Hypoimmunogenic stem cells, hypoimmunogenic cells differentiated or derived from stem cells, and method for producing same

Abstract

The present invention provides hypoimmunogenic stem cells that can suppress immune rejection upon transplantation by increasing the expression or activity level of immune activity suppressing factors, hypoimmunogenic cells differentiated or derived from stem cells, a method for producing the same, and a cell therapy using the same.

Description

[Technical field]

[0001] The present invention provides hypoimmunogenic stem cells that can suppress immune rejection upon transplantation by increasing the expression or activity level of immune activity suppressing factors, hypoimmunogenic cells differentiated or derived from stem cells, a method for producing the same, and a cell therapy using the same. [Background technology]

[0002] Induced pluripotent stem cells (hereinafter referred to as "iPSCs") are somatic cells isolated from the human body that are reverse-differentiated through artificial stimulation into pluripotent stem cells that can differentiate into any cell in our body. Using this pluripotency, iPSCs are attracting attention as a regenerative cell therapy that can regenerate damaged cells, tissues, and organs.

[0003] When artificial pluripotent stem cells are created from the patient's own cells and differentiated into the necessary cells, organoids, organs, etc. for use in the patient's own treatment, there is little immune rejection, so they can be used for autologous cell therapy. However, in the case of such custom-made stem cell therapy, there are limitations to its commercialization, as it requires time and manpower to produce cells and tissues for regenerative therapy.

[0004] For this reason, allogenic cell therapy agents derived from other people rather than autologous cell therapy agents made from the patient's own cells could be an alternative. However, there is a risk that these agents may be recognized by immune cells such as NK cells and T cells, which are responsible for important immune mechanisms in the human body, causing an immune rejection reaction.

[0005] Natural killer cells (NK cells) bind to their ligands expressed on abnormal cells such as cancer cells and virus-infected cells through various activating and inhibitory receptors on the cell surface, and their activity is regulated by the balance between the signals induced by these. In addition, the immune system has a suppression mechanism called immune checkpoint to prevent T cells, which can directly attack cells, from attacking normal cells by being overactivated. Activation of T cells begins when the T cell receptor (TCR) on the cell surface recognizes an antigen bound to the MHC molecule of an antigen presenting cell (APC). After recognizing the antigen through TCR-MHC binding, CD80, CD40, etc. expressed on the APC simultaneously bind to the ligands on the T cell surface, such as CD28 and CD40L, resulting in activation of the T cell. On the other hand, immune checkpoint receptors on T cells, such as CTLA-4 and PD-1, send inhibitory signals that deactivate T cells by binding with immune checkpoint ligands, such as CD80, CD86, and PD-L1, on abnormal cells, including cancer cells.

[0006] Therefore, genetic manipulation of ligands that interact with such immune activation- and inhibition-related receptors in vivo may be a preferable alternative to avoid immune rejection.

[0007] (Patent Document 1) Japanese Patent Publication No. 2018-515139

[0008] (Patent Document 2) Republic of Korea Patent Publication No. 10-2020-0120939

[0009] (Non-Patent Document 1) Nayoung Kim, HunSik Kim, Front.Immunol., 10 September 2018, Targeting Checkpoint Receptors and Molecules for Therapeutic Modulation of Natural Killer Cells

[0010] (Non-Patent Document 2) Rupal S. Bhatt et al., November 23, 2020, Cancer Immunology Research.KIR3DL3 is an inhibitory receptor for HHLA2 that mediates an alternative immunoinhibitory pathway to PD1 Summary of the Invention [Problem to be solved by the invention]

[0011] The objective of the present invention is to provide low immunogenic stem cells capable of suppressing immune rejection during cell, tissue, or organ transplantation, low immunogenic cells differentiated or derived from stem cells, a method for producing the same, and a cell therapy agent utilizing the same. [Means for solving the problem]

[0012] To achieve the above object, the present invention provides an artificially engineered stem cell having an artificially engineered gene in which a gene encoding one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 is inserted into the stem cell genome.

[0013] The present invention also provides an artificially engineered cell differentiated or derived from a stem cell, which has an artificially engineered gene in which a gene encoding one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 is inserted into the genome of the cell differentiated or derived from the stem cell.

[0014] The present invention also provides cells differentiated or derived from the artificially engineered stem cells, which have increased expression or activity of one or more immune activity suppressor factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2.

[0015] The present invention also provides a composition for producing a hypoimmunogenic stem cell or a hypoimmunogenic cell differentiated or derived from a stem cell, comprising a guide nucleic acid or a nucleic acid encoding the same that can target a target sequence located in the genome of a stem cell or a cell differentiated or derived from a stem cell; a gene donor or a nucleic acid encoding the same that encodes one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2, and an editor protein or a nucleic acid encoding the same.

[0016] The present invention also relates to a method for producing a low immunogenic cell, comprising the steps of: introducing into an isolated stem cell or a cell differentiated or derived from the isolated stem cell a composition for producing the low immunogenic cell or a cell differentiated or derived from the stem cell; and

[0017] knocking in a gene encoding one or more immune activation inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 into the genome of the stem cell or a cell differentiated or derived from the isolated stem cell, so as to increase the expression or activity of one or more immune activation inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 in the stem cell or a cell differentiated or derived from the isolated stem cell;

[0018] The present invention provides a method for producing hypoimmunogenic stem cells or hypoimmunogenic cells differentiated or derived from stem cells, comprising the steps of:

[0019] The present invention also provides a composition for cell transplantation or biological tissue regeneration, which contains the artificially engineered stem cells as an active ingredient.

[0020] The present invention also provides a composition for cell transplantation or tissue regeneration, which contains, as an active ingredient, artificially engineered stem cells differentiated or derived from the stem cells.

[0021] The present invention also provides a composition for cell transplantation or biological tissue regeneration, comprising as an active ingredient cells that are differentiated or derived from the artificially engineered stem cells and have increased expression or activity of one or more immune activation inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2. Effect of the Invention

[0022] The stem cells of the present invention or cells differentiated or derived from the stem cells exhibit low immunogenicity that avoids immune rejection during cell, tissue, or organ transplantation, and can therefore be differentiated into various cells and used as cell therapeutic agents that do not cause immune rejection in autologous or allogeneic environments. [Brief description of the drawings]

[0023] [Figure 1]This is a schematic diagram of the insertion of three genes, LGALS9 (Gal-9), CLEC4G (LSECtin), and HHLA2, between the left and right sides of the homology arms based on a specific site in AAVS1, which is one of the safe harbor sites. [Diagram 2] This figure shows the results of PCR performed on cellular DNA to select multiple single clones from iPSCs in which three of the genes prepared in Example 1 were knocked in (KI), and the results of Sanger sequencing performed using the PCR products obtained above. [Diagram 3] 1 shows the results of confirming changes in mRNA levels for the three genes knocked in in Example 1 using a real-time PCR method. [Figure 4] 1 is a graph showing the results of confirming the copy number of a knock-in (KI) gene using a ddPCR method in Experimental Example 3. [Diagram 5] 1 shows the results of measuring the HHLA2 expression level of the AAVS1-ALC3#11 clone prepared in Example 1 by flow cytometry in Experimental Example 4. [Figure 6] Fig. 6(a) shows the results of flow cytometry using anti-CD31 antibody after wild-type (WT) iPSCs and iPSCs with three genes knocked in (KI) prepared in Example 1 were differentiated into endothelial cells (ECs). Fig. 6(b) shows the results of confirming that HLA-ABC antigens appear on the surface of endothelial cells (ECs) differentiated from iPSCs. [Figure 7][Fig. 7(a)] Graph showing the results of confirming cytotoxicity when K562 cells, endothelial cells differentiated from wild-type (WT) iPSCs (WT-iPSC_EC), and endothelial cells differentiated from iPSCs with three genes knocked in (KI) prepared in Example 1 (KI-iPSC EC) were cultured at various ratios with NK cells as effector cells. [Fig. 7(b)] Graph showing the results of evaluating NK cell cytotoxicity in endothelial cells differentiated from wild-type (WT) iPSCs expressing 98% or more of HLA-ABC (WT-iPSC_EC, Fig. 6(b)) and endothelial cells differentiated from iPSCs with three genes knocked in (KI) prepared in Example 1 (KI-iPSC EC). [Figure 8] FIG. 1 shows an example of a lentivirus for inserting each of the gene sequences of LGALS9(Gal-9) / CLEC4G(LSECtin) / HHLA-2 (SEQ ID NO: 23), LGALS9(Gal-9) (SEQ ID NO: 24), CLEC4G(LSECtin) (SEQ ID NO: 25), LGALS9(Gal-9) / CLEC4G(LSECtin) (SEQ ID NO: 26), and LGALS9(Gal-9) / CLEC4G(LSECtin) / PD-L1 (SEQ ID NO: 27). [Figure 9] FIG. 9(a) is a graph showing the results of confirming cytotoxicity when K562 cells, endothelial cells differentiated from wild-type (WT) iPSCs (WT-iPSC_EC), endothelial cells differentiated from iPSCs into which the Gal-9 gene of SEQ ID NO: 24 has been inserted (Gal-9_EC), endothelial cells differentiated from iPSCs into which the CLEC4G gene of SEQ ID NO: 25 has been inserted (CLEC4G_EC), endothelial cells differentiated from iPSCs into which the Gal-9 / CLEC4G gene of SEQ ID NO: 26 has been inserted (Gal-9+CLEC4G_EC), and endothelial cells differentiated from iPSCs into which the Gal-9 / CLEC4G / PD-L1 gene of SEQ ID NO: 27 has been inserted (Gal-9+CLEC4G+ PD-L1_EC) were cultured with effector NK cells at various ratios. [Figure 9(b)] This is a graph showing the results of measuring 7-AAD+ cells when effector cells (NK cells):target cells (EC, endothelial cells) were co-cultured at a 1:1 ratio. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] The present invention will be described in detail below.

[0025] As used herein, the term "stem cell" refers to a broad concept that collectively refers to undifferentiated cells that have the ability to differentiate into various types of body tissue cells, i.e., stemness. In this regard, the stem cells may be induced pluripotent stem cells, embryonic stem cells, somatic cell nuclear transfer (PSC) or adult stem cells. In addition, the cells may be derived from humans, but are not limited thereto.

[0026] As used herein, "differentiation" refers to the phenomenon in which cell structure and function become specialized while cells divide and grow to form an entire organism. In other words, it refers to the process in which cells, tissues, etc. of an organism change to a form and function suited to perform the role that each cell or tissue is assigned to. For example, differentiation can include the process in which pluripotent stem cells change to ectoderm (cerebral cortex, midbrain, hypothalamus, etc.), mesoderm (yolk sac, etc.), and endoderm cells, as well as the process in which hematopoietic stem cells change to red blood cells, white blood cells, platelets, etc., i.e., precursor cells expressing specific differentiation traits.

[0027] As used herein, "increased expression" refers to a level of expression of a protein that is higher than the expression level measured in a wild-type cell. The increase may be about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 50% or more, about 60% or more, about 70% or more, or about 100% or more compared to cells without a genetic mutation or wild-type cells. The increase in expression may be caused by an increase in gene copy number or increased transcription or translation.

[0028] As used herein, the term "increase in activity" or "increased activity" may refer to a detectable increase in protein or enzyme activity. "Increase in activity" or "increased activity" refers to a higher level of protein or enzyme activity compared to a given parent cell or wild-type cell.

[0029] As used herein, the term "immunoactivity inhibitor" refers to a ligand that can specifically bind to an immune checkpoint receptor or an inhibitory receptor expressed in immune cells such as T cells and NK cells, thereby suppressing immune cell activity.

[0030] As used herein, "low immunogenicity" means that the cells, when transplanted into a different individual, exhibit reduced or eliminated immune rejection compared to the wild type. The immune rejection can be reduced by 20% or more, about 30% or more, about 40% or more, about 50% or more, about 55% or more, about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, or about 100%.

[0031] The expression or activity level of an immunosuppressive factor is increased, thereby providing a hypoimmunogenic stem cell or a hypoimmunogenic cell differentiated or derived from the stem cell, which can suppress immune rejection upon transplantation.

[0032] The stem cells have increased expression or activity of ligands that bind to immune checkpoint receptors that suppress the activation of immune cells such as T cells and NK cells, and expression or activity of ligands that bind to inhibitory receptors, so that when used as a cell therapy in an autologous or allogeneic environment, immune rejection reactions can be suppressed and a state of immune tolerance can be achieved.

[0033] According to one embodiment of the present invention, the stem cells or cells differentiated or derived from the stem cells may have increased expression or activity of one or more immune activation inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, compared to wild-type stem cells or wild-type cells.

[0034] Galectin-9 (Gal-9) or LGALS9 is a known ligand for TIM-3 (T-cell immunoglobulin and mucin domain protein 3) and is known by many different names, such as lectin, galactoside-binding, soluble, 9; tumor antigen HOM-HD-21; ecalectin; Gal-9; urate transporter / channel protein; LGALS9A; and HUAT. TIM-3 is an immunosuppressive receptor expressed on T cells, regulatory T cells, B cells, dendritic cells, NK cells, and macrophages, and when it binds to the ligand for TIM-3, galectin-9, it suppresses the activity of T cells, NK cells, and other immune cells.

[0035] LSECtin (liver and lymph node sinusoidal endothelial cell C-type lectin) is a ligand for LAG-3 (lymphocyte activation gene 3). LAG-3 is one of many immune checkpoint proteins such as TIM3, CTLA-4, PD-1, and PD-L1, and is expressed in helper T cells, cytotoxic T cells, regulatory T cells, some NK cells, B cells, etc. Immune evasion occurs when immune checkpoint proteins located on the surface of T cells bind to specific ligands present on abnormal cells, neutralizing T cells and NK cells.

[0036] PD-L1 (Programmed cell death ligand-1) is a transmembrane protein present in normal cells, and binds to the programmed cell death protein 1 (PD-1) of T cells as a ligand for PD-1, inducing immune attack evasion. Meanwhile, in order for T cells to be activated, a secondary signal stimulus (co-stimulation) is required in addition to the primary signal stimulus of the T cell receptor and antigen. At this time, if neither of the two signals is present, the T cell will be inactivated. PD-1 (programmed death-1) is a secondary signal stimulator (immune check point or immune modulator) that regulates the secondary signal activity of T cells, and by binding to PD-L1 (programmed cell death ligand 1) or B7.1 (CD80) expressed on the cell surface of activated T cells (CD8 and / or CD4) and dendritic cells, it can suppress the proliferation of T cells and suppress the expression of cytokines, thereby suppressing the function of T cells.

[0037] HHLA2 (human endogenous retrovirus-H long terminal repeat associating protein 2) is a newly identified B7 family member that regulates T cell function. HHLA2 has been identified as a specific ligand for TMIGD2 (transmembrane and immunoglobulin domain containing 2), and HHLA2 / TMIGD2 interaction selectively co-stimulates human T cell growth and cytokine production through an AKT-dependent signaling cascade. HHLA2 also binds to the receptor KIR3DL3 (killer cell immunoglobulin-like receptor, three immunoglobulin domains and long cytoplasmic tail 3) on T and NK cells, and inhibits T cell activation.

[0038] According to one embodiment of the present invention, the stem cells are artificially engineered stem cells having an artificially engineered gene in which a gene encoding one or more immune activity inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 is inserted into the stem cell genome.

[0039] According to one embodiment of the present invention, the cells differentiated or derived from stem cells are artificially engineered cells differentiated or derived from stem cells, having an artificially engineered gene in which a gene encoding one or more immune activity inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 is inserted into the genome of a cell differentiated or derived from a stem cell.

[0040] According to one embodiment of the present invention, the cells differentiated or derived from the stem cells are one selected from the group consisting of human vascular endothelial cells, pancreatic cells, bone cells, chondrocytes, cardiac muscle cells, muscle cells, epidermal cells, fibroblasts, nerve cells, hepatic cells, intestinal cells, gastric cells, skin cells, adipocytes, blood cells, immune cells, cell spheroids, and organoids.

[0041] According to one embodiment of the present invention, the gene sequence of the artificially engineered stem cells is different from the gene sequence of the wild-type stem cells, and compared to the wild-type stem cells, the expression or activity of genes encoding one or more immune activity inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, or one or more immune activity inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, may be increased.

[0042] According to one embodiment of the present invention, the genetic sequence of the artificially engineered cells differentiated or derived from the stem cells is different from the genetic sequence of the wild-type cells, and compared to the wild-type stem cells, the expression or activity of genes encoding one or more immune activity inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, or one or more immune activity inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, may be increased.

[0043] As used herein, "increased expression or activity" can mean that a protein is expressed at a higher level compared to a wild-type stem cell or cell, or that if the protein is expressed, its activity is higher.

[0044] That is, in stem cells or cells differentiated or derived from stem cells, the expression or activity of one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 may be increased by about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 55% or more, about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, or about 100% compared to the expression or activity of wild-type stem cells or wild-type cells.

[0045] In the present invention, artificial modification of a gene nucleic acid sequence can be achieved through modification of the nucleic acids that constitute the gene. This can be achieved by mutating, substituting or deleting a part or the whole of the gene, or by inserting one or more bases into the gene, and can be achieved using gene scissors technology. For example, it can be achieved by non-homologous end joining (NHEJ) or homology directed repair (HDR) mechanisms.

[0046] In one embodiment of the present invention, the stem cells or cells differentiated or derived from the stem cells may have genes encoding one or more immune activity inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 knocked in.

[0047] As used herein, "knock-in" refers to the insertion of a specific nucleic acid or gene into a target gene or nucleic acid in an animal genome in a cell.

[0048] Cells have intrinsic mechanisms to repair any double-stranded or single-stranded DNA damage. DNA double-strand break (DSB) repair mechanisms can be classified into non-homologous end joining (NHEJ) and homologous recombination (HR).

[0049] Homology directed repair (HDR) is a method that uses a homologous sequence as a template to repair or repair damaged genes or nucleic acids, and is a method that can correct without errors. Generally, to repair or repair damaged DNA, information from a complementary nucleotide sequence that has not been altered or information from a sister chromatid is used to repair or repair the damaged DNA.

[0050] For the repair or restoration of damaged DNA using HDR, instead of using the complementary nucleotide sequence or sister chromatid that the cell originally has, an artificially synthesized DNA template using complementary nucleotide sequence or homologous nucleotide sequence information, i.e., a nucleic acid template containing a complementary nucleotide sequence or a homologous nucleotide sequence, can be provided to the cell to repair or restore the damaged DNA. In this case, when the nucleic acid template is additionally provided with a nucleic acid sequence or a nucleic acid fragment to repair or restore the damaged DNA, the additionally provided nucleic acid sequence or nucleic acid fragment can be knocked in to the damaged DNA.

[0051] As an example, the CRISPR complex can be used to cut the double or single strand of a target gene or nucleic acid, and a nucleic acid template containing a nucleotide sequence complementary to the nucleotide sequence adjacent to the cut site can be provided to a cell to repair or repair the cut nucleotide sequence of the target gene or nucleic acid using the HDR method. Homology-independent targeted integration (HITI) allows the insertion of a transgene in proliferating and non-proliferating cells (Suzuki et al., Nature, 2016, 540(7631):144-149). HITI uses CRISPR / Cas9 to target an insertion site and provides a donor containing a specific nucleotide sequence so that the specific nucleotide sequence of the donor can be inserted between the cut ends of the target DNA through non-homologous end joining (NHEJ).

[0052] As an example, a target gene can be cut using CRISPR / Cas9 to knock-in a donor containing a specific nucleotide sequence using the HITI method.

[0053] In one embodiment of the present invention, a gene encoding one or more immune activation inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 may be inserted into a safe harbor site in the genome of a stem cell or a cell differentiated or derived from a stem cell, but is not limited thereto. In one embodiment, the gene encoding the immune activation inhibitor may be inserted into the AAVS1 locus, CCR5 locus, CLYBL locus, ROSA26 locus, and SHS231 locus (chromosome 4 "safe harbor site" 231) in the genome.

[0054] The present invention provides a method for producing hypoimmunogenic stem cells or hypoimmunogenic cells differentiated or derived from stem cells, comprising increasing the expression or activity of one or more immune activity suppressors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 in the stem cells or cells differentiated or derived from the stem cells.

[0055] The expression or activity of the immune activity suppressor / protein can be increased by artificially modifying the corresponding gene, for example, by using gene scissors technology.

[0056] As an example, the gene scissors technology can be, but is not limited to, TALEN (transcription activator-like effector nuclease) in which a TAL effector (transcription activator-like effector or TALE) domain is fused with a cleavage domain, zinc-finger nuclease, or the CRISPR enzyme system derived from CRISPR, a microbial immune system.

[0057] "TALEN" refers to a nuclease that can recognize and cleave a target region of DNA. The TALEN is a fusion protein that includes a TALE domain and a nucleotide cleavage domain. TAL effectors are known proteins secreted through these types of secretion systems when Xanthomonas bacteria infect various plant species. The proteins can bind to promoter sequences in the host plant and activate the expression of plant genes that aid in bacterial infection. The proteins recognize plant DNA sequences through a central repeat domain that is composed of a variable number of amino acid repeats up to 34. A "TALE domain" or "TALE" is a polypeptide that includes one or more TALE repeat domains / units. This repeat domain is involved in the binding of the TALE to its cognate target DNA sequence. A single "repeat unit" is typically 33-35 amino acids in length and shows at least some sequence homology to other TALE repeat sequences in naturally occurring TALE proteins. The TALE domain is a protein domain that binds to nucleotides in a sequence-specific manner through one or more TALE-repeat modules.

[0058] The TALE DNA binding domain comprises at least one TALE-repeat module, more specifically, but not limited to, 1-30 TALE-repeat modules. The TALE DNA binding domain may comprise half of a TALE-repeat module. The entire contents of International Publication WO2012 / 093833 or US Publication No. 2013-0217131 relating to the TALE are incorporated herein by reference.

[0059] A "zinc finger DNA binding protein" (or binding domain) is a protein, or a domain within a larger protein, that binds to DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through the coordination of a zinc ion. The term "zinc finger DNA binding protein" is commonly abbreviated as zinc finger protein or ZFP.

[0060] The zinc-finger nuclease (ZFN) comprises a zinc finger protein engineered to bind to a target site in a target gene and a cleavage domain or cleavage half-domain. The ZFN can be an artificial restriction enzyme comprising a zinc finger DNA binding domain and a DNA cleavage domain, where the zinc finger DNA binding domain can be engineered to bind to a selected sequence. For example, Beerli et al. (2002) Nature Biotechnol. 20:135-141; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr. Opin. Struct. Biol. 10:411-416 may be incorporated by reference herein. Compared to naturally occurring zinc finger proteins, engineered zinc finger binding domains can have novel binding specificities. Engineering methods include, but are not limited to, rational design and diverse types of selection. Rational design can involve, for example, the use of a database that includes triplex (or quadruple) nucleotide sequences and individual zinc finger amino acid sequences, where each triplex or quadruple nucleotide sequence is associated with one or more sequences of zinc fingers that bind to that particular triplex or quadruple sequence.

[0061] The selection of target genes and target sequences for ZFNs, and the design and construction of fusion proteins or polynucleotides encoding the same are well known to those of skill in the art and are described in detail in U.S. Patents 7,888,121 and 8,409,861, the entireties of which are incorporated herein by reference. As disclosed in these references and others in the art, zinc finger domains and / or multi-finger zinc finger proteins can be linked together by any suitable linker sequence, including linkers having a length of 5 or more amino acids.

[0062] Examples of linker sequences of six or more amino acids in length are provided in U.S. Patents 6,479,626; 6,903,185; and 7,153,949. The proteins described herein can include any combination of suitable linkers between each zinc finger of the protein.

[0063] Nucleases such as the ZFNs comprise a cleavage domain and / or a cleavage half-domain that is the active portion of the nuclease. By way of example, the cleavage domain can be a cleavage domain derived from a different nuclease than the zinc finger DNA binding domain, i.e., a heterologous cleavage domain.

[0064] As yet another example, the cleavage half-domain can be a fusion protein derived from any nuclease or portion thereof that requires dimerization for cleavage activity. When a fusion protein contains a cleavage half-domain, typically two fusion proteins will be required for cleavage. Alternatively, a single protein containing two cleavage half-domains can be utilized. The two cleavage half-domains can be derived from the same endonuclease (or functional fragments thereof), or each cleavage half-domain can be derived from a different endonuclease (or functional fragments thereof). Additionally, the target sites of the two fusion proteins are preferably positioned in a relationship such that binding of the two fusion proteins to their respective target sites positions the cleavage half-domains in a spatially oriented relationship relative to one another such that the cleavage half-domains can form a functional cleavage domain, e.g., by dimerization.

[0065] The "CRISPR-enzyme system" is composed of a guide nucleic acid and / or an editor protein. "Guide nucleic acid" refers to a nucleic acid that can recognize a target nucleic acid, a target gene, or a target chromosome and interact with an editor protein, where the guide nucleic acid can form a complementary bond with a portion of a nucleotide in the target nucleic acid, a target gene, or a target chromosome. The guide nucleic acid may be a target DNA-specific guide RNA, a DNA encoding the guide RNA, or a mixed form of DNA / RNA.

[0066] The guide nucleic acid may be a guide RNA. A "guide RNA" may be in vitro transcribed, in particular, but not limited to, an oligonucleotide duplex, or transcribed from a plasmid template.

[0067] The design and construction of the guide RNA are known to those skilled in the art and are described in detail in Korean Patents Nos. 10-1656236, 10-1656237, 10-1706085, 10-2052286, and 10-2182847, the entire texts of which are incorporated herein by reference.

[0068] The guide nucleic acid may include a scaffold sequence portion and a guide sequence portion. The scaffold sequence portion is a portion that interacts with a Cas protein, and allows the Cas protein and the guide nucleic acid to bind to form a complex (ribonucleoprotein, RNP). In general, the scaffold sequence portion includes a portion of the sequence of tracrRNA and crRNA, and the scaffold sequence is determined depending on the type of Cas protein used.

[0069] The guide sequence portion is a portion that can bind complementarily to a nucleotide sequence portion of a certain length in a target gene, and is a portion of bases that can be artificially modified and is determined by a target nucleotide sequence (or target sequence) of interest. In this case, the guide sequence may be a nucleotide sequence that has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% or more complementarity with the guide nucleic acid binding sequence of the target gene or target nucleic acid, or has complete complementarity. The guide sequence may be a sequence contained in the guide domain of the guide nucleic acid.

[0070] The guide sequence portion may be included in the crRNA. For example, the guide nucleic acid may be a dual RNA comprising two RNAs, i.e., crRNA (CRISPRRNA) and tracrRNA (trans-activating crRNA), as components.

[0071] As another example, the guide nucleic acid may be a single-chain guide RNA (sgRNA) in which the main portions of crRNA and tracrRNA are linked together.

[0072] The target sequence is a nucleotide sequence of a certain length present in a target gene or target nucleic acid, and specifically, it may be a partial nucleotide sequence within a target region divided into a regulatory region, a coding region (or CDS, coding sequence), or a non-coding region (or UTR, untranslated region) of a target gene, or one or more partial nucleotide sequences selected from a combination of the target regions. The target sequence may be a target of a guide nucleic acid-editor protein complex (RNP).

[0073] In one embodiment of the present invention, the target sequence may be, but is not limited to, a safe harbor site. In one embodiment, the safe harbor site may be one selected from the group consisting of the AAVS1 locus, the CCR5 locus, the CLYBL locus, the ROSA26 locus, and the SHS231 locus.

[0074] The target sequence is a nucleotide sequence adjacent to and surrounding a protospacer-adjacent motif (PAM) sequence recognized by an editor protein, and may include, but is not limited to, the entire or a part of the PAM.

[0075] The term target sequence can be used to refer to both sets of nucleotide sequence information. For example, in the case of a target gene, the target sequence can refer to the sequence information of the transcribed strand of the target gene DNA, or it can refer to the nucleotide sequence information of the non-transcribed strand.

[0076] The target sequence includes a guide nucleic acid binding sequence or a guide nucleic acid non-binding sequence. A "guide nucleic acid binding sequence" is a nucleotide sequence that has partial or complete complementarity with a guide sequence contained in a guide domain of a guide nucleic acid, and can bind complementary to a guide sequence contained in a guide domain of a guide nucleic acid. The target sequence and the guide nucleic acid binding sequence are nucleotide sequences that can be changed depending on the target gene or nucleic acid, i.e., the subject to be genetically manipulated or edited, and the guide nucleic acid can be designed in various ways depending on the target gene or target nucleic acid.

[0077] The "guide nucleic acid non-binding sequence" is a nucleotide sequence that has partial or complete homology with the guide sequence contained in the guide domain of the guide nucleic acid, and cannot bind complementary to the guide sequence contained in the guide domain of the guide nucleic acid. In addition, the guide nucleic acid non-binding sequence is a nucleotide sequence that has complementarity with the guide nucleic acid binding sequence, and can bind complementary to the guide nucleic acid binding sequence. The guide nucleic acid binding sequence is a part of the nucleotide sequence of the target sequence, and can be one of two nucleotide sequences having different sequence orders of the target sequence, that is, two nucleotide sequences that can bind complementary to each other. In this case, the guide nucleic acid non-binding sequence can be the remaining nucleotide sequence of the target sequence excluding the guide nucleic acid binding sequence.

[0078] The guide nucleic acid binding sequence may be a nucleotide sequence selected from the target sequence, i.e., the same nucleotide sequence as the transcribed strand and the same nucleotide sequence as the non-transcribed strand. In this case, the guide nucleic acid non-binding sequence may be the remaining nucleotide sequence of the target sequence excluding the guide nucleic acid binding sequence, i.e., the same nucleotide sequence as the transcribed strand and the same nucleotide sequence as the non-transcribed strand.

[0079] The length of the guide nucleic acid binding sequence may be the same as the length of the target sequence. The length of the guide nucleic acid non-binding sequence may be the same as the length of the target sequence or the guide nucleic acid binding sequence. The guide nucleic acid binding sequence may be a sequence of 5 to 50 nucleotides.

[0080] In one embodiment, the guide nucleic acid binding sequence may be a 16 nucleotide sequence, a 17 nucleotide sequence, a 18 nucleotide sequence, a 19 nucleotide sequence, a 20 nucleotide sequence, a 21 nucleotide sequence, a 22 nucleotide sequence, a 23 nucleotide sequence, a 24 nucleotide sequence, or a 25 nucleotide sequence. The guide nucleic acid non-binding sequence may be a 5 to 50 nucleotide sequence.

[0081] In one embodiment, the guide nucleic acid non-binding sequence may be a 16 nucleotide sequence, a 17 nucleotide sequence, an 18 nucleotide sequence, a 19 nucleotide sequence, a 20 nucleotide sequence, a 21 nucleotide sequence, a 22 nucleotide sequence, a 23 nucleotide sequence, a 24 nucleotide sequence, or a 25 nucleotide sequence.

[0082] The guide nucleic acid binding sequence can bind partially or completely complementary to the guide sequence contained in the guide domain of the guide nucleic acid, and the length of the guide nucleic acid binding sequence can be the same as the length of the guide sequence.

[0083] The guide nucleic acid binding sequence may be a nucleotide sequence complementary to the guide sequence contained in the guide domain of the guide nucleic acid, for example, at least 70%, 75%, 80%, 85%, 90% or 95% complementary or completely complementary.

[0084] For example, the guide nucleic acid binding sequence may have or include a 1 to 8 nucleotide sequence that is not complementary to the guide sequence contained in the guide domain of the guide nucleic acid.

[0085] The guide nucleic acid non-binding sequence may have partial or complete homology with the guide sequence contained in the guide domain of the guide nucleic acid, and the length of the guide nucleic acid non-binding sequence may be the same as the length of the guide sequence. For example, the guide sequence may be designed based on a sequence having homology with the guide nucleic acid non-binding sequence.

[0086] The guide nucleic acid non-binding sequence may be a nucleotide sequence having homology to the guide sequence contained in the guide domain of the guide nucleic acid, for example, a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, or 95% or more homology, or a nucleotide sequence having complete homology.

[0087] For example, the guide nucleic acid non-binding sequence may have or include a 1 to 8 nucleotide sequence that is not homologous to the guide sequence included in the guide domain of the guide nucleic acid. The guide nucleic acid non-binding sequence may be complementary to the guide nucleic acid binding sequence, and the length of the guide nucleic acid non-binding sequence may be the same as the length of the guide nucleic acid binding sequence.

[0088] The guide nucleic acid non-binding sequence may be a nucleotide sequence that is complementary to the guide nucleic acid binding sequence, for example, at least 90% or 95% or more complementary or a completely complementary nucleotide sequence.

[0089] For example, the guide nucleic acid non-binding sequence may have or include 1 to 2 nucleotide sequences that are not complementary to the guide nucleic acid binding sequence, and the guide nucleic acid binding sequence may be a nucleotide sequence located adjacent to a sequence complementary to a nucleotide sequence (PAM sequence) that can be recognized by an editor protein.

[0090] For example, the guide nucleic acid binding sequence may be a contiguous 5 to 50 nucleotide sequence located adjacent to the 5' end or / and 3' end of a sequence complementary to a nucleotide sequence (PAM sequence) that can be recognized by an editor protein.

[0091] Alternatively, the guide nucleic acid non-binding sequence may be a nucleotide sequence located adjacent to a nucleotide sequence (PAM sequence) that can be recognized by an editor protein.

[0092] As an example, the guide nucleic acid non-binding sequence may be a contiguous 5 to 50 nucleotide sequence located adjacent to the 5' end or / and 3' end of a nucleotide sequence (PAM sequence) that can be recognized by an editor protein.

[0093] "Editor protein" refers to a peptide, polypeptide, or protein that can directly bind to nucleic acid or can interact with nucleic acid without directly binding to it. The editor protein is also conceptually called "artificially engineered nuclease" or RGEN (RNA-Guided Endonuclease).

[0094] In one embodiment, the editor protein may be a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) enzyme. A "CRISPR enzyme" is a major protein component of the CRISPR-enzyme system, and is also called a "Cas protein (CRISPR associated protein)". It is a nuclease that can recognize a target sequence and cleave DNA by mixing or forming a complex with a guide RNA.

[0095] CRISPR enzymes are known to those skilled in the art, see Korean Patent Registration Nos. 10-1656236, 10-1656237, 10-1706085, 10-2052286, and 10-2182847. The term "CRISPR enzyme" as used herein includes not only naturally occurring proteins, but also mutants that can act as activated endonucleases or nickases in cooperation with guide RNA. When activated, the enzyme can cause target DNA cleavage, which can be used to cause gene editing. When activated, the enzyme can cause transcriptional regulation or target DNA separation.

[0096] The CRISPR enzyme is a nucleic acid or polypeptide (or protein) having a sequence encoding the CRISPR enzyme. Typically, Type II CRISPR enzyme or Type V CRISPR enzyme is widely used, and an example of the Type II CRISPR enzyme is the CRISPR associated protein 9 (Cas9) protein.

[0097] The Cas9 protein can be derived from a variety of microorganisms, such as Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Campylobacter jejuni, and Staphylococcus auricularis.

[0098] In order for the Cas9 protein to induce a double-stranded DNA break, it must recognize a protospacer adjacent motif (PAM) sequence, which is a nucleotide sequence of a certain length, and a part of the guide RNA (the guide sequence portion) must bind complementarily to the complementary strand of a single strand of DNA in which the target sequence is located.

[0099] The PAM sequence is determined by the type and origin of the Cas9 protein, for example, the Streptococcus pyogenes Cas9 protein (SpCas9) can recognize the 5'-NGG-3' sequence (complementary sequence: 5'-CCN-3') in the target nucleic acid, where N is one of adenosine (A), thymidine (T), cytidine (C), and guanosine (G).

[0100] The Type V CRISPR enzyme includes Cpf1, which is capable of inhibiting Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiracea e, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococ Cpf1 from C.cus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, uberibacillus, Bacillus, Brevibacilus, Methylobacterium or Acidaminococcus.

[0101] The CRISPR enzyme, such as the Cas9 or Cpf1 protein, may be isolated from a microorganism existing in nature or produced non-naturally by a recombinant or synthetic method. The Cas protein may also be in a form that is easily introduced into cells. For example, the Cas protein may be linked to a cell-penetrating peptide or a protein transduction domain. The protein transduction domain may be, but is not limited to, polyarginine or a TAT protein derived from HIV. Since various types of cell-penetrating peptides or protein transduction domains are known in the art other than the above-described examples, those skilled in the art may apply various examples to the present specification without being limited to the above examples. The Cas protein may also be fused to a functional domain such as an NLS (nuclear localization sequence or signal). The Cas9 protein may also be encoded in the form of a vector and expressed in cells.

[0102] The present invention provides a composition for genetic manipulation for producing hypoimmunogenic stem cells or hypoimmunogenic cells differentiated or derived from stem cells, comprising a guide nucleic acid or a nucleic acid encoding the same that can target a target sequence located in the genome of a stem cell or a cell differentiated or derived from a stem cell; a gene donor or a nucleic acid encoding the same that encodes one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2, and an editor protein or a nucleic acid encoding the same.

[0103] In one embodiment of the present invention, the target sequence may be, but is not limited to, a safe harbor site. In one embodiment, the safe harbor site may be one selected from the group consisting of the AAVS1 locus, the CCR5 locus, the CLYBL locus, the ROSA26 locus, and the SHS231 locus.

[0104] In addition, the composition for genetic manipulation may optionally further comprise a donor containing a specific nucleotide sequence desired to be inserted or a nucleic acid encoding the same.

[0105] The donor refers to exogenous nucleotide sequences capable of expressing a specific peptide or protein, which can be inserted into genomic DNA through homology directed repair (HDR). In this case, the nucleic acid sequence to be inserted may be a nucleotide sequence of a part of a gene encoding one or more immune activity suppressors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2.

[0106] The donor can be a double-stranded or single-stranded nucleic acid. The donor can be linear or circular.

[0107] The donor may be in the form of a viral vector or a non-viral vector (e.g., a plasmid). The virus may be a DNA virus or an RNA virus. In this case, the DNA virus may be a double-stranded DNA (dsDNA) virus or a single-stranded DNA (ssDNA) virus. In this case, the RNA virus may be a single-stranded RNA (ssRNA) virus. The viral vector may be one or more viral vectors selected from the group consisting of retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), vaccinia virus, poxvirus, and herpes simplex virus (HSV).

[0108] The target sequence can be a target of the guide nucleic acid-editor protein complex, and the target sequence can include, but is not limited to, a protospacer-adjacent motif (PAM) sequence recognized by the editor protein.

[0109] As used herein, the guide nucleic acid, editor protein or guide nucleic acid-editor protein complex (ribonucleoprotein, RNP) and / or donor can be delivered or introduced into a subject in a variety of forms.

[0110] In this context, "subject" refers to an organism into which a guide nucleic acid, editor protein, or guide nucleic acid-editor protein complex is introduced; an organism in which a guide nucleic acid, editor protein, or guide nucleic acid-editor protein complex acts; or a specimen or sample obtained from an organism.

[0111] The subject can be an organism that contains a target gene, target nucleic acid, or target chromosome of the guide nucleic acid-editor protein complex.

[0112] The organism may be an animal, an animal tissue or an animal cell, where the tissue may be an eye, skin, liver, kidney, heart, lung, brain, muscle or blood.

[0113] The cell may be a stem cell, a hepatocyte, a cardiomyocyte, an endothelial cell or a pancreatic cell. The specimen or sample may be obtained from an organism that contains the target gene, target nucleic acid or target chromosome, such as saliva, blood, liver tissue, brain tissue, hepatocytes, neurons, phagocytes, macrophages, T cells, B cells, astrocytes, cancer cells or stem cells. The guide nucleic acid, editor protein, or guide nucleic acid-editor protein complex may be delivered or introduced into a subject in the form of DNA, RNA, or a mixture thereof.

[0114] In this case, the DNA, RNA or mixture thereof encoding the guide nucleic acid and / or the editor protein may be delivered or introduced into the subject by methods known in the art, or the DNA, RNA or mixture thereof encoding the guide nucleic acid and / or the editor protein may be delivered or introduced into the subject by a vector, a non-vector or a combination thereof.

[0115] In this case, the DNA, RNA, or a mixture thereof encoding the guide nucleic acid and / or the editor protein may be delivered or introduced into the subject by a method known in the art. Alternatively, the DNA, RNA, or a mixture thereof encoding the guide nucleic acid and / or the editor protein may be delivered or introduced into the subject by a vector, a non-vector, or a combination thereof. The vector may be a viral vector or a non-viral vector (e.g., a plasmid). The virus may be a DNA virus or an RNA virus. In this case, the DNA virus may be a double-stranded DNA (dsDNA) virus or a single-stranded DNA (ssDNA) virus. In this case, the RNA virus may be a single-stranded RNA (ssRNA) virus. The viral vector may be one or more selected from the group consisting of retrovirus, lentivirus, adenovirus, adeno-associated virus (AAV), vaccinia virus, poxvirus, and herpes simplex virus.

[0116] The non-vector may be naked DNA, a DNA complex or mRNA.

[0117] In one embodiment of the present invention, the guide nucleic acid and / or the nucleic acid encoding the editor protein may be delivered or introduced into the subject by a vector.

[0118] The vector may include a nucleic acid sequence encoding a guide nucleic acid and / or an editor protein. For example, the vector may simultaneously include a guide nucleic acid and a nucleic acid sequence encoding an editor protein. For another example, the vector may include a nucleic acid sequence encoding a guide nucleic acid. For example, the nucleic acid sequence encoding the guide nucleic acid may be all contained in one vector, or the nucleic acid sequence encoding the guide nucleic acid may be divided and included in multiple vectors. For another example, the vector may include a nucleic acid sequence encoding an editor protein. For example, in the case of the editor protein, the nucleic acid sequence encoding the editor protein may be included in one vector, or the nucleic acid sequence encoding the editor protein may be divided and included in multiple vectors.

[0119] The editor protein may be delivered or introduced into a subject in the form of a peptide, polypeptide or protein.

[0120] The editor protein can be delivered or introduced into a subject in the form of a peptide, polypeptide or protein by methods known in the art.

[0121] The guide nucleic acid and editor protein can be delivered or introduced into the subject in the form of a nucleic acid-protein combination.

[0122] The guide nucleic acid and the editor protein may be delivered or introduced into a subject in the form of a guide nucleic acid-editor protein complex. For example, the guide nucleic acid may be in the form of DNA, RNA, or a mixture thereof. The editor protein may be in the form of a peptide, polypeptide, or protein. For example, the guide nucleic acid and the editor protein may be delivered or introduced into a subject in the form of a guide nucleic acid-editor protein complex, i.e., ribonucleoprotein (RNP), in which the guide nucleic acid in the form of an RNA and the editor protein in the form of a protein are combined. The present invention also provides a method for producing hypoimmunogenic stem cells, comprising contacting stem cells with the composition for producing hypoimmunogenic stem cells to edit genes encoding one or more immune activity inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2, so as to increase the expression or activity of one or more immune activity inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 in the stem cells.

[0123] In one embodiment of the present invention, the method for producing the hypoimmunogenic stem cells or hypoimmunogenic cells differentiated or derived from stem cells includes the steps of: introducing a composition for producing the hypoimmunogenic stem cells or hypoimmunogenic cells differentiated or derived from stem cells into isolated stem cells or cells differentiated or derived from isolated stem cells; and

[0124] The method may include knocking in a gene encoding one or more immune activation inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 into the genome of the stem cell or a cell differentiated or derived from the stem cell, so as to increase the expression or activity of one or more immune activation inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 in the stem cell or a cell differentiated or derived from the stem cell.

[0125] The artificially manipulated stem cells of the present invention, cells differentiated or derived therefrom, or artificially manipulated cells differentiated or derived from stem cells have increased expression or activity of one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2, thereby suppressing immune rejection when transplanted into a mammal having a disease or pathological condition, and can be used as a composition for cell transplantation or biological tissue regeneration to treat various diseases.

[0126] In one embodiment of the present invention, the artificially engineered stem cells of the present invention can be differentiated or cultured into human vascular endothelial cells, pancreatic cells, bone cells, chondrocytes, cardiac muscle cells, muscle cells, epidermal cells, fibroblasts, nerve cells, hepatic cells, intestinal cells, gastric cells, skin cells, adipocytes, blood cells, immune cells, cell spheroids, organoids, etc., and used as a composition for cell transplantation or biological tissue regeneration to restore damaged cells or tissues.

[0127] In one embodiment of the present invention, the biological tissue may be a damaged tissue selected from tissue with ulcer or pressure sore, brain tissue damaged by cell degeneration, brain tissue missing due to surgical manipulation, brain tissue damaged by traumatic brain disease, brain tissue damaged by inflammatory brain disease, damaged bone tissue, damaged periodontal tissue, tissue damaged by central nervous system disease, and tissue damaged by intractable dermatitis, and the regeneration of the biological tissue may be, but is not limited to, restoration of the damaged tissue, epidermal regeneration, reproduction of secretory glands or hair follicles, microvascularization of dermal tissue, wound healing, correction of defects in soft tissue, bone healing or bone regeneration, cartilage regeneration, etc.

[0128] In one embodiment of the present invention, the composition for cell transplantation or biological tissue regeneration may be a cell therapy composition, a gene therapy composition, a tissue engineering therapy composition, an immunotherapy composition, or a cancer prevention or treatment composition.

[0129] As used herein, the term "cell therapy" refers to a pharmaceutical product (as defined by the U.S. FDA) that is used for therapeutic, diagnostic and preventive purposes using cells and tissues isolated from an individual, cultured and specially processed, and that is used for therapeutic, diagnostic and preventive purposes through a series of actions such as expanding and selecting living autologous, allogeneic or xenogeneic cells in vitro to restore the function of cells or tissues, or by changing the biological properties of cells in other ways.

[0130] As used herein, the term "gene therapy agent" refers to a pharmaceutical agent administered to affect the expression of genetic material and containing cells into which genetic material has been transformed or introduced.

[0131] In one embodiment of the present invention, the disease or condition is a myocardial infarction, heart failure, ischemic cardiomyopathy, myocarditis, ischemic enteritis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, acute cholecystitis, acute cholangitis, chronic cholecystitis, acute pancreatitis, chronic pancreatitis, acute nephritis, chronic nephritis, acute renal failure, chronic renal failure, pneumonia, interstitial pneumonia, idiopathic interstitial pneumonia, desquamative interstitial pneumonia, acute interstitial pneumonia, nonspecific interstitial pneumonia, drug-induced pulmonary disease, acute respiratory distress syndrome, chronic obstructive pulmonary disease, cerebral paralysis syndrome including cerebral paralysis of childhood, amyotrophic lateral sclerosis (ALS), multiple neuropathy, spinal muscular atrophy, acute transverse myelitis, stroke, multiple sclerosis, peripheral artery disease, and / or peripheral artery disease. The disease may be one selected from the group consisting of myelopathy, pulmonary arterial disease (PAD), thromboangiitis obliterans (Buerger's disease), Kawasaki disease (KD), graft versus host disease (GVHD), Parkinson's disease, dementia, Alzheimer's disease, Huntington's disease, amyotrophic lateral sclerosis, memory decline, myasthenia gravis, progressive supranuclear palsy, multiple system atrophy, essential tremor, cortico-basal degeneration, diffuse Lewy body disease, and Pick's disease, and the present invention may be used to treat and prevent these diseases, but is not limited thereto.

[0132] The administration route of the composition for cell transplantation or biological tissue regeneration of the present invention may be any common route as long as it can reach the target tissue, including, but not limited to, parenteral administration, such as intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, and intravascular administration.

[0133] The composition for cell transplantation or tissue regeneration may be formulated in a suitable form with a pharmaceutical carrier commonly used in cell therapy. "Pharmaceutically acceptable" refers to a composition that is physiologically acceptable and does not normally cause allergic or similar reactions such as gastrointestinal disorders and dizziness when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycol, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methylparaben or propylparaben, and chlorobutanol. Other pharmaceutically acceptable carriers may be referred to those described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995). The composition may also be administered by any device that can transfer the cell therapy agent to the target cells.

[0134] The cell transplantation or tissue regeneration composition of the present invention may contain a therapeutically effective amount of cells for the treatment of a disease. The term "therapeutically effective amount" refers to an amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal or human as contemplated by a researcher, veterinarian, physician or other clinical practitioner, including an amount that induces alleviation of symptoms of the disease or disorder being treated.

[0135] It is obvious to those skilled in the art that the cells contained in the composition of the present invention can be varied depending on the desired effect. Therefore, the optimal cell content can be easily determined by those skilled in the art and can be adjusted depending on various factors including the type of disease, the severity of the disease, the content of other ingredients contained in the composition, the type of dosage form, and the patient's age, weight, general health condition, sex and diet, administration time, administration route, and secretion rate of the composition, treatment period, and drugs used simultaneously. It is important to include an amount that can obtain the maximum effect at the minimum amount without side effects, taking into consideration all of the above factors. For example, the daily dose of the stem cells of the present invention is 1.0×10 5 ~1.0×10 30 Cells / kg body weight, preferably 1.0×10 10 ~1.0×10 20 The cells / kg body weight can be administered in one or several doses. However, it should be understood that the actual dosage of the effective amount should be determined in light of various relevant factors such as the disease to be treated, the severity of the disease, the route of administration, the patient's body weight, age and sex, etc., and therefore said dosage does not limit the scope of the present invention in any way.

[0136] In addition, in the therapeutic method of the present invention, a composition containing the cells of the present invention as an active ingredient can be administered in a conventional manner via rectal, intravenous therapy (IV), intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, topical, intraocular or intradermal routes. The present invention provides a therapeutic method comprising administering a therapeutically effective amount of the artificially engineered stem cells or cells differentiated or derived therefrom to a mammal having a disease or condition. The term mammal as used herein refers to a mammal that is the subject of treatment, observation or experiment, preferably a human.

[0137] The present invention also provides a cell therapy method using stem cells, comprising the step of administering a therapeutically effective amount of the artificially manipulated stem cells, cells differentiated or derived therefrom, or artificially manipulated cells differentiated or derived from stem cells to a mammal having a disease or pathological condition.

[0138] In one embodiment of the present invention, the method comprises administering artificially engineered stem cells, cells differentiated or derived from artificially engineered stem cells, or artificially engineered cells differentiated or derived from stem cells, which have increased expression or activity levels of one or more immune activation inhibitors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2, thereby suppressing immune rejection and achieving an immune tolerance state when used as a cell therapy in an autologous or allogeneic environment.

[0139] The present invention will now be described in more detail with reference to the following examples.

[0140] It will be obvious to those skilled in the art to which the present invention pertains that these examples are provided solely for the purpose of illustrating the present invention in more detail, and that the scope of the present invention is not limited to these examples.

[0141] Example 1: Production of iPSC (induced pluripotent stem cell) cells with a gene inserted (knock-in) into the AAVS1 site

[0142] Cell culture

[0143] iPSCs were cultured according to the manufacturer's instructions. TM (STEMCELL Technologies) for 1 h at room temperature. TM -E8 TM (STEMCELL Technologies) medium was used for culture.

[0144] Gene insertion (Knock-In, KI)

[0145] To insert genes (Knock-In, KI), a complex of guide RNA (sgRNA, sequence number 1: gtcaccaatcctgtccctag) targeting a specific AAVS1 site, Cas9 protein, and LGALS9 (Gal-9), CLEC4G (LSECtin), and HHLA2 gene donors was introduced into iPSCs by electroporation (Amaxa 4D nucleofector).

[0146] The above sgRNA, Cas9 protein, and gene donor complex was prepared by mixing 4 × 10 5 Electroporation was performed with iPSCs using the nucleofector program (CA-137) according to the manufacturer's (Lonza, 4D nucleofector) protocol.

[0147] Experimental example 1: Confirmation of gene knock-in in iPSC (induced pluripotent stem cell) cells

[0148] It was confirmed by PCR whether the gene was inserted into the AAVS1 site-knocked-in iPSC (induced pluripotent stem cell) cells prepared in Example 1.

[0149] PCR (Polymerase chain reaction)

[0150] After confirming the base sequence of the gene primers, the primers in Table 1 below were used. The PCR reaction was performed by repeating the process of primary denaturation at 98°C for 1 minute, denaturation at 98°C for 20 seconds, annealing at 62°C for 30 seconds, and extension at 72°C for 3 minutes for a total of 40 times, and finally extension at 72°C for 5 minutes to stabilize the PCR product.

[0151] [Table 1]

[0152] Figure 2 shows the results of PCR performed on cell DNA and Sanger sequencing performed on the PCR products obtained above to select multiple single clones from iPSCs in which three genes were knocked in (KI) prepared in Example 1. SEQ ID NOs: 10 to 13 are sequence information confirmed from the PCR reaction, and as shown in Figure 2, a specific size band of the inserted gene was confirmed in the KI-iPSC (AAVS1-ALC3#11) single clone compared to WT-iPSCs in which no genes were knocked in (KI).

[0153] Experimental example 2: Confirmation of mRNA expression in gene-inserted (KI) cells

[0154] Changes in mRNA levels of the three genes knocked in in Example 1 were confirmed as follows.

[0155] Real-time PCR (qRT-PCR)

[0156] mRNA was extracted from iPSCs using the RNeasy mini kit (Qiagen) according to the manufacturer's protocol. 100 ng of mRNA was then reverse transcribed using a cDNA reverse transcription kit (Thermo Fisher Scientific). qRT-PCR was performed using the QuantStudio 3 (Thermo Fisher Scientific) with PowerUp according to the manufacturer's protocol. TM SYBR TM The experiment was carried out using 100 ng of Green Master Mix. Gene expression levels were calculated using C values, and GAPDH was used as an endogenous control.

[0157] Figure 3 shows the results of confirming the change in mRNA level by real-time PCR for the three genes knocked in in Example 1. As shown in Figure 3, it was confirmed that the mRNA levels of Galectin-9, CLEC4G, and HHLA2 were all higher than those of Mock (WT).

[0158] Experimental example 3: Confirmation of knock-in gene copy number

[0159] The copy number of the knock-in gene in Example 1 was confirmed by ddPCR as follows.

[0160] ddPCR

[0161] The cultured cells were washed twice with phosphate buffered saline (PBS), detached using 0.05% trypsin-EDTA, and centrifuged at 1,000 rpm for 5 minutes. gDNA was extracted from the cells and then restriction enzyme digestion was performed. QX200 ddPCR Supermix for probes (Biorad), forward primer (100 pmole / ul), reverse primer (100 pmole / ul), and Taqman probe (10 pmole / ul) shown in Tables 2 and 3 below were prepared at room temperature. A ddPCR master mix was prepared according to the Biorad manual. The prepared master mix and restriction enzyme-treated template gDNA were dispensed into a ddPCR 96-well plate. The plate was sealed with a PX1 PCR plate sealer (Biorad) and then installed in the QX200 Auto DG droplet digital PCR system to generate droplets. After droplet generation was completed, PCR amplification was performed according to the manual protocol. After PCR amplification was completed, the fluorescence values ​​were read and analyzed using a QX200 Droplet reader.

[0162] [Table 2]

[0163] [Table 3]

[0164] Figure 4 is a graph showing the results of confirming the copy number of the knock-in (KI) gene using ddPCR. It was confirmed that two copies of the gene were knocked in (KI) in the KI-iPSC clone.

[0165] Experimental example 4: Measurement of expression level of knock-in (KI) genes through flow cytometry

[0166] To confirm the transgene expression of the knock-in (KI) gene, the AAVS1-ALC3#11 clone prepared in Example 1 was analyzed using flow cytometry.

[0167] Flow cytometry analysis

[0168] The cultured cells were washed twice with phosphate buffered saline (PBS), detached using 0.05% trypsin-EDTA, and centrifuged at 1,000 rpm for 5 minutes. The cells were suspended in 100 ul of FACS staining buffer, mixed with the antibody, incubated at 4°C for 1 hour, washed twice with PBS, and suspended in 500 ul of PBS for FACS analysis.

[0169] FIG. 5 shows the results of measuring the HHLA expression level of the AAVS1-ALC3#11 clone prepared in Example 1 through flow cytometry in Experimental Example 4. Compared to the isotype, 98% of the AAVS1-ALC3#11 clone was confirmed to be HHLA2+.

[0170] Experimental Example 5: Immunogenicity Confirmation

[0171] To evaluate the immunogenicity of the gene-knocked-in induced pluripotent stem cell (KI-iPSC) cells prepared in Example 1 and the endothelial cells (EC, Endothelial Cells) differentiated from iPSCs using the lentivirus disclosed in Figure 8, WT and KI-iPSCs were differentiated into endothelial cells (EC, Endothelial Cells) as described below. The differentiated endothelial cells were co-cultured with immune cells to confirm their immunogenicity.

[0172] Endothelial Cell Differentiation

[0173] Human ESCs were seeded in 6-well plates (Thermo Fisher Scientific) and incubated in TeSR containing 10 mM ROCK inhibitor, Y-27632 (Tocris). TM -E8 TMThe cells were cultured in medium (STEMCELL Technologies) for 1 day. The next day, the medium was replaced with N2B27 medium containing 46.9% (v / v) DMEM / F12 (Gibco), 50% (v / v) Neurobasal medium (Gibco), 0.97% N2 (Gibco), 1.94% B27 (Gibco), 0.97% β-mercaptoethanol (Gibco), 8 μM CHIR99021 (Cayman Chemical), and 25 ng / ml BMP-4 (Peprotech), and the cells were then incubated for 3 days. The medium was then replaced with StemPro-34 SFM (Thermo Fisher Scientific) supplemented with 100 ng / ml vascular endothelial growth factor (Peprotech), 50 ng / ml basic fibroblast growth factor (Peprotech), and 2 μM forskolin (Abcam), and the cells were then incubated for 2 days. The cell population was then enriched for CD144+ cells using MACS cell sorting (Miltenyi Biotec). CD144+ cells were plated and cultured in endothelial cell growth medium (EGM) for at least 7 days for further differentiation. TM -2blletKit TM ) (Lonza). Endothelial cells were analyzed by flow cytometry using anti-CD31 antibody (1:25, Clone WM-59, eBioscience).

[0174] FIG. 6(a) shows the results of flow cytometry using anti-CD31 antibody after wild-type (WT) iPSCs and iPSCs with the three genes knocked in (KI) prepared in Example 1 were differentiated into endothelial cells (ECs). It was observed that more than 98% of the cells expressed CD31+, an EC marker.

[0175] FIG. 6(b) shows the results of flow cytometry after wild-type (WT) iPSCs and iPSCs with three genes knocked in (KI) prepared in Example 1 were differentiated into endothelial cells (ECs). It was confirmed that HLA-ABC antigens were present on the surface of EC cells differentiated from iPSCs, and the level was further increased after treatment with interferon gamma at a concentration of 100 ng / ml for 48 hours.

[0176] Cytotoxicity Assays (In Vitro Fluorometric Cytotoxicity Assays for Measuring NK Cell Effects)

[0177] The effects of NK cells on KI clones (target cells) and K562 cells (ATCC) were evaluated by flow cytometry. Target cells were labeled with CellTraceViolet (Thermo Fisher Scientific) for 15 min at room temperature and then cultured with NK cells at various ratios in a 37°C, 5% CO2 incubator.

[0178] To measure the number of killed target cells, the washed cells were stained with 7-Amino-Actinomycin (7-AAD, BD Bioscience) according to the manufacturer's instructions and analyzed on an Attune Flow Cytometer (Thermo Fisher Scientific).

[0179] 7(a) is a graph showing the results of confirming cytotoxicity when K562 cells, endothelial cells differentiated from wild-type (WT) iPSCs (WT-iPSC_EC), and endothelial cells differentiated from iPSCs with three genes knocked in (KI) prepared in Example 1 (KI-iPSC_EC) were cultured with effector cells (NK cells) at various ratios. Cell death was detected as 7-AAD+ cells, and it was confirmed that K562 tumor cells that do not express HLA and endothelial cells differentiated from wild-type (WT) iPSCs (WT-iPSC_EC) were highly vulnerable to NK cell cytotoxicity.

[0180] FIG. 7(b) is a graph showing the results of evaluating the cytotoxicity of NK cells in endothelial cells (WT-iPSC_EC, FIG. 6(b)) differentiated from wild-type (WT) iPSCs expressing 98% or more of HLA-ABC, and endothelial cells (KI-iPSC EC) differentiated from iPSCs with three genes knocked in (KI) prepared in Example 1. Referring to FIG. 7(b), effector cells (NK cells): target cells (EC, endothelial cells) were co-cultured at a ratio of 1:1, and 7-AAD+ cells were measured. As a result, it was confirmed that the KI-iPSC_EC had a lower percentage of apoptotic cells compared to WT-iPSC_EC, and the percentage of 7-AAD+ cells increased as the effector cell (NK cells): target cell (EC, endothelial cells) ratio increased.

[0181] Production of overexpressing EC cells differentiated from iPSCs using lentivirus

[0182] 8 is a diagram showing an example of a lentivirus for inserting each of the genes LGALS9(Gal-9) / CLEC4G(LSECtin) / HHLA-2 (SEQ ID NO: 23), LGALS9(Gal-9) (SEQ ID NO: 24), CLEC4G(LSECtin) (SEQ ID NO: 25), LGALS9(Gal-9) / CLEC4G(LSECtin) (SEQ ID NO: 26), and LGALS9(Gal-9) / CLEC4G(LSECtin) / PD-L1 (SEQ ID NO: 27). In this case, the gene can be inserted into a target sequence on an EC cell genome.

[0183] The genes to be inserted are shown in Tables 4 to 8 below.

[0184] [Table 4] JPEG2025506976000006.jpg73169

[0185] [Table 5]

[0186] [Table 6] JPEG2025506976000009.jpg73169

[0187] [Table 7] JPEG2025506976000011.jpg95169

[0188] [Table 8] JPEG2025506976000013.jpg102169

[0189] To stably overexpress genes, EC cells differentiated from WT-iPSCs were transduced with the lentiviruses disclosed in FIG. 8. On the day before transducing the lentivirus, 500,000 cells were cultured in a culture dish, and 24 hours later, the cells were infected with lentivirus particles at an MOI of 100. After infection, the medium was replaced with fresh medium and the cells were maintained at 37°C for 48 hours as indicated. The four lentiviruses used were produced by VectorBuilder (Vector Builder Inc, China).

[0190] FIG. 9(a) shows endothelial cells differentiated from K562 cells, wild-type (WT) iPSCs (WT-iPSC_EC), endothelial cells differentiated from iPSCs inserted with the Gal-9 gene of SEQ ID NO: 24 (Gal-9_EC), endothelial cells differentiated from iPSCs inserted with the CLEC4G gene of SEQ ID NO: 25 (CLEC4G_EC), endothelial cells differentiated from iPSCs inserted with the Gal-9 / CLEC4G genes of SEQ ID NO: 26 (Gal-9+CLEC4G_EC), and endothelial cells differentiated from iPSCs inserted with the Gal-9 / CLEC4G / PD-L1 genes of SEQ ID NO: 27 (Gal-9+CLEC4G+ Figure 9(b) is a graph showing the results of measuring 7-AAD+ cells when effector cells (NK cells) and target cells (EC, endothelial cells) were co-cultured at a 1:1 ratio.

[0191] As shown in FIG. 9 , endothelial cells in which the Gal-9 gene of SEQ ID NO: 24 is inserted into endothelial cells differentiated from iPSCs (Gal-9_EC), endothelial cells in which the CLEC4G gene of SEQ ID NO: 25 is inserted into endothelial cells differentiated from iPSCs (CLEC4G_EC), endothelial cells in which the Gal-9 / CLEC4G gene of SEQ ID NO: 26 is inserted into endothelial cells differentiated from iPSCs (Gal-9+CLEC4G_EC), endothelial cells in which the Gal-9 / CLEC4G / PD-L1 gene of SEQ ID NO: 27 is inserted into endothelial cells differentiated from iPSCs (Gal-9+CLEC4G+ It was confirmed that 7-AAD+ cells increased as the effector cell (NK cell) to target cell (EC, endothelial cell) ratio increased, and that 7-AAD+ cells decreased as the effector cell (NK cell) to target cell (EC, endothelial cell) ratio increased.

Claims

1. An artificially engineered stem cell having an artificially engineered gene in which a gene encoding one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 is inserted into the stem cell genome.

2. the genetic sequence of the artificially engineered stem cell is different from the genetic sequence of a wild-type stem cell; The artificially engineered stem cell according to claim 1, wherein the artificially engineered stem cell has increased expression or activity of a gene encoding one or more immune activity suppressors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, or one or more immune activity suppressors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2.

3. In said artificially engineered stem cells, The artificially manipulated stem cell of claim 1, wherein the mRNA transcribed from the artificially manipulated gene has a higher mRNA expression level or a different sequence compared to the expression level of the mRNA transcribed from the gene of a wild-type stem cell in a wild-type stem cell.

4. The artificially engineered stem cell of claim 1, wherein the stem cell is an induced pluripotent stem cell (iPSC), an embryonic stem cell, a somatic cell nuclear transfer-PSC, or an adult stem cell.

5. The artificially engineered stem cell of claim 1, wherein the gene encoding one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 is knocked in or inserted into the stem cell genome.

6. An artificially engineered cell differentiated or derived from a stem cell, having an artificially engineered gene in which a gene encoding one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 is inserted into the genome of the cell differentiated or derived from a stem cell.

7. the genetic sequence of the engineered cell differentiated or derived from the stem cell is different from the genetic sequence of the wild-type cell, The artificially engineered cell differentiated or derived from a stem cell according to claim 6, wherein the artificially engineered cell differentiated or derived from a stem cell has increased expression or activity of a gene encoding one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, or one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2.

8. In an artificially engineered cell differentiated or derived from the stem cell, The artificially engineered cell differentiated or derived from a stem cell according to claim 6, wherein the mRNA transcribed from the artificially engineered gene has a higher mRNA expression level or a different sequence compared to the expression level of the mRNA transcribed from the gene in a wild-type cell.

9. The artificially engineered cell differentiated or derived from a stem cell according to claim 6, wherein the gene encoding one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 is knocked in or inserted into a genome of a cell differentiated or derived from the stem cell.

10. The artificially engineered cell differentiated or derived from a stem cell according to claim 6, wherein the cell differentiated or derived from the stem cell is one selected from the group consisting of human vascular endothelial cells, pancreatic cells, bone cells, chondrocytes, cardiac muscle cells, muscle cells, epidermal cells, fibroblasts, nerve cells, hepatic cells, intestinal cells, gastric cells, skin cells, adipocytes, blood cells, immune cells, cell spheroids and organoids.

11. The artificially engineered cell differentiated or derived from a stem cell according to claim 6, wherein the stem cell is an induced pluripotent stem cell (iPSC), an embryonic stem cell, a somatic cell nuclear transfer-PSC or an adult stem cell.

12. A cell differentiated or derived from the artificially engineered stem cell according to any one of claims 1 to 5, in which the expression or activity of one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2 is increased.

13. The cell according to claim 12, wherein the cell is one selected from the group consisting of human vascular endothelial cells, pancreatic cells, bone cells, chondrocytes, cardiac muscle cells, muscle cells, epidermal cells, fibroblasts, nerve cells, hepatic cells, intestinal cells, gastric cells, skin cells, adipocytes, blood cells, immune cells, cell spheroids and organoids.

14. a guide nucleic acid or a nucleic acid encoding the same that is capable of targeting a target sequence located within the genome of a stem cell or a cell differentiated or derived from a stem cell; A gene donor encoding one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2, or a nucleic acid encoding the same; and A composition for producing hypoimmunogenic stem cells or hypoimmunogenic cells differentiated or derived from stem cells, comprising an editor protein or a nucleic acid encoding the same.

15. The composition The composition for producing a hypoimmunogenic stem cell or a hypoimmunogenic cell differentiated or derived from a stem cell according to claim 14, comprising the editor protein and the guide nucleic acid in the form of a ribonucleoprotein (RNP).

16. The composition The composition of low immunogenic cells for producing low immunogenic stem cells or differentiated or derived from stem cells described in claim 14, comprising a nucleic acid encoding the editor protein and a nucleic acid encoding the guide nucleic acid in one or more vector forms.

17. The composition for producing a hypoimmunogenic stem cell or a hypoimmunogenic cell differentiated or derived from a stem cell according to claim 16, wherein the vector is selected from the group consisting of a plasmid, a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus, a vaccinia virus, a poxvirus and a herpes simplex virus.

18. Introducing the composition for producing the hypoimmunogenic stem cell or the hypoimmunogenic cell differentiated or derived from the stem cell of claim 14 into the isolated stem cell or the cell differentiated or derived from the isolated stem cell; and The method for producing a hypoimmunogenic stem cell or a hypoimmunogenic cell differentiated or derived from an isolated stem cell includes knocking in a gene encoding one or more immune activity suppressors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 into the genome of the stem cell or a cell differentiated or derived from the isolated stem cell, so as to increase an expression or activity of the one or more immune activity suppressors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1, and HHLA2 in the stem cell or a cell differentiated or derived from the isolated stem cell.

19. The method for producing a hypoimmunogenic stem cell or a hypoimmunogenic cell differentiated or derived from an isolated stem cell according to claim 18, wherein the composition comprises a nucleic acid encoding the editor protein and a nucleic acid encoding the guide nucleic acid in the form of one or more vectors.

20. The method for producing a hypoimmunogenic stem cell or a hypoimmunogenic cell differentiated or derived from a stem cell according to claim 18, characterized in that an indel is generated in the target sequence by contacting a CRISPR / Cas9 complex comprising a Cas9 protein derived from Streptococcus pyogenes and a guide RNA capable of targeting the target sequence with the target sequence located in the genome of the stem cell or the cell differentiated or derived from the stem cell.

21. A composition for cell transplantation or biological tissue regeneration, comprising the artificially engineered stem cell according to any one of claims 1 to 5 as an active ingredient.

22. The composition for cell transplantation or biological tissue regeneration described in claim 21, which is a cell therapy composition, a gene therapy composition, a tissue engineering therapy composition, an immunotherapy composition, or a cancer prevention or treatment composition.

23. A composition for cell transplantation or biological tissue regeneration, comprising artificially engineered cells differentiated or derived from the stem cells according to any one of claims 6 to 11 as active ingredients.

24. The composition for cell transplantation or biological tissue regeneration described in claim 23, which is a cell therapy composition, a gene therapy composition, a tissue engineering therapy composition, an immunotherapy composition, or a cancer prevention or treatment composition.

25. A composition for cell transplantation or biological tissue regeneration, comprising as an active ingredient cells that have increased expression or activity of one or more immune activity suppressing factors selected from the group consisting of LGALS9 (Gal-9), CLEC4G (LSECtin), PD-L1 and HHLA2, and that are differentiated or derived from the artificially manipulated stem cell described in any one of claims 1 to 5.

26. The composition for cell transplantation or biological tissue regeneration according to claim 25, wherein the cells are one selected from the group consisting of human vascular endothelial cells, bone cells, chondrocytes, cardiac muscle cells, muscle cells, epidermal cells, fibroblasts, nerve cells, hepatic cells, intestinal cells, gastric cells, skin cells, adipocytes, blood cells, immune cells, cell spheroids and organoids.

27. The composition for cell transplantation or biological tissue regeneration described in claim 25, which is a cell therapy composition, a gene therapy composition, a tissue engineering therapy composition, an immunotherapy composition, or a cancer prevention or treatment composition.

Images