Microorganisms with reduced capacity

Abstract

The present invention relates to microorganisms with reduced competence and to compositions, in particular feed, food and pharmaceutical compositions, containing said microorganisms.

Description

[Technical field]

[0001] The subject of the present invention relates to microorganisms with reduced competence and to compositions, in particular feed, food and pharmaceutical compositions, containing said microorganisms. [Background technology]

[0002] Many bacterial species are able to bind and take up DNA from the surrounding medium. This ability, called "competence", allows bacterial strains to acquire new characteristics, particularly to adapt to the environment. This process is also called "natural transformation" (Non-Patent Document 1). One problem with this ability is that strains may acquire undesirable antibiotic resistance genes, which is not a desirable characteristic, particularly for a microbial strain to be released into the environment. The ability of bacterial cells to acquire genetic information from the environment is therefore problematic for established production strains, particularly for probiotics that are sold as feed additives and should not change their characteristics during or after their production if they are to be applied in feeding applications. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Breitling and Dubnau(1990);J Bacteriology 172(3):1499-1508 Summary of the Invention [Problem to be solved by the invention]

[0004] It was therefore an object of the present invention to provide a microbial strain which has a reduced ability to modify its genetic material by acquiring genetic information from the environment due to a reduced competence. The object of the present invention can be achieved by providing a microorganism comprising a knocked-out competence gene, the knocked-out competence gene being preferably a transcription factor, more preferably the competence transcription factor comK. [Means for solving the problem]

[0005] Surprisingly, it was found that by introducing several point mutations into the comK gene it is possible to knock out the microbial competence mechanism, while knocking out the comK gene does not have any detrimental effect on the characteristics of the resulting cells, in particular in terms of safety and risk, nor does it have a negative effect on the probiotic activity.

[0006] Thus, a first subject of the present invention is a microorganism with reduced competence, where "reduced competence" preferably means a reduction in the ability to take up DNA from the surrounding medium by natural transformation of at least 50%, more preferably at least 60, 70 or 80%, in particular at least 90 or 95%, compared to the wild type or parent strain. In a particularly preferred embodiment of the present invention, the microorganism of the present invention is completely unable to take up DNA from the surrounding medium by natural transformation, i.e. the competence is reduced by 100%. The reduction in cell competence is preferably determined with a stock solution containing 25 μg of plasmid DNA, more preferably as disclosed in Example 3.

[0007] The microorganism of the present invention preferably comprises at least one competence gene that is knocked out, i.e., is expressed at a significantly reduced level and / or has a significantly reduced activity. The at least one competency gene that is knocked out or has significantly reduced expression or activity is preferably a gene encoding a transcription factor, and most preferably the competency gene is the competency transcription factor comK. Preferably, the competence gene of the microorganism of the invention, in particular the comK gene, comprises 1 to 20, more preferably 1 to 10, in particular 1 to 5 mutations compared to the wild type and / or parent strain from which the microorganism is derived, said mutations being preferably point mutations. In a highly preferred embodiment of the invention, at least one of the mutations, preferably at least two of said mutations, introduces a stop codon into the sequence coding for the competence gene, in particular comK, and highly preferred, the comK parent sequence is the comK sequence as represented by SEQ ID NO: 1 present in the Bacillus velezensis strain CECT 5940, preferably at least one stop codon is introduced at positions 1 to 50 of the sequence coding for the competence gene, in particular within the comK sequence. In a more preferred embodiment of the invention, the microorganism comprises at least one, preferably both, of the following mutations in the comK gene: substitution of adenine at position -10 by thymine; substitution of guanine at position -37 by thymine, both of which introduce a stop codon each. In a particularly preferred embodiment of the invention, the microorganism contains a comK mutant having the sequence set forth in SEQ ID NO:2. Alternatively and / or in addition to reducing and / or knocking out the activity of ComK, the activity of at least one other and / or further competence gene can be reduced and / or knocked out, in particular by introducing at least one stop codon into said gene, said alternative and / or further competence genes being in particular selected from the comGA, comGB, comGC, comGD, comGE, comGF, comGG, comS, comEA, comEC, comFA, dprA, ssbB and recA genes.

[0008] The microorganisms according to the invention can in principle be obtained by any kind of method, i.e. GMO or non-GMO methods. However, preferably, the microorganisms are not genetically modified, i.e. non-GMO. This means that the microorganisms are preferably either naturally occurring microorganisms or natural mutants of naturally occurring microorganisms or microorganisms obtained by another method classified as non-GMO. The term "natural mutants" refers to mutants that arise from naturally occurring microorganisms and / or parent strains, but not by genetic modification of the microorganisms, by applying classical genetic engineering and / or biotechnological methods, such as site-directed mutagenesis. Said natural mutants can be obtained by classical methods of natural selection, such as growing the microorganisms in the presence of UV light and / or by applying high temperature or protoplast formation and / or in the presence of a specific antibiotic to which the parent strain is sensitive. Natural mutants can furthermore, but less preferably, be obtained using mutagens, i.e. chemicals that induce the formation of mutants. The formation of natural mutants using mutagens is less preferred, therefore in a preferred embodiment of the invention, the natural mutants and / or non-GMO mutants are obtained without using said mutagens. If the variants are obtained by applying genetic and / or biotechnological methods, such as site-directed mutagenesis, preferably methods are applied which are classified as non-GMO. Non-GMO methods according to the invention are preferably characterized in that no heterologous genetic information is introduced into the microorganism. In a particularly preferred embodiment of the invention, the microorganism of the invention is a non-naturally occurring mutant, in particular a non-GMO and / or naturally occurring mutant as defined above. The microorganism of the invention preferably has the same characteristics as the parent strain from which it is derived, but with a reduced competence as described above. In a particularly preferred embodiment, the only difference in the genome sequence between the microorganism of the invention and the parent strain from which it is derived is the mutation in the comK sequence.

[0009] The microorganism of the present invention can be produced, for example, by the following method: A method for obtaining a microorganism with reduced competence, comprising the steps of: (a) introducing a reporter gene, preferably a reporter gene encoding a fluorescent marker, downstream of a promoter of a gene activated by said competence gene or regulatory gene, such that activation of said promoter results in expression of the reporter gene; (b) screening for conditions that induce said competence by analyzing the expression level of said reporter gene in a microorganism; (c) introducing a knockout into a gene that confers an auxotrophy on the strain and at the same time confers resistance to a particular substance on the transformed strain; (d) screening the knocked-out strains obtained in step (c) by screening the strains with the desired resistance; (e) co-transforming the strain identified in step (d) with an active form of the gene knocked out in step (c) and a knockout mutant of the competence gene or regulatory gene; (f) searching for said strain exhibiting prototrophy; (g) screening the strains identified in step (f) to determine whether the regulatory gene has been knocked out; The method can be obtained by a method comprising the steps of: In the process, steps (c) and (e), and optionally also step (g), are preferably carried out under conditions as specified in step (b) of the process.

[0010] The microorganism of the present invention is preferably one of the following: (a) introducing a reporter gene, preferably a reporter gene encoding a fluorescent marker, downstream of the promoter of the competence gene comGA, which is activated by ComK, such that activation of the promoter results in expression of the reporter gene; (b) screening for conditions that induce said competence by analyzing the expression level of said reporter gene in a microorganism; (c) introducing a knockout in a gene that confers an auxotrophy on the strain and at the same time confers resistance to a particular substance on the transformed strain, said gene preferably being pyrE and said knockout preferably conferring resistance to 5-fluoroorotic acid (5-FOA); (d) searching for said knocked out strains by screening for said strains with the desired resistance, preferably resistance to 5-FOA; (e) co-transforming the strain identified in step (d) with active forms of the genes knocked out in step (c), i.e., preferably an active form of pyrE and a knockout mutant of comK; (f) searching for said strain exhibiting prototrophy; (g) screening the strain identified in step (f), preferably under the conditions identified in step (c), to determine whether the regulatory gene comK has been knocked out; The method can be obtained by a method comprising the steps of: In the process, steps (c) and (e), and optionally also step (g), are preferably carried out under conditions as specified in step (b) of the process.

[0011] The microorganisms according to the invention are preferably furthermore non-pathogenic, in particular non-pathogenic for humans and animals, and preferably also non-pathogenic for plants. The microorganisms according to the present invention are preferably selected from the list of microorganisms listed as direct-fed microorganisms ("DFM") or probiotics, as listed on the list of Generally Recognized as Safe ("GRAS") or relevant lists, such as, but not limited to, the EFSA QPS list, the AAFCO list, or the list by the Chinese Ministry of Agriculture (MOA).

[0012] The microorganism according to the invention is preferably susceptible to at least 5 antibiotics, more preferably at least 6, 8 or 10 antibiotics, especially at least 11 or 12 antibiotics, wherein the antibiotics are preferably selected from tylosin, nalidixic acid, trimethoprim, apramycin, sulfonamides, ampicillin, vancomycin, gentamicin, kanamycin, streptomycin, erythromycin, clindamycin, tetracycline, chloramphenicol, nourseothricin, daptomycin and virginiamycin. In a highly preferred embodiment, the microorganism according to the invention is susceptible to all of the above antibiotics. "Susceptible to an antibiotic" means that the growth of the microorganism is inhibited by the antibiotic under conditions in which the microorganism would otherwise grow. Susceptibility to antibiotics is preferably tested according to CLSI guidelines (M07-A8 and M45-A2). Bacillus strains are preferably considered susceptible for vancomycin, gentamicin, kanamycin, streptomycin, erythromycin, clindamycin, tetracycline and chloramphenicol if growth is detected only at or below the breakpoint concentrations specified in EFSA Journal 2012;10(6):2740. For tylosin, nalidixic acid, trimethoprim, apramycin, sulfonamides, ampicillin, nourseothricin, daptomycin and virginiamycin, for which no breakpoints have been given by EFSA for the genus Bacillus, the breakpoint is preferably 4 mg / L. The microorganism of the present invention can be any type of microorganism with natural competence, in particular endospore-forming bacteria and / or non-spore-forming bacteria, but in a preferred embodiment of the present invention, the microorganism is an endospore-forming bacteria. The cells of the endospore-forming bacteria of the present invention may be present, in particular in the composition of the present invention, as spores (dormant), as vegetative cells (growing), as transitional cells (in the transition from the growth phase to the spore-forming phase), or as a combination of at least two, in particular all, of these types of cells. In a preferred embodiment, the composition of the present invention mainly contains spores or only contains spores.

[0013] The microorganism of the present invention is preferably selected from endospore-forming bacteria of the phylum Bacillota (formerly known as Firmicutes), preferably of the genus Bacillus, more preferably of the following species: Bacillus subtilis, B. amyloliquefaciens, B. velezensis, Bacillus licheniformis, Bacillus spp. licheniformis, Bacillus paralicheniformis, Bacillus pumilus, Bacillus megaterium, Bacillus lentus, Bacillus laterosporus, Bacillus alevi, Bacillus cereus, Bacillus badius, Bacillus thuringiensis, Bacillus coagulans, Bacillus siamensis, Bacillus glycinifermentans, Bacillus methylotrophicus ... Preferably, the bacterium is selected from Bacillus methylotrophicus, Bacillus thuringensis, Bacillus polyfermenticus, Bacillus vallismortis, Bacillus tequilensis, Bacillus atrophaeus, Bacillus mojavensis, Bacillus sonorensis, Bacillus inaquosus and B. safensis, and most preferably, Bacillus beruerensis or Bacillus amyloliquefaciens. In a further preferred embodiment of the invention, the microorganism of the phylum Bacillario is of the genus Clostridium, preferably C. butyricum, C. tyrobutyricum or C. acetobutylicum. In a highly preferred embodiment of the invention, the microorganism according to the invention is of the species Bacillus beruesensis, more preferably the genomic sequence of the microorganism is at least 99%, in particular at least 99.5% or 99.8%, especially at least 99.9% or 99.99% identical to the genomic sequence of the Bacillus beruesensis strain CECT 5940. In a particularly preferred embodiment, the only difference in the genomic sequence between the CECT 5940 strain and the strain according to the invention is the mutation in the comK sequence.

[0014] In a highly preferred embodiment of the invention, the microorganisms according to the invention furthermore have probiotic activity and / or can be used as direct-feeding microorganisms. The microorganism according to the invention particularly preferably further comprises: (a) the ability to grow rapidly in large-scale bioreactors; (b) the ability to grow in the presence of bile, preferably in the presence of 2 to 4 mM bile and / or in the presence of 0.3% by mass bile; (c) the ability to grow in the presence of formate, acetate, propionate, and / or lactate; (d) the ability to produce organic acids, especially lactic acid; (e) the ability to grow under high salt conditions; (f) the ability to form endospores; (g) the ability to grow anaerobically; (h) the ability to inhibit pathogenic bacteria, particularly Clostridium perfringens, Salmonella Enteritidis, Salmonella typhimurium, Escherichia coli, Clostridioides difficile, and Vibrio parahaemolyticus; (i) the ability to produce at least one enzyme, preferably an enzyme selected from amylase, lipase, catalase, cellulase, xylanase and protease; (j) susceptibility to selected antibiotics; (k) the ability to produce biosurfactants, in particular surfactin; (l) Function to regulate the microbiome; There is at least one, more preferably at least two, three, four or five properties selected from:

[0015] The microorganisms of the present invention, particularly those of the Bacillus genus, are preferably capable of rapid growth in large-scale bioreactors, which means heterotrophic growth in the absence of light, particularly with a doubling time of less than 60 minutes in a stirred tank reactor.

[0016] The microorganism of the present invention is further preferably characterized in that it is capable of growing in the presence of 2 mM bile, preferably in the presence of 4 mM bile, in particular in that in the presence of 2 mM bile it has an AUC5 performance value of at least 0.5, preferably at least 0.65, in particular at least 0.8, and an AUC10 performance value of at least 1.2, preferably at least 1.4, in particular at least 1.6; and / or further characterized in that it is capable of growing in the presence of 0.3% by weight bile, in particular in the presence of 0.3% by weight chicken bile and / or in the presence of 0.3% by weight porcine bile, and preferably in that it is capable of surviving exposure to 0.3% by weight bile, in particular 0.3% by weight chicken bile and / or 0.3% by weight porcine bile, for at least 3 hours, preferably at least 5 to 8 hours.

[0017] The microorganism of the present invention is further preferably characterized in that it is capable of growing anaerobically, in particular in that it is capable of degrading water-insoluble cellulose and / or protein under anaerobic conditions. The microorganisms of the invention are further preferably characterized in that at least 50%, preferably at least 70 or 90% of the spores survive exposure to 99° C. for 20 minutes. The microorganism of the present invention is preferably used to prepare a feed or food additive composition by mixing the microorganism with a suitable carrier.

[0018] In a particularly preferred embodiment of the invention, the microorganism of the invention is preferably used in the form of a dry fermentation medium, where "dried" means that the residual water content is preferably 0.1 to 10% by weight, more preferably 0.2 to 5% by weight, especially 0.3 to 4% by weight. A further subject of the invention is therefore also a feed or food additive containing the microorganism according to the invention, which may in particular be provided in the form of a dry fermentation medium. The feed or food additive according to the invention preferably comprises the microorganism or the dry fermentation medium of the microorganism in an amount of 0.1 to 10% by weight, more preferably in an amount of 0.2 to 5% by weight, in particular in an amount of 0.3 to 3% by weight. The feed or food additive further preferably comprises a carrier, in particular in an amount of at least 80% by weight, preferably in an amount of at least 90 or at least 95% by weight, in particular in an amount of 90 to 99.9% by weight or 95 to 99.8% by weight or 97 to 99.7% by weight. In a preferred embodiment of the invention, the feed or food additive consists exclusively of a mixture of the microorganism or the dry fermentation medium of the microorganism and said carrier. The feed or food additive preferably contains 1×10 microorganisms. 9 ~1×10 11 cfu (colony forming units), more preferably 5 x 10 per gram of feed or food additive 9 ~5×10 10 The amount of cfu.

[0019] Carriers included in the feed or food additive are preferably selected from inert formulation ingredients added to improve recovery, efficacy or physical properties and / or to aid packaging and administration. The carriers may be added individually or in combination. The carriers may be selected from anti-caking agents, antioxidants, bulking agents, binders, structuring agents, coating agents and / or protective agents. Examples of useful carriers are polysaccharides (particularly starch, maltodextrin, methylcellulose, gums, chitosan and / or inulin), protein sources (particularly skim milk powder and / or sweet whey powder), protein hydrolysates (particularly peptones such as soy peptone and / or yeast extract), peptides, sugars (particularly lactose, trehalose, sucrose and / or dextrose), lipids (particularly lecithin, vegetable oils and / or mineral oils), salts (particularly sodium chloride, sodium carbonate, cellulose, cellulose acetate ... Examples of suitable carriers for animal feed additives include calcium carbonate, chalk, limestone, magnesium carbonate, sodium phosphate, calcium phosphate, magnesium phosphate and / or sodium citrate), and silicates (particularly clays, especially beolite clay, amorphous silica, fumed / precipitated silica, zeolites, Fuller's earth, Bayliss®, Clintporite, montmorillonite, diatomaceous earth, talc, bentonite, and / or silicates such as aluminum silicate, magnesium silicate and / or calcium silicate). Suitable carriers for animal feed additives are described in the official publications of American Feed Control Officials, Inc., published annually. See, for example, Official Publication of American Feed Control Officials, Sharon Krebs, editor, 2006 edition, ISBN 1-878341-18-9. The carriers can be added after concentrating the fermentation medium containing the microorganism of the invention and / or during and / or after drying the fermentation medium.

[0020] The residual moisture content of the feed or food additive according to the present invention is preferably 0.1 to 6 mass%, preferably 0.3 to 5 mass%, more preferably 0.5 to 4 mass%, and further preferably has a water activity of 0.05 to 0.6, preferably 0.1 to 0.5 (aw value).

[0021] A further subject of the present invention is also the preparation of a microorganism according to the invention or a dried fermentation medium of said microorganism, preferably at a concentration of 1×10 9 ~1×10 11 cfu (colony forming units), more preferably 5 x 10 per gram of feed or food additive. 9 ~5×10 10 A method for preparing the feed or food additive according to the invention, in particular by mixing with the above-mentioned carriers, in an amount to adjust the amount of cfu.

[0022] The above feed additives, like the microorganisms themselves, can be used in the preparation of feed and pharmaceutical compositions and can be added to drinking water and breeding water. In a preferred embodiment, 0.1 kg to 100 kg of feed additive, in particular 1 kg to 10 kg of feed additive, are used per tonne of feed, drinking water or breeding water to provide a composition that can be used to feed animals. Feed and food compositions can be prepared by mixing the feed or food additive with conventional feed or food ingredients, respectively. A further subject of the present invention is therefore also a feed or food composition comprising a microorganism and / or a feed or food additive according to the invention, and preferably at least one further feed or food ingredient. A further subject of the present invention is therefore also the use of a microorganism according to the invention and / or a feed or food additive according to the invention for preparing a feed or food composition. A further subject of the present invention is therefore also a method for preparing a feed or food composition according to the invention, in which the microorganism according to the invention and / or the feed or food additive according to the invention are mixed with further feed or food ingredients. A further subject of the present invention is also a pharmaceutical composition comprising a microorganism according to the invention and at least one pharma- ceutically acceptable carrier. A further subject of the invention is therefore also the use of a microorganism according to the invention and / or a feed or food additive according to the invention for preparing a pharmaceutical composition, in particular a pharmaceutical composition for the treatment, prevention or alleviation of the course of intestinal diseases. A further subject of the invention is therefore also a process for preparing a pharmaceutical composition according to the invention, comprising mixing the microorganism according to the invention and / or the feed or food additive according to the invention with a pharma- ceutically acceptable carrier.

[0023] Endospore-forming bacteria of the genus Bacillus, in particular the species Bacillus beruesennsis, and especially the Bacillus beruesennsis CECT 5940 strain, are generally known to have beneficial effects on the intestine of animals and humans. Thus, when administered to an animal, the microorganisms of the invention preferably serve to promote the health of the animal, and / or improve the general physical condition of the animal, and / or improve the feed conversion of the animal, and / or reduce the mortality rate of the animal, and / or increase the survival rate of the animal, and / or improve the weight gain of the animal, and / or increase the disease resistance of the animal, and / or increase the productivity of the animal, and / or modulate the immune response of the animal, and / or establish or maintain a healthy gut microbiota in the animal, and / or improve the meat quality of the animal, in particular the meat elasticity and / or meat toughness, and / or reduce the shedding of bacterial and / or viral pathogens through the faeces of the animal. In particular, the microorganisms and compositions of the invention may be used to help re-establish a healthy balance of the gut microbiota after the administration of antibiotics for therapeutic purposes.

[0024] A further subject of the present invention is therefore a method for promoting the health of an animal, and / or improving the general body condition of said animal, and / or improving the feed conversion rate of said animal, and / or reducing the mortality rate of said animal, and / or increasing the survival rate of said animal, and / or improving the weight gain of said animal, and / or increasing the productivity of said animal, and / or increasing the disease resistance of said animal, and / or modulating the immune response of said animal, and / or establishing or maintaining a healthy intestinal microflora in said animal, and / or improving the meat quality of said animal, and / or reducing the shedding of bacterial and / or viral pathogens via the faeces of said animal, wherein at least one microorganism and / or at least one feed additive and / or at least one composition of the present invention is administered to the animal. A further subject of the present invention is therefore also a method for promoting human health and / or improving the general physical condition of a human and / or increasing the disease resistance of a human and / or modulating the immune response of a human and / or for establishing or maintaining a healthy intestinal microflora in a human, in which at least one microorganism and / or at least one composition according to the invention is administered to the human.

[0025] A further subject of the present invention is therefore also the use of at least one microorganism and / or at least one feed additive and / or at least one composition of the invention (for preparing a composition) for promoting the health of an animal and / or improving the general body condition of an animal and / or improving the feed conversion rate of an animal and / or reducing the mortality rate of an animal and / or increasing the survival rate of an animal and / or improving the weight gain of an animal and / or increasing the productivity of an animal and / or increasing the disease resistance of an animal and / or modulating the immune response of an animal and / or establishing or maintaining a healthy intestinal microflora in an animal and / or improving the meat quality of an animal and / or reducing the shedding of bacterial and / or viral pathogens via the faeces of an animal, wherein the at least one microorganism and / or the at least one feed additive and / or the at least one composition of the invention is administered to an animal. A further subject of the present invention is therefore the use of at least one microorganism and / or at least one composition of the invention (for the preparation of a composition) for promoting human health and / or improving the general physical condition of a human and / or for increasing the disease resistance of a human and / or for modulating the immune response of a human and / or for establishing or maintaining a healthy intestinal microflora in a human, wherein at least one microorganism and / or at least one composition of the invention is administered to a human.

[0026] Further subject matter of the present invention is therefore also at least one microorganism and / or at least one feed or food additive and / or at least one composition according to the invention for promoting the health of animals and / or humans and / or for improving the general physical condition of animals and / or humans and / or for improving the feed conversion rate of animals and / or for reducing the mortality rate of animals and / or for increasing the survival rate of animals and / or for improving the weight gain of animals and / or for increasing the productivity of animals and / or humans and / or for increasing the disease resistance of animals and / or humans and / or for modulating the immune response of animals and / or humans and / or for establishing or maintaining a healthy intestinal microflora in animals and / or humans and / or for improving the meat quality of animals and / or for reducing the shedding of bacterial and / or viral pathogens via the faeces of animals. "Enhancing animal productivity" refers specifically to any of the following: production of more or better quality eggs, milk or meat, or increasing the number of offspring, or improving survival of the offspring. By using the microorganisms, feed or food additives and compositions of the invention, preferably an improvement in at least one of the above characteristics is achieved, preferably meaning an improvement of at least 1%, more preferably at least 3 or at least 5%, compared to a suitable negative control. As a negative control, an average known in the animal husbandry field may be used, but preferably an animal that is subjected to the same treatment as the animals to be tested, but that is not administered the microbial preparation and / or composition of the invention, is used.

[0027] In particular, the microorganisms, preparations and compositions of the invention may be administered or fed to an animal in an amount effective to inhibit and / or reduce the growth of pathogenic bacteria in the intestine of the animal, including, in particular, Listeria, Enterococci, Staphylococci, Aeromonas, Streptococci, Campylobacter, Shigella, Haemophilus and Brachyspira, in addition to Clostridium, Salmonella, Vibrio and Escherichia coli. Relatedly, the method of the invention may be used to reduce the amount of pathogenic bacteria, viruses and protozoa excreted in animal feces. The method of the invention may also be used to maintain or enhance the growth of beneficial bacteria, such as lactic acid bacteria, in the intestine of the animal. The compositions of the present invention can maintain an overall healthy gut microbiome by reducing pathogenic bacteria and / or enhancing or maintaining beneficial bacteria.

[0028] A further subject of the present invention is therefore a method for inhibiting and / or reducing the growth of pathogenic bacteria and / or for maintaining and / or enhancing the growth of beneficial bacteria, in particular in the gastrointestinal tract of an animal or human, in which a microorganism, preparation and / or composition according to the invention is administered to an animal or human and in which the pathogenic bacteria are preferably of the genus Clostridium, in particular Clostridium perfringens, Clostridium difficile, C. novyi, C. septica, C. erythropoeias ... um and Clostridium colinum; the genus Listeria, in particular L. monocytogenes, L. seeligeri and L. welshimeri; the genus Salmonella, in particular the subspecies Salmonella enterica, arizonae, bongori and in particular the serovars Salmonella gallinarum, Salmonella pullorum, Salmonella typhimurium, Salmonella enteritidis, Salmonella cholerasuis, Salmonella heidelberg, Salmonella dublin, Salmonella hadar, Salmonella typhi, Salmonella paratyphi and Salmonella infantis; Enterococcus , especially Enterococcus faecalis, Enterococcus faecium and Enterococcus cecorum; Staphylococci, especially Staphylococcus aureus; Aeromonas, Streptococci, especially Salmonella suis and Salmonella gallinaceus; Campylobacter, especially Campylobacter jejuni and Campylobacter coli.coli, E. coli, Haemophilus, in particular Haemophilus parasuis, Brachyspira, in particular Brachyspira hyodysenteriae, and Vibrio, in particular Vibrio parahaemolyticus and V. harveyi, and the beneficial bacteria are preferably selected from Lactobacillus, in particular Lactobacillus and Bifidobacterium. The pathogenic microorganisms are in a preferred embodiment selected from Clostridium, in particular Clostridium perfringens, Salmonella, in particular S. enterica, and Vibrio, in particular Vibrio parahaemolyticus. In a preferred embodiment of the invention, the amount of at least one pathogenic bacterium, in particular the amount of Clostridium perfringens, Salmonella enteritidis and / or Vibrio parahaemolyticus, is reduced by at least 0.5 log, more preferably by at least 1 log, 2 log or 3 log. Thus, further subject of the present invention are microorganisms, preparations and compositions according to the invention for inhibiting and / or reducing the growth of pathogenic bacteria and / or for maintaining and / or enhancing the growth of beneficial bacteria, the pathogenic bacteria being preferably those of the genus Clostridium, in particular Clostridium perfringens, Clostridium difficile, Clostridium novyi, Clostridium septicum and Clostridium colinum, the genus Listeria, in particular Listeria monocytogenes, Listeria seeligeri and Listeria welshimeri, the genus Salmonella, in particular Salmonella arizonae, bongori and in particular serotypes, Salmonella gallinarum, Salmonella prolum, Salmonella typhimurium, Salmonella enterica serovar Ty ... Salmonella cholera, Salmonella heidelberg, Salmonella dublin, Salmonella harder, Salmonella typhi, Salmonella paratyphi and Salmonella infantis; Enterococci, in particular Enterococcus faecalis, Enterococcus faecium and Enterococcus secorrum; Staphylococci, in particular Staphylococcus aureus; Aeromonas, Streptococci, in particular Salmonella suis and Salmonella gallina In a preferred embodiment, the pathogenic microorganism is selected from the genus Clostridium, in particular Clostridium difficile and Clostridium perfringens, the genus Salmonella, in particular Salmonella typhimurium and Salmonella enteritidis, the genus Vibrio, in particular Vibrio parahaemolyticus and Vibrio harveyi, and the beneficial bacteria is preferably selected from the genus Lactobacillus and Bifidobacterium. In a preferred embodiment, the pathogenic microorganism is selected from the genus Clostridium, in particular Clostridium difficile and Clostridium perfringens, the genus Salmonella, in particular Salmonella typhimurium and Salmonella enteritidis, the genus Vibrio, in particular Vibrio parahaemolyticus and Escherichia coli.

[0029] The occurrence and / or increased proliferation of pathogenic bacteria may result in or cause the occurrence of certain diseases. For example, the occurrence and / or increased proliferation of Clostridium perfringens may result in the occurrence of intestinal diseases, especially the occurrence of necrotic enteritis in pigs and poultry. The occurrence and / or increased proliferation of Clostridium perfringens may also result in the occurrence of further diseases, such as bacterial enteritis, necrotic dermatitis and cholangiohepatitis. Even the mildest forms of infection with Clostridium perfringens may already be accompanied by diarrhea, which may cause the litter to become wet, which may lead to secondary diseases, such as footpad dermatitis. Clostridium perfringens type C is generally considered to be the main cause of necrotic enteritis and necrotic hemorrhagic enteritis in piglets, while type A is associated with intestinal diseases in suckling and feeding pigs, with mild necrotic enteritis and villous atrophy. C. difficile is an important emerging pathogen causing diarrhea primarily in neonatal pigs. Affected piglets can suffer from respiratory distress, abdominal bloating, and scrotal edema.

[0030] S. aureus subsp. aureus can cause digital knot disease in chickens and streptococcal mastitis in sows, and can produce toxins that cause food poisoning in humans.

[0031] Salmonella is an important cause of human food poisoning, often associated with the consumption of meat, such as poultry, pork or products derived from them. Therefore, controlling Salmonella is an important challenge for the meat production industry. In Europe, a baseline study carried out in 2005 on the prevalence of Salmonella in egg-laying flocks showed that at a global level in the EU, 20.3% of large-scale egg-laying hens were bacteriologically positive for Salmonella Enteritidis. In some countries, the prevalence was even higher than 80% [European Food Safety Authority (2006), "Preliminary report: analysis of a baseline study on the prevalence of Salmonella in egg-laying flocks of chickens (Gallus gallus)"].

[0032] Vibrio parahaemolyticus is responsible for diseases in shellfish, particularly early mortality syndrome (EMS), also known as acute hepatopancreatic necrosis (AHPND), which affects both giant black tiger prawn (Penaeus monodon) and white shrimp (Penaeus vannamei). Pathogens can cause further diseases such as polyarthritis, fibrous polyserositis, postweaning intestinal disorders such as postweaning diarrhea and edema disease, and swine dysentery. A preferred subject of the present invention is therefore in particular produced by Clostridium , in particular Clostridium difficile or Clostridium perfringens, and / or Salmonella , in particular Salmonella Enteritidis, preferably Salmonella enteritidis subsp. or Salmonella typhimurium, and / or Vibrio , in particular Vibrio parahaemolyticus, and / or Escherichia coli, for treating diseases.

[0033] A further preferred subject in this context is therefore a therapeutic composition for the treatment and / or prevention of necrotic enteritis and / or necrotic hemorrhagic enteritis, in particular asymptomatic necrotic enteritis and / or necrotic hemorrhagic enteritis, in animals, preferably pigs or poultry, comprising the strain and / or preparation and / or composition of the invention. A further preferred subject in this context is therefore a therapeutic composition for treating and / or preventing premature mortality syndrome in animals, preferably in animals kept in aquaculture, more preferably in crustaceans, in particular shrimp and prawns, comprising the microorganism and / or preparation and / or composition of the invention. A further preferred subject in this context is therefore a therapeutic composition for treating and / or preventing diseases caused by food poisoning comprising the microorganism and / or preparation and / or composition of the invention. Another preferred subject in this context is therefore a therapeutic composition for the treatment and / or prevention of bacterial enteritis, necrotic dermatitis, cholangiohepatitis, clostridiosis, diarrhoea, dyspnoea, abdominal distension, scrotal oedema, digital bloating, padding of the feet, streptococcal mastitis, lameness, arthritis, polyarthritis, fibrous polyserositis, post-weaning intestinal disorders such as post-weaning diarrhoea and oedema diseases, dysentery, osteomyelitis, inflammation of the joints and / or bone tissue, pericarditis, splenomegaly, hepatomegaly, nephromegaly, congestion, necrosis, infarction in the liver or spleen, valvular endocarditis, sepsis and / or meningitis in animals, preferably pigs or poultry, comprising the microorganism and / or preparation and / or composition of the invention.

[0034] A further subject of the present invention is therefore also the treatment and / or prevention of diseases, in particular intestinal diseases, associated with bacterial infections by Clostridium, in particular Clostridium perfringens, and / or Salmonella, in particular Salmonella, preferably Salmonella subsp. Enteritidis and / or Vibrio, in particular Vibrio parahaemolyticus, by administering a microorganism and / or a preparation and / or composition according to the invention to an animal in need thereof, the animal being preferably a pig or a poultry. A further subject of the present invention is therefore also the treatment and / or prevention of diseases, in particular intestinal diseases, preferably necrotizing enteritis or necrotic hemorrhagic enteritis, in particular asymptomatic necrotizing enteritis or asymptomatic necrotizing hemorrhagic enteritis, by administering a microorganism and / or a preparation and / or a composition according to the invention to an animal in need thereof, the animal being preferably a pig or a poultry. A further subject of the present invention is therefore also the treatment and / or prevention of diseases in aquatic animals, in particular early mortality syndrome, by administering a microorganism and / or a preparation and / or a composition according to the invention to an animal in need thereof, the animal being preferably an animal reared in aquaculture, more preferably a crustacean, in particular shrimp and prawn. A further subject of the present invention is therefore also the treatment and / or prevention of diseases caused by food poisoning, comprising the administration of a microorganism and / or a preparation and / or a composition according to the invention to an animal or human in need thereof. A further subject of the present invention is therefore the treatment and / or prevention of diseases caused by food poisoning, by applying the microorganisms and / or preparations and / or compositions of the invention to animal products, in particular meat or eggs, to avoid poisoning in humans. A further subject of the present invention is therefore the treatment and / or prevention of diseases, preferably of pigs or poultry, selected from bacterial enteritis, dermatitis gangrenosum, cholangiohepatitis, clostridiosis, diarrhoea, dyspnoea, abdominal distension, scrotal oedema, digital bloating, padding of the feet, streptococcal mastitis, lameness, arthritis, polyarthritis, fibrous polyserositis, postweaning intestinal disorders such as postweaning diarrhoea and oedema diseases, dysentery, osteomyelitis, inflammation of the joints and / or bone tissue, pericarditis, splenomegaly, hepatomegaly, nephromegaly, congestion, necrosis, infarction in the liver or spleen, valvular endocarditis, septicaemia and / or meningitis.

[0035] The methods and uses of the microorganisms, feed or food additives and compositions of the invention may be pharmaceutical or non-pharmaceutical, in particular therapeutic or non-therapeutic. In particularly preferred embodiments of the invention, the methods and uses are non-pharmaceutical, in particular non-therapeutic, preferably feed and food applications. Preferred food compositions according to the invention are fermented foods and / or dairy products, in particular yoghurt, cheese, milk, butter, curd and natto. The microorganisms according to the invention may be used in particular in beverages and milk substitutes, such as infant formulas. Pharmaceutical compositions according to the invention preferably contain at least one pharma- ceutically acceptable carrier. They may further contain other ingredients, such as conventional food ingredients, as further listed below.

[0036] The pharmaceutical compositions according to the invention are preferably liquids, pastes, aerosols, tablets, suppositories or dry compositions, in particular for administration to the pharynx / respiratory tract, the gastrointestinal tract, the urogenital tract or the skin. Administration can be carried out by using medical devices such as sprays, pumps or inhalers. A further subject of the present invention is therefore also a method for preparing a pharmaceutical composition, in which the microorganism according to the invention is mixed with a pharma- ceutically acceptable carrier and, optionally, with further compounds, and the pharmaceutical composition can be provided in the form of a medical device. A further subject of the invention is in particular also a food supplement containing a microorganism according to the invention and at least one pharma- ceutically acceptable carrier.

[0037] In a preferred embodiment of the present invention, the microorganisms and compositions of the present invention are orally administered to animals or humans. Administration is preferably carried out in the form of feed and food compositions, but can also be carried out by applying the microbial preparation or feed additive of the present invention to drinking water or rearing water. Thus, a further subject of the present invention is water, in particular an aqueous solution or aqueous suspension, containing at least one microorganism or feed additive according to the present invention. In particular, when administered to drinking water or rearing water, the microorganisms and compositions of the present invention may be applied in the form of compositions, particularly tablets, that dissolve easily after exposure to drinking water or rearing water and release the microorganisms into the aqueous environment. Such compositions, particularly tablets, are further preferred embodiments of the present invention. These compositions preferably include a carrier, such as a betaine salt, a citrate salt, a carbonate salt and / or a bicarbonate salt, as disclosed, for example, in WO 2020 / 225020. The feed, food and pharmaceutical compositions, as well as drinking water, rearing water, effluent or wastewater of the present invention preferably have a concentration of about 1 × 10 to about 1 × 10 10 CFU / g feed or ml water, preferably about 1 x 10 4 ~Approx. 1×10 9 CFU / g feed or ml water, more preferably 1×10 6 ~1×10 8 Contains microorganisms in CFU / g feed or ml water. Similarly, a preferred amount of the feed or food additive of the present invention in the feed, food and water composition of the present invention is in the range of 0.01% to 10% by mass, more preferably 0.05% to 5% by mass, and particularly 0.1% to 2% by mass.

[0038] The feed, food and pharmaceutical compositions of the present invention may comprise further carriers or further conventional feed ingredients or combinations thereof. Suitable carriers for the preparation of feed, food and pharmaceutical compositions are the same as those mentioned above for the preparation of feed or food additives starting from the microorganism of the invention or the fermentation medium of said microorganism. Suitable conventional animal feed ingredients which may be contained in a composition according to the invention and / or which may be used in the preparation of a feed or food composition starting from the microorganism and / or microbial fermentation medium and / or feed or food additive according to the invention include one or more of the following: proteins, carbohydrates, fats, further probiotics, prebiotics, enzymes, vitamins, immunomodulators, milk replacers, minerals, amino acids, carriers, coccidiostats, acid-based products and / or medicines, such as antibiotics. Carbohydrate-containing ingredients that may be used in the present invention are, for example, forage, roughage, wheat meal, corn meal, sunflower meal or soybean meal, and mixtures thereof.

[0039] Protein-containing ingredients that may be used in the present invention are, for example, soy protein, pea protein, wheat gluten, corn gluten, rice, canola meal, marine animal meals, particularly fish meal, land animal meals, and mixtures thereof. "Marine animal meals" include meat meal, meat and bone meal, blood meal, liver meal, poultry meal, silkworm meal, silkworm pupa meal, and combinations thereof.

[0040] The fats are usually marine animal oils, vegetable oils or microbial oils, in particular microalgae oils, or combinations thereof. Examples of vegetable oils include soybean oil, rapeseed oil, sunflower seed oil, canola oil, cottonseed oil, linseed oil and palm oil. Marine animal oils include fish oils, as well as oils from krill, clams, squid or shrimp, and also fatty oils from fish of the families Engraulidae, Carangidae, Clupeidae, Osmeridae, Scombridae and / or Ammodytidae. Examples of microalgae oils include, in particular, Labyrinthulea oils, preferably Schizochytria or Thraustochytria oils. In addition to isolated oils, defatted biomass itself can also be used as fat source, i.e., in particular marine animal meals, preferably fishmeal, or vegetable meals, in particular soybean meal, rapeseed meal, sunflower meal, canola meal, cottonseed meal and / or linseed meal.

[0041] Protein-containing ingredients further containing fat that can be used in the present invention are, for example, fish meal, krill meal, bivalve meal, squid meal or shrimp shells, as well as combinations thereof. The feed according to the present invention preferably has a total protein content of 20-50% by mass and / or a total fat content of 1-15% by mass and / or a total carbohydrate content of 20-60% by mass.

[0042] Further probiotics (DFM) and / or microorganisms that may be used in the present invention in combination with the microorganisms and feed or food additives of the present invention are preferably bacteria selected from the species Bacillus subtilis, Bacillus licheniformis, Bacillus paralicheniformis, Bacillus lentus, Bacillus pumilus, Bacillus laterosporus, Bacillus coagulans, aerobic spore-forming bacteria, Bacillus cereus, Bacillus badius, Bacillus thuringiensis, Bacillus amyloliquefaciens, Bacillus beruerensis, Enterococcus faecium, and Pediococcus acidilactici.Preferred examples are Bacillus pumilus DSM 32539 and Bacillus subtilis DSM 32540 (both deposited at the DSMZ on June 14, 2017 under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure) and their derivatives, Bacillus licheniformis DSM 32314 and Bacillus subtilis DSM 32315 (both deposited at DSMZ on May 12, 2016 under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure) and its derivatives, Bacillus subtilis PB6 (described in U.S. Pat. No. 7,247,299 and deposited under ATCC Accession No. PTA-6737) (sold by Kemin under the trademark CLOSTAT(Canadian)®), Bacillus subtilis C-3102 (described in U.S. Pat. No. 4,919,936 and deposited in Japan at the National Institute of Advanced Industrial Science and Technology under the trademark FERM BP1096) (sold by Calpis under the trademark CALSPORIN®), Bacillus subtilis DSM 17299 (sold by Chr. Hansen under the trademark GalliPro®), Bacillus licheniformis DSM 17236 (sold under the trademark GalliProTect® by Chr. Hansen), a mixture of Bacillus licheniformis DSMZ 5749 and Bacillus subtilis DSMZ 5750 spores (sold under the trademark BioPlus® YC by Hansen), Bacillus subtilis DSM 29784 (sold under the trademark Alterion® by Adisseo / Novozymes), Bacillus subtilis sold under the trade name PORCBOOST® by Chr. Hansen, Bacillus licheniformis DSM 28710 sold under the trademark B-Act® by Hevepharma, a three-strain Bacillus probiotic sold under the trademark Enviva® PRO by DuPont, the probiotic PureGro™ sold by DSM, or the Bacillus coagulans microorganism described in U.S. Pat. No. 6,849,256.In particular, in food compositions, further probiotics known to be useful for human health may be used, such as bacteria producing lactic acid bacteria of the order Lactobacillales, more preferably the family Aerococcaceae, Carnobacteriaceae, Enterococcaceae, Lactobacillaceae, Leuconostocaceae or the family Streptococci, or of the order Bifidobacteriales, preferably the order Bifidobacteriales, in particular the genus Bifidobacterium. If said further probiotics are not formulated as part of the composition of the invention, they may be administered together with the composition of the invention (at the same time or at different times).

[0043] The prebiotics that may be used in the present invention are preferably oligosaccharides, in particular oligosaccharides selected from galactooligosaccharides, sialyloligosaccharides, lactulose, lactosucrose, fructooligosaccharides, palatinose or isomaltose oligosaccharides, glycosylsucrose, maltooligosaccharides, isomaltooligosaccharides, cyclodextrins, gentiooligosaccharides, soybean oligosaccharides, xylooligosaccharides, dextran, pectin, polygalacturonan, rhamnogalacturonan, mannan, hemicellulose, arabinogalactan, arabinan, arabinoxylan, resistant starch, mebiose, chitosan, agarose, inulin, tagatose, polydextrose, and alginates.

[0044] Enzymes which may be used in the feed composition according to the invention and which may aid in the digestion of the feed are preferably phytase (EC 3.1.3.8 or 3.1.3.26), xylanase (EC 3.2.1.8), galactanase (EC 3.2.1.89), galactosidase, in particular α-galactosidase (EC 3.2.1.22), protease (EC 3.4), phospholipase, in particular phospholipase A1 (EC 3.1.1.32), A2 (EC 3.1.1.4), C (EC 3.1.4.3) and D (EC 3.1.4.4), lysophospholipase (EC 3.1.1.5), amylase, in particular α-amylase (EC 3.2.1.1), lysozyme (EC 3.2.1.17), glucanases, in particular β-glucanases (EC 3.2.1.4 or EC 3.2.1.6), glucoamylases, cellulases, pectinases, or any mixture thereof. Examples of commercially available phytases include Bio-Feed™ Phytase (Novozymes), Ronozyme® P and HiPhos™ (DSM Nutritional Products), Natuphos™ (BASF), Finase® and Quantum® Blue (AB Enzymes), Phyzyme® XP (Verenium / DuPont) and Axtra® PHY (DuPont). Other suitable phytases include those described, for example, in WO 98 / 28408, WO 00 / 43503, and WO 03 / 066847. Examples of commercially available xylanases include Ronozyme® WX and G2 (DSM Nutritional Products), Econase® XT and Barley (AB Vista), Xylathin® (Verenium) and Axtra® XB (Xylanase / beta-glucanase, DuPont). Examples of commercially available proteases include Ronozyme® ProAct (DSM Nutritional Products).

[0045] Vitamins that may be used in the present invention are, for example, vitamin A, vitamin D3, vitamin E, vitamin K, e.g., vitamin K3, vitamin B12, biotin, choline, vitamin B1, vitamin B2, vitamin B6, niacin, folic acid and pantothenate, e.g., Ca-D-pantothenate, or combinations thereof.

[0046] Immunomodulatory agents that may be used in the present invention are, for example, antibodies, cytokines, spray-dried plasma, interleukins, or interferons, or combinations thereof. Minerals that may be used in the present invention are, for example, boron, cobalt, chloride, chromium, copper, fluoride, iodine, iron, manganese, molybdenum, selenium, zinc, calcium, phosphorus, magnesium, potassium, or sodium, or combinations thereof. Amino acids that can be used in the present invention are, for example, lysine, alanine, threonine, methionine, or tryptophan, or combinations thereof. The composition of the invention may further comprise betaine and / or choline and / or other physiologically available methyl group donors. The feed may further comprise polyunsaturated fatty acids, in particular DHA and / or EPA.

[0047] Therefore, a further embodiment of the present invention is also a method for preparing an animal feed composition, comprising mixing at least one microorganism and / or microbial preparation and / or feed additive of the present invention, in particular in an amount effective for promoting animal health, in particular intestinal health, with feed ingredients such as proteins, lipids and / or carbohydrates, and optionally further beneficial substances, preferably as mentioned above, to provide a feed product, which may also include, for example, a pelleting process. Standard pelleting processes known to those skilled in the art may be used, including extrusion of dry or semi-moist feed. The preferred pelleting temperature is from about 65°C to about 120°C. The microorganisms, microbial preparations, feed additives and compositions of the invention can be administered to the animal in the feed and / or drinking water and / or rearing water over multiple days throughout the life of the animal or during a particular stage or portion of the life of the animal. For example, the microorganisms and / or microbial preparations and / or compositions may be administered only in the starter feed or only in the finishing feed of the livestock.

[0048] The microorganisms, microbial preparations and compositions of the present invention can further be used in a wide range of doses, for example, in a daily dose range of about 1 mg to about 500 mg per kilogram of live weight, in particular in a range of about 5 mg to about 200 mg, in a range of about 10 mg to about 100 mg, or in a range of about 20 to about 60 mg.

[0049] According to the invention, it is preferred that in every embodiment of the invention an effective amount of the microorganism and / or microbial preparation and / or feed additive and / or composition of the invention is used. The term "effective amount" refers to an amount that brings about at least one beneficial effect on an animal and / or environment, in particular with regard to the above-mentioned characteristics, when compared to an animal or environment that is not administered the microorganism and / or microbial preparation and / or composition of the invention, but is administered the same diet (including feed and other compounds) or the same composition, respectively. For therapeutic applications, preferably therapeutic amounts of the microorganisms and / or microbial preparations and / or feed or food additives and / or compositions of the present invention are used. The term "therapeutic amount" refers to an amount sufficient to improve, reverse or prevent a disease state in an animal. Optimal dosage levels for different animals can be easily determined by those skilled in the art by evaluating, inter alia, the ability of the composition to (i) inhibit or reduce pathogenic viruses and / or bacteria in the gastrointestinal tract, particularly in the intestine, or in the oral or nasopharyngeal cavity, or on the skin or gills, at different doses, (ii) increase or maintain the level of beneficial bacteria, at different doses, and / or (iii) promote the health of the animal, particularly the intestinal health, at different doses.

[0050] The method of the present invention may be used with all kinds of animals, particularly all kinds of vertebrates, such as mammals, aquatic animals and birds. Animals that may benefit from the present invention include, but are not limited to, farm animals, pets, exotic animals, zoo animals, and animals used for sport, recreation or work. In a highly preferred embodiment of the invention, the animals are livestock raised for consumption or food production, such as poultry, pigs and ruminants. The poultry may be selected from production or livestock poultry, but also from luxury poultry or wild birds. Preferred productive poultry in this context are chickens, turkeys, ducks and geese. Production livestock in this context are preferably poultry optimized for juvenile production or poultry optimized for meatiness. Preferred luxury poultry or wild birds are peacocks, pheasants, quails, chukkars, guinea fowl, quails, egyptians, ptarmigans, pigeons and swans, with quails being particularly preferred. Further preferred poultry are ratites, especially ostriches and emus, as well as parrots. The ruminant according to the present invention is preferably selected from cows, goats and sheep. In one embodiment, the composition of the present invention can be fed to pre-ruminant animals to improve their health, in particular to reduce the incidence of diarrhea in these animals. Pre-ruminant animals are ruminant animals ranging from birth to about 12 weeks of age, including calves. Pets are preferably selected from dogs, cats, domestic birds and domestic exotic animals.Sport animals may in particular be horses.

[0051] Aquatic animals according to the invention are preferably fishes, in particular Actinopterygii or crustaceans, such as, in particular, tilapia and other cichlids, carps and other cyprinids, salmon and other salmonids, catfish, in particular African catfish and Pangasius, tuna, sea bass, cod, smelt, milkfish, gourami, sea bass, in particular barramundi, sea fish of the Sparidae family, grouper and snakehead fish. Salmon and other salmonid fish in this context include Atlantic salmon, sockeye salmon, cherry salmon, Chinook salmon, Chum salmon, Coho salmon, Danube salmon, Pacific salmon, pink salmon and trout. The aquatic animal according to the invention is particularly preferably a tilapia. Crustaceans include, inter alia, shrimp, lobster, crab, prawns and crayfish. Preferred shrimps in this context include the genera Litopenaeus, Farfantepenaeus and Penaeus, in particular Penaeus stylirostris, Penaeus vannamei, Penaeus monodon, Penaeus chinensis, Penaeus occidentalis, Penaeus californiensis, Penaeus semisulcatus, Penaeus esculentu, Penaeus setiferus, Penaeus japonicus, Penaeus azuesco, Penaeus serrata ... Penaeus aztecus, Penaeus duorarum, Penaeus indicus, and Penaeus merguiensis. Penaeus bannameji, also called white legged shrimp, is highly preferred in the present invention. The aquatic animals, in particular shrimp, treated or fed with the microorganisms and / or preparations and / or compositions according to the invention may in particular be larval, post-larval or juvenile shrimp. The aquatic animal may in particular be a fish which is subsequently processed into fishmeal or fish oil. In this context, the fish is preferably herring, pollock, cod or anchovy, blue whiting, capelin, driftfish, jack, mackerel, menhaden, sardine or scad fish. The fishmeal or fish oil thus obtained can be used in aquaculture for cultivating edible fish or crustaceans. The aquatic animals may further be oysters, clams, cockles, arkshells, bivalves, mussels or scallops. However, the aquatic animals may also be small organisms used as feed in aquaculture. These small organisms may take the form of, for example, nematodes, small crustaceans or rotifers.

[0052] The farming of aquatic animals may take place in ponds, tanks, basins, or isolated areas of the sea or lakes or rivers, in particular in this case in cages or net racks. Aquaculture can be used to farm finished food fish, but also for the farming of juvenile fish that are released to replenish wild fish stocks. In salmon farming, the fish are preferably first grown to smolts in freshwater tanks or artificial waterways and then grown in floating cages or net racks in the sea, ponds or rivers, preferably fixed in bays or fjords. Therefore, the feed composition according to the present invention is preferably a feed for use in raising the above-mentioned animals.

[0053] The preferred use of the animal feed according to the present invention is for cattle, pigs, poultry, fish, crustaceans or pets, with pigs, especially weaned piglets, and poultry being particularly preferred.Spore-forming microorganisms, especially those of the Bacillus genus, are particularly suitable for this use, since they produce heat-resistant spores that can be mixed into the animal feed before the pelleting process.The microorganisms of the present invention are particularly preferably used in milk replacers for cattle, goats, sheep and pigs, or as post-pelleting spray-on coatings for pelleted feed materials.

[0054] The microorganisms and fermentation media that can be used in the present invention can be obtained by culturing the microorganisms of the present invention by methods known in the art, including using media and other methods described, for example, in Elisashvili et al. (Probiotics and Antimicrobial Proteins 11, 731-747 (2019)), Ren et al. (AMB Express 8:21 (2018)) or the Food and Agriculture Organization of the United Nations (FAO) report 179 entitled "Probiotics in Animal Nutrition" (Bajagai et al., FAO (2016)). Conventional large-scale microbial cultivation processes include submerged fermentation, solid-state fermentation, or liquid surface culture. The fermentation is configured to obtain a high level of colony forming units of microbial cells. Optionally, the fermentation medium thus obtained may be washed, for example via a diafiltration process, to remove residual fermentation medium and metabolites. The fermentation medium used for the preparation of the feed or food additive according to the present invention is preferably prepared by culturing the microorganisms of the present invention at a concentration of 5×10 0.01% after the fermentation is completed. 10 ~5×10 12 cfu / g, more preferably 1×10 11 ~4×10 12 Contains cells in amounts of cfu / g. Example 1

[0055] Searching for conditions under which external DNA uptake functions effectively As parental strain, Bacillus beruezensis CECT 5940 strain was used. Natural competence induction of this strain was also monitored using an engineered fluorescent reporter strain. The engineered strain encodes a genomic mNeonGreen copy (Shaner et al. (2013); J. Nat Methods 10(5):407-409), which is controlled by the promoter of the competence gene comGA. The reporter strain is obtained from the parental strain by applying standard cloning techniques using primers CACAATCACTGGCCGCAATG (SEQ ID NO: 3) and TAGACTTCCCTCCTTCCGCAC (SEQ ID NO: 4) to amplify the comGA promoter region. Homologous comGA gene transcription is induced in competent Bacillus cells by the central competence activating protein ComK. The reporter strain was applied as a spore preparation and the spores were activated routinely at 80°C for 10 min. To screen the conditions under which competence was induced, the activated spores were subjected to different media, applying different dilution factors and incubation times. The incubation targeting germination (1 h, 25°C) was carried out in Eppendorf tubes in a Thermomix, whereas all subsequent incubation steps after germination were carried out in 96-well deep-well plates (DWPs) in a Duetz shaking system (Kuehner AG, Switzerland). After carrying out the series of incubation steps, 100 μl of the sample was transferred from the DPW to the MTP and the fluorescence was detected with a Fluostar® Omega device (BMG Labtech, Germany). It was found that optimal fluorescence induction of the CECT 5940 strain was obtained for cells a) germinated in 100 μl HS supplemented with AGFK, then incubated for 2 hours after addition of 500 μl MG12, or b) germinated in 200 μl HS supplemented with AGFK, then incubated for 3 hours after addition of 1000 μl mF12. With longer and shorter incubation steps, the overall fluorescence became significantly lower, while at the same time no cells visibly fluoresced under microscopy. In contrast, conditions with a significant increase in overall fluorescence also resulted in the detection of fluorescent cells under microscopy. Example 2

[0056] Generation of safe strains The chromosomal comK locus was chosen for the generation of the containing strains since it is the central competence regulator (van Sinderen et al. (1995); Mol Microbiol. 15(3):455-62). The mutagenesis target was placed in the comK open reading frame. Two stop codons were introduced in comK via two point mutations at positions 10 and 37, and an additional point mutation was introduced at position 35 to generate a new HindIII restriction site useful for detection of successful mutants by colony PCR digestion. This was achieved by using a single PCR product from PCR with primer pairs com1 / com2 and com3 / com4 as templates for overlap extension PCR to generate the final mutagenesis cassette. Mutations were introduced via primers com2 and com3, which further share a suitable overlap region for generation of the final mutagenesis cassette in overlap extension PCR with primer pair com1 / com4. com1 ATCATTAATACGGCCTCTATTACC (SEQ ID NO: 5) com2 CTTTCTAAGGGTGCATGTGTTTACTGGCACATAATGTG (SEQ ID NO: 6) com3 TGCACCCTTAGAAAGCTTCTAAGTAAATCGTTCAACC (SEQ ID NO: 7) com4 GTGCACCGAATCAGTCCATC (SEQ ID NO: 8) To select for successful DNA introduction, the chromosomal pyrE (encoding orotate phosphoribosyltransferase) locus was chosen as a selection marker. This gene is useful for double-directional selection (Sakaguchi et al. (2013); Biosci Microbiota Food Health. 32(2):59-68). Cells with pyrE inactivated become uracil auxotrophic and can be selected via their resistance to 5-fluoroorotic acid (5-FOA). The pyrE inactivation mutagenesis cassette was designed to introduce two stop codons into the open reading frame of pyrE via two SNPs. This was achieved by using a single PCR product from PCR with primer pairs pyr1 / pyr2 and pyr3 / pyr4 as a template for overlap extension PCR to generate a final mutagenesis cassette of 1825 bp. Mutations were introduced via primers pyr2 and pyr3, which further share a suitable overlap region for the generation of the final mutagenesis cassette in overlap extension PCR with primer pair pyr1 / pyr4. pyr1 TCCGGATGGTATACGAAGTCAG (SEQ ID NO: 9) pyr2 TCAATGTGTAATAGATGTTATGCGATAGCC (SEQ ID NO: 10) pyr3 TCTATTACACATTGAAGCTGTCTTTTAACGCCCGAATGAG (SEQ ID NO: 11) pyr4 TCCAGCGGAATGAAAGACAGTG (SEQ ID NO: 12) A range of 5-FOA concentrations was subsequently tested by plating the parent strain CECT 5940 on minimal medium (MM, see Appendix for media) agar plates to identify pyrE inactivated mutants. MM plates supplemented with the solvent DMSO (used in 5-FO stocks) served as growth control. The parent strain CECT 5940 was already completely inhibited by supplementation of 10 mg / L 5-FOA on MM plates. The inhibition of the parent strain by 5-FOA produced the same effect when 10 μg / ml uracil was added to the agar medium. Agar plates with 10 mg / ml 5-FOA and 10 μg / ml uracil concentration were then appropriately applied for the selection of pyrE inactivated mutants. The genotype of the generated pyrE inactivated (uracil auxotrophic) mutant strains was confirmed by sequencing the PCR products covering the mutagenized site. The pyrE-inactivated strain so obtained was used as the recipient cell for co-transformation of the mutagenesis cassette for comK inactivation with the pyrE wild-type cassette and subsequent selection for prototrophy. Both mutagenesis cassettes were generated by fusing two separate PCR products via overlap extension PCR. The mutagenesis site was located in the center with 450–500 bp of non-mutated sequence serving as homologous recombination flanks. The wild-type pyrE cassette applied for co-transformation together with the comK mutagenesis cassette was generated in a single PCR using only the outer primers pyr1 / pyr4. Transformants that were able to grow on minimal medium (MM) agar plates were restreaked on MM agar to verify their prototrophic status and subsequently confirmed the presence of the desired mutated comK by PCR product sequencing. Three verified clones were then selected for genome sequencing (gDNA prepared with Illumina, MasterPure Grampositive gDNA Kit). Resequencing results were bioinformatically compared with the wild-type genome sequence to confirm the presence of the point mutation. All three clones showed the desired mutation at the comK locus, two of which had no additional mutations at non-targeted loci. The third clone still carried a mutation in pyrE from the progenitor strain. Based on these results, two clones without non-targeted mutations were selected for phenotypic analysis. Example 3

[0057] Phenotypic evaluation of comK knockout mutants The competence phenotype of the two validated comK mutants was evaluated by testing the transformation efficiency of plasmid DNA via natural competence. Transformations were performed with two independent cultures of each strain, with the parent strain CECT 5940 as a negative control. To maximize the transformation efficiency, each transformation reaction was supplemented with 25 μg of plasmid DNA stock solution (shuttle vector resistant to Tet) isolated from a CECT 5940 transformant. The transformation efficiency of the parent strain was 0.5-1 / μg DNA, while none of the comK inactivated mutants yielded transformants. This confirms the complete loss of the mutant's natural competence-mediated DNA uptake function, as expected. In addition to the loss of the natural competence-mediated DNA uptake function, the mutant thus obtained possesses all the characteristics of the parent strain CECT 5940. Thus, the introduction of the mutation eliminated the risk that the strain could acquire unwanted antibiotic resistance genes after release into the environment, without, on the other hand, having a detrimental effect on the probiotic activity of the strain.

Claims

1. A microorganism with reduced competence.

2. 2. The microorganism according to claim 1, which has a function selected from the group consisting of probiotic activity, the ability to inhibit pathogenic bacteria selected from Clostridium perfringens, Salmonella Enteritidis, Salmonella typhimurium, Escherichia coli, Clostridioides difficile, Vibrio parahaemolyticus, and combinations thereof, the ability to grow in the presence of bile, the ability to produce organic acids, and the ability to produce lactic acid.

3. 2. The microorganism of claim 1, wherein the competence of the microorganism is reduced by at least 20%, at least 50%, at least 70% or at least 90% and / or the microorganism is completely unable to take up DNA by natural transformation.

4. 2. The microorganism of claim 1, comprising at least one competency gene with reduced activity or at least one competency gene that has been knocked out, wherein the competency gene is a transcription factor.

5. 5. The microorganism according to claim 4, wherein the at least one competence gene with reduced activity or the at least one knocked-out competence gene is comK encoding a competence transcription factor ComK, and the mutant comK gene has 1 to 20, 1 to 10, or 1 to 5 mutations compared to a functionally expressed comK gene, or at least one of the mutations is the introduction of a stop codon into the comK sequence.

6. Bacillus phylum (phylum Bacillota), or Bacillus genus, or Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus velezensis, Bacillus licheniformis Bacillus licheniformis, Bacillus paralicheniformis, Bacillus pumilus, Bacillus megaterium, Bacillus lentus, Bacillus laterosporus, Bacillus alevi, Bacillus cereus, Bacillus Bacillus badius, Bacillus thuringiensis, Bacillus coagulans, Bacillus siamensis, Bacillus glycinigermentans, Bacillus methylotrophicus, Bacillus thuringiensis uringensis), Bacillus polyfermenticus (B. polyfermenticus), Bacillus valismortis (B. vallismortis), Bacillus tequilensis (B. tequilensis), Bacillus atrophaeus (B. atrophaeus), Bacillus mojavensis (B. mojavensis), Bacillus sonorensis (B. sonorensis), Bacillus 2. The microorganism according to claim 1, which belongs to the group consisting of Bacillus inaquosus and Bacillus safensis, or is selected from the group consisting of Bacillus subtilis, Bacillus beruerensis, Bacillus amyloliquefaciens, Bacillus pumilus or Bacillus megaterium, or is Bacillus amyloliquefaciens or Bacillus beruerensis.

7. 7. The microorganism of claim 6, which is a Bacillus beruesenzis strain, wherein the genomic DNA of the Bacillus beruesenzis strain is at least 99%, at least 99.5%, at least 99.9%, or at least 99.99% identical to the genomic DNA of a CECT 5940 strain.

8. A method for obtaining the microorganism with reduced competence according to claim 1, comprising the steps of: (a) introducing a reporter gene, or a reporter gene encoding a fluorescent marker, downstream of a promoter of a gene activated by a competence gene, such that activation of the promoter results in expression of the reporter gene; (b) screening for conditions that induce said competence by analyzing the expression level of said reporter gene in a microorganism; (c) introducing a knockout into a gene of said microorganism that confers an auxotrophy on the strain and confers resistance to a particular substance on the transformed strain; (d) screening the knocked-out strains obtained in step (c) by screening the strains with the desired resistance; (e) co-transforming the strain identified in step (d) with an active form of the gene knocked out in step (c) and a knockout mutant of the competence gene; (f) detecting said strains exhibiting prototrophy; (g) screening the strains identified in step (f) to determine whether the competence gene has been knocked out; A method comprising:

9. 9. The method of claim 8, wherein the competence gene is comK, the gene whose knockout is introduced in step (c) is a knockout mutant of pyrE, the strain becomes auxotrophic for uracil and resistant to 5-FOA, and in step (e) is co-transformed with an active form of pyrE and the knockout mutant of comK.

10. 10. The method according to claim 8 or 9, wherein the microorganism belongs to the phylum Bacillus, the genus Bacillus, the following species: Bacillus subtilis, Bacillus beruerensis, Bacillus amyloliquefaciens, Bacillus pumilus or Bacillus megaterium, or the species Bacillus amyloliquefaciens or Bacillus beruerensis.

11. A feed or food additive comprising the microorganism according to claim 1.

12. A feed or food composition comprising a microorganism according to claim 1 or a feed or food additive according to claim 11 and at least one further feed or food ingredient, preferably selected from carriers, proteins, carbohydrates, fats, further probiotics, prebiotics, enzymes, vitamins, immunomodulators, milk replacers, minerals, amino acids, carriers, anticoccidial drugs, acid-based products and / or medicines such as antibiotics.

13. 10. A pharmaceutical composition for treating, preventing or alleviating the course of an intestinal disorder, comprising the microorganism of claim 1 and a pharma- ceutically acceptable carrier.

14. 2. Use of a microorganism according to claim 1 for the preparation of a composition for promoting the health of an animal, and / or improving the general body condition of said animal, and / or improving the feed conversion rate of said animal, and / or reducing the mortality rate of said animal, and / or increasing the survival rate of said animal, and / or improving the weight gain of said animal, and / or increasing the productivity of said animal, and / or increasing the disease resistance of said animal, and / or modulating the immune response of said animal, and / or establishing or maintaining a healthy gut microflora in said animal, and / or improving the meat quality of said animal, and / or reducing the shedding of bacterial and / or viral pathogens via the faeces of said animal.

15. 13. A method of feeding a non-human animal, comprising feeding said animal the microorganism of claim 1.

Images