RNAi agents for prion expression

Abstract

Provided are RNAi agents, pharmaceutical compositions, and methods for reducing the amount or activity of PRNP RNA in a cell or subject, and in certain instances, for reducing the amount of prion protein in a cell or subject. Such RNAi agents, pharmaceutical compositions, and methods are useful for ameliorating at least one symptom or characteristic of a neurodegenerative disease. Such neurodegenerative diseases include prion diseases such as Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, or kuru; synucleopathies such as Alzheimer's disease, Parkinson's disease, or dementia with Lewy bodies; or tauopathies such as frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE).

Description

[Technical field]

[0001] Sequence Listing This application has been filed with an electronic sequence listing, which is provided as a file named BIOL0410SEQ.xml, created on February 2, 2023, and 302 kb in size. The information in the electronic format of this sequence listing is incorporated herein by reference in its entirety.

[0002] RNAi agents, methods, and pharmaceutical compositions are provided for reducing the amount or activity of PRNP RNA in a cell or subject, and in certain cases, for reducing the amount of prion protein (PrP) in a cell or subject. Such agents, methods, and pharmaceutical compositions are useful for improving at least one symptom or characteristic of a neurodegenerative disease associated with PrP. Such symptoms and characteristics include rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, gliomatosis, or the presence of markers of neuronal cell loss. Such neurodegenerative diseases include prion diseases such as Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, and kuru; synucleinopathies such as Alzheimer's disease, Parkinson's disease, and dementia with Ruby bodies; and tauopathies such as frontotemporal dementia associated with Tau mutations, Pick's disease, progressive hypernuclear palsy, corticobasal degeneration, and chronic traumatic encephalopathy (CTE). [Background technology]

[0003] Prion diseases (also known as transmissible spongiform encephalopathies or TSEs) are a group of rare, progressive neurodegenerative disorders that affect both humans and non-human animals. Such diseases result from the recombination of the normal prion protein ("PrP"). CPrion-like disorders and Transmissible Spongiform Encephalopathies: An overview of the mechanistic features that are shared by the various disease-related misfolded proteins, 2017, 483:1125-1136). Characteristics of prion disease include, but are not limited to, spongy changes in the brain, development of abnormal protein aggregates, neuronal loss, gliosis, and the presence of markers of neuronal loss (Sigurdson, et al., “Cellular and Molecular Mechanisms of Prion Disease,” Annu. Rev. Pathol. Mech. Dis. 2019, 14:497-516). Symptoms of prion disease include, but are not limited to, rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, speech loss, coma, and death. Prion diseases include, but are not limited to, Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical CJD (cCJD), familial CJD (fCJD), or sporadic CJD (sCJD)), Gerstmann-Straussler-Scheinker syndrome (GSS), fatal familial insomnia (FFI), and kuru.

[0004] Prion protein can occur in several different conformational states: the normal cellular form, PrP C and the protease-resistant scrapie, disease-causing form, known as the scrapie or disease-causing prion protein, PrP Sc " (Senesi, 2017). Sc The scrapie form of PrP is the causative agent of transmissible spongiform encephalopathy. Both forms of the protein have the same amino acid sequence encoded by the PRNP gene and differ only in how they fold in three-dimensional space. However, certain mutations in the PRNP gene cause a predisposition to express the disease-causing PrP protein. Sc (Mastrianni, “The genetics of prion diseases”, Genetic Med., 2010, 12(4):187-195). PrP Sc forms aggregates and is resistant to proteolysis by proteinase K. Infectious PrP Sc is normal cellular PrP C This leads to the misfolding of PrP, which is proteinase K-resistant. Sc This can be converted to PrP Sc It causes increased cellular levels of prion protein, leading to increased protein aggregates and the spread of misfolded forms throughout the CNS. Patients rapidly develop the characteristic signs and symptoms of prion diseases, which are invariably fatal.

[0005] In addition to prion diseases, PrP CIt has also been implicated as a molecular target in synucleinopathies such as Parkinson's disease and dementia with Lewy bodies (Ferreira, et. al., "α-synuclein interacts with PrPC to induce cognitive impairment through mGluR5 and NMDAR2B", Nature Neuroscience, 2017, 20:1569-157) and Alzheimer's disease (Purro, et al., "Alzheimer's", Biological Psychiatry, 2018, 83(4):358-368).

[0006] PrP C PrP has further been implicated as a molecular target in tauopathies (Corbett et al., “PrP is a central player in toxicity mediated by soluble aggregates of neurodegeneration-causing proteins,” Acta Neuropathologica (2020, 139:503-526). Such tauopathies include, but are not limited to, frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, and chronic traumatic encephalopathy (CTE).

[0007] PrP C and PrP Sc Both can be detected in cerebrospinal fluid (CSF). C Infectious PrP can be detected in CSF by standard methods such as Western blot and enzyme-linked immunosorbent assay (ELISA). Sccan be detected in the CSF of prion-infected patients via the RT-QuIC test (real-time vibration-induced conversion), as described in Orru, et. al., mBio, “Rapid and sensitive RT-QuIC detection of human Creutzfeldt-Jakob disease using cerebrospinal fluid,” 2015, 6(1):e02451-14. This test detects PrP by the ability of the CSF sample to induce misfolding of recombinant PrP substrate. Sc PrP C Distinguish from.

[0008] It is the object of the present specification to provide RNAi agents, pharmaceutical compositions and methods for the treatment of such PrP-related neurodegenerative diseases.Certain RNAi agents have been described.RNAi agents interact with RNA silencing complex (RISC), ultimately resulting in the cleavage of target nucleic acid.See, for example, Sharp et al., 2001, Genes Dev.15:485; Bernstein, et al., 2001, Nature, 409:363; Nykanen, et al., 2001, Cell, 107:309; Elbashir, et al., 2001, Genes Dev.15:188; and Lima et al., 2012, Cell, 150:883-894. Summary of the Invention

[0009] Provided herein are RNAi agents, pharmaceutical compositions and methods of use for reducing the amount or activity of PRNP RNA, and in certain embodiments, for reducing the amount of prion protein in cells or subjects.In certain embodiments, the subject has a neurodegenerative disease associated with PrP.In certain embodiments, the neurodegenerative disease is a prion disease.In certain embodiments, the neurodegenerative disease is a synucleinopathy.In certain embodiments, the neurodegenerative disease is a tauopathy. In certain embodiments, the neurodegenerative disease is Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome (GSS), fatal familial insomnia (FFI), kuru, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontolateral dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, or chronic traumatic encephalopathy (CTE). In certain embodiments, an RNAi agent useful for reducing expression of PRNP RNA is an oligomeric duplex. In certain embodiments, an RNAi agent useful for reducing expression of PRNP RNA is an antisense agent. In certain embodiments, the oligomeric duplex comprises a modified oligonucleotide.In certain embodiments, the oligomeric duplex comprises an antisense RNAi oligonucleotide.

[0010] Also provided are methods useful for ameliorating at least one symptom or characteristic of a neurodegenerative disease associated with PrP. In certain embodiments, the neurodegenerative disease is a prion disease. In certain embodiments, the neurodegenerative disease is a synucleinopathy. In certain embodiments, the neurodegenerative disease is a tauopathy. In certain embodiments, the neurodegenerative disease is Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome (GSS), fatal familial insomnia (FFI), KRU, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontolateral dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, or chronic traumatic encephalopathy (CTE). In certain embodiments, symptoms or characteristics include rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, gliomas, and the presence of markers of neuronal cell loss. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory and are not limiting of the claimed embodiments. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless otherwise stated. Furthermore, the use of the term "including" as well as other forms of "includes" and "included" are not limiting.

[0012] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and papers, and GenBank and NCBI reference sequence records, as well as portions of documents discussed herein, are expressly incorporated herein by reference in their entirety.

[0013] definition Unless specific definitions are given, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, patent applications, published patent applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0014] Unless otherwise indicated, the following terms have the following meanings. As used herein, "2'-deoxyribonucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D deoxynucleoside, which includes a 2'-β-D-deoxyribosyl sugar moiety having a β-D ribosyl structure as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside or a nucleoside that includes an unmodified 2'-deoxyribosyl sugar moiety can include a modified nucleobase or can include an RNA nucleobase (uracil).

[0015] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-MOE sugar moiety" means a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" means O-methoxyethyl.

[0016] As used herein, "2'-MOE nucleoside" or "2'-O(CH2)2OCH3 nucleoside" or "2'-OCH2CH2OCH3 nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety (or a 2'-O(CH2)2OCH3 ribosyl sugar moiety).

[0017] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" or "2'-O-methylribosyl sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0018] As used herein, "2'-OMe nucleoside" or "2'-OMe modified nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0019] As used herein, "2'-F" refers to a 2'-fluoro group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-F sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, the 2'-F sugar moiety is in the β-D-ribosyl configuration.

[0020] As used herein, "2'-F nucleoside" or "2'-F modified nucleoside" means a nucleoside that includes a 2'-F modified sugar moiety.

[0021] As used herein, "Xylo 2'-F" refers to a 2'-F sugar moiety of β-D-xylosyl configuration.

[0022] As used herein, "2'-substituted nucleoside" means a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with reference to the sugar moiety means the sugar moiety includes at least one 2'-substituent group other than H or OH.

[0023] As used herein, "3' target site" refers to the 3'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0024] As used herein, "5' target site" refers to the 5'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0025] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0026] As used herein, "abasic sugar moiety" means the sugar portion of a nucleoside that is not linked to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0027] As used herein, "administering" or "administration" means providing a pharmaceutical agent or composition to a subject.

[0028] As used herein, "ameliorating" in the context of treatment refers to an improvement in at least one symptom or characteristic compared to the same symptom or characteristic in the absence of treatment. In certain embodiments, amelioration is a decrease in the severity or frequency of a symptom or characteristic, or a delay in the onset of a symptom or characteristic, or a delay in the progression of their severity or frequency. In certain embodiments, the symptom or characteristic is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal loss, gliomas, or the presence of markers of neuronal loss. The progression or severity of an indicator can be determined by subjective or objective measures, which are known to those skilled in the art.

[0029] As used herein, "antisense activity" refers to any detectable and / or measurable change that can result from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of an antisense compound.

[0030] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0031] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0032] As used herein, "antisense oligonucleotide" refers to an oligonucleotide that comprises an oligonucleotide portion of an antisense compound that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0033] As used herein, a "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0034] As used herein, "sense oligonucleotide" refers to the oligonucleotide that comprises the oligonucleotide portion of an oligomeric compound that can hybridize with antisense oligonucleotide.Sense oligonucleotide includes but is not limited to sense RNAi oligonucleotide.

[0035] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0036] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl sugar moiety.

[0037] As used herein, "blunt" or "blunt ended" with respect to an oligomeric duplex means that there are no unpaired nucleotides at the ends (i.e., there are no overhanging nucleotides). One or both ends of an oligomeric duplex can be blunt.

[0038] As used herein, "cell targeting moiety" means a conjugate group or a portion of a conjugate group that is capable of binding to a particular cell type or types of cells.

[0039] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties (e.g., osmolality, pH, and / or electrolytes) that are similar to cerebrospinal fluid and is biocompatible with CSF.

[0040] As used herein, a "cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0041] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of an oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite orientations. As used herein, "complementary nucleobases" means nucleobases that are capable of forming hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (C) and 5-methylcytosine (D) and 5-methylcytosine (E). mThe term "fully complementary" or "100% complementary" as used herein with respect to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to another oligonucleotide or a target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0042] As used herein, a "region of complementarity" in reference to an oligonucleotide is the stretch of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or target nucleic acid.

[0043] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0044] As used herein, "conjugate linker" means a single bond or a group of atoms that contains at least one bond that connects a conjugate moiety to an oligonucleotide.

[0045] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0046] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in a sequence.

[0047] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar moiety" means a β-D ribosyl bicyclic sugar moiety, where the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0048] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.

[0049] As used herein, "chirally enriched" in reference to a population refers to a plurality of molecules of the same molecular formula, where the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom, as defined herein. A chirally enriched population of molecules with multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds that include modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorus atom of the phosphorothioate internucleoside linkage.

[0050] As used herein, "diluent" refers to an ingredient in a composition that lacks pharmacological activity, but is medicamentously necessary or desirable. For example, a diluent in a composition to be injected can be a liquid, such as aCSF, PBS, or saline solution.

[0051] As used herein, "duplex" in reference to a region or oligonucleotide refers to a duplex formed by complementary strands of nucleic acid (including, but not limited to, oligonucleotides) hybridized to one another. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that are folded back on themselves (e.g., a hairpin structure).

[0052] As used herein, "duplex" or "double-stranded region" refers to the structure formed by two oligonucleotides or portions thereof that are hybridized to one another.

[0053] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to RNAi agent-mediated reduction in the amount or activity of the target nucleic acid.

[0054] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Without being limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense oligonucleotides and nucleic acid targets.

[0055] As used herein, "internucleoside bond" refers to the covalent bond between adjacent nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond."Phosphorothioate internucleoside bond" refers to a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0056] As used herein, "inverted nucleoside" means a nucleotide having 3' to 3' and / or 5' to 5' internucleoside linkages as depicted herein.

[0057] As used herein, "inverted sugar moiety" means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having 3' to 3' and / or 5' to 5' internucleoside linkages.

[0058] As used herein, a "lipid nanoparticle" or "LNP" is a vesicle that includes a lipid layer that encapsulates a medicamentously active molecule, such as a nucleic acid molecule, e.g., an RNAi agent, or a plasmid into which an RNAi agent is transcribed. LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.

[0059] As used herein, "linked nucleosides" are nucleosides that are joined in a contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0060] As used herein, "linker-nucleoside" refers to a nucleoside that links an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker-nucleoside is located within the conjugate linker of an oligomeric compound. The linker-nucleoside is not considered part of the oligonucleotide portion of an oligomeric compound, even if they are contiguous with the oligonucleotide.

[0061] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first nucleic acid sequence that is not complementary to a corresponding nucleobase of a second nucleic acid sequence when the first and second nucleic acid sequences are aligned in opposing orientations.

[0062] As used herein, "modified nucleoside" means a nucleoside containing a modified nucleobase and / or a modified sugar moiety.

[0063] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0064] As used herein, "neurodegenerative disease" or "neurodegenerative disease associated with PrP" refers to a condition characterized by progressive loss of function or structure, including loss of neuronal function and death of neurons. In certain embodiments, the neurodegenerative disease is a prion disease. In certain embodiments, the neurodegenerative disease is a synucleopathy or tauopathy in which alpha-synuclein or tau-induced toxicity, respectively, is mediated by a PrP-dependent mechanism. In certain embodiments, the neurodegenerative disease is Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE).

[0065] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications such as substituents that do not form a bridge between two atoms of the sugar to form a second ring.

[0066] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0067] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a target nucleic acid or oligonucleotide, each of which, optionally independently, is modified or unmodified and independent of any sugar or internucleoside linkage modifications.

[0068] As used herein, a "nucleobase sequence of" a reference SEQ ID NO: refers only to the nucleobase sequence provided in such SEQ ID NO, and thus, unless otherwise indicated, includes compounds in which each nucleobase, each sugar moiety, and each internucleoside linkage, independently, may be modified or unmodified, with or without the modifications set forth in the reference SEQ ID NO.

[0069] As used herein, "nucleoside" means a compound or fragment of a compound that comprises a nucleobase and a sugar moiety, each of which, independently, is unmodified or modified.

[0070] As used herein, "nucleoside overhang" refers to unpaired nucleosides at either or both termini of an oligomeric duplex formed by hybridization of two oligonucleotides.

[0071] As used herein, "oligomeric agent" refers to an oligomeric compound and, optionally, one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or can be an oligomeric duplex formed by two complementary oligomeric compounds.

[0072] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound can be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or it can be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0073] As used herein, the term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.

[0074] As used herein, "oligonucleotide" means a polymer of linked nucleosides joined via internucleoside linkages, where each nucleoside and internucleoside linkage can be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides.

[0075] As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage has been modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.

[0076] As used herein, "pharmaceutical acceptable carriers or diluents" refers to any substance suitable for use in administration to animals. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as pills, tablets, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutical acceptable carriers or diluents are sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0077] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects.

[0078] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition shows activity in a free uptake assay in certain cell lines.

[0079] As used herein, a "prodrug" refers to a therapeutic agent that is in a first form outside the body that is converted to a second form within the subject or cells thereof. Typically, the conversion of the prodrug in the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions. As used herein, a "prodrug" is an inactive or less active form of a compound that is metabolized to form an active or more active compound when administered to a subject. In certain embodiments, the prodrug comprises a cell targeting moiety and at least one active compound.

[0080] As used herein, "PrP C " refers to the normal cellular form of the prion protein (PrP).

[0081] As used herein, "PrP Sc " refers to the protease-resistant, disease-causing form of the prion protein.

[0082] As used herein, "RNA" means RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0083] As used herein, "RNAi agent" refers to an antisense compound or agent that acts, at least in part, through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may include conjugate groups and / or end groups. In certain embodiments, RNAi agents regulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H.

[0084] As used herein, "antisense RNAi oligonucleotide" means an oligonucleotide that is complementary to a target sequence and contains a region that contains at least one chemical modification suitable for RNAi-mediated nucleic acid reduction.

[0085] As used herein, "standard in vitro assay" means the assay described in Example 2 and reasonable variations thereof.

[0086] As used herein, "stereorandom" or "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that has a random stereochemical configuration. For example, in a population of molecules that includes a stereorandom chiral center, the number of molecules having the stereorandom chiral center's (S) configuration may be the same as the number of molecules having the stereorandom chiral center's (R) configuration ("racemic"), but they do not necessarily have to be the same. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0087] As used herein, a "stabilized phosphate group" refers to a 5'-phosphate analog that is more metabolically stable than the 5'-phosphate naturally occurring on DNA or RNA.

[0088] As used herein, "subject" means a human or a non-human animal. In certain embodiments, the subject is a human. As used herein, the terms "subject" and "animal" are used interchangeably.

[0089] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl sugar moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0090] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can attach a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides, including sugar surrogates, can be incorporated at one or more positions in an oligonucleotide, and such oligonucleotides can hybridize to a complementary oligomeric compound or target nucleic acid.

[0091] As used herein, "symptom" or "characteristic" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is evident to the subject or a medical professional examining or examining the subject. In certain embodiments, the characteristic is evident upon invasive diagnostic testing, including but not limited to postmortem examination. In certain embodiments, the characteristic is evident upon an MRI scan of the brain. In certain embodiments, the symptoms and characteristics include rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, impaired vision, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal loss, gliomas, and the presence of markers of neuronal loss. As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an antisense compound is designed to affect. Target RNA refers to an mRNA transcript, and includes pre-mRNA and mRNA, unless otherwise specified.

[0092] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0093] As used herein, "terminal group" refers to a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0094] As used herein, "treating" means improving a disease or condition in a subject by administering an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent described herein. In certain embodiments, treating a subject improves symptoms for the same symptoms in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of a symptom, or delays the onset of a symptom, delays the progression of a symptom, or delays the severity or frequency of a symptom.

[0095] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent or composition that provides a therapeutic effect to an animal. For example, a therapeutically effective amount ameliorates a symptom of a disease.

[0096] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0097] Embodiment 1. An oligomeric compound, the oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, the nucleobase sequence of the modified oligonucleotide comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20-175, and the modified oligonucleotide comprising at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0098] Embodiment 2. The oligomeric compound of embodiment 1, wherein the nucleobase sequence of the modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 20-175.

[0099] Embodiment 3. The oligomeric compound according to claim 1, wherein the nucleobase sequence of the modified oligonucleotide consists of any one of the nucleobase sequences of SEQ ID NOs: 20 to 175.

[0100] Embodiment 4. The oligomeric compound according to any one of embodiments 1 to 3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of any of SEQ ID NOs: 1 to 9.

[0101] Embodiment 5. The modified oligonucleotide is selected from the group consisting of 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17-30, 17-5 5. The oligomeric compound according to any one of embodiments 1 to 4, consisting of 0, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-29, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0102] Embodiment 6. The nucleobase sequence of the modified oligonucleotide is: An isometric portion of nucleobases 839 to 895 of SEQ ID NO: 1; An isometric portion of nucleobases 1179 to 1235 of SEQ ID NO: 1; An isometric portion of nucleobases 1332 to 1371 of SEQ ID NO: 1; An isometric portion of nucleobases 1383 to 1507 of SEQ ID NO: 1; An isometric portion of nucleobases 1553 to 1660 of SEQ ID NO: 1; An isometric portion of nucleobases 1672 to 1711 of SEQ ID NO: 1; An isometric portion of nucleobases 1808 to 1915 of SEQ ID NO: 1; An isometric portion of nucleobases 1978 to 2034 of SEQ ID NO: 1; An isometric portion of nucleobases 2131 to 2238 of SEQ ID NO: 1; An isometric portion of nucleobases 2284 to 2476 of SEQ ID NO: 1; An isometric portion of nucleobases 2488 to 2586 of SEQ ID NO: 1; An isometric portion of nucleobases 2505 to 2586 of SEQ ID NO: 1; An isometric portion of the nucleic acid bases 2590 to 2790 of SEQ ID NO: 1, or The oligomeric compound according to any one of embodiments 1 to 5, which is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of an isometric portion of nucleobases 2624 to 2790 of SEQ ID NO:1.

[0103] Embodiment 7. The nucleobase sequence of the modified oligonucleotide is: SEQ ID NOs: 45, 46, and 50, SEQ ID NOs: 68, 70, and 72; SEQ ID NOs: 75 and 76, SEQ ID NOs: 80, 81, 82, 83, 84, 85, and 86; SEQ ID NOs: 89, 90, 91, 92, 96, and 97; SEQ ID NOs: 93 and 98, SEQ ID NOs: 105, 106, 107, 108, 109, and 110; SEQ ID NOs: 111, 116, and 117; SEQ ID NOs: 123, 124, 125, 127, 128, and 133; SEQ ID NOs: 129, 130, 134, 135, 136, 137, 139, 140, 143, 144, and 145; SEQ ID NOs: 141, 146, 149, 150, 151, 162, and 164; SEQ ID NOs: 146, 149, 150, 151, 162, and 164; SEQ ID NOs: 147, 169, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175, and 7. The oligomeric compound according to any one of embodiments 1 to 6, comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of a nucleobase sequence selected from SEQ ID NOs: 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175.

[0104] Embodiment 8. The nucleobase sequence of the modified oligonucleotide is: SEQ ID NOs: 45, 46, and 50, SEQ ID NOs: 68, 70, and 72; SEQ ID NOs: 75 and 76, SEQ ID NOs: 80, 81, 82, 83, 84, 85, and 86; SEQ ID NOs: 89, 90, 91, 92, 96, and 97; SEQ ID NOs: 93 and 98, SEQ ID NOs: 105, 106, 107, 108, 109, and 110; SEQ ID NOs: 111, 116, and 117; SEQ ID NOs: 123, 124, 125, 127, 128, and 133; SEQ ID NOs: 129, 130, 134, 135, 136, 137, 139, 140, 143, 144, and 145; SEQ ID NOs: 141, 146, 149, 150, 151, 162, and 164; SEQ ID NOs: 146, 149, 150, 151, 162, and 164; SEQ ID NOs: 147, 169, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175, and 7. The oligomeric compound according to any one of the preceding embodiments, comprising or consisting of a nucleobase sequence selected from SEQ ID NOs: 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175.

[0105] Embodiment 9. The oligomeric compound according to any one of embodiments 1 to 8, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

[0106] Embodiment 10 The oligomeric compound of embodiment 9, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0107] Embodiment 11. The oligomeric compound according to embodiment 10, wherein the bicyclic sugar moiety comprises a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0108] Embodiment 12 The oligomeric compound of embodiment 9, wherein the modified sugar moiety is a non-bicyclic modified sugar moiety.

[0109] Embodiment 13 The oligomeric compound of embodiment 12, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.

[0110] Embodiment 14 The oligomeric compound of embodiment 9, wherein the modified sugar moiety is a sugar surrogate.

[0111] Embodiment 15. The oligomeric compound of embodiment 14, wherein the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).

[0112] Embodiment 16. The oligomeric compound according to any one of embodiments 1 to 15, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0113] Embodiment 17 The oligomeric compound according to embodiment 16, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0114] Embodiment 18 The oligomeric compound according to embodiment 16, wherein at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.

[0115] Embodiment 19. The oligomeric compound according to any one of embodiments 1 to 18, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage.

[0116] Embodiment 20. The oligomeric compound according to any one of embodiments 1 to 19, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0117] Embodiment 21. The oligomeric compound according to any one of embodiments 1 to 19, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a mesyl phosphoramidate internucleoside linkage.

[0118] Embodiment 22. The oligomeric compound of any of embodiments 1-21, wherein the modified oligonucleotide has a backbone motif of 5'-ssooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage.

[0119] Embodiment 23. The oligomeric compound according to any one of embodiments 1 to 22, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0120] Embodiment 24. The oligomeric compound according to embodiment 23, wherein the modified nucleobase is 5-methylcytosine.

[0121] Embodiment 25 The oligomeric compound according to embodiment 23 or 24, wherein each cytosine is a 5-methylcytosine.

[0122] Embodiment 26. The oligomeric compound according to embodiment 23 or 24, wherein one or more cytosine nucleobases are unmodified.

[0123] Embodiment 27. The oligomeric compound according to any one of embodiments 1 to 26, wherein the modified oligonucleotide has a sugar motif of 5'-yfyfyfyfyfyfyfyfyfyfyy-3', wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0124] Embodiment 28. The oligomeric compound according to any one of embodiments 1 to 27, wherein the oligomeric compound comprises a conjugate group.

[0125] Embodiment 29. The oligomeric compound according to embodiment 28, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0126] Embodiment 30 The oligomeric compound of embodiment 29, wherein the conjugate moiety is a lipophilic group.

[0127] Embodiment 31. The oligomeric compound according to embodiment 29 or 30, wherein the conjugate moiety is selected from C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0128] Embodiment 32. The oligomeric compound according to any one of embodiments 29 to 31, wherein the conjugate linker consists of a single bond.

[0129] Embodiment 33 The oligomeric compound according to any one of embodiments 29 to 32, wherein the conjugate linker is cleavable.

[0130] Embodiment 34. An oligomeric compound according to any one of embodiments 1 to 33, comprising a terminal group.

[0131] Embodiment 35. The oligomeric compound according to embodiment 34, wherein the terminal group is a 5'-stabilized phosphate group.

[0132] Embodiment 36. The oligomeric compound according to embodiment 35, wherein the 5'-stabilized phosphate group is selected from cyclopropylphosphonate and vinylphosphonate.

[0133] Embodiment 37. The oligomeric compound according to any one of embodiments 1 to 36, wherein the modified oligonucleotide is an antisense oligonucleotide.

[0134] Embodiment 38. The oligomeric compound according to any one of embodiments 1 to 37, wherein the modified oligonucleotide is an antisense RNAi oligonucleotide.

[0135] Embodiment 39. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound described in any one of embodiments 1 to 38.

[0136] Embodiment 40. The oligomeric duplex of embodiment 39, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide.

[0137] Embodiment 41. The oligomeric duplex of embodiment 39, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that are at least 95% complementary to an equal length portion of the first modified oligonucleotide.

[0138] Embodiment 42. The oligomeric duplex of embodiment 39, wherein the second oligomeric compound comprises a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that are 100% complementary to an equal length portion of the first modified oligonucleotide.

[0139] Embodiment 43 The oligomeric duplex of any one of embodiments 39 to 42, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0140] Embodiment 44 The oligomeric duplex of embodiment 43, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0141] Embodiment 45. The oligomeric duplex of embodiment 44, wherein the bicyclic sugar moiety comprises a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0142] Embodiment 46 The oligomeric duplex of embodiment 43, wherein the modified sugar moiety is a non-bicyclic modified sugar moiety.

[0143] Embodiment 47 The oligomeric duplex of embodiment 46, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.

[0144] Embodiment 48 The oligomeric duplex of embodiment 43, wherein the modified sugar moiety is a sugar surrogate.

[0145] Embodiment 49. The oligomeric duplex of embodiment 48, wherein the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), 6-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).

[0146] Embodiment 50 The oligomeric duplex of any one of embodiments 39 to 49, wherein the second modified oligonucleotide comprises at least one modified internucleoside linkage.

[0147] Embodiment 51 The oligomeric duplex of embodiment 50, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0148] Embodiment 52. The oligomeric duplex of embodiment 50, wherein at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.

[0149] Embodiment 53. The oligomeric duplex of any one of embodiments 39 to 52, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage.

[0150] Embodiment 54. The oligomeric duplex of any one of embodiments 39 to 53, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0151] Embodiment 55. The oligomeric duplex of any one of embodiments 39 to 53, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0152] Embodiment 56. The oligomeric duplex of any one of embodiments 39 to 55, wherein the second modified oligonucleotide has a backbone motif of 5'-ssooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage.

[0153] Embodiment 57 The oligomeric duplex of any one of embodiments 39 to 56, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

[0154] Embodiment 58. The oligomeric duplex of embodiment 57, wherein the modified nucleobase is 5-methylcytosine.

[0155] Embodiment 59 The oligomeric duplex of embodiment 57 or 58, wherein each cytosine is a 5-methylcytosine.

[0156] Embodiment 60. The oligomeric duplex of embodiment 57 or 58, wherein one or more cytosine nucleobases are unmodified.

[0157] Embodiment 61. The oligomeric duplex of any one of embodiments 39 to 59, wherein the second modified oligonucleotide has a sugar motif of 5'-fyfyfyfyfyfyfyfyfyf-3', wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0158] Embodiment 62. An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20 to 175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide; An oligomeric duplex comprising:

[0159] Embodiment 63. An oligomeric duplex comprising: a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20 to 175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 176 to 331, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide; An oligomeric duplex comprising:

[0160] Embodiment 64. An oligomeric duplex comprising: A first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, the first oligomeric compound having a nucleic acid base sequence consisting of any one of SEQ ID NOs: 20 to 175; a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, the second modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 176-331, the nucleobase sequence of the second modified oligonucleotide being at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide; An oligomeric duplex comprising:

[0161] Embodiment 65. The oligomeric duplex of any one of embodiments 62 to 64, wherein the nucleobase sequence of the second modified oligonucleotide is at least 95% of 100% complementary to the nucleobase sequence of the equal length portion of the first modified oligonucleotide.

[0162] Embodiment 66 The oligomeric duplex of any one of embodiments 62 to 65, wherein the first modified oligonucleotide comprises a 5'-stabilizing phosphate group.

[0163] Embodiment 67. The oligomeric duplex of embodiment 66, wherein the 5'-stabilized phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate.

[0164] Embodiment 68. The oligomeric duplex of any one of embodiments 62 to 67, wherein at least one nucleoside of the first modified oligonucleotide and at least one nucleoside of the second modified oligonucleotide each independently comprises a modified sugar moiety.

[0165] Embodiment 69 The oligomeric duplex of embodiment 68, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0166] Embodiment 70. The oligomeric duplex of embodiment 69, wherein the bicyclic sugar moiety comprises a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0167] Embodiment 71. The oligomeric duplex of any one of embodiments 62 to 70, wherein at least one nucleoside of the first modified oligonucleotide and at least one nucleoside of the second modified oligonucleotide each independently comprises a non-bicyclic modified sugar moiety.

[0168] Embodiment 72 The oligomeric duplex of embodiment 71, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety.

[0169] Embodiment 73 The oligomeric duplex of any one of embodiments 62 to 72, wherein at least one nucleoside of the first modified oligonucleotide or the second modified oligonucleotide each independently comprises a sugar surrogate.

[0170] Embodiment 74. The oligomeric duplex of embodiment 73, wherein the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), 6-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).

[0171] Embodiment 75. The oligomeric duplex of any one of embodiments 62 to 74, wherein the first modified oligonucleotide comprises at least one modified internucleoside linkage.

[0172] Embodiment 76 The oligomeric duplex of any one of embodiments 62 to 75, wherein the second modified oligonucleotide comprises at least one modified internucleoside linkage.

[0173] Embodiment 77. The oligomeric duplex of embodiment 75 or 76, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0174] Embodiment 78. The oligomeric duplex of embodiment 75 or 76, wherein at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage.

[0175] Embodiment 79. The oligomeric duplex of embodiment 75 or 77, wherein each internucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0176] Embodiment 80. The oligomeric duplex of embodiment 75 or 78, wherein each internucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a mesyl phosphoramidate internucleoside linkage.

[0177] Embodiment 81. The oligomeric duplex of any one of embodiments 75, 76, 77, 79, or 80, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0178] Embodiment 82. The oligomeric duplex of any one of embodiments 75, 76, 78, 79, or 80, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a mesyl phosphoramidate internucleoside linkage.

[0179] Embodiment 83. The oligomeric duplex of any one of embodiments 62 to 82, wherein the first modified oligonucleotide has a backbone motif of 5'-ssooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage.

[0180] Embodiment 84. The oligomeric duplex of any one of embodiments 62 to 83, wherein the second modified oligonucleotide has a backbone motif of 5'-ssooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage.

[0181] Embodiment 85. The oligomeric duplex of any one of embodiments 62 to 84, wherein the first modified oligonucleotide and the second modified oligonucleotide each independently comprise at least one modified nucleobase.

[0182] Embodiment 86 The oligomeric duplex of embodiment 85, wherein at least one modified nucleobase is 5-methylcytosine.

[0183] Embodiment 87 The oligomeric duplex of embodiment 85 or 86, wherein each cytosine is a 5-methylcytosine.

[0184] Embodiment 88. The oligomeric duplex of embodiment 85 or 86, wherein the first modified oligonucleotide and the second modified oligonucleotide each independently comprise one or more cytosine nucleobases that are unmodified.

[0185] Embodiment 89. At least one nucleoside of the first modified oligonucleotide comprises a 2'-F sugar moiety and at least one nucleoside comprises Position 2 or 14 from the 5' end, Positions 2, 6, or 14 from the 5' end, Positions 2, 14, or 16 from the 5' end, at positions 2, 6, 14, or 16 from the 5' end, or The oligomeric duplex of any one of embodiments 62 to 88, which is at position 2, 6, 8, 9, 14, or 16 from the 5' end.

[0186] Embodiment 90. The nucleosides of the first modified oligonucleotide each comprise a 2'-F sugar moiety, and the nucleosides are Positions 2 and 14 from the 5' end, Positions 2, 6, and 14 from the 5' end; Positions 2, 14, and 16 from the 5' end; positions 2, 6, 14, and 16 from the 5' end, or The oligomeric duplex of any one of embodiments 62 to 88, which is at positions 2, 6, 8, 9, 14, and 16 from the 5' end.

[0187] Embodiment 91. At least one nucleoside of the second modified oligonucleotide comprises a 2'-F sugar moiety and at least one nucleoside comprises 9, 10, or 11 positions from the 5' end, 7, 9, 10, or 11 positions from the 5' end, at positions 11, 12, or 15 from the 5' end, or The oligomeric duplex of any one of embodiments 62-88, which is at position 7, 9, 10, 11, 12, or 15 from the 5' end.

[0188] Embodiment 92. The nucleosides of the second modified oligonucleotide each comprise a 2'-F sugar moiety, and the nucleosides are at positions 9, 10, and 11 from the 5' end, or The oligomeric duplex of any one of embodiments 62 to 88, which is at positions 7, 9, 10, and 11 from the 5' end.

[0189] Embodiment 93 The oligomeric duplex of embodiment 89 or 90, wherein the nucleosides at the remaining positions of the first modified oligonucleotide each contain a 2'-OMe sugar moiety.

[0190] Embodiment 94 The oligomeric duplex of any one of embodiments 89 to 93, wherein the nucleosides at the remaining positions of the second modified oligonucleotide each contain a 2'-OMe sugar moiety.

[0191] Embodiment 95. The oligomeric duplex of any one of embodiments 62-88, wherein the first modified oligonucleotide has a sugar motif of 5'-yfyfyfyfyfyfyfyfyfyfyy-3', wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0192] Embodiment 96. The oligomeric duplex of any one of embodiments 62-88 or 95, wherein the second modified oligonucleotide has a sugar motif of 5'-fyfyfyfyfyfyfyfyfyf-3', wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety.

[0193] Embodiment 97 The oligomeric duplex of any one of embodiments 62 to 96, wherein the second modified oligonucleotide comprises a conjugate group.

[0194] Embodiment 98 The oligomeric duplex of embodiment 97, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0195] Embodiment 99. The oligomeric duplex of embodiment 97 or 98, wherein the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide.

[0196] Embodiment 100. The oligomeric duplex of embodiment 97 or 98, wherein the conjugate group is attached to the second modified oligonucleotide at the 3' end of the second modified oligonucleotide.

[0197] Embodiment 101. The oligomeric duplex of embodiment 97 or 98, wherein the conjugate group is attached to the second modified oligonucleotide at the 2' position of the furanosyl sugar moiety.

[0198] Embodiment 102. The oligomeric duplex of embodiment 97 or 98, wherein the conjugate group is attached to the second modified oligonucleotide via a modified internucleoside linkage.

[0199] Embodiment 103. The oligomeric duplex of any one of embodiments 97-102, wherein the conjugate group comprises C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0200] Embodiment 104 The oligomeric duplex of any one of embodiments 39 to 103, wherein the second modified oligonucleotide comprises a terminal group.

[0201] Embodiment 105. The oligomeric duplex of embodiment 104, wherein the terminal group is an abasic sugar moiety.

[0202] Embodiment 106. The second modified oligonucleotide is selected from the group consisting of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 106. The oligomeric duplex of any one of embodiments 39-105, consisting of 25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0203] Embodiment 107. The oligomeric duplex of any one of embodiments 39 to 106, wherein the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides.

[0204] Embodiment 108. An antisense agent, wherein the antisense agent is an oligomeric duplex according to any one of embodiments 39 to 107.

[0205] Embodiment 109. The antisense agent according to embodiment 108, wherein the antisense agent is an RNAi agent capable of reducing the amount of PRNP RNA by activating RISC / Ago2.

[0206] Embodiment 110. A population of oligomeric duplexes according to embodiments 39 to 107, wherein the population is chiral enriched for modified oligonucleotides containing at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0207] Embodiment 111. The population of embodiment 110, wherein the population is chiral enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0208] Embodiment 112. The population according to embodiment 110, wherein the population is chirally enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages, or the population is chirally enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0209] Embodiment 113. A population of oligomeric compounds comprising a modified oligonucleotide according to any one of embodiments 1 to 38, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom.

[0210] Embodiment 114. The population of oligomeric duplexes according to any one of embodiments 39 to 107, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides of the first oligomeric compound are stereorandom.

[0211] Embodiment 115. The population of oligomeric duplexes according to embodiment 114, wherein all of the phosphorothioate internucleoside linkages of the second modified oligonucleotide of the second oligomeric compound are stereorandom.

[0212] Embodiment 116. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 38, an oligomeric duplex according to any one of embodiments 39 to 107, an antisense agent according to embodiment 108 or 109, or a population according to any one of embodiments 110 to 115, and a pharma- ceutical acceptable diluent or carrier.

[0213] Embodiment 117. The pharmaceutical composition according to embodiment 116, wherein the pharma- cerebrospinal fluid is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF).

[0214] Embodiment 118. The pharmaceutical composition according to embodiment 117, wherein the pharmaceutical composition consists essentially of an oligomeric compound according to any one of embodiments 1 to 38, an oligomeric duplex according to any one of embodiments 39 to 107, an antisense agent according to embodiment 108 or 109, or a population according to any one of embodiments 110 to 115, and aCSF.

[0215] Embodiment 119. The pharmaceutical composition of embodiment 117, wherein the pharmaceutical composition consists essentially of an oligomeric compound according to any one of embodiments 1 to 38, an oligomeric duplex according to any one of embodiments 39 to 107, an antisense agent according to embodiments 108 or 109, or a population according to any one of embodiments 110 to 115, and PBS.

[0216] Embodiment 120. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 1 to 38, an oligomeric duplex according to any one of embodiments 39 to 107, an antisense agent according to embodiment 108 or 109, a population according to any one of embodiments 110 to 115, or a pharmaceutical composition according to any one of embodiments 116 to 119.

[0217] Embodiment 121. The method of embodiment 120, wherein the subject has a prion disease.

[0218] Embodiment 122. The method of embodiment 120, wherein the subject has a synucleinopathy.

[0219] Embodiment 123. The method of embodiment 120, wherein the subject has a tauopathy.

[0220] Embodiment 124. The method of embodiment 120, wherein the subject has Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE).

[0221] Embodiment 125. A method for treating a neurodegenerative disease associated with PrP, comprising administering to a subject having or at risk of developing a neurodegenerative disease associated with PrP a therapeutically effective amount of an oligomeric compound according to any one of embodiments 1 to 38, an oligomeric duplex according to any one of embodiments 39 to 107, an antisense agent according to embodiment 108 or 109, a population according to any one of embodiments 110 to 115, or a pharmaceutical composition according to any one of embodiments 116 to 119, thereby treating the neurodegenerative disease associated with PrP.

[0222] Embodiment 126. The method of embodiment 125, wherein the neurodegenerative disease associated with PrP is a prion disease.

[0223] Embodiment 127. The method of embodiment 125, wherein the PrP-associated neurodegenerative disease is a synucleinopathy.

[0224] Embodiment 128. The method of embodiment 125, wherein the neurodegenerative disease associated with PrP is a tauopathy.

[0225] Embodiment 129. The method of embodiment 125, wherein the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE).

[0226] Embodiment 130. The method of embodiment 129, wherein the CJD is variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD).

[0227] Embodiment 131. The method of embodiment 125, wherein at least one symptom or characteristic of a neurodegenerative disease associated with PrP is ameliorated.

[0228] Embodiment 132. The method of embodiment 131, wherein the at least one symptom or characteristic is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual disturbances, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, gliosis, or the presence of markers of neuronal cell loss.

[0229] Embodiment 133. The method of any one of embodiments 125-132, wherein administering the oligomeric compound of any one of embodiments 1-38, the oligomeric duplex of any one of embodiments 39-107, the antisense agent of embodiment 108 or 109, the population of any one of embodiments 110-115, or the pharmaceutical composition of any one of embodiments 116-119 reduces or delays the onset or progression of rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, spongiform changes in the brain, development of abnormal protein aggregates, neuronal cell loss, or gliosis, or delays death, or reduces the presence of markers of neuronal cell loss.

[0230] Embodiment 134. The method of any one of embodiments 120 to 133, wherein the oligomeric compound of any one of embodiments 1 to 38, the oligomeric duplex of any one of embodiments 39 to 107, the antisense agent of embodiment 108 or 109, the population of any one of embodiments 110 to 115, or the pharmaceutical composition of any one of embodiments 116 to 119 is administered to the central nervous system or systemically.

[0231] Embodiment 135. The method of any one of embodiments 120 to 134, wherein the oligomeric compound of any one of embodiments 1 to 38, the oligomeric duplex of any one of embodiments 39 to 107, the antisense agent of embodiment 108 or 109, the population of any one of embodiments 110 to 115, or the pharmaceutical composition of any one of embodiments 116 to 119 is administered intrathecally.

[0232] Embodiment 136. The method of any one of embodiments 120 to 135, wherein the subject is a human.

[0233] Embodiment 137. A method for reducing PRNP RNA in a cell, comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 38, an oligomeric duplex according to any one of embodiments 39 to 107, an antisense agent according to embodiment 108 or 109, a population according to any one of embodiments 110 to 115, or a pharmaceutical composition according to any one of embodiments 116 to 119.

[0234] Embodiment 138. A method for reducing a prion protein in a cell, comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 38, an oligomeric duplex according to any one of embodiments 39 to 107, an antisense agent according to embodiment 108 or 109, a population according to any one of embodiments 110 to 115, or a pharmaceutical composition according to any one of embodiments 116 to 119.

[0235] Embodiment 139. The method of embodiment 137 or 138, wherein the cell is a neuron or a glial cell.

[0236] Embodiment 140. The method of embodiment 139, wherein the glial cells are astrocytes.

[0237] Embodiment 141. The method of any one of embodiments 137 to 140, wherein the cell is a human cell.

[0238] Embodiment 142. Use of an oligomeric compound according to any one of embodiments 1 to 38, an oligomeric duplex according to any one of embodiments 39 to 107, an antisense agent according to embodiment 108 or 109, a population according to any one of embodiments 110 to 115, or a pharmaceutical composition according to any one of embodiments 116 to 119 for the treatment of a neurodegenerative disease associated with PrP.

[0239] Embodiment 143. Use of an oligomeric compound according to any one of embodiments 1 to 38, an oligomeric duplex according to any one of embodiments 39 to 107, an antisense agent according to embodiment 108 or 109, a population according to any one of embodiments 110 to 115, or a pharmaceutical composition according to any one of embodiments 116 to 119 in the manufacture of a medicament for the treatment of a neurodegenerative disease associated with PrP.

[0240] Embodiment 144. The use according to embodiment 142 or 143, wherein the neurodegenerative disease associated with PrP is a prion disease.

[0241] Embodiment 145. The use according to embodiment 142 or 143, wherein the neurodegenerative disease associated with PrP is a synucleinopathy.

[0242] Embodiment 146. The use according to embodiment 142 or 143, wherein the neurodegenerative disease associated with PrP is a tauopathy.

[0243] Embodiment 147. The use according to embodiment 142 or 143, wherein the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE).

[0244] I. Certain Oligonucleotides Provided herein is an oligomeric compound comprising an antisense oligonucleotide complementary to PRNP RNA, and optionally a sense oligonucleotide complementary to the antisense oligonucleotide. The antisense oligonucleotide and the sense oligonucleotide typically comprise at least one modified nucleoside and / or at least one modified internucleoside bond. Certain modified nucleosides and modified internucleoside bonds suitable for use in antisense oligonucleotides and / or sense oligonucleotides are described below.

[0245] A. Certain modified nucleosides Modified nucleosides contain a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase. Modified nucleosides containing the following modified sugar moieties and / or the following modified nucleobases can be incorporated into antisense and / or sense oligonucleotides.

[0246] 1. Modified sugar moieties In certain embodiments, the sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can contain one or more substitutions that correspond to other types of modified sugar moieties.

[0247] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety that includes one or more acyclic substituents, including but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the one or more acyclic substituents of the non-bicyclic modified sugar moiety are branched.

[0248] In certain embodiments, a non-bicyclic modified sugar moiety comprises a 2'-substituent. Examples of suitable substituents at the 2'-position of a modified sugar moiety include, but are not limited to, -F, -OCH3 ("OMe" or "O-methyl"), and -O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ) and each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 Alkyl, -O(CH2)2ON(CH3)2 ("DMAOE"), 2'-O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), 2'-substituents described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0249] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2 and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 It is an alkyl.

[0250] In certain embodiments, the 2'-substituted sugar moiety of a modified nucleoside comprises a 2' substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 ("DMAOE"), O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").

[0251] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2' substituent selected from F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0252] In certain embodiments, the 2'-substituted sugar moiety of a modified nucleoside comprises a 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0253] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric structure. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric structures other than the naturally occurring β-D-deoxyribosyl structure. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional chiral center at the 2' position compared to the 2'-deoxyfuranosyl sugar moiety. Thus, such sugar moieties have a total of 16 possible isomeric structures. The modified furanosyl sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0254] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 4' position. Examples of suitable substituents at the 4' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO2015 / 106128.

[0255] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3' position. Examples of suitable substituent groups for the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

[0256] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 5' position. Examples of suitable substituent groups for the 5' position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkyl (e.g., methyl (R or S), ethyl).

[0257] In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as the modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0258] In naturally occurring nucleic acids, the sugars are linked to each other 3' to 5'. In certain embodiments, an oligonucleotide comprises one or more nucleosides or sugar moieties linked at alternating positions, e.g., 2' or conversely, 5' to 3'. For example, if the linkage is at the 2' position, the 2'-substituent may instead be at the 3' position.

[0259] Certain modified sugar moieties include a substituent that bridges two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety, hi certain embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,569,686). al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., US 7,741,457, and Swayze et al., US 8,022,193), al., J. Org. Chem., 2009, 74, 118-134), 4'CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', each R, R a , and R bare independently H, a protecting group, or C-C 12 and alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0260] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl, or a protecting group.

[0261] The molecular weight of the particles was obtained by analyzing the solvent, Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443;Albaek et al.,J.Org.Chem.,2006,71,7731-7740;Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.OpinionInvens.Drugs,2001,2,558-561;Braasch et al al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490; al.US6,770,748; Imanishi et al.,USRE44,779; Wengel et al.,US6,794,499; al., US8,034,909, Wengel et al., US8,153,365, Wengel et al., US7,572,582, and Ramasamy et al., US6,525,191, Torsten et al., WO 2004 / 106356 1999 / 014226 Seth et al.,WO 2007 / 134181, Seth et al.,US7,547,684, Seth et al.,US7,666,854, Seth et al.,US8,088,746, Seth et al.,US7,750,131, Seth et al.,US8,030,467, Seth et al. al., US8,268,980, Seth et al., US8,546,556, Seth et al., US8,530,640, Migawa et al., US9,012,421, Seth et al., US8,501,805, Allerson et al., US2008 / 0039618, and Migawa et al. al., US2015 / 0191727. .

[0262] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka]

[0263] Alpha-L-methyleneoxy (4'-CH2-O-2') or alpha-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase the stability of siRNAs in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified in the exemplary embodiments herein, they are in the β-D configuration, unless otherwise specified.

[0264] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0265] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and a substitution at the 2' position (see, for example, Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or a substitution at the 5' position.

[0266] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans can be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] ("F-HNA", see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, and Swayze et al., US9,005,906), which may also be referred to as F-THP or 3'-fluorotetrahydropyran, and nucleosides include the additional modified THP compound having the formula: [ka] wherein, independently for each such modified THP nucleoside: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, an attached conjugate group, or a 5' or 3'-terminal group; and each of q1, q2, q3, q4, q5, q6, and q7 are independently H, a C1-C6 alkyl group, R1 and R2 are each independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0267] In certain embodiments, modified THP nucleosides are provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided, wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0268] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685, Summerton et al., US 5,166,315, Summerton et al., US 5,185,444, and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka]

[0269] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents from the morpholino structures shown above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0270] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Additional PNA compounds suitable for use in RNAi oligonucleotides are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0271] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is a nucleoside in which any of the bonds of the sugar moiety are removed to form an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.

[0272] In certain embodiments, the sugar surrogate is glycerol, such as found in GNA (glycol nucleic acid) nucleosides, as shown below: [ka] In the formula, Bx represents any nucleic acid base.

[0273] Many other modified sugar moieties and sugar surrogates are known in the art and can be used in modified nucleosides.

[0274] 2. Certain modified nucleobases In certain embodiments, an oligonucleotide comprises one or more nucleosides that comprise a modified nucleobase. In certain embodiments, an oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides that comprise a hypoxanthine nucleobase).

[0275] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobases are 2-aminopropyladenine, 5-hydroxymethylcytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C≡C—CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, general bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-ones, 1,3-diazaphenothiazin-2-ones, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-ones (G-clamps).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0276] Publications teaching the preparation of certain of the above modified nucleobases, as well as other modified nucleobases, include Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. et al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al., US6,005,096.

[0277] 3. Certain modified internucleoside linkages The naturally occurring internucleoside bond of RNA and DNA is a 3' to 5' phosphodiester bond. In certain embodiments, the nucleosides of an oligonucleotide can be linked together using one or more modified internucleoside linkages. Two main classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages ("P=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphodiesters, including phosphorothioates ("P=S") and phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can alter, typically increase, the nuclease resistance of oligonucleotides compared to naturally occurring phosphodiester internucleoside linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0278] In certain embodiments, the modified internucleoside linkage is any of those described in WO / 2021 / 030778, incorporated herein by reference. In certain embodiments, the modified internucleoside linkage is any of those described in WO / 2021 / 030778, incorporated herein by reference. In certain embodiments, the modified internucleoside linkage is any of the following formulas: [ka] and for each internucleoside linkage group of the modified oligonucleotide, independently: X is selected from O or S; R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; T is selected from SO2R2, C(=O)R3, and P(=O)R4R5; R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl substituted C1-C6 alkynyl, and a conjugate group; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and a conjugate group; R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0279] In certain embodiments, the modified internucleoside linkage comprises a mesyl phosphoramidate linking group having the following formula: [ka] In certain embodiments, the mesyl phosphoramidate internucleoside linkage may contain a chiral center. In certain embodiments, the modified oligonucleotides containing (Rp) and / or (Sp) mesyl phosphoramidate each include one or more of the following formulas, where "B" represents a nucleobase: [ka]

[0280] Representative internucleoside linkages with chiral centers include, but are not limited to, alkyl phosphonates, mesyl phosphoramidates, and phosphorothioates. Modified oligonucleotides with internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides with stereorandom internucleoside linkages, or as a population of modified oligonucleotides with phosphorothioate or other linkages that contain chiral centers in a specific stereochemical configuration. In certain embodiments, a population of modified oligonucleotides includes phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, a population of modified oligonucleotides includes mesyl phosphoramidate internucleoside linkages, and all mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using a synthetic method that results in random selection of the stereochemical configuration of each phosphorothioate or mesyl phosphoramidate linkage. Nevertheless, each individual phosphorothioate or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain one or more specific phosphorothioate or mesyl phosphoramidate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population.In certain embodiments, a particular arrangement of a particular phosphorothioate or mesyl phosphoramidate bond is present in at least 99% of the molecules in the population. Such a chirally enriched population of modified oligonucleotides can be produced using synthetic methods well known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides with at least one of the indicated phosphorothioates or mesyl phosphoramidates in the (Rp) configuration. In certain embodiments, the (Rp) and / or (Sp) phosphorothioate-containing modified oligonucleotides each comprise one or more of the following formulae, where "B" represents a nucleobase: [ka] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can have a specific stereochemical configuration.

[0281] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research, YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580, Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages including mixed N, O, S, and CH2 constituent moieties.

[0282] In certain embodiments, oligonucleotides (such as antisense and / or sense oligonucleotides) contain one or more inverted nucleosides, as shown below: [ka] In the formula, each Bx independently represents any nucleobase.

[0283] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), and therefore only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of the oligonucleotide.

[0284] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is terminal (i.e., the last nucleoside at one end of an oligonucleotide), and thus only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) can be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to either or both ends of an oligonucleotide.

[0285] In certain embodiments, the nucleic acids can be linked 2' to 5' rather than the standard 3' to 5' linkage. Such linkages are shown below. [ka] , In the formula, each Bx represents any nucleobase.

[0286] B. Antisense Oligonucleotides In certain embodiments, the antisense oligonucleotides comprise multiple linked nucleosides, and certain nucleosides and / or linkages are modified.

[0287] 1. A certain length In certain embodiments, the antisense oligonucleotide comprises 12-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide comprises 17-25 linked nucleosides. In certain embodiments, the antisense oligonucleotide comprises 17-23 linked nucleosides. In certain embodiments, the antisense oligonucleotide comprises 17-21 linked nucleosides. In certain embodiments, the antisense oligonucleotide comprises 18-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide comprises 20-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide comprises 21-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide comprises 23-30 linked nucleosides. In certain embodiments, the antisense oligonucleotide comprises 18-25 linked nucleosides. In certain embodiments, the antisense oligonucleotide comprises 20-22 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 21-23 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 23-24 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 21 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 22 linked nucleosides. In certain embodiments, the antisense oligonucleotide consists of 23 linked nucleosides.

[0288] 2. Certain glycomotifs In certain embodiments, the sugar moiety of at least one nucleoside of the antisense oligonucleotide is a modified sugar moiety.

[0289] In certain embodiments, at least one nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least twelve nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least fourteen nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least fifteen nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least seventeen nucleosides comprise a 2'-OMe sugar moiety. In certain such embodiments, at least eighteen nucleosides comprise a 2'-OMe sugar moiety. In certain such embodiments, at least 20 nucleosides comprise a 2'-OMe sugar moiety.In certain such embodiments, at least 21 nucleosides comprise a 2'-OMe sugar moiety.

[0290] In certain embodiments, at least one nucleoside comprises a 2'-F sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least six nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least eleven nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least twelve nucleosides comprise a 2'-F sugar moiety. In certain embodiments, one, but not more than one, nucleoside comprises a 2'-F sugar moiety. In certain embodiments, one or two nucleosides comprise a 2'-F sugar moiety. In certain embodiments, one to three nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least one to four nucleosides comprise a 2'-F sugar moiety. In certain embodiments, the antisense oligonucleotide has a block of two to four contiguous 2'-F modified nucleosides. In certain embodiments, four nucleosides of the antisense oligonucleotide are 2'-F modified nucleosides, and three of those 2'-F modified nucleosides are contiguous. In certain such embodiments, the remainder of the nucleosides are 2'OMe modified.

[0291] In certain embodiments, one nucleoside of the antisense oligonucleotide is a UNA.

[0292] In certain embodiments, one nucleoside of the antisense oligonucleotide is GNA.

[0293] In certain embodiments, 1 to 4 nucleosides of the antisense oligonucleotide are DNA. In certain such embodiments, the 1 to 4 DNA nucleosides are at one or both termini of the antisense oligonucleotide.

[0294] 3. Certain internucleoside bonds In certain embodiments, at least one bond of the antisense oligonucleotide is a modified bond. In certain embodiments, the 5'-most bond is modified (i.e., the first nucleoside from the 5'-end is linked to the second nucleoside from the 5'-end). In certain embodiments, the two 5'-most bonds are modified. In certain embodiments, the first one or two bonds from the 3'-end are modified. In certain embodiments, the modified bond is a phosphorothioate bond. In certain embodiments, the modified bond is a mesyl phosphoramidate bond. In certain embodiments, all remaining bonds are unmodified phosphodiester bonds.

[0295] In certain embodiments, at least one bond of the antisense oligonucleotide is an inverted bond.

[0296] C. Sense oligonucleotides In certain embodiments, a sense oligonucleotide comprises multiple linked nucleosides, and certain nucleosides and / or linkages are modified.

[0297] 1. A certain length In certain embodiments, the sense oligonucleotide comprises 12-30 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 17-25 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 17-23 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 17-21 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 18-30 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 20-30 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 21-30 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 23-30 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 18-25 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 20-22 linked nucleosides. In certain embodiments, the sense oligonucleotide comprises 21-23 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 23-24 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 21 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 22 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 23 linked nucleosides. In certain embodiments, the sense oligonucleotide consists of 25 linked nucleosides.

[0298] 2. Certain glycomotifs In certain embodiments, the sugar moiety of at least one nucleoside of the sense oligonucleotide is a modified sugar moiety.

[0299] In certain embodiments, at least one nucleoside comprises a 2'-OMe sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least twelve nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least fourteen nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least fifteen nucleosides comprise a 2'-OMe sugar moiety. In certain embodiments, at least seventeen nucleosides comprise a 2'-OMe sugar moiety. In certain such embodiments, at least eighteen nucleosides comprise a 2'-OMe sugar moiety. In certain such embodiments, at least 20 nucleosides comprise a 2'-OMe sugar moiety.In certain such embodiments, at least 21 nucleosides comprise a 2'-OMe sugar moiety.

[0300] In certain embodiments, at least one nucleoside comprises a 2'-F sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least six nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least eleven nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least twelve nucleosides comprise a 2'-F sugar moiety. In certain embodiments, one, but not more than one, nucleoside comprises a 2'-F sugar moiety. In certain embodiments, one or two nucleosides comprise a 2'-F sugar moiety. In certain embodiments, one to three nucleosides comprise a 2'-F sugar moiety. In certain embodiments, at least one to four nucleosides comprise a 2'-F sugar moiety. In certain embodiments, a sense oligonucleotide has a block of two to four contiguous 2'-F modified nucleosides. In certain embodiments, four nucleosides of a sense oligonucleotide are 2'-F modified nucleosides, and three of those 2'-F modified nucleosides are contiguous. In certain such embodiments, the remainder of the nucleosides are 2'OMe modified.

[0301] In certain embodiments, one nucleoside of the sense oligonucleotide is a UNA.

[0302] In certain embodiments, one nucleoside of the sense oligonucleotide is GNA.

[0303] In certain embodiments, 1 to 4 nucleosides of the sense oligonucleotide are DNA. In certain such embodiments, 1 to 4 DNA nucleosides are at one or both termini of the sense oligonucleotide.

[0304] 3. Certain internucleoside bonds In certain embodiments, at least one bond of the sense oligonucleotide is a modified bond. In certain embodiments, the 5'-most bond is modified (i.e., the first nucleoside from the 5'-end is linked to the second nucleoside from the 5'-end). In certain embodiments, the two 5'-most bonds are modified. In certain embodiments, the first one or two bonds from the 3'-end are modified. In certain embodiments, the modified bond is a phosphorothioate bond. In certain embodiments, the modified bond is a mesyl phosphoramidate bond. In certain embodiments, all remaining bonds are unmodified phosphodiester bonds.

[0305] In certain embodiments, at least one bond of the sense oligonucleotide is an inverted bond.

[0306] II. Oligomeric duplex In certain embodiments, an oligomeric compound described herein comprising an oligonucleotide having a nucleobase sequence complementary to the nucleobase sequence of a target nucleic acid is paired with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a first modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside. In certain embodiments, the two oligonucleotides have at least one mismatch with respect to each other. In certain embodiments, the oligomeric duplex is an antisense agent.

[0307] In certain embodiments, the oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 15 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20 to 175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 176 to 331, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide; Includes.

[0308] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of the equal length portion of the first modified oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0309] In certain embodiments, the oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20 to 175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide; Includes.

[0310] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 90% complementary to the nucleobase sequence of the equal portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 95% complementary to the nucleobase sequence of the equal portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is 100% complementary to the nucleobase sequence of the equal portion of the first modified oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0311] In certain embodiments, the oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 20 to 175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 176 to 331, and wherein the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide; Includes.

[0312] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of the equal length portion of the first modified oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0313] In certain embodiments, the oligomeric duplex comprises: A first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, the first oligomeric compound having a nucleic acid base sequence consisting of any one of SEQ ID NOs: 20 to 175; a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, the second modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 176-331, the nucleobase sequence of the second modified oligonucleotide being at least 90% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide; Includes.

[0314] In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of the equal length portion of the first modified oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0315] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 15-30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 22, at least 24, at least 26, at least 28, at least 29, at least 30, at least 32, at least 36, at least 38, at least 39, at least 40, at least 42, at least 44, at least 46, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 9 The nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 176-331, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of the equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of the equal-length portion of the first modified oligonucleotide. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide.In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.In certain embodiments, the oligomeric duplex is an antisense agent.

[0316] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 18-30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 22, at least 24, at least 26, at least 28, at least 29, at least 30, at least 32, at least 36, at least 38, at least 39, at least 40, at least 42, at least 44, at least 46, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 9 The nucleobase sequence of the second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 176-331, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of the equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of the equal-length portion of the first modified oligonucleotide. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide.In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.In certain embodiments, the oligomeric duplex is an antisense agent.

[0317] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 18-30 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 20-175, and the nucleobase sequence of the second modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 176-331, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of the equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of the equal-length portion of the first modified oligonucleotide. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide.In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.In certain embodiments, the oligomeric duplex is an antisense agent.

[0318] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 20-175, and the nucleobase sequence of the second modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 176-331, and the nucleobase sequence of the second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of the equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the second modified oligonucleotide is at least 95% or 100% complementary to the nucleobase sequence of the equal-length portion of the first modified oligonucleotide. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound.In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide.In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide.In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide.In certain embodiments, the oligomeric duplex is an antisense agent.

[0319] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19-29 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are set forth in SEQ ID NOs: 20 / 176, 21 / 177, 22 / 178, 23 / 179, 24 / 180, 25 / 181, 26 / 182, 27 / 183, 28 / 184, 29 / 185, 28 / 186, 29 / 187, 29 / 188, 30 / 189, 31 / 181, 32 / 182, 33 / 183, 34 / 184, 35 / 185, 36 / 186, 37 / 187, 38 / 188, 39 / 189, 40 / 189, 41 / 180, 42 / 181, 43 / 182, 44 / 183, 45 / 184, 46 / 185, 47 / 186, 48 / 187, 49 / 188, 50 / 189, 51 / 189, 52 / 180, 53 / 181, 54 / 182, 55 / 183, 56 / 184, 57 / 185, 58 / 186, 59 / 187, 60 / 188, 61 / 189, 62 / 189, 63 / 180, 64 / 181, 65 / 182, 66 / 183, 67 / 184, 68 / 185, 69 , 30 / 186, 31 / 187, 32 / 188, 33 / 189, 34 / 190, 35 / 191, 36 / 192, 37 / 193, 38 / 194, 39 / 195, 40 / 196, 41 / 197, 42 / 198, 43 / 199, 44 / 200, 45 / 201, 46 / 202, 47 / 2 03, 48 / 204, 49 / 205, 50 / 206, 51 / 207, 52 / 208, 53 / 209, 54 / 210, 55 / 211, 56 / 212, 57 / 213, 58 / 214, 59 / 215, 60 / 216, 61 / 217, 62 / 218, 63 / 219, 64 / 220, 65 / 221, 66 / 222, 67 / 223, 68 / 224, 69 / 225, 70 / 226, 71 / 227, 72 / 228, 73 / 229, 74 / 230, 75 / 231, 76 / 232, 77 / 233, 78 / 234, 79 / 235, 80 / 236, 81 / 237, 82 / 238, 8 3 / 239, 84 / 240, 85 / 241, 86 / 242, 87 / 243, 88 / 244, 89 / 245, 90 / 246, 91 / 247, 92 / 248, 93 / 249, 94 / 250, 95 / 251, 96 / 252, 97 / 253, 98 / 254, 99 / 255, 100 / 256 , 101 / 257, 102 / 258, 103 / 259, 104 / 260, 105 / 261, 106 / 262, 107 / 263, 108 / 264, 109 / 265, 110 / 266, 111 / 267, 112 / 268, 113 / 269, 114 / 270, 115 / 271, 116 / 272, 117 / 273, 118 / 274, 119 / 275, 120 / 276, 121 / 277, 122 / 278, 123 / 279, 124 / 280, 125 / 281, 126 / 282, 127 / 283, 128 / 284, 129 / 285, 130 / 286, 131 / 287,132 / 288, 133 / 289, 134 / 290, 135 / 291, 136 / 292, 137 / 293, 138 / 294, 139 / 295, 140 / 296, 141 / 297, 142 / 298, 143 / 299, 144 / 300, 145 / 301, 146 / 302, 147 / 303, 148 / 304, 149 / 305, 150 / 306, 151 / 307, 152 / 308, 153 / 309, 154 / 310, 155 / 311, 156 / 312, 157 / 313, 158 / 314, 159 / 315, 160 / 316, 161 / 317, 1 The modified oligonucleotide comprises any of the pairs of nucleobase sequences listed in SEQ ID NO: 62 / 318, 163 / 319, 164 / 320, 165 / 321, 166 / 322, 167 / 323, 168 / 324, 169 / 325, 170 / 326, 171 / 327, 172 / 328, 173 / 329, 174 / 330, or 175 / 331, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first sequence listed in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second sequence listed in the pair. In certain embodiments, the first oligomeric compound is an antisense compound. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0320] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are set forth in SEQ ID NOs: 20 / 176, 21 / 177, 22 / 178, 23 / 179, 24 / 180, 25 / 181, 26 / 182, 27 / 183, 28 / 184, 29 / 185, 30 / 186, 31 / 187, 32 / 189, 33 / 188, 34 / 189, 35 / 180, 36 / 181, 37 / 182, 38 / 183, 39 / 184, 40 / 185, 41 / 186, 42 / 187, 43 / 189, 44 / 188, 45 / 189, 46 / 180, 47 / 181, 48 / 182, 49 / 183, 50 / 184, 51 / 185, 52 / 186, 53 / 187, 54 / 188, 55 / 189, 56 / 189, 57 / 180, 58 / 181, 59 / 182, 60 / 183, 61 / 184, 62 / 185, 63 / 186, 64 / 187, 65 / 188, 66 / 189, 67 / 181, 68 / 182, 69 / 183, 70 / 184, 71 / 185, 72 / 186, , 31 / 187, 32 / 188, 33 / 189, 34 / 190, 35 / 191, 36 / 192, 37 / 193, 38 / 194, 39 / 195, 40 / 196, 41 / 197, 42 / 198, 43 / 199, 44 / 200, 45 / 201, 46 / 202, 47 / 203, 48 / 204, 49 / 205, 50 / 206, 51 / 207, 52 / 208, 53 / 209, 54 / 210, 55 / 211, 56 / 212, 57 / 213, 58 / 214, 59 / 215, 60 / 216, 61 / 217, 62 / 2 04, 49 / 205, 50 / 206, 51 / 207, 52 / 208, 53 / 209, 54 / 210, 55 / 211, 56 / 212, 57 / 213, 58 / 214, 59 / 215, 60 / 216, 61 / 217, 62 / 218, 63 / 219, 64 / 220, 65 / 221, 66 / 222, 67 / 223, 68 / 224, 69 / 225, 70 / 226, 71 / 227, 72 / 228, 73 / 229, 74 / 230, 75 / 231, 76 / 232, 77 / 233, 78 / 234, 79 / 235, 80 / 236, 81 / 237, 82 / 238, 83 / 239, 8 4 / 240, 85 / 241, 86 / 242, 87 / 243, 88 / 244, 89 / 245, 90 / 246, 91 / 247, 92 / 248, 93 / 249, 94 / 250, 95 / 251, 96 / 252, 97 / 253, 98 / 254, 99 / 255, 100 / 256, 101 / 25 7, 102 / 258, 103 / 259, 104 / 260, 105 / 261, 106 / 262, 107 / 263, 108 / 264, 109 / 265, 110 / 266, 111 / 267, 112 / 268, 113 / 269, 114 / 270, 115 / 271, 116 / 272, 117 / 273, 118 / 274, 119 / 275, 120 / 276, 121 / 277, 122 / 278, 123 / 279, 124 / 280, 125 / 281, 126 / 282, 127 / 283, 128 / 284, 129 / 285, 130 / 286, 131 / 287, 132 / 288,133 / 289, 134 / 290, 135 / 291, 136 / 292, 137 / 293, 138 / 294, 139 / 295, 140 / 296, 141 / 297, 142 / 298, 143 / 299, 144 / 300, 145 / 301, 146 / 302, 147 / 303, 148 / 304, 149 / 305, 150 / 306, 151 / 307, 152 / 308, 153 / 309, 154 / 310, 155 / 311, 156 / 312, 157 / 313, 158 / 314, 159 / 315, 160 / 316, 161 / 317, 162 / 3 The modified oligonucleotide is any of the pairs of nucleobase sequences listed in Table 18, 163 / 319, 164 / 320, 165 / 321, 166 / 322, 167 / 323, 168 / 324, 169 / 325, 170 / 326, 171 / 327, 172 / 328, 173 / 329, 174 / 330, or 175 / 331, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first sequence listed in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second sequence listed in the pair. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0321] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, bicyclic sugar moieties, e.g., 2'-4' bridges selected from -O-CH2- and -O-CH(CH3)-, and non-bicyclic sugar moieties, such as 2'-MOE sugar moieties, 2'-F sugar moieties, 2'-OMe sugar moieties, or 2'-NMA sugar moieties. In certain embodiments, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise an unmodified 2'-deoxyribosyl sugar moiety. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe. In certain embodiments, one or more 2'-F sugar moieties have an identity other than 2'-β-D-ribosyl. In certain embodiments, one or more 2'-F sugar moieties are in a 2'-β-D-xylosyl conformation.

[0322] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholino, hexitol nucleic acid (HNA), fluoro-hexitol nucleic acid (F-HNA), glycol nucleic acid (GNA) sugar surrogates, and unlocked nucleic acid (UNA). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate, and the sugar surrogate may be GNA.

[0323] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19-29 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified sugar moiety is a non-bicyclic sugar moiety. In certain embodiments, the non-bicyclic sugar moiety is selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the first modified oligonucleotide comprises 2, 3, 4, 5, 6, or more nucleosides comprising a non-bicyclic sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the second modified oligonucleotide comprises two, three, four, or more nucleosides comprising a non-bicyclic sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, at least one nucleoside at position 2, 6, 8, 9, 14, or 16 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 6, 14, or 16 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 6, or 14 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 14, or 16 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, the nucleoside at positions 2 or 14 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 6, 8, 9, 14, and 16 from the 5' end of the first modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 6, 14, and 16 from the 5' end of the first modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments,The nucleosides at positions 2, 6, and 14 from the 5' end of the first modified oligonucleotide each contain a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 14, and 16 from the 5' end of the first modified oligonucleotide each contain a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 2 and 14 from the 5' end of the first modified oligonucleotide each contain a 2'-F sugar moiety. In certain embodiments, at least one nucleoside from the remaining positions of the first modified oligonucleotide each contains a 2'-OMe sugar moiety. In certain embodiments, the nucleosides at the remaining positions of the first modified oligonucleotide each contain a 2'-OMe sugar moiety. In certain embodiments, at least one nucleoside at positions 7, 9, 10, 11, 12, or 15 from the 5' end of the second modified oligonucleotide each contains a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at positions 7, 9, 10, or 11 from the 5' end of the second modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at positions 9, 10, or 11 from the 5' end of the second modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at positions 11, 12, or 15 from the 5' end of the second modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 7, 9, 10, and 11 from the 5' end of the second modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 9, 10, and 11 from the 5' end of the second modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments, at least one nucleoside from the remaining positions of the second modified oligonucleotide comprises a 2'-OMe sugar moiety. In certain embodiments, the nucleosides at the remaining positions of the second modified oligonucleotide each comprise a 2'-OMe sugar moiety. In certain embodiments, the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are set forth in SEQ ID NOs: 20 / 176, 21 / 177, 22 / 178, 23 / 179, 24 / 180, 25 / 181,26 / 182、27 / 183、28 / 184、29 / 185、30 / 186、31 / 187、32 / 188、33 / 189、34 / 190、35 / 191、36 / 192、37 / 193、38 / 194、39 / 195、40 / 196、41 / 197、42 / 198、43 / 199、44 / 200、45 / 201、46 / 202、47 / 203、48 / 204、49 / 205、50 / 206、51 / 207、52 / 208、53 / 209、54 / 210、55 / 211、56 / 212、57 / 213、58 / 214、59 / 215、60 / 216、61 / 217、62 / 218、63 / 219、64 / 220、65 / 221、66 / 222、67 / 223、68 / 224、69 / 225、70 / 226、71 / 227、72 / 228、73 / 229、74 / 230、75 / 231、76 / 232、77 / 233、78 / 234、79 / 235、80 / 236、81 / 237、82 / 238、83 / 239、84 / 240、85 / 241、86 / 242、87 / 243、88 / 244、89 / 245、90 / 246、91 / 247、92 / 248、93 / 249、94 / 250、95 / 251、96 / 252、97 / 253、98 / 254、99 / 255、100 / 256、101 / 257、102 / 258、103 / 259、104 / 260、105 / 261、106 / 262、107 / 263、108 / 264、109 / 265、110 / 266、111 / 267、112 / 268、113 / 269、114 / 270、115 / 271、116 / 272、117 / 273、118 / 274、119 / 275、120 / 276、121 / 277、122 / 278、123 / 279、124 / 280、125 / 281、126 / 282、127 / 283、128 / 284、129 / 285、130 / 286、131 / 287、132 / 288、133 / 289、134 / 290、135 / 291、136 / 292、137 / 293、138 / 294、139 / 295、140 / 296、141 / 297、142 / 298、143 / 299、144 / 300、145 / 301、146 / 302、147 / 303、148 / 304、149 / 305、150 / 306、151 / 307、152 / 308、153 / 309、154 / 310、155 / 311、156 / 312、157 / 313、158 / 314、159 / 315、The modified oligonucleotide is any of the pairs of nucleobase sequences listed in 160 / 316, 161 / 317, 162 / 318, 163 / 319, 164 / 320, 165 / 321, 166 / 322, 167 / 323, 168 / 324, 169 / 325, 170 / 326, 171 / 327, 172 / 328, 173 / 329, 174 / 330, or 175 / 331, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first sequence number listed in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second sequence number listed in the pair. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0324] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified sugar moiety is a non-bicyclic sugar moiety. In certain embodiments, the non-bicyclic sugar moiety is selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the first modified oligonucleotide comprises 2, 3, 4, 5, 6, or more nucleosides comprising a non-bicyclic sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the second modified oligonucleotide comprises two, three, four, or more nucleosides comprising a non-bicyclic sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, at least one nucleoside at position 2, 6, 8, 9, 14, or 16 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 6, 14, or 16 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 6, or 14 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at position 2, 14, or 16 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, the nucleoside at positions 2 or 14 from the 5' end of the first modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 6, 8, 9, 14, and 16 from the 5' end of the first modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 6, 14, and 16 from the 5' end of the first modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments,The nucleosides at positions 2, 6, and 14 from the 5' end of the first modified oligonucleotide each contain a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 2, 14, and 16 from the 5' end of the first modified oligonucleotide each contain a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 2 and 14 from the 5' end of the first modified oligonucleotide each contain a 2'-F sugar moiety. In certain embodiments, at least one nucleoside from the remaining positions of the first modified oligonucleotide each contains a 2'-OMe sugar moiety. In certain embodiments, the nucleosides at the remaining positions of the first modified oligonucleotide each contain a 2'-OMe sugar moiety. In certain embodiments, at least one nucleoside at positions 7, 9, 10, 11, 12, or 15 from the 5' end of the second modified oligonucleotide each contains a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at positions 7, 9, 10, or 11 from the 5' end of the second modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at positions 9, 10, or 11 from the 5' end of the second modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, at least one nucleoside at positions 11, 12, or 15 from the 5' end of the second modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 7, 9, 10, and 11 from the 5' end of the second modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 9, 10, and 11 from the 5' end of the second modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments, at least one nucleoside from the remaining positions of the second modified oligonucleotide comprises a 2'-OMe sugar moiety. In certain embodiments, the nucleosides at the remaining positions of the second modified oligonucleotide each comprise a 2'-OMe sugar moiety. In certain embodiments, the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are set forth in SEQ ID NOs: 20 / 176, 21 / 177, 22 / 178, 23 / 179, 24 / 180, 25 / 181,26 / 182、27 / 183、28 / 184、29 / 185、30 / 186、31 / 187、32 / 188、33 / 189、34 / 190、35 / 191、36 / 192、37 / 193、38 / 194、39 / 195、40 / 196、41 / 197、42 / 198、43 / 199、44 / 200、45 / 201、46 / 202、47 / 203、48 / 204、49 / 205、50 / 206、51 / 207、52 / 208、53 / 209、54 / 210、55 / 211、56 / 212、57 / 213、58 / 214、59 / 215、60 / 216、61 / 217、62 / 218、63 / 219、64 / 220、65 / 221、66 / 222、67 / 223、68 / 224、69 / 225、70 / 226、71 / 227、72 / 228、73 / 229、74 / 230、75 / 231、76 / 232、77 / 233、78 / 234、79 / 235、80 / 236、81 / 237、82 / 238、83 / 239、84 / 240、85 / 241、86 / 242、87 / 243、88 / 244、89 / 245、90 / 246、91 / 247、92 / 248、93 / 249、94 / 250、95 / 251、96 / 252、97 / 253、98 / 254、99 / 255、100 / 256、101 / 257、102 / 258、103 / 259、104 / 260、105 / 261、106 / 262、107 / 263、108 / 264、109 / 265、110 / 266、111 / 267、112 / 268、113 / 269、114 / 270、115 / 271、116 / 272、117 / 273、118 / 274、119 / 275、120 / 276、121 / 277、122 / 278、123 / 279、124 / 280、125 / 281、126 / 282、127 / 283、128 / 284、129 / 285、130 / 286、131 / 287、132 / 288、133 / 289、134 / 290、135 / 291、136 / 292、137 / 293、138 / 294、139 / 295、140 / 296、141 / 297、142 / 298、143 / 299、144 / 300、145 / 301、146 / 302、147 / 303、148 / 304、149 / 305、150 / 306、151 / 307、152 / 308、153 / 309、154 / 310、155 / 311、156 / 312、157 / 313、158 / 314、159 / 315、The modified oligonucleotide is any of the pairs of nucleobase sequences listed in 160 / 316, 161 / 317, 162 / 318, 163 / 319, 164 / 320, 165 / 321, 166 / 322, 167 / 323, 168 / 324, 169 / 325, 170 / 326, 171 / 327, 172 / 328, 173 / 329, 174 / 330, or 175 / 331, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first sequence number listed in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second sequence number listed in the pair. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0325] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19-29 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, each nucleoside of the first modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the nucleosides of the first modified oligonucleotide have a 2'-F / 2'-OMe sugar motif alternating with the nucleoside at position 1 from the 5' end comprising a 2'-OMe sugar moiety. In certain embodiments, each nucleoside of the second modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the nucleosides of the second modified oligonucleotide have an alternating 2'-F / 2'-OMe sugar motif with the nucleoside first from the 5' end comprising a 2'-F sugar moiety. In certain embodiments, the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 20 / 176, 21 / 177, 22 / 178, 23 / 179, 24 / 180, 25 / 181, 26 / 182, 27 / 183, 28 / 184, 29 / 185, 30 / 186, 31 / 187, 32 / 188, 33 / 189, 34 / 190, 35 / 191, 36 / 192, 37 / 193, 38 / 194, 39 / 195, 40 / 196, 41 / 197, 42 / 198, 43 / 199, 44 / 191, 45 / 192, 46 / 193, 47 / 194, 48 / 195, 49 / 196, 50 / 197, 51 / 198, 52 / 199, 53 / 198, 54 / 199, 55 / 199, 56 / 190, 57 / 191, 58 / 191, 59 / 192, 60 / 193, 61 / 194, 62 / 195, 63 / 196, 64 / 197, 65 / 198, 66 / 199, 67 / 199, 68 / 190, 69 / 191, 70 / 192, 71 / 193, 72 / 194, 73 / 195, 74 / 195, 75 / 196, 76 / 197, 77 / 198, 78 / 199, 79 3 / 199, 44 / 200, 45 / 201, 46 / 202, 47 / 203, 48 / 204, 49 / 205, 50 / 206, 51 / 207, 52 / 208, 53 / 209, 54 / 210, 55 / 211, 56 / 212, 57 / 213, 58 / 214, 59 / 215, 60 / 216, 61 / 217, 62 / 218, 63 / 219, 64 / 220, 65 / 221, 66 / 222, 67 / 223, 68 / 224, 69 / 225, 70 / 226, 71 / 227, 72 / 228, 73 / 229, 74 / 230,75 / 231, 76 / 232, 77 / 233, 78 / 234, 79 / 235, 80 / 236, 81 / 237, 82 / 238, 83 / 239, 84 / 240, 85 / 241, 86 / 242, 87 / 243, 88 / 244, 89 / 245, 90 / 246, 91 / 247, 92 / 248, 93 / 249, 94 / 250, 95 / 251, 96 / 252, 97 / 253, 98 / 254, 99 / 255, 100 / 256, 101 / 257, 102 / 258, 103 / 259, 104 / 260, 105 / 261, 106 / 2 62, 107 / 263, 108 / 264, 109 / 265, 110 / 266, 111 / 267, 112 / 268, 113 / 269, 114 / 270, 115 / 271, 116 / 272, 117 / 273, 118 / 274, 119 / 275, 120 / 276, 121 / 277, 122 / 278, 123 / 279, 124 / 280, 125 / 281, 126 / 282, 127 / 283, 128 / 284, 129 / 285, 130 / 286, 131 / 287, 132 / 288, 133 / 289, 134 / 290, 13 5 / 291, 136 / 292, 137 / 293, 138 / 294, 139 / 295, 140 / 296, 141 / 297, 142 / 298, 143 / 299, 144 / 300, 145 / 301, 146 / 302, 147 / 303, 148 / 304, 149 / 305, 150 / 306, 151 / 307, 152 / 308, 153 / 309, 154 / 310, 155 / 311, 156 / 312, 157 / 313, 158 / 314, 159 / 315, 160 / 316, 161 / 317, 162 / 318, 163 / 31 9, 164 / 320, 165 / 321, 166 / 322, 167 / 323, 168 / 324, 169 / 325, 170 / 326, 171 / 327, 172 / 328, 173 / 329, 174 / 330, or 175 / 331, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO listed in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO listed in the pair. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound isIn certain embodiments, the second modified oligonucleotide is a sense compound. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0326] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, each nucleoside of the first modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the nucleosides of the first modified oligonucleotide have a 2'-F / 2'-OMe sugar motif alternating with the nucleoside at position 1 from the 5' end comprising a 2'-OMe sugar moiety. In certain embodiments, each nucleoside of the second modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the nucleosides of the second modified oligonucleotide have an alternating 2'-F / 2'-OMe sugar motif with the nucleoside first from the 5' end comprising a 2'-F sugar moiety. In certain embodiments, the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 20 / 176, 21 / 177, 22 / 178, 23 / 179, 24 / 180, 25 / 181, 26 / 182, 27 / 183, 28 / 184, 29 / 185, 30 / 186, 31 / 187, 32 / 188, 33 / 189, 34 / 190, 35 / 191, 36 / 192, 37 / 193, 38 / 194, 39 / 195, 40 / 196, 41 / 197, 42 / 198, 43 / 199, 44 / 200, 45 / 201, 46 / 202, 47 / 203, 48 / 204, 49 / 205, 50 / 206, 51 / 207, 52 / 208, 53 / 209, 54 / 210, 55 / 211, 56 / 212, 57 / 213, 58 / 214, 59 / 220, 60 / 221, 61 / 222, 62 / 223, 63 / 224, 64 / 225, 65 / 226, 66 / 227, 67 / 228, 68 / 229, 69 / 230, 70 / 231, 71 / 232, 72 / 233, 73 / 234, 74 / 235, 75 / 236, 76 / 237, 77 / 238, 78 / 239, 79 99, 44 / 200, 45 / 201, 46 / 202, 47 / 203, 48 / 204, 49 / 205, 50 / 206, 51 / 207, 52 / 208, 53 / 209, 54 / 210, 55 / 211, 56 / 212, 57 / 213, 58 / 214, 59 / 215, 60 / 216, 61 / 217, 62 / 218, 63 / 219, 64 / 220, 65 / 221, 66 / 222, 67 / 223, 68 / 224, 69 / 225, 70 / 226, 71 / 227, 72 / 228, 73 / 229, 74 / 230, 75 / 231,76 / 232, 77 / 233, 78 / 234, 79 / 235, 80 / 236, 81 / 237, 82 / 238, 83 / 239, 84 / 240, 85 / 241, 86 / 242, 87 / 243, 88 / 244, 89 / 245, 90 / 246, 91 / 247, 92 / 248, 93 / 249, 94 / 250, 95 / 251, 96 / 252, 97 / 253, 98 / 254, 99 / 255, 100 / 256, 101 / 257, 102 / 258, 103 / 259, 104 / 260, 105 / 261, 106 / 262, 10 7 / 263, 108 / 264, 109 / 265, 110 / 266, 111 / 267, 112 / 268, 113 / 269, 114 / 270, 115 / 271, 116 / 272, 117 / 273, 118 / 274, 119 / 275, 120 / 276, 121 / 277, 122 / 278, 123 / 279, 124 / 280, 125 / 281, 126 / 282, 127 / 283, 128 / 284, 129 / 285, 130 / 286, 131 / 287, 132 / 288, 133 / 289, 134 / 290, 135 / 2 91, 136 / 292, 137 / 293, 138 / 294, 139 / 295, 140 / 296, 141 / 297, 142 / 298, 143 / 299, 144 / 300, 145 / 301, 146 / 302, 147 / 303, 148 / 304, 149 / 305, 150 / 306, 151 / 307, 152 / 308, 153 / 309, 154 / 310, 155 / 311, 156 / 312, 157 / 313, 158 / 314, 159 / 315, 160 / 316, 161 / 317, 162 / 318, 163 / 319, The modified oligonucleotide may be any of the pairs of nucleobase sequences listed in 164 / 320, 165 / 321, 166 / 322, 167 / 323, 168 / 324, 169 / 325, 170 / 326, 171 / 327, 172 / 328, 173 / 329, 174 / 330, or 175 / 331, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first sequence listed in the pair, and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second sequence listed in the pair. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the second oligomeric compound isIn certain embodiments, the second modified oligonucleotide is a sense compound. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0327] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 19-29 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15-29 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, each nucleoside of the first modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the nucleosides of the first modified oligonucleotide have a 2'-F / 2'-OMe sugar motif alternating with the nucleoside at position 1 from the 5' end comprising a 2'-OMe sugar moiety. In certain embodiments, each nucleoside of the second modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, at least one nucleoside at positions 9, 10, or 11 from the 5' end of the second modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, the nucleosides at positions 9, 10, and 11 from the 5' end of the second modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments, the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 20 / 176, 21 / 177, 22 / 178, 23 / 179, 24 / 180, 25 / 181, 26 / 182, 27 / 183, 28 / 184, 29 / 185, 30 / 186, 31 / 187, 32 / 188, 33 / 189, 34 / 190, 35 / 191, 36 / 192, 37 / 193, 38 / 194, 39 / 195, 40 / 196, 41 / 197, 42 / 198, 43 / 199, 44 / 190, 45 / 191, 46 / 192, 47 / 193, 48 / 194, 49 / 195, 50 / 196, 51 / 197, 52 / 198, 53 / 199, 54 / 190, 55 / 191, 56 / 192, 57 / 193, 58 / 194, 59 / 195, 60 / 196, 61 / 197, 62 / 198, 63 / 199, 64 / 190, 65 / 191, 66 / 193, 67 / 194, 68 / 195, 69 / 196, 70 / 197, 71 / 198, 72 / 199, 73 / 199, 74 / 199, 75 / 190, 76 / 191, 77 / 191, 78 / 192, 79 9 / 195, 40 / 196, 41 / 197, 42 / 198, 43 / 199, 44 / 200, 45 / 201, 46 / 202, 47 / 203, 48 / 204, 49 / 205, 50 / 206, 51 / 207, 52 / 208, 53 / 209, 54 / 210, 55 / 211, 56 / 212, 57 / 213, 58 / 214, 59 / 215, 60 / 216, 61 / 217, 62 / 218, 63 / 219, 64 / 220, 65 / 221, 66 / 222,67 / 223, 68 / 224, 69 / 225, 70 / 226, 71 / 227, 72 / 228, 73 / 229, 74 / 230, 75 / 231, 76 / 232, 77 / 233, 78 / 234, 79 / 235, 80 / 236, 81 / 237, 82 / 238, 83 / 239, 84 / 240, 85 / 241, 86 / 242, 87 / 243, 88 / 244, 89 / 245, 90 / 246, 91 / 247, 92 / 248, 93 / 249, 94 / 250, 95 / 251, 96 / 252, 97 / 253, 98 / 254, 99 / 255, 100 / 256, 101 / 257, 102 / 258, 103 / 259, 104 / 260, 105 / 261, 106 / 262, 107 / 263, 108 / 264, 109 / 265, 110 / 266, 111 / 267, 112 / 268, 113 / 269, 114 / 270, 115 / 271, 116 / 272, 117 / 273, 118 / 274, 119 / 275, 120 / 276, 121 / 277, 122 / 278, 123 / 279, 124 / 280, 125 / 281, 126 / 282, 127 / 283, 128 / 284, 129 / 285, 130 / 286, 131 / 28 7, 132 / 288, 133 / 289, 134 / 290, 135 / 291, 136 / 292, 137 / 293, 138 / 294, 139 / 295, 140 / 296, 141 / 297, 142 / 298, 143 / 299, 144 / 300, 145 / 301, 146 / 302, 147 / 303, 148 / 304, 149 / 305, 150 / 306, 151 / 307, 152 / 308, 153 / 309, 154 / 310, 155 / 311, 156 / 312, 157 / 313, 158 / 314, 159 / 315, 160 / 316, 161 / 317, 162 / 318, 163 / 319, 164 / 320, 165 / 321, 166 / 322, 167 / 323, 168 / 324, 169 / 325, 170 / 326, 171 / 327, 172 / 328, 173 / 329, 174 / 330, or 175 / 331, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO listed in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO listed in the pair. In certain embodiments, the first modified oligonucleotide comprisesIn certain embodiments, the second oligomeric compound is an antisense oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0328] In certain embodiments, the oligomeric duplex comprises a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides and a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, wherein at least one nucleoside of the first modified oligonucleotide and / or the second modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, each nucleoside of the first modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, the nucleosides of the first modified oligonucleotide have a 2'-F / 2'-OMe sugar motif alternating with the nucleoside at position 1 from the 5' end comprising a 2'-OMe sugar moiety. In certain embodiments, each nucleoside of the second modified oligonucleotide comprises a modified sugar moiety selected from a 2'-F sugar moiety and a 2'-OMe sugar moiety. In certain embodiments, at least one nucleoside located at position 9, 10, or 11 from the 5' end of the second modified oligonucleotide comprises a 2'-F sugar moiety. In certain embodiments, the nucleosides located at positions 9, 10, and 11 from the 5' end of the second modified oligonucleotide each comprise a 2'-F sugar moiety. In certain embodiments, the nucleobase sequences of the first modified oligonucleotide and the second modified oligonucleotide are selected from the group consisting of SEQ ID NOs: 20 / 176, 21 / 177, 22 / 178, 23 / 179, 24 / 180, 25 / 181, 26 / 182, 27 / 183, 28 / 184, 29 / 185, 30 / 186, 31 / 187, 32 / 188, 33 / 189, 34 / 190, 35 / 191, 36 / 192, 37 / 193, 38 / 194, 39 / 195, 40 / 196, 41 / 197, 42 / 198, 43 / 199, 44 / 190, 45 / 191, 46 / 192, 47 / 193, 48 / 194, 49 / 195, 50 / 196, 51 / 197, 52 / 198, 53 / 199, 54 / 190, 55 / 191, 56 / 192, 57 / 193, 58 / 194, 59 / 195, 60 / 196, 61 / 197, 62 / 198, 63 / 199, 64 / 190, 65 / 191, 66 / 193, 67 / 194, 68 / 195, 69 / 196, 70 / 197, 71 / 198, 72 / 199, 73 / 199, 74 / 199, 75 / 190, 76 / 191, 77 / 191, 78 / 192, 79 9 / 195, 40 / 196, 41 / 197, 42 / 198, 43 / 199, 44 / 200, 45 / 201, 46 / 202, 47 / 203, 48 / 204, 49 / 205, 50 / 206, 51 / 207, 52 / 208, 53 / 209, 54 / 210, 55 / 211, 56 / 212, 57 / 213, 58 / 214, 59 / 215, 60 / 216, 61 / 217, 62 / 218, 63 / 219, 64 / 220, 65 / 221, 66 / 222,67 / 223, 68 / 224, 69 / 225, 70 / 226, 71 / 227, 72 / 228, 73 / 229, 74 / 230, 75 / 231, 76 / 232, 77 / 233, 78 / 234, 79 / 235, 80 / 236, 81 / 237, 82 / 238, 83 / 239, 84 / 240, 85 / 241, 86 / 242, 87 / 243, 88 / 244, 89 / 245, 90 / 246, 91 / 247, 92 / 248, 93 / 249, 94 / 250, 95 / 251, 96 / 252, 97 / 253, 98 / 254, 99 / 255, 100 / 256, 101 / 257, 102 / 258, 103 / 259, 104 / 260, 105 / 261, 106 / 262, 107 / 263, 108 / 264, 109 / 265, 110 / 266, 111 / 267, 112 / 268, 113 / 269, 114 / 270, 115 / 271, 116 / 272, 117 / 273, 118 / 274, 119 / 275, 120 / 276, 121 / 277, 122 / 278, 123 / 279, 124 / 280, 125 / 281, 126 / 282, 127 / 283, 128 / 284, 129 / 285, 130 / 286, 131 / 28 7, 132 / 288, 133 / 289, 134 / 290, 135 / 291, 136 / 292, 137 / 293, 138 / 294, 139 / 295, 140 / 296, 141 / 297, 142 / 298, 143 / 299, 144 / 300, 145 / 301, 146 / 302, 147 / 303, 148 / 304, 149 / 305, 150 / 306, 151 / 307, 152 / 308, 153 / 309, 154 / 310, 155 / 311, 156 / 312, 157 / 313, 158 / 314, 159 / 315, 160 / 316, 161 / 317, 162 / 318, 163 / 319, 164 / 320, 165 / 321, 166 / 322, 167 / 323, 168 / 324, 169 / 325, 170 / 326, 171 / 327, 172 / 328, 173 / 329, 174 / 330, or 175 / 331, wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of the first SEQ ID NO listed in the pair and the nucleobase sequence of the second modified oligonucleotide comprises the nucleobase sequence of the second SEQ ID NO listed in the pair. In certain embodiments, the first modified oligonucleotide comprisesIn certain embodiments, the second oligomeric compound is an antisense oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second oligomeric compound is a sense compound. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. In certain embodiments, the oligomeric duplex is an antisense agent.

[0329] In any of the oligomeric duplexes described herein, at least one internucleoside bond of the first modified oligonucleotide and / or the second modified oligonucleotide may comprise a modified internucleoside bond. In certain embodiments, the modified internucleoside bond is a phosphorothioate internucleoside bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the first modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, at least one of the first, second, or third internucleoside bonds from the 5'-end and / or 3'-end of the second modified oligonucleotide comprises a phosphorothioate bond. In certain embodiments, the modified internucleoside bond is a mesyl phosphoramidate internucleoside bond. In certain embodiments, at least one of the first or second internucleoside linkages from the 5'-end and / or 3'-end of a first modified oligonucleotide comprises a mesyl phosphoramidate internucleoside linkage. In certain embodiments, at least one of the first or second internucleoside linkages from the 5'-end and / or 3'-end of a second modified oligonucleotide comprises a mesyl phosphoramidate internucleoside linkage.

[0330] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage.

[0331] In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can be independently selected from a phosphodiester, a phosphorothioate, or a mesyl phosphoramidate internucleoside linkage.

[0332] In any of the oligomeric duplexes described herein, each internucleoside linkage of the first modified oligonucleotide and / or the second modified oligonucleotide can be independently selected from a phosphodiester, a phosphorothioate internucleoside linkage.

[0333] In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the first modified oligonucleotide can be 5'-ssooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage. In any of the oligomeric duplexes described herein, the internucleoside linkage motif of the second modified oligonucleotide can be 5'-ssooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage.

[0334] In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and / or the second modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

[0335] In any of the oligomer duplexes described herein, one or more nucleobases of the first modified oligonucleotide and / or the second modified oligonucleotide can be unmodified nucleobases.In certain embodiments, one or more cytosine nucleases of the first modified oligonucleotide are unmodified.In certain embodiments, one or more cytosine nucleases of the second modified oligonucleotide are unmodified.

[0336] In any of the oligomeric duplexes described herein, the first modified oligonucleotide can include a stabilized phosphate group attached to the 5' position of the 5'-most nucleoside. In certain embodiments, the stabilized phosphate group comprises a cyclopropylphosphonate or an (E)-vinylphosphonate.

[0337] In any of the oligomeric duplexes described herein, the first modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5' end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at an internal position. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide via a 2' modification of the furanosyl sugar moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide via a modified internucleoside linkage. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for the transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1.In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0338] In any of the oligomeric duplexes described herein, the second modified oligonucleotide may comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at an internal position. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide via a 2' modification of the furanosyl sugar moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide via a modified internucleoside linkage. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for the transferrin receptor (TfR) (also known as TfR1 and CD71). In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or a fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1.In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl. In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0339] In certain embodiments, the antisense agent comprises an antisense compound that comprises an oligomeric compound or oligomeric duplex described herein. In certain embodiments, the antisense agent can comprise an oligomeric compound or oligomeric duplex described herein and is an RNAi agent that can reduce the amount of PRNP RNA by activating RISC / Ago2.

[0340] Certain embodiments provide an oligomeric agent comprising two or more oligomeric duplexes. In certain embodiments, the oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, the oligomeric agent comprises two or more of the same oligomeric duplexes, which may be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked together at their 3' ends. In certain embodiments, the two or more oligomeric duplexes are covalently linked together by a glycol linker, such as a tetraethylene glycol linker. Certain such compounds are described, for example, in Alterman, et al., Nature Biotech., 37:844-894, 2019.

[0341] Certain end groups In certain embodiments, the oligomeric compound comprises a terminal group. In certain such embodiments, the oligomeric compound comprises a phosphorus-containing group at the 5'-end of the antisense oligonucleotide and / or the sense oligonucleotide. In certain embodiments, the terminal group is a phosphate group stabilized with phosphate. The 5'-terminal phosphorus-containing group can be 5'-terminal phosphate (5'-P), 5'-terminal phosphorothioate (5'-PS), 5'-terminal phosphorodithioate (5'-PS2), 5'-terminal vinylphosphonate (5'-VP), 5'-terminal methylphosphonate (MePhos), or 5'-deoxy-5'-C-malonyl. When the 5'-terminal phosphorus-containing group is 5'-terminal vinylphosphonate, the 5'VP can be either a 5'-E-VP isomer (i.e., trans-vinyl phosphate), a 5'-Z-VP isomer (i.e., cis-vinyl phosphate), or a mixture thereof. Such phosphate groups can be attached to either antisense or sense oligonucleotides, but are typically attached to antisense oligonucleotides, as they have been shown to improve the activity of certain RNAi agents. See, e.g., Prakash et al., Nucleic Acids Res., 43(6):2993-3011, 2015; Elkayam, et al., Nucleic Acids Res., 45(6):3528-3536, 2017; Parmar, et al. ChemBioChem, 17(11)985-989; 2016, and Harastzi, et al., Nucleic Acids Res., 45(13):7581-7592, 2017. In certain embodiments, the phosphate stabilizing group is 5'-cyclopropylphosphonate. See, e.g., WO / 2018 / 027106.

[0342] Certain conjugated oligomeric compounds In certain embodiments, the oligomeric compound comprises one or more conjugate groups. The conjugate group is composed of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide of the oligomeric compound. The conjugate group can be attached to either or both ends of the oligonucleotide and / or any internal position. In certain embodiments, the conjugate group modifies one or more properties of the oligomeric compound, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0343] Conjugation of one or more carbohydrate moieties to an oligomeric compound can optimize one or more properties of the oligomeric compound. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of an oligomeric compound. For example, the ribose sugar of one or more ribonucleotide subunits of an oligomeric compound can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit is thus replaced is referred to herein as a ribose-replacement modified subunit ("RRMS"), which is a modified sugar moiety. The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can include two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can include one or more double bonds.

[0344] A. Certain Specific Conjugate Groups Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantaneacetic acid, palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, i, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038 / mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0345] 1. Conjugate part Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0346] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0347] 2. Conjugate Linker The conjugate moiety is linked to the oligomeric compound via a conjugate linker. In certain embodiments, the conjugate group is a single chemical bond (i.e., the conjugate moiety is linked to the oligonucleotide via the conjugate linker by a single bond). In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0348] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0349] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0350] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, for example, one known in the art to be useful for linking a conjugate group to a parent compound, such as an oligonucleotide, provided herein. In general, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site of the compound, and the other is selected to bind to a composite group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0351] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 and alkynyl, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0352] In certain embodiments, the conjugate linker comprises 1-5 linker nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise modified sugar moieties. In certain embodiments, the linker-nucleosides are unmodified. In certain embodiments, the linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker nucleoside to be cleaved from the compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0353] In this specification, linker-nucleosides are not considered as part of oligonucleotide.Thus, in the embodiment where an oligomeric compound comprises two oligonucleotides, each of which comprises a specific number or range of linking nucleosides and an antisense oligonucleotide with a specific percentage of complementarity with reference nucleic acid, and the oligomeric compound also comprises a conjugate group that comprises a conjugate linker that comprises linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide of the oligomeric compound and are not used to determine the percentage of complementarity of the antisense oligonucleotide with reference nucleic acid.Unless otherwise indicated, the conjugate linker comprises 10 or less linker nucleosides.In certain embodiments, the conjugate linker comprises 5 or less linker-nucleosides.In certain embodiments, the conjugate linker comprises 3 or less linker-nucleosides.In certain embodiments, the conjugate linker comprises 2 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises no more than one linker nucleoside.

[0354] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligomeric compound. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are more likely to be taken up by certain cell types, but after the oligomeric compound is taken up, it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligomeric compound. Thus, certain conjugates may contain one or more cleavable moieties, typically within the conjugate linker. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0355] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0356] In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the compound by a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'-terminal nucleoside or the 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0357] 3. Certain cell-targeting conjugate moieties In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor on target cell.In certain embodiments, each ligand has affinity for at least one receptor on the surface of mammalian liver cells.In certain embodiments, each ligand has affinity for hepatic asialoglycoprotein receptor (ASGP-R).In certain embodiments, each ligand is a carbohydrate.

[0358] In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. For example, see WO2011 / 131693, WO2014 / 064257.

[0359] A certain motif Oligomeric duplexes can be described by motifs or particular features. In certain embodiments, oligomeric duplexes having motifs or particular features described herein are antisense agents.

[0360] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' end; (iii) 2'-F modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 19 and 20, and between nucleoside positions 20 and 21 (counting from the 5' end). and a sense oligonucleotide having the formula: (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3, 5, 9, 11, 13, 15, 17, 19, and 21-23, and 2'-F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5' end); and an antisense oligonucleotide having the formula: The two nucleosides at the 3' end of the antisense oligonucleotide are overhanging nucleosides, and the ends of the oligomeric duplex comprising the 5' end of the antisense oligonucleotide and the 3' end of the sense oligonucleotide are blunt (i.e., neither oligonucleotide has an overhanging nucleoside at its end; instead, the hybridizing region of the sense oligonucleotide comprises the 3'-most nucleoside of the sense oligonucleotide, which hybridizes to the 5'-most nucleoside of the antisense oligonucleotide).

[0361] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' end, and (iii) 2'-F modifications at positions 1, 3, 5, 7, 9-11, 13, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 12, 14-16, 18, and 20 (counting from the 5' end). and a sense oligonucleotide having the formula: (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3, 5, 9, 11-13, 15, 17, 19, 21, and 23, and 2'F modifications at positions 2, 4, 6-8, 10, 14, 16, 18, 20, and 22 (counting from the 5' end); and (iii) phosphorothioate internucleoside linkages between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5' end); An antisense oligonucleotide having the formula: and The two nucleosides at the 3' end of the antisense oligonucleotide are overhanging nucleosides, and the ends of the oligomeric duplex comprising the 5' end of the antisense oligonucleotide and the 3' end of the sense oligonucleotide are blunt (i.e., neither oligonucleotide has an overhanging nucleoside at its end; instead, the hybridizing region of the sense oligonucleotide comprises the 3'-most nucleoside of the sense oligonucleotide, which hybridizes to the 5'-most nucleoside of the antisense oligonucleotide).

[0362] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' end; (iii) 2'-F modifications at positions 1, 3, 5, 7, 9-11, 13, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5' end) and a sense oligonucleotide having the formula: (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3, 5, 7, 9, 11-13, 15, 17, 19, and 21-23, and 2'F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5' end); and (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5' end); and an antisense oligonucleotide having the formula: The oligomeric duplex contains a two nucleoside overhang at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide.

[0363] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' end; (iii) 2'-OMe modifications at positions 1-6, 8, 10, and 12-21, and 2'-F modifications at positions 7 and 9, and a deoxynucleoside at position 11 (counting from the 5' end); and (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5' end) and a sense oligonucleotide having the formula: (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3, 7, 9, 11, 13, 15, 17, and 19-23, and 2'F modifications at positions 2, 4-6, 8, 10, 12, 14, 16, and 18 (counting from the 5' end); and (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5' end); and an antisense oligonucleotide having the formula: The oligomeric duplex contains two nucleoside overhangs at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide.

[0364] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' end; (iii) 2'-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2'-F modifications at positions 7, and 9 to 11, and (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5' end) and a sense oligonucleotide having the formula: (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 8, 10-13, 15, and 17-23, and 2'F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5' end); and (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5' end); and an antisense oligonucleotide having the formula: The oligomeric duplex has a two nucleotide overhang at the 3' end of the antisense oligonucleotide and contains a blunt end at the 5' end of the antisense oligonucleotide.

[0365] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 21 nucleosides; (ii) a conjugate attached to the 3' end; (iii) 2'-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2'-F modifications at positions 7, and 9 to 11, and (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5' end) and a sense oligonucleotide having the formula: (b) (i) a length of 23 nucleosides; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 10-13, 15, and 17-23, and 2'F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5' end); and (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 21 and 22, and between nucleoside positions 22 and 23 (counting from the 5' end); and an antisense oligonucleotide having the formula: The oligomeric duplex contains two nucleoside overhangs at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide.

[0366] In certain embodiments, the oligomeric duplexes described herein are (a) (i) a length of 19 nucleosides; (ii) a conjugate attached to the 3' end; (iii) 2'-OMe modifications at positions 1 to 4, 6, and 10 to 19, and 2'-F modifications at positions 5, and 7 to 9, and (iv) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, and between nucleoside positions 2 and 3 (counting from the 5' end) and a sense oligonucleotide having the formula: (b) (i) a length of 21 nucleosides; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 10-13, 15, and 17-21, and 2'F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5' end); and (iii) phosphorothioate internucleoside linkages between nucleoside positions 1 and 2, between nucleoside positions 2 and 3, between nucleoside positions 19 and 20, and between nucleoside positions 20 and 21 (counting from the 5' end); and an antisense oligonucleotide having the formula: The oligomeric duplex contains two nucleoside overhangs at the 3' end of the antisense oligonucleotide and a blunt end at the 5' end of the antisense oligonucleotide.

[0367] In any of the above embodiments, the conjugate at the 3' end of the sense oligonucleotide can include a targeting moiety.In certain embodiments, the cell targeting moiety targets neurotransmitter receptors.In certain embodiments, the cell targeting moiety targets neurotransmitter transporters.In certain embodiments, the cell targeting moiety targets GABA transporters.

[0368] In certain embodiments, the oligomeric duplex comprises a sense oligonucleotide consisting of 21 nucleosides and an antisense oligonucleotide consisting of 23 nucleosides, the sense oligonucleotide contains at least one motif of three consecutive 2'F-modified nucleosides at positions 9, 10, 11 from the 5' end, and the antisense oligonucleotide contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleosides at positions 11, 12, 13 from the 5' end, and one end of the oligomeric duplex is blunt, while the other end contains two nucleotide overhangs.Preferably, the two nucleotide overhangs are at the 3' end of the antisense oligonucleotide.

[0369] In certain embodiments, when two nucleotide overhangs are present at the 3' end of the antisense oligonucleotide, there may be two phosphorothioate internucleoside bonds between the terminal three nucleotides, two of which are overhanging nucleotides, and the third nucleotide is the paired nucleotide next to the overhanging nucleotide. In certain embodiments, the oligomer duplex further comprises two phosphorothioate internucleoside bonds between the terminal three nucleotides at both the 5' end of the sense oligonucleotide and the 5' end of the antisense oligonucleotide. In certain embodiments, all nucleosides of the sense oligonucleotide and the antisense oligonucleotide of the oligomer duplex are modified nucleosides. In certain embodiments, each nucleoside is independently modified with 2'-O-methyl or 3'-fluoro, for example, in an alternating motif. Optionally, the oligomer duplex comprises a conjugate.

[0370] In certain embodiments, all nucleotides of the sense and antisense oligonucleotides of the oligomeric duplex, including those that are part of a motif, may be modified. Each nucleotide may be modified with the same or different modifications, which may include one or more changes to one or both of the non-linked phosphate oxygens, changes to the components of the ribose sugar, such as the 2' hydroxyl on the ribose sugar, wholesale replacement of the phosphate moiety with a "dephospho" linker, modification or replacement of naturally occurring bases, and replacement or modification of the ribose-phosphate backbone.

[0371] In certain embodiments, each nucleoside of the sense oligonucleotide and the antisense oligonucleotide is independently modified with LNA, cEt, UNA, HNA, CeNA, 2'-MOE, 2'-OMe, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. The oligomer duplex may contain more than one modification. In one embodiment, each nucleoside of the sense oligonucleotide and the antisense oligonucleotide is independently modified with 2'-O-methyl or 2'-F. In certain embodiments, the modification is a 2'-NMA modification.

[0372] The term "alternating motif" as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleosides of an oligonucleotide. The alternating nucleosides may refer to one every other nucleoside, or one every three nucleosides, or a similar pattern. For example, if A, B, and C each represent one type of modification to a nucleoside, the alternating motif may be "ABABABABABAB...", "AABBAABBAABB...", "AABAABAABAAB...", "AAABAAABAAAB...", "AAABBBAAABBB...", or "ABCABCABCABC...", etc.

[0373] The types of modifications included in the alternating motif can be the same or different. For example, if A, B, C, D each represent one type of modification on a nucleoside, the alternation pattern, i.e., the modifications on all other nucleosides, can be the same, but each sense or antisense oligonucleotide can choose from several possibilities of modifications within the alternating motif, such as "ABABAB...", "ACACAC...", "BDBDBD...", or "CDCDCD...".

[0374] In certain embodiments, the modification pattern of the alternating motif on the sense oligonucleotide is shifted relative to the modification pattern of the alternating motif on the antisense oligonucleotide. The shift can be such that a group of modified nucleotides of the sense oligonucleotide corresponds to a group of different modified nucleotides of the antisense oligonucleotide, or vice versa. For example, when a sense oligonucleotide is paired with an antisense oligonucleotide in an oligomer duplex, within the double-stranded region, the alternating motif in the sense oligonucleotide can start with "ABABAB" from 5' to 3' of the oligonucleotide, and the alternating motif in the antisense oligonucleotide can start with "BABABA" from 5' to 3' of the oligonucleotide. As another example, within the double-stranded region, the alternating motif in the sense oligonucleotide can start with "AABBAABB" from 5' to 3' of the oligonucleotide, and the alternating motif in the antisense oligonucleotide can start with "BBAABBAA" from 5' to 3' of the oligonucleotide, resulting in a complete or partial shift of 10 patterns of modification between the sense oligonucleotide and the antisense oligonucleotide.

[0375] In certain embodiments, the oligomer duplex comprises a pattern of alternating motifs of 2'-O-methyl and 2'-F modifications on the sense oligonucleotide, initially has a shift to the pattern of alternating motifs of 2'-O-methyl and 2'-F modifications on the antisense oligonucleotide, i.e., the 2'-O-methyl modified nucleotide on the sense oligonucleotide base is paired with the 2'-F modified nucleotide on the antisense oligonucleotide, and vice versa. Position 1 of the sense oligonucleotide can start with 2'-F modification, and position 1 of the antisense oligonucleotide can start with 2'-O-methyl modification.

[0376] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides into sense and / or antisense oligonucleotides interrupts the initial modification pattern present in the sense and / or antisense oligonucleotides. This interruption of the modification pattern of sense and / or antisense oligonucleotides by introducing one or more motifs of three identical modifications on three consecutive nucleotides into sense and / or antisense oligonucleotides surprisingly enhances gene silencing activity against target genes. In one embodiment, when a motif of three identical modifications on three consecutive 25 nucleotides is introduced into any of the oligonucleotides, the modification of the nucleotide next to the motif is a different modification from the modification of the motif. For example, the portion of the sequence containing the motif is "...NaYYYNb...", where "Y" represents the modification of the motif of three identical modifications on three consecutive nucleotides, "Na" and "Nb" represent the modification of the nucleotide next to the motif "YYY" that is different from the modification of Y, and Na and Nb can be the same modification or different modifications. Alternatively, where wing modifications are present, Na and / or Nb may or may not be present.

[0377] In certain embodiments, the sense oligonucleotide may be represented by formula (I): 5'n p -N a -(XXX)iN b -YYY-N b -(ZZZ) r N a -n q 3'(I) During the ceremony, i and j are each independently 0 or 1; p and q each independently represent 0 to 6; each N a independently represent 0 to 25 linked nucleosides comprising at least two different modified nucleosides; each N b independently represent 0 to 10 linked nucleosides; each n p and n q independently represent an overhanging nucleoside; N b and Y do not have the same modification, XXX, YYY, and ZZZ each independently represent a modified nucleoside, where each X nucleoside has the same modification, each Y nucleoside has the same modification, and each Z nucleoside has the same modification. In certain embodiments, each Y includes a 2'-F modification.

[0378] In certain embodiments, N a and N b includes alternating pattern modifications.

[0379] In certain embodiments, the YYY motif occurs at or near the cleavage site of the target nucleic acid.For example, when the oligomer duplex has a double-stranded region of 17-23 nucleotides in length, the YYY motif can occur near or near the cleavage site of the sense oligonucleotide (e.g., can occur at 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13 positions), and counting starts from the first nucleotide from the 5' end, or optionally, counting starts from the first paired nucleotide in the double-stranded region from the 5' end.

[0380] In certain embodiments, the oligomeric duplex antisense oligonucleotide may be represented by the following formula: 5'n q -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p 3'(II) During the ceremony, k and l are each independently 0 or 1; p' and q' are each independently 0 to 6; each Na ' independently represent 0 to 25 linked nucleotides that contain at least two different modified nucleotides; each N b ' independently represents 0 to 10 linked nucleotides; each n p ' and n q ' independently represents an overhanging nucleoside; N b ' and Y' do not have the same modification, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent a modified nucleoside, where each X' nucleoside has the same modification, each Y' nucleoside has the same modification, and each Z' nucleoside has the same modification. In certain embodiments, each Y' includes a 2'-F modification. In certain embodiments, each Y' includes a 2'-OMe modification.

[0381] In certain embodiments, N a ' and / or N b ' includes alternating pattern modifications.

[0382] In certain embodiments, the Y'Y'Y' motif occurs at or near the cleavage site of the target nucleic acid. For example, when the oligomer duplex has a double-stranded region of 17-23 nucleotides in length, the Y'Y'Y' motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense oligonucleotide, counting starting from the first nucleotide from the 5' end, or optionally counting starting from the first paired nucleotide in the double-stranded region from the 5' end. Preferably, the Y'Y'Y' motif occurs at positions 11, 12, 13.

[0383] In certain embodiments, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0384] Thus, the antisense oligonucleotide may be represented by the formula: 5'n q '-N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p '3'(IIb); 5'n q '-N a '-Y'Y'Y'-N b '-X'X'X'-n p '3' (IIc); or 5'n q '-N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p '3'(IId).

[0385] When the antisense oligonucleotide is represented by formula IIb, N b Each N' represents 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a ' independently represents 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0386] When the antisense oligonucleotide is represented by formula IIc, N b Each N' represents 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a ' independently represents 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0387] When the antisense oligonucleotide is represented by formula IId, N b Each N' represents 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a Each N' independently represents 2 to 20, 2 to 15, or 2 to 10 linked nucleosides. b ' is 0, 1, 2, 3, 4, 5, or 6.

[0388] In certain embodiments, k is 0, l is 0, and the antisense oligonucleotide may be represented by the following formula: 5'n p '-Na'-Y'Y'Y'-N a '-n q '3'(Ia).

[0389] When the antisense oligonucleotide is represented by Formula IIa, each N a ' independently represents 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0390] Each X', Y', and Z' can be the same or different from each other.

[0391] Each nucleoside of the sense oligonucleotide and the antisense oligonucleotide can be independently modified with LNA, UNA, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2'-fluoro. For example, each nucleoside of the sense oligonucleotide and the antisense oligonucleotide can be independently modified with 2'-O-methyl or 2'-fluoro. Each X, Y, Z, X', Y', and Z' can specifically represent 2'-O-methyl modification or 2'-fluoro modification. In certain embodiments, the modification is 2'-NMA modification.

[0392] In certain embodiments, the sense oligonucleotide of the oligomeric duplex may contain a YYY motif occurring at positions 9, 10, and 11 of the oligonucleotide when the double-stranded region is 21 nucleotides, counting starting from the first nucleotide from the 5' end, or optionally counting starting from the first paired nucleotide in the double-stranded region from the 5' end, and Y represents a 2'-F modification. The sense oligonucleotide may further contain a XXX motif or a ZZZ motif as a wing modification at the opposite end of the double-stranded region, where XXX and ZZZ each independently represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0393] In certain embodiments, the antisense oligonucleotide may contain a Y'Y'Y' motif occurring at positions 11, 12, 13 of the oligonucleotide, counting starting from the first nucleotide from the 5' end, or optionally counting starting from the first paired nucleotide in the double-stranded region from the 5' end, where Y' represents a 2'-O-methyl modification. The antisense oligonucleotide may further contain an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the double-stranded region, where X'X'X' and Z'Z'Z' each independently represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0394] A sense oligonucleotide represented by any one of the above formulas Ia, Ib, Ic, and Id forms a duplex with an antisense oligonucleotide represented by any one of the above formulas IIa, IIb, IIc, and IId, respectively.

[0395] Thus, the oligomeric duplexes described herein can include a sense oligonucleotide and an antisense oligonucleotide, each oligonucleotide having between 14 and 30 nucleotides, and the oligomeric duplex is represented by formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense:3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5' During the ceremony, i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and N a ' independently represents 0 to 25 linked nucleosides, each sequence containing at least two different modified nucleotides; each N b and N b ' independently represents 0 to 10 linked nucleosides; each n p ',n p , n q ', and n q each may be present or absent and independently represents an overhang nucleotide; XXX, YYY, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0396] In certain embodiments, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In other embodiments, k is 0 and l is 0; or k is 1 and l is 0; or k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

[0397] Exemplary combinations of sense and antisense oligonucleotides that form oligomeric duplexes include the following formulas: 5'n p -N a -YYY-N a -n q 3' 3'np'-N a '-Y'Y'Y'-N a 'n q '5' (IIIa) 5'n p -N a -YYY-N b -ZZZ-N a-n q 3' 3'n p '-N a '-Y'Y'Y'-Nb'-Z'Z'Z'-N a 'n q '5' (IIIb) 5'np-N a -XXX-N b -YYY-N a -n q 3' 3'np'-N a '-X'X'X'-N b '-Y'Y'Y'-N a '-n q '5' (IIIc) 5'np-N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'np'-N a '-X'X'X'-N b '-Y'Y'Y'-N b '-Z'Z'Z'-N a -n q '5' (IIId)

[0398] When the oligomer duplex has the formula IIIa, each N a independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0399] When the oligomeric duplex is represented by formula IIIb, each N b Each N independently represents 1 to 10, 1 to 7, 1 to 5, or 1 to 4 linked nucleosides. a independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0400] When the oligomeric duplex is represented by formula IIIc, each N b , N bEach N′ independently represents 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0401] When the oligomeric duplex is represented by formula IIId, each N b , N b Each N′ independently represents 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a , N a Each N′ independently represents 2 to 20, 2 to 15, or 2 to 10 linked nucleosides. a , N a ', N b , N b ' independently includes alternating pattern modifications.

[0402] Each of X, Y, and Z in formulas III, IIIa, IIIb, IIIc, and IIId can be the same as or different from one another.

[0403] When the oligomeric duplex is represented by formula III, IIIa, IIIb, IIIc, and / or IIId, at least one of the Y nucleotides can be base-paired with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides can be base-paired with a corresponding Y' nucleotide, or all three of the Y nucleotides can be base-paired with a corresponding Y' nucleotide.

[0404] When the oligomeric duplex is represented by formula IIIb or IIId, at least one of the Z nucleotides can be base-paired with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides can be base-paired with a corresponding Z' nucleotide, or all three of the Z nucleotides can be base-paired with a corresponding Z' nucleotide.

[0405] When the oligomeric duplex is represented by formula IIIc or IIId, at least one of the X nucleotides can be base-paired to one of the X' nucleotides. Alternatively, at least two of the X nucleotides can be base-paired to a corresponding X' nucleotide, or all three of the X nucleotides can be base-paired to a corresponding X' nucleotide.

[0406] In certain embodiments, the modification of a Y nucleotide is different from the modification on a Y' nucleotide, the modification on a Z nucleotide is different from the modification on a Z' nucleotide, and / or the modification on an X nucleotide is different from the modification on an X' nucleotide.

[0407] In certain embodiments, when the oligomeric duplex is represented by formula IIId, N a The modification is a 2'-O-methyl or a 2'-fluoro modification. In another embodiment, when the oligomeric duplex is represented by formula IIId, N a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In another embodiment, when the oligomeric duplex is represented by formula IIId, N a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In certain embodiments, when the oligomeric duplex is represented by formula IIId, N is linked to the adjacent nucleotide via a phosphorothioate bond, and the sense oligonucleotide is conjugated to one or more cell targeting groups linked via a bivalent or trivalent branched linker. a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p' is linked to an adjacent nucleotide via a phosphorothioate bond, the sense oligonucleotide comprises at least one phosphorothioate bond, and the sense oligonucleotide is conjugated to one or more cell targeting groups attached via a divalent or trivalent branched linker.

[0408] In certain embodiments, when the oligomeric duplex is represented by Formula IIIa, N a The modification is a 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p ' is linked to an adjacent nucleotide via a phosphorothioate bond, the sense oligonucleotide comprises at least one phosphorothioate bond, and the sense oligonucleotide is conjugated to one or more cell targeting groups attached via a divalent or trivalent branched linker.

[0409] In certain embodiments, the modification is a 2'-NMA modification.

[0410] III. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acid to provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense agents. In certain antisense activities, antisense agents or parts of antisense agents are incorporated into RNA-induced silencing complexes (RISCs), ultimately resulting in cleavage of target nucleic acid. For example, certain antisense compounds result in cleavage of target nucleic acid by Argonaute. Antisense agents with antisense oligonucleotides incorporated into RISCs are RNAi agents. RNAi agents can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0411] In certain embodiments, the RNAi agent is capable of RISC-mediated regulation of target nucleic acid in a cell. In certain embodiments, such compounds reduce or inhibit the amount or activity of target nucleic acid by 25% or more in a standard in vitro assay in which they are described in Example 2. In certain embodiments, the RNAi agent selectively affects more than one target nucleic acid. Such an RNAi agent comprises a nucleobase sequence that hybridizes to more than one target nucleic acid and produces more than one desired antisense activity. In certain embodiments, the RNAi agent does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in such a way that it produces significant undesired antisense activity.

[0412] Antisense activity can be observed directly or indirectly. In certain embodiments, observing or detecting RNAi activity involves observing or detecting a change in the amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a phenotypic change in a cell or subject.

[0413] IV. Certain Target Nucleic Acids In certain embodiments, the antisense agent comprises an antisense oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the oligomeric compound or oligomeric duplex comprises an antisense oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain embodiments, the oligomeric compound or oligomeric duplex is an RNAi agent.

[0414] A. Target / Duplex Complementarity In certain embodiments, the antisense agent comprises an antisense oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the oligomeric compound or oligomeric duplex comprises an antisense oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the antisense oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the antisense oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the antisense oligonucleotide and comprises a region of 100% or full complementarity to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0415] In certain embodiments, antisense oligonucleotide comprises one or more mismatched nucleobases with target nucleic acid.In certain embodiments, the antisense activity against target is reduced by such mismatch, but the activity against non-target is reduced by a larger amount.Therefore, in certain embodiments, the selectivity of antisense oligonucleotide is improved.

[0416] In certain embodiments, the antisense oligonucleotide comprises a region that is complementary to the target nucleic acid. In certain embodiments, the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleosides. In certain embodiments, the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleosides. In certain embodiments, the complementary region comprises 70%, 80%, 85%, 90%, 95% of the nucleosides of the antisense oligonucleotide. In certain embodiments, the complementary region comprises all of the nucleosides of the antisense oligonucleotide. In certain embodiments, the complementary region of the antisense oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the complementary region of the antisense oligonucleotide is 100% complementary to the target nucleic acid.

[0417] In certain embodiments, the oligomeric duplex comprises a sense oligonucleotide. In certain embodiments, the antisense agent comprises a sense oligonucleotide. In such embodiments, the sense oligonucleotide comprises a region complementary to the antisense oligonucleotide. In certain embodiments, the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleosides. In certain embodiments, the complementary region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 consecutive nucleosides. In certain embodiments, the complementary region comprises 70%, 80%, 85%, 90%, 95% of the nucleosides of the sense oligonucleotide. In certain embodiments, the complementary region comprises all of the nucleosides of the sense oligonucleotide. In certain embodiments, the complementary region of the sense oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the antisense oligonucleotide. In certain embodiments, the complementary region of the sense oligonucleotide is 100% complementary to the antisense oligonucleotide.

[0418] The complementary region of the sense oligonucleotide hybridizes with the antisense oligonucleotide to form a double-stranded region.In certain embodiments, such a double-stranded region is composed of 7 pairs of hybridized nucleosides (one of each pair is on the antisense oligonucleotide, and the other of each pair is on the sense oligonucleotide).In certain embodiments, the double-stranded region comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 hybridized pairs. In certain embodiments, the double-stranded region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 hybridized pairs. In certain embodiments, each nucleoside of the antisense oligonucleotide is paired in the double-stranded region (i.e., the antisense oligonucleotide has no overhanging nucleosides). In certain embodiments, the antisense oligonucleotide comprises unpaired nucleosides (overhanging nucleosides) at the 3'-end and / or 5'-end. In certain embodiments, each nucleoside of the sense oligonucleotide is paired in the double-stranded region (i.e., the sense oligonucleotide has no overhanging nucleosides). In certain embodiments, the sense oligonucleotide comprises unpaired nucleosides (overhang nucleosides) at the 3'-end and / or 5'-end. In certain embodiments, the duplex formed by the antisense oligonucleotide and the sense oligonucleotide does not comprise any overhang at one or both ends. Such ends that do not have overhangs are called blunt.In certain embodiments where an antisense oligonucleotide has overhanging nucleosides, one or more of the overhanging nucleosides are complementary to the target nucleic acid. In certain embodiments where an antisense oligonucleotide has overhanging nucleosides, one or more of the overhanging nucleosides are not complementary to the target nucleic acid.

[0419] B. Prion In certain embodiments, the oligomeric compounds, oligomeric duplexes, antisense agents, or RNAi agents disclosed herein comprise or consist of antisense oligonucleotides that comprise a region complementary to a target nucleic acid, and the target nucleic acid is PRNP RNA. In each of the above-mentioned embodiments, the RNAi agents, antisense agents, oligomeric compounds, or oligomeric duplexes disclosed herein can target PRNP RNA. In certain embodiments, the RNAi agents are oligomeric duplexes. In certain embodiments, the PRNP RNA has the sequence of any one of the sequences set forth in SEQ ID NO:1 (GENBANK Accession No. NM_000311.4), SEQ ID NO:2 (GENBANK Accession No. NM_001080121.2), SEQ ID NO:3 (GENBANK Accession No. NM_001080122.2), SEQ ID NO:4 (GENBANK Accession No. NM_001271561.2), SEQ ID NO:5 (GENBANK Accession No. NM_183079.3), SEQ ID NO:6 (GENBANK Accession No. DA737108.1), SEQ ID NO:7 (GENBANK Accession No. DA277019.1), SEQ ID NO:8 (GENBANK Accession No. BI667722.1), and SEQ ID NO:9 (GENBANK Accession No. NM_001080123.2). In certain embodiments, contacting a cell with an oligomeric duplex comprising an oligomeric compound, the oligomeric compound comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9, reduces the amount of PRNP RNA, and in certain embodiments, reduces the amount of prion protein. In certain embodiments, contacting a cell with an oligomeric duplex comprising an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9, results in reduced aggregation of prion protein. In certain embodiments, the oligomeric compound consists of an antisense oligonucleotide. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent comprises a conjugate group.In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises more than one conjugate group.

[0420] In certain embodiments, contacting a cell of a subject with an RNAi agent disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9 ameliorates one or more symptoms or characteristics of a neurodegenerative disease associated with PrP. In certain embodiments, the neurodegenerative disease associated with PrP is a prion disease. In certain embodiments, the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, or kuru. In certain embodiments, the CJD is variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD). In certain embodiments, the neurodegenerative disease associated with PrP is a synucleinopathy. In certain embodiments, the synucleinopathy is Alzheimer's disease, Parkinson's disease, or dementia with Lewy bodies. In certain embodiments, the neurodegenerative disease associated with PrP is a tauopathy. In certain embodiments, the tauopathy is frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE). In certain embodiments, the one or more symptoms or characteristics are rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, gliomas, and the presence of markers of neuronal cell loss.In certain embodiments, contacting a subject's cells with an RNAi agent disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9 reduces or delays the onset or progression of rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, or gliosis, or delays death, or reduces the presence of markers of neuronal cell loss.

[0421] In certain embodiments, contacting a subject's cells with an antisense agent disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9 ameliorates one or more symptoms or characteristics of a neurodegenerative disease associated with PrP. In certain embodiments, the one or more symptoms or characteristics are rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, gliomas, and the presence of markers of neuronal cell loss. In certain embodiments, contacting a subject's cells with an antisense agent disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9 reduces or delays the onset or progression of rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, or gliosis, or delays death, or reduces the presence of markers of neuronal cell loss.

[0422] In certain embodiments, contacting a subject's cells with an oligomeric compound disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9 ameliorates one or more symptoms or characteristics of a neurodegenerative disease associated with PrP. In certain embodiments, the one or more symptoms or characteristics are rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, gliomas, and the presence of markers of neuronal cell loss. In certain embodiments, contacting a subject's cells with an oligomeric compound disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9 reduces or delays the onset or progression of rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongiform changes in the brain, development of abnormal protein aggregates, neuronal cell loss, or gliosis, or delays death, or reduces the presence of markers of neuronal cell loss. In certain embodiments, contacting a subject's cells with an oligomeric duplex disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9 ameliorates one or more symptoms or characteristics of a neurodegenerative disease associated with PrP. In certain embodiments, the one or more symptoms or characteristics are rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, gliomas, and the presence of markers of neuronal cell loss.In certain embodiments, contacting a subject's cells with an oligomeric compound disclosed herein comprising or consisting of an antisense oligonucleotide complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, or SEQ ID NO:9 reduces or delays the onset or progression of rapidly progressive dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, visual impairment, insomnia, blindness, loss of speech, coma, death, spongy changes in the brain, development of abnormal protein aggregates, neuronal cell loss, or gliosis, or delays death, or reduces the presence of markers of neuronal cell loss.

[0423] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an antisense oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being expressed in a pharmacologically relevant tissue. In certain embodiments, the oligomeric duplex comprises an antisense oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue comprising the central nervous system. In certain embodiments, the tissue comprises the cerebral cortex, spinal cord, hippocampus, thalamus, cerebellum, and brainstem. In certain embodiments, the tissue comprises the cerebral cortex and spinal cord. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell comprises a neuron and a glial cell. In certain embodiments, the glial cell comprises an astrocyte.

[0424] V. Certain Methods and Uses Certain embodiments provided herein relate to a method of reducing PRNP RNA or reducing or inhibiting PRNP RNA expression or activity, which may be useful for treating or alleviating PrP-associated neurodegenerative disease. In certain embodiments, the PrP-associated neurodegenerative disease is a prion disease. In certain embodiments, the PrP-associated neurodegenerative disease is a synucleinopathy. In certain embodiments, the PrP-associated neurodegenerative disease is a tauopathy. In certain embodiments, the PrP-associated neurodegenerative disease is Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), familial Creutzfeldt-Jakob disease (fCJD), Gerstmann-Straussler-Scheinker syndrome (GSS), fatal familial insomnia (FFI), kuru, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE). In certain embodiments, the Creutzfeldt-Jakob disease (CJD) is variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD). In certain embodiments, the PrP-associated neurodegenerative disease is CJD. In certain embodiments, the PrP-associated neurodegenerative disease is Gerstmann-Straussler-Scheinker syndrome. In certain embodiments, the PrP-associated neurodegenerative disease is fatal familial insomnia. In certain embodiments, the PrP-associated neurodegenerative disease is kuru. In certain embodiments, the PrP-associated neurodegenerative disease is Alzheimer's disease. In certain embodiments, the PrP-associated neurodegenerative disease is Parkinson's disease. In certain embodiments, the PrP-associated neurodegenerative disease is dementia with Lewy bodies. In certain embodiments, the PrP-associated neurodegenerative disease is frontotemporal dementia associated with Tau mutations. In certain embodiments, the PrP-associated neurodegenerative disease is Pick's disease.In certain embodiments, the neurodegenerative disease associated with PrP is progressive supranuclear palsy.In certain embodiments, the neurodegenerative disease associated with PrP is corticobasal neurodegeneration.In certain embodiments, the neurodegenerative disease associated with PrP is chronic traumatic encephalopathy (CTE).

[0425] In certain embodiments, the method comprises administering to a subject an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to PRNP. In certain embodiments, the subject has or is at risk of developing a neurodegenerative disease associated with PrP. In certain embodiments, the subject has a prion disease. In certain embodiments, the subject has a synucleinopathy. In certain embodiments, the subject has a tauopathy. In certain embodiments, the subject has Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE). In certain embodiments, the subject has Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)). In certain embodiments, the subject has Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, or dementia with Lewy bodies. In certain embodiments, the subject has frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE). In certain embodiments, the oligomeric compound is an antisense agent.

[0426] In certain embodiments, a method for treating a neurodegenerative disease associated with PrP comprises administering to a subject an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to PRNP. In certain embodiments, the subject has or is at risk of developing a neurodegenerative disease. In certain embodiments, the subject has or is at risk of developing a prion disease. In certain embodiments, the subject has a prion disease. In certain embodiments, the subject has a synucleinopathy. In certain embodiments, the subject has a tauopathy. In certain embodiments, the subject has Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE). In certain embodiments, the subject has Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)). In certain embodiments, the subject has Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, or dementia with Lewy bodies. In certain embodiments, the subject has frontotemporal dementia associated with a Tau mutation, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE). In certain embodiments, at least one symptom or feature of a PrP-associated neurodegenerative disease is ameliorated.In certain embodiments, the at least one symptom or characteristic is rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, vision loss, insomnia, blindness, loss of speech, coma, death, cavernous changes in the brain, development of abnormal protein aggregates, neuronal cell loss, gliomas, or the presence of markers of neuronal cell loss. In certain embodiments, administering an oligomeric compound, oligomeric duplex, or antisense agent to a subject reduces or delays the onset or progression of rapidly progressing dementia, personality changes, ataxia, hallucinations, myoclonus (muscle spasms), chorea, autonomic neuropathy, vision loss, insomnia, blindness, loss of speech, coma, cavernous changes in the brain, development of abnormal protein aggregates, neuronal cell loss, or gliosis, or delays death, or reduces the presence of markers of neuronal cell loss.

[0427] In certain embodiments, the method of reducing expression of PRNP or reducing prion protein in a cell comprises contacting the cell with an oligomeric compound, oligomeric duplex, or antisense agent, any of which has a nucleobase sequence complementary to PRNP. In certain embodiments, the cell is a neuron or a glial cell. In certain embodiments, the glial cell is an astrocyte. In certain embodiments, the cell is a human cell.

[0428] Certain embodiments are provided for oligomeric compounds, oligomeric duplexes, or antisense agents, any of which have a nucleobase sequence complementary to PRNP, for use in treating PrP-associated neurodegenerative diseases or for use in the manufacture of medicaments for treating PrP-associated neurodegenerative diseases. In certain embodiments, the PrP-associated neurodegenerative disease is a prion disease. In certain embodiments, the PrP-associated neurodegenerative disease is a synucleinopathy. In certain embodiments, the PrP-associated neurodegenerative disease is a tauopathy. In certain embodiments, the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)), Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE). In certain embodiments, the neurodegenerative disease associated with PrP is Creutzfeldt-Jakob disease (CJD) (e.g., variant Creutzfeldt-Jakob disease (vCJD), classical Creutzfeldt-Jakob disease (cCJD), familial Creutzfeldt-Jakob disease (fCJD), or sporadic Creutzfeldt-Jakob disease (sCJD)). In certain embodiments, the neurodegenerative disease associated with PrP is Gerstmann-Straussler-Scheinker syndrome, fatal familial insomnia, kuru, Alzheimer's disease, Parkinson's disease, or dementia with Lewy bodies. In certain embodiments, the neurodegenerative disease associated with PrP is frontotemporal dementia associated with Tau mutations, Pick's disease, progressive supranuclear palsy, corticobasal degeneration, or chronic traumatic encephalopathy (CTE).

[0429] In any of the methods or uses described herein, the oligomeric compound, oligomeric duplex, or antisense agent may be any of those described herein.

[0430] VI. Certain Pharmaceutical Compositions The oligomeric compounds, oligomeric duplexes, antisense agents, or RNAi agents described herein can be mixed with pharmaceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations.The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including but not limited to the route of administration, the extent of disease, or the dosage administered.In certain embodiments, the RNAi agent is an oligomeric duplex.

[0431] Certain embodiments provide pharmaceutical compositions comprising one or more oligomeric compounds, oligomeric duplexes, or antisense agents, or salts thereof. In certain such embodiments, the pharmaceutical composition comprises a suitable pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises sterile saline and one or more oligomeric compounds, oligomeric duplexes, or antisense agents. In certain embodiments, such pharmaceutical compositions consist of sterile saline and one or more oligomeric compounds, oligomeric duplexes, or antisense agents. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents, and sterile water. In certain embodiments, the pharmaceutical composition consists of one or more oligomeric compounds, oligomeric duplexes, or antisense agents, and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents, and phosphate buffered saline (PBS). In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises cerebrospinal fluid (CSF) and one or more oligomeric compounds, oligomeric duplexes, or antisense agents. In certain embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents comprise sense oligonucleotides and antisense oligonucleotides. In certain embodiments, the CSF is artificial CSF (aCSF). The composition and method for the formulation of the pharmaceutical composition depends on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0432] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid (aCSF). In certain embodiments, the pharmaceutical composition consists of one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of one or more oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0433] In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dianhydrous dihydrate, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to a range of about 7.1 to 7.3, or about 7.2, using a suitable pH adjusting agent, for example, an acid such as hydrochloric acid and an alkali such as sodium hydroxide.

[0434] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds, oligomeric duplexes, or antisense agents and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0435] In certain embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0436] Pharmaceutical compositions comprising oligomeric compounds, oligomeric duplexes, or antisense agents provided herein include any pharma- ceutical acceptable salts, esters, or salts of such esters, which, when administered to animals, including humans, can provide (directly or indirectly) biologically active metabolites or residues thereof. Thus, for example, the present disclosure also focuses on pharma-ceutical acceptable salts of compounds, prodrugs, pharma-ceutical acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharma-ceutical acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharma-ceutical acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts.

[0437] Prodrugs may include oligomeric compounds, oligomeric duplexes, or incorporation of additional nucleosides at one or both termini of an antisense agent that are cleaved by endogenous nucleases in the body to form the active compound.

[0438] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0439] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0440] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% (w / v) benzyl alcohol, 8% (w / v) of the non-polar surfactant Polysorbate 80™, and 65% (w / v) of polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems may vary significantly without significantly changing their solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0441] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or in a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid solubility or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are provided in unit dosage form, for example, in ampoules, or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles, and may include formulatory agents such as suspending, stabilizing, and / or dispersing agents. Particular solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.

[0442] In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in an aqueous solution that includes sodium. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in an aqueous solution that includes potassium. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in PBS. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in water. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is in aCSF. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to the desired pH.

[0443] VII. Certain hotspot areas 1. Nucleic acid bases 839 to 895 of SEQ ID NO:1 In certain embodiments, nucleobases 839-895 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 839-895 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0444] The nucleobase sequences of SEQ ID NOs: 45, 46, and 50 are complementary to nucleobases 839 to 895 of SEQ ID NO: 1. The nucleobase sequences of the antisense oligonucleotides of compound numbers 1547376, 1547377, and 1547393 are complementary to nucleobases 839 to 895 of SEQ ID NO: 1.

[0445] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 839-895 of SEQ ID NO:1 achieve at least a 69% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 839-895 of SEQ ID NO:1 achieve an average of 84% reduction in PRNP RNA in a standard in vitro assay.

[0446] 2. Nucleic acid bases 1179 to 1235 of SEQ ID NO:1 In certain embodiments, nucleobases 1179-1235 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 1179-1235 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0447] The nucleobase sequences of SEQ ID NOs: 68, 70, and 72 are complementary to nucleobases 1179 to 1235 of SEQ ID NO: 1. The nucleobase sequences of the antisense oligonucleotides of compound numbers 1547447, 1547449, and 1547451 are complementary to nucleobases 1179 to 1235 of SEQ ID NO: 1.

[0448] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1179-1235 of SEQ ID NO:1 achieve at least an 81% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1179-1235 of SEQ ID NO:1 achieve an average of 86% reduction in PRNP RNA in a standard in vitro assay.

[0449] 3. Nucleic acid bases 1332 to 1371 of SEQ ID NO:1 In certain embodiments, nucleobases 1332-1371 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 1332-1371 of SEQ ID NO: 1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0450] The nucleobase sequences of SEQ ID NOs: 75 and 76 are complementary to nucleobases 1332 to 1371 of SEQ ID NO: 1. The nucleobase sequences of the antisense oligonucleotides of compound numbers 1547466 and 1547467 are complementary to nucleobases 1332 to 1371 of SEQ ID NO: 1.

[0451] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1332-1371 of SEQ ID NO:1 achieve at least an 81% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1332-1371 of SEQ ID NO:1 achieve an average of 85% reduction in PRNP RNA in a standard in vitro assay.

[0452] 4. Nucleic acid bases 1383 to 1507 of SEQ ID NO:1 In certain embodiments, nucleobases 1383-1507 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 1383-1507 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0453] The nucleic acid base sequences of SEQ ID NOs: 80, 81, 82, 83, 84, 85, and 86 are complementary to nucleic acid bases 1383 to 1507 of SEQ ID NO: 1. The nucleic acid base sequences of the antisense oligonucleotides of compound numbers 1547483, 1547484, 1547485, 1547486, 1547487, 1547488, and 1547501 are complementary to nucleic acid bases 1383 to 1507 of SEQ ID NO: 1.

[0454] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1383-1507 of SEQ ID NO:1 achieve at least a 64% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1383-1507 of SEQ ID NO:1 achieve an average of 84% reduction in PRNP RNA in a standard in vitro assay.

[0455] 5. Nucleic acid bases 1553 to 1660 of SEQ ID NO:1 In certain embodiments, nucleobases 1553-1660 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 1553-1660 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0456] The nucleobase sequences of SEQ ID NOs: 89, 90, 91, 92, 96, and 97 are complementary to nucleobases 1553 to 1660 of SEQ ID NO: 1. The nucleobase sequences of the antisense oligonucleotides of compound numbers 1547510, 1547511, 1547512, 1547519, 1547523, and 1547524 are complementary to nucleobases 1553 to 1660 of SEQ ID NO: 1.

[0457] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1553-1660 of SEQ ID NO:1 achieve at least a 79% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1553-1660 of SEQ ID NO:1 achieve an average of 88% reduction in PRNP RNA in a standard in vitro assay.

[0458] 6. Nucleic acid bases 1672 to 1711 of SEQ ID NO:1 In certain embodiments, nucleobases 1672-1711 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 1672-1711 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0459] The nucleobase sequences of SEQ ID NOs: 93 and 98 are complementary to nucleobases 1672 to 1711 of SEQ ID NO: 1. The nucleobase sequences of the antisense oligonucleotides of compound numbers 1547520 and 1547537 are complementary to nucleobases 1672 to 1711 of SEQ ID NO: 1.

[0460] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1672-1711 of SEQ ID NO:1 achieve at least 85% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1672-1711 of SEQ ID NO:1 achieve an average of 90% reduction in PRNP RNA in a standard in vitro assay.

[0461] 7. Nucleic acid bases 1808 to 1915 of SEQ ID NO:1 In certain embodiments, nucleobases 1808-1915 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 1808-1915 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0462] The nucleobase sequences of SEQ ID NOs: 105, 106, 107, 108, 109, and 110 are complementary to nucleobases 1808 to 1915 of SEQ ID NO: 1. The nucleobase sequences of the antisense oligonucleotides of compound numbers 1547556, 1547557, 1547558, 1547559, 1547560, and 1547573 are complementary to nucleobases 1808 to 1915 of SEQ ID NO: 1.

[0463] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1808-1915 of SEQ ID NO:1 achieve at least a 66% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1808-1915 of SEQ ID NO:1 achieve an average of 85% reduction in PRNP RNA in a standard in vitro assay.

[0464] 8. Nucleic acid bases 1978 to 2034 of SEQ ID NO:1 In certain embodiments, nucleobases 1978-2034 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 1978-2034 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0465] The nucleobase sequences of SEQ ID NOs: 111, 116, and 117 are complementary to nucleobases 1978 to 2034 of SEQ ID NO: 1. The nucleobase sequences of the antisense oligonucleotides of compound numbers 1547574, 1547591, and 1547592 are complementary to nucleobases 1978 to 2034 of SEQ ID NO: 1.

[0466] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1978-2034 of SEQ ID NO:1 achieve at least 89% reduction of PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 1978-2034 of SEQ ID NO:1 achieve an average of 91% reduction of PRNP RNA in a standard in vitro assay.

[0467] 9. Nucleic acid bases 2131 to 2238 of SEQ ID NO:1 In certain embodiments, nucleobases 2131-2238 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 2131-2238 of SEQ ID NO: 1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0468] The nucleic acid base sequences of SEQ ID NOs: 123, 124, 125, 127, 128, and 133 are complementary to nucleic acid bases 2131 to 2238 of SEQ ID NO: 1. The nucleic acid base sequences of the antisense oligonucleotides of compound numbers 1547610, 1547611, 1547612, 1547614, 1547627, and 1547632 are complementary to nucleic acid bases 2131 to 2238 of SEQ ID NO: 1.

[0469] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2131-2238 of SEQ ID NO:1 achieve at least an 82% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2131-2238 of SEQ ID NO:1 achieve an average of 89% reduction in PRNP RNA in a standard in vitro assay.

[0470] 10. Nucleic acid bases 2284 to 2476 of SEQ ID NO:1 In certain embodiments, nucleobases 2284-2476 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 2284-2476 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0471] The nucleic acid base sequences of SEQ ID NOs: 129, 130, 134, 135, 136, 137, 139, 140, 143, 144, and 145 are complementary to nucleic acid bases 2284 to 2476 of SEQ ID NO: 1. The nucleic acid base sequences of the antisense oligonucleotides of compound numbers 1547628, 1547629, 1547645, 1547646, 1547647, 1547648, 1547650, 1547663, 1547666, 1547667, and 1547668 are complementary to nucleic acid bases 2284 to 2476 of SEQ ID NO: 1.

[0472] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2284-2476 of SEQ ID NO:1 achieve at least a 71% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2284-2476 of SEQ ID NO:1 achieve an average of 89% reduction in PRNP RNA in a standard in vitro assay.

[0473] 11. Nucleic acid bases 2488 to 2586 of SEQ ID NO:1 In certain embodiments, nucleobases 2488-2586 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 2488-2586 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0474] The nucleic acid base sequences of SEQ ID NOs: 141, 146, 149, 150, 151, 162, and 164 are complementary to nucleic acid bases 2488 to 2586 of SEQ ID NO: 1. The nucleic acid base sequences of compound numbers 1547664, 1547681, 1547684, 1547685, 1547686, 1547721, and 1547735 are complementary to nucleic acid bases 2488 to 2586 of SEQ ID NO: 1.

[0475] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2488-2586 of SEQ ID NO:1 achieve at least an 81% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2488-2586 of SEQ ID NO:1 achieve an average of 92% reduction in PRNP RNA in a standard in vitro assay.

[0476] 12. Nucleic acid bases 2505 to 2586 of SEQ ID NO:1 In certain embodiments, nucleobases 2505-2586 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 2505-2586 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0477] The nucleic acid base sequences of SEQ ID NOs: 146, 149, 150, 151, 162, and 164 are complementary to nucleic acid bases 2505 to 2586 of SEQ ID NO: 1. The nucleic acid base sequences of the antisense oligonucleotides of compound numbers 1547681, 1547684, 1547685, 1547686, 1547721, and 1547735 are complementary to nucleic acid bases 2505 to 2586 of SEQ ID NO: 1.

[0478] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2505-2586 of SEQ ID NO:1 achieve at least a 92% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2505-2586 of SEQ ID NO:1 achieve an average of a 93% reduction in PRNP RNA in a standard in vitro assay.

[0479] 13. Nucleic acid bases 2590 to 2790 of SEQ ID NO:1 In certain embodiments, nucleobases 2590-2790 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent comprises an antisense oligonucleotide complementary to a portion of nucleobases 2590-2790 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0480] The nucleobase sequences of SEQ ID NOs: 147, 169, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175 are complementary to nucleobases 2590 to 2790 of SEQ ID NO:1. The nucleobase sequences of the antisense oligonucleotides of compound numbers 1547682, 1547740, 1547699, 1547700, 1547701, 1547702, 1547703, 1547704, 1547717, 1547718, 1547719, 1547720, 1547737, 1547738, 1547739, and 1547759 are complementary to nucleobases 2590 to 2790 of SEQ ID NO:1.

[0481] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2590-2790 of SEQ ID NO:1 achieve at least a 60% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2590-2790 of SEQ ID NO:1 achieve an average of 85% reduction in PRNP RNA in a standard in vitro assay.

[0482] 14. Nucleic acid bases 2624 to 2790 of SEQ ID NO:1 In certain embodiments, nucleobases 2624-2790 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the oligomeric duplex comprises an antisense oligonucleotide complementary to a portion of nucleobases 2624-2790 of SEQ ID NO:1. In certain embodiments, the antisense oligonucleotide is 15-30 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 17-30, 18-30, 18-25, or 20-23 nucleobases in length. In certain embodiments, the antisense oligonucleotide is 23 nucleobases in length.

[0483] The nucleic acid base sequences of SEQ ID NOs: 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175 are complementary to nucleic acid bases 2624 to 2790 of SEQ ID NO: 1. The nucleic acid base sequences of the antisense oligonucleotides of compound numbers 1547700, 1547701, 1547702, 1547703, 1547704, 1547717, 1547718, 1547719, 1547720, 1547737, 1547738, 1547739, and 1547759 are complementary to nucleic acid bases 2624 to 2790 of SEQ ID NO: 1.

[0484] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2624-2790 of SEQ ID NO:1 achieve at least a 60% reduction in PRNP RNA in a standard in vitro assay. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents comprising an antisense oligonucleotide complementary to a portion of nucleobases 2624-2790 of SEQ ID NO:1 achieve an average of 86% reduction in PRNP RNA in a standard in vitro assay.

[0485] Non-Limiting Disclosure and Incorporation by Reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.

[0486] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples only serve to illustrate the compounds described herein and are not intended to limit such compounds. Each of the references, GenBank accession numbers, etc. listed in this application are incorporated herein by reference in their entirety.

[0487] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in reality these sequences can be modified by any combination of chemical modifications. Those skilled in the art will readily appreciate that such designations, such as "RNA" or "DNA", indicate that the modified oligonucleotide is arbitrary in certain cases. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those set forth in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleic acid bases, unless otherwise specified. By way of further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" is intended to be illustrative, but not limiting, of such compounds that contain RNA bases, e.g., those having the sequence "AUCGAUCG", as well as any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including those that have some DNA bases and some RNA bases, e.g., "AUCGATCG". m CGAUCG” (in the formula, m(C represents a cytosine base containing a methyl group at position 5). Finally, for clarity, unless otherwise indicated, the phrase "nucleobase sequence of SEQ ID NO:X" refers only to the nucleobase sequence of SEQ ID NO:X, independent of any sugar or internucleoside linkage modifications also set forth in such SEQ ID NO.

[0488] Efforts have been made to accurately describe the compounds in the attached sequence listing, but in the event of any discrepancy between the description in this specification and the attached sequence listing, the description in this specification, and not the sequence listing, is the accurate description.

[0489] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, and therefore give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry, such as (R) or (S), α or β (e.g., for sugar anomers), or (D) or (L) (e.g., for amino acids). Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the compound depicted. Compounds provided herein that are depicted or described without a defined stereochemistry include all such possible isomers, including stereorandom and optically pure forms, unless otherwise indicated. Similarly, tautomeric forms of the compounds described herein are also included, unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include the corresponding salt forms.

[0490] The compounds described herein include modifications in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds described herein that contain hydrogen atoms include 1 Isomeric substitutions encompassed by the compounds herein include: 1 Instead of H 2 H or 3 H, 12 Instead of C13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 In certain embodiments, non-radioactive isotope substitution can provide novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make the compounds suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0491] The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are provided, the inventors intend the general application of those specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides reasonable support for further oligonucleotides having that motif or similar motifs.Similarly, for example, when a specific high affinity modification is found at a specific position, other high affinity modifications at the same position are also considered suitable, unless otherwise indicated.

[0492] Example 1: Design of oligomeric duplexes with oligomeric compounds complementary to human PRNP nucleic acid An oligomeric duplex containing an antisense oligonucleotide complementary to a human PRNP nucleic acid and a sense oligonucleotide complementary to the antisense oligonucleotide was designed as follows.

[0493] The oligomeric duplexes in the table below include antisense and sense oligonucleotides, in each case 23 nucleosides in length, have a sugar motif (5' to 3') of yfyfyfyfyfyfyfyfyfyfyy, where each "y" represents a 2'-OMe sugar moiety, each "f" represents a 2'-F sugar moiety, and have an internucleoside linkage motif (5' to 3') of ssooooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage, and each "s" represents a phosphorothioate internucleoside linkage. In each case, the sense oligonucleotide is 21 nucleosides long, has a sugar motif (5' to 3') of fyfyfyfyfyfyfyfyfyfyf, where each "y" represents a 2'-OMe sugar moiety, each "f" represents a 2'-F sugar moiety, and has an internucleoside linkage motif (5' to 3') of ssooooooooooooooooooss, where each "o" represents a phosphodiester internucleoside linkage, and each "s" represents a phosphorothioate internucleoside linkage. Each antisense oligonucleotide is complementary to a target nucleic acid (PRNP, encoded prion protein), and each sense oligonucleotide is complementary to the first 21 nucleosides (5' to 3') of the antisense oligonucleotide, where the last two 3'-nucleosides of the antisense oligonucleotide are not paired to the sense oligonucleotide (they are overhanging nucleosides).

[0494] "START SITE" indicates the 5'-most nucleoside in the human gene sequence to which the antisense oligonucleotide is complementary. "START SITE" indicates the 3'-most nucleoside in the human gene sequence to which the antisense oligonucleotide is complementary. Each antisense oligonucleoside listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NM_000311.4). [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6]

[0495] Example 2: Effect of oligomeric duplexes on human PRNP RNA in vitro, in a single dose The above oligomeric duplexes were tested in a series of experiments under similar incubation conditions, and the results of each experiment are presented in separate tables below.

[0496] A431 cells cultured at a density of 20,000 cells per well were transfected with 20 nM of RNAi compounds using Lipofectamine 2000. After a treatment period of approximately 24 hours, RNA was isolated from the cells and PRNP RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using human primer probe set RTS42354 (forward sequence CCTCTCCTCACGACCGA (referred to herein as SEQ ID NO: 10); reverse sequence CCCAGTGTTCCATCCTCCA (referred to herein as SEQ ID NO: 11); probe sequence CCACAAAGAGAACCAGCATCCAGCA (referred to herein as SEQ ID NO: 12)). PRNP RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented as the percentage of PRNP RNA relative to the amount in untreated control cells (%UTC). Values ​​marked with "†" indicate that the antisense modified oligonucleotide is complementary to the amplicon region of the primer probe set. In such cases, the activity of the oligomeric duplexes was further assessed using human primer probe set RTS42359 (forward sequence AGTGGAACAAGCCGAGTAAG, designated herein as SEQ ID NO:13, reverse sequence CCTCATAGTCACTGCCGAAAT, designated herein as SEQ ID NO:14, probe sequence AACCAACATGAAGCACATGGCTGG, designated herein as SEQ ID NO:15). [Table 2-1] [Table 2-2] [Table 3-1] [Table 3-2]

Claims

1. 1. An oligomeric compound, comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 93, 98, 20-92, 94-97, and 99-175, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. the nucleobase sequence of said modified oligonucleotide is an isometric portion of nucleobases 1672 to 1711 of SEQ ID NO: 1; an isometric portion of nucleobases 839 to 895 of SEQ ID NO: 1; an isometric portion of nucleobases 1179 to 1235 of SEQ ID NO: 1; an isometric portion of nucleobases 1332 to 1371 of SEQ ID NO: 1; an isometric portion of nucleobases 1383 to 1507 of SEQ ID NO: 1; an isometric portion of nucleobases 1553 to 1660 of SEQ ID NO: 1; an isometric portion of nucleobases 1808 to 1915 of SEQ ID NO: 1; an isometric portion of nucleobases 1978 to 2034 of SEQ ID NO: 1; an isometric portion of nucleobases 2131 to 2238 of SEQ ID NO: 1; an isometric portion of nucleobases 2284 to 2476 of SEQ ID NO: 1; an isometric portion of nucleobases 2488 to 2586 of SEQ ID NO: 1; an isometric portion of nucleobases 2505 to 2586 of SEQ ID NO: 1; an isometric portion of nucleobases 2590 to 2790 of SEQ ID NO: 1; or At least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, or at least 22 of an isometric portion of nucleobases 2624 to 2790 of SEQ ID NO: 1 2. The oligomeric compound of claim 1, wherein the oligomeric compound is complementary to 23 consecutive nucleobases.

3. I) a) the nucleobase sequence of said modified oligonucleotide is: i) SEQ ID NOs: 93 and 98, SEQ ID NOs: 45, 46, and 50; SEQ ID NOs: 68, 70, and 72; SEQ ID NOs: 75 and 76, SEQ ID NOs: 80, 81, 82, 83, 84, 85, and 86; SEQ ID NOs: 89, 90, 91, 92, 96, and 97; SEQ ID NOs: 105, 106, 107, 108, 109, and 110; SEQ ID NOs: 111, 116, and 117; SEQ ID NOs: 123, 124, 125, 127, 128, and 133; SEQ ID NOs: 129, 130, 134, 135, 136, 137, 139, 140, 143, 144, and 145; SEQ ID NOs: 141, 146, 149, 150, 151, 162, and 164; SEQ ID NOs: 146, 149, 150, 151, 162, and 164; SEQ ID NOs: 147, 169, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175; SEQ ID NOs: 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175; or, ii) SEQ ID NOs: 93 and 98, SEQ ID NOs: 45, 46, and 50; SEQ ID NOs: 68, 70, and 72; SEQ ID NOs: 75 and 76, SEQ ID NOs: 80, 81, 82, 83, 84, 85, and 86; SEQ ID NOs: 89, 90, 91, 92, 96, and 97; SEQ ID NOs: 105, 106, 107, 108, 109, and 110; SEQ ID NOs: 111, 116, and 117; SEQ ID NOs: 123, 124, 125, 127, 128, and 133; SEQ ID NOs: 129, 130, 134, 135, 136, 137, 139, 140, 143, 144, and 145; SEQ ID NOs: 141, 146, 149, 150, 151, 162, and 164; SEQ ID NOs: 146, 149, 150, 151, 162, and 164; SEQ ID NOs: 147, 169, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175; SEQ ID NOs: 153, 154, 155, 156, 157, 158, 159, 160, 161, 166, 167, 168, and 175; comprising or consisting of a nucleic acid sequence selected from: and / or II) a) the nucleobase sequence of the modified oligonucleotide comprises or consists of the nucleobase sequence of any of SEQ ID NOs: 20-175; and / or b) the nucleobase sequence of said modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of any of SEQ ID NOs: 1-9; and / or c) the modified oligonucleotide is selected from the group consisting of 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-2 consisting of 5, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-29, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides; and / or III) a) at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety, optionally wherein: i) the modified sugar moiety comprises a bicyclic sugar moiety, optionally wherein the bicyclic sugar moiety comprises a 2'-4' bridge, wherein the 2'-4' bridge is -O-CH ２ - and -O-CH(CH ３ )-; or ii) the modified sugar moiety is a non-bicyclic modified sugar moiety, optionally wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety; or iii) the modified sugar moiety is a sugar surrogate, optionally wherein the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), 6-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA); and / or b) the modified oligonucleotide comprises at least one modified internucleoside linkage, optionally wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage or a mesyl phosphoramidate internucleoside linkage; and / or c) each internucleoside linkage of said modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage, optionally wherein: i) each internucleoside linkage of said modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage; or ii) each internucleoside linkage of said modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a mesyl phosphoramidate internucleoside linkage; and / or d) the modified oligonucleotide has a backbone motif of 5'-ssooooooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage; and / or e) said modified oligonucleotide comprises at least one modified nucleobase; Optionally, wherein said modified nucleobase is 5-methylcytosine, and further, optionally: i) each cytosine is a 5-methylcytosine; or ii) one or more cytosine nucleobases are unmodified; and / or f) the modified oligonucleotide has a sugar motif of 5'-yfyfyfyfyfyfyfyfyfyfyy-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; and / or g) the oligomeric compound comprises a conjugate group; Optionally, wherein the conjugate group comprises a conjugate moiety and a conjugate linker, for example, wherein: i) the conjugate moiety is a lipophilic group; and / or ii) the conjugate moiety is selected from C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl; and / or iii) the conjugate linker consists of a single bond; and / or iv) the conjugate linker is cleavable; and / or h) the oligomeric compound comprises a terminal group, and optionally i) the terminal group is a 5'-stabilized phosphate group; and / or ii) the terminal group is a 5'-stabilized phosphate group selected from cyclopropylphosphonate and vinylphosphonate; and / or i) the modified oligonucleotide is an antisense oligonucleotide; and / or j) the modified oligonucleotide is an antisense RNAi oligonucleotide; 3. The oligomeric compound according to claim 1 or 2.

4. 10. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is the oligomeric compound of claim 1 or claim 2, I) a) the second oligomeric compound is i) a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal-length portion of said first modified oligonucleotide; or ii) a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 95% complementary to an equal-length portion of said first modified oligonucleotide; or iii) a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is 100% complementary to an equal-length portion of said first modified oligonucleotide; and / or II) a) at least one nucleoside of said second modified oligonucleotide comprises a modified sugar moiety, optionally wherein: i) the modified sugar moiety comprises a bicyclic sugar moiety, e.g., the bicyclic sugar moiety comprises a 2'-4' bridge, the 2'-4' bridge being -O-CH ２ - and -O-CH(CH ３ )-; or ii) the modified sugar moiety is a non-bicyclic modified sugar moiety, e.g., the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety; or iii) the modified sugar moiety is a sugar surrogate, e.g., the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), 6-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA); and / or b) the second modified oligonucleotide comprises at least one modified internucleoside linkage, and optionally i) the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage; or ii) the at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage; and / or c) each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage; and / or d) each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage, or independently selected from a phosphodiester internucleoside linkage and a mesyl phosphoramidate internucleoside linkage; and / or e) the second modified oligonucleotide has a backbone motif of 5'-ssooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage; and / or f) the second modified oligonucleotide comprises at least one modified nucleobase, optionally wherein the modified nucleobase is 5-methylcytosine, e.g., i) each cytosine is a 5-methylcytosine; or ii) one or more cytosine nucleobases are unmodified; and / or g) the second modified oligonucleotide has a sugar motif of 5'-fyfyfyfyfyfyfyfyfyf-3', wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; The oligomeric duplex.

5. 10. An oligomeric duplex comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is the oligomeric compound of claim 3, I) a) the second oligomeric compound is i) a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of an equal-length portion of said first modified oligonucleotide; or ii) a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is at least 95% complementary to an equal-length portion of said first modified oligonucleotide; or iii) a second modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises a complementary region of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 nucleobases that is 100% complementary to an equal-length portion of said first modified oligonucleotide; and / or II) a) at least one nucleoside of said second modified oligonucleotide comprises a modified sugar moiety, optionally wherein: i) the modified sugar moiety comprises a bicyclic sugar moiety, e.g., the bicyclic sugar moiety comprises a 2'-4' bridge, the 2'-4' bridge being -O-CH ２ - and -O-CH(CH ３ )-; or ii) the modified sugar moiety is a non-bicyclic modified sugar moiety, e.g., the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety; or iii) the modified sugar moiety is a sugar surrogate, e.g., the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), 6-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA); and / or b) the second modified oligonucleotide comprises at least one modified internucleoside linkage, and optionally i) the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage; or ii) the at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage; and / or c) each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage; and / or d) each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage, or independently selected from a phosphodiester internucleoside linkage and a mesyl phosphoramidate internucleoside linkage; and / or e) the second modified oligonucleotide has a backbone motif of 5'-ssooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage; and / or f) the second modified oligonucleotide comprises at least one modified nucleobase, optionally wherein the modified nucleobase is 5-methylcytosine, e.g., i) each cytosine is a 5-methylcytosine; or ii) one or more cytosine nucleobases are unmodified; and / or g) the second modified oligonucleotide has a sugar motif of 5'-fyfyfyfyfyfyfyfyfyf-3', wherein each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; The oligomeric duplex.

6. an oligomeric duplex, a) a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of said first modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175; and a second modified oligonucleotide consisting of 15 to 29 linked nucleosides; a second oligomeric compound comprising: a first modified oligonucleotide; and a second modified oligonucleotide comprising: a first modified oligonucleotide; a second modified oligonucleotide comprising: a first modified oligonucleotide; a second modified oligonucleotide; a second modified oligonucleotide; a second modified oligonucleotide; a second modified oligonucleotide; a second modified oligonucleotide; a second modified oligonucleotide; a second modified oligonucleotide; a second modified oligonucleotide; a second modified oligonucleotide; Includes; or, b) a first oligomeric compound comprising a first modified oligonucleotide consisting of 18 to 30 linked nucleosides, wherein the nucleobase sequence of said first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or 23 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 20-175; and a second oligomeric compound comprising a second modified oligonucleotide consisting of 15 to 29 linked nucleosides, wherein the nucleobase sequence of said second modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or 21 contiguous nucleobases of the nucleobase sequence of any of SEQ ID NOs: 176-331, and wherein the nucleobase sequence of said second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal-length portion of said first modified oligonucleotide; Includes; or, c) a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides, the first oligomeric compound having a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 20-175; a second oligomeric compound comprising a second modified oligonucleotide consisting of 21 linked nucleosides, said second modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 176-331, wherein the nucleobase sequence of said second modified oligonucleotide is at least 90% complementary to the nucleobase sequence of an equal length portion of said first modified oligonucleotide; Including, The oligomeric duplex.

7. 7. The oligomeric duplex of claim 6, a) the nucleobase sequence of the second modified oligonucleotide is at least 95% complementary to the nucleobase sequence of an equal length portion of the first modified oligonucleotide; and / or b) the first modified oligonucleotide comprises a 5'-stabilized phosphate group, optionally wherein the 5'-stabilized phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate; and / or c) at least one nucleoside of the first modified oligonucleotide and at least one nucleoside of the second modified oligonucleotide each independently comprise a modified sugar moiety, optionally the modified sugar moiety comprises a bicyclic sugar moiety, optionally the bicyclic sugar moiety comprises a 2'-4' bridge, the 2'-4' bridge being selected from the group consisting of -O-CH ２ - and -O-CH(CH ３ )-selected from; and / or d) at least one nucleoside of the first modified oligonucleotide and at least one nucleoside of the second modified oligonucleotide each independently comprise a non-bicyclic modified sugar moiety, optionally wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, or a 2'-F sugar moiety; and / or e) at least one nucleoside of the first modified oligonucleotide or the second modified oligonucleotide each independently comprises a sugar surrogate, optionally the sugar surrogate is selected from morpholino, modified morpholino, glycol nucleic acid (GNA), 6-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA); and / or f) the first modified oligonucleotide comprises at least one modified internucleoside linkage, and optionally i) the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage, and further, optionally, each internucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage; and / or ii) the at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage, and further, optionally, each internucleoside linkage of the first modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a mesyl phosphoramidate internucleoside linkage; and / or g) the second modified oligonucleotide comprises at least one modified internucleoside linkage, and optionally i) the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage, and further, optionally, each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage; and / or ii) the at least one modified internucleoside linkage is a mesyl phosphoramidate internucleoside linkage, and further, optionally, each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a mesyl phosphoramidate internucleoside linkage; and / or h) the first modified oligonucleotide has a backbone motif of 5'-ssooooooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage; and / or i) the second modified oligonucleotide has a backbone motif of 5'-ssooooooooooooooooooooss-3', where each "s" is a phosphorothioate internucleoside linkage and each "o" is a phosphodiester internucleoside linkage; and / or j) the first modified oligonucleotide and the second modified oligonucleotide each independently comprise at least one modified nucleobase, and optionally i) the at least one modified nucleobase is a 5-methylcytosine, e.g., each cytosine is a 5-methylcytosine; or ii) said first modified oligonucleotide and said second modified oligonucleotide each independently comprise one or more cytosine nucleobases that are unmodified; The oligomeric duplex.

8. 8. The oligomeric duplex of claim 6 or 7, wherein: I) a) at least one nucleoside of the first modified oligonucleotide comprises a 2'-F sugar moiety, and said at least one nucleoside comprises: Position 2 or 14 from the 5' end, at positions 2, 6, or 14 from the 5' end; at positions 2, 14, or 16 from the 5' end; at positions 2, 6, 14, or 16 from the 5' end, or at positions 2, 6, 8, 9, 14, or 16 from the 5' end; Optionally, wherein the nucleosides at the remaining positions of the first modified oligonucleotide each comprise a 2'-OMe sugar moiety; or b) the nucleosides of the first modified oligonucleotide each comprise a 2'-F sugar moiety, and the nucleosides are positions 2 and 14 from the 5' end, positions 2, 6, and 14 from the 5' end; positions 2, 14, and 16 from the 5' end; positions 2, 6, 14, and 16 from the 5' end, or at positions 2, 6, 8, 9, 14, and 16 from the 5' end; Optionally, wherein the nucleosides at the remaining positions of the first modified oligonucleotide each comprise a 2'-OMe sugar moiety; or c) at least one nucleoside of the second modified oligonucleotide comprises a 2'-F sugar moiety, and said at least one nucleoside comprises: at positions 9, 10, or 11 from the 5' end; at positions 7, 9, 10, or 11 from the 5' end; at positions 11, 12, or 15 from the 5' end, or at positions 7, 9, 10, 11, 12, or 15 from the 5' end; Optionally, wherein the nucleosides at the remaining positions of the second modified oligonucleotide each comprise a 2'-OMe sugar moiety. d) the nucleosides of the second modified oligonucleotide each comprise a 2'-F sugar moiety, and the nucleosides are positions 9, 10, and 11 from the 5' end, or at positions 7, 9, 10, and 11 from the 5' end; Optionally, wherein the nucleosides at the remaining positions of the second modified oligonucleotide each comprise a 2'-OMe sugar moiety; or e) the first modified oligonucleotide has a sugar motif of 5'-yfyfyfyfyfyfyfyfyfyfyy-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; Optionally, the second modified oligonucleotide has a sugar motif of 5'-fyfyfyfyfyfyfyfyfyf-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; or f) the second modified oligonucleotide has a sugar motif of 5'-fyfyfyfyfyfyfyfyfyf-3', where each "y" represents a 2'-OMe sugar moiety and each "f" represents a 2'-F sugar moiety; and / or II) a) the second modified oligonucleotide comprises a conjugate group, optionally wherein the conjugate group comprises a conjugate linker and a conjugate moiety, e.g., i) the conjugate group is attached to the second modified oligonucleotide at the 5' end of the second modified oligonucleotide; or ii) the conjugate group is attached to the second modified oligonucleotide at the 3′ end of the second modified oligonucleotide; or iii) the conjugate group is attached to the second modified oligonucleotide at the 2' position of the furanosyl sugar moiety; or iv) the conjugate group is attached to the second modified oligonucleotide via a modified internucleoside linkage; and / or b) the conjugate group comprises a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C17 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, a C5 alkyl, a C22 alkenyl, a C20 alkenyl, a C16 alkenyl, a C10 alkenyl, a C21 alkenyl, a C19 alkenyl, a C18 alkenyl, a C17 alkenyl, a C15 alkenyl, a C14 alkenyl, a C13 alkenyl, a C12 alkenyl, a C11 alkenyl, a C9 alkenyl, a C8 alkenyl, a C7 alkenyl, a C6 alkenyl, or a C5 alkenyl; and / or c) the second modified oligonucleotide comprises a terminal group, optionally wherein the terminal group is an abasic sugar moiety; and / or d) the second modified oligonucleotide is selected from the group consisting of 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, and 16-50 , 17-20, 17-25, 17-30, 17-50, 18-20, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides; and / or e) the first modified oligonucleotide consists of 23 linked nucleosides and the second modified oligonucleotide consists of 21 linked nucleosides; the oligomeric duplexes described above.

9. 3. A population of oligomeric compounds comprising the modified oligonucleotides of claim 1 or claim 2, wherein all of the phosphorothioate internucleoside linkages of said modified oligonucleotides are stereorandom.

10. A population of oligomeric compounds comprising the modified oligonucleotide of claim 3, wherein all of the phosphorothioate internucleoside linkages of said modified oligonucleotide are stereorandom.

11. 5. The population of oligomeric duplexes of claim 4, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides of the first oligomeric compound are stereorandom, and optionally, all of the phosphorothioate internucleoside linkages of the second modified oligonucleotides of the second oligomeric compound are stereorandom.

12. 6. The population of oligomeric duplexes of claim 5, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides of the first oligomeric compound are stereorandom, and optionally, all of the phosphorothioate internucleoside linkages of the second modified oligonucleotides of the second oligomeric compound are stereorandom.

13. 8. The population of oligomeric duplexes of claim 6 or 7, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides of the first oligomeric compound are stereorandom, and optionally all of the phosphorothioate internucleoside linkages of the second modified oligonucleotides of the second oligomeric compound are stereorandom.

14. 9. The population of oligomeric duplexes of claim 8, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides of the first oligomeric compound are stereorandom, and optionally, all of the phosphorothioate internucleoside linkages of the second modified oligonucleotides of the second oligomeric compound are stereorandom.

15. 10. A pharmaceutical composition comprising an oligomeric compound according to claim 1 or 2 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further, optionally, the pharmaceutical composition consists essentially of the oligomeric compound of claim 1 or 2 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

16. 4. A pharmaceutical composition comprising the oligomeric compound of claim 3 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further, optionally, the pharmaceutical composition consists essentially of the oligomeric compound of claim 3 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

17. 10. A pharmaceutical composition comprising the oligomeric duplex of claim 4 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further optionally, the pharmaceutical composition consists essentially of the oligomeric duplex of claim 4 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

18. 10. A pharmaceutical composition comprising the oligomeric duplex of claim 5 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further optionally, the pharmaceutical composition consists essentially of the oligomeric duplex of claim 5 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

19. 8. A pharmaceutical composition comprising the oligomeric duplex of claim 6 or 7 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further optionally, the pharmaceutical composition consists essentially of the oligomeric duplex of claim 6 or 7 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

20. 9. A pharmaceutical composition comprising the oligomeric duplex of claim 8 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further optionally, the pharmaceutical composition consists essentially of the oligomeric duplex of claim 8 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

21. 10. A pharmaceutical composition comprising the population of claim 9 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further, optionally, the pharmaceutical composition consists essentially of the population of claim 9 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

22. 11. A pharmaceutical composition comprising the population of claim 10 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further, optionally, the pharmaceutical composition consists essentially of the population of claim 10 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

23. 12. A pharmaceutical composition comprising the population of claim 11 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further, optionally, the pharmaceutical composition consists essentially of the population of claim 11 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

24. 13. A pharmaceutical composition comprising the population of claim 12 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further, optionally, the pharmaceutical composition consists essentially of the population of claim 12 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

25. 14. A pharmaceutical composition comprising the population of claim 13 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further, optionally, the pharmaceutical composition consists essentially of the population of claim 13 and (A) aCSF, or (B) PBS. The pharmaceutical composition.

26. 15. A pharmaceutical composition comprising the population of claim 14 and a pharmaceutically acceptable diluent or carrier, Optionally, the pharmaceutically acceptable diluent is phosphate buffered saline (PBS) or artificial cerebrospinal fluid (aCSF); Further, optionally, the pharmaceutical composition consists essentially of the population of claim 14 and (A) aCSF, or (B) PBS. The pharmaceutical composition.