Nucleic Acid Detection

Abstract

The present invention relates to the detection of nucleic acids, and in particular, but not exclusively, to a rapid, one-pot, single-step method and associated kit for amplifying and detecting a target nucleic acid sequence in a sample obtained from a subject. The method and kit can be used to detect pathogenic nucleic acid sequences in a sample, such as a blood or saliva sample, by selective amplification of the target nucleic acid to provide a point-of-care diagnosis of infectious diseases or other RNA-related diseases, such as cancer.

Description

[Technical field]

[0001] The present invention relates to the detection of nucleic acids, and in particular, but not exclusively, to a rapid, one-pot, single-step method and associated kit for amplifying and detecting a target nucleic acid sequence in a sample obtained from a subject. The method and kit can be used to detect pathogenic nucleic acid sequences in a sample, such as a blood or saliva sample, by selective amplification of the target nucleic acid to provide a point-of-care diagnosis of infectious diseases or other RNA-related diseases, such as cancer. [Background technology]

[0002] During the COVD-19 pandemic, it has become clear that detection and tracing of infected cases is crucial to control the spread of viral infections. For this reason, point-of-care diagnostics play a central role and diagnostic methods should meet the criteria of rapidity, simplicity, sensitivity, affordability, and portability.

[0003] Despite the great efforts to establish rapid and portable tests, the reverse transcription polymerase chain reaction (RT-PCR) test adopted by WHO remains the gold standard method, showing the best limit of detection (LOD) (about 0.1 copies / μL) among available methods. However, this method is not suitable in terms of rapid point-of-care testing, because the collected patient sample must be transported to a well-equipped laboratory and analyzed using specialized techniques and equipment. Therefore, RT-PCR tests require several hours or days to complete, which does not meet the criteria of rapidity. In addition, the high cost of thermal cyclers may further limit diagnosis.

[0004] To solve these limitations of RT-PCR testing, several alternative methods have been established. Reverse transcription loop mediated isothermal amplification (RT-LAMP) is an isothermal reaction method, in which target amplification is performed at the DNA melting temperature (60-65°C) using a special DNA polymerase (Bst DNA polymerase) and several primer sets. The reaction is very rapid and produces pyrophosphate, so pH changes can be used as a readout. DNA staining can help increase the LOD to about 10 copies / μL. Although the sensitivity is worse, this method can skip the RNA isolation step and may be able to directly detect viral RNA in heated positive specimens. Currently, RT-LAMP is accepted as an alternative to RT-PCR and is actually used as a point-of-care diagnostic.

[0005] Antigen-based tests performed by lateral flow strips are commonly used as a quick test that takes about 15 minutes. Instead of amplifying the pathogen signal with an enzymatic reaction, the antibodies on the strip simply detect the pathogen antigen. As a result, the LOD is low (>100 copies / μL) and usually only active infections can be detected.

[0006] Nucleic acid sequence-based amplification (NASBA) is a molecular biology technique that uses three enzymes and two primers to generate multiple transcribed copies of RNA or RNA fragments of a specific DNA. First, when amplifying a target RNA sequence, a primer containing a T7 promoter hybridizes to the target RNA and is extended by reverse transcriptase (RT) using dNTPs to form a cDNA copy of the template RNA. RNase H then destroys the hybridized RNA leaving naked cDNA. A second primer then hybridizes to the cDNA and RT synthesizes another DNA strand from the bound primer, generating double-stranded DNA. T7 RNA polymerase binds to the double-stranded promoter region and then transcribes the RNA using NTPs. Since multiple copies of the RNA have been made, the free primer can continue to hybridize and be extended to generate more template. This results in exponential amplification of the DNA template and RNA product. Alternatively, when amplifying target DNA sequence, the first primer hybridizes to the DNA sequence (after the first denaturation step) and is extended by RT.The second primer is added, and after the second denaturation step, it hybridizes to the extension product of the first primer and is extended, producing double-stranded DNA sequence.Then, T7 RNA polymerase binds to the promoter and transcribes RNA.

[0007] Mango is a fluorescent RNA aptamer that can be used to label RNA of interest. Mango fluoresces when bound to a thiazole orange-based ligand (TO1-biotin), providing a fluorescent readout of the transcription of specific DNA sequences, allowing the technique to be used to identify pathogens in biological samples such as saliva or blood.

[0008] The NASBA molecular biology technique has been combined with fluorogenic aptamers such as Mango to result in the nested Mango-NASBA assay for amplifying and detecting nucleic acid sequences (see Figure 1). This nested Mango-NASBA assay amplifies an RNA sequence recognized by two primer sets (outer primers: PA / PB or P1 / P2, and inner primers: PC / PD or P3 / P4). However, the nested Mango-NASBA assay requires that the saliva sample is first pretreated to extract pathogenic nucleic acids before two sequential nested amplification reactions are performed. Thus, the current nested Mango-NASBA assay for detecting nucleic acids does not meet the criteria of rapidity, simplicity, and portability. Summary of the Invention [Problem to be solved by the invention]

[0009] Therefore, there is a need to provide improved methods for rapid detection of nucleic acids to provide point-of-care diagnosis of infectious diseases. [Means for solving the problem]

[0010] The present inventors have modified a nucleic acid detection method and surprisingly first demonstrated that by carefully controlling the amounts of reagents and primers, the two nested amplification steps of the Mango-NASBA method can be performed in parallel in a single tube. Secondly, by changing the RNA polymerase used in the original assay, the detection of the Mango fluorescent signal can be improved and stabilized.

[0011] Therefore, according to a first aspect of the present invention there is provided a method for detecting a target nucleic acid sequence in a sample obtained from a subject, comprising the steps of: - The sample, (a) one or more primers, at least one of the primers comprising a fluorescent molecule; (b) one or more polymerases; and (c) a plurality of deoxynucleotide triphosphates (dNTPs) and / or nucleotide triphosphates (NTPs); amplifying the target nucleic acid sequence by nucleic acid sequence-based amplification (NASBA), comprising contacting the target nucleic acid sequence with - detecting a target nucleic acid sequence, wherein a fluorescent signal indicates the presence of the target nucleic acid sequence in the sample; Including, The amplifying step is carried out under the following conditions: (i) contacting the sample with 1 to 59 mM Tris HCl; (ii) contacting the sample with spermidine; (iii) pH 6.8-9.0; (iv) a fixed temperature; and / or (v) the polymerase is T3 RNA polymerase; A method is provided that includes at least one of the following:

[0012] According to a second aspect of the present invention, there is provided a method for diagnosing or prognosing an infectious disease in a subject, the method comprising detecting a target nucleic acid sequence in a sample obtained from the subject, - The sample, (a) one or more primers, at least one of the primers comprising a fluorescent molecule; (b) one or more polymerases; and (c) a plurality of deoxynucleotide triphosphates (dNTPs) and / or nucleotide triphosphates (NTPs); amplifying the target nucleic acid sequence by nucleic acid sequence-based amplification (NASBA), comprising contacting the target nucleic acid sequence with - detecting a target nucleic acid sequence, wherein a fluorescent signal indicates that the subject is suffering from an infectious disease or has a negative prognosis; and Including, The amplifying step is carried out under the following conditions: (i) contacting the sample with 1 to 59 mM Tris HCl; (ii) contacting the sample with spermidine; (iii) pH 6.8-9.0; (iv) a fixed temperature; and / or (v) the polymerase is T3 RNA polymerase; A method is provided that includes at least one of the following:

[0013] According to a third aspect of the present invention there is provided a kit for detecting a target nucleic acid sequence in a sample obtained from a subject, comprising: - a reagent for amplifying a target nucleic acid sequence by nucleic acid sequence-based amplification (NASBA), comprising: (a) one or more primers, at least one of the primers comprising a fluorescent molecule; (b) one or more polymerases; and (c) a plurality of deoxynucleotide triphosphates (dNTPs) and / or nucleotide triphosphates (NTPs); A reagent comprising: - means for detecting a target nucleic acid sequence, wherein a fluorescent signal indicates the presence of the target nucleic acid sequence in a sample; Including, At least one of the following: (i) 1-59 mM Tris HCl; (ii) spermidine; (iii) pH 6.8-9.0; (iv) used at a fixed temperature; and / or (v) the polymerase is T3 RNA polymerase; A kit is provided comprising:

[0014] For a better understanding of the present invention, and to show how embodiments thereof may be carried into effect, reference will now be made, by way of example, to the accompanying drawings in which: [Brief description of the drawings]

[0015] [Figure 1]Schematic diagram of the prior art nested Mango-NASBA assay process. The nested Mango-NASBA assay includes an outer primer pair, whose product is then diluted and sent to a second, inner Mango-NASBA reaction to reduce the generation of artifacts. The addition of the Mango aptamer template to primer PD results in the generation of an RNA product containing a fluorescent Mango tag. [Diagram 2] 1 is a graph showing optimization of P4Mango primers for one embodiment of the method of the present invention comprising a NASBA reaction. The NASBA reaction was performed in the presence of T7 RNA polymerase (180 U per reaction, NEB:M0251L), 25 nM primers, 50 nM TO1-B, and 40 ng HEK293T RNA with a conventional incubation step. [Diagram 3] Graph showing comparison of three different RNA polymerases in Mango-NASBA reactions (non-nested). (A) T7 or T3 RNA polymerase-mediated NASBA reactions for amplification of 18S ribosomal RNA (18S-rRNA) with primer sets. (B) Response time and amplification levels using three different RNA polymerases (T7, T3 or SP6) in Mango-NASBA reactions (non-nested). All reaction conditions and results are comparable (180U RNA polymerase, 25nM primers, 50nM TO1-B, 35ng HEK293T tot-RNA per reaction with the conventional reaction steps described above). [Figure 4]PAGE for detection of Mango-NASBA RNA transcripts over time (0-2 h) using three different RNA polymerases. The left lane shows the two primers (P1_T3 and P3_M) used for the T3 pol-mediated Mango-NASBA reaction, and the base-paired marker-ladder (M) (ssRNA ladder N0362S). Mango-NASBA reactions were performed with 35 ng of HEK293T tot-RNA. Mango-NASBA products were taken at each time point and loaded onto a 15% polyacrylamide gel (PAGE) under denaturing conditions (8 M urea) and stained with SYBR Gold (S11494). White arrows indicate the expected NASBA products, and black arrows are considered to be the synthesized DNA templates. [Diagram 5] Graph showing the effect of RNA polymerase combinations in one-pot nested Mango-NASBA. Top: Non-nested Mango-NASBA reactions for 18S-rRNA amplification with either T7 or T3 RNA polymerase. Bottom: One-pot nested NASBA reactions in different combinations using T7 and T3 RNA polymerase. Reactions were performed with 35ng HEK293T tot-RNA and 50nM TO1-B in standard Mango-NASBA conditions. [Figure 6-1] Figure 6 illustrates the contribution of primer concentration to one-pot nested NASBA reactions. The left arrow indicates the primer set used for the amplification of 18S-rRNA. The outer and inner primer concentrations (P1–P4) were systematically titrated from 25 to 100 nM (Figure 6A) and 5 to 100 nM (Figure 6B) for the single-pot nested Mango-NASBA reactions. The reaction conditions were 20 mM Tris-HCl (pH 8.0), 100 ng HEK tot-RNA, 180 U T3 RNA polymerase, and 2 mM spermidine. Images were taken after 1 h 20 min. [Figure 6-2]Figure 6 illustrates the contribution of primer concentration to one-pot nested NASBA reactions. The left arrow indicates the primer set used for the amplification of 18S-rRNA. The outer and inner primer concentrations (P1–P4) were systematically titrated from 25 to 100 nM (Figure 6A) and 5 to 100 nM (Figure 6B) for the single-pot nested Mango-NASBA reactions. The reaction conditions were 20 mM Tris-HCl (pH 8.0), 100 ng HEK tot-RNA, 180 U T3 RNA polymerase, and 2 mM spermidine. Images were taken after 1 h 20 min. [Figure 7] Graph showing the contribution of Tris-HCl amount in NASBA reaction. The pH value was fixed at pH 8.8, and NASBA reaction for r18S amplification was performed at different Tris-HCl levels. The bottom row shows the amplification with T3 pol in the range of 40-53.3 mM. The top row shows the results with T7 pol in the range of 0-40 mM. According to the results, 20 mM Tris-HCl is optimal for NASBA reaction. [Figure 8] Graph showing the effect of pH on NASBA reaction. Titration of pH levels in 40 mM Tris-HCl in the presence of T7 or T3 polymerase using r18S primer. In both cases, NASBA at pH 8.0 shows optimal amplification levels and kinetics. The target is 18S-rRNA. [Figure 9] FIG. 13 is a graph showing the effect of spermidine concentration on the NASBA reaction. The presence of spermidine improves amplification and response time during the conditional NASBA reaction. 20 mM Tris-HCl, 25 nM primers, 200 ng HeLa RNA, and T7 pol were used. Results are reproducible with HEPES-based buffers (not shown). [Figure 10] 1 is a graph showing detection of endogenous RNA in saliva in an optimized nested NASBA method. 18S ribosomal RNA naturally expressed in cells in saliva was successfully detected in the optimized single-pot nested NASBA condition (20 mM Tris-HCl, pH 8.0, and 2 mM spermidine). [Figure 11] Graph showing detection of viral RNA by optimized conditions. Left: Titration of viral RNA (vRNA) fragments (fragment 2, F2) in one-step Mango-NASBA reaction. Primer amounts ([P1] and [P2] = 25 nM, [P3] and [P4] = 100 nM). Right: 2 ng of viral RNA fragments was used as a positive control in culture medium. Cultured SARS-CoV-2 virus was successfully detected by treatment with transport buffer, while no treatment led to no amplification. 4% (106 TCID50 / ml) of cultured virus was applied to the NASBA reaction. Due to the transport buffer treatment, the reaction mixture contains 50 mM guanidine-HCl at a final concentration. Both incubation steps of the NASBA reaction were performed in the conventional manner. Saliva is not included in this experiment. [Figure 12] Illustrates the contribution of the annealing step and optimal temperature in NASBA reactions. Left: Arrows indicate the primer concentrations (P1 and P2 / P3 and P4) used for amplification. The graph below shows the impact of the annealing step in single-pot nested NASBA, suggesting that the annealing step does not improve single-tube nested NASBA reactions and can be excluded. The image on the right shows the incubation temperature optimization in NASBA reactions. NASBA at around 37°C gives better results than 41°C used in traditional NASBA reactions. [Figure 13] Figure 1. NASBA amplification by incubation through the human body. NASBA reaction mix was hand-held and incubated. 200 pg of RNA (F2) per reaction. P1 and P2 primers were at 25 nM, and P3 and P4 primers were at 100 nM. Incubation time was 30 min. [Figure 14] Figure 1 shows the limit of detection for the one-pot Mango NASBA reaction. The amount of RNA was titrated to determine the limit of detection for this assay. On the left, the results of the titration experiment are shown. The slope coefficients were calculated from the linear portion of the curves in the left panel. The figure on the right shows each coefficient value in its corresponding number of copies per microliter. [Figure 15] Graphs showing the detection of influenza A virus and mycoplasma. (A) Influenza A virus RNA segments were amplified from cultured influenza A virus using pepper RNA aptamers. (B) Mycoplasma detection using mycoplasma-infected cells. [Figure 16] Graph showing systematic analysis of primer melting temperature in NASBA reaction. The melting temperatures of P1&2 and P3&P4 primer sets were varied at 48, 51, and 53°C to systematically analyze the contribution of primer melting temperature in NASBA reaction. C: Control (minus RNA), RNA: Fragment 2 200pg / reaction. [Figure 17] Graphs showing RNA detection in blood samples. (A-C) F2 RNA fragments spiked into blood samples were amplified by Mango-NASBA method in different buffer conditions. After applying the buffer, whole blood samples were spun at 21,000×g for 5 min and the supernatant was used for the assay. SARS2-CoV2 template RNA in the reaction was 200 pg. (E-F) Endogenous ribosomal 18S RNA detection by NASBA assay. (E) r18S detection using blood supernatant. (F) Boiled blood sample (95°C / 5 min) for improved amplification of Mango signal. [Figure 18] FIG. 1 shows primers capable of hybridizing to a SARS-CoV-2 target nucleic acid sequence. [Figure 19] FIG. 1 shows primers capable of hybridizing to an 18S ribosomal RNA target sequence. [Figure 20] FIG. 1 shows primers capable of hybridizing to an influenza A target nucleic acid sequence. [Figure 21] FIG. 1 shows primers capable of hybridizing to a Mycoplasma target nucleic acid sequence. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0016] As discussed above, the inventors were surprised to observe that by carefully controlling the amounts of reagents and primers, the two nested amplification steps of the prior art NASBA method can be performed in parallel in a single tube. Also, by modifying the RNA polymerase used in the original assay, the detection of the fluorescent molecule signal can be improved and stabilized. Advantageously, the result of these improvements is a one-step, single-container, single-temperature reaction that takes less than 30 minutes. The reaction can also be performed with saliva stored in a conventional virus transport buffer without pretreatment or RNA extraction. Therefore, the improved NASBA method and kit of the claimed invention are a rapid, portable, and adaptable technique that is well suited for infection control in a variety of settings. Moreover, by using multiple fluorescent molecules that target multiple sequences, the technique can be easily adapted to test for multiple pathogens in a single reaction.

[0017] In one embodiment, the method and / or kit includes at least conditions (i) and (ii); (i) and (iii); (i) and (iv); (i) and (v); (ii) and (iii); (ii) and (iv); (ii) and (v); (iii) and (iv); (iii) and (v); or (iv) and (v).

[0018] Alternatively, in another embodiment, the method and / or kit comprises at least conditions (i), (ii) and (iii); (i), (ii) and (iv); (i), (ii) and (v); (i), (iii) and (iv); (i), (iii) and (v); (i), (iv) and (v); (ii), (iii) and (iv); (ii), (iv) and (v); (ii), (iv) and (v); or (iii), (iv) and (v).

[0019] Alternatively, in another embodiment, the method and / or kit includes at least conditions (i), (ii), (iii) and (iv); (i), (ii), (iii) and (v); (i), (ii), (iv) and (v); (i), (iii), (iv) and (v); or (ii), (iii), (iv) and (v).

[0020] Alternatively, in another embodiment, the method and / or kit includes all of conditions (i), (ii), (iii), (iv) and (v).

[0021] Advantageously, the method according to the first and second aspects, or the kit according to the third aspect, does not require extraction of RNA from the sample before carrying out the amplification reaction.Thus, in a preferred embodiment, the method and / or kit does not include extraction or purification of nucleic acid from the sample, or does not include means for extracting or purifying nucleic acid from the sample.

[0022] Preferably, the process is carried out in one step and / or in a single pot or vessel, which is a significant advance over prior art processes that require multiple steps carried out in multiple vessels.

[0023] The term "primer", within the context of the present invention, denotes a nucleotide sequence that can specifically hybridize to a target nucleic acid sequence and serve to initiate amplification.

[0024] The primer of the present invention may be a single-stranded nucleotide sequence having a length of 10 to 200 nucleotides, 10 to 180, 10 to 160, 10 to 140, 10 to 120, 10 to 110, 10 to 100, 10 to 80 nucleotides, 10 to 70 nucleotides, 10 to 60 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 30 nucleotides, or 10 to 20 nucleotides.

[0025] Preferably, the primer of the present invention has a length of 15 to 60 nucleotides, 25 to 60 nucleotides, 35 to 60 nucleotides, 45 to 60 nucleotides, 55 to 60 nucleotides, 15 to 50 nucleotides, 25 to 50 nucleotides, 35 to 50 nucleotides, 45 to 50 nucleotides, 15 to 40 nucleotides, 25 to 40 nucleotides, 35 to 40 nucleotides, 15 to 30 nucleotides, or 25 to 30 nucleotides.

[0026] Preferably, the primer of the present invention has a length of 10 to 30 nucleotides, 12 to 28 nucleotides, 14 to 26 nucleotides, 16 to 24 nucleotides, or 18 to 22 nucleotides. In another preferred embodiment, the primer of the present invention has a length of 35 to 55 nucleotides, 37 to 53 nucleotides, 39 to 51 nucleotides, 41 to 49 nucleotides, or 43 to 47 nucleotides.

[0027] In one embodiment, the one or more primers comprise a first and a second primer (forward primer and reverse primer).Preferably, in this embodiment, the first and the second primer form a first primer pair.The forward primer is designed to be complementary to the sequence of the upstream nucleotide of the target sequence, while the reverse primer is designed to be complementary to the sequence of the downstream nucleotide of the target sequence.

[0028] Preferably, the first and second primers hybridize to at least a portion of a target nucleic acid sequence, or a reverse complementary sequence thereof, and are capable of carrying out a first amplification reaction to generate a first amplification product.

[0029] Alternatively, the amplification reaction may be "nested", which requires dilution of the first amplification product before a subsequent amplification, improving sensitivity and specificity and reducing amplification artifacts.

[0030] Thus, in another embodiment, the one or more primers comprise a first, a second, a third and a fourth primer. Preferably, in this embodiment, the first and second primers (forward and reverse primers) form a first primer pair, and the second and third primers (forward and reverse primers) form a second primer pair.

[0031] Preferably, the first and second primers hybridize to at least a portion of the target nucleic acid sequence, or a reverse complementary sequence thereof, and are capable of carrying out a first amplification reaction to generate a first amplification product. Preferably, the second and third primers hybridize to at least a portion of the first amplification product, or a reverse complementary sequence thereof, and are capable of carrying out a second amplification reaction to generate a second amplification product.

[0032] As discussed in Example 3, the inventors discovered that nested Mango-NASBA reactions only work if the same RNA promoter sequence is used in the outer (P1) and inner (P3) primers. Thus, in a preferred embodiment, the first and third primers contain polymerase promoters that contain identical nucleotide sequences.

[0033] In one embodiment, the fluorescent molecule may be a molecular beacon probe. A molecular beacon probe is a single-stranded oligonucleotide with a stem and loop structure. A fluorophore and a quencher are covalently attached to either end of the molecular beacon, and the stem holds them in close proximity, quenching the fluorescence of the fluorophore. When the molecular beacon hybridizes to its target, it undergoes a conformational change that separates the fluorophore and the quencher, allowing the fluorophore to emit fluorescence. The fluorophore may be any fluorophore known to those skilled in the art, such as fluorescein (FAM), 6-carboxy-X-rhodamine (ROX), and cascade blue (CB).

[0034] Preferably, the fluorescent molecule is a fluorogenic aptamer, which is a nucleic acid molecule that can bind to a ligand (fluorophore) with high selectivity and specificity and generate a fluorescent signal.

[0035] In one embodiment, the fluorogenic aptamer may be selected from the group of aptamers consisting of Mango, Pepper, Peach, Broccoli, Corn, Spinach, Spinach2, Carrot, Radish, RT aptamers, hemin-binding G-quadruplex DNA and RNA aptamers, and malachite green-binding aptamers. Examples of fluorogenic aptamers are: Ouellet, Jonathan. "RNA fluorescence with light-up aptamers." Frontiers in chemistry 4(2016):29; Dolgosheina, Elena V. et al. "RNA mango aptamer-fluorophore: a bright, high-affinity complex for RNA labelling and tracking." ACS chemical biology 9.10(2014):2412-2420; Strack, Rita L., Matthew D. Disney, and Samie R. Jaffrey. "A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat-containing RNA." Nature methods 10.12(2013):1219-1224; Filonov, Grigory S. et al. "Broccoli: rapid selection of an RNA mimic of green fluorescent protein by fluorescence-based selection and directed evolution." Journal of the American Chemical Society 136.46(2014):16299~16308, and Song, Wenjiao et al. "Imaging RNA polymerase III transcription using a photostable RNA-fluorophore complex." Nature chemical biology 13.11(2017):1187~1194.

[0036] Most preferably, the fluorogenic aptamer is a Mango aptamer, such as a Mango RNA aptamer. The Mango RNA aptamer binds to a thiazole orange-based ligand (To1-biotin) and generates a fluorescent signal. Thus, in one embodiment, the method includes contacting the sample with a thiazole orange-based ligand (To1-biotin) and / or the kit includes a thiazole orange-based ligand (To1-biotin). Preferably, the Mango RNA aptamer is a Mango II, Mango III, or Mango IV RNA aptamer.

[0037] The first, second, third or fourth primer may comprise a fluorescent molecule. Preferably, the fluorescent molecule is located at the 3' end of the first, second, third or fourth primer. Most preferably, when the amplification reaction is nested, the third or fourth primer comprises a fluorescent molecule.

[0038] As discussed in Example 1, the inventors determined the optimal length of the Mango primer stem nucleotides and discovered that a 5-mer stem primer set exhibited the best amplification ratio between the positive and negative template RNAs.

[0039] Thus, in one embodiment, the primer comprising the fluorescent molecule comprises a terminal stem structure of 2 bp to 15 bp, 3 bp to 14 bp, 4 bp to 13 bp, 5 to 12 bp, 6 to 11 bp, or 7 to 10 bp.

[0040] In one embodiment, a primer comprising a fluorescent molecule comprises a terminal stem structure of 2bp to 13bp, 2bp to 11bp, 2bp to 9bp, 2bp to 7bp, 2bp to 5bp, 3bp to 15bp, 3bp to 13bp, 3bp to 11bp, 3bp to 9bp, 3bp to 7bp, 3bp to 5bp, 4bp to 15bp, 4bp to 13bp, 4bp to 11bp, 4bp to 9bp, or 4bp to 7bp.

[0041] Preferably, the primer containing the fluorescent molecule contains a terminal stem structure of 2 bp to 8 bp, or 3 bp to 7 bp, or 4 bp to 6 bp. Most preferably, the primer containing the fluorescent molecule contains a terminal stem structure of 5 bp.

[0042] Furthermore, we performed a systematic titration of primers to determine the optimal primer concentration, as discussed in Example 4. We found that the Mango signal was efficiently amplified when the concentration of the outer primer (i.e., the first primer pair) was lower than that of the inner primer (i.e., the second primer pair).

[0043] Thus, in a preferred embodiment, the concentration of the first and second primers (ie, the first primer pair) is lower than the concentration of the third and fourth primers (ie, the second primer pair).

[0044] For example, in one embodiment, the concentration of the first and second primers may be 1 to 50 nM, 5 to 45 nM, 10 to 40 nM, 15 to 35 nM, or 20 to 30 nM.

[0045] In one embodiment, the concentration of the first and second primers may be 1 to 50 nM, 1 to 45 nM, 1 to 40 nM, 1 to 35 nM, 1 to 30 nM, 1 to 25 nM, 1 to 20 nM, 1 to 15 nM, 1 to 10 nM, or 1 to 5 nM.

[0046] In another embodiment, the concentration of the first and second primers is 5 to 50 nM, 10 to 50 nM, 15 to 50 nM, 20 to 50 nM, 25 to 50 nM, 30 to 50 nM, 35 to 50 nM, 40 to 50 nM, or 45 to 50 nM. Preferably, the concentration of the first and second primers is 22 to 28 nM, or 24 to 26 nM. Most preferably, the concentration of the first and second primers is 25 nM.

[0047] The concentrations of the third and fourth primers may be 10 to 150 nM, 20 to 140 nM, 30 to 130 nM, 40 to 120 nM, 50 to 110 nM, 60 to 100 nM, or 70 to 90 nM.

[0048] In one embodiment, the concentrations of the third and fourth primers may be 20 to 150 nM, 30 to 150 nM, 40 to 150 nM, 50 to 150 nM, 60 to 150 nM, 70 to 150 nM, 80 to 150 nM, 90 to 150 nM, 100 to 150 nM, 110 to 150 nM, 120 to 150 nM, 130 to 150 nM, or 140 to 150 nM. In another embodiment, the concentration of the third and fourth primers may be 10 to 140 nM, 10 to 130 nM, 10 to 120 nM, 10 to 110 nM, 10 to 100 nM, 10 to 90 nM, 10 to 80 nM, 10 to 70 nM, 10 to 60 nM, 10 to 50 nM, 10 to 40 nM, 10 to 30 nM, or 10 to 20 nM. Most preferably, the concentration of the third and fourth primers is 100 nM.

[0049] The inventors have also found that excessive levels of primers, for example, greater than 100 nM, result in reduced Mango signal amplification. Thus, in a preferred embodiment, the concentration of one or more primers is 100 nM or less.

[0050] Furthermore, as discussed in Example 14, the inventors discovered that optimizing the melting temperature (Tm) of the primers improved the amplification of the Mango signal, and that when the primer melting temperatures were all 51°C, the signal difference between the presence and absence of template RNA was maximized.

[0051] Thus, in one embodiment, the melting temperature of the primer or primers is 48-54° C., 49-53° C., or 50-52° C. Most preferably, the melting temperature of the primer or primers is 51° C.

[0052] For example, in an embodiment where the one or more primers comprises a first and a second primer, preferably the melting temperature of the first and second primers is 51° C. In an embodiment where the one or more primers comprises a third and a fourth primer, preferably the melting temperature of the third and fourth primers is 51° C. Alternatively, in an embodiment where the one or more primers comprises a first, a second, a third and a fourth primer, preferably the melting temperature of the first, a second, a third and a fourth primers is 51° C.

[0053] As discussed above, in some embodiments, the method comprises one single amplification reaction, in which the amplification comprises contacting the sample with one polymerase.

[0054] Alternatively, in embodiments in which the amplification reaction is nested (ie, comprises two amplification reactions), the amplification comprises contacting the sample with a first and a second polymerase.

[0055] Preferably, the one or more polymerases are RNA polymerases.Even more preferably, the one or more polymerases are T3 RNA polymerases.Alternatively, in the embodiment where the one or more polymerases are not T3 RNA polymerases, the one or more polymerases may be selected from the group of polymerases consisting of T7 RNA polymerase and SP6 RNA polymerase.

[0056] Thus, in embodiments in which the method comprises one single amplification reaction, the amplification comprises contacting the sample with T3 RNA polymerase. As discussed in Example 3, the inventors have discovered that the nested Mango-NASBA reaction works only if the same RNA polymerase is used in the first and second amplification reactions.

[0057] Thus, in embodiments in which the amplification involves contacting the sample with a first and a second polymerase, preferably the first and second polymerases are the same type of polymerase. Most preferably, the first and second polymerases are T3 RNA polymerase.

[0058] The target nucleic acid sequence may be a DNA or RNA sequence. In a preferred embodiment, the target nucleic acid sequence is an RNA sequence. The target nucleic acid sequence may be single-stranded or double-stranded, or may be a combination of single-stranded and double-stranded. For example, the target nucleic acid sequence may be selected from chromosomal DNA, mitochondrial DNA, messenger RNA, transfer RNA, ribosomal RNA, small nuclear RNA, microRNA, small interfering RNA, viral RNA, and extrachromosomal DNA.

[0059] In some embodiments, the target nucleic acid sequence may be from a virus, bacteria, mycoplasma, fungus, animal, plant, algae, parasite, or protozoan. Preferably, the target nucleic acid sequence is from a virus or bacteria.

[0060] In one embodiment, the target nucleic acid sequence may be from an RNA-associated disease, such as cancer.

[0061] The target nucleic acid sequence may be between 10 and 1000 nucleotides, between 20 and 900 nucleotides, between 30 and 800 nucleotides, between 40 and 700 nucleotides, between 50 and 600 nucleotides, between 60 and 500 nucleotides, between 70 and 400 nucleotides, between 80 and 300 nucleotides, or between 90 and 200 nucleotides in length.

[0062] In one embodiment, the target nucleic acid sequence has a length of 10-800 nucleotides, 10-600 nucleotides, 10-400 nucleotides, 10-200 nucleotides, 20-1000 nucleotides, 20-800 nucleotides, 20-600 nucleotides, 20-400 nucleotides, 20-200 nucleotides, 30-1000 nucleotides, 30-800 nucleotides, 30-600 nucleotides, 30-400 nucleotides, 30-200 nucleotides, 40-1000 nucleotides, 40-800 nucleotides, 40-600 nucleotides, 40-400 nucleotides, 40-200 nucleotides, 50-1000 nucleotides, 50-800 nucleotides, 50-600 nucleotides, 50-400 nucleotides, 50-200 nucleotides, 60-10 00 nucleotides, 60 to 800 nucleotides, 60 to 600 nucleotides, 60 to 400 nucleotides, 60 to 200 nucleotides, 70 to 1000 nucleotides, 70 to 800 nucleotides, 70 to 600 nucleotides, 70 to 400 nucleotides, 70 to 200 nucleotides, 80 to 1000 nucleotides, 80 to 800 nucleotides, 80 to 600 nucleotides, 80 to 400 nucleotides, 80 to 200 nucleotides, 90 to 1000 nucleotides, 90 to 800 nucleotides, 90 to 600 nucleotides, 90 to 400 nucleotides, 90 to 200 nucleotides, 100 to 1000 nucleotides, 100 to 800 nucleotides, 100 to 600 nucleotides, 100 to 400 nucleotides, or 100 to 200 nucleotides.

[0063] Preferably, the target nucleic acid sequence may be 40 to 160 nucleotides, 50 to 150 nucleotides, 60 to 140 nucleotides, 70 to 130 nucleotides, 80 to 120 nucleotides, or 90 to 110 nucleotides in length.

[0064] The virus may be a DNA virus or an RNA virus. The virus may be selected from one of the following: African Horse Sickness virus, African Swine Fever virus, Akabane virus, Banja virus, Calicivirus (e.g., human enteric viruses such as Norovirus and Sapovirus), Long-tailed Monkey Herpesvirus 1, Chikungunya virus, Swine Fever virus, Coronavirus (e.g., Severe Acute Respiratory Syndrome (SARS), Middle East Respiratory Syndrome (MERS), Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2)), Dengue virus, such as serotypes 1 (DENV1) and 3 (DENV3), and related viruses, such as Chikungunya virus (CHIKV); Dugbe virus virus; Ebola virus; Encephalitis virus, such as Eastern Equine Encephalitis virus, Japanese Encephalitis virus, Murray Valley Encephalitis, and Venezuelan Equine Encephalitis virus; Equine Morbillivirus; flavirus, Flexal virus; Foot and Mouth Disease virus; Germiston virus; virus); goatpox virus; hantavirus or other hantaviruses; hendra virus; human immunodeficiency virus (HIV); influenza viruses (e.g., H1 N1, H5N1, avian influenza viruses); Lassa fever virus; louping ill virus; lymphocytic choriomeningitis virus; poliovirus; potato virus; poxviruses; South American hemorrhagic fever viruses; variola major virus (smallpox virus); vesicular stomatitis virus; West Nile virus; yellow fever virus; human pathogenic flaviviruses such as Zika virus.

[0065] The bacterium may be selected from one of the following: Aeromonas hydrophila; Bacillus anthracis; Bacillus cereus; botulinum neurotoxin producing species of the genus Clostridium; Brucella abortus; Brucella melitensis; Brucella suis; Burkholderia mallei (formerly Pseudomonas mallei); Burkholderia pseudomallei (formerly Pseudomonas pseudomallei); Campylobacter jejuni; Chlamydia psittaci; Clostridium botulinum; Clostridium botulinum; Clostridium perfringens; Coccidioides immitis; Coccidioides posadasii; Cowdria ruminantium); Coxiella burnetii; Enterovirulent Escherichia coli group (EEC group), such as Escherichia coli - enterotoxigenic (ETEC), Escherichia coli - enteropathogenic (EPEC), Escherichia coli -0157.'H7 enterohemorrhagic (EHEC), and Escherichia coli-enteroinvasive (EIEC); Ehrlichia species, e.g., Ehrlichia chaffeensis; Francisella tularensis; Legionella pneumophilia; Liberobacter africanus; Liberobacter asiaticus; Listeria monocytogenes; various enterobacteria, e.g., Klebsiella, Enterobacter, Proteus, Citrobacter, Aerobacter, Providencia, and Serratia; Mycobacterium bovis; Mycobacterium tuberculosis; Mycoplasma capricolum; Mycoplasma mycoides ssp mycoides; Rickettsia prowazekii; Rickettsia rickettsii; Salmonella spp.; Schlerophthora rayssiae varzeae; Shigella spp.; Staphylococcus aureus; Streptococcus; Synchytrium endobioticum; Vibrio cholerae non-01; Vibrio cholerae 01; Vibrio parahaemolyticus and other Vibrios; Vibrio vulnificus; Xanthomonas oryzae; Xylella fastidiosa; Yersinia enterocolitica and Yersinia pseudotuberculosis; or Yersinia pestis.

[0066] In one embodiment, the target nucleic acid sequence is from SARS-CoV-2. One embodiment of a SARS-CoV-2 target nucleic acid sequence is referred to herein as SEQ ID NO:1, as follows: AUCACAACUG UAGCUGCAUU UCACCAAGAA UGUAGUUUAC AGUCAUGUAC UCAACAUCAA CCAUAUGUAG UUGAUGACCC GUGUCCUAUU CACUUCUAUU [SEQ ID NO: 1] Thus, in a preferred embodiment, the SARS-CoV-2 target nucleic acid sequence comprises or consists of a nucleotide sequence substantially as set forth as SEQ ID NO:1, or a fragment or variant thereof.

[0067] Preferably, in this embodiment, the one or more primers are capable of hybridizing to a nucleotide sequence substantially as set forth in SEQ ID NO: 1, or a fragment or variant thereof. Examples of such primers are listed in FIG.

[0068] Thus, in one embodiment, the nucleotide sequences encoding one or more SARS-CoV-2 primers are referred to herein as SEQ ID NOs: 2-7, as follows: CTTTAATACG ACTCACTATA GGGTAGAAGT GAATAGGACA CGGGT [SEQ ID NO:2] CTTTAATACG ACTCACTATA GGGAGAATGT AGTTTACAGT CATGTAC [SEQ ID NO:3] CTT AAT TAA CCC T CA C TA AAG GGT AGA AGT GAA T AGG ACA CGG GT [SEQ ID NO:4] ATCACAACTG TAGCTGCATT TCA [SEQ ID NO:5] CTTAATTAA CCCTCACTAA AGGGAGAATG TAGTTTACAG TCATGTAC [SEQ ID NO:6] ACGAATATAC CACATACCAA ACCTTCCTTC GTCAACTACA TATGGTTGAT GTTGA [SEQ ID NO: 7] Thus, in a preferred embodiment, the one or more primers are encoded by a nucleotide sequence substantially as set out in any one of SEQ ID NOs: 2-7, or a fragment or variant thereof.

[0069] In another embodiment, the target nucleic acid sequence is derived from 18S-rRNA. One embodiment of an 18S-rRNA target nucleic acid sequence is referred to herein as SEQ ID NO:8, as follows: AAGACGGACC AGAGCGAAAG CAUUUGCCAA GAAUGUUUUC AUUAAUCAAG AACGAAAGUC GGAGGUUCGA AGACGAUCAG AUACCGUCGU AGUUCCGACC [SEQ ID NO:8] Thus, in a preferred embodiment, the 18S-rRNA target nucleic acid sequence comprises or consists of a nucleotide sequence substantially as set out as SEQ ID NO:8, or a fragment or variant thereof.

[0070] Preferably, in this embodiment, the one or more primers are capable of hybridizing to a nucleotide sequence substantially as set forth in SEQ ID NO: 8, or a fragment or variant thereof. Examples of such primers are listed in FIG.

[0071] Thus, in one embodiment, the nucleotide sequences encoding one or more 18S-rRNA primers are referred to herein as SEQ ID NOs: 9-15, as follows: CTTTAATACG ACTCACTATA GGGGGAACTA CGACGGTATC TGA [SEQ ID NO: 9] CGGACCAGAG CGAAAGC [SEQ ID NO: 10] CTTTAATACG ACTCACTATA GGGGCCAAGA ATGTTTT CATTAATCAA G [SEQ ID NO: 11] ACGAATATAC CACATACCAA ACCTTCCTTC GTTCTTCGAA CCTCCGACTT [SEQ ID NO: 12] CTTATTTAGG TGACACTATA GGGGGAACTA CGACGGTATC TGA [SEQ ID NO: 13] CTTAATTAAC CCTCACTAAA GGGGGAACTA CGACGG TAT CTG A [SEQ ID NO: 14] GGCACGTACG AATATACCAC ATACCAAACC TTCCTTCGTA CGTGCCGCCA AGAATGTTTT CATTAATCAAG [SEQ ID NO: 15] Thus, in a preferred embodiment, the one or more primers are encoded by a nucleotide sequence substantially as set out in any one of SEQ ID NOs: 9-15, or a fragment or variant thereof.

[0072] In another embodiment, the target nucleic acid sequence is from influenza A. One embodiment of an influenza A target nucleic acid sequence is referred to herein as SEQ ID NO: 16, as follows: GAGAAUCCAG CACACAAGAG UCAACUGGUG UGGAUGGGAU GCCAUUCUGC CGCAUUUGAA GAUCUAAGAG UAUUGAGCUU CAUCAAAGGG ACGAAGGUGG UCC [SEQ ID NO: 16] Thus, in a preferred embodiment, the influenza A target nucleic acid sequence comprises or consists of a nucleotide sequence substantially as set out as SEQ ID NO: 16, or a fragment or variant thereof.

[0073] Preferably, in this embodiment, the one or more primers are capable of hybridizing to a nucleotide sequence substantially as set forth in SEQ ID NO: 16, or a fragment or variant thereof. Examples of such primers are listed in FIG.

[0074] Thus, in one embodiment, the nucleotide sequences encoding one or more influenza A primers are referred to herein as SEQ ID NOs: 17-20, as follows: CTTAATTAAC CCTCACTAAA GGGGGACCAC CTTCGTCCCT [SEQ ID NO:17] TACCCCCTGC ATACACTAAT GAGAATCCAG CACACAAGAG [SEQ ID NO: 18] CTTAATTAAC CCTCACTAAA GGGCTGGTGT GGATGGGATG [SEQ ID NO: 19] ACGAATATAC CACATACCAA ACCTTCCTTC GTGCTCAATA CTCTTAGATC TTCAAA [SEQ ID NO:20] Thus, in a preferred embodiment, the one or more primers are encoded by a nucleotide sequence substantially as set out in any one of SEQ ID NOs: 17-20, or a fragment or variant thereof.

[0075] In another embodiment, the target nucleic acid sequence is from Mycoplasma. One embodiment of a Mycoplasma target nucleic acid sequence is referred to herein as SEQ ID NO: 21, as follows: ATCCGCCTGA GTAGTATGCT CGCAAGAGTG AAACTTAAAG GAATTGACGG GAACCCGCAC AAGCGGTGGA GCATGTGGTT TAATTTGAAG ATACGCG [SEQ ID NO:21] Thus, in a preferred embodiment, the Mycoplasma target nucleic acid sequence comprises or consists of a nucleotide sequence substantially as set out as SEQ ID NO:21, or a fragment or variant thereof.

[0076] Preferably, in this embodiment, the one or more primers are capable of hybridizing to a nucleotide sequence substantially as set forth in SEQ ID NO: 21, or a fragment or variant thereof. Examples of such primers are listed in FIG.

[0077] Thus, in one embodiment, the nucleotide sequences encoding one or more Mycoplasma primers are referred to herein as SEQ ID NOs: 22-25, as follows: CTTAATTAAC CCTCACTAAA GGGCGCGTAT CTTCAAATTA AACCAC [SEQ ID NO:22] ATCCGCCTGAGTAGTATGCA [SEQ ID NO:23] CTTAATTAAC CCTCACTAAA GGGCAAGAGT GAAACTTAAA GGAATTGA [SEQ ID NO:24] AC GAA TAT ACC ACA TAC CAA ACC TTC CTT CGT CAC CGC TTG TGC GGG T [SEQ ID NO:25] Thus, in a preferred embodiment, the one or more primers are encoded by a nucleotide sequence substantially as set out in any one of SEQ ID NOs: 22-24, or a fragment or variant thereof.

[0078] Preferably, the method or kit includes the use of multiple deoxynucleotide triphosphates (dNTPs) and nucleotide triphosphates (NTPs). Preferably, the amplifying step includes the use of multiple deoxynucleotide triphosphates (dNTPs) and nucleotide triphosphates (NTPs).

[0079] Preferably, the plurality of deoxynucleotide triphosphates (dNTPs) are selected from the group consisting of dATP, dGTP, dCTP and / or dTTP. dNTPs are building blocks of DNA.

[0080] Preferably, the plurality of nucleotide triphosphates (NTPs) are selected from the group consisting of ATP, GTP, CTP and / or UTP. NTPs are building blocks of RNA.

[0081] As discussed in Example 5, we investigated the contribution of Tris-HCl levels to the nested Mango-NASBA assay. Surprisingly, we found that increasing Tris-HCl reduced the amplification levels of Mango RNA, and 20 mM Tris-HCl appeared to be the optimal amount for the NASBA reaction.

[0082] Thus, in a preferred embodiment, the amplification comprises contacting the sample with 1-59 mM Tris HCl, 2-55 mM Tris HCl, 4-50 mM Tris HCl, 6-45 mM Tris HCl, 8-40 mM Tris HCl, 10-35 mM Tris HCl, 12-30 mM Tris HCl, 14-25 mM Tris HCl, or 16-20 mM Tris HCl. More preferably, the amplification comprises contacting the sample with 4-55 mM Tris HCl, 6-45 mM Tris HCl, 8-35 mM Tris HCl, 10-30 mM Tris HCl, 12-28 mM Tris HCl, 14-26 mM Tris HCl, 16-24 mM Tris HCl, or 18-22 mM Tris HCl. Most preferably, the amplification comprises contacting the sample with 20 mM Tris-HCl.

[0083] Thus, in a preferred embodiment, the amplification comprises contacting the sample with 5-59 mM Tris HCl. More preferably, the amplification comprises contacting the sample with 10-59 mM Tris HCl, 15-59 mM Tris HCl, or 18-59 mM Tris HCl. Alternatively, the amplification comprises contacting the sample with 1-55 mM Tris HCl, 1-50 mM Tris HCl, 1-40 mM Tris HCl, 1-30 mM Tris HCl, or 1-25 mM Tris HCl. Most preferably, the amplification comprises contacting the sample with 1-22 mM Tris-HCl.

[0084] It will be appreciated that the kit according to the third aspect may contain any one of the above defined concentrations of Tris HCl.

[0085] The present inventors also investigated the contribution of pH to the NASBA reaction (see Example 6) and found that pH 8.0 gave the best amplification levels and response rates.

[0086] Thus, in preferred embodiments, the amplifying step is carried out at a pH of 6.8 to 9.0, 7.0 to 8.8, 7.2 to 8.6, 7.4 to 8.4, or 7.6 to 8.2.

[0087] In one embodiment, the amplifying step is carried out at a pH of 6.8-8.8, 6.8-8.7, 6.8-8.6, 6.8-8.5, 6.8-8.4, 6.8-8.3, 6.8-8.2, 6.8-8.1, or 6.8-8.0. In another embodiment, the amplifying step is carried out at a pH of 7.0-9.0, 7.1-9.0, 7.2-9.0, 7.3-9.0, 7.4-9.0, 7.5-9.0, 7.6-9.0, 7.7-9.0, 7.8-9.0, 7.9-9.0, or 8.0-9.0. Preferably, the amplifying step is carried out at a pH of 7.5-8.5, 7.6-8.4, 7.7-8.3, 7.8-8.2, or 7.9-8.1. Most preferably, the amplifying step is carried out at a pH of 8.0.

[0088] It will be appreciated that the reagents of the kit according to the third aspect may comprise any one of the pH levels defined above.

[0089] As discussed in Example 7, the inventors also investigated the contribution of spermidine to the NASBA reaction and found that the presence of spermidine improved the amplification and response time of the original NASBA reaction.

[0090] Thus, preferably the amplifying step comprises contacting the sample with at least 0.1 mM spermidine, at least 0.25 mM spermidine, or at least 0.5 mM spermidine. Preferably the amplifying step comprises contacting the sample with at least 0.75 mM spermidine, at least 1 mM spermidine, or at least 1.25 mM spermidine. Preferably the amplifying step comprises contacting the sample with at least 01.5 mM spermidine, at least 1.75 mM spermidine, or at least 2 mM spermidine.

[0091] In a preferred embodiment, the amplifying step comprises contacting the sample with 1-20 mM spermidine, 1.2-15 mM spermidine, 1.4-10 mM spermidine, 1.6-5 mM spermidine, 1.8-4 mM spermidine, or 2-3 mM spermidine.

[0092] In one embodiment, the amplification comprises contacting the sample with 1.2-20 mM spermidine, 1.4-20 mM spermidine, 1.6-20 mM spermidine, 1.8-20 mM spermidine, 2-20 mM spermidine, 1-15 mM spermidine, 1.2 and 15 mM spermidine, 1.4-15 mM spermidine, 1.6-15 mM spermidine, 1.8-15 mM spermidine, 2-15 mM spermidine, 1-10 mM spermidine, 1.2 and 10 mM spermidine, 1.4-10 mM spermidine, 1.6-10 mM spermidine, 1.8-10 mM spermidine, 2-10 mM spermidine. In one embodiment, the amplifying step comprises contacting the sample with 1.2-5 mM spermidine, 1.4-5 mM spermidine, 1.6-5 mM spermidine, 1.8-5 mM spermidine, or 2-5 mM spermidine. Alternatively, the amplifying step comprises contacting the sample with 1-4.5 mM spermidine, 1-4 mM spermidine, 1-3.5 mM spermidine, 1-3 mM spermidine, 1-2.5 mM spermidine, or 1-2 mM spermidine. Most preferably, the amplifying step comprises contacting the sample with 2 mM spermidine.

[0093] It will be appreciated that the kit according to the third aspect may contain any one of the above defined concentrations of spermidine.

[0094] In the original Mango-NASBA protocol, an annealing step was included at 65°C for 10 min before adding the enzyme mix at 41°C. The annealing step increases the assay time because the annealing temperature is different from the NASBA reaction temperature. To understand the effect of the annealing step on the NASBA reaction, we compared the Mango signal with and without the annealing step and surprisingly found that annealing did not improve the NASBA reaction. Furthermore, we found that approximately 37°C was the optimal temperature for amplification of the Mango signal.

[0095] Thus, in a preferred embodiment, the amplifying step is carried out at a fixed temperature, preferably at 30-70°C, 31-60°C, 32-50°C, 33-40°C, 34-39°C, or 35-38°C.

[0096] In one embodiment, the amplifying step is carried out at a fixed temperature of 30-64° C., 30-58° C., 30-54° C., 30-50° C., 30-46° C., 30-42° C., or 30-38° C. In another embodiment, the amplifying step is carried out at a fixed temperature of 31-70° C., 32-70° C., 33-70° C., 34-70° C., 35-70° C., or 36-70° C. Most preferably, the amplifying step is carried out at a fixed temperature of 37° C.

[0097] The inventors have also discovered that the human body can be utilized to incubate the NASBA reaction mixture. Thus, in one embodiment, the amplifying step comprises incubating the reaction mixture by holding it in the individual's hand.

[0098] It will be appreciated that the kit according to the third aspect may be used at any one of the temperatures defined above.

[0099] The sample is preferably a biological sample taken from a subject. Detection of the presence of the target nucleic acid sequence in the sample is therefore preferably performed in vitro. The sample may include tissue, blood, plasma, serum, spinal fluid, urine, sweat, saliva, sputum, tears, breast aspirate, prostatic fluid, semen, vaginal fluid, stool, cervical scraping, amniotic fluid, ocular fluid, mucous membrane, exhaled air, animal tissue, cell lysate, tumor tissue, hair, skin, oral scraping, nail, bone marrow, cartilage, prion, bone powder, ear wax, or combinations thereof. The sample may be a biopsy. Preferably, the sample is blood. Preferably, the sample includes cultured cells. Most preferably, the sample is saliva.

[0100] In another embodiment, the sample may be contained in a subject, which may be an experimental animal (e.g., a mouse or a rat) or a human, and the method is an in vivo-based test. Alternatively, the sample may be an ex vivo sample or an in vitro sample. Thus, the cells to be tested may be in a tissue sample (for ex vivo-based tests), or the cells may be grown in culture (in vitro samples). Preferably, the biological sample is an ex vivo sample.

[0101] In some embodiments, the amplification may be a multiplex amplification, which advantageously allows for the simultaneous detection of multiple target nucleic acids within the same reaction.

[0102] Thus, in one embodiment, primer pairs are different for each target nucleic acid to be amplified.For example, in one embodiment, sample can be contacted with two primer pairs that preferentially amplify two different target nucleic acid sequences.Alternatively, in another embodiment, sample can be contacted with three primer pairs that preferentially amplify three different target nucleic acid sequences.Preferably, in this embodiment, different fluorescent molecules with separate emission spectra can be used.

[0103] It will be appreciated that the kit according to the third aspect may comprise primer pairs as described above, which vary depending on the target nucleic acid, for use in a multiplex amplification reaction.

[0104] In some embodiments, the amplifying step further comprises contacting the sample with MgCl2, KCl, DMSO, ddH2O and / or DTT. Thus, in one embodiment, the kit comprises MgCl2, KCl, DMSO, ddH2O and / or DTT. Preferably, MgCl2, KCl, DMSO, ddH2O and / or DTT are premixed with Tris-HCl and / or spermidine to form a "NASBA buffer".

[0105] In some embodiments, the amplifying step further comprises contacting the sample with Superscript III RT, RNase H and / or BSA. Thus, in one embodiment, the kit comprises Superscript III RT, RNase H and / or BSA. Preferably, Superscript III RT, RNase H, and / or BSA are premixed with the polymerase, NASBA buffer, and / or ddH2O to form an "enzyme mix."

[0106] In some embodiments, the amplifying step is carried out in a premixed "reaction mixture." Preferably, the reaction mixture includes NASBA buffer, NTPs, dNTPs, one or more primers, a sample (e.g., saliva) containing the target nucleic acid sequence, ddH2O, TO1-B, and an "enzyme mix."

[0107] As discussed in Example 8, the inventors have found that 10% saliva (v / v) of the total reaction volume is optimal for the Mango-NASBA assay. Thus, in one embodiment, the reaction mixture comprises 1-50% saliva (v / v), 2-45% saliva (v / v), 3-40% saliva (v / v), 4-35% saliva (v / v), 5-30% saliva (v / v), 6-25% saliva (v / v), 7-20% saliva (v / v), or 8-15% saliva (v / v). In one embodiment, the reaction mixture comprises 1-45% saliva (v / v), 1-40% saliva (v / v), 1-35% saliva (v / v), 1-30% saliva (v / v), 1-25% saliva (v / v), 1-20% saliva (v / v), 1-15% saliva (v / v), or 1-12% saliva (v / v). In another embodiment, the reaction mixture comprises 2-50% saliva (v / v), 3-50% saliva (v / v), 4-50% saliva (v / v), 5-50% saliva (v / v), 6-50% saliva (v / v), 7-50% saliva (v / v), 8-50% saliva (v / v), or 9-50% saliva (v / v). Most preferably, the reaction mixture comprises 10% saliva (v / v).

[0108] It will be appreciated by those skilled in the art that any one of the amplification parameters, such as nucleotide concentration and / or buffer concentration, may be optimized to improve the Mango-NASBA assay. Exemplary NTP mixes, NASBA buffers, enzyme mixes, and reaction mixes are shown in Tables 1-4.

[0109] In some embodiments, the method further comprises quantifying the target nucleic acid. The quantification step occurs after the amplifying step of the method according to the first and second aspects. In one embodiment, the kit comprises a means for quantifying the target nucleic acid. The quantification may comprise measuring the intensity of the fluorescent signal to determine the concentration of the target nucleic acid in the sample.

[0110] The kit and / or method may include the use of a positive control and / or a negative control to which the fluorescent signal can be compared. For example, a negative control sample is a sample that does not contain the target nucleic acid sequence. A positive control sample is a sample that contains the target nucleic acid sequence.

[0111] Thus, in one embodiment, the method further comprises comparing the fluorescent signal with the fluorescent signal of a positive and / or negative control. In one embodiment, an increase in the fluorescent signal compared to the negative control indicates that the sample contains the target nucleic acid sequence. In another embodiment, a fluorescent signal having an intensity equal to or greater than that of the positive control indicates that the sample contains the target nucleic acid sequence.

[0112] Alternatively, a decrease in the fluorescent signal compared to the positive control indicates that the sample does not contain the target nucleic acid. In another embodiment, a fluorescent signal having an intensity equal to or less than that of the negative control indicates that the sample does not contain the target nucleic acid sequence.

[0113] Preferably, the kit includes a positive control that contains the target nucleic acid sequence. In addition, the kit may include a negative control that does not contain the target nucleic acid sequence. In a preferred embodiment, the kit includes a positive control and a negative control. Preferably, the kit includes a means for comparing the fluorescent signal of the sample with the fluorescent signal of the positive and / or negative control.

[0114] Advantageously, by detecting the presence of the target nucleic acid sequence, the method and kit of the present invention provide a rapid and sensitive means for diagnosing infectious diseases. Preferably, the method and / or kit of the present invention is useful for enabling a clinician to determine the best course of treatment for a subject currently suffering from an infectious disease. Preferably, the method and / or kit is useful for providing a prognosis of a subject's condition so that the subject can be treated for the infectious disease.

[0115] Therefore, the difference between the fluorescent signal of the sample and the positive and / or negative control can be used as a diagnostic and / or prognostic marker to suggest that the subject is suffering from an infectious disease.If the sample has an increased fluorescent signal compared to the negative control, or a fluorescent signal with an intensity equal to or greater than that of the positive control, it is understood that the subject is suffering from an infectious disease.Alternatively, if the sample has a decreased fluorescent signal compared to the positive control, or a fluorescent signal with an intensity equal to or less than that of the negative control, the subject is not suffering from an infectious disease.

[0116] It will be understood that the present invention extends to any nucleic acid or peptide that substantially comprises any amino acid or nucleic acid sequence of any of the sequences referred to herein (including variants or fragments thereof), or variants, derivatives or analogs thereof. The terms "substantially amino acid / nucleotide / peptide sequence", "variant" and "fragment" may refer to a sequence that has at least 40% sequence identity with any one of the amino acid / nucleotide / peptide sequences referred to herein, for example, 40% identity with a sequence identified as SEQ ID NO: 1-16, etc.

[0117] Also envisaged are amino acid / polynucleotide / polypeptide sequences having sequence identity to any of the mentioned sequences that is greater than 65%, more preferably greater than 70%, even more preferably greater than 75%, and even more preferably greater than 80% sequence identity. Preferably, the amino acid / polynucleotide / polypeptide sequence has at least 85% identity, more preferably at least 90% identity, even more preferably at least 92% identity, even more preferably at least 95% identity, even more preferably at least 97% identity, even more preferably at least 98% identity, and most preferably at least 99% identity to any of the sequences mentioned herein.

[0118] A skilled artisan will understand how to calculate the identity percentage between two amino acid / polynucleotide / polypeptide sequences. To calculate the identity percentage between two amino acid / polynucleotide / polypeptide sequences, the alignment of the two sequences must be made first, and then the sequence identity value must be calculated. The identity percentage of two sequences can take different values ​​depending on: (i) the method used to align sequences, such as ClustalW, BLAST, FASTA, Smith-Waterman (implemented in different programs), or structural alignment from 3D comparison; and (ii) the parameters used by the alignment method, such as local vs. global alignment, the pair score matrix used (such as BLOSUM62, PAM250, Gonnet, etc.), and gap penalties, such as function form and constants.

[0119] Once an alignment is made, there are many different ways to calculate the percentage of identity between two sequences. For example, the number of identities may be divided by: (i) the length of the shortest sequence; (ii) the length of the alignment; (iii) the average length of the sequences; (iv) the number of non-gap positions; or (v) the number of equivalent positions excluding overhangs. It will be further understood that the percentage of identity is also strongly length-dependent. Thus, the shorter the sequence pair, the higher the sequence identity that can be expected to occur by chance.

[0120] It will therefore be appreciated that accurate alignment of protein or DNA sequences is a complex process. The well-known multiple alignment program ClustalW (Thompson et al., 1994, Nucleic Acids Research, 22, 4673-4680; Thompson et al., 1997, Nucleic Acids Research, 24, 4876-4882) is the preferred method for creating multiple alignments of proteins or DNA according to the present invention. Suitable parameters for ClustalW may be as follows: for DNA alignments: gap opening penalty=15.0, gap extension penalty=6.66, and matrix=identity. for protein alignments: gap opening penalty=10.0, gap extension penalty=0.2, and matrix=Gonnet. for DNA and protein alignments: ENDGAP=-1, and GAPDIST=4. Those skilled in the art will be aware that these and other parameters may need to be varied for optimal sequence alignment.

[0121] Preferably, the calculation of the percentage identity between two amino acid / polynucleotide / polypeptide sequences can then be calculated from the alignment as (N / T)×100, where N is the number of positions where the sequences share identical residues, and T is the total number of positions compared, including gaps, including or excluding overhangs. Preferably, the overhangs are included in the calculation. Thus, the most preferred method of calculating the percentage identity between two sequences includes (i) generating a sequence alignment using the ClustalW program with appropriate parameter sets, for example, those set forth above, and (ii) inserting the values ​​of N and T into the following formula:- sequence identity=(N / T)×100.

[0122] Due to the degeneracy of the genetic code, it is clear that any nucleic acid sequence described herein may be altered or modified without substantially affecting the sequence of the protein encoded thereby, resulting in a functional variant thereof. Suitable nucleotide variants are those in which the sequence is altered by substitution of different codons that code for the same amino acid within the sequence, thus resulting in a silent (synonymous) change. Other suitable variants are those that have a homologous nucleotide sequence but contain all or a portion of the sequence, and are altered by substitution of different codons that code for amino acids with side chains of similar biophysical properties to the amino acid they replace, resulting in a conservative change. For example, small non-polar hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine. Large non-polar hydrophobic amino acids include phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include serine, threonine, cysteine, asparagine, and glutamine. Positively charged (basic) amino acids include lysine, arginine, and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Thus, it will be understood which amino acids may be replaced with amino acids having similar biophysical properties, and the skilled artisan will know the nucleotide sequences that code for these amino acids.

[0123] All of the features described in this specification (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined with any of the above embodiments in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive. EXAMPLES

[0124] material 3x NASBA buffer: 60mM Tris-HCl (pH8.0) (Invitrogen AM9855G), 36mM MgCl2 (AM9530G), 210mM ​​KCl (AM9640G), 0.15% DMSO (MP #191418), 6mM spermidine (SIGMA S2501-1G), 30mM DTT (SIGMA D9779-10G).

[0125] 5x Nucleotide (NT) Mix: 50 mM NTP (NEB N0450L), 25 mM dNTP (NEB N0447L).

[0126] Enzymes: Superscript III reverse transcriptase (200U / μl) (ThermoFisher #1808009), T3 RNA polymerase (50U / μl) (NEB #M0378S), RNase H (5U / μl) (NEB #M297S), BSA (SIGMA A7906-100G).

[0127] Transport buffer: 5M Guanidine-HCl (Life science 0118-500G), 40% Isopropanol (I9516_500ml), 0.05% Tween 20 (SIGMA P9416_50ml), 115mM Sodium Acetate (SIGMA S7988-100ml).

[0128] Lysis buffer: 20mM Tris-HCl (pH 8.0), 2mM EDTA, 0.5% Triton X-100. One-pot nested NASBA reaction

[0129] [Table 1]

[0130] [Table 2]

[0131] 5x NTP mix (Table 1) and 3x NASBA buffer (Table 2) are first prepared. Inactivation and detection of pathogens in saliva or nasal swab samples can be achieved by pretreating the samples by heating or mixing with transport buffer. For heat inactivation, saliva was spat into a 50 mL tube and 1 mL of saliva was transferred to a 1.5 mL tube. The tube was incubated in a thermomixer (Eppendorf) at 95°C for 2 min with shaking (1,500 rpm). After incubation, samples were kept on ice or stored below -20°C until use.

[0132] [Table 3]

[0133] [Table 4]

[0134] For preparation of transport buffer treatment, the saliva sample may be transferred to a 1.5 mL tube as described above, but then mixed with transport buffer in a 2:3 ratio (e.g., 400 μL saliva + 600 μL transport buffer). The mixture is further diluted with ddHO in a 1:5 ratio (e.g., 100 μL saliva / transport buffer mixture + 500 μL ddHO).

[0135] The reaction mix was prepared in a 1.5 mL tube as shown in Table 3 and dispensed into 200 μL PCR tubes or 96-well plates for a real-time PCR thermal cycler (Bio-Rad: CFX96).

[0136] The enzyme mix was as described in Table 4 and prepared in 1.5 mL tubes. After adding 8.5 μL of the enzyme mix to each tube or well, the samples are incubated at 37° C. for 30 minutes. Incubation steps used in conventional NASBA reactions: the reaction mix was preheated (annealed) at 65° C. for 2 minutes and then pre-incubated at 41° C. for 10 minutes. After this step, the enzyme mix was applied to the reaction mix and the measurement was started. Polyacrylamide gel electrophoresis (PAGE) 15% acrylamide supplemented with 8M urea was polymerized in a glass plate chamber. Primers and NASBA products were mixed with formamide loading dye (2x) (1x TBE, 90% formamide, 1mM EDTA) and loaded into the wells after a 20-minute pre-run. The run power was maintained at 24mW. Gels were stained with SYBR Gold (S11494) for 30 minutes and scanned with an image detector (Amersham Imager 680). method 1. Prepare 5x NT mix and 3x NASBA buffer as described in Tables 1 and 2. 2. Pretreat saliva samples for pathogen inactivation. 2.1 Heating Spit saliva into a sterile 50 ml Falcon tube and collect 1 ml of saliva into a 1.5 ml tube with a P1000 pipette. Place the tube in a thermomixer (Eppendorf) and incubate the tube at 95 °C / 1500 rpm for 2 min. After incubation, keep the saliva sample on ice until use. If not used immediately, the heated sample may be stored at -20 °C. 2.2 Transport buffer treatment Spit saliva into a sterile 50 ml Falcon tube, collect 400 μl of saliva and transfer with a P1000 pipette into 600 μl of transport buffer in a 1.5 ml tube. Due to the viscosity of saliva, cutting the end of a 1000 μl tip helps to collect a precise amount of saliva. The final ratio of saliva and transport buffer is 3 to 2, respectively. Collect 100 μl of saliva / transport buffer mixture and dilute it in 500 μl of water (ddH2O) in the tube. The relative ratio is 1 to 5, resulting in a final guanidine HCl concentration of 50 mM. The volume of transport buffer affects the nonspecific signal generated in the control, so the ratio of saliva and transport buffer can be optimized to reduce the nonspecific signal. 3. Preparation of reaction mix The reaction mix can be prepared as in Table 3. The P1 and P2 primer amounts affect the amplification and background signal levels as described in Figure 6 and can be optimized from 5 nM to 25 nM. The P1 and P2 primers create the first template but need to be completely consumed so as not to interfere with the second NASBA reaction with the P3 and P4 primers. Excessive P1 and P2 primers generally slow down the reaction and reduce the amplification level.

[0137] T3 RNA polymerase is sensitive to salt content, so NaOH-adjusted NTPs or dNTPs will affect the NABSA reaction. The relative volume of the 5x NT mix is ​​20% of the total reaction volume, and any errors in pH or salt level of the NT mix will significantly affect the outcome of the NABSA reaction.

[0138] Prepare enough reaction master mix for the experiment and dispense into 200 μl PCR tubes or 96-well plates for a real-time PCR thermal cycler (Bio-Rad: CFX96). 4. Preparation of enzyme mix The enzyme master mix is ​​prepared as per Table 4 in a 1.5 ml tube. 8.5 μl of enzyme mix is ​​added to the tube or well. The enzyme master mix can be stored at -20°C. Superscript III (ThermoFisher) is superior to Superscript IV (ThermoFisher), AMV reverse transcriptase (NEB), and WarmStart reverse transcriptase (NEB) (data not shown). RNase H activity levels affect NASBA reaction times and amplification levels, but RNase H does not appear to be stable upon long-term storage at -20°C. 5. NASBA reaction The reaction is carried out at 37° C. and is completed in 30 minutes. Once the reaction mixture is incubated at the reaction temperature, the enzyme loses activity, and reincubation of the mixture no longer amplifies new aptamer RNA. Incubation longer than 30 minutes generally increases non-specific signals, resulting in false positives. result EXAMPLES

[0139] Mango primer optimization Compared with other Mango arrays, the Mango III (A10U) array has longer (9-mer) complementary nucleotides at both ends, forming a double-stranded stem in register. However, longer primers may increase the chance of unexpected hybridization and enhance nonspecific amplification in NASBA assays. For this reason, we systematically determined the optimal length of Mango stem nucleotides. NASBA reactions were performed with a conventional incubation step, and the 5-mer stem primer set showed the best amplification ratio between the positive and negative template RNAs, as illustrated in Figure 2. EXAMPLES

[0140] Comparison of RNA polymerases T7, T3, and SP6 RNA polymerases are commonly used in molecular biology, and we tested the functionality of these enzymes in the NASBA assay. All experiments were performed in parallel, and the results in Figure 3 show that T3 polymerase amplifies the Mango signal more efficiently and rapidly than other RNA polymerases.

[0141] In addition to the detection by fluorometer, the transcription level was examined by PAGE detection as shown in Figure 4. Surprisingly, the transcription level by T3 was lower than that by other polymerases. The results suggest that at first glance, the general transcription level and the Mango RNA transcription level do not necessarily correlate, and T3 RNA polymerase seems to transcribe Mango RNA better from the synthesized template. On the other hand, T7 and SP6 seem to generate template DNA quickly, but a large amount of DNA template does not contribute to the generation of Mango RNA. In the gel detection, 25 nM primers were quickly consumed in the reaction. This result implies that additional primer sets can be mixed in the same tube for subsequent nested NASBA reactions. EXAMPLES

[0142] One-pot nested NASBA reaction To test the feasibility of a one-pot nested NASBA reaction, different combinations of T7 and T3 RNA polymerases and primer sets were mixed and the Mango signal was monitored over time as shown in Figure 5. For this purpose, mixing two different RNA polymerases did not improve the NASBA reaction or reduce the background signal generated in the control reaction. The nested Mango reaction only worked when the same RNA promoter sequence was used in the outer (P1) and inner primers (P3) and the same RNA polymerase was also used. In those cases, nested NASBA largely reduces nonspecific amplification. EXAMPLES

[0143] Optimization of primer amount We found that the established single-tube nested NASBA amplifies the target RNA. Then, the optimal primer concentration was identified by systematic titration of the primers. As expected, the Mango signal was efficiently amplified when the amount of the outer primer was lower than that of the inner primer, as illustrated in Figure 6A. On the other hand, excessive levels of primer (>100 nM) led to a decrease in the Mango signal amplification (Figure 6B).

[0144] Since the nested NASBA assay was successful in one tube, we applied this method with intact saliva samples. In COVID-19 testing, RNA isolation from patient samples is always a time-limiting step, and skipping this step would allow for a rapid diagnosis. Saliva completely precludes the amplification of the Mango signal. And we noticed that if intact saliva were applied directly, the viscosity and neutral pH (6.2-7.2) of saliva could affect the NASBA reaction (data not shown). We still expected that the use of intact saliva in the NASBA reaction would be possible, and therefore we tried to find the optimal NASBA conditions by investigating the contribution of other NASBA reaction components. EXAMPLES

[0145] Optimization of Tris-HCl amount In conventional NASBA buffer conditions, application of intact saliva resulted in a decrease in pH. We expected that increasing the amount of Tris-HCl would help maintain the pH value. However, increasing Tris-HCl reduced the amplification level of Mango RNA. To investigate the contribution of Tris-HCl level, the amount was titrated, and 20 mM Tris-HCl appeared to be optimal for the NASBA reaction, as illustrated in Figure 7. EXAMPLES

[0146] Contribution of pH Since the addition of saliva lowered the pH of the NASBA buffer, eliminating the NASBA response, we evaluated the contribution of pH to the NASBA response. Tris-HCl was maintained at 40 mM and pH levels were varied (pH 6.8-9.0). We tested both T7 and T3, and in both cases, pH 8.0 showed the best amplification levels and response rates (see Figure 8). EXAMPLES

[0147] Spermidine contribution In general, the amine group of spermidine neutralizes and stabilizes the phosphate backbone of nucleotides, and spermidine can improve the transcription activity of T7 and T3 RNA polymerases. Therefore, we tested spermidine in NASBA reactions. Spermidine 2 mM was used for conventional transcription. As illustrated in Figure 9, the presence of spermidine improves the amplification and response time in the conditional NASBA reaction. The results were also reproducible in Hepes-based buffers (data not shown). EXAMPLES

[0148] Intact saliva testing Optimized nested NASBA conditions (20 mM Tris-HCl, pH 8.0, and 2 mM spermidine) were tested for the detection of endogenous 18S ribosomal RNA occurring in intact saliva. For this purpose, endogenous r18S RNA was successfully detected, and titration experiments showed that around 10% saliva to total reaction volume was optimal for the NASBA assay conditions, as shown in Figure 10. EXAMPLES

[0149] SARS-CoV2 RNA detection The optimized conditions were applied to the detection of SARS-CoV2 RNA. 2 ng of viral RNA fragments were used as a positive control in the culture medium. Cultured SARS-CoV-2 virus was detected by transport buffer treatment, while no treatment led to no amplification (see Figure 11). 4% (1xe6 TCID50 / ml) of cultured virus was applied to the NASBA reaction. Due to the transport buffer treatment, the reaction mixture contains 50 mM guanidine-HCl at a final concentration. Both incubation steps of the NASBA reaction were performed under conventional conditions. Saliva was not included in this experiment. EXAMPLES

[0150] Optimization of the incubation process In the original protocol (Abdolahzader et al., 2019), an annealing step was included at 65°C for 10 min before applying the enzyme mix at 41°C. The annealing step generally consumes assay time because the annealing temperature and NASBA reaction temperature were different. To understand the impact of the annealing step on the NASBA reaction, we compared the Mango signal with and without the annealing step. As illustrated in Figure 12, the annealing step did not improve the single-tube nested NASBA reaction, confirming that the Mango-NASBA reaction can be performed at a single fixed temperature. We further attempted to determine the optimal temperature for the reaction, and found that approximately 37°C rather than 41°C showed a higher Mango signal. EXAMPLES

[0151] Possible incubation methods for the NASBA assay The optimum temperature of 37°C gave us the idea that we could use the human body to incubate the NASBA reaction mixture. To test this idea, we grabbed a vial of the reaction mixture by hand and wrapped it in a glove for 30 minutes. This experiment was successful and the Mango signal was detected as shown in Figure 13. EXAMPLES

[0152] Detection limit To optimize all buffer conditions, incubation methods, and temperatures, the amount of target RNA was titrated to determine the detection limit of this assay. The theoretical detection limit was determined by the curve coefficients calculated from the linear portion of the titration curve in the left panel of Figure 14. When the linear fit curve was adjusted for each coefficient value, the theoretical LOD indicated one copy per microliter. The LOD of RT-LAMP was reported to be 5-100 copies / µL for purified RNA, and therefore, the LOD of Mango-NASBA was found to be superior to competitive isothermal methods. EXAMPLES

[0153] Detection of other pathogens To demonstrate that the established NASBA method can detect other pathogens, the target RNA segment of influenza A virus was amplified from cultured influenza virus by the NASBA method (see Figure 15A). The experiment was performed using the Pepper RNA aptamer. In the ideal case, different pathogens are detected by different aptamers. In addition to influenza virus, mycoplasma in mammalian cells was also successfully detected (Figure 15B). EXAMPLES

[0154] Insights into primer annealing temperatures Optimization of the melting temperature (Tm) of primers may help efficient amplification of Mango signal. For this aspect, the effect of Tm was systematically analyzed using different Tm (48, 51, and 53 °C). Ideally, the outer NASBA reaction should be rapid and not disturb the inner NASBA reaction. For this purpose, when the primer Tm was all 51 °C, the signal difference between the presence and absence of template RNA was maximized. EXAMPLES

[0155] RNA detection in blood samples The possibility of RNA detection in blood samples was investigated. Blood samples were diluted with different buffers, and SARS-CoV2 template RNA was added to the samples. Although whole blood material excluded the amplification of the NASBA reaction (data not shown), the supernatant of blood material obtained after centrifugation at 21,000 × g for 5 min worked in the NASBA assay and amplified the Mango signal. It was found that the lysis buffer aided in the amplification in the reaction. Boiling the blood sample further improved the NASBA reaction, and endogenous 18S ribosomal RNA was successfully detected (see Figure 17). Since blood samples are commonly used in various types of clinical diagnosis, the results suggest that Mango-NASBA may be used in clinical diagnosis. Consideration Compared to other assays, the Mango NASBA assay of the claimed invention is a rapid isothermal reaction performed at 37°C, the amplified Mango signal is detectable in less than 15 minutes, and the reaction can be completed within 30 minutes. The optimal incubation temperature of the assay allows the human body to potentially be used as an incubation device. This suggests that no special heating equipment is required. While other isothermal methods require a specialized DNA polymerase (Bst DNA polymerase), the three enzymes in the NASBA reaction (RNA polymerase, reverse transcriptase, and RNaseH) are not unique and are commonly used in molecular biology research. These features suggest that the Mango NASBA method can reduce the cost per reaction and overcome resource limitations.

[0156] Moreover, this NASBA reaction is compatible with intact saliva and can detect target RNA in saliva without any pretreatment. Heating as well as transport buffer treatment of saliva samples can be compatible with this assay, and the LOD with saliva revealed about 1 copy / μL, which may be superior to the LOD of RT-LAMP. Since RT-LAMP has already been proven as a point-of-care COVID-19 diagnostic, it is expected that the established NASBA will also play a role in point-of-care COVID-19 diagnostics and other pathogen diagnostics. Therefore, this assay can be easily adapted to detect multiple pathogens simultaneously and can be utilized in point-of-care diagnostics. conclusion We established a rapid one-pot pathogen detection method by optimizing the Mango RNA aptamer and NASBA reaction. Although several previous studies have already attempted to amplify target RNA by NASBA, the amplification reaction was extremely slow and suffered from high background signals occurring in the control. Thus, the use of the NASBA method has been limited, especially in the field of pathogen detection. However, we evaluated the rationality of the NASBA reaction steps and established a simple and rapid isothermal one-tube method for pathogen detection. Therefore, this novel NASBA approach provides a new avenue for nucleotide-based rapid pathogen detection.

Claims

1. 1. A method for detecting a target nucleic acid sequence in a sample obtained from a subject, comprising: - said sample, (a) one or more primers, at least one of the primers comprising a fluorescent molecule; (b) one or more polymerases; and (c) a plurality of deoxynucleotide triphosphates (dNTPs) and / or nucleotide triphosphates (NTPs); amplifying the target nucleic acid sequence by nucleic acid sequence-based amplification (NASBA), comprising contacting the target nucleic acid sequence with - detecting said target nucleic acid sequence, wherein a fluorescent signal indicates the presence of said target nucleic acid sequence in said sample; Including, The amplifying step is carried out at a fixed temperature of 30 to 40°C, and the amplifying step is carried out under the following conditions: (i) contacting the sample with 1 to 59 mM Tris HCl; (ii) contacting the sample with spermidine; (iii) a pH of 6.8 to 9.0; and / or (iv) the polymerase is T3 RNA polymerase and A method that is performed in one step and / or in a single pot or vessel and does not involve extracting or purifying said nucleic acid from said sample.

2. 1. A method for diagnosing or prognosing an infectious disease in a subject, comprising detecting a target nucleic acid sequence in a sample obtained from the subject, - said sample, (a) one or more primers, at least one of the primers comprising a fluorescent molecule; (b) one or more polymerases; and (c) a plurality of deoxynucleotide triphosphates (dNTPs) and / or nucleotide triphosphates (NTPs); amplifying the target nucleic acid sequence by nucleic acid sequence-based amplification (NASBA), comprising contacting the target nucleic acid sequence with - detecting the target nucleic acid sequence, wherein a fluorescent signal indicates that the subject is suffering from an infection or has a negative prognosis; Including, The amplifying step is carried out at a fixed temperature of 30 to 40°C, and the amplifying step is carried out under the following conditions: (i) contacting the sample with 1 to 59 mM Tris HCl; (ii) contacting the sample with spermidine; (iii) a pH of 6.8 to 9.0; and / or (iv) the polymerase is T3 RNA polymerase and A method that is performed in one step and / or in a single pot or vessel and does not involve extracting or purifying said nucleic acid from said sample.

3. 1. A kit for detecting a target nucleic acid sequence in a sample obtained from a subject, comprising: - reagents for amplifying said target nucleic acid sequence by nucleic acid sequence-based amplification (NASBA), (a) one or more primers, at least one of the primers comprising a fluorescent molecule; (b) one or more polymerases; and (c) a plurality of deoxynucleotide triphosphates (dNTPs) and / or nucleotide triphosphates (NTPs); a reagent comprising: - means for detecting said target nucleic acid sequence, wherein a fluorescent signal indicates the presence of said target nucleic acid sequence in said sample; Including, Used at a fixed temperature of 30-40°C: (i) 1-59mM Tris HCl; (ii) spermidine; (iii) a pH of 6.8 to 9.0; and / or (iv) the polymerase is T3 RNA polymerase may include configured to detect the target nucleic acid sequence in one step and / or in a single pot or vessel; does not include means for extracting or purifying nucleic acids from said sample; and At least the conditions: a) (i) and (ii); (i) and (iii); (i) and (iv); (ii) and (iii); (ii) and (iv); or (iii) and (iv); b) (i), (ii) and (iii); (i), (ii) and (iv); (i), (iii) and (iv); or (ii), (iii) and (iv); or c) A kit comprising (i), (ii), (iii) and (iv).

4. At least the conditions: a) (i) and (ii); (i) and (iii); (i) and (iv); (ii) and (iii); (ii) and (iv); or (iii) and (iv) b) (i), (ii) and (iii); (i), (ii) and (iv); (i), (iii) and (iv); or (ii), (iii) and (iv); or c) The method of claim 1 or 2, comprising (i), (ii), (iii) and (iv).

5. 4. The method or kit of claim 1 or 3, wherein the one or more primers comprise a first and a second primer that form a first primer pair.

6. 4. The method or kit of claim 1 or 3, wherein the one or more primers comprise a first, second, third and fourth primer, the first and second primers forming a first primer pair and the second and third primers forming a second primer pair.

7. the fluorescent molecule may be a molecular beacon probe or a fluorogenic aptamer, and the fluorogenic aptamer may be selected from the group of aptamers consisting of Mango, Pepper, Peach, Broccoli, Corn, Spinach, Spinach2, Carrot, Radish, RT aptamer, hemin-binding G-quadruplex DNA and RNA aptamer, and malachite green-binding aptamer; The fluorogenic aptamer may be a Mango RNA aptamer, and the Mango RNA aptamer may be a Mango II, Mango III, or Mango IV RNA aptamer; 4. The method or kit of claim 1 or 3, wherein the method may comprise contacting the sample with a thiazole orange-based ligand (To1-biotin) and / or the kit may comprise a thiazole orange-based ligand (To1-biotin).

8. The method or kit according to claim 1 or 3, wherein the primer comprising the fluorescent molecule comprises a terminal stem structure of 2 bp to 8 bp, or 3 bp to 7 bp, or 4 bp to 6 bp, and preferably the primer comprising the fluorescent molecule comprises a terminal stem structure of 5 bp.

9. 7. The method or kit of claim 6, wherein the concentrations of the first and second primers (the first primer pair) are lower than the concentrations of the third and fourth primers (the second primer pair), and the concentrations of the first and second primers may be 1 to 50 nM, 5 to 45 nM, 10 to 40 nM, 15 to 35 nM, or 20 to 30 nM, and / or the concentrations of the third and fourth primers may be 10 to 150 nM, 20 to 140 nM, 30 to 130 nM, 40 to 120 nM, 50 to 110 nM, 60 to 100 nM, or 70 to 90 nM.

10. 4. The method or kit of claim 1 or 3, wherein the melting temperature of the one or more primers is 48-54°C, 49-53°C, or 50-52°C, preferably the melting temperature of the one or more primers is 51°C.

11. 4. The method or kit of claim 1 or 3, wherein the target nucleic acid sequence is: (i) a DNA or RNA sequence, wherein the target nucleic acid sequence may be selected from chromosomal DNA, mitochondrial DNA, messenger RNA, transfer RNA, ribosomal RNA, small nuclear RNA, microRNA, small interfering RNA, viral RNA, or extrachromosomal DNA; and / or (ii) derived from a virus, bacterium, mycoplasma, fungus, animal, plant, algae, parasite, or protozoan, preferably derived from a virus or bacterium.

12. 4. The method or kit of claim 1 or 3, wherein the plurality of deoxynucleotide triphosphates (dNTPs) are selected from the group consisting of dATP, dGTP, dCTP and / or dTTP, and / or the plurality of nucleotide triphosphates (NTPs) are selected from the group consisting of ATP, GTP, CTP and / or UTP.

13. (i) the amplifying step and / or the kit comprises contacting the sample with 1 to 59 mM Tris HCl, 2 to 55 mM Tris HCl, 4 to 50 mM Tris HCl, 6 to 45 mM Tris HCl, 8 to 40 mM Tris HCl, 10 to 35 mM Tris HCl, 12 to 30 mM Tris HCl, 14 to 25 mM Tris HCl, or 16 to 20 mM Tris HCl; (ii) the amplifying step and / or the kit comprises a pH of 6.8 to 9.0, 7.0 to 8.8, 7.2 to 8.6, 7.4 to 8.4, or 7.6 to 8.2; (iii) the amplifying step and / or the kit comprises contacting the sample with 1 to 20 mM spermidine, 1.2 to 15 mM spermidine, 1.4 to 10 mM spermidine, 1.6 to 5 mM spermidine, 1.8 to 4 mM spermidine, or 2 to 3 mM spermidine; and / or (iv) The method or kit according to claim 1 or 3, wherein the amplifying step and / or kit is carried out at a fixed temperature of 34 to 39°C, or 35 to 38°C. Claim 14: (i) the sample comprises tissue, blood, plasma, serum, cerebrospinal fluid, urine, sweat, saliva, sputum, tears, breast aspirate, prostatic fluid, semen, vaginal fluid, stool, cervical scraping, amniotic fluid, ocular fluid, mucous membrane, exhaled breath, animal tissue, cell lysate, tumor tissue, hair, skin, oral scraping, nail, bone marrow, cartilage, prions, bone meal, earwax, or a combination thereof; and / or (ii) The method or kit according to claim 1 or 3, wherein the sample is a saliva sample and the reaction mixture may comprise 10% saliva (v / v).

15. the method may further comprise quantifying the target nucleic acid, and / or the kit may comprise means for quantifying the target nucleic acid, wherein the quantification comprises measuring the intensity of the fluorescent signal; 4. The method or kit of claim 1 or 3, wherein the method may further comprise comparing the fluorescent signal with the fluorescent signal of a positive and / or negative control, and / or the kit may comprise a positive and / or negative control.

Images