues, even more preferably 2 to 7 amino acids. Preferably, the cyclic polypeptide, derivative or analogue thereof comprises or consists of 3 to 20 amino acid residues, more preferably 3 to 15 amino acid residues, more preferably 3 to 10 amino acid residues, even more preferably 3 to 7 amino acids. Preferably, the cyclic polypeptide, derivative or analogue thereof comprises or consists of 4 to 20 amino acid residues, more preferably 4 to 15 amino acid residues, more preferably 4 to 10 amino acid residues, even more preferably 4 to 7 amino acids.

[0045] Preferably, the cyclic polypeptide, derivative or analogue thereof comprises or consists of 2 to 15 amino acid residues, more preferably 3 to 9 amino acid residues, more preferably 3 to 8 amino acid residues, even more preferably 4 to 7 amino acids.

[0046] Most preferably, the cyclic polypeptide, derivative or analogue thereof comprises or consists of 5 amino acid residues.

[0047] In one embodiment, the cyclic polypeptide, derivative or analog thereof comprises or consists of an amino acid sequence set forth in any one of SEQ ID NOs: 8-84, as follows:

[0048] [Table 1]

[0049] Thus, a preferred cyclic polypeptide, derivative or analogue thereof according to the invention comprises or consists of an amino acid sequence substantially as set out in any one of SEQ ID NOs: 8 to 84 or a functional variant or fragment thereof. The peptides of the first aspect are referred to herein as DOS compounds, i.e. disruptors of sMAC.

[0050] As shown in Figures 30 and 31, the cyclic polypeptide has a DOS alt A cyclic polypeptide may be referred to as a DOS sel SEQ ID NO: 167 (DOSsel3) is sometimes referred to as a cyclic polypeptide that does not have the amino acid residues conserved between Sestrin1 / 3 and Sestrin2 in a blast search at the same position. Note that in situations where selective inhibition is preferred, selective compounds that lack the essential motif may be desirable. *** , RGGGS) may be the most preferred selective inhibitor for epilepsy, a condition in which Sestrin3 plays a role in disease development (Johnson et al., 2015).

[0051] Alternatively, as shown in Figures 32 and 33, the cyclic polypeptide may be sim In addition, two types of consensus sequences are sometimes called DOS sequences, i.e., when the BLAST search identifies regions of homology (chemical similarity) at different positions. In addition, two types of consensus sequences; sequences have overlap and / or chemical similarity between any two Sestrins, and they are referred to herein as DOS sequences. con the first type, called sestrin-specific sestrins (Figures 34 and 35); the second type, whose sequences are completely overlapped among all three sestrins (these are DOS supercon Note the presence of the .gamma.-dimension (shown in FIG. 36).

[0052] Thus, in another embodiment, the cyclic polypeptides, derivatives or analogs thereof according to the invention comprise or consist essentially of an amino acid sequence as set forth in SEQ ID NO: 58, 59, 63, 65, 86, 87, 92, 94-97, 107, 113, 114, 116-119, 121-124, 126, 130, 133, 148, 150, 154, 155, 159-162, 170-172, 174, 179, 187, 190, 196-199, or 202, or any one of its functional variants or fragments. alt These are called cyclic polypeptides.

[0053] Alternatively, in yet another embodiment, the cyclic polypeptides, derivatives or analogs thereof according to the present invention comprise or consist essentially of any one of the amino acid sequences set forth in SEQ ID NOs: 58-60, 62-65, 71-73, 88-91, 93, 98-112, 115, 120, 125, 127-129, 131, 132, 134-147, 149, 151-153, 156-158, 163-169, 173, 175, 176, 180-186, 188, 189, 191-195, 200, 201, or 203-205, or functional variants or fragments thereof. These cyclic peptides are DOS sel These are called cyclic polypeptides.

[0054] Alternatively, in yet another embodiment, the cyclic polypeptides, derivatives or analogs thereof according to the present invention comprise or consist essentially of any one of the amino acid sequences set forth in SEQ ID NOs: 89-91, 97, 176, 180, or 206-234, or functional variants or fragments thereof. These cyclic peptides are DOS sim These are called cyclic polypeptides.

[0055] Alternatively, in yet another embodiment, the cyclic polypeptides, derivatives or analogs thereof according to the present invention comprise or consist essentially of the amino acid sequence set forth in SEQ ID NOs: 54, 56, 57, 177, 178, 235-269, or any one of their functional variants or fragments. con These are called cyclic polypeptides.

[0056] Alternatively, in yet another embodiment, the cyclic polypeptides, derivatives or analogs thereof according to the present invention comprise or consist essentially of any one of the amino acid sequences set forth in SEQ ID NOs: 58, 59, 62-65, 107, or functional variants or fragments thereof. These cyclic peptides are DOS supercon These are called cyclic polypeptides.

[0057] It is well known to those skilled in the art that amino acids can be L- or D-type. Thus, in one embodiment, the cyclic polypeptide, its derivative or analogue, is composed of only L-amino acids. Thus, in this embodiment, it will be understood that the cyclic polypeptide of the present invention is an L-enantiomer. Alternatively, in another embodiment, the cyclic polypeptide, its derivative or analogue, is composed of only D-amino acids. Thus, in this embodiment, the cyclic polypeptide of the present invention is a D-enantiomer. Alternatively, in another embodiment, the cyclic polypeptide, its derivative or analogue, contains both D- and L-amino acids. The names given to the cyclic polypeptides of the present invention indicate whether they are D- or L-enantiomers, for example, DOS46L (SEQ ID NO: 22) is an L-enantiomer, while DOS46D is a D-enantiomer.

[0058] The most preferred cyclic polypeptide, derivative or analogue thereof comprises or consists essentially of an amino acid sequence as set forth in SEQ ID NO: 22 or a functional variant or fragment thereof. Even more preferably, the cyclic polypeptide, derivative or analogue thereof comprises the L-enantiomer or consists essentially of the L-amino acid sequence as set forth in SEQ ID NO: 22. This peptide is referred to herein as DOS46L.

[0059] Another preferred cyclic polypeptide, derivative or analogue thereof comprises or consists of an amino acid sequence substantially as set forth in SEQ ID NO: 77, or a functional variant or fragment thereof. Even more preferably, the cyclic polypeptide, derivative or analogue thereof comprises the D-enantiomer or consists of a D-amino acid sequence substantially as set forth in SEQ ID NO: 77. This peptide is referred to herein as DOS144D.

[0060] Another preferred cyclic polypeptide, derivative or analogue thereof comprises or consists essentially of an amino acid sequence as set forth in SEQ ID NO: 47, or a functional variant or fragment thereof. Even more preferably, the cyclic polypeptide, derivative or analogue thereof comprises the L-enantiomer or consists essentially of the L-amino acid sequence as set forth in SEQ ID NO: 47. This peptide is referred to herein as DOS104L.

[0061] It will be understood that the polypeptides or peptides described herein can be synthesized de novo using standard peptide synthesis methods commonly known to those skilled in the art, and can then be used in any of the therapeutic applications described herein. Thus, any of the peptides can be made by forming peptide bonds between adjacent amino acids of the sequences provided herein to build up to the full sequence length, i.e., a first amino acid is provided to which a second amino acid is attached, and so on, until the desired length of the peptide. Therefore, it is not necessary to start with the full Sestrin 1, 2, or 3 sequence (preferably Sestrin 2) or a shorter truncation thereof and reduce the length of the polypeptide by removing amino acids from the N-terminus and / or C-terminus until the desired peptide length is reached. Indeed, for the sake of speed, convenience, and cost, it is preferred that the polypeptides, or biologically active variants or fragments thereof, are produced using de novo peptide synthesis methods. Once the polypeptides or peptides are synthesized, they can then undergo cyclization.

[0062] It will be understood that any of the sequences represented as SEQ ID NOs: 8-84 can be readily cyclized to form a cyclic polypeptide of the first aspect, or a derivative or analogue. For example, peptide cyclization can be achieved by side chain-to-side chain, head-to-side chain, tail-to-side chain, head-to-tail (C-terminus-N-terminus), or backbone-to-backbone cyclization techniques. In one preferred embodiment, head-to-tail cyclization is the preferred method by which cyclic polypeptides are made. Cyclic polypeptides can be synthesized using either classical solution (liquid) phase linear peptide cyclization or resin (solid) based cyclization. In this embodiment, polypeptides are made using a cyclization cleavage approach, in which cyclic polypeptides are synthesized by stepwise linear peptide synthesis followed by cyclization. An advantage of this method is that no side chains need to be tethered, making the approach more general. Preferably, a sample of the resulting cyclic peptide can be analyzed by MALDI-TOF MS prior to use.

[0063] In a preferred embodiment, cyclization is achieved through an amide bond. Alternatively, cyclization can be achieved through an ester bond or a disulfide bond.

[0064] Thus, in a second aspect, there is provided a cyclic polypeptide comprising or consisting of an amino acid sequence selected from any of SEQ ID NOs: 8 to 84, a derivative or analogue thereof.

[0065] As described in the Examples, the inventors have shown that DOS compounds derived from Sestrin2 (e.g., DOS46L) (i.e., the polypeptide of the first aspect) bind to and inhibit Sestrin1 and Sestrin3 proteins in addition to Sestrin2 in the sMAC complex (Figure 8D). Indeed, the inventors have found that some of the DOS compounds are conserved or have homology across all three Sestrin proteins (Sestrin1, Sestrin2, and Sestrin3), which would be expected to maintain the same binding / inhibitory properties. These compounds are called pan-inhibitors. However, the inventors have also found that some of the DOS compounds can only specifically bind or inhibit one or two isoforms of Sestrin, i.e., they are selective inhibitors.

[0066] However, it should be considered that direct binding is not a prerequisite for DOS Sestrin inhibitory function: for example, DOS46L does not directly bind recombinant Sestrin3 in vitro, but it is found complexed with Sestrin3 in real cells (most preferably T cells) that have the entire sMAC, which results in pan-Sestrin inhibition by disruption of the sMAC complex (Figure 8B-D).

[0067] Thus, in one embodiment, the cyclic polypeptide, derivative or analog thereof may bind to and / or inhibit Sestrin 1, Sestrin 2, and Sestrin 3. In this embodiment, the cyclic polypeptide, derivative or analog thereof is an inhibitor (or antagonist) of Sestrin 1, Sestrin 2, and Sestrin 3. Alternatively, in another embodiment, the cyclic polypeptide, derivative or analog thereof may selectively bind to and / or inhibit Sestrin 1, Sestrin 2, and / or Sestrin 3. In this embodiment, the cyclic polypeptide, derivative or analog thereof is a selective inhibitor of Sestrin 1, Sestrin 2, and / or Sestrin 3.

[0068] In another embodiment, the cyclic polypeptide, derivative or analogue thereof may selectively bind to and / or inhibit Sestrin 1 and / or Sestrin 3 without binding to and / or inhibiting Sestrin 2. In this embodiment, the cyclic polypeptide, derivative or analogue thereof is a selective inhibitor of Sestrin 1 and / or Sestrin 3.

[0069] In another embodiment, the cyclic polypeptide, derivative or analogue thereof may selectively bind to and / or inhibit Sestrin 1 and / or Sestrin 2, without binding to and / or inhibiting Sestrin 3. In this embodiment, the cyclic polypeptide, derivative or analogue thereof is a selective inhibitor of Sestrin 1 and / or Sestrin 2.

[0070] In another embodiment, the cyclic polypeptide, derivative or analogue thereof may not bind to and / or inhibit Sestrin 1, but may selectively bind to and / or inhibit Sestrin 2 and / or Sestrin 3. In this embodiment, the cyclic polypeptide, derivative or analogue thereof is a selective inhibitor of Sestrin 2 and / or Sestrin 3.

[0071] In one embodiment, the cyclic polypeptide, derivative or analogue thereof is a selective inhibitor of Sestrin 1, wherein Sestrin 1 has an amino acid sequence substantially as set forth in SEQ ID NO: 1, 2 or 3, or a variant or fragment thereof.

[0072] Preferably, in this embodiment, the cyclic polypeptide, derivative or analogue thereof is a selective inhibitor of Sestrin 1 and comprises or consists essentially of an amino acid sequence set forth in SEQ ID NOs: 58-60, 62, 64, 88-91, 93, 98-112, 115, 120, 125, 127-129, 131, 132, or 134-147. Even more preferably, the selective inhibitor of Sestrin 1 can be found in FIG. 30 and is a DOSsel * As an example, SEQ ID NO: 138 is a selective DOS inhibitor of Sestrin 1. The sequence is PLPLH.

[0073] In another embodiment, the cyclic polypeptide, derivative or analogue thereof is a selective inhibitor of Sestrin 3, wherein Sestrin 3 has an amino acid sequence substantially as set forth in SEQ ID NO: 5, 6, or 7, or a variant or fragment thereof.

[0074] Preferably, in this embodiment, the cyclic polypeptide, derivative or analogue thereof is a selective inhibitor of Sestrin 3 and comprises or consists essentially of an amino acid sequence as set forth in SEQ ID NO: 47, 58 or 77, 62-65, 71-73, 149, 151-153, 156-158, 163-169, 173, 175, 176, 180-186, 188, 189, 191-195, 200, 201, or 203-205. Even more preferably, the selective inhibitor of Sestrin 3 can be found in FIG. 31 and is a DOS sel *** As an example, SEQ ID NO: 167 is a selective DOS inhibitor of Sestrin 3. The sequence is RGGGS.

[0075] The inventors have formulated a general formula as shown in FIG.

[0076] [ka]

[0077] Thus, preferably, the cyclic polypeptides, derivatives or analogues thereof of the invention comprise or consist of a cyclised form of formula (I).

[0078] It will be understood that the R group of formula (I) is most preferably selected from the standard amino acids known to those skilled in the art. Thus, the R group of formula (I) can be selected from any one of the following amino acids: alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, methionine, asparagine, proline, glutamine, arginine, serine, threonine, valine, tryptophan, and / or tyrosine. In addition, it is observed that any amino acid in the general formula can be replaced with a non-natural variant known to those skilled in the art.

[0079] For the avoidance of doubt, unnatural amino acids that may be used include, but are not limited to, 2-aminoadipic acid, 3-aminoadipic acid, beta-alanine, beta-aminopropionic acid, 2-aminobutyric acid, 4-aminobutyric acid, piperidinic acid, 6-aminocaproic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminopimelic acid, 2,4-diaminobutyric acid, desmosine, 2,2-diaminopimelic acid, 2,3-diaminopropionic acid, N-ethylglycine, N-ethylasparagine, hydroxylysine, allo-hydroxylysine, 3-hydroxyproline, 4-hydroxyproline, isodesmosine, allo-isoleucine, N-methylglycine, sarcosine, N-methylisoleucine, 6-N-methyllysine, N-methylvaline, norvaline, norleucine, ornithine.

[0080] In one embodiment, the cyclic polypeptide, derivative or analog thereof, comprises or consists of formula (I), making the cyclic polypeptide, derivative or analog thereof: (i) terminal NH2 and COOH groups (i.e., peptide bonds); (ii) NH2 group and NH2 group (i.e., hydrazine bond); (iii) an NH2 group and a CONH2 group (i.e., a primary amide bond); (iv) N=NH and NH2 groups (i.e., hydrazine bonds); (v) NH2 and OH groups (i.e., hydroxylamine bonds); (vi) NH2 and SH groups (i.e., thiol-hydroxylamine bonds); (vii) NH2 and SR groups (i.e., hydrosulfide bonds); (viii) a COOH group and a CONH2 group (i.e., an amide bond); (ix) COOH group and COOH group (i.e., dicarboxylic acid bond); (x) a COOH group and an N=NH group (i.e., a carboxyl-amidogen bond); (xi) COOH and OH groups (i.e., hydroxycarboxyl bonds); (xii) COOH and SH groups (i.e., thiol bonds); (xiii) COOH and SR groups (i.e., thiol bonds); (xiv) N=NH group and CONH2 group (i.e., amidogen bond); (xv) N = NH and OH groups (i.e., N-hydroxylamine bond); (xvi) CONH2 groups and CONH2 groups (i.e., diamide bonds); (xvii) CONH2 group and SR group (i.e., s-amide bond); (xviii) SR group and OH group (i.e., hydroxy-thiol bond); (xix) SR group and NH group (i.e., thiolamine bond); (xx) NH2 and NH groups (i.e., hydrazine bonds); (xxi) COOH and NH groups (i.e., amino-propanoic acid bonds); (xxii) SH and OH groups (i.e., hydrophilic bonds); (xxiii) SH and NH groups (i.e., amino-thiol bonds); (xxiv) OH and NH groups (i.e., hydroxylamine bonds); (xxv) OH groups and OH groups (i.e., hydroxy bonds); (xxvi) CONH2 group and OH group (i.e., hydroxyamide bond); (xxvii) SH groups and SH groups (i.e., dithiol bonds); (xxviii) a CONH2 group and an NH group (i.e., a hydroxyamide bond); or (xxix) NH group and NH group (i.e., diammonium bond) This includes, but is not limited to, binding or conjugation of

[0081] Any of the above bonds, other than the head-to-tail NH2-COOH cyclization, can occur at any point in the molecule to achieve DOS alt (A cyclic polypeptide with amino acid residues conserved between Sestrin 1 / 3 and Sestrin 2 in a blast search at the same position), DOS sel (a cyclic polypeptide that does not have amino acid residues conserved between Sestrin 1 / 3 and Sestrin 2 in a blast search at the same position), and DOS sim(Blast searches may identify regions of homology, e.g., chemical similarity, at different positions). Most preferably, cyclization should not destroy essential amino acids in the sequence. For the avoidance of doubt, essential here means amino acids that are conserved in at least one other Sestrin protein on a Blast search. Also of note is the presence of a conserved motif of at least three amino acids across any Sestrin (not necessarily contiguous within the pentameric sequence) at different positions in the protein as a result of frameshifts that occur during evolution and / or alternative splicing. For the avoidance of doubt, conserved motifs should also be considered essential. As an example, the conserved motif in DOS46L is FIP, while the conserved motif in DOS144D is WL-G. Comparing DOS46L with DOS144D, we found that head-(A)-tail-(V) cyclization in DOS46L requires terminal non-essential A and V (alanine in the head and valine in the tail) and, as a result, head-(E)-tail-(G) cyclization yields better results than head-to-tail cyclization in DOS144D, which destroys essential amino acids (G, glycine in the tail) (Figure 3). The results showed the advantage of cyclization to non-essential amino acids over essential amino acids.

[0082] In one embodiment, the cyclic polypeptide, derivative or analog thereof may be as follows: x1x2x3x4x5[Sequence number 85] (wherein x1, x2, x3, x4, or x5 is any amino acid residue). It comprises or consists of the consensus or recurrentem sequence provided herein as SEQ ID NO: 85. In one embodiment, x1, x2, x3, x4, or x5 can be a non-polar and neutral amino acid, i.e., A, G, I, L, M, F, P, or V.

[0083] In another embodiment, x1, x2, x3, x4, or x5 can be a polar and neutral amino acid, i.e., C, S, T, Y, N, or Q.

[0084] In another embodiment, x1, x2, x3, x4, or x5 can be a polar and basic amino acid, i.e., H, K, or R.

[0085] In another embodiment, x1, x2, x3, x4, or x5 can be a polar and acidic amino acid, i.e., D or E.

[0086] Preferably, x1 is A, P, H, L, R, M, D, F, V, I, E, N, Y, S, Q, or T; x2 is Y, A, L, R, M, F, K, V, E, I, D, S, Q, N, W or T; x3 is L, A, S, R, M, D, E, K, F, T, Q, C, V, P, I, or N; x4 is L, A, E, S, K, D, V, I, F, Q, H, C, T, P, N, R, or Y; and / or x5 is L, R, A, E, S, K, I, P, D, F, H, Y, C, T, N, Q, V, or M.

[0087] Thus, in one embodiment, the cyclic polypeptide, derivative or analogue thereof comprises or consists of the amino acid sequence set forth in SEQ ID NO: 85 or a variant or fragment thereof.

[0088] Preferably, in SEQ ID NO: 85, x1 is A, P, H, L, R, M, or D. Preferably, x2 is Y, A, L, or R. Preferably, x3 is L, A, S, or R. Preferably, x4 is L, A, or E. Preferably, x5 is L, R, A, or E. Preferably, cyclization should not occur at an amino acid in a consensus position. In the unlikely event that cyclization occurs between two or more amino acids in a consensus position, software-based alignment can be used to determine which amino acids should be selected for cyclization, such that less reproducible ones are favored.

[0089] Besides and in addition to consensus or repetition, the presence of a conserved motif (consensus) as pointed out above, of at least 3 amino acids (not necessarily consecutive), which is most preferably conserved in at least two Sestrin proteins and responsible for pan-Sestrin inhibition in targeting, is noted. It is the result of frameshifting, most likely due to protein evolution and / or alternative splicing, regardless of their exact location in the protein (e.g., most conveniently within the first 160 amino acids, but can be anywhere in the protein). Thus, these motifs are not revealed by computer-based search, but they appear when frameshifting the DOS sequence starting from one position forward (e.g., at one amino acid pace). As mentioned above, by way of example, this frameshifting allowed the inventors to discover the presence of FIP and WL-G motifs (present in either Sestrin 1, Sestrin 3, or both, respectively) in two of the preferred DOS compounds, DOS46L and DOS144D.

[0090] Thus, preferably, cyclization occurs at an amino acid residue that is not essential for Sestrin function, for example, an amino acid residue that is not essential for Sestrin function may be one that is not conserved in any of the three Sestrins or within any of their conserved motifs throughout the protein.

[0091] In another embodiment, taking into consideration the alignment between Sestrin 2 and Sestrin 1 (Figure 28), cyclization of the polypeptide, derivative or analog thereof is performed at amino acid residues 4, 9, 10, 15, 16, 19, 20, 21, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 46, 50, 56, 61, 63, 65, 66, 67, 71, 73, 84, 91, 94, 96, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 230, 231, 232, 233, 234, 235, 236, 237, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 26 96, 99, 103, 108, 109, 110, 131, 134, 147, 185, 204, 217, 220, 226, 228, 230, 233, 234, 236, 237, 238, 239, 240, 241, 244, 249, 251, 252, 255, 256, 272, 273, 274, 277, 284, 292, 298, 299, 301, 303, 304, 306, 309, 310, 311, 313, 314, 319, 331, 333, 33 4, 343, 359, 369, 431, 442, or 467, and / or amino acid residues 1 to 68, 72, 77, 78, 79, 84, 85, 88, 89, 90, 93, 95, 96, 97, 98, 99, 100, 102, 103, 104, 109, 113, 119, 124, 126, 128, 129, 130, 131, 135, 137, 148, 155, 158, 160, 163, 167, 172, 173, Occurs in 174, 195, 198, 211, 249, 268, 281, 284, 290, 292, 294, 297, 298, 300-312, 315, 319, 320, 321, 323, 325, 326, 329, 330, 346, 347, 350, 357, 365, 371, 372, 374, 376, 378, 381, 382, ​​383, 385, 386, 391, 403, 405, 414, 430, 440, 502, 513, or 538.

[0092] In another embodiment, taking into consideration the alignment between Sestrin 2 and Sestrin 3 (FIG. 29), the cyclization of the polypeptide, derivative or analog thereof is performed by cyclizing the amino acid residues 1, 2, 4, 5, 10, 11, 14 to 29, 34, 35, 36, 39, 40, 41, 50, 56, 59, 61, 63, 66, 69, 70, 71, 81, 87, 91, 94, 96, 99, 103, 108, 109, 110, 131, 134, 142, 146, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 199, 200, 201, 202, 203, 204, 205, 206, 207, 20 143, 147, 151, 180, 192, 204, 217, 220, 222, 224, 226, 228, 230, 231, 233, 234, 239, 240, 241, 243, 244, 245, 246, 249, 251, 255, 256, 272, 273, 277, 289, 299, 301, 302, 303, 306, 307, 310, 313, 314, 320, 331, 333, 334, 357, 359, 369, 380, 342, or 36 7, and / or amino acid residues 1 to 14, 16, 17, 22, 23, 30, 31, 32, 35, 36, 37, 46, 52, 55, 57, 59, 62, 65, 66, 67, 77, 83, 87, 90, 92, 95, 99, 104, 105, 106, 127, 130, 138, 138, 143, 147, 176, 188, 200, 213, 216, 218, 220, 222, 224, 226, 227, 229, 230, 23 Occurs in 2, 234, 235, 236, 237, 238, 239, 243, 244, 245, 247, 248, 249, 250, 253, 255, 259, 260, 276, 280, 292, 302, 304, 305, 308, 309, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 325, 326, 332, 343, 345, 346, 369, 371, 381, 392, 454, or 479.

[0093] Preferably, the cyclic polypeptide, derivative or analogue thereof targets Sestrin in immune cells. More preferably, the cyclic polypeptide, derivative or analogue thereof targets Sestrin in B cells, Natural Killer (NK) cells, and / or T cells (T lymphocytes). Even more preferably, the cyclic polypeptide, derivative or analogue thereof targets Sestrin in CD4+ and / or CD8+ T cells. Even more preferably, the cyclic polypeptide, derivative or analogue thereof targets Sestrin in CD4+ CD27+ CD28+ cells and / or CD4+ CD27- CD28+ cells. More preferably, the cyclic polypeptide, derivative or analogue thereof targets Sestrin in CD4+ CD27- CD28- T cells (i.e., senescent T cells).

[0094] Preferably, the cyclic polypeptide, its derivative or analog induces or restores cytokine production. For example, preferably, the cyclic polypeptide, its derivative or analog induces or restores the production of IFN gamma, TNF alpha, IL-10, and / or IL-4. Preferably, the cyclic polypeptide, its derivative or analog induces or restores cytokine production in immune cells, even more preferably in T cells. Most preferably, the T cells are senescent T cells.

[0095] Preferably, the cyclic polypeptide, derivative or analogue thereof prevents or reverses immunosenescence.

[0096] Immunosenescence is the gradual deterioration of the immune system naturally caused by aging (Montecino-Rodriguez et al., 2013). It affects both the host's ability to respond to infection and the development of long-term immune memory, especially by vaccination (Goronzy and Weyand, 2013). Immunosenescence is thought to be a major factor in the increased frequency of morbidity and / or mortality among the elderly. Immunosenescence is caused by the age-dependent accumulation of senescent lymphocytes, especially senescent T cells, along with loss of responsiveness to antigenic stimulation caused by short telomeres, endogenous DNA damage, lack of telomerase activity, or, as recently discovered by the inventors (Lanna (Group), 2020), loss of telomere transfer from antigen-presenting cells to T cells, and increased Sestrin expression. The compounds can restore telomere transfer both from antigen presenting cells to T cells, resulting in telomere elongation in T cells that have acquired telomeres, as shown in Figure 23. Thus, preferably, the cyclic polypeptides, derivatives or analogs thereof according to the present invention bind and inhibit Sestrin, resulting in the prevention of immunosenescence.

[0097] Preferably, the cyclic polypeptide, derivative or analogue thereof is adapted to rejuvenate the immune system.

[0098] "Rejuvenating the immune system" may refer to restoring the responsiveness of immune cells, particularly T cells, to antigenic stimulation. Additionally, rejuvenating the immune system may refer to restoring telomere length and / or movement and / or telomerase activity in immune cells. Rejuvenating the immune system may also refer to restoring antigen-specific proliferation and / or cytokine production in immune cells, preferably T cells. In addition, rejuvenation may refer to the restoration of B cells and / or CD8 + It may mean restoring antigen-specific antibody production by T cell and / or natural killer cell proliferation.

[0099] As described in the Examples, the inventors have created novel cyclic polypeptides, derivatives, or analogs (i.e., DOS compounds) of the present invention that can revive immunity during aging with a single dose. For example, the inventors have found that a single injection of their cyclic peptides (DOS) restored antiviral responses in old mice, thus surprisingly indicating that DOS can be added to next-generation vaccine formulations. Additionally, the inventors have shown that DOS compounds reduced senescent T cells while increasing the levels of stem-like long-lived memory T cells (Gattinoni et al., 2009, 2011). Thus, the compounds can be used to induce a stem-like state or increase stemness in cells, such as bone marrow resident cells for transplantation (Copelan, 2006). DOS compounds also increase the levels of cytokines such as IFN gamma, TNF alpha, and IL-10 upon DOS treatment and therefore can be used to prevent, ameliorate, or treat several age-related conditions, or they act as immune stimulants in an antigen-specific manner, as shown in FIG. 25.

[0100] Thus, in a third aspect of the invention there is provided a cyclic polypeptide, derivative or analogue thereof according to the first or second aspect for use in therapy.

[0101] In a fourth aspect of the invention there is provided a nucleic acid encoding a cyclic polypeptide, a derivative or analogue thereof according to the first or second aspect for use in therapy.

[0102] The nucleic acid molecule may be an isolated or purified nucleic acid sequence. The nucleic acid sequence may be a DNA sequence. The nucleic acid molecule may comprise synthetic DNA. The nucleic acid molecule may comprise cDNA. The nucleic acid may be operably linked to a heterologous promoter. The nucleic acid sequence encoding the cyclic polypeptide, its derivative or analog may be incorporated into a genetic construct for therapeutic use or for cloning purposes.

[0103] Thus, in one preferred embodiment, the nucleic acid molecule encoding the cyclic polypeptide, derivative or analogue thereof is a genetic construct. More preferably, the nucleic acid molecule or genetic construct is provided within a recombinant vector.

[0104] The genetic construct of the present invention may take the form of an expression cassette, which may be suitable for expression of the encoded cyclic polypeptide, derivative or analogue thereof in a host cell. The genetic construct may be introduced into a host cell without it being incorporated into a vector. By way of example, the genetic construct, which may be a nucleic acid molecule, may be incorporated into a liposome or a viral particle.

[0105] Alternatively, purified nucleic acid molecules (e.g., histone-free or naked DNA) can be directly inserted into host cells by suitable means, such as direct endocytic uptake. For cloning purposes, constructs can be directly introduced into host subject cells (e.g., bacterial, eukaryotic, or animal cells) by transfection, infection, electroporation, microinjection, cell fusion, protoplast fusion, or ballistic bombardment.

[0106] Alternatively, the genetic constructs of the present invention can be directly introduced into host cells using particle bombardment. Alternatively, the genetic constructs can be present in a recombinant vector for expression in a suitable host cell. For administration to the subject being treated, the constructs can be contained in a phage delivery system such as AAV.

[0107] The recombinant vector may be a plasmid, cosmid, or phage. Such recombinant vectors are useful for transforming host cells with genetic constructs and replicating expression cassettes therein. Those skilled in the art will understand that the genetic constructs of the present invention can be combined with many types of backbone vectors for expression purposes. The recombinant vector may contain various other functional elements, such as a suitable promoter for initiating gene expression. As an example, the recombinant vector may be designed so that it replicates autonomously in the cytosol of the host cell. In this case, elements that induce or control DNA replication may be required in the recombinant vector. Alternatively, the recombinant vector may be designed so that it integrates into the genome of the host cell. In this case, a DNA sequence that favors targeted integration (e.g., by homologous recombination) is envisioned.

[0108] To facilitate cloning, recombinant vectors can also contain DNA that codes for genes that can be used as selection markers in cloning steps, i.e., to allow the selection of cells that have been transfected or transformed, and to allow the selection of cells that have vectors that incorporate heterologous DNA.Alternatively, the selection marker gene can be in a different vector that can be used simultaneously with the vector that contains the gene of interest.Vector can also contain DNA that is involved in controlling the expression of coding sequences, or DNA that targets the expressed cyclic polypeptide to a certain part of host cells.

[0109] In a fifth aspect, there is provided a cyclic polypeptide, a derivative or analogue thereof according to the first or second aspect, or a nucleic acid encoding said cyclic polypeptide, derivative or analogue thereof, for use in treating, preventing or ameliorating a microbial infection, an age-related condition, or a T-cell mediated disease.

[0110] In a sixth aspect, there is provided a method of treating, preventing or ameliorating a microbial infection, an age-related condition or a T-cell mediated disease in a subject, comprising administering to a subject in need of such treatment a therapeutically effective amount of a cyclic polypeptide, a derivative or analogue thereof according to the first or second aspect, or a nucleic acid encoding said cyclic polypeptide, derivative or analogue thereof.

[0111] The microbial infection may be bacterial, viral, fungal, or protozoan.

[0112] An age-associated condition is a condition that is accompanied by, caused by, or associated with aging and / or decline of the immune system. Preferably, the age-associated condition is characterized by Sestrin-dependent sMAC activation and / or immunosenescence (Lanna et al., 2017). For example, the age-related condition can be cancer (e.g., pediatric neuroblastoma, melanoma, liver, pancreatic, testicular, or pancreatic cancer (Guo et al., 2020; Kumar et al., 2018; Wang et al., 2018; Won et al., 2019; Zhao et al., 2017)), smoking-induced emphysema (Heidler et al., 2013), epilepsy (Johnson et al., 2015), depression (Kato et al., 2019), metabolic disease (EL-Ashmawy and Ahmed, 2019), osteoporosis (Oh et al., 2021), or a neurodegenerative disease, such as Alzheimer's disease (Rai et al., 2016) or dementia (Chen et al., 2019). 2019), as well as erectile dysfunction, infertility, and polycystic ovary syndrome (Xu et al., 2021).

[0113] The T cell mediated disease may be a disease selected from the group consisting of infectious diseases (e.g., microbial infections), cancer, autoimmune disorders (including, e.g., type I diabetes), inflammatory disorders, various injuries (chemical, electrical, physical), ulcers, and skin disorders including burns.

[0114] As shown in particular in the Examples and Figure 5, some DOS compounds have the ability to inhibit all three Sestrins (e.g., DOS46L and DOS144D) and therefore can be defined as pan-inhibitors. Others inhibit only one or two Sestrins (e.g., DOS104D and DOS117L) and therefore can be defined as selective inhibitors. This therefore shows the possibility of choosing either a pan-inhibitor or a selective inhibitor that inactivates sMAC depending on the condition to be treated. By way of example, certain therapeutic approaches, such as vaccination against bacterial or viral infections, may benefit from pan-inhibition of Sestrins (e.g., by DOS46L), while other conditions, such as epilepsy, are regulated by Sestrin 3 (Johnson et al., 2015) and may benefit from selective Sestrin 3 inhibitors, such as DOS117L.

[0115] Thus, in one embodiment, there is provided a cyclic polypeptide, derivative or analogue thereof comprising or consisting of an amino acid sequence substantially as set forth in SEQ ID NO: 47, 58 or 77, 62-65, 71-73, 149, 151-153, 156-158, 163-169, 173, 175, 176, 180-186, 188, 189, 191-195, 200, 201, or 203-205 for use in treating, preventing or ameliorating epilepsy. It will be appreciated that these peptides inhibit Sestrin 3.

[0116] In another embodiment, there is provided a cyclic polypeptide comprising or consisting of an amino acid sequence substantially as set forth in SEQ ID NO: 8, 13, 14, 15, 38, 68, or 70, a derivative or analog thereof, for use in treating, preventing, or ameliorating a microbial infection. It will be appreciated that these peptides inhibit Sestrin 1, 2, and 3, respectively.

[0117] In a seventh aspect there is provided a composition comprising a cyclic polypeptide of the first or second aspect, a derivative or analogue thereof, or a nucleic acid encoding said cyclic polypeptide, derivative or analogue thereof, and a vaccine.

[0118] In an eighth aspect, there is provided a cyclic polypeptide of the first or second aspect, a derivative or analogue thereof, or a nucleic acid encoding said cyclic polypeptide, derivative or analogue thereof, for use in stimulating an immune response, preferably as a vaccine booster.

[0119] The vaccine can be any antimicrobial vaccine, for example an antiviral, antibacterial, antifungal, or antiprotozoal vaccine.

[0120] Preferably, the cyclic polypeptide, derivative or analogue thereof of the first or second aspect is for use in stimulating a T cell mediated immune response.

[0121] It will be understood that the cyclic polypeptide, its derivative or analogue according to the present invention can be used in drugs that can be used in monotherapy (i.e., use of cyclic polypeptide, its derivative or analogue) to treat, ameliorate or prevent microbial (e.g., bacterial or viral) infection or age-related conditions.For example, the use of DOS (e.g., DOS46L) monotherapy was demonstrated in Figure 18 after single dose administration. In this example, a single injection of DOS prevented the death of animals due to lethal challenge with viral infection (H1N1 PR8 / 54). Notably, the effect is long-lasting (e.g., protection during viral challenge 8 weeks after subcutaneous administration of DOS).

[0122] Alternatively, the cyclic polypeptides, derivatives or analogs thereof according to the present invention can be used to treat, ameliorate or prevent microbial (e.g., bacterial or viral) infections, as an adjunct or in combination with known therapies, e.g., vaccine formulations for preventing infections such as coronavirus or influenza. For example, the combined use of DOS (e.g., DOS46L or DOS144D) was demonstrated in Figure 15 after single dose administration with influenza vaccine (FLUAD). Thus, the cyclic polypeptides, derivatives or analogs thereof can be administered together with vaccine formulations to allow immune cells to rejuvenate.

[0123] Alternatively, the cyclic polypeptides, derivatives or analogs thereof according to the present invention may be used as an adjunct or in combination with known therapies to treat, ameliorate or prevent age-related conditions. For example, the cyclic polypeptides, derivatives or analogs may be used in combination with cancer immunotherapeutics such as checkpoint inhibitors.

[0124] The cyclic polypeptides according to the invention can be combined into compositions having several different forms, depending in particular on the manner in which the composition is to be used. Thus, for example, the composition can be a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micellar solution, transdermal patch, liposomal suspension, or any other suitable form that can be administered to a human or animal in need of treatment. It will be understood that the vehicle of the drug according to the invention should be one that is well tolerated by the subject to which it is given.

[0125] Drugs comprising the cyclic polypeptides according to the present invention can be used in several ways. For example, oral administration may be required, in which case the cyclic polypeptides can be contained in compositions that can be taken orally, for example in the form of tablets, capsules, or liquids. Alternatively, the cyclic polypeptides can be modified, for example by methylation, to favor oral administration by conferring resistance to proteolysis. An alternative option for administering the cyclic polypeptides would be to use nasal sprays. Thus, compositions comprising the cyclic polypeptides of the present invention can be administered by inhalation (e.g., intranasally). The compositions can also be formulated for topical use. For example, creams or ointments can be applied to the skin.

[0126] The cyclic polypeptides according to the present invention can also be incorporated into sustained or delayed release devices. Such devices can be inserted, for example, above or below the skin, and the drug can be released over a period of weeks or even months. The device can be positioned at least adjacent to the treatment site. Such devices can be particularly advantageous when long-term treatment with the cyclic polypeptides used according to the present invention is required and usually requires frequent administration (e.g., at least daily injections).

[0127] In a preferred embodiment, the drug according to the invention may be administered to a subject by injection into the bloodstream or directly to the site requiring treatment. Injection may be intravenous (bolus or infusion), or subcutaneous (bolus or infusion), or intradermal (bolus or infusion).

[0128] It will be understood that the amount of cyclic polypeptide, its analog or derivative required is determined by its biological activity and bioavailability, which in turn depends on the mode of administration, the physicochemical properties of the cyclic polypeptide, and whether it is used as a single agent or in a combination therapy.The frequency of administration is also affected by the half-life of the cyclic polypeptide in the subject being treated.The optimal dosage to be administered can be determined by those skilled in the art and varies depending on the specific cyclic polypeptide used, the strength of the pharmaceutical composition, the mode of administration, and the progression of the condition being treated.Additional factors that depend on the specific subject being treated, such as the subject's age, weight, sex, diet, and time of administration, will result in the need to adjust the dosage.

[0129] Generally, a daily dose of 0.001 μg / kg to 10 mg / kg of body weight of a cyclic polypeptide according to the invention can be used to treat, ameliorate, or prevent a bacterial or viral infection or an age-related condition, depending on which cyclic polypeptide is used. More preferably, the daily dose is 0.01 μg / kg to 1 mg / kg of body weight, even more preferably, approximately 0.1 μg / kg to 100 μg / kg of body weight, and most preferably, approximately 0.1 μg / kg to 10 μg / kg of body weight.

[0130] The cyclic polypeptide may be administered before, during, or after the onset of bacterial or viral infection or age-related condition. The daily dose may be given as a single dose (e.g., a single injection or inhalation of a nasal spray once a day). Alternatively, the cyclic polypeptide may require administration two or more times a day. By way of example, the cyclic polypeptide may be administered as a dose of 0.07 μg to 700 mg (i.e., assuming a body weight of 70 kg) twice a day (or more, depending on the severity of the bacterial or viral infection or age-related condition being treated). The patient to be treated may take one dose upon waking, followed by a second dose at night (if in a two-dose regimen), or at intervals of every three or four hours thereafter. Alternatively, a sustained release device may be used to provide the patient with an optimal dose of the cyclic polypeptide according to the invention without the need to administer repeated doses.

[0131] Known procedures, such as those commonly used by the pharmaceutical industry (e.g., in vivo experiments, clinical trials, etc.), can be used to formulate specific formulations of the cyclic polypeptides of the invention and precise treatment regimens (e.g., daily doses of agent and times of administration), which the inventors believe to be the first to suggest anti-sMAC compositions based on the use of the cyclic polypeptides of the invention.

[0132] Thus, in a ninth aspect of the present invention there is provided a pharmaceutical composition comprising a therapeutically effective amount of a cyclic polypeptide, a derivative or analogue thereof according to the first or second aspect, or a nucleic acid encoding said cyclic polypeptide, a derivative or analogue thereof, and optionally a pharma- ceutically acceptable vehicle.

[0133] The present invention also provides in a tenth aspect a method for making a pharmaceutical composition according to the ninth aspect, comprising combining a therapeutically effective amount of a cyclic polypeptide, a derivative or analogue thereof according to the first or second aspect, or a nucleic acid encoding said cyclic polypeptide, a derivative or analogue thereof, with a pharma- ceutically acceptable vehicle.

[0134] "Subject" may be a vertebrate, a mammal, or a domesticated animal. Thus, the medicament according to the present invention may be used to treat any mammal, for example, livestock (e.g., horses), pets, or in other veterinary applications. However, most preferably, the subject is a human. Even more preferably, the subject is at least 50, 60, 70, 80, 90, or 100 years old.

[0135] A "therapeutically effective amount" of a cyclic polypeptide is any amount that is the amount of active agent needed to treat a microbial (e.g., bacterial, or viral, or protozoan, or parasitic) infection or age-related condition or produce a desired effect when administered to a subject.

[0136] For example, the therapeutically effective amount of cyclic polypeptide used can be from about 0.001 mg to about 800 mg, preferably from about 0.01 mg to about 500 mg. It is preferred that the amount of cyclic polypeptide is from about 0.1 mg to about 100 mg.

[0137] As referred to herein, a "pharmaceutically acceptable vehicle" is any known compound, or combination of known compounds, known to those of skill in the art to be useful in formulating a pharmaceutical composition.

[0138] In one embodiment, the pharma- ceutically acceptable medium may be solid, and the composition may take the form of a powder or tablet. The solid pharma- ceutically acceptable medium may include one or more substances that may act as flavoring agents, lubricants, solubilizers, suspending agents, dyes, fillers, glidants, compression aids, inert binders, sweeteners, preservatives, coating agents, or tablet disintegrants. The medium may also be an encapsulating material. In powders, the medium is a finely divided solid mixed with the finely divided active substance according to the present invention. In tablets, the active substance (i.e., the modulator) may be mixed with the medium having the necessary compression properties in appropriate proportions and compressed in the desired shape and size. Powders and tablets preferably contain up to 99% of the active substance. Suitable solid mediums include, for example, calcium phosphate, magnesium stearate, talc, sugar, lactose, dextrin, starch, gelatin, cellulose, polyvinylpyrrolidone, low melting waxes, and ion exchange resins. In another embodiment, the pharmaceutical vehicle may be a gel and the composition may take the form of a cream or the like.

[0139] However, the pharmaceutical medium may be liquid and the pharmaceutical composition is in the form of a solution. Liquid media are used to prepare solutions, suspensions, emulsions, syrups, elixirs, and pressurized compositions. The active substance (cyclic polypeptide) according to the present invention may be dissolved or suspended in a pharma- ceutically acceptable liquid medium, such as water, an organic solvent, a mixture of both, or a pharma- ceutically acceptable oil or fat. The liquid medium may contain other suitable pharmaceutical additives, such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavorings, suspending agents, thickeners, colorants, viscosity regulators, stabilizers, or osmolality regulators. Suitable examples of liquid media for oral and parenteral administration include water (in part containing additives as described above, e.g., cellulose derivatives, preferably sodium carboxymethylcellulose solution), alcohols (e.g., monohydric and polyhydric alcohols, e.g., glycols) and their derivatives, and oils (e.g., fractionated coconut oil and peanut oil). For parenteral administration, the medium may also be an oily ester, such as ethyl oleate and isopropyl myristate. Sterile liquid vehicles are useful in sterile liquid form compositions for parenteral administration. The liquid vehicle for pressurized compositions can be halogenated hydrocarbon or other pharma- ceutically acceptable propellant.

[0140] Liquid pharmaceutical compositions that are sterile solutions or suspensions can be utilized, for example, by intramuscular, intrathecal, epidural, intraperitoneal, intravenous, and especially subcutaneous injection. The cyclic polypeptides can be prepared as sterile solid compositions that can be dissolved or suspended at the time of administration using sterile water, saline, or other suitable sterile injectable medium.

[0141] Cyclic polypeptides and compositions of the invention may be administered orally in the form of a sterile solution or suspension containing other solutes or suspending agents (e.g., sufficient saline or glucose to make the solution isotonic), bile salts, gum acacia, gelatin, sorbitan monooleate, polysorbate 80 (oleic acid ester of sorbitol and its anhydrides, copolymerized with ethylene oxide), and the like. Cyclic polypeptides used according to the invention may also be administered orally in either liquid or solid composition form. Compositions suitable for oral administration include solid forms such as pills, capsules, granules, tablets, and powders, and liquid forms such as solutions, syrups, elixirs, and suspensions. Forms useful for parenteral administration include sterile solutions, emulsions, and suspensions.

[0142] It will be understood that the present invention extends to any nucleic acid or peptide, or variant, derivative, or analogue thereof, comprising substantially any amino acid or nucleic acid sequence of any of the sequences referred to herein (including functional variants or functional fragments thereof). It is also noted that the presence of a conserved motif of at least three amino acids that can be found at different positions in the three Sestrins is likely the result of protein sequence evolution and / or alternative splicing. For example, FIP is a conserved domain of DOS46L that is found in both Sestrin 1 and 3, albeit at slightly different positions, yet still results in potent pan-Sestrin inhibition. The terms "substantially an amino acid / nucleotide / peptide sequence", "functional variant", and "functional fragment" may refer to a sequence having at least 40% sequence identity with the amino acid / nucleotide / peptide sequence of any one of the sequences referred to herein, such as 40% identity with the sequences identified as SEQ ID NOs: 1-235.

[0143] Also envisaged are amino acid / polynucleotide / polypeptide sequences having sequence identity of more than 60%, preferably more than 65%, more preferably more than 70%, even more preferably more than 75%, and even more preferably more than 80% sequence identity with any of the mentioned sequences. Preferably, the amino acid / polynucleotide / polypeptide sequence has at least 85% identity with any of the mentioned sequences, more preferably at least 90% identity, even more preferably at least 92% identity, even more preferably at least 95% identity, even more preferably at least 97% identity, even more preferably at least 98% identity, and most preferably at least 99% identity with any of the sequences mentioned herein.

[0144] Those skilled in the art will understand how to calculate the percentage identity between two amino acid / polynucleotide / polypeptide sequences.To calculate the percentage identity between two amino acid / polynucleotide / polypeptide sequences, the alignment of the two sequences must first be prepared, and then the sequence identity value is calculated.The percentage identity for two sequences can take different values ​​depending on: (i) the method used to align sequences, such as ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used in the alignment method, such as local vs. global alignment, the pair-score matrix used (such as BLOSUM62, PAM250, Gonnet, etc.), and gap penalty, such as function type and constant.

[0145] Once aligned, there are many different ways to calculate the percentage identity between two sequences. For example, the number of identicals can be divided by: (i) the length of the shortest sequence; (ii) the length of the alignment; (iii) the average length of the sequences; (iv) the number of positions that are not gaps; or (iv) the number of positions that are equalized, excluding overhangs. Furthermore, it will be understood that percentage identity is also strongly dependent on length. Therefore, the shorter the sequence pair, the higher the sequence identity can be expected to occur by chance.

[0146] It will therefore be appreciated that accurate alignment of protein or DNA sequences is a complex process. The popular multiple alignment program ClustalW (Thompson et al., 1994, Nucleic Acids Research, 22, 4673-4680; Thompson et al., 1997, Nucleic Acids Research, 24, 4876-4882) is the preferred method for creating multiple alignments of proteins or DNA according to the present invention. Suitable parameters for ClustalW may be as follows: for DNA alignment: gap opening penalty = 15.0, gap extension penalty = 6.66, and matrix = Identity. for protein alignment: gap opening penalty = 10.0, gap extension penalty = 0.2, and matrix = Gonnet. for DNA and protein alignment: ENDGAP = -1, and GAPDIST = 4. Those skilled in the art will appreciate that it may be necessary to vary these and other parameters for optimal sequence alignment.

[0147] Preferably, the percentage identity calculation between two amino acid / polynucleotide / polypeptide sequences can then be calculated from such alignment as (N / T)×100, where N is the number of positions where sequences share identical residues, and T is the total number of positions compared, including gaps and either including or excluding overhangs.Preferably, overhangs are included in the calculation.Thus, the most preferred method for calculating the percentage identity between two sequences includes: (i) preparing sequence alignment using the ClustalW program, for example, as shown above, with a suitable set of parameters; and (ii) inserting the values ​​of N and T into the following formula: sequence identity=(N / T)×100.

[0148] Alternative methods for identifying similar sequences will be known to those skilled in the art. For example, substantially similar nucleotide sequences are encoded by sequences that hybridize under stringent conditions with DNA sequences or their complements. Stringent conditions mean that the nucleotides hybridize with filter-bound DNA or RNA in 3x sodium chloride / sodium citrate (SSC) at approximately 45°C, followed by at least one wash in 0.2x SSC / 0.1% SDS at approximately 20-65°C. Alternatively, substantially similar polypeptides may differ from the sequences shown in SEQ ID NOs: 1-235 by at least one, but less than 5, 10, 20, 50, or 100 amino acids.

[0149] Due to the degeneracy of the genetic code, it is clear that any nucleic acid sequence described herein may be altered or changed to provide a functional variant thereof without substantially affecting the sequence of the protein encoded thereby. Suitable nucleotide variants are those that have a sequence that is altered by the substitution of different codons that code for the same amino acid within the sequence, thus resulting in a silent change. Other suitable variants are those that have a homologous nucleotide sequence, except that they contain all or a portion of the sequence that is altered by the substitution of different codons that code for amino acids with side chains of similar biophysical properties to the amino acid they replace, resulting in a conservative change. For example, small, non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large, non-polar, hydrophobic amino acids include phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include serine, threonine, cysteine, asparagine, and glutamine. Positively charged (basic) amino acids include lysine, arginine, and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. It will therefore be understood which amino acids can be replaced with amino acids having similar biophysical properties, and those skilled in the art will know the nucleotide sequences encoding these amino acids. For example, the consensus in Figures 32-33 shows DOS sim It is considered to prepare a compound of the formula:

[0150] All of the features described in this specification (including any accompanying claims, abstract, and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination with any of the above aspects, except combinations where at least some of such features and / or steps are mutually exclusive.

[0151] For a better understanding of the present invention, and to show how embodiments thereof may be carried into practice, reference will now be made, by way of example, to the accompanying drawings in which: FIG. [Brief description of the drawings]

[0152] [Figure 1] FIG. 1 shows a model of sestrin-MAPK complex (sMAC) in senescent T cells. [Diagram 2] Figure 1 shows the inhibitory activity of various embodiments of the polypeptides of the present invention (i.e., referred to herein as DOS peptides) as a percentage of AMPK1 activity. DOS peptide inhibitory activity was screened by ATP consumption in an AMPK kinase reaction assay in the presence of recombinant Sestrin 1 and Sestrin 2. [Diagram 3] Figure 1 shows the potency of the polypeptides of the invention (DOS compounds). IC50 doses were calculated for compounds that showed significant Sestrin 2 inhibition. Log concentration values ​​are shown. [Figure 4] Figure 1. Cellular permeability of DOS in T cells and its localization to the sMAC. (A-B) CD4+ T cells were isolated from peripheral blood mononuclear cells (PBMCs) from healthy donors and treated with DOS compounds. (A) Representative confocal images of CD4+ T cells stained with DOS-FITC and CD3-AF594. (B) Quantification of DOS46L permeation by flow cytometry in CD4+ CD27- CD28- cells (Tsen) and CD4+ CD27+ CD28+ cells (Terl). (C) Localization of DOS in the ER (KDEL ER marker) where the sMAC resides. **p<0.01. [Diagram 5] Figure 1 shows heat maps showing signal disruption by DOS compounds. CD4+ T cells were isolated from PBMCs from healthy donors, treated with DOS compounds for 4 h, and collected for immunoblot analysis. Heat maps for Sestrin1, Sestrin2, Sestrin3, p-mTOR1, p-JNK, p-AMPK, p-ERK1 / 2, and p-p38 represent the average of three to nine experiments. Histone 3 was used as a control. [Figure 6]Figure 1. sMAC disruption by DOS46L. (A) CD4+ T cells were purified from PBMCs from healthy donors and treated with DOS46L (10 uM) for the indicated times. Binding of AMPK to Sestrin 2 was quantified relative to total levels of immunoprecipitated Sestrin 2 and detected by ELISA. IgG immunoprecipitates served as background controls. (B) Cells were pretreated with the proteasome inhibitor MG-132 (10 uM) for 30 min and subsequently treated with DOS46L (10 uM) for 4 h. Cells were harvested for immunoblot analysis or proceeded to immunoprecipitation. Levels of Sestrin 2, p38, and AMPK were assessed by immunoblotting. H3 was used as a loading control. Representative images of three experiments are shown. (C) Immunoblot levels of ubiquitin, Sestrin 2, and Histone 3 in Sestrin 2 immunoprecipitates and their lysates were analyzed. Representative images are shown (top). The average values ​​of ubiquitinated proteins in Sestrin 2 immunoprecipitates (bottom) are shown. Results are shown as the mean ± SD of four repeated experiments. Student's T-test was used to analyze the data. **p<0.01 [Figure 7]Figure 1. Titration of DOS46L. (A-B) CD4+ CD27- CD28- T cells were isolated from PBMCs from healthy donors, treated with increasing doses of DOS46L compounds for 4 h, and collected for immunoblot analysis. (A) Levels of Sestrin 2, p-p38, and H2B were assessed by immunoblot. (B) Quantification of Sestrin 2 was analyzed with Histone 3 as a loading control. Means ± SEM of at least three independent experiments are represented. Values ​​are compared using one-way ANOVA test followed by Tukey's post-hoc test. (C-D) CD4+ CD27- CD28- T cells were treated with DOS46L compounds (10 uM) for 0.5 h, 1 h, 2 h, and 4 h, and collected for immunoblot analysis at the indicated time points. (C) Levels of Sestrin 1, Sestrin 2, and Sestrin 3 were assessed by immunoblot. Histone 3 was used as a loading control. (D) Quantification of Sestrin 1, Sestrin 2, and Sestrin 3 with Histone 3 as a loading control. Means ± SEM of at least four independent experiments are represented. Values ​​are compared using one-way ANOVA test followed by Tukey's post-hoc test or Student's T test. *p<0.05, **p<0.01 [Figure 8] Figure 1. Binding of DOS46L to sMAC. (A) Biotinylated DOS46L was mixed with Flag-recombinant Sestrin, immunoprecipitated with streptavidin, and immunoblotted for Flag-Sestrin. DOS46L binds Sestrin directly. Representative images from three experiments are shown. (B-C) Recombinant Sestrin do not bind to each other. (D) DOS46L binds to the entire sMAC complex in CD4 T cells. CD4+ T cells were isolated from PBMCs from healthy donors and treated with biotinylated DOS46L compound (10 uM) for 4 h. Cells were harvested for immunoprecipitation analysis. [Figure 9]Figure 1: Cell proliferation in the presence of DOS with or without Sestrin. CD4+ CD27- CD28- T cells were purified from PBMCs from healthy donors, transduced with lentiviral vectors to remove Sestrin, stained with CTV (Cell Trace Violet) and treated with DOS46L compound (10 uM) for 96 hours. Cell proliferation was assessed by FACS analysis. shCtrl T cells expressed Sestrin. Representative of 9 experiments. [Figure 10] Figure 1. Immune rejuvenation of DOS46L. (A) PBMCs were purified from PBMCs from healthy donors and treated with DOS46L compound (10 uM) for 12 days. Senescent T cells and stem cells were analyzed using FACS analysis. (B-C) The ratio relative to untreated samples is represented. Each dot is an individual donor. (D) Oxygen consumption rate (OCR) of T cells treated with DOS46L for 24 h was measured by Seahorse. Induction of fatty acid oxidation (FAO) by DOS46L. (E) FAO index was calculated by OCR difference between control and DOS46L treated T cells in the presence or absence of FAO inhibitor etomoxir by Seahorse. Student's T-test was used to analyze the data. **p<0.01; ***p<0.001. [Figure 11] Figure 1 shows cytokine production by DOS. PBMCs were purified from healthy donors and treated with DOS46L compound (10 uM) for 12 days and then analyzed by FACS analysis. Cytokine analysis in senescent T cells after 12 days of DOS46L stimulation. The number of cytokine-producing cells is underlined. [Figure 12] Figure 1. In vitro IgG quantification by DOS. (A) PBMCs were isolated from whole blood and treated with various DOS compounds (10 uM). IgG levels were analyzed by ELISA. (B) Mouse splenocytes treated with DOS compounds (10 uM). IgG levels were analyzed by ELISA. Anova with Tukey's post-hoc correction test was used to analyze the data. **p<0.01, ***p<0.001 [Figure 13]Figure 1. Levels of Sestrin in DOS-treated mice blood and tissues. (A-B) Old mice were subcutaneously inoculated with DOS46L compound (0.1mg / kg or 1mg / kg). Blood was collected at 0 hours, 48 ​​hours, 72 hours and 8 weeks after inoculation. Pharmacodynamics of Sestrin2 was analyzed by FACS in CD4+ T cell populations. (C) Long-term mRNA silencing of Sestrin expression in spleens from old mice 10 days after a single dose of DOS46L (0.1mg / Kg). Untreated age-matched controls are shown. (D) 72 hours after DOS treatment, mice were sacrificed and old tissues were collected to analyze Sestrin levels in different organs by immunoblotting. **p<0.01, *p<0.05. [Figure 14] Figure 1. Long-term effect of DOS after immunization. Old mice were subcutaneously inoculated with DOS compounds (0.1 mg / kg or 1 mg / kg). Blood was collected 18 days (A), 36 days (B), and 8 weeks (C) after immunization. (D) Correlation curve between IgG levels and Sestrin2 in blood from mice after treatment with DOS46 for 18 days. Student's T-test was applied. ***p<0.001, **p<0.01, *p<0.05. [Figure 15] Figure 1. Clinical efficacy of DOS with vaccination. Aged mice were vaccinated with or without DOS compound and infected with H1N1 PR8 / 54 6 months later. Mice were monitored for 14 days and their survival (A), clinical scores (B) and body weight (C) were analyzed. Disease severity is summarized in (D). ANOVA with Bonferroni post-hoc correction test. **p<0.001, ***p<0.001 [Figure 16]Analysis of influenza-specific IgG antibodies and their neutralizing effect before and after infection. (A) The presence of circulating influenza-specific IgG antibodies in blood from young and old mice vaccinated and infected with H1N1 PR8 / 54 was assessed by ELISA. (B) The neutralizing effect of sera from young and old mice vaccinated and treated with DOS46L (0.1 mg / Kg) was assessed after 6 months, followed by infection with H1N1 PR8 / 54 and microneutralization assay against the virus. The graph shows the percentage of inhibition of virus growth. Each dot is an individual mouse over time. ANOVA with Bonferroni post-hoc correction test was used. ****p<0.0001; ns, not significant. [Figure 17] Figure 1: In vivo immune activation by DOS in lungs of infected mice. Cytokine production in lung CD4+ and CD8+ T cells from old mice vaccinated with FLUAD with or without DOS compound (single dose) and then infected with H1N1 PR8 / 54 6 months later. Young vaccinated mice served as controls. Representative of 10 animals per group. [Figure 18]Figure 1 shows survival data of mice treated with DOS only. (A) Old mice were treated or not with DOS and then infected with H1N1 PR8 / 54 after 72 hours or 10 weeks (long-term). Mice were monitored for 14 days and their survival was analyzed. Young mice not treated with DOS are also shown. Note the prophylactic action of DOS, which protects mice from influenza infection (3.5x105 viral particles) in both the short and long term in the absence of vaccination. Clinical scores are shown on the right. 7-10 mice per group are shown. Young mice served as controls. (B) IgG titers in old mice treated with DOS only for 10 days and infected with H1N1 PR8 / 54. Young and old controls are also shown. Each dot is an individual mouse. (C) Microneutralization assay performed on sera of mice infected long term since DOS treatment. Old and young controls are also shown. Note that the neutralizing effect of DOS alone is comparable to that of vaccinated mice. ANOVA with Bonferroni post-hoc correction test. ****p<0.0001; ***p<0.001. [Figure 19] Figure 1. Viral clearance by DOS compounds from lungs of old mice. Lungs were removed 6 days after infection. (A) Necropsy lung analysis and (B) viral clearance were measured by the absence of viral protein PA normalized to housekeeping gene L34. qPCR was performed on cells from lungs of old mice that were not or were treated with DOS46L 2 days before infection with H1N1. Mann-Whitney test was used. *p<0.05. [Figure 20] Figure 1 shows the effect of DOS on stem-like memory T cells in vivo. The time course of stem-like generation among CD95+ CD62L+ CD44- CD4+ memory T cells was monitored by FACS analysis in mouse spleens at 10, 21, 30, and 8 weeks after injection of DOS46L (0.1 mg). Results are representative of at least 3 mice per group. [Figure 21]Figure 1. Checkpoint inhibition by DOS. PD1 and Tim3 expression in primary human senescent CD27- CD28- CD4+ T cells activated with anti-CD3 and anti-CD28 for 12 days in the presence or absence of DOS (10 mM). Results are representative of 6 donors. The percentage of checkpoint inhibitor positive cells is shown. DOS inhibits checkpoint expression. UN represents untreated control. Student's t-test was used. *p<0.05, **p<0.001. [Figure 22] Figure 1. Induction of cancer cell death by DOS compounds. (Left) An immortalized pediatric neuroblastoma cell line (sh-sy5y) was treated with different concentrations of DOS46L and DOS144D (from 1 uM to 20 uM) for 48 hours and then analyzed by FACS for viability staining. (Right) A breast cancer cell line (MCF-7) was treated with a constant concentration of DOS46L and DOS144D (20 uM) for 48 hours and then analyzed by FACS for viability dye staining. UN represents untreated control. Results of triplicate cultures are shown. [Diagram 23] Live telomere transfer from APC to T cells in the presence of DOS. (A, left): T cell showing baseline fluorescence in the Tel C channel; (A, center): T cell cultured with APC and treated with DOS; (A, right): T cell co-cultured with APC in the absence of DOS. DOS enhances telomere transfer by approximately 2-fold. Representative of three experiments. (B): Telomere lengthening was quantified by qPCR. Synaptically driven telomere lengthening (Δkb) in T cells exposed to APC and treated or not with DOS46L. Results from five donors are shown. It is noted that the recovery in telomere length is similar to that observed in young T cells (Lanna (Group), 2020). Mann-Whitney test was used. *p<0.05. [Figure 24]Figure 1. Stimulation of COVID-specific antibodies by DOS. PBMCs from older donors (75-95 years) were isolated from whole blood and treated with various DOS46L or DOS132L compounds (10 μM). Levels of IgG were analyzed by ELISA. **p<0.01. [Diagram 25] Figure 1: Induction of antigen-specific proliferation by DOS. Flow cytometry assay showing restored proliferation (Ki67*) in senescent human CD27- CD28- CD4+ T cells treated for 3 days with DOS compounds together with surrogate CD3 / IL2 activation (A) or specific antigen-loaded APCs (B). Note that DOS stimulates T cell proliferation independent of the antigen used. Experiment representative of 5 donors in (A) and 4 donors in (B). Student's T-test was used to analyze the data. ***p<0.001. [Figure 26] FIG. 1 shows formula (I) and different linking options for making cyclic polypeptides of the invention. [Figure 27-1] FIG. 1 shows the docking of a cyclic polypeptide of the invention, in particular DOS46L, with Sestrin2. [Figure 27-2] Same as above. [Figure 28] Figure 1 shows an alignment of the amino acid sequences of human Sestrin 2 and human Sestrin 1. * indicates conserved amino acids; ** indicates chemically similar amino acids. [Figure 29] Figure 1 shows an alignment of the amino acid sequences of human Sestrin 2 and human Sestrin 3. * indicates conserved amino acids; ** indicates chemically similar amino acids. [Figure 30-1]FIG. 1 shows a comparison of cyclic polypeptides (DOS compounds) derived from Sestrin 1 and Sestrin 2. Conserved amino acid residues are underlined. Cyclic polypeptides having conserved amino acid residues between Sestrin 1 and Sestrin 2 are termed DOS alternative variants, i.e., "DOSalt." Cyclic polypeptides not having conserved amino acid residues between Sestrin 1 and Sestrin 2 are termed selective DOS compounds, i.e., "DOSsel." [Figure 30-2] Same as above. [Figure 30-3] Same as above. [Figure 31-1] FIG. 1 shows a comparison of cyclic polypeptides (DOS compounds) derived from Sestrin 2 and Sestrin 3. Conserved amino acid residues are underlined. Cyclic polypeptides with conserved amino acid residues between Sestrin 2 and Sestrin 3 are named DOS alternative variants, i.e., "DOSalt." Cyclic polypeptides without conserved amino acid residues between Sestrin 2 and Sestrin 3 are named selective DOS compounds, i.e., "DOSsel." ***** indicates alternative compounds that are actually conserved between Sestrin 2 and Sestrin 3. [Figure 31-2] Same as above. [Figure 31-3] Same as above. [Diagram 32] 1 shows the amino acid sequence of the DOSsim cyclic polypeptide for Sestrin 1, for which a blast search identified regions of homology (chemical similarity) at positions that differ between Sestrin 1 and 2. [Diagram 33] 1 shows the amino acid sequence of the DOSsim cyclic polypeptide for Sestrin 3, for which a blast search identified regions of homology (chemical similarity) at positions that differ between Sestrin 3 and 2. [Diagram 34]1 shows the amino acid sequence of the DOScon cyclic polypeptide between Sestrin 2 and Sestrin 1. DOScon has overlap and / or chemical similarity between any two Sestrins. [Diagram 35] 1 shows the amino acid sequence of the DOScon cyclic polypeptide between Sestrin 2 and Sestrin 3. DOScon has overlap and / or chemical similarity between any two Sestrins. [Diagram 36] 1 shows the amino acid sequence of the DOSsupercon cyclic polypeptide, which shares overlap and / or chemical similarity between all three Sestrins. EXAMPLES

[0153] We have generated novel cyclic polypeptide inhibitors of the Sestrin-MAPK complex (sMAC), termed DOS (Disruptors of sMAC), and demonstrate that these polypeptide DOS compounds can inhibit sMAC at nanomolar amounts by targeting Sestrin for proteasomal degradation.

[0154] material and method In vitro screening of peptide libraries for inhibition of AMPK1 stimulation by Sestrin1 1. Recombinant protein AMPK1 (5 ng) and DOS peptide (20 ng) were incubated at room temperature for 30 min; 2. Sestrin1 / ATP / AMP / SAMsite (1ug) was added and incubated at room temperature for 1 hour; 3.20 μl ADP-Glo ​​reagent was added and incubated at room temperature for 40 min; 4. Then, 40 μl of kinase detection reagent was added and incubated at room temperature for 30 minutes; 5.Results were obtained using an ELISA reader.

[0155] Immunofluorescence for DOS localization in CD3+ cells 1. Purified T cells were plated at 1 x 10 in a 24-well plate. 6 Cells were plated at a concentration of 1000 cells / well. 2. Cells were treated with 10 μM DOS-FITC for 4 hours. 3. Then, the cells were collected and centrifuged at 500 g for 5 minutes. 4. Wash twice with ice-cold PBS 5. Cells were resuspended in 200 ul of PBS and plated onto polylysine pretreated coverslips. 6. Cells were fixed with 4% formaldehyde on ice for 20 minutes. 7. Wash 3 times with PBS 8. Blocked with PBS-BSA 5% 9. Cells were then incubated with primary antibody (anti-CD3 1:100) overnight at 4°C. 10. Washed 3 times with PBS 11. Then, the sections were incubated with secondary antibody (anti-mouse conjugated with AF-594; 1:250) for 1 hour at room temperature. 12. Washed 3 times with PBS 13. Cells were permeabilized with Triton 0.25% in PBS for 2 min. 14. The cells were then incubated overnight at 4°C with the antibodies anti-KDEL (Abcam) and anti-Sestrin 2 (Gentex) diluted 1:100. 15. Washed 3 times with PBS 16. Then, the sections were incubated with secondary antibodies 647-conjugated anti-mouse or 594-conjugated anti-rabbit at 1:250 dilution for 1 hour at room temperature. 17. All were washed 3 times with PBS. 18. Coverslips were mounted with Vectashield mounting medium DAPI+. 19. Images were acquired with a Zeiss confocal microscope

[0156] Western Blotting Protocol 1. CD4+ cells were isolated from PBMCs using the appropriate microbead kit (Miltenyi). 2. Cells were resuspended in Whole RPMI medium and plated into 24 multi-well plates. 3. Then, the cells were activated with DOS compounds for 4 hours. 4. Cells were then harvested, washed with PBS, and resuspended in lysis buffer (RIPA with phosphate inhibitors). 5. The cell lysis mixture was incubated on ice for 20 minutes. 6. Samples were centrifuged at full speed for 20 minutes. 7. Collect the supernatant and add Lemmli buffer + β-mercaptoethanol 8.The samples were then boiled at 95°C for 5 minutes. 9. Samples were loaded onto a polyacrylamide gel and run in TRIS-glycine-SDS running buffer. 10. Once the run was complete, the proteins were transferred from the gel to a nitrocellulose membrane using a Trans-Blot machine (Biorad). 11. The membrane was washed with 0.1% Tween-TBS buffer and blocked in 5% non-fat milk for 1 hour. 12.Then, the cells were incubated overnight with the primary antibody. 13. The next day, the membrane was washed three times with 0.1% Tween-TBS buffer for at least 30 minutes each. 14.Then, the secondary antibody was added for 1 hour. 15. The membrane was washed three times with 0.1% Tween-TBS buffer for at least 30 minutes each. 16. Signal was generated using ECL solution

[0157] Immunoprecipitation of Sestrin 2 1. The cell pellet was lysed in 100 μL of denaturing lysis buffer. 2. Then mix thoroughly by vortexing vigorously at maximum speed for 2-3 seconds. 3. The samples were then boiled at 95°C for 5 minutes. 4. The sample was then diluted with 900 μl of non-denaturing lysis buffer and mixed gently. 5. The cell lysate was then passed 5-10 times through a needle attached to a 1 mL syringe or sonicated. 6. Then, incubate on ice for 5 minutes. 7. Samples were pre-cleaned by spinning at maximum speed for 20 minutes at 4°C. 8. The supernatant was collected in a new tube. 9.7ul (5ug) of SESN2 (Abcam) primary antibody was added directly to the supernatant and incubated overnight at 4℃ on a rotor. 10. 200 ul of Protein A / G beads were washed 4-5 times in IP buffer, then blocked overnight in IP buffer containing BSA and placed on a rotor at 4°C. 11. The next day, 50ul of Protein A / G beads were added to the sample and incubated on a rotor at 4°C for 3 hours. 12. The protein-bead conjugate was washed 5-10 times in IP buffer by spinning at 3000g for 2-3 minutes. 13. Then, 1× Laemmli reducing agent was added and the samples were boiled at 95°C for 10 min. 14. Next, the Western blotting protocol was carried out.

[0158] In vitro pull-down of proteins from cell extracts 1.5×10 6 Cells were lysed in 200 ul of PE buffer (supplemented with phosphatase and protease inhibitors) and incubated on ice for 30 min; 2. The cell extract was mixed with 1800 μl of PD buffer; 3. The extract was pre-cleared by centrifugation at maximum speed for 30 minutes; 4. Then, 600 ul of the supernatant was incubated with DOS-biotin (20 μM concentration) overnight at 4°C; 5. Streptavidin-agarose beads (1000 μl) were washed with PD buffer and blocked overnight with 5% BSA; 6. The beads were washed again and incubated with the cell extract for 1 hour at room temperature. 7. The beads were then washed with PD buffer. 8. Protein was eluted with 50 μl Laemmli 1×

[0159] Lentivirus production in HEK293 cells Day 1.0: HEK293 cells were plated in cell culture flasks t75 at a certain concentration to yield 70% confluence the following day (for each, lentivirus was plated in 2 flasks t75 of HEK293 cells). 2. Day 1: HEK293 cells were transfected by using Lipofectamine LTX reagent with PLUS reagent (Invitrogen); 3. Specifically, prior to transfection, the medium was removed and 5 mL Opti-MEM serum-reduced medium (Gibco) was added to each flask; Plasmid DNA-PLUS lipid complexes were obtained by combining 4.4 μg DNA with 10 μl Lipofectamine 2000 and PLUS reagent at a 1:1 ratio. The mixture was incubated at room temperature for 10 min. For lentiviral particle production, cells were co-transfected with the following three plasmids: pCMV-VSV-G envelope vector (Cell Biolabs); p.891 packaging vector; p-SIREN-scramble / p-SIREN-shsesn1 / p-SIREN-shsesn2 / p-SIREN-shsesn3. 5. The DNA-lipid complexes were then added dropwise to the cells; 6. Five hours after transfection, the medium was carefully aspirated and replaced with 15 mL of fresh DMEM complete medium; 7. The cells were incubated at 37°C, 5% CO2 for 48 hours. 8. Day 3: The medium containing the lentivirus was collected 48 hours after transfection and the cells were replaced with fresh medium. Day 9.4: Medium containing lentivirus was also harvested 72 hours post-transfection.

[0160] Lentivirus concentration 1. Lentivirus particles were concentrated using Lenti-Pac Lentivirus Concentration Solution (GeneCopoeia). 2. The medium containing the lentiviral particles was centrifuged at 2000g for 10 minutes at 4°C; 3. Then it was mixed with Lenti-Pac concentrated solution in a ratio of 5:1; 4. Incubated overnight at 0–4°C and centrifuged at 3500 g for 25 min at 4°C; 5. Carefully discard the supernatant. 6. The viral pellet was resuspended in 100 μL of PBS. 7. Virus aliquots were stored at -80°C.

[0161] CTV staining 1. Harvesting Transduced Cells 2. The cell supernatant was centrifuged and the cell pellet was resuspended in warm PBS containing 5 μM CTV. 3.Then, the plate was incubated at 37°C for 10 minutes. 4. Cold PBS was added and the cells were centrifuged. 5. The cells were then resuspended in medium and counted. 6. An aliquot of these cells was checked by FACS 7. The cells were then stimulated with DOS in 200 μL and allowed to grow for 12 days.

[0162] RNA extraction, reverse transcription, and qPCR 1. CD4+ cells were purified from mouse spleens using appropriate microbeads (Miltenyi). 2. Total RNA was extracted from CD4+ cells using the “PureLink RNA Mini Kit” (Invitrogen). 3. RNA concentration was obtained by NANO-DROP spectrophotometer (Thermo-Scientific). 4. 1 μg of total RNA was reverse transcribed into cDNA following the protocol advised by the kit "qScript cDNA Synthesis Kit" (Quanta Biosciences). 5. qPCR reactions were performed on 100 μg of cDNA per sample using the SensiFAST Hi ROX kit (Bioline). 6. For the investigation of human Sestrin, the following Taqman probes were used: - Sestrin1 Hs00902782_m1, - Sestrin2 Hs00230241_m1, - Sestrin 3 Hs00914870_m1 - RPLPO Hs00420895_gH (used as housekeeping control) For the investigation of mouse Sestrin 2, the following primers were used: - Fw TCTCGGCACTTTGAGGACAC - Rw AACCATGGTCTTCCCAGCAG Standard primers for RPL34 were used as housekeeping controls. For the investigation of the PA viral protein of the H1N1 virus, the following primers were used: - Fw CGGTCCAAATTCCTGCTGA - Rw CATTGGGTTCCTTCCATCCA 7. qPCR reactions were carried out using the "StepOne Plus System" machine (Applied Biosystems).

[0163] Seahorse assay for cellular metabolism 1. CD4+ cells were purified from PBMCs using appropriate microbeads (Miltenyi). 2. Purified CD4+ cells were activated with CD3 / CD28 Dynabeads (Gibco) and treated overnight with DOS46L at 10 μM. 3. The following day, the regular growth medium was removed from the cells and "substrate-limited growth medium" was added, consisting of basal DMEM supplemented with 0.5 mM glucose, 1 mM glutamine and 1% FBS. 4. The cells were then incubated with this medium for 4 hours in an incubator. 5. Cells were then counted and plated at 2 x 10 cells in a polylysine pretreated XF 96-well plate. 5 Cells were plated at a concentration of 1000 cells / well. 6. The cells were then fed with "assay medium" consisting of XF DMEM containing 2 mM glucose and 0.5 mM L-carnitine. 7. Immediately before performing the assay, cells were treated with 1x palmitate-BSA or 1x BSA. 8. During the assay, cells were treated with Etomoxir (4 μM), Oligomycin (1.5 μM), FCCP (1 μM), and Rotenone / Antimycin A (0.5 μM) at different time points. 9. The Seahorse machine read the OCR values ​​at different times over a 120 minute period.

[0164] PBMC in vitro treatment with DOS 1. PBMCs were thawed and resuspended in 5 mL of medium. 2. Leave it in the incubator overnight 3. CD4+ CD27- CD28- cells were purified using appropriate microbeads (Miltenyi). 4. The cells were then plated in flat-bottom 96-well plates with CD3 CD28 Dynabeads (10 6 The cells were stimulated overnight with 20 μL 5. The cells were left in the incubator for 12 days after which they were analyzed.

[0165] Determination of IgG production after immunization 1. Analysis of plasma IgG specific for the H1N1 virus was performed by ELISA on days 18 and 36 after immunization. 2. Antigen (FLUAD) was coated into 96-well plates; 50 μl per well, diluted 1:40 (12 ml PBS + 300 μl FLUAD) 3. Then, wash in PBS 0.5% Tween-20 4. Then, the sections were blocked with 4% milk in PBS 0.5% Tween-20 for 2 hours at room temperature. 5. Mouse plasma was then added to the blocked plates at a dilution of 1:200 in 0.1% milk PBS 0.5% Tween-20. 6. The plates were incubated overnight at 4°C. 7. Wash once with PBS 0.5% Tween-20 8. Then, anti-mouse IgG1 biotin-conjugated antibody diluted 1:250 in 0.1% milk PBS 0.5% Tween-20 was added and incubated for 2 hours at room temperature. 9. The plate was washed twice with PBS 0.5% Tween-20. 10. Streptavidin-HRP conjugated antibody diluted 1:3000 in PBS 0.5% Tween-20 was added and left at room temperature for 1 hour. 11.Then, wash three times with PBS 0.5% Tween-20. 12. Add TMB substrate to the wells and leave for 15-30 minutes until color develops. 13. The reaction was stopped with stop solution (ThermoFisher). 14. The absorbance was detected at 450 nm by an ELISA reader.

[0166] Live telomere movement 1. CD4+ cells were purified from PBMCs using appropriate microbeads (Miltenyi). 2. CD4+ and CD4- cells were collected 3. CD4+ cells were then used to purify CD27- and CD28- cells using the Miltenyi purification kit. 4.1×10 7CD4- cells were spot plated in the center of wells (6-well plates), treated with DOS46L 10 μM and allowed to attach for 2.30 hours. 5. In parallel, 5 x 10 5 CD27- / CD28- cells were also treated with DOS46L 10 μM for 2.30 hours. 6. CD4- cells were then stained for 5 min with TelC-Cy5 probe (PNA bio Link) diluted 1:50 in PBS. 7. In each well containing stained CD4- cells, glass beads were added; the plate was gently rocked for 2 minutes to create pores in the cell membrane. 8. Cells were washed with PBS and centrifuged 9. The pellet was resuspended and CD4- cells were counted. 10. CD4+ cells were mixed with CD4- cells in a ratio of 1:3. 11. The combined CD4+ and CD4- cells were then stimulated with a 1:1 mixture of CMV and EBV. 12. Cells were incubated overnight 13. The next day, cells were stained for surface proteins and analyzed by flow cytometer.

[0167] Microneutralization assay 1. Mouse serum was diluted 1:200 and incubated with 1:10000 diluted H1N1 virus at 37°C for 1 hour. 2. MDCK cells were then added at a concentration of 15,000 cells per well (96-well plate) and incubated overnight at 37°C with 5% CO2. 3. The next day, cells were fixed with 80% cold acetone in PBS. 4. A 1:250 dilution of primary antibody anti-Influenza A NP was added to the wells and incubated for 1 hour at room temperature. 5. The plate was washed twice with PBS-Tween 0.3%. 6. Secondary antibody (HRP-conjugated goat anti-mouse IgG) diluted 1:2500 was added and the plate was incubated for 1 hour at room temperature. 7. The plate was washed twice with PBS-Tween 0.3%. 8.TMB substrate was added to each well and left until a color change occurred. 9. The reaction was stopped with stop solution (Thermos Fisher) and the OD was taken at 750 nm in an ELISA reader.

[0168] In vitro kinase assay 1. Sestrin or AMPK immunoprecipitates were washed twice in lysis buffer and twice in kinase buffer (all from Cell Signaling). 2. Immunoprecipitates were left untreated or treated with 10 μM cyclic DOS compounds in the presence or absence of 200 μM ATP (Cell Signaling) for 30 minutes at 30° C. 3. The sample was resuspended in PBS. 4. ELISA plates were coated with the kinase reaction products overnight at 4°C. 5. Plates were then blocked with 4% milk in PBS-Tween 0.5% for 1 hour. 6. MAPK activity was assessed by using antibodies anti-phosphorylated p38 (D3F9, Cell-Signalling) or by using anti-phosphorylated SAPK / JNK (81E11) (Cell Signalling) and phosphorylated p44 / 42 MAPK (ERK 1 / 2) (D13.14.4E) (Cell Signalling). All antibodies were diluted 1:100 and incubated for 2 h at room temperature. 7. The plate was washed twice with PBS-Tween 0.5%. 8. Secondary anti-rabbit IgG-HRP conjugated antibody (Millipore) diluted 1:2000 was added to each well and left at room temperature for 1 hour. 9. The plate was washed three times with PBS-Tween 0.5%. 10. TMB substrate was added until color developed; the reaction was stopped with stop solution (ThermoFisher) 11. The absorbance was read on an ELISA reader. 12. In vitro kinase assay data were presented as proportional to the fold increase in absorbance at 450 nm ± sem of triplicate wells normalized to the total amount of coimmunoprecipitated MAPK.

[0169] Mouse survival 1. Mice (strain CS7B) were injected with Fluad vaccine (GSK) combined 1:20 with DOS (46L, 144D, and 144L) at two different doses 0.1 mg / kg and 1 mg / kg. Number of groups = 8 2. The mice were divided into 5 groups, with 8 animals per group. The groups were: - Group 1: aged mice (18 months old) vaccinated with Fluad without DOS; - Group 2: old mice (18 months old) vaccinated with Fluad + DOS46L at two doses; - Group 3: old mice (18 months old) vaccinated with Fluad+DOS144D; - Group 4: old mice (18 months old) vaccinated with Fluad+DOS144L; - Group 5: Young mice (8 months old) vaccinated with Fluad without DOS 3. Four months after vaccination, mice were inoculated with H1N1 influenza virus (viral pfu 6 × 10 5 ) was infected 4. Mice were monitored for 15 days: body weight, disease progression, clinical scores, and survival data were obtained. 5.15 days later, mice were sacrificed and tissues were harvested (blood, lungs, spleen, and thymus).

[0170] Dynamic DOS 1. Mice (young and old) were subcutaneously injected with DOS46L (0.1 mg or 1 mg), and blood was then collected from the cheek at 2, 4, 24, and 48 hours. 2. Purified PBMCs 3. Cells were stained for T cell surface proteins for 30 minutes 4. Wash with PBS 5. Cells were fixed with PBS-fixation buffer (1:1) and incubated at 37° C. for 10 min. 6. Wash with PBS and centrifuge 7. Then, cold Perm Buffer (BD) was added to the cells and incubated in the dark at 4°C for 20 minutes. 8. Wash with PBS 9. Cells were stained with antibody anti-Sestrin 2 (1:100) (GenTex) for 20 min on ice. 10. Wash in PBS 11. Cells were resuspended in PBS and analyzed on a FACS machine

[0171] Mice treated with DOS only and infected with H1N1 virus 1. Mice (strain CS7B) were divided into three groups: - Group 1: 10 aged mice (18 months old) subcutaneously injected with DOS46L at 0.1 mg / kg - Group 2: 10 aged mice (18 months old) that were not injected with DOS - Group 3: 3 young mice (8 months old) that were not injected with DOS 2. 48 hours after DOS administration, all mice from all groups were administered 3.5 × 10 per mouse in an intranasal manner. 5 The animals were infected with the H1N1 virus at a concentration of 100 PFU. 3. Clinical scores were recorded for each mouse from day 1 to day 10 after infection. The clinical score included the following parameter assessments: - Weight - Behavior - Hair condition - chest breathing - Eye conditions 4. Mice were sacrificed when they reached a clinical score of 13 (a grade of severity accepted by the ethical committee). Tissues were collected from each mouse (blood, lungs, spleen, and thymus).

[0172] Telomere length quantification assay 1. CD4- and CD4+ cells were purified from PBMCs using the appropriate microbead kit (Miltenyi). 2. CD4+ cells were then used to purify CD27- and CD28- cells by using a Miltenyi purification kit. 3. Pellets of CD4- cells and CD4+ / CD27- / CD28- cells were frozen. 4.4×10 6 1 × 10 CD4- cells 6 CD4+ / CD27- / CD28- cells were mixed with 10 μM DOS 46L in the presence or absence. 14. The mixed cells were stimulated overnight with a 1:1 mixture of CMV and EBV. 15. The next day, the CD4- cells were detached from the complex with CD4+ / CD27- / CD28- cells using a syringe with cold PBS. 5. CD4- cells were then purified from CD4+ cells by using the Miltenyi purification kit. 16. The post-conjugation CD4- and CD4+ cell pellets were then frozen. 17. Genomic DNA was extracted from frozen cell pellets using the PureLink Genomic DNA Mini Kit (Invitrogen). 18. qPCR reactions were carried out according to the protocol suggested by the "Absolute Human Telomere Length Quantification qPCR Assay Kit" (ScienCell-Research Laboratories). 19. Telomere length was calculated from ΔCT according to the formula suggested by the kit mentioned above.

[0173] Design of DOS compounds The inventors designed DOS compounds for the protein Sestrin 2. However, to broaden the DOS compounds to those that may potentially be active against Sestrin 1 and Sestrin 3, the inventors aligned the DOS compounds designed for Sestrin 2 against the protein sequences of Sestrin 1 and 3, as shown in Figures 28 and 29.

[0174] In doing so, the inventors identified DOS compounds that specifically bind to Sestrin 1 or Sestrin 3, but not to Sestrin 2, and hence termed them selective DOS compounds. For these compounds, and for all compounds that partially matched the Sestrin 2 sequence, the inventors predicted possible chemical bonds that could occur naturally or synthetically between the reactive chemical groups present in the amino acids that make up the DOS sequence, according to a specific formula.

[0175] To report all the possible cyclic secondary structure formations that may result in the formation of functional compounds, the inventors used a specific code for each type of bond. Then, for each code, they linked the letter of the amino acid involved in the bond. Specifically, if an amino acid has more than one specific reactive group, they assigned a number for each group to the letter of that amino acid. For example, arginine presents three available NH groups, which the inventors named R2, R3, and R4. They used the code R' to refer to the additional NH group available when arginine is located at the N-terminus of the amino acid sequence.

[0176] DOS synthesis To synthesize the cyclic peptide DOS compounds, conventional protection and activation chemistry was used such that the amino functionality of the first amino acid is protected with a removable amino protecting group (e.g., benzoyloxycarbonyl (Cbz), tert-butoxycarbonyl (t-Boc), and 9-fluorene-methoxycarbonyl (FMOC)) and the carboxyl functionality of the second amino acid is protected with a removable carboxyl protecting group. The carboxyl group can be protected by forming an acid or base labile ester, e.g., methyl, ethyl, benzyl, or trimethylsilyl ester. After protection, the first and second amino acids are reacted in a solution composed exclusively of the respective L / D-amino acids, i.e., L / D-Arg, L / D-Gly, and L / D-Asp. After the coupling reaction, selective deprotection of the amino group of the first amino acid is achieved by acidic hydrolysis under conditions that do not remove the carboxyl protecting group of the second amino acid. The procedure is repeated for additional protected amino acids. Solid phase synthesis, such as the well-known Merrifield, FMOC, and MeDBz resins, can be used to synthesize the DOS peptides of the invention. A linear peptide is first derived from the native sestrin and then cyclized.

[0177] [Example 1] Discovery of DOS compounds To develop first-in-class inhibitors of Sestrin, we designed a minimal in vitro assay with bacterially purified proteins (Sestrin1 and Sestrin2). Sestrin targets AMPK, a heterotrimeric alpha-beta-gamma kinase, which coordinates Sestrin-dependent MAPK activation within the sMAC. After activation of AMPK detected by ATP-mediated kinase reaction, 156 different sequences were tested by in vitro ELISA assay, the results of which are shown in Figure 2.

[0178] Pentameric sequences were rationally designed based on the region between amino acid residues 1-160 of Sestrin 2 (SEQ ID NO: 4), since this entire region was shown to be essential for Sestrin-AMPK interaction. Additionally, 5 amino acids is considered to be the limiting length for generating cell-penetrating peptides with inhibitory function. This approach identified several promising inhibitory Sestrin Fragments (ISFs), 74 for Sestrin 2 and 50 for Sestrin 1, that were able to abrogate AMPK activity by 40-100% in the assay (see Figure 2). The remaining sequences were unable to inhibit AMPK and were therefore excluded from further analysis.

[0179] However, we found that incubation of T cells with ISF failed to produce inhibition of Sestrin or AMPK phosphorylation, suggesting limited cell permeability and / or stability. Therefore, to overcome these challenges, we created head-to-tail cyclic peptidomimetics (both L- and D-variants) of the ISFs identified in in vitro screening. For reasons explained below, we renamed these cyclic peptidomimetics as Disruptors of sMAC (DOS) compounds.

[0180] [Example 2] Ability of DOS compounds to inactivate sMAC Among all the DOS compounds tested, we identify DOS46L and DOS144D as the most effective compounds in inactivating sMAC.For example, DOS46L silences sMAC pathway by 90%.Therefore, as an example, we focus on DOS46L (SEQ ID NO:22) and DOS144D (SEQ ID NO:77) for most of the following studies.

[0181] Next, we performed titration studies of DOS compounds, DOS46L and DOS144D, on AMPK1 / Sestrin2 activity. As shown in Figure 3, the titration studies showed that DOS compounds could inhibit Sestrin-driven AMPK activation at nanomolar amounts with recombinant proteins in vitro (DOS46L, IC50 0.096mM; DOS144D, 0.844mM), demonstrating the potency of the newly created DOS compounds.

[0182] Next, we tested the ability of DOS compounds to penetrate T cells. As shown in Figure 4, DOS compounds (DOS46L) could penetrate T cells, especially senescent CD3+ CD4+ CD27- CD28- population. Similar results were obtained for CD8+ T cells and major antigen-presenting cells (APCs), such as dendritic cells, monocytes, macrophages, and B cells. When DOS compounds were added to APCs, they spontaneously triggered the release of telomeric vesicles that could be used for rejuvenation.

[0183] Total CD4 at 10 μM concentration + When tested in T cells, DOS compounds inhibited total sMAC signaling, as shown in Figure 5. This was indicated by downregulation of Sestrin 1, 2, and 3 expression, and AMPK and MAPK phosphorylation. This therefore indicates that active Sestrin inhibition results in disruption of Sestrin-dependent sMAC activation, resulting in downregulation of MAPK signaling.

[0184] As shown in Figure 5, some DOS compounds (e.g., DOS46L and DOS144D) have the ability to inhibit all three Sestrins and can therefore be defined as pan-inhibitors. Others (e.g., DOS104D and DOS117L) functionally inhibit only one or two Sestrins and can therefore be defined as selective inhibitors. This therefore shows the possibility of choosing either a pan-inhibitor or a selective inhibitor to inactivate sMAC depending on the condition to be treated. As an example, certain therapeutic approaches, such as vaccination against bacterial, viral or parasitic infections, may benefit from pan-inhibition of Sestrins (e.g., by DOS46L), while other conditions, such as epilepsy, are regulated by Sestrin3 and may benefit from selective Sestrin3 inhibitors, such as DOS117L.

[0185] Next, using ELISA coupled with Sestrin2 immunoprecipitation, we confirmed that addition of a DOS compound (DOS46L) directly to Sestrin immunoprecipitates in vitro also disrupted Sestrin-AMPK interaction, which inhibited global MAPK activation (ERK, p38, and JNK) within the sMAC complex (Figure 6). For example, as shown in Figure 6A, binding of AMPK to Sestrin2 in CD4+ T cells was decreased after 1 or 2 h treatment with DOS46L.

[0186] Referring to Figure 7, titration studies in aged CD4+ T cells exposed to DOS46L showed that the DOS compound inhibited sMAC activation within 4 hours of treatment, starting from nanomolar amounts (16 nM), similar to previous observations made with recombinant proteins and confirming the potency of the newly created inhibitor in real cells.

[0187] Treatment of CD4+ T cells with the proteasome inhibitors MG132 and DOS46L suggested that inhibition of Sestrin, as well as AMPK, was due to proteasome-mediated degradation, since the effect was abolished in cells pretreated with the proteasome inhibitors, as shown in Figure 6B. We also immunoprecipitated increased amounts of ubiquitinated Sestrin2 in T cells exposed to DOS46L (Figure 6C). Thus, these data indicate that DOS compounds are first-in-class inhibitors of sMAC, targeting the complex at the Sestrin site, thereby inducing sMAC degradation through ubiquitination.

[0188] With reference to Figure 8, immunoprecipitation with biotinylated variants of DOS46L and immunoblotting to Flagged Sestrins showed that DOS binds directly to Sestrin 1 and Sestrin 2 (Figure 8A). No Sestrins were found in control precipitates with free biotin, demonstrating direct DOS46L-Sestrin binding in vitro. In contrast, Sestrins did not bind to each other, suggesting that Sestrins must be within the sMAC to be found in complex together (Figure 8B-C). In real cells, biotinylated DOS46L was found within the sMAC (Sestrin 1, 2, and 3, plus AMPK and MAPK), but not with elements of the GATOR complex (WDR59 and mTOR; Figure 8D). Selective interactions were also studied using the state-of-the-art AlphaFold algorithm for molecular docking prediction based on the deposited Sestrin 2 crystal structure. These studies revealed that the compound likely binds in domain A of Sestrin2, at the interface with domains B and C, and importantly, distant from the GATOR / mTORC1 regulatory site (domain C; Figure 27). These data indicate that DOS is a first-in-class selective sMAC inhibitor.

[0189] The specificity of DOS compounds was further tested in "Sestrin null" T cells generated by shRNA delivery. DOS compounds restored senescent CD4+ T cell proliferation in shCtrl (control) but not in Sestrin null T cells (Figure 9); this was confirmed in all nine donors tested. This finding supports the fact that DOS compounds regulate T cell function via Sestrin.

[0190] [Example 3] DOS compounds' ability to rejuvenate the immune system Immunophenotyping of PBMCs from healthy donors treated with DOS for 12 days showed a 50% reduction in senescent CD4+ T cells and a concomitant increase in stem-like memory T cells and naive T cells, characteristic of immune rejuvenation (Figure S10A-B). The rejuvenation potential was also demonstrated by an increase in oxidative metabolism and fat burning (FAO) in DOS-treated T cells (Seahorse experiment) (Figure S10C-D).

[0191] This is also true for senescent CD8+ T cells. In addition, cytokine analysis in stimulated CD4+ T cells revealed increased production of IFN-gamma, TNF-alpha, and IL-4 upon DOS treatment, all of which are well-established factors that promote T-cell-B-cell cooperation and antibody production (Figure 11) (Bot et al., 2000).

[0192] Indeed, the addition of DOS to primary human peripheral blood mononuclear cells (PBMCs) isolated from older donors (70-85 years old) was sufficient to restore in vitro influenza-specific IgG antibody production to the levels observed in younger donor cells (20-40 years old) not treated with DOS (Figure 12A). This effect was also observed in mouse splenocyte cultures, reaching up to a three-fold increase in influenza-specific IgG antibody production (Figure 12B). Notably, we obtained similar results when using heat-inactivated SARS-CoV2 (Figure 24). Thus, these data indicate that DOS compounds can be used as effective vaccine boosters.

[0193] DOS activity in vivo was tested at two different doses. Inhibition of T cell Sestrin was robust in the blood of mice injected with DOS compounds, evident after 48 hours, peaking at 72 hours (up to 80% Sestrin inhibition) and remaining stable for up to 8 weeks (Figure 13A). Long-term Sestrin downregulation was likely due to transcriptional silencing, as samples from DOS-treated mice showed reduced mRNA Sestrin expression compared to untreated age-matched animals, beginning at day 10 of DOS administration (Lanna et al., 2017), which was similar to expression levels present in young mice. Thus, DOS inhibit sMAC in a three-step mechanism; first, they induce the disruption of the AMPK-Sestrin regulatory binding (e.g., within 2 hours); second, they target the dissociated protein to ubiquitin-mediated proteasomal degradation (e.g., within 4 hours); and finally, they transcriptionally silence Sestrin mRNA expression (e.g., starting from day 10), resulting in permanent rejuvenation with a single dose administration. Young and old mice showed similar trends, indicating the ability of DOS to inhibit Sestrin at different ages. The fact that the compound is effective at a very low dosage (0.1 mg / Kg) in old mice suggests enhanced specificity for old T cells that only have sMAC and not mTOR. Furthermore, immunoblotting in harvested organs showed Sestrin inhibition not only in circulating blood cells, but also in the brain, heart, liver, kidney, and lung (Figure 13C). This illustrates that DOS can therefore be used in a variety of conditions characterized by Sestrin / sMAC activation.

[0194] Inspired by the long-lasting pharmacodynamic effect, we decided to test whether a single injection of DOS was sufficient to restore vaccine responsiveness in old mice (median age 16 months). Remarkably, a single dose of DOS46L (0.1 mg / Kg) along with the vaccine completely restored influenza-specific antibody titers at weeks 2, 4, and 8 post-vaccination to the levels observed in young mice (median age 3 months) vaccinated in the absence of DOS (Figure 14A-C). The in vivo IgG stimulatory effect is likely Sestrin-dependent, as it strongly correlates with DOS-induced T cell Sestrin downregulation in blood (Figure 14D). Similar results were obtained with another sMAC inhibitor, DOS144D. These data demonstrate the restoration of vaccine responsiveness during aging by a first-in-class sMAC inhibitor in vivo.

[0195] Long-lasting protection was observed at 6 × 10 5 The survival of DOS-treated mice was tested by lethal inoculation with PFU live H1N1 PR8 / 54 viral particles and monitoring for 14 days. Figure 15 shows 100% survival of DOS-treated mice (n=8) in infection, identical to the vaccinated young mice (n=8). In contrast, the old cohort vaccinated in the absence of DOS showed only 15% survival (n=7). Survival data is similar for DOS46L and DOS144D, but furthermore DOS46L is more effective at very low doses (0.1mg / Kg), consistent with its higher potency shown in vitro. The beneficial effect of DOS was also monitored by clinical scores, including behavior, hair, respiration, eyes, and body weight.

[0196] Autopsy analysis revealed that lymphocytes infiltrating tissues (e.g., lungs) of DOS-treated mice displayed high levels of IFN-gamma and IL10, cytokines involved in inflammation and immune defense against pulmonary viral infection (Figure 17). Together, these data identify DOS as a new class of compound that can be added to next-generation vaccine formulations to restore immunity in the elderly.

[0197] However, only a single treatment with DOS alone in vivo is sufficient to boost immune defense against lethal influenza infection in old mice, both immediately after DOS treatment (day 2) and in a long-term protocol (8 weeks) (Figure 18A). IgG-H1N1-specific antibody titers and their neutralizing effects were also restored in old mice with DOS-only regimen, similar to those treated with vaccine together with DOS46L (Figures 16 and 18). Figure 19 shows protection from lung necrosis in DOS46L-treated animals compared to untreated age-matched infected old controls. Consequently, in fact, real-time qPCR in the lungs of DOS-treated animals showed much lower amounts of H1N1 virus titers than old mice not injected with DOS. Long-term rejuvenation effects were also observed by permanent stem-like generation in animals treated with DOS46L, which was examined up to 8 weeks, which may be related to the immunoprophylactic effect of DOS.

[0198] DOS regimens can be complementary to, but also alternative to, vaccination because they completely rejuvenate immunity and restore antigen-specific function, resulting in very broad immune protection from viruses, as shown for COVID (Figure 24), cytomegalovirus (CMV), and varicella zoster virus (VZV) (Figure 25), as well as protection from bacteria, as for the tuberculosis BCG vaccine. This therefore indicates that DOS compounds can be used as preventative antiviral and antimicrobial compounds in general, as well as vaccine boosters.

[0199] It is well known to those skilled in the art that cancers can evade the immune system by regulating checkpoint inhibitors, such as PD-1 and TIM-3, on T cells (Robert, Nature Communication 2020). In addition, it is well documented in the literature that Sestrin is an important mediator in various types of cancers and diseases. Phenotypic analysis further showed that DOS-treated T cells downregulate immune checkpoint inhibitor receptors PD-1 and TIM3, which are utilized by cancers for immune evasion and are responsible for checkpoint inhibitor resistance treatment (Figure 21). Thus, DOS-induced checkpoint inhibitor downregulation may prevent cancer cells from evading the immune response. Thus, combined treatment of checkpoint inhibitors and DOS, as well as treatment of DOS alone, may be beneficial. For example, DOS compounds can act alone to induce the death of cancer cells, especially cells of neuroblastoma and breast cancer, which are pediatric diseases with very poor prognosis (Figure 22).

[0200] conclusion The present inventors have created novel inhibitors of sMAC (cyclic polypeptides), named DOS (Disruptors of sMAC), and have demonstrated that these DOS compounds can inhibit sMAC at nanomolar doses by directing sestrins to proteasomal degradation. Advantageously, the present inventors have demonstrated that the novel DOS compounds can provide long-term immune protection against bacterial or viral infections at a single dose, both in the presence and absence of vaccines. Furthermore, the present inventors have shown that DOS compounds can reduce senescent T cells and increase the levels of cytokines such as IFN gamma, TNF alpha, and IL-4 with DOS treatment. Advantageously, this therefore indicates the ability of DOS compounds to rejuvenate the aged immune system in elderly people, prevent, treat, or ameliorate some bacterial or viral infections, as well as age-related conditions, including cancer and neurodegenerative diseases.

Claims

1. A cyclic polypeptide comprising or consisting of an amino acid sequence derived from a sestrin, or a truncation thereof, a derivative or analogue thereof.

2. A cyclic polypeptide, derivative or analogue thereof as described in claim 1, wherein the cyclic polypeptide, derivative or analogue comprises or consists of an amino acid sequence derived from Sestrin 1 or a truncation thereof, and optionally, Sestrin 1 comprises an amino acid sequence substantially represented by SEQ ID NO: 1, 2, or 3, or a variant or fragment thereof.

3. A cyclic polypeptide, derivative or analogue thereof as described in claim 1, wherein the cyclic polypeptide, derivative or analogue comprises or consists of an amino acid sequence derived from Sestrin 2 or a truncation thereof, and optionally, Sestrin 2 comprises an amino acid sequence substantially as represented by SEQ ID NO: 4 or a variant or fragment thereof.

4. A cyclic polypeptide, derivative or analogue thereof as described in claim 1, wherein the cyclic polypeptide, derivative or analogue comprises or consists of an amino acid sequence derived from Sestrin 3 or a truncation thereof, and optionally, Sestrin 3 comprises an amino acid sequence substantially as represented by SEQ ID NO: 5, 6, or 7, or a variant or fragment thereof.

5. The cyclic polypeptide, derivative or analog thereof of claim 3, comprising or consisting of an amino acid sequence derived from the first 160 amino acids forming Sestrin 2, or a truncation thereof.

6. A cyclic polypeptide, derivative or analogue thereof described in any of the preceding claims, wherein the cyclic polypeptide, derivative or analogue is configured to bind to domain A and / or at the interface between domains A and C of Sestrin 1, Sestrin 2, and / or Sestrin 3.

7. A cyclic polypeptide, derivative or analogue thereof according to any preceding claim, comprising or consisting of 2 to 15 amino acid residues, more preferably 3 to 9 amino acid residues, more preferably 3 to 8 amino acid residues, even more preferably 4 to 7 amino acids.

8. 10. A cyclic polypeptide, derivative or analogue thereof according to any preceding claim, comprising or consisting of 5 amino acid residues.

9. The cyclic polypeptide, derivative or analog thereof, comprises substantially: (i) SEQ ID NOs: 8-84, or functional variants or fragments thereof; (ii) SEQ ID NOs: 58, 59, 63, 65, 86, 87, 92, 94-97, 107, 113, 114, 116-119, 121-124, 126, 130, 133, 148, 150, 154, 155, 159-162, or a functional variant or fragment thereof; (iii) SEQ ID NO: 170-172, 174, 179, 187, 190, 196-199, or 202, or a functional variant or fragment thereof; (iv) SEQ ID NOs: 58-60, 62, 64, 88-91, 93, 98-112, 115, 120, 125, 127-129, 131, 132, or 134-147, or a functional variant or fragment thereof; (v) SEQ ID NOs: 47, 58 or 77, 62-65, 71-73, 149, 151-153, 156-158, 163-169, 173, 175, 176, 180-186, 188, 189, 191-195, 200, 201, or 203-205, or a functional variant or fragment thereof; (vi) SEQ ID NOs: 89-91, 97, 206-218, or a functional variant or fragment thereof; (vii) SEQ ID NOs: 176, 180, 219-234, or a functional variant or fragment thereof; (viii) SEQ ID NOs:235-247, or a functional variant or fragment thereof; (viv) SEQ ID NOs:248-260, or a functional variant or fragment thereof; (vv) SEQ ID NO: 58, 59, 62-65, or a functional variant or fragment thereof; or (vvi) SEQ ID NOs: 261-269, or functional variants or fragments thereof. A cyclic polypeptide, derivative or analog thereof according to any of the preceding claims, comprising or consisting of an amino acid sequence represented by any one of the following:

10. The cyclic polypeptide, derivative or analog thereof of any preceding claim, comprising or consisting essentially of an amino acid sequence as set forth in SEQ ID NO: 22, 47, or 77, or a functional variant or fragment thereof.

11. 2. A cyclic polypeptide, derivative or analogue thereof according to any preceding claim, wherein the cyclic polypeptide, derivative or analogue thereof is composed solely of L-amino acids, or composed solely of D-amino acids, or composed of both D- and L-amino acids.

12. A cyclic polypeptide, derivative or analog thereof, comprising or consisting of an amino acid sequence selected from any of SEQ ID NOs: 8-84.

13. A cyclic polypeptide, derivative or analogue thereof described in any of the preceding claims, which binds to and / or inhibits Sestrin 1, Sestrin 2 and Sestrin 3, preferably domain A thereof.

14. The cyclic polypeptide, derivative or analog thereof, (i) selectively binds to and / or inhibits Sestrin 2; (ii) contains an amino acid residue that is conserved between Sestrin 1 and Sestrin 2 in a blast search at the same position; (iii) contains an amino acid residue that is conserved between Sestrin 3 and Sestrin 2 in a blast search at the same position; (iv) does not contain an amino acid residue conserved between Sestrin 1 and Sestrin 2 in a blast search at the same position; (v) does not contain an amino acid residue conserved between Sestrin 3 and Sestrin 2 in a blast search at the same position; (vi) contains regions of Sestrin 1 homology (chemical similarity) at different positions; (vii) contains regions of Sestrin 3 homology (chemical similarity) in different positions; (viii) contains sequence overlap and / or chemical similarity of Sestrin 1 with Sestrin 2; (viv) contains sequence overlap and / or chemical similarity of Sestrin 3 with Sestrin 2; (vv) consists of or comprises a sequence that is completely overlapping between all three Sestrins; and / or (vvi) consisting of or including a sequence that completely overlaps between Sestrin 1 and Sestrin 3; A cyclic polypeptide, derivative or analogue thereof according to any of the preceding claims.

15. The cyclic polypeptide, derivative or analog thereof has the formula (I): 【Chemistry 1】 2. A cyclic polypeptide, derivative or analogue thereof according to any preceding claim, comprising or consisting of:

16. The cyclic polypeptide, derivative or analog thereof, comprises the following bonds or conjugations: (i) Terminal NH ２ and COOH groups (i.e., peptide bonds); (ii) NH ２ Group and NH ２ group (i.e., hydrazine bond); (iii) NH ２ Group and CONH ２ group (i.e., a primary amide bond); (iv) N=NH group and NH ２ group (i.e., hydrazine bond); (v) NH ２ group and an OH group (i.e., a hydroxylamine bond); (vi) NH ２ groups and SH groups (i.e., thiol-hydroxylamine bonds); (vii) NH ２ groups and SR groups (i.e., hydrosulfide bonds); (viii) COOH group and CONH ２ group (i.e., an amide bond); (ix) a COOH group and a COOH group (i.e., a dicarboxylic acid bond); (x) a COOH group and an N=NH group (i.e., a carboxyl-amidogen bond); (xi) a COOH group and an OH group (i.e., a hydroxycarboxyl bond); (xii) a COOH group and an SH group (i.e., a thiol bond); (xiii) a COOH group and an SR group (i.e., a thiol bond); (xiv) N=NH group and CONH ２ group (i.e., amidogen bond); (xv) N=NH and OH groups (i.e., N-hydroxylamine bonds); (xvi) CONH ２ Group and CONH ２ group (i.e., diamide bond); (xvii) CONH ２ a group and an SR group (i.e., an s-amide bond); (xviii) an SR group and an OH group (i.e., a hydroxy-thiol bond); (xix) an SR group and an NH group (i.e., a thiolamine bond); (xx)NH ２ groups and NH groups (i.e., hydrazine bonds); (xxi) a COOH group and an NH group (i.e., an amino-propanoic acid bond); (xxii) SH and OH groups (i.e., hydrophilic bonds); (xxiii) SH and NH groups (i.e., amino-thiol bonds); (xxiv) OH and NH groups (i.e., hydroxylamine bonds); (xxv) OH groups to OH groups (i.e., hydroxy bonds); (xxvi) CONH ２ group and an OH group (i.e., a hydroxyamide bond); (xxvii) SH groups and SH groups (i.e., dithiol bonds); (xxviii) CONH ２ group and an NH group (i.e., a hydroxyamide bond); or (xxix) NH group and NH group (i.e., diammonium bond) 16. A cyclic polypeptide, derivative or analog thereof, as claimed in claim 15.

17. Said cyclic polypeptide, derivative or analogue thereof comprises or consists of the consensus or recursive sequence provided herein as SEQ ID NO:85: x １ x ２ x ３ x ４ x ５ [SEQ ID NO: 85] (In the formula, x １ is A, P, H, L, R, M, D, F, V, I, E, N, Y, S, Q, or T, preferably x １ is A, P, H, L, R, M, or D; x ２ is Y, A, L, R, M, F, K, V, E, I, D, S, Q, N or T, preferably x ２ is Y, A, L or R; x ３ is L, A, S, R, M, D, E, K, F, T, Q, C, V, P or N, preferably x ３ is L, A, S or R; x ４ is L, A, E, S, K, D, V, I, F, Q, H, C, T, P, N, R or Y, preferably x ４ is L, A or E; and / or x ５ is L, R, A, E, S, K, I, P, D, F, H, Y, C, T, N, Q, V, or M, preferably x ５ is L, R, A, or E) A cyclic polypeptide, derivative or analogue thereof according to any of the preceding claims.

18. The cyclization of the polypeptide, derivative or analogue thereof is carried out by cyclizing the amino acid residues 4, 9, 10, 15, 16, 19, 20, 21, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 46, 50, 56, 61, 63, 65, 66, 67, 71, 73, 84, 91, 94, 96, 99, 103, 108, 109, 110, 131, 134, 147, 185, 204, 206, 208, 210, 212, 214, 216, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 230, 231, 232, 233, 234, 235, 236, 237, 238, 240, 241, 242, 243, 244, 245, 246, 250, 256, 258, 260, 262, 264, 266, 270, 272, 274, 276, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 290, 303, 3 17, 220, 226, 228, 230, 233, 234, 236, 237, 238, 239, 240, 241, 244, 249, 251, 252, 255, 256, 272, 273, 274, 277, 284, 292, 298, 299, 301, 303, 304, 306, 309, 310, 311, 313, 314, 319, 331, 333, 334, 343, 359, 369, 431, 442, or 467, and / or Sesto Amino acid residues 1 to 68, 72, 77, 78, 79, 84, 85, 88, 89, 90, 93, 95, 96, 97, 98, 99, 100, 102, 103, 104, 109, 113, 119, 124, 126, 128, 129, 130, 131, 135, 137, 148, 155, 158, 160, 163, 167, 172, 173, 174, 195, 198, 211, 249, 268, 281, 284, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346 2, 294, 297, 298, 300-312, 315, 319, 320, 321, 323, 325, 326, 329, 330, 346, 347, 350, 357, 365, 371, 372, 374, 376, 378, 381, 382, ​​383, 385, 386, 391, 403, 405, 414, 430, 440, 502, 513, or 538, or a derivative or analogue thereof.

19. The cyclization of the polypeptide, derivative or analogue thereof is carried out by cyclizing the amino acid residues 1, 2, 4, 5, 10, 11, 14-29, 34, 35, 36, 39, 40, 41, 50, 56, 59, 61, 63, 66, 69, 70, 71, 81, 87, 91, 94, 96, 99, 103, 108, 109, 110, 131, 134, 142, 143, 147, 151, 180, 192, 204, 217, 220, 222, 224, 226, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, , 228, 230, 231, 233, 234, 239, 240, 241, 243, 244, 245, 246, 249, 251, 255, 256, 272, 273, 277, 289, 299, 301, 302, 303, 306, 307, 310, 313, 314, 320, 331, 333, 334, 357, 359, 369, 380, 342, or 367, and / or amino acid residues 1 to 14, 16, 17 of Sestrin 3 (SEQ ID NO: 5), 22, 23, 30, 31, 32, 35, 36, 37, 46, 52, 55, 57, 59, 62, 65, 66, 67, 77, 83, 87, 90, 92, 95, 99, 104, 105, 106, 127, 130, 138, 138, 143, 147, 176, 188, 200, 213, 216, 218, 220, 222, 224, 226, 227, 229, 230, 232, 234, 235, 236, 237, 238, 239, 243, 244, 245 , 247, 248, 249, 250, 253, 255, 259, 260, 276, 280, 292, 302, 304, 305, 308, 309, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 325, 326, 332, 343, 345, 346, 369, 371, 381, 392, 454, or 479 of the cyclic polypeptide, or a derivative or analog thereof, according to any of the preceding claims.

20. A cyclic polypeptide, derivative or analogue thereof described in any of the preceding claims, which targets sestrins in immune cells, preferably sestrins in B cells, natural killer (NK) cells and / or T cells (T lymphocytes).

21. The cyclic polypeptide, derivative or analog thereof of claim 20, which targets sestrin in CD4+ and / or CD8+ T cells, preferably sestrin in CD4+ CD27+ CD28+ cells and / or CD4+ CD27- CD28+ cells, more preferably sestrin in CD4+ CD27- CD28- T cells (senescent T cells).

22. A cyclic polypeptide, derivative or analogue thereof according to any of the preceding claims, wherein the cyclic polypeptide, derivative or analogue thereof induces or restores cytokine production, preferably induces or restores the production of IFN-gamma, TNF-alpha and / or IL-4.

23. 10. A cyclic polypeptide, derivative or analog thereof according to any preceding claim, wherein the cyclic polypeptide, derivative or analog thereof prevents or reverses immunosenescence.

24. 10. A cyclic polypeptide, derivative or analogue thereof according to any preceding claim, wherein the cyclic polypeptide, derivative or analogue thereof is configured to rejuvenate the immune system.

25. Rejuvenating the immune system includes (i) restoring immune cell responsiveness to antigen stimulation; (ii) restoring telomere length and / or telomerase activity in immune cells; (iii) restoring antigen-specific proliferation and / or cytokine production in immune cells; and / or (iv) restoring B cells and / or CD8 ＋ 25. The cyclic polypeptide, derivative or analog thereof of claim 24, which comprises restoring antigen-specific antibody production by T cell and / or natural killer cell proliferation.

26. 10. A cyclic polypeptide, derivative or analogue thereof according to any preceding claim for use in therapy.

27. A nucleic acid encoding a cyclic polypeptide, a derivative or analogue thereof according to any one of claims 1 to 25, for use in therapy.

28. 26. A cyclic polypeptide, derivative or analogue thereof, or a nucleic acid encoding said cyclic polypeptide, derivative or analogue thereof, according to any one of claims 1 to 25, for use in treating, preventing or ameliorating a microbial infection, an age-related condition or a T-cell mediated disease.

29. 29. The cyclic polypeptide, derivative or analog thereof for use according to claim 28, wherein the microbial infection is bacterial, viral, fungal or protozoan.

30. 29. A cyclic polypeptide, derivative or analog thereof for use as described in claim 28, wherein the age-associated condition is a condition associated with, caused by or associated with aging and / or decline of the immune system, and optionally the age-associated condition is characterized by Sestrin-dependent sMAC activation and / or immunosenescence.

31. 29. The cyclic polypeptide, derivative or analog thereof for use according to claim 28, wherein the age-related condition is selected from the group consisting of cancer (e.g., childhood neuroblastoma, melanoma, liver, pancreatic, testicular or pancreatic cancer), smoking-induced emphysema, epilepsy, depression, metabolic disease (including obesity), osteoporosis, erectile dysfunction, infertility, or neurodegenerative disease, e.g., Alzheimer's disease or dementia.

32. A composition comprising a cyclic polypeptide, a derivative or analogue thereof according to any one of claims 1 to 25, or a nucleic acid encoding said cyclic polypeptide, a derivative or analogue thereof, and a vaccine.

33. A cyclic polypeptide, derivative or analogue thereof according to any one of claims 1 to 25, or a nucleic acid encoding said cyclic polypeptide, derivative or analogue thereof, for use in stimulating an immune response, preferably as a vaccine booster.

34. A pharmaceutical composition comprising a therapeutically effective amount of a cyclic polypeptide, derivative or analog thereof according to any one of claims 1 to 25, or a nucleic acid encoding said cyclic polypeptide, derivative or analog thereof, and optionally a pharma- ceutical acceptable vehicle.

35. 35. A method for making the pharmaceutical composition of claim 34, comprising combining a therapeutically effective amount of a cyclic polypeptide, derivative or analog thereof, or a nucleic acid encoding said cyclic polypeptide, derivative or analog thereof, of any one of claims 1 to 25, with a pharma- ceutically acceptable vehicle.

Images