Therapeutic adeno-associated virus for treating Pompe disease with prolonged cessation of GAA enzyme replacement therapy
Patent Information
- Application Number
- JP2024550218
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-05-12
- Filing Date
- 2023-02-23
- Publication Date
- 2026-03-03
AI Technical Summary
In the prior art, the treatment of Pompe disease relies on long-term GAA enzyme replacement therapy (ERT), but this therapy has the inconvenience of frequent injections and the possible production of antibodies in patients, resulting in poor efficacy.
The in vivo expression and secretion of GAA enzymes are achieved by delivering genes encoding α-glucoside (GAA) polypeptides to the liver using adenopolyvirus-associated virus (AAV), thereby reducing or eliminating dependence on long-term ERT.
This method can maintain clinical stability in patients with Pompe disease without continuous long-term ERT, reduce antibody response, improve quality of life and treatment flexibility.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 314,093, filed February 25, 2022, and U.S. Provisional Application No. 63 / 319,034, filed March 11, 2022, and U.S. Provisional Application No. 63 / 340,972, filed May 12, 2022, the contents of each of which are incorporated herein by reference in their entirety.
[0002] FIELD OF THE INVENTION The present invention relates to methods for treating Pompe disease by administering adeno-associated virus (AAV) particles, virions, and vectors for expression of alpha-glucosidase (GAA) polypeptides, allowing for the ability to reduce or eliminate the clinical need for administration of long-term GAA enzyme replacement therapy (ERT) for extended periods of time. [Background technology]
[0003] background Pompe disease (glycogen storage disease type II; acid maltase deficiency; MIM 232300) is caused by a recessive mutation in the GAA gene, resulting in complete or partial deficiency of the lysosomal enzyme acid α-glucosidase (GAA). Absence of GAA leads to the progressive accumulation of glycogen in the lysosomes of many tissues, particularly skeletal muscle and cardiac muscle cells. Impaired energy metabolism then leads to severe destruction of muscle structure, dysfunction, autophagy, and, in adults, significant fat replacement of skeletal muscle myocytes.
[0004] Clinically, the condition ranges from fulminant infantile-onset Pompe disease (IOPD), which typically results in death before 12 months of age, to late-onset Pompe disease (LOPD), which slowly progresses, leading to a myopathy causing loss of mobility and typically resulting in death from respiratory failure 5 to 15 years after diagnosis. Infant-onset patients often have cardiomyopathy noticeable at birth or even prenatally, often with elevated creatine kinase (CK), and then develop severe hypotonia, respiratory insufficiency requiring ventilator support, and very severe cardiac hypertrophy within weeks to months of birth. Death most often results from cardiopulmonary failure, aspiration pneumonia, or ventricular arrhythmias. Patients with late-onset Pompe disease (LOPD), mostly adults but also some young people, experience slowly progressive muscle weakness, which often leads to delayed diagnosis, extensive fatty replacement of the trunk and proximal limb muscles, and progression to respiratory failure, the leading cause of death (Carlier et al. 2011). Basilar artery aneurysms develop and can become life-threatening if they rupture (El-Gharbawy et al. 2011; Hobson-Webb et al. 2012). As an alternative or adjunct to enzyme therapy, the feasibility of gene therapy approaches to treat GSD-II is being explored (Amalfitano, A., et al., (1999) Proc. Natl. Acad. Sci. USA 96:8861-8866; Ding, E., et al. (2002) Mol. Ther. 5:436-446; Fraites, TJ, et al., (2002) Mol. Ther. 5:571-578; Tsujino, S., et al. (1998) Hum. Gene Ther. 9:1609-1616).
[0005] MYOZYME® (alglucosidase alfa) was the first product approved in the United States for the treatment of Pompe disease (in 2006), and LUMIZYME® (alglucosidase alfa) was approved in 2010 and is currently the standard of care (SOC) treatment for patients with infantile-onset and late-onset Pompe disease. Alglucosidase alfa is administered intravenously as an infusion at a dose of 20 mg / kg every two weeks (LUMIZYME package insert 2014). Alglucosidase alfa provides an exogenous source of GAA. Binding to the mannose-6-phosphate receptor on the cell surface has been shown to occur via the carbohydrate group on the GAA molecule, which is then internalized and transported to lysosomes, where it undergoes proteolytic cleavage, resulting in increased enzymatic activity. It then exerts its enzymatic activity in the cleavage of glycogen. While enzyme replacement therapy (ERT) prolongs survival in most patients with infantile Pompe disease, a subset either dies, experiences ongoing muscle weakness, or remains severely hypotonic requiring mechanical ventilator support despite adherence to SOC ERT. For late-onset patients, ERT initially modestly improves muscle and pulmonary function parameters, followed by stable or declining function, remaining far from ideal treatment (Schoser et al. 2017).
[0006] For infantile-onset patients, especially those with severe or null mutations (cross-reactive immunoglobulin [CRIM] negative), high and persistent anti-rhGAA immunoglobulin G (IgG)-mediated immunity to the GAA enzyme is a major reason for impaired or inadequate response to ERT. ERT is known to induce antibody responses in both IgG and IgE forms and can also result in infusion-related reactions (Kishnani et al. 2007; Kishnani et al. 2010). Current practice is to initiate immune modulation with ERT in patients with LOPD who are at risk for antibody formation.
[0007] Additionally, enzyme replacement therapy (ERT) with alglucosidase alfa (MYOZYME® / LUMIZYME®), delivered as cumbersome biweekly or weekly infusions, is the only treatment currently available. In individuals with infantile-onset Pompe disease (IOPD), GAA is absent (CRIM-negative) or minimal (approximately 1% of normal), rapidly leading to progressive cardiopulmonary failure and, if untreated, death by age 2 years (Parini et al. 2018). Subjects with significant GAA deficiency present as juveniles or adults with less severe and more slowly progressing symptoms (late-onset Pompe disease [LOPD]). Failure to administer biweekly treatment can also result in significant regression, requiring months of ERT to restore the same levels.
[0008] Therefore, despite temporary therapeutic success, alglucosidase alfa ERT remains a clear unmet medical need in both IOPD and LOPD. Longitudinal data in subjects confirm that ERT does not result in complete correction or normalization in patients with Pompe disease. Ultimately, subjects typically decline, albeit at a slower rate that delays the inevitable progression to death (Kuperus et al. 2017; Parini et al. 2018). Although alglucosidase alfa extends survival in subjects with both IOPD and LOPD (LUMIZYME package insert, 2014), the antibody response to GAA and reduced efficacy pose several drawbacks.
[0009] Therefore, from a clinical perspective, long-term treatment of Pompe patients with ERT has had limited success. In a subset of IOPD patients, many experience high and persistent anti-rhGAA antibody titers (HSAT). Pompe patients who lack any residual GAA protein are considered CRIM-negative. CRIM-negative patients develop HSAT, and the subset of CRIM-positive patients who also develop high or persistent moderate titers suffer a significantly increased mortality rate (Banugaria et al. 2011). Furthermore, the use of immunosuppression to prevent antibody formation in patients at risk for HSAT significantly prolongs survival, confirming the clinical relevance of HSAT (Mendelsohn et al. 2009; Banugaria et al. 2011). Furthermore, the literature indicates that only approximately 1% of ERTs are pharmacologically active. Therefore, although enzyme therapy has shown reasonable efficacy for severe infantile GSD II, the benefits of GAA enzyme therapy are limited by the need for frequent infusions and by subjects developing inhibitors or neutralizing antibodies against the recombinant hGAA protein (Amalfitano, A., et al. (2001) Genet. In Med. 3:132-138), and there is a need for improved methods and alternative therapies for treating patients with Pompe disease. Adeno-associated virus (AAV) vector-mediated gene transfer offers a suitable and feasible alternative. [Prior art documents] [Non-patent literature]
[0010] [Non-Patent Document 1] El-Gharbawy, AH, et al.. 2011. 'Expanding the clinical spectrum of late-onset Pompe disease: dilated arteriopathy involving the thoracic aorta, a novel vascular [Non-patent document 2] Hobson-Webb, LD, et al., 2012. 'Autopsy findings in late-onset Pompe disease: a case report and systematic review of the literature', Mol Genet Metab, 106: 462-9. [Non-licensed document 3] Amalfitano, A., et al., (1999) Proc. Natl. Acad. Sci. USA 96:8861-8866
Non-licensed Document 4
Non-licensed Document 5
Non-licensed Document 6
Non-licensed Document 7
Non-licensed literature 9
Non-patent Document 10
Non-patent Document 11
Non-patent Document 12
Non-patent Document 13
[0011] Summary of the Invention The technology described herein generally relates to gene therapy constructs, methods, and compositions for the treatment of Pompe disease. More specifically, the technology relates to methods using adeno-associated (AAV) virions configured to deliver heterologous nucleic acid encoding a GAA polypeptide to a subject, more specifically to deliver heterologous nucleic acid encoding a GAA polypeptide to the liver of a subject where the GAA polypeptide is secreted from liver cells.
[0012] In particular, the technology described herein is based on findings from human clinical trials demonstrating the ability to reduce or eliminate the clinical need for long-term hGAA ERT administration when subjects are administered AAV expressing a GAA polypeptide.
[0013] While not wishing to be bound by theory, the only current treatment for Pompe disease is the long-term administration of recombinant human GAA (rhGAA) ERT, which is typically administered on an every-other-week regimen. Herein, the inventors have demonstrated that subjects with Pompe disease can take a break from their usual ERT regimen (e.g., long-term ERT break) for extended periods without clinical regression when the subjects are administered specific doses of an AAV vector expressing a GAA polypeptide as disclosed herein. In some embodiments, cessation of long-term ERT begins approximately at the time of administration of the AAV vector to the subject (e.g., the day before, the day of, or the day after), or in some embodiments, cessation of long-term ERT can occur about 24 weeks after administration of the AAV vector, or anywhere within about 24 to about 26 weeks.
[0014] In some embodiments, a subject administered with an AAV vector expressing a GAA disclosed herein can be administered supplemental ERT after an initial period of long-term cessation of long-term ERT administration, wherein the supplemental ERT is administered about 6 months or about 1 year, or more than 1 year after the cessation of long-term ERT.In other words, without wishing to be bound by theory, the technology disclosed herein relates to a method by which a subject with Pompe disease administered with an AAV vector expressing a GAA disclosed herein can take a break or "vacation" from regular long-term ERT administration.That is, according to the method disclosed herein, a subject administered with an AAV vector expressing a GAA disclosed herein can be off long-term ERT administration for a long period of time.In some embodiments, the method disclosed herein allows flexibility in regular ERT regimens, in that a long-term break or cessation of long-term ERT administration does not result in clinical decline, i.e., the subject remains clinically stable despite not having ongoing long-term ERT.
[0015] In some embodiments, the methods disclosed herein involve re-administration of ERT after a long period of cessation of ERT administration (referred to herein as "complementary ERT"), allowing for flexibility in the normal ERT regimen, since the continuous production of GAA expressed by AAV allows for flexibility in ERT. In some embodiments, the complementary ERT is pulse administration of ERT as disclosed herein. In some embodiments, the complementary ERT is administered at less frequent intervals, or at lower doses, or at irregular doses, or at irregular intervals, compared to the previous administration of long-term ERT.
[0016] Therefore, the method disclosed herein provides significant benefits to subjects with Pompe disease, including but not limited to reducing or eliminating the rigorous and laborious weekly or every other week infusion of long-term rhGAA ERT treatment, which is time-consuming, geographically restricted, and prevents patients with Pompe disease from long-term travel from the area where they receive ERT infusion.In addition, as disclosed herein, the absence of ERT administration also reduces any side effects caused by anti-rhGAA antibodies to ERT, and also avoids the need for the administration of immunosuppressants that are usually co-administered with ERT for some doses.Therefore, the method for treating Pompe disease disclosed herein provides greater flexibility in Pompe treatment and improves the quality of life and lifestyle of subjects with Pompe disease.
[0017] Thus, in one embodiment, the technology relates to a method of treating Pompe disease in a subject, comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding an expressible form of an alpha-glucosidase (GAA) polypeptide, in the extended absence of administration of long-term GAA enzyme replacement therapy (ERT) (e.g., ERT administration can be discontinued or stopped about 24 weeks, or about 26 weeks, or sooner than 24 or 26 weeks, e.g., any time between 1 day and 26 weeks, after administration of the recombinant AAV), wherein the heterologous nucleic acid is operably linked to a liver-specific promoter. In some embodiments, the dosage of the recombinant AAV comprising a nucleic acid encoding GAA is 4.0 E. coli. 12 In some embodiments, the dosage of the AAV expressing GAA is 4.0E vg / kg or less, and in some embodiments, the GAA is expressed to a level such that the subject achieves serum levels of GAA expressed by the AAV in the pharmaceutically active range of 160 to ≦2,260 nmol / mL / hr, 165 to ≦2,260 nmol / ml / hr, 175 to ≦2,260, 180 to ≦2,260, 185 to ≦2,260, or 189 to ≦2,260 within at least two weeks of administration. 12 In some embodiments, the dosage of the AAV expressing GAA is 4.0 E or less, and in some embodiments, the GAA is expressed to a level that results in the subject obtaining a serum level of GAA expressed by the AAV in the pharmaceutically active range of 189 to ≦2,260 nmol / mL / hr within at least two weeks of administration. 12 In some embodiments, the GAA is expressed to a level that results in the subject obtaining a serum level of AAV-expressed GAA in the pharmaceutically active range of 189 to 2,260 nmol / mL / hr within at least two weeks of administration. In some embodiments, the serum level of GAA is obtained within at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days. In some embodiments, the serum level of GAA is obtained within about 3 weeks, about 4 weeks, about 5 weeks, or more. In some embodiments, the specified serum level is 5e 10vg / kg~1.6e 13 This is achieved within this time frame as a result of a dose of AAV-GAA between 1000 and 1500 mg / kg. In some embodiments, the subject has IOPD. In some embodiments, the subject has LOPD.
[0018] In some embodiments, the dosage of the recombinant AAV comprising a nucleic acid encoding GAA is between about 1.6E12 and about 1.6E13 vg / kg, and the GAA is expressed to a level such that the subject achieves serum levels of AAV-expressed GAA in a pharmaceutically active range of 160 to ≦2,260 nmol / mL / hr, 165 to ≦2,260 nmol / mL / hr, 175 to ≦2,260, 180 to ≦2,260, 185 to ≦2,260, or 189 to ≦2,260 within at least two weeks of administration or less than two weeks of administration. In some embodiments of the invention, glycogen content in tissues is reduced from baseline by about 10% to about 40%, about 10% to about 30%, or about 15% to about 25% after administration of the rAAV. In some embodiments, clinically stable motor function is observed after rAAV administration as determined by a 6MWT decline of ≦12% or a decline of less than 43 meters from baseline on two consecutive assessments, at least three months apart. Stated differently, a clinically stable level of motor function as determined by 6MWT position is a decline of 0-12% from baseline on two consecutive assessments, at least three months apart. In some embodiments, clinically stable FVC% is observed after rAAV administration as predicted in the upright position, with a decline of ≦15% from baseline on two consecutive assessments, at least three months apart. Stated differently, a clinically stable level of pulmonary function as determined by %FVC predicted in the upright position is between 1-14% from baseline on two consecutive assessments, at least three months apart.
[0019] In some aspects of the invention described herein, an immune modulator is co-administered with AAV on the day of AAV administration or any day between 1 and 15 days prior to AAV administration. In some embodiments, the immune modulator is steroidal and / or non-steroidal, and / or a combination thereof. In some embodiments, the immune modulator is prednisone. In some embodiments, the immune modulator is methotrexate. In some embodiments, the immune modulator is a combination of methotrexate and prednisone. In some embodiments, methotrexate is administered at a starting dose of between about 2.5 mg / day and about 30 mg / day. In some embodiments, prednisone is administered at a starting dose of 60 mg / day, followed by tapering to lower doses.
[0020] In some embodiments of the invention, the dosage of recombinant AAV (rAAV) comprising a nucleic acid encoding GAA is between about 1.6E10 and about 1.6E12 vg / kg, and the subject receiving said AAV dose has received previous ERT, and ERT was discontinued on the same day, the day after, the day before, or any time between day 1 and week 26 after rAAV is administered any time between the day, the day after, the day before, or 1 day after ERT discontinuation, and GAA is expressed to a level such that the subject obtains serum levels of GAA expressed by the AAV in the pharmaceutically active range of 160 to ≦2,260 nmol / mL / hr, 165 to ≦2,260 nmol / ml / hr, 175 to ≦2,260, 180 to ≦2,260, 185 to ≦2,260, or 189 to ≦2,260 within at least two weeks of administration or less than two weeks of administration. In some embodiments, ERT is discontinued after a longer time point, e.g., after greater than about 26 weeks. In some aspects of the invention described herein, an immune modulator is co-administered with AAV on the day of AAV administration or any day between 1 and 15 days prior to AAV administration. In some embodiments, the immune modulator is steroidal and / or non-steroidal, and / or a combination thereof. In some embodiments, the immune modulator is prednisone. In some embodiments, the immune modulator is methotrexate. In some embodiments, the immune modulator is a combination of methotrexate and prednisone. In some embodiments, methotrexate is administered at a starting dose of between about 2.5 mg / day and about 30 mg / day. In some embodiments, prednisone is administered at a starting dose of 60 mg / day, followed by tapering to lower doses.
[0021] In some aspects of the present invention, there is no substantial overlap between rAAV administration and ERT. In some aspects of the present invention, there is only a one-day overlap between rAAV administration and ERT. In some embodiments, a subject receives a single rAAV infusion, and the previous ERT was discontinued before or on the same day as the rAAV infusion. In some embodiments, a subject receives ERT for at least about 24 weeks, at least about 26 weeks, at least about 30 weeks, at least about 50 weeks, about 52 weeks, or longer before rAAV administration. After ERT is discontinued, a single rAAV administration of at least 1.6E12vg / kg can result in one or more of the following clinically stable outcomes as measured by normal circulating and tissue GAA levels, normal tissue glycogen levels, clinically stable FVC%, and clinically stable 6MWT.
[0022] In particular, the technology described herein relates to the discovery that a single injection of a rAAV vector expressing human acid alpha-glucosidase (GAA) can be a sole replacement for repeated injections of enzyme replacement therapy (ERT) with recombinant human GAA protein (rhGAA). The inventors demonstrate that a one-time administration of an AAV expressing GAA results in long-term transduction of the normal GAA gene into hepatocytes and continuous constitutive expression of GAA in the systemic circulation. Thus, the inventors herein demonstrate that administration of a composition comprising an AAV expressing hGAA can replace the biweekly exogenous administration of ERT that subjects with Pompe disease normally undergo. That is, the inventors herein demonstrate that subjects with Pompe disease who are administered the AAV expressing hGAA disclosed herein can have a long-term cessation of ERT.
[0023] In particular, described herein are methods for treating Pompe in a subject in need thereof by administering to the subject a composition comprising an AAV vector expressing an alpha-glucosidase (GAA) protein, wherein the subject is not concurrently receiving GAA enzyme replacement therapy. In some embodiments, the technology relates to methods for administering an AAV expressing GAA, which allows the subject to discontinue GAA enzyme replacement therapy (ERT) for an extended period of time, such as at least three months, at least four months, at least five months, at least one year, at least one and a half years, and six months or longer. In some embodiments, the subject is discontinued from ERT on or shortly before the day of administration of the AAV expressing GAA as disclosed herein and is clinically stable with respect to at least one or more Pompe symptoms. In some embodiments, the subject is discontinued from ERT any time between one to two days before or after administration of the AAV expressing GAA and about six months after administration, as disclosed herein, and is clinically stable with respect to at least one or more Pompe symptoms for at least six months.
[0024] Additionally, the inventors have discovered that in Pompe patients administered AAV expressing GAA according to the methods and dose ranges disclosed herein, there is a minimal immune response to the GAA protein expressed by the AAV. Thus, in some embodiments, there is minimal or no need for immunomodulation or immunosuppressant administration at the time of, before, or after administration of the AAV to the subject, and therefore, the usual immunosuppressant protocols typically administered when a subject receives a viral vector or undergoes gene therapy are not required.
[0025] Therefore, in all embodiments herein, the method for treating Pompe comprises, or consists essentially of, or consists of administering an AAV vector expressing GAA disclosed herein in the absence of administering ERT for Pompe, and also in the absence of immune modulation. In some embodiments, the subject has late-onset Pompe disease (LOPD) or infantile-onset Pompe disease (IOPD).
[0026] In all embodiments disclosed herein, the AAV comprises a nucleotide sequence containing inverted terminal repeats (ITRs), a promoter, a heterologous gene, a polyA tail, and potentially other regulatory elements for use in treating Pompe disease, e.g., late-onset Pompe disease (LOPD), wherein the heterologous gene is GAA, and the vector, e.g., rAAV, can be administered to a patient at a therapeutically effective dose for expression of the heterologous GAA gene and delivery to appropriate tissues and / or organs for treatment of the disease, e.g., Pompe disease.
[0027] Aspects of the present invention teach certain advantages in construction and use that result in exemplary benefits described below. Other features and advantages of aspects of the present invention will become apparent from the following more detailed description, taken in conjunction with the accompanying drawings which illustrate, by way of example, the principles of aspects of the present invention.
[0028] An embodiment of the invention described herein is a method of treating Pompe disease in a subject, comprising administering to a subject a dose of about 1.6e 12 vg / kg ~ approx. 1.6e 13The present invention also relates to a method for treating Pompe disease with long-term GAA enzyme replacement therapy (ERT), comprising administering a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding a polypeptide comprising an expressible form of an alpha-glucosidase (GAA) polypeptide at a dosage of between 1000 and 10 ... In some embodiments of the methods disclosed herein, methotrexate is administered at a starting dose of 30 mg or less per week, between about 5 and 30 mg per week, or between 5 and 7.5 mg per week.
[0029] The accompanying drawings illustrate aspects of the present invention. In such drawings: [Brief explanation of the drawings]
[0030] [Figure 1-1] 1 is a diagrammatic representation of the plasmid map of the pAAV-LSPhGAA plasmid used to generate AAV8-hGAA (ACTUS-101) for use in a method for treating Pompe disease, according to at least one embodiment. The nucleotide sequences of the ITRs (single underlined), promoter (double underlined), coding sequence for hGAA (uppercase), and polyA (bold and italicized) are also shown. The entire sequence shown is SEQ ID NO:606. The 5' ITR sequence is SEQ ID NO:601, the 3' ITR sequence is SEQ ID NO:602, the promoter sequence is SEQ ID NO:603, the coding sequence for hGAA is SEQ ID NO:604, and the polyA sequence is SEQ ID NO:605. [Figure 1-2]1 is a diagrammatic representation of the plasmid map of the pAAV-LSPhGAA plasmid used to generate AAV8-hGAA (ACTUS-101) for use in a method for treating Pompe disease, according to at least one embodiment. The nucleotide sequences of the ITRs (single underlined), promoter (double underlined), coding sequence for hGAA (uppercase), and polyA (bold and italicized) are also shown. The entire sequence shown is SEQ ID NO:606. The 5' ITR sequence is SEQ ID NO:601, the 3' ITR sequence is SEQ ID NO:602, the promoter sequence is SEQ ID NO:603, the coding sequence for hGAA is SEQ ID NO:604, and the polyA sequence is SEQ ID NO:605. [Figure 1-3] 1 is a diagrammatic representation of the plasmid map of the pAAV-LSPhGAA plasmid used to generate AAV8-hGAA (ACTUS-101) for use in a method for treating Pompe disease, according to at least one embodiment. The nucleotide sequences of the ITRs (single underlined), promoter (double underlined), coding sequence for hGAA (uppercase), and polyA (bold and italicized) are also shown. The entire sequence shown is SEQ ID NO:606. The 5' ITR sequence is SEQ ID NO:601, the 3' ITR sequence is SEQ ID NO:602, the promoter sequence is SEQ ID NO:603, the coding sequence for hGAA is SEQ ID NO:604, and the polyA sequence is SEQ ID NO:605.
[0031] [Figure 2A-B] Figures 2A and 2B are tables (A) and (B), respectively, showing the initial demographic and baseline characteristics of the cohort.
[0032] [Figure 3] FIG. 3 contains two tables, the upper table showing adverse events and the lower table showing reported adverse events and resolution reports for each subject in the cohort through week 52.
[0033] [Figure 4]Figure 4 is a series of graphical representations of safety and efficacy data for each subject (101001, 101002, and 101003) over the indicated time periods. ELISA activity was obtained using three polypeptides representing the AAV8 capsid proteins, AAV8_A, AAV8_B, and AAV8_C. Serum GAA and alanine aminotransferase (ALT) levels are also shown.
[0034] [Figure 5A-D] Figures 5A-5D are a series of graphical representations of bioactivity markers: from left to right: Figure 5A) serum GAA, Figure 5B) muscle GAA, Figure 5C) muscle glycogen, and Figure 5D) glucose tetrasaccharide (Glc4).
[0035] [Figure 6] FIG. 6 is a graphical representation of a set of data from measurements of muscle function.
[0036] [Figure 7] FIG. 7 is a graphical representation of a set of data from measurements of muscle fatigue.
[0037] [Figure 8-1] Figure 8 is Appendix 1. [Figure 8-2] Figure 8 is Appendix 1. [Figure 8-3] Figure 8 is Appendix 1. [Figure 8-4] Figure 8 is Appendix 1.
[0038] [Figure 9-1] Figure 9 is Appendix 2. [Figure 9-2] Figure 9 is Appendix 2.
[0039] [Figure 10A-B]Figures 10A-10F are a series of graphical representations of data showing the 52-week safety profile of liver transaminases, CK, anti-rhGAA Ab, and AAV8-A ELISPOT. Figure 10A: aspartate aminotransferase; Figure 10B: alanine aminotransferase; Figure 10C: gamma glutamyltransferase; Figure 10D: creatine kinase; Figure 10E: anti-human recombinant acid alpha-glucosidase antibody (reverse titer); Figure 10F: T cell response (AAV8-A). [Figure 10C-D] Figures 10A-10F are a series of graphical representations of data showing the 52-week safety profile of liver transaminases, CK, anti-rhGAA Ab, and AAV8-A ELISPOT. Figure 10A: aspartate aminotransferase; Figure 10B: alanine aminotransferase; Figure 10C: gamma glutamyltransferase; Figure 10D: creatine kinase; Figure 10E: anti-human recombinant acid alpha-glucosidase antibody (reverse titer); Figure 10F: T cell response (AAV8-A). [Figure 10E-F] Figures 10A-10F are a series of graphical representations of data showing the 52-week safety profile of liver transaminases, CK, anti-rhGAA Ab, and AAV8-A ELISPOT. Figure 10A: aspartate aminotransferase; Figure 10B: alanine aminotransferase; Figure 10C: gamma glutamyltransferase; Figure 10D: creatine kinase; Figure 10E: anti-human recombinant acid alpha-glucosidase antibody (reverse titer); Figure 10F: T cell response (AAV8-A).
[0040] [Figure 11] FIG. 11 is a graphical representation of serum acid alpha-glucosidase activity for each patient over a 52-week period.
[0041] [Figure 12A-B]Figures 12A-12B show the results of long-term follow-up of each subject (001, 002, and 003) 104 weeks after administration of AAV8-LSPhGAA (ACTUS 101). Figure 12A shows the results from the 6MWT (6-minute walk test), and Figure 12B shows the results of FVC (forced vital capacity). Subjects 001 and 002 remained ERT-free for the entire 24- to 104-week period, while subject 003 discontinued ERT at 24 weeks but resumed ERT after 97 weeks.
[0042] [Figure 13A] Figures 13A-13B are graphical representations of T cell reactivity (SFU / million PBMCs) to AAV8 vectors, transaminitis (ALT levels), and serum GAA levels in subjects from Cohort 2. Figure 13A shows data for subject 006, and Figure 13B shows data for subject 004. [Figure 13B] Figures 13A-13B are graphical representations of T cell reactivity (SFU / million PBMCs) to AAV8 vectors, transaminitis (ALT levels), and serum GAA levels in subjects from Cohort 2. Figure 13A shows data for subject 006, and Figure 13B shows data for subject 004.
[0043] [Figure 14] FIG. 14 is a graphical representation of the methotrexate and prednisone regimens for Cohort 3 subjects.
[0044] [Figure 15] FIG. 15 is a table showing biopsy results for Cohort 3 subjects at 24 and 52 weeks.
[0045] [Figure 16]Figure 16 is a graphical representation of results from Cohort 3 showing T cell reactivity to vector capsid and GAA as indicated by SFU / 1e6 PBMCs (bars) and hypertransaminasmia as indicated by AST / ALT (IU / L) levels (solid line). Dotted lines indicate normal range for ALT (top line) and AST (bottom line).
[0046] [Figure 17] FIG. 17 is a graphical representation of serum GAA levels in Cohort 3 over time.
[0047] [Figure 18] Figure 18 is a schematic diagram showing the study design. Supplements are prepared for Treatment A (active and indistinguishable placebo) and Treatment B (active and indistinguishable placebo), and subjects then receive two sets of treatments: A (active) and B (placebo), or A (placebo) and B (active). DETAILED DESCRIPTION OF THE INVENTION
[0048] The figures described above illustrate aspects of the present invention in at least one of its exemplary embodiments, which are further defined in detail in the following description. Features, elements, and aspects of the present invention referenced by the same numerals in different figures represent the same, equivalent, or similar features, elements, or aspects according to one or more embodiments.
[0049] Detailed Description The technology described herein relates to the discovery that administration of a rAAV vector expressing human GAA can be a sole replacement for repeated injections of GAA enzyme replacement therapy (ERT). In the examples herein, it is demonstrated that a single administration of an appropriate dose of AAV expressing the GAA disclosed herein results in permanent transduction of normal GAA gene into hepatocytes and continuous constitutive expression of systemic GAA, thereby negating the need for exogenous administration of ERT weekly or every other week, which is usually administered to subjects with Pompe disease. That is, the inventors herein demonstrated that subjects with Pompe disease administered AAV expressing hGAA disclosed herein can have long-term cessation of ERT.
[0050] Thus, the disclosure described herein generally relates to methods and compositions for treating Pompe disease in a subject, methods that comprise, consist essentially of, or consist of administering an AAV vector expressing GAA as disclosed herein in the absence of co-administration with enzyme replacement therapy (ERT) using GAA or other small molecule treatments for Pompe. In some embodiments, the methods also comprise, consist essentially of, or consist of administering an AAV vector expressing GAA with minimal or no immune modulation.
[0051] In some embodiments, the methods for treating Pompe disease disclosed herein include administering to a subject a pharmaceutical composition comprising, consisting essentially of, or consisting of an AAV vector expressing GAA disclosed herein, in the absence of concomitant treatment or administration of another therapy or treatment for Pompe, including, but not limited to, enzyme replacement therapy (ERT) with GAA or other small molecule treatments for Pompe. That is, the methods disclosed herein relate to treating Pompe by administering to a subject an AAV expressing GAA, in the absence of co-administration, combination treatment, or concomitant treatment with GAA ERT.
[0052] In some embodiments, the subject has late-onset Pompe disease (LOPD) or infantile-onset Pompe disease.
[0053] The disclosure herein generally relates to a method for treating a subject with Pompe disease, comprising, or consisting essentially of, administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding a polypeptide, including an alpha-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter, and wherein the subject is not receiving GAA enzyme replacement therapy (ERT).
[0054] In all aspects disclosed herein, recombinant AAV (rAAV) vectors and constructs for rAAV for delivering nucleic acids encoding GAA polypeptides to a subject for the treatment of Pompe disease are disclosed in International Publication Nos. WO2020 / 102645 and WO2021102107A1, both of which are incorporated by reference in their entireties herein.
[0055] The present inventors demonstrate that, for example, an rAAV vector (referred to herein as AAV8-LSPhGAA) containing an AAV8 capsid, a liver-specific promoter (LSP) and a transgene for hGAA selectively expresses and secretes GAA from transduced hepatocytes when administered as a one-time single IV dose.The present inventors demonstrate that the main mechanism of action of rAAV8-LSPhGAA is to secrete continuous low levels of GAA from the liver into the systemic circulation to provide a therapeutic level of GAA exposure to tissues, for example, but not exclusively in muscle, to remove glycogen and restore cellular structure and function.In addition, the present inventors demonstrate that rAAV8-LSP-hGAA also mediates a regulatory T cell response in the host, resulting in immune tolerance to secreted GAA. Thus, the data presented in the Examples herein demonstrate that rAAV8-LSP-hGAA expresses GAA at levels that induce immune tolerance, counteracting the potentially negative effects of co-administration of an ERT (e.g., alglucosidase alfa / LUMIZYME®), and thus suppressing the inhibition of receptor-mediated uptake of GAA by neutralizing antibodies.
[0056] In some embodiments, recipient subjects maintain substantially low T cell reactivity to the vector capsid. In some embodiments, T cell reactivity is below a threshold range of >40 to <120 SFU / million PBMCs, as measured, for example, by ELISpot reactivity. In some embodiments, subjects exhibit these levels for at least about 250 days after AAV-LSP-hGAA administration and / or for at least about 80 days after ERT cessation.
[0057] In some embodiments, GAA is expressed by comprising at least a signal peptide that promotes the secretion of GAA polypeptide from liver.In some embodiments, GAA polypeptide or modified GAA is expressed as a fusion protein that comprises at least a signal peptide that promotes the secretion of GAA polypeptide from liver.In some embodiments, GAA can be optionally fused with a targeting sequence that allows efficient targeting to lysosome in mammalian cells, such as muscle cells, for example, human heart and skeletal muscle cells.
[0058] In all aspects of all embodiments of the technology described herein, liver-specific promoter preferentially expresses hGAA polypeptide in liver.In all aspects of all embodiments of the technology described herein, liver-specific promoter preferentially expresses hGAA polypeptide in liver.In all aspects of all embodiments of the technology described herein, in some embodiments, AAV vector comprises at least one capsid protein that targets liver.
[0059] I. Method of Administration The disclosure herein generally relates to a method for treating a subject with Pompe disease, the method comprising administering to the subject a pharmaceutical composition comprising, or consisting essentially of, a recombinant adeno-associated virus (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding a polypeptide, including an alpha-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter, and the subject may not be receiving GAA enzyme replacement therapy (ERT) for an extended period of time or may have had an extended break from ERT. In one embodiment, ERT is continued but at least one of the dosage or frequency is reduced.
[0060] In the examples, the results of human clinical trials for AAV-mediated gene transfer of GAA for Pompe disease are disclosed herein. In particular, the examples disclosed herein disclose the results of a clinical development program established to evaluate the therapeutic efficacy of administering AAV8-LSPhGAA viral vector, which is AAV8 (see, for example, Figure 1 herein) that expresses GAA under the control of a liver-specific promoter (LSP), and its ability to treat Pompe disease without concurrent ERT administration and / or after ERT cessation.
[0061] In all aspects disclosed herein, recombinant AAV (rAAV) vectors and constructs for rAAV for delivering GAA polypeptides to subjects in the methods for treating Pompe disease disclosed herein are disclosed in International Publication Nos. WO2020 / 102645 and WO2021102107, both of which are incorporated by reference in their entireties.
[0062] While not wishing to be bound by theory, the inventors have discovered a method for treating Pompe disease by AAV-mediated delivery of GAA to a subject, wherein the rAAV expresses GAA to a steady state shortly after administration, such that the subject can discontinue ERT as early as the time of rAAV administration, contemporaneously with, or approximately at the time of rAAV administration, e.g., ERT can be discontinued the day before, the same day, or the day after administration, or within one or two weeks of administration. As disclosed herein, steady-state GAA expression by the rAAV disclosed herein is a serum level of GAA in the pharmacologically active range of about 160 to ≦2,260 nmol / mL / hour, or about 189 to ≦2,260 nmol / mL / hour. In some embodiments, ERT is discontinued when the subject shows biochemical evidence of secretion of the transgene GAA. In some embodiments, the subject also does not exhibit a clinically significant decline in motor function (6MWT) or function (FVC upright). In some embodiments, ERT is discontinued anytime between about 24 weeks and about 104 weeks.
[0063] In some embodiments, methods for treating Pompe disease using rAAV expressing GAA disclosed herein include administration of a therapeutically effective amount of rAAV that results in serum levels of expressed hGAA within a pharmacologically active range of between 189 and 410 nmol / mL / hour, or between 410 and ≦2,260 nmol / mL / hour.
[0064] In some embodiments, methods for treating Pompe disease using rAAV expressing GAA disclosed herein include administering an rAAV that results in a serum level of expressed hGAA within the range of 189 to ≦2,260 nmol / mL / hour, and the subject achieves clinical stability of one or more symptoms of Pompe disease. Clinical stability includes a steady state of any one or more of the following parameters: 6MWT (6-minute walk test) and FVC (forced vital capacity). In some embodiments, clinical stability refers to a stable level of either motor function (determined by 6MWT) and / or pulmonary function (determined by FVC) at two consecutive assessments separated by at least three months. In some embodiments, a clinically stable level of motor function as determined by 6MWT is a ≦12% decline from baseline or a decrease of less than 43 meters at two consecutive assessments separated by at least three months. In other words, a clinically stable level of motor function as determined by 6MWT position is a decline of 0-12% from baseline at two consecutive assessments separated by at least three months.
[0065] In some embodiments, the clinically stable level of lung function as determined by %FVC predicted in an upright position is a decrease of ≦15% from baseline on two consecutive assessments at least three months apart. Stated another way, the clinically stable level of lung function as determined by %FVC predicted in an upright position is between 1-14% from baseline on two consecutive assessments at least three months apart.
[0066] In some embodiments, the baseline 6MWT or FVC level is a level measured at or before administration of a GAA-expressing rAAV. In some embodiments, the baseline 6MWT or FVC level is a level measured at or before administration of a GAA-expressing rAAV if the subject is concurrently administered GAA ERT. In some embodiments, the baseline 6MWT or FVC level is a level measured at or before administration of a GAA-expressing rAAV if the subject is discontinued from GAA ERT. In some embodiments, the baseline 6MWT or FVC level is a level measured before discontinuing GAA ERT, for example, about 24 to about 26 weeks. In some embodiments, clinical stability is maintained in a Pompe patient between before and after ERT discontinuation, where the patient received a single dose of an AAV comprising a nucleic acid encoding GAA administered at the time of, before, or after ERT administration. Maintained clinical stability indicates that 6MWT and / or FVC are within the range from baseline described herein.
[0067] In some embodiments, methods for treating Pompe disease using rAAV expressing GAA disclosed herein include administering an amount of rAAV that results in a reduction of glycogen levels in one or more tissues to within the normal range, where the normal range is the glycogen level in a comparison tissue of a subject without Pompe disease. In some embodiments of the invention, glycogen content in the tissue is reduced by about 10% to about 40%, about 10% to about 30%, or about 15% to about 25% from baseline (e.g., measurements taken on or before day 1 of AAV-GAA administration).
[0068] A. AAV-hGAA Dosage As disclosed herein, in the Examples, human subjects were administered a dose of 1.6E12 vg / kg of rAAV expressing GAA (Cohort 1), with ERT cessation occurring approximately 24 or 26 weeks after recombinant AAV administration; i.e., the final dose of ERT for Cohort 1 subjects was administered approximately 24 weeks after rAAV administration, and thus ERT cessation occurred at or approximately the beginning of the 26th week after administration. In Cohort 1, even in the absence of ERT, there was therapeutic correction of disease pathophysiology and also protection against immune responses to the expressed hGAA, as measured, for example, by antibodies to the expressed hGAA, demonstrating that subjects with Pompe disease administered an AAV expressing hGAA as disclosed herein can have long-term cessation of ERT.
[0069] In some embodiments, the dose of rAAV vector or rAAV genome administered to a subject in accordance with the methods for treating Pompe disease disclosed herein depends on the mode of administration, the severity of Pompe disease or other condition being treated and / or prevented, the condition of the individual subject, the particular viral vector or capsid, the liver-specific promoter used, and the nucleic acid being delivered, including, but not limited to, a nucleic acid encoding a signal peptide attached 5' to a nucleic acid encoding an expressible GAA polypeptide, and can be determined in a routine manner.
[0070] In some embodiments, a therapeutically effective amount of a GAA-expressing rAAV vector is an amount that results in a steady-state serum GAA concentration similar to the GAA pharmacological activity achieved by long-term GAA ERT (e.g., within 5%, 10%, or 20% of such a level). For example, the steady-state target GAA serum concentration is in the range of about 160 to ≦2,260 nmol / mL / hour, about 189 to ≦2,260 nmol / mL / hour, or about 410 to ≦2,260 nmol / mL / hour. In some embodiments, the dose of a GAA-expressing rAAV vector is a therapeutically effective amount that achieves a steady-state target GAA serum concentration that confers a pharmacological activity range of 189 to ≦2,260 nmol / mL / hour. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA levels in a subject to >0.30 μmol 4MU / min / gram tissue, where the normal range of tissue GAA content in subjects without Pompe disease is 0.36±0.13 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA levels in a subject to between 0.25-0.4 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that results in a normal tissue GAA content of about 0.36 μmol 4MU / min / gram of tissue, e.g., about 0.25, or about 0.26, or about 0.27, or about 0.28, or about 0.29, or about 0.30, or about 0.31, or about 0.32, or about 0.33, or about 0.34, or about 0.35, or about 0.36, or about 0.37, or about 0.38, or about 0.39, or about 0.40 μmol 4MU / min / gram of tissue.
[0071] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA levels in a subject by between 0.1 and 0.5 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that results in normal tissue GAA content greater than about 0.36 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content or levels in a subject by between 0.2 and 0.4 μmol 4MU / min / gram tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in a subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the normal muscle tissue GAA content of 0.36±0.13 (μmol 4MU / min / gram tissue), where normal muscle tissue GAA content is the reference level of GAA in subjects without Pompe disease. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in a subject to greater than 0.1 mol 4MU / min / gram tissue, where the normal range of GAA content in subjects with Pompe disease is 0.05±0.04 (μmol 4MU / min / gram tissue). In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in the subject by more than 2-fold, or 3-fold, or 4-fold, or 5-fold, or 6-fold, or 7-fold, or 8-fold, or 9-fold, or more than 10-fold the level of GAA tissue content in a subject with Pompe. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that increases tissue GAA content in the subject by about 50%, or about 40%, or about 30%, or about 20%, or about 10%, or about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, or about 1% of the level of GAA tissue content in a subject with Pompe.In some embodiments, GAA activity in muscle is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 5-fold, at least 8-fold, or at least 10-fold the level before AAV administration. In some embodiments, GAA activity in muscle is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 5-fold, at least 8-fold, or at least 10-fold the level after long-term ERT has been discontinued for at least about 24 weeks.
[0072] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that reduces tissue glycogen levels in a subject by 0.25% wet tissue weight to about 1.5% wet tissue weight. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that reduces muscle tissue glycogen levels in a subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of the normal muscle tissue glycogen content (measured as % wet tissue weight) of 0.99% ± 0.74 (% wet tissue weight) in subjects without Pompe disease.
[0073] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount of GAA that exhibits a 3-5 fold improvement in therapeutic index.
[0074] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that results in stabilization of one or more symptoms of Pompe disease, for example, as determined by the clinical stability parameters disclosed herein. Such parameters include the steady-state 6MWT (6-minute walk test) and / or FVC (forced vital capacity) at two consecutive assessments at least three months apart, as disclosed herein. In some embodiments, the clinically stable level of motor function as determined by the 6MWT is a decrease of ≦12% or less than 43 meters from baseline at two consecutive assessments at least three months apart. In some embodiments, the clinically stable level of pulmonary function as determined by FVC% predicted in the upright position is a decrease of ≦15% from baseline at two consecutive assessments at least three months apart.
[0075] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount that results in the subject having clinically stable levels of hGAA 10 weeks, or at least 20 weeks, or 30 weeks after AAV administration.
[0076] In certain embodiments, as used herein, without limitation, the term "effective amount" is synonymous with "therapeutically effective amount," "effective dose," or "therapeutically effective dose." In certain embodiments, the effectiveness of the therapeutic compounds disclosed herein for treating Pompe disease can be determined by observing an improvement in an individual based on, without limitation, one or more clinical symptoms and / or physiological indicators associated with Pompe disease. In certain embodiments, an improvement in symptoms associated with Pompe disease can be indicated by a reduced need for concomitant therapy.
[0077] In some embodiments, when the rAAV vector expressing hGAA is AAV8-LSPhGAA as disclosed herein, exemplary doses to achieve a therapeutic effect are at least about 1.0E11vg / kg, 1.1E11vg / kg, 1.2E11vg / kg, 1.3E11vg / kg, 1.4E11vg / kg, 1.5E11vg / kg, 1.6E11vg / kg, 1.7E11vg / kg, 1.8E11vg / kg, 1.9E11vg / kg, 1.10E11vg / kg, 1.11E11vg / kg, 1.2E11vg / kg, 1.3E11vg / kg, 1.4E11vg / kg, 1.5E11vg / kg, 1.6E11vg / kg, 1.12E11vg / kg, 1.13E11vg / kg, 1.14E11vg / kg, 1.15E11vg / kg, 1.16E11vg / kg, 1.17E11vg / kg, 1.18E11vg / kg, 1.19E11vg / kg, 1.20E11vg / kg, 1.21E11vg / kg, 1.22E11vg / kg, 1.23E11vg / kg, 1.24E11vg / kg, 1.25E11vg / kg, 1.26E11vg / kg, 1.27E11vg / kg, 1.28E11vg / kg, 1.29E11vg / kg, 1.30E11vg / kg, 1.31E11vg / kg, 1. 11vg / kg, 1.7E11vg / kg, 1.8E11vg / kg, 1.9E11vg / kg, approximately 1.0E12vg / kg, approximately 1.1E12vg / kg, approximately 1.2E12vg / kg, approximately 1.3E12vg / kg, approximately 1.4E12vg / kg, approximately 1.5E12vg / kg, approximately 1.6E12vg / kg, approximately 1.7E12vg / kg, approximately 1.8E12vg / kg , about 1.9E12vg / kg, about 2.0E12vg / kg, about 3.0E12vg / kg, about 4.0E12vg / kg, about 5.0E12vg / kg, about 6.0E12vg / kg, Approx. 7.0E12vg / kg, approx. 8.0E12vg / kg, approx. 9.0E12vg / kg, approx. 1.0E13vg / kg, approx. 1.2E13vg / kg, approx. 1.2E13vg / kg, approx. 1 The potency is about 0.2E13vg / kg, about 1.3E13vg / kg, about 1.4E13vg / kg, about 1.5E13vg / kg, about 1.6E13vg / kg, about 1.7E13vg / kg, about 1.8E13vg / kg, about 1.9E13vg / kg, about 2.0E13vg / kg, about 3.0E13vg / kg, about 4.0E13vg / kg, and about 5.0E13vg / kg.
[0078] In preferred embodiments, exemplary doses for achieving a therapeutic effect according to the methods disclosed herein are between 1.2E11 and 4.0E11vg / kg, e.g., a potency of at least about 1.0E11vg / kg, 1.1E11vg / kg, 1.2E11vg / kg, 1.3E11vg / kg, 1.4E11vg / kg, 1.5E11vg / kg, 1.6E11vg / kg, 1.7E11vg / kg, 1.8E11vg / kg, 1.9E11vg / kg. In other preferred embodiments, exemplary doses are between 1.2E12 and 4.0E12 vg / kg, e.g., at least about 1.0E12 vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 2.1E12 vg / kg, about 2.2E12 vg / kg, about 2.3E12 vg / kg, The potency is about 2.4E12vg / kg, about 2.5E12vg / kg, about 2.6E12vg / kg, about 2.7E12vg / kg, about 2.8E12vg / kg, about 2.9E12vg / kg, about 3.0E12vg / kg, about 3.1E12vg / kg, about 3.2E12vg / kg, about 3.3E12vg / kg, about 3.4E12vg / kg, about 3.5E12vg / kg, about 3.6E12vg / kg, about 3.7E12vg / kg, about 3.8E12vg / kg, about 3.9E12vg / kg, about 4.0E12vg / kg.
[0079] In some embodiments, when the rAAV vector expressing hGAA is AAV8-LSPhGAA as disclosed herein, an exemplary dose to achieve a therapeutic effect is a titer of at least about 1.0E11 to 4.0E11 vg / kg, or about 1.0E12 to 4.0E12 vg / kg, or about 1.2E12 to 3.0E12 vg / kg, or about 1.2E12 to 2.5E12 vg / kg, or about 2.5E12 to 4.0E12 vg / kg, or about 2.0E12 vg / kg to about 5E12 vg / kg, or about 4.E12 vg / kg to about 2E13 vg / kg.
[0080]
[0081] In some embodiments, the dosage may be modified by those skilled in the art. For example, the administered dose may be lower than 1.0E12 vg / kg or lower than about 1.6E12 vg / kg when a promoter stronger than the LSP used in the AAV8-LSPhGAA vector disclosed herein is operably linked to a nucleic acid encoding GAA. In contrast, in alternative embodiments, the dosage may be modified by those skilled in the art. For example, the administered dose of the rAAV vector may be higher than about 1.6E12 vg / kg or higher than about 5.0E12 vg / kg when a liver-specific promoter weaker than the LSP used in the AAV8-LSPhGAA vector disclosed herein is operably linked to a nucleic acid encoding GAA. An exemplary dose for achieving a therapeutic effect is at least about 1.0E12 vg / kg. 5 , 1.0E 6 , 1.0E 7 , 1.0E 8 , 1.0E 9 , 1.0E 10 , 1.0E 11 , 1.0E 12 The titer is approximately 1.0E vg / kg, if necessary. 10 ~approx. 1.0E 12 Transducing units (vg / kg), if needed, approximately 4.0E 12 Not to exceed vg / kg, or, if necessary, approximately 3.0E 12 Transducing units (vg / kg).
[0082] Similarly, in some embodiments, dosages may be modified by one skilled in the art, e.g., the administered dose may be lower than 1.0E12 vg / kg or lower than about 1.6E12 vg / kg when a signal sequence stronger than the endogenous GAA signal sequence used in the AAV8-LSPhGAA vector disclosed herein is linked 5' to the expressed GAA polypeptide. In contrast, in alternative embodiments, dosages may be modified by one skilled in the art, e.g., the administered dose of rAAV vector may be higher than about 1.6E12 vg / kg or higher than about 1.6E13 vg / kg when an immunomodulatory agent is used.
[0083] In further embodiments, administration of an rAAV vector or rAAV genome according to the methods disclosed herein to treat a subject with Pompe disease can result in production of GAA protein with a circulating half-life of 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, or longer.
[0084] In some embodiments, the methods for treating Pompe disease disclosed herein involve using a single dose of rAAV expressing hGAA to treat a subject in a single administration. However, in some embodiments, the administered dose of rAAV can be given to a subject in multiple doses, for example, the dose of rAAV can be divided into subdoses and administered in multiple doses.
[0085] In certain embodiments, the period between administration of sub-doses of an rAAV vector according to the methods for treating Pompe disclosed herein is selected from any of the following: 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more.
[0086] In some embodiments, it is contemplated that the methods for treating Pompe disclosed herein may include multiple administrations of a single dose of an rAAV expressing hGAA, i.e., a subject may be treated with booster doses (i.e., second, third, fourth, etc.) of an rAAV expressing hGAA after a defined period of time following the initial or first administration. The booster dose (i.e., second, third, fourth, fifth, etc.) may be the same dose (amount) of rAAV-hGAA administered in the first administration, or may be a higher or lower dose depending on the factors described above, including, but not limited to, a therapeutically effective dose that achieves any one or more of one or more Pompe symptoms, including, but not limited to, (i) serum GAA levels indicative of a steady state of GAA expression, (ii) reduction in glycogen levels and / or maintenance of glycogen levels within the normal range in muscle, and (iii) muscle and / or lung function within clinically stable levels. As disclosed herein, steady-state GAA expression by the rAAVs disclosed herein is a serum level of GAA in the pharmacologically active range of 165 to ≦2,260 nmol / ml / hr, or 189 to ≦2,260 nmol / mL / hr. Stability of one or more symptoms of Pompe disease can be determined by the clinical stability parameters disclosed herein, including steady-state 6MWT (6-minute walk test) and / or FVC (forced vital capacity) at two consecutive assessments at least three months apart. In some embodiments, a clinically stable level of motor function as determined by the 6MWT is a ≦12% decline from baseline or a decrease of less than 43 meters at two consecutive assessments at least three months apart. In some embodiments, a clinically stable level of pulmonary function as determined by FVC% predicted in the upright position is a ≦15% decline from baseline at two consecutive assessments at least three months apart.
[0087] In certain embodiments, the period between administration of the first dose and subsequent doses (i.e., booster doses) of an rAAV vector according to the methods for treating Pompe disclosed herein is selected from any of the following: about 4 months, about 6 months, about 7 months, about 8 months, about 9 months, about 12 months, about 18 months, about 24 months, or about 3 years, about 4 years, about 5 years, or more than 5 years.
[0088] In another embodiment, administration of an rAAV vector or rAAV genome disclosed herein for the treatment of Pompe disease results in a weight gain of, e.g., at least 0.5 pounds, at least 1 pound, at least 1.5 pounds, at least 2 pounds, at least 2.5 pounds, at least 3 pounds, at least 3.5 pounds, at least 4 pounds, at least 4.5 pounds, at least 5 pounds, at least 5.5 pounds, at least 6 pounds, at least 6.5 pounds, at least 7 pounds, at least 7.5 pounds, at least 8 pounds, at least 8.5 pounds, at least 9 pounds, at least 9.5 pounds, at least 10 pounds, at least 10.5 pounds, at least 11 pounds, at least 11.5 pounds, at least 12 pounds, at least 12.5 pounds, at least 13 pounds, at least 13.5 pounds, at least 14 pounds, at least 14.5 pounds, at least 15 pounds, at least 20 pounds, at least 25 pounds, at least 30 pounds, or at least 50 pounds.
[0089] In another embodiment, an AAV GAA of any serotype disclosed herein for the treatment of Pompe disease results in a weight gain of, for example, 0.5 lbs to 50 lbs, 0.5 lbs to 30 lbs, 0.5 lbs to 25 lbs, 0.5 lbs to 20 lbs, 0.5 lbs to 15 lbs, 0.5 lbs to 10 lbs, 0.5 lbs to 7.5 lbs, 0.5 lbs to 5 lbs, 1 lb to 15 lbs, 1 lb to 10 lbs, 1 lb to 7.5 lbs, 1 lb to 5 lbs, 2 lbs to 10 lbs, or 2 lbs to 7.5 lbs.
[0090] B. Discontinuation of long-term ERT Treatment of Pompe disease typically involves the administration of long-term enzyme replacement therapy (ERT) using recombinant human acid α-glucosidase (rhGAA), which has previously been reported to prolong survival in both LOPD and IOPD patients by improving pulmonary and muscle function. However, Schoser et al. reported that after a stabilization period, both of these parameters continued to decline over time (see Schoser et al., 2017 Neurol, 264: 621-30). In addition, ERT using recombinant GAA protein has numerous disadvantages, including, but not limited to, the short half-life of administered recombinant GAA in the blood, the lack of efficient skeletal muscle uptake, the potential for high-titer antibody responses and even some patients not responding to ERT, and the demanding administration of recombinant GAA infusions every 2 weeks, which can take between 5 and 8 hours. And although disease progression is slowed compared to untreated subjects, the benefits of ERT may be short-lived, and many patients die or remain debilitated despite adherence to treatment (Tarnopolsky et al. 2016 Can J Neurol Sci, 43: 472-85).
[0091] The declining efficacy of recombinant GAA protein ERT in subjects is partly explained by an immune response to ERT, resulting in the formation of high and persistent anti-GAA antibody titers (HSAT). Subjects with HSAT showed greatly increased mortality compared with patients who did not develop antibodies or developed only low-titer antibodies (Banugaria et al. 2011). Furthermore, the ability to prevent antibody formation in subjects at risk for HSAT through immunosuppression significantly extended survival, confirming the clinical relevance of HSAT (Mendelsohn et al. 2009; Banugaria et al. 2013; Kazi et al. 2017).
[0092] Subjects with Pompe disease are considered cross-reactive immunological material (CRIM) positive if they have residual GAA enzyme activity and CRIM negative if no residual GAA activity is detectable. Based on pooled clinical study data, 28% of Pompe disease cases have the infantile-onset form, of which approximately 85% have the classic infantile-onset form, three-quarters of which are CRIM positive (Kemper, Comeau, and Green 2013). Determining CRIM status in newly diagnosed IOPD patients is important because it allows for the initiation of preventive immunomodulatory measures before initiating ERT, thus offsetting the worst deleterious effects of HSAT. CRIM-negative Pompe disease subjects developed HSAT and showed significantly reduced efficacy from ERT using rhGAA (Amalfitano et al. 2001). In the first pilot study of ERT in Pompe disease using Chinese hamster ovary cell-derived rhGAA, two subjects who were CRIM-negative developed higher anti-GAA antibody titers than the third subject who was CRIM-positive. This corresponded to a marked reduction in the efficacy of ERT in CRIM-negative subjects. The relevance of antibody formation to the efficacy of treatment in Pompe disease was highlighted by the poor response of CRIM-negative subjects to ERT, which correlated with the onset of HSAT (Kishnani et al. 2010).
[0093] Although LOPD subjects are not CRIM-negative, some mount high antibody responses to rhGAA that may prevent optimal efficacy of ERT (Patel et al. 2012; de Vries et al. 2017; "LUMIZYME Prescribing Information" 2014). Additionally, all Pompe subjects mount some level of anti-GAA antibody response, but the effect on ERT efficacy is unknown.
[0094] As disclosed herein, the inventors have demonstrated herein that subjects with Pompe disease administered with an AAV expressing hGAA as disclosed herein can have a long-term hiatus from long-term ERT administration. In particular, the Examples present data demonstrating that subjects with Pompe disease administered with an AAV expressing a GAA polypeptide have the ability to reduce or eliminate the clinical need for long-term hGAA ERT administration.
[0095] Thus, the disclosed methods allow subjects with Pompe disease to discontinue or stop long-term administration of recombinant human GAA (rhGAA) ERT, which is typically administered on a weekly or every other week regimen. In some embodiments, the methods disclosed herein allow subjects with Pompe disease to take an extended period of time (e.g., a long-term ERT break) off their usual ERT regimen when the subject is administered a particular dose of an AAV vector expressing a GAA polypeptide disclosed herein. In some embodiments, the discontinuation of long-term ERT begins approximately at the time of administration of the AAV vector to the subject (e.g., the day before, the day of, or the day after), or in some embodiments, the discontinuation of long-term ERT can occur about 24 weeks, or anywhere between about 24 weeks and about 26 weeks, after administration of the AAV vector. In some embodiments, the discontinuation of ERT begins sometime within a defined period of time after administration of AAV-GAA (e.g., between day 1 and 26 weeks, or between day 1 and 6 months). In some embodiments, discontinuation of ERT begins after the subject demonstrates biochemical evidence of transgene GAA secretion within a defined pharmacological activity range (eg, as discussed herein).
[0096] As disclosed herein, "long-term ERT" refers to the standard of care (SOC) treatment for subjects with Pompe disease, including IOPD and LOPD, and is typically a regimen of regular and frequent, e.g., weekly or biweekly, intravenous administration of recombinant human alglucosidase alfa protein (rhGAA) to a subject, without any breaks in the regimen, where the administered rhGAA protein provides an exogenous source of GAA. MYOZYME® (alglucosidase alfa), the first product approved in the United States for the treatment of Pompe disease (in 2006), and LUMIZYME® (alglucosidase alfa), approved in 2010, are exemplary current standard of care (SOC) treatments for infantile-onset and late-onset Pompe patients. The usual long-term ERT regimen is intravenous alglucosidase alfa administered as an infusion at a dose of 20 mg / Kg every 2 weeks (LUMIZYME Package Insert 2014).
[0097] As disclosed herein, the methods disclosed herein allow for the cessation or withdrawal of long-term ERT administration for an extended period of time, in some embodiments, at least about 3 months, or at least about 6 months, or at least about 1 year, or more than 1 year.
[0098] As disclosed herein, a "long-term" period, as referred to in relation to the period during which long-term ERT administration is discontinued, refers to a period of time greater than one month, and in some embodiments, greater than up to five missed doses of ERT.
[0099] Thus, in some embodiments, the methods for treating a subject with Pompe disease disclosed herein include administering to the subject a pharmaceutical composition comprising an AAV expressing GAA, wherein the subject has not been receiving long-term GAA enzyme replacement therapy (ERT) for a long period of time. In some embodiments, the cessation or discontinuation of long-term ERT occurs anywhere between 1-2 days and at least 24 weeks after administration of the AAV-GAA vector. That is, in some embodiments, the subject being treated can stop administering ERT on the day of, before, or after administration of AAV-GAA. In some embodiments, the subject being treated by the methods disclosed herein can stop ERT about 1 week, or about 2 weeks, or about 3 weeks, or about 1 month, or about 2 months, or about 3 months, or about 4 months, or about 5 months, or about 6 months after administration of AAV-GAA.
[0100] The exact time frame for stopping or pausing ERT in each subject according to the methods disclosed herein can be determined by one skilled in the art, and without wishing to be limited by theory, encompassed herein are methods in which ERT is stopped when the serum GAA level achieved from expression by AAV-hGAA is at least 165 nmol / ml / hour, or at least 189 nmol / ml / hour, for example, close to or approximately a serum level within the pharmacologically active range of 189 to ≦2,260 nmol / mL / hour. In some embodiments, encompassed herein are methods in which ERT is stopped when the serum GAA level achieved from expression by AAV-hGAA is within 50%, or within 60%, or within 70%, or within 80% of a serum level within the pharmacologically active range of 189 nmol / mL / hour. In some embodiments, methods are encompassed herein in which ERT is terminated when serum GAA levels achieved from expression by AAV-hGAA are within 50%, or within 60%, or within 70%, or within 80% of serum levels within the pharmacological activity range of between 165 and about 2000 nmol / mL / hour.
[0101] In some embodiments, the present invention encompasses a method in which ERT is stopped when the serum GAA level that is achieved by normal ERT regimen is replaced by the GAA serum level that is achieved by AAV-hGAA expression.For example, when the serum GAA level that is caused by recombinant hGAA from the last ERT administration decreases, there is a simultaneous increase in the serum GAA level that is achieved by AAV-hGAA expression, so that ERT cessation or suspension does not lead to a decrease in the clinical stability of one or more symptoms of Pompe disease in the subject, as measured by 6MWT or FVC according to the method disclosed herein. For illustrative purposes only, in some embodiments, ERT discontinuation or cessation occurs when the administered AAV-hGAA results in expressed GAA levels that achieve serum GAA levels for clinical stabilization of one or more symptoms of Pompe disease in the subject, e.g., a clinically stable level of motor function as determined by 6MWT is a ≦12% decrease or a decrease of less than 43 meters from baseline on two consecutive assessments separated by at least three months, or a clinically stable level of pulmonary function as determined by upright FVC% is a ≦15% decrease from baseline on two consecutive assessments separated by at least three months, thus obviating the need for recombinant hGAA since the last ERT administration.
[0102] In some embodiments, the methods disclosed herein allow for an extended cessation of ERT for a period of about 1 year, or about 15 months, or about 18 months, or about 24 months, or about 30 months, or longer than 30 months (e.g., 3, 4, 5, or more), while maintaining clinical stability with one or more symptoms of Pompe disease, e.g., as measured by 6MWT and / or %FVC, normal-range GAA levels in tissue or serum, normal-range tissue glycogen levels, or other symptoms disclosed herein, e.g., at least 73 weeks, at least 75 weeks, at least 80 weeks, at least 100 weeks, at least 150 weeks, at least 200 weeks, and all points in between.
[0103] Therefore, the methods disclosed herein provide significant benefits to subjects with Pompe disease, including, but not limited to, reducing or eliminating the rigorous and laborious weekly or every other week infusion of long-term rhGAA ERT treatment, which is time-consuming, geographically restricted, and prevents patients with Pompe disease from long-term travel from the area where they receive ERT infusion.In addition, as disclosed herein, the absence of ERT administration also reduces any side effects caused by anti-rhGAA antibodies to ERT, and also avoids the need for the administration of immunosuppressants that are usually co-administered with ERT.Therefore, the methods for treating Pompe disease disclosed herein provide greater flexibility in Pompe treatment and improve the quality of life and lifestyle of subjects with Pompe disease.
[0104] C. Administration of complementary ERT As disclosed herein, the methods for treating Pompe disease by administering an AAV vector expressing GAA allow a subject to take a break from or "break" from the usual regimen of long-term ERT administration. That is, according to the methods disclosed herein, a subject administered an AAV vector expressing GAA disclosed herein can undergo a long period of time without long-term ERT administration. Also, in some embodiments, a subject administered an AAV vector expressing GAA disclosed herein can be administered supplemental ERT after an initial period of cessation of long-term ERT administration, where the supplemental ERT is administered about 6 months or about 1 year, or more than 1 year after the cessation of long-term ERT. As disclosed herein, the methods allow flexibility in the usual long-term ERT administration regimen, allowing for both long periods of time off or absence of long-term ERT administration that do not result in clinical decline, i.e., the subject remains clinically stable for long periods of time despite not having ongoing long-term ERT administration.
[0105] In some embodiments, the methods disclosed herein involve re-administration of ERT after a prolonged cessation of ERT administration (referred to herein as "complementary ERT"), allowing for flexibility in the normal ERT regimen, since the continuous production of GAA expressed by AAV allows for flexibility in ERT. In some embodiments, the complementary ERT is pulsed administration of ERT as disclosed herein. In some embodiments, the complementary ERT is administered at less frequent intervals, or at lower doses, or at irregular doses, or at irregular intervals, compared to the previous administration of long-term ERT.
[0106] In some embodiments, the methods disclosed herein involve resumption of ERT (referred to herein as "complementary ERT") after an extended period of at least 6 months to about 1 year of absence from long-term ERT administration. In some embodiments, the complementary ERT can be short-term, followed by a second, extended period of ERT cessation. In some embodiments, the complementary ERT can be for a period of anywhere between 3 months and about 2 years, e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11 months, or about 1 year.
[0107] In some embodiments, the method involves administering a rAAV expressing GAA to a subject with Pompe, wherein the administration of long-term ERT continues after the administration of the recombinant AAV. However, the ERT is administered at a lower dose and / or frequency than before the administration of the recombinant AAV vector. For example, after administration of the AAV vector, long-term ERT can be administered every 3 weeks, once a month, every other month, once every 3 months, every 4 months, every 5 months, or every 6 months for at least 24 weeks after administration of the AAV-GAA. In one embodiment, the dosage of long-term ERT can be reduced. In one method, a pulsed administration regimen of long-term ERT can be used after administration of the AAV vector, thereby allowing for the use of an irregular dosing schedule and / or amount. As discussed herein, in some embodiments, the administration of long-term ERT can be discontinued at 24 weeks or earlier, as disclosed herein.
[0108] In some embodiments, due to the continuous expression of GAA by the administered AAV vector, the methods disclosed herein allow for the flexibility of administering both long-term ERT or complementary ERT, so that if a subject is not scheduled to, or inadvertently or accidentally misses one or more ERT doses of a long-term ERT or complementary ERT regimen, the subject will maintain clinical stability. Currently, when ERT is missed, much larger amounts of ERT are required to return to the same clinical level.
[0109] In some embodiments, the complementary ERT is administered at less frequent intervals, or at lower doses, or at irregular doses, or at irregular intervals, compared with the previous administration of long-term ERT.For example, in some embodiments, the dose of rhGAA administered in the complementary ERT is less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 2%, or less than 1% of the usual dose of rhGAA administered in the long-term ERT regimen.
[0110] In some embodiments, supplemental ERT is administered as a pulse dose.In alternative embodiments, the subject who receives the rAAV vector composition disclosed herein can take a break or interrupt the regular dosing regimen of long-term ERT administration or supplemental ERT, and in this case, long-term ERT or supplemental ERT is administered by pulse dose.For example, in some embodiments, the administration of long-term ERT or supplemental ERT can be administered by pulse dose.In certain embodiments, the subject who receives the composition can have pulse dose of long-term ERT or supplemental ERT.
[0111] In certain embodiments, pulsed administration of complementary ERT is effective to help a subject maintain clinical stability and / or achieve serum GAA levels of 189 nmol / hour or less. *It is preferred that the subject be administered an AAV vector composition disclosed herein at a dose sufficient to maintain continuous expression of GAA at or above that level (e.g., during the entire duration of an ERT break or "ERT holiday" during which regularly scheduled ERT is not administered). In certain embodiments, the methods disclosed herein allow a subject to receive pulsed administration of complementary ERT throughout the subject's lifetime.
[0112] In some embodiments, the regimen of administration of the complementary ERT can have intermittent breaks, where administration of the ERT is stopped (e.g., the duration of the breaks or "ERT holidays" during which the regimen of administration of the ERT is stopped).
[0113] In some embodiments, the method comprises administering a complementary ERT in a pulsed manner, wherein the pulsed administration of the complementary ERT occurs at least once a month, at least every other month, or at least every six months, or at least every year, or every other year. The methods disclosed herein are for continuous expression of GAA in a subject, and for 189 nmol / hour * Since this involves administering an AAV vector at a dose sufficient to maintain serum GAA levels at or above 100 mg / kg / day, when complementary ERT is administered, pulsed administration can substantially reduce the amount of ERT administered to a patient per dose or per total treatment regimen, with increased efficacy, allowing for increased flexibility in ERT administration regimens. This represents a significant savings in time, effort, and cost, and more importantly, an improvement in the quality of life of Pompe patients, as well as a lower ERT dose that may reduce any side effects, including anti-GAA antibodies to the administered rhGAA protein.
[0114] In some embodiments, the administration of the complementary ERT is pulsed. In certain embodiments, the pulsed administration comprises administering the complementary ERT for about 8 weeks, followed by about 4 weeks without administering the complementary ERT. In some embodiments, the pulsed administration comprises administering the complementary ERT for about 6 weeks (i.e., 6 injections per week, or 3 injections every 2 weeks), followed by about 2 weeks without administering the complementary ERT. In certain embodiments, the pulsed administration comprises administering the complementary ERT for about 4 weeks, followed by about 2 weeks without administering the complementary ERT. In some embodiments, the pulsed administration comprises administering the complementary ERT for about 2 weeks, followed by about 2 weeks without administering the complementary ERT.
[0115] In some embodiments, the pulsed administration of complementary ERT is at intervals less frequent than conventional regimens for long-term ERT administration, e.g., the interval for pulsed complementary ERT can be about every 3 weeks, or about every 1 month, or about every 6 weeks, or about every 2 months, or about every 3 months, or about every 4 months of ERT administration or infusion. In some embodiments, the intervals between pulsed administrations of complementary ERT can be irregularly spaced, and by way of example only, ERT administrations can be 3 weeks apart, then 4 weeks apart, then 6 weeks apart, then 3 weeks apart, etc., with spacing determined based on the clinical stability of the subject as disclosed herein or simply convenience of the timing and / or schedule of complementary ERT administration.
[0116] In some embodiments, the interval between pulses can be determined by the clinical stability parameters disclosed herein. In an alternative embodiment, the interval between pulses of administration of complementary ERT can be calculated by administering another dose of ERT when the administered rhGAA is no longer detectable in the patient before delivery of the next pulse, or when serum GAA levels fall below a certain threshold, e.g., below the pharmacologically active range from 189 nmol / hr×ml. The interval can also be calculated from the in vivo half-life of the administered rhGAA polypeptide in the MYOZYME® or LUMIZYME® formulation. The interval may be calculated as being longer than the in vivo half-life, or 2, 3, 4, 5, or even 10 times longer than the half-life of the composition. For compositions with a fairly fast half-life, the interval may be 25, 50, 100, 150, 200, 250, 300, or even 500 times the half-life of the rhGAA polypeptide. The number of pulses in long-term complementary ERT administration can be as low as 2, but is typically about 5-10, 10-20, 15-30, or more. In some embodiments, patients can receive the pulsed complementary ERT disclosed herein for life via the methods of the present invention without the problems and inconveniences associated with current long-term ERT regimens.
[0117] D. Absence of long-term immunosuppression Subjects receiving rhGAA ERT typically receive immunosuppressants along with ERT therapy to avoid the reduced efficacy of ERT due to high and persistent anti-GAA antibody titers (HSAT) against rhGAA. Importantly, it has previously been reported that the declining efficacy of ERT for the treatment of Pompe disease in subjects is partly explained by an immune response to ERT, resulting in the formation of high and persistent anti-GAA antibody titers (HSAT). Subjects with HSAT showed significantly increased mortality compared with patients who did not develop antibodies or developed only low-titer antibodies (Banugaria et al. 2011). Furthermore, the ability to prevent antibody formation in subjects at risk for HSAT through immunosuppression significantly extended survival, confirming the clinical relevance of HSAT (Mendelsohn et al. 2009; Banugaria et al. 2013; Kazi et al. 2017).
[0118] Subjects with Pompe disease are considered cross-reactive immunological material (CRIM) positive if they have residual GAA enzyme activity and CRIM negative if no residual GAA activity is detected. Based on pooled clinical study data, 28% of Pompe disease cases have the infantile-onset form, of which approximately 85% have the classic infantile-onset form, three-quarters of which are CRIM-positive (Kemper, Comeau, and Green 2013). Determining CRIM status in newly diagnosed IOPD patients is important because it allows for the initiation of preventive immune-modulating measures before initiating ERT, thus offsetting the worst deleterious effects of HSAT.
[0119] CRIM-negative Pompe disease subjects developed HSAT and showed significantly reduced efficacy from ERT with rhGAA (Amalfitano et al. 2001). The relevance of antibody formation to treatment efficacy in Pompe disease is highlighted by the poor response of CRIM-negative subjects to ERT, which correlated with the onset of HSAT (Kishnani et al. 2010). Although LOPD subjects are not CRIM-negative, some mount high antibody responses to rhGAA, which may prevent optimal efficacy of ERT (Patel et al. 2012; de Vries et al. 2017; "LUMIZYME Prescribing Information" 2014). Additionally, all Pompe disease subjects mount some level of anti-GAA antibody response, but the effect on ERT efficacy is unknown.
[0120] Herein, the inventors demonstrate that in Pompe disease subjects administered AAV-GAA, there is minimal anti-GAA antibody produced against the GAA expressed by AAV.Therefore, in some embodiments, the methods disclosed herein include administering AAV-GAA to subjects without ongoing immunosuppression.That is, in some embodiments, immunosuppression is not administered to subjects long-term.
[0121] In some embodiments, an immunosuppressant or immunomodulator (interchangeably referred to herein) is administered to a subject as an immunoprophylactic to prevent or reduce any immune response to the administered AAV vector, thus allowing for subsequent or booster administration of an AAV vector expressing GAA according to the methods disclosed herein, if necessary.
[0122] In some embodiments, the immune modulator is administered for an initial period at or approximately the time when the AAV vector expressing GAA is administered to the subject. For example, the immune modulator is administered starting about 24 hours before the AAV vector expressing GAA is administered to the subject. The initial administration period of the immune modulator (e.g., methotrexate / prednisone) can alternatively be 2, 3, 4, 5, 6, or 7 days before rAAV administration. In some embodiments, the immune modulator is administered starting about 24 hours before AAV administration and is administered at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week, or more than 1 week after administration of the AAV vector expressing GAA. In some embodiments, the immune modulator is administered starting at or about 24 hours before AAV administration and is administered for up to 1 day, or 2 days, or 3 days, or 4 days, or 5 days, or 6 days, or 1 week, or 2 weeks, or 3 weeks, or 1 month after administration of the AAV vector expressing GAA.
[0123] In some embodiments, the immune modulator is administered to the subject in decreasing lower doses, such as a first dose for a first period, a second lower dose for a second period, and a third dose lower than the second dose for a third period, until no immune response to the AAV or GAA occurs. For example, in some embodiments, a first dose of immune modulator is administered starting at or about 24 hours before AAV administration and for at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week, or about 2 weeks, or about 3 weeks, or about 4 weeks, after which the immune modulator is reduced to a second dose (lower than the first dose) for a second period of time (e.g., for at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week, or about 2 weeks, or about 3 weeks, or about 4 weeks), after which the immune modulator is reduced to a third dose (lower than the second dose) for a third period of time (e.g., for at least 1 day, or at least 2 days, or at least 3 days, or at least 4 days, or at least 5 days, or at least 6 days, or about 1 week).
[0124] For illustrative purposes only, in some embodiments, methods for treating Pompe disease disclosed herein include administering prednisone as an immunosuppressant, i.e., immunoprophylactic, at a first dose of 60 milligrams (given orally) starting 24 hours prior to AAV vector administration. In some embodiments, prednisone is continued at 60 mg / day po until the completion of week 4 after vector administration, after which, at the beginning of week 5, the prednisone dose is tapered to a second dose level of 55 mg / day po and maintained for 7 days. In some embodiments, at the beginning of week 6, the dose is tapered to a third dose level of 50 mg / day po and maintained for 7 days, etc., such that the immunosuppressant (i.e., prednisone) dose is tapered by 5 mg / day each week after the 4-week initial immunosuppressant dose. In some embodiments, the first dose, e.g., prednisone, is less than 60 milligrams (e.g., 55 milligrams, 50, 45, 40, 35, 30, 25, 20, 15, or 10 milligrams). In some embodiments, another corticosteroid, e.g., methylprednisolone, is used in place of prednisone, optionally in lower amounts. In some embodiments, the dosage and regimen are sufficient to maintain T cell reactivity to the vector capsid at a substantially low level.
[0125] In some embodiments, prednisone is combined with another immunosuppressant (e.g., methotrexate). In some embodiments, immunosuppression is achieved by administering prednisone, methotrexate, sirolimus, tacrolimus, rapamycin, or any combination thereof. Without being bound by theory, it is believed that combined treatment with prednisone and methotrexate suppresses CD4 and CD8 cell proliferation. The first administration period of the second agent (e.g., methotrexate) does not need to be the same time or follow the same course as the first agent (e.g., prednisone), and can be the same day as AAV administration (e.g., 1 hour before), or alternatively, 1, 2, 3, 4, 5, 6, or 7 days before AAV administration.
[0126] In some embodiments, prednisone is combined with methotrexate as an immunosuppressant. For example, prednisone is administered as described immediately above (e.g., 60 mg of prednisone, 24 hours before AAV administration, once daily for 4 weeks, then tapered by 5 mg each week), and methotrexate is administered (e.g., on study day 1, 1 hour before vector administration). In some embodiments, methotrexate is initially administered for a period of time, for example, at a total weekly dose of 30 mg, which is then tapered. Typically, methotrexate is administered on one day per weekly dose. Folic acid can be administered on non-methotrexate treatment days (e.g., 1 mg / day), and once methotrexate is terminated, it is maintained at that dose throughout the entire tapering period. To maximize absorption and bioavailability, a single methotrexate dose should not exceed 15 mg. Doses higher than 15 mg are given in a split schedule (e.g., 30 mg given at 15 mg twice per day). In some embodiments, the initial methotrexate dose is continued for 12 weeks. After the initial dosing period, tapering is achieved by reducing the weekly methotrexate dose by a specific amount each week (e.g., by 5 mg each week). For example, in week 13, to achieve a total weekly dose of 25 mg methotrexate, the second daily dose of methotrexate is reduced by 5 mg, with 15 mg given in the morning, followed by 10 mg given in the evening. In week 14, to achieve a total weekly dose of 20 mg methotrexate, the first daily dose of methotrexate is reduced by 5 mg, with 10 mg given in the morning, followed by 10 mg given in the evening. In weeks 15, 16, and 17, methotrexate can be administered as a single dose. At week 15, one 15 mg dose of methotrexate is administered to achieve a total weekly dose of 15 mg. At week 16, one 10 mg dose of methotrexate is administered to achieve a total weekly dose of 10 mg. At week 17, one 5 mg dose of methotrexate is administered to achieve a total weekly dose of 5 mg. At week 18, methotrexate is no longer administered.
[0127] The dose and / or administration regimen of prednisone and methotrexate may be modified, if necessary, based on AST / ALT elevation. In some embodiments, the dosage and regimen are sufficient to maintain T cell reactivity to the vector capsid at a substantially low level. In some embodiments, prednisone is administered as described immediately above (60 mg prednisone once daily for 4 weeks, starting 24 hours before AAV administration, then tapered by 5 mg each week), and methotrexate is initially administered at a weekly dose lower than 30 mg / week (e.g., 25 mg / week, 20, 15, 10, 7.5, or 5 mg / week) for a period (e.g., on study day 1, 1 hour before vector administration), which can then be tapered if appropriate (e.g., after 12 weeks). In some embodiments, to taper methotrexate, the dose is reduced by 2.5 mg / week after an initial period (e.g., 12 weeks) at the starting dosage. Folic acid can be administered (e.g., 1 mg / day) on non-methotrexate treatment days, and once methotrexate is discontinued, the dose is maintained throughout the entire taper period. In a preferred embodiment, the starting methotrexate dose is 5 mg / week to 7.5 mg / week (e.g., 5, 5.5, 6, 6.5, 7, or 7.5 mg / week) for 12 weeks, which is then tapered (e.g., by 2.5 mg / week). In some embodiments, methotrexate and folic acid are not tapered to zero; instead, low-level doses are given for an extended period or indefinitely.
[0128] The use of prednisone is exemplified herein as an immunosuppressant for immunoprophylaxis according to the methods disclosed herein, however, it is contemplated that prednisone can be readily substituted with different immune modulators and administration regimens known to those skilled in the art.
[0129] In some embodiments, conventional immunoprophylaxis to prevent immune reactivity to the expressed GAA is stopped or discontinued on the first day, or just before or after, administration of an rAAV expressing GAA according to the methods disclosed herein.
[0130] (i) Immunomodulation and immunosuppression: As disclosed herein, in some embodiments, the methods disclosed herein involve administration of AAV-GAA to a subject without ongoing immunosuppression. That is, in some embodiments, immunosuppression is not administered chronically to a subject, but rather is administered only for a short, predefined period of time after administration of an AAV vector expressing GAA to a subject, including an initial period (at a starting dose) and a tapering period (at gradually tapering doses). Thus, in some embodiments, immunosuppression is administered for 4 weeks to a maximum of about 15 weeks after administration of an AAV vector expressing GAA to a subject, and can be administered at the starting and tapering doses disclosed herein.
[0131] Thus, in some embodiments, methods and compositions using the AAV vectors and AAV genomes described herein for treating Pompe further comprise administering an immune modulator during an initial period followed by a tapering period. In some embodiments, the immune modulator can be administered at the time of, prior to, or after administration of the rAAV vector.
[0132] In any embodiment of the methods and compositions disclosed herein, a subject receiving an rAAV vector or rAAV genome disclosed herein is also administered an immunosuppressant. Various methods are known for immunosuppressing the immune response of a patient receiving AAV. Methods known in the art include administering an immunosuppressant, such as a proteasome inhibitor, to the patient. For example, one such proteasome inhibitor known in the art is bortezomib, as disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15 / 796,137, both of which are incorporated herein by reference. In another embodiment, the immunosuppressant can be an antibody, including polyclonal, monoclonal, SCFV, or other antibody-derived molecules that can suppress the immune response, for example, by eliminating or suppressing antibody-producing cells. In a further embodiment, the immunosuppressant element can be a short hairpin RNA (shRNA). In such an embodiment, the coding region for the shRNA is included in the rAAV cassette and is generally located 3' downstream of the polyA tail. shRNAs can be targeted to reduce or eliminate expression of immune stimulators, such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF, and others known).
[0133] In some embodiments, the immune modulator is an immunoglobulin-degrading enzyme, such as IdeS, IdeZ, IdeS / Z, Endo S, or a functional variant thereof. Non-limiting examples of references to such immunoglobulin-degrading enzymes and their uses are described in US 7,666,582, US 8,133,483, US20180037962, US20180023070, US20170209550, US 8,889,128, WO2010 / 057626, US 9,707,279, US 8,323,908, US20190345533, US20190262434, and WO2020 / 016318, each of which is incorporated by reference in its entirety.
[0134] In some embodiments, the immunomodulator or immunosuppressant is a proteasome inhibitor. In certain aspects, the proteasome inhibitor is bortezomib. In some aspects of the embodiment, the immunomodulator comprises bortezomib and the anti-CD20 antibody rituximab. In other aspects of the embodiment, the immunomodulator comprises bortezomib, rituximab, methotrexate, and intravenous gamma globulin. Non-limiting examples of such references include the proteasome inhibitors described in US 10,028,993, US 9,592,247, and US 8,809,282, and their combinations with rituximab, methotrexate, and intravenous gamma globulin, each of which is incorporated by reference in its entirety. One such proteasome inhibitor known in the art is bortezomib, as disclosed, for example, in U.S. Pat. No. 9,169,492 and U.S. patent application Ser. No. 15 / 796,137, both of which are incorporated herein by reference.
[0135] In another embodiment, the immunosuppressant may be an antibody, including polyclonal, monoclonal, SCFV, or other antibody-derived molecules that can suppress the immune response, for example, by eliminating or suppressing antibody-producing cells. In a further embodiment, the immunosuppressive element may be a short hairpin RNA (shRNA). In such an embodiment, the coding region of the shRNA is included in the rAAV cassette and is generally located 3' downstream of the polyA tail. The shRNA may be targeted to reduce or eliminate the expression of immune stimulatory agents, such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF, and others).
[0136] In alternative embodiments, the immunomodulator is an inhibitor of the NF-kB pathway. In certain aspects of the embodiment, the immunomodulator is rapamycin or a functional variant. By way of non-limiting example, US10,071,114, US20160067228, US20160074531, US20160074532, US20190076458, and US10,046,064 disclose rapamycin and its uses, which are incorporated in their entirety. In other aspects of the embodiment, the immunomodulator is a synthetic nanocarrier comprising an immunosuppressant drug. Non-limiting examples of references to immunosuppressants, immunosuppressants coupled to synthetic nanocarriers, synthetic nanocarriers comprising rapamycin, and / or tolerogenic synthetic nanocarriers, their dosages, administration, and uses include US20150320728, US20180193482, US20190142974, US20150328333, US20160243253, US10,039,822, US20190076522, US20160022650, US10,441,651, US No. 10,420,835, US20150320870, US2014035636, US10,434,088, US10,335,395, US20200069659, US10,357,483, US20140335186, US10,668,053, US10,357,482, US20160128986, US20160128987, US20200038462, US20200038463, each of which is incorporated by reference in its entirety.
[0137] In some embodiments, the immune modulator is a synthetic nanocarrier (ImmTOR™ nanoparticle) comprising rapamycin, as disclosed in US20200038463, US Patent 9,006,254 (Kishimoto, et al., 2016, Nat Nanotechnol, 11(10): 890-899; Maldonado, et al., 2015, PNAS, 112(2): E156-165), each of which is incorporated herein by reference in its entirety. In some embodiments, the immune modulator is an engineered cell, for example, an immune cell modified using SQZ technology as disclosed in WO2017192786, which is incorporated herein by reference in its entirety.
[0138] In some embodiments, the immune modulator is poly-ICLC, 1018 ISS, aluminum salts, Amplivax, AS15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Julvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PEPTEL, vector systems, PLGA microparticles, resiquimod, SRL172, virosomes and other virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, and Aquila's QS21 stimulon. In another further embodiment, the immune modulator or adjuvant is poly-ICLC.
[0139] In some embodiments, the immune modulator is a small molecule that inhibits the innate immune response in cells, such as chloroquine (a TLR signaling inhibitor) and 2-aminopurine (a PKR inhibitor), and can also be administered in combination with a composition comprising at least one rAAV vector disclosed herein. Some non-limiting examples of commercially available TLR signaling inhibitors include BX795, chloroquine, CLI-095, OxPAPC, polymyxin B, and rapamycin (all available from INVIVOGEN™). In addition, inhibitors of pattern recognition receptors (PRRs) (involved in innate immune signaling), such as 2-aminopurine, BX795, chloroquine, and H-89, can also be used in compositions and methods comprising at least one rAAV vector disclosed herein for in vivo protein expression.
[0140] In some embodiments, the rAAV vector can also encode a negative regulator of innate immunity, such as NLRX1. Thus, in some embodiments, the rAAV vector can optionally encode one or more of NLRX1, NS1, NS3 / 4A, or A46R, or any combination thereof. In addition, in some embodiments, a composition comprising at least one rAAV vector disclosed herein can also include a synthetic modified RNA encoding an inhibitor of the innate immune system to avoid an innate immune response generated by a tissue or subject.
[0141] In some embodiments, the immune modulator for use in the administration methods disclosed herein is an immunosuppressant. As used herein, the term "immunosuppressant drug or immunosuppressant" is intended to include pharmaceutical agents that inhibit or interfere with normal immune function. Examples of immunosuppressants suitable for the methods disclosed herein include agents that inhibit the T cell / B cell costimulatory pathway, such as agents that prevent the coupling of T cells and B cells via the CTLA4 and B7 pathways disclosed in U.S. Patent Publication No. 2002 / 0182211. In one embodiment, the immunosuppressant is cyclosporin A. Other examples include mycophenolate mofetil, rapamicin, and antithymocyte globulin. In one embodiment, the immunosuppressant drug is administered in a composition comprising at least one rAAV vector disclosed herein, or in a separate composition, but can be administered simultaneously with, before, or after administration of a composition comprising at least one rAAV vector via the methods of administration disclosed herein. The immunosuppressant drug is administered to the subject in a formulation compatible with the route of administration and in a dosage sufficient to achieve the desired therapeutic effect, hi some embodiments, the immunosuppressant drug is administered transiently for a time sufficient to induce tolerance to the rAAV vectors disclosed herein.
[0142] Various methods are known for immunosuppressing the immune response of patients receiving AAV. Methods known in the art include administering immunosuppressants, such as proteasome inhibitors, to patients. For example, one such proteasome inhibitor known in the art is bortezomib, as disclosed in U.S. Patent No. 9,169,492 and U.S. Patent Application No. 15 / 796,137, both of which are incorporated herein by reference. In some embodiments, the immunosuppressant can be an antibody, including polyclonal, monoclonal, SCFV, or other antibody-derived molecules that can suppress the immune response, for example, by eliminating or suppressing antibody-producing cells. In further embodiments, the immunosuppressive element can be a short hairpin RNA (shRNA). In such embodiments, the coding region of the shRNA is included in the rAAV cassette and is generally located 3' downstream of the polyA tail. The shRNA can be targeted to reduce or eliminate the expression of immunostimulatory agents, such as cytokines, growth factors (including transforming growth factors β1 and β2, TNF, and others).
[0143] The use of such immune modulating agents facilitates the ability to use multiple dosing (e.g., multiple administrations) over the course of months and / or years, which allows for the use of multiple agents, e.g., rAAV vectors encoding multiple genes, or multiple administrations to a subject, as discussed below.
[0144] E. Pharmaceutical Compositions For example, a rAAV vector disclosed herein (e.g., an rAAV vector expressing GAA) for use in the methods of administration disclosed herein can be formulated into a pharmaceutical composition with a pharmaceutically acceptable excipient, i.e., one or more pharmaceutically acceptable carrier substances and / or additives, such as buffers, carriers, excipients, stabilizers, etc. The pharmaceutical composition may also be provided in the form of a kit. Pharmaceutical compositions comprising a rAAV vector disclosed herein for use in the methods of administration disclosed herein, and uses thereof, are known in the art.
[0145] Accordingly, a further aspect of the present invention provides pharmaceutical compositions comprising the rAAV vectors disclosed herein for use in the methods of administration disclosed herein. The relative amounts of the active ingredient (e.g., the rAAV vectors disclosed herein), pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure may vary depending on the identity, size, and / or condition of the subject being treated, as well as the route by which the composition is administered. For example, the composition may contain between 0.1 percent and 99 percent (w / w) active ingredient. By way of example, the composition may contain between 0.1 percent and 100 percent, e.g., between 0.5 and 50 percent, between 1 and 30 percent, between 5 and 80 percent, or at least 80 percent (w / w) active ingredient.
[0146] Pharmaceutical compositions can be formulated using one or more excipients or diluents to (1) increase stability; (2) increase cell transfection or transduction; (3) enable sustained or delayed release of the payload; (4) alter biodistribution (e.g., target viral particles to specific tissues or cell types); (5) increase translation of the encoded protein; (6) alter the release profile of the encoded protein; and / or (7) enable tunable expression of the payload of the invention. In some embodiments, a pharmaceutically acceptable excipient can be at least 95 percent, at least 96 percent, at least 97 percent, at least 98 percent, at least 99 percent, or 100 percent pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient may be approved by the U.S. Food and Drug Administration. In some embodiments, the excipient may be of pharmaceutical grade. In some embodiments, the excipient may meet the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia. As used herein, excipients include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, etc., as appropriate for a particular desired dosage form. Various excipients for formulating pharmaceutical compositions and techniques for preparing compositions are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, AR Gennaro, Lippincott, Williams and Wilkins, Baltimore, MD, 2006; the entire contents of which are incorporated herein by reference).Except insofar as any conventional excipient medium is incompatible with the substance or its derivatives, for example, by producing any undesired biological effect or otherwise interacting in a deleterious manner with any other component of the pharmaceutical composition, the use of conventional excipient media may be contemplated within the scope of the present disclosure.
[0147] The rAAV vectors disclosed herein for use in the methods of administration disclosed herein may be used in combination with one or more other therapeutic, prophylactic, research, or diagnostic agents. "In combination with" is not intended to imply that the agents must be administered at the same time and / or formulated for delivery together, although these delivery methods are within the scope of the present invention. The compositions can be administered simultaneously with, before, or after one or more other desired therapeutic agents or medical procedures. In some embodiments, delivery of one treatment (e.g., a gene therapy vector) is still occurring when delivery of a second treatment (e.g., one or more therapeutic agents) begins, resulting in an overlap in administration. This may be referred to herein as "simultaneous" or "concurrent delivery." In other embodiments, delivery of one treatment ends before delivery of the other treatment begins. In some embodiments in either case, the treatment is more effective due to the combined administration. For example, the second treatment may be more effective, e.g., a comparable effect may be seen with less of the second treatment, or the second treatment may reduce symptoms to a greater extent than would be seen if the second treatment were administered in the absence of the first treatment, or a similar situation may be seen with the first treatment. In some embodiments, the delivery is such that the reduction in symptoms or other parameters related to the disorder is greater than would be observed with one treatment delivered in the absence of the other. The effects of the two treatments may be partially additive, entirely additive, or greater than additive. The delivery may be such that the effect of the first treatment delivered is still detectable when the second is delivered. The composition described herein and at least one additional treatment can be administered simultaneously, in the same or separate compositions, or sequentially. For sequential administration, the gene therapy vector described herein can be administered first, and one or more therapeutic agents can be administered second, or the order of administration can be reversed.The gene therapy vector and one or more therapeutic agents can be administered during a period of active disease or during a period of remission or less active disease. The gene therapy vector can be administered before, concurrently with, or after another treatment, or during remission of the disorder.
[0148] When administered in combination, the rAAV vector disclosed herein for use in the methods of administration disclosed herein and one or more therapeutic agents (e.g., second or third therapeutic agents), or all, can be administered in amounts or dosages that are higher, lower, or the same as the amounts or dosages used individually, e.g., as monotherapy. In certain embodiments, the administered amounts or dosages of the rAAV vector disclosed herein for use in the methods of administration disclosed herein and one or more therapeutic agents (e.g., second or third agents), or all, are lower (e.g., at least 20%, at least 30%, at least 40%, or at least 50%) than the amounts or dosages used individually. In other embodiments, the amount or dosage of an rAAV vector disclosed herein and one or more therapeutic agents (e.g., second or third agents), or all, for use in the methods of administration disclosed herein that results in a desired effect (e.g., treatment of cardiovascular or cardiac disease) is lower (e.g., at least 20%, at least 30%, at least 40%, or at least 50% lower) than the amount or dosage of each individually required to achieve the same therapeutic effect.
[0149] In some embodiments, the methods of administration of the rAAV vectors disclosed herein can deliver the rAAV vectors disclosed herein alone or in combination with an additional agent, e.g., an immune modulator disclosed herein.
[0150] In some embodiments, the AAV vector expressing GAA disclosed herein is not administered simultaneously with or in combination with ERT.In alternative embodiments, the AAV vector expressing GAA disclosed herein is administered in combination with ERT for a maximum period of 24 weeks or less than 24 weeks after the AAV vector expressing ERT is administered.In some embodiments, the AAV vector expressing GAA disclosed herein is administered in combination with immune modulator during the initial period and, if necessary, during the tapering period after the AAV vector expressing ERT is administered.
[0151] Thus, in one aspect, provided herein are compositions (e.g., pharmaceutical compositions) comprising the recombinant AAV vector particles described herein. Generally, the compositions contain about 1 e 9 vg / ml ~ approx. 1e 15 In some embodiments, the composition comprises a recombinant AAV vector particle described herein at a concentration of about 1e vg / ml. 10 vg / ml ~ approx. 1e 14 In some embodiments, the composition comprises a recombinant AAV vector particle described herein at a concentration of about 1e vg / ml. 12 vg / ml ~ approx. 1e 14 In some embodiments, the composition comprises a recombinant AAV vector particle described herein at a concentration of about 1e vg / ml. 12 vg / ml ~ approx. 1e 15 For example, the composition may comprise a recombinant AAV vector particle described herein at a concentration of about 3 e 12 vg / ml~about 3e 13 vg / ml, about 2.5e 12 vg / ml ~ approx. 1e 14 vg / ml, about 3e 13 vg / ml ~ approx. 1e 14 vg / ml, or 1e 13 vg / ml ~ approx. 1e 14 vg / ml of the recombinant AAV vector particles described herein.
[0152] In some embodiments, the composition has a concentration of about 1e 12vg / ml, or approximately 1.5e 12 vg / ml, or approximately 2e 12 vg / ml, or approximately 2.5e 12 vg / ml, or approximately 3e 12 vg / ml, or approximately 3.5e 12 vg / ml, or approximately 4e 12 vg / ml, or approximately 4.5e 12 vg / ml, or approximately 5e 12 vg / ml, or approximately 5.5e 12 vg / ml, or approximately 6e 12 vg / ml, or approximately 6.5e 12 vg / ml, or approximately 7e 12 vg / ml, or approximately 7.5e 12 vg / ml, or approximately 8e 12 vg / ml, or approximately 8.5e 12 vg / ml, or approximately 9e 12 vg / ml, or approximately 9.5e 13 vg / ml, or approximately 1e 13 vg / ml, or approximately 1.5e 13 vg / ml, or approximately 2e 13 vg / ml, or approximately 2.5e 13 vg / ml, or approximately 3e 13 vg / ml, or approximately 3.5e 13 vg / ml, or approximately 4e 13 vg / ml, or approximately 4.5e 13 vg / ml, or approximately 5e 13 vg / ml, or approximately 5.5e 13 vg / ml, or approximately 6e 13 vg / ml, or approximately 6.5e 13 vg / ml, or approximately 7e 13 vg / ml, or approximately 7.5e 13 vg / ml, or approximately 8e 13 vg / ml, or approximately 8.5e 13 vg / ml, or approximately 9e 13 vg / ml, or approximately 9.5e 13 vg / ml, or approximately 1e 14 vg / ml of the recombinant AAV vector particles described herein.
[0153] In some embodiments, the composition includes a buffer. Note that any physiological buffer can be used. Non-limiting examples of buffers include, but are not limited to, PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, α-ketoglutaric acid, carbonate (bicarbonate-carbonate buffer), and protein buffers. In some embodiments, the buffer is PBS. In some embodiments, the buffer includes Tris. In some embodiments, the buffer is Tris.HCl. In some embodiments, the buffer is a histidine buffer.
[0154] Typically, the buffer has a salt concentration of about 50 mM to about 750 mM. For example, the buffer has a salt concentration of about 75 mM to about 700 mM, about 100 mM to about 650 mM, about 120 mM to about 600 mM, or about 140 mM to about 550 mM. In some embodiments, the buffer has a salt concentration of about 150 mM to about 400 mM. In some embodiments, the buffer has a salt concentration of about 150 mM, about 175 mM, about 200 mM, about 225 mM, about 250 mM, about 275 mM, about 300 mM, about 325 mM, about 350 mM, about 375 mM, about 400 mM, about 425 mM, about 450 mM, or about 475 mM. In some preferred embodiments, the buffer has a salt concentration of about 150 mM, about 200 mM, or about 365 mM.
[0155] In some embodiments, the ionic strength of the composition is at least about 100 mM, e.g., about 125 mM to about 750 mM, or about 150 mM to about 500 mM, or about 175 mM to about 700 mM, or about 200 mM to about 600 mM, or about 225 mM to about 550 mM, or about 250 mM to about 500 mM, or about 275 mM to about 450 mM, or about 300 mM to about 400 mM. In some embodiments, the ionic strength of the composition is at least about 125 mM, at least about 150 mM, at least about 175 mM, at least about 200 mM, at least about 225 mM, at least about 250 mM, at least about 275 mM, at least about 300 mM, at least about 325 mM, at least about 350 mM, at least about 375 mM, at least about 400 mM, at least about 425 mM, at least about 450 mM, at least about 475 mM, or at least about 500 mM. In some embodiments, the ionic strength of the composition is less than 100 mM, e.g., about 95 mM, about 90 mM, about 85 mM, about 80 mM, about 75 mM, about 70 mM, about 65 mM, about 60 mM, about 55 mM, about 50 mM, or even less.
[0156] The osmolality of the composition is maintained near an isotonic level. For example, the osmolality of the composition is about 100 mOsm to about 600 mOsm, e.g., about 125 mOsm to about 500 mOsm, or about 130 mOsm to about 350 mOsm, or about 140 mOsm to about 400 mOsm, or about 140 mOsm to about 350 mOsm, or about 200 mOsm to about 400 mOsm, or about 500 mOsm to about 600 mOsm, or about 200 mOsm to about 600 mOsm, or about 300 mOsm to about 600 mOsm, or about 200 mOsm to about 500 mOsm. In some embodiments, the isotonicity of the composition may be about 300 mOsm to about 400 mOsm, about 150 mOsm to about 350 mOsm, about 175 mOsm to about 300 mOsm, about 300 mOsm to about 375 mOsm, about 200 mOsm to about 350 mOsm, about 225 mOsm to about 325 mOsm, or about 525 mOsm to about 590 mOsm.
[0157] Generally, the composition has a pH of about 6.5 to about 8.0. For example, the composition has a pH of about 6.5 to about 7.5. In some embodiments, the composition has a pH of about 7 to about 8. For example, the composition has a pH of about 7.3 to about 7.9. In some other non-limiting examples, the composition has a pH of about 7.4 to about 7.8, or about 7.4 to about 7.7. In some embodiments, the composition has a pH of about 7.3 to about 7.6, e.g., about 7.3 to about 7.55. In some preferred embodiments, the composition has a pH of less than about 7.5. For example, the composition has a pH of about 7.4 or less, about 7.3 or less, about 7.2 or less, about 7.1 or less, about 7.0 or less, about 6.9 or less, about 6.8 or less, about 6.7 or less, about 6.6 or less, or about 6.5 or less.
[0158] The composition can include one or more ions and / or salts thereof. Exemplary ions include, but are not limited to, sodium, potassium, chloride, magnesium, ammonium, carbonate, nitrate, chlorate, chlorite, and calcium. The ions can be provided as salts, such as halide (F, Cl, Br, I) salts of sodium, potassium, magnesium, and / or calcium, non-limiting examples of which include NaCl, KCl, MgCl, CaCl, and combinations thereof. Additional exemplary salts that can be used include, but are not limited to, salts of carboxylic acids such as acetate, propionate, pyrrole idonecarboxylate (or pidorate) or sorbate; salts of polyhydroxylated carboxylic acids such as gluconate, heptagluconate, ketogluconate, lactogluconate, ascorbate, or pantothenate; salts of mono- or polycarboxylic hydroxy acids such as citrate or lactate; salts of amino acids such as aspartate or glutamate; and salts of fulvic acid. The salts are individually included at concentrations of about 500 μM to about 500 mM.
[0159] In some embodiments, the composition includes one or more multivalent ions and / or salts thereof. Exemplary multivalent ions include, but are not limited to, calcium, citrate, sulfate, magnesium, and phosphate. The multivalent ions and / or salts thereof may be present in the composition at a concentration of about 500 μM to about 500 mM, for example, about 500 μM, about 750 μM, about 1 mM, about 1.3 mM, about 1.5 mM, about 1.7 mM, about 2.3 mM, about 2.5 mM, about 2.7 mM, about 3.3 mM, about 3.5 mM, about 3.7 mM, about 4.3 mM, about 4.5 mM, about 4.7 mM, about 5 mM, about 10 mM, about 25 mM, about 50 ... The salts may be individually included at a concentration of about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95 mM, about 100 mM, about 125 mM, about 150 mM, about 175 mM, about 200 mM, about 225 mM, about 250 mM, about 275 mM, about 300 mM, about 325 mM, about 350 mM, about 375 mM, about 400 mM, about 425 mM, about 450 mM, about 475 mM, or about 500 mM. Non-limiting examples of salts are NaCl, KCl, CaCl, CaSO, MgSO, NaPO, CaCO, NaNO, Al(SO).
[0160] In some embodiments, the composition includes NaCl. If present, NaCl may be at a concentration of about 100 mM to about 500 mM, or about 125 mM to about 450 mM, or about 100 mM to about 200 mM, or about 150 mM to about 200 mM. For example, the composition may include NaCl at a concentration of about 150 mM to about 425 mM, about 175 mM to about 400 mM, or about 175 mM to about 375 mM, or about 200 mM to about 375 mM.
[0161] In some embodiments, the composition includes KCl. When present, the KCl may be at a concentration of about 1 mM to about 10 mM. For example, the composition may include KCl at a concentration of about 1.5 mM to about 7.5 mM.
[0162] In some embodiments, the composition includes CaCl. When present, CaCl may be at a concentration of about 0.1 mM to about 2 mM. For example, the composition may include CaCl at a concentration of about 0.5 mM to about 1.5 mM. In some embodiments, the composition includes CaCl at a concentration of about 0.75 mM to about 1.25 mM.
[0163] In some embodiments, the composition includes MgCl. When present, the MgCl may be at a concentration of about 0.1 mM to about 1.5 mM. For example, the composition may include MgCl at a concentration of about 0.25 mM to about 1 mM or about 0.25 mM to about 0.75 mM.
[0164] In some embodiments, the composition includes MgSO4. When present, MgSO4 may be at a concentration of about 5 mM to about 150 mM. For example, the composition may include MgSO4 at a concentration of about 10 mM to about 120 mM, or about 10 mM to about 50 mM, or about 15 mM to about 45 mM, or about 75 mM to about 125 mM, or about 80 mM to about 100 mM, or about 85 mM to about 95 mM, or about 15 mM to about 100 mM.
[0165] In some embodiments, the composition comprises a phosphate, e.g., a monobasic or dibasic phosphate, or a salt thereof. When present, the phosphate, e.g., a monobasic or dibasic phosphate, or a salt thereof, may be present at a concentration of about 5 mM to about 30 mM. For example, the composition may comprise a phosphate, e.g., a monobasic or dibasic phosphate, or a salt thereof, at a concentration of about 7.5 mM to about 25 mM. In some embodiments, the composition may comprise a phosphate, e.g., a monobasic or dibasic phosphate, or a salt thereof, at a concentration of about 10 mM to about 20 mM.
[0166] In some embodiments, the composition comprises a monobasic phosphate or a salt thereof at a concentration of about 0.25 mM to about 3 mM. For example, the composition comprises a monobasic phosphate or a salt thereof at a concentration of about 0.5 mM to about 2.75 mM, about 0.75 mM to about 2.5 mM, or about 1 mM to about 2.25 mM. In some embodiments, the monobasic phosphate or a salt thereof is monobasic potassium phosphate.
[0167] In some embodiments, the composition comprises dibasic phosphate or its salt at a concentration of about 5 mM to about 15 mM. For example, the composition comprises dibasic phosphate or its salt at a concentration of about 7.5 mM to about 12.5 mM, or about 8 mM to about 10 mM. In some embodiments, the dibasic phosphate or its salt is dibasic sodium phosphate. In some embodiments, the composition is substantially free of dibasic phosphate, for example, dibasic sodium phosphate.
[0168] In some embodiments, the composition comprises Tris (e.g., Tris.HCl) or a salt thereof at a concentration of about 1 mM to about 50 mM. For example, the composition comprises Tris (e.g., Tris.HCl) or a salt thereof at a concentration of about 5 mM to about 40 mM, or about 7.5 mM to about 35 mM, or about 10 mM to about 30 mM, or about 15 mM to about 25 mM.
[0169] In some embodiments, the composition comprises histidine or a salt thereof at a concentration of about 1 mM to about 50 mM, e.g., about 5 mM to about 40 mM, or about 7.5 mM to about 35 mM, or about 10 mM to about 30 mM, or about 15 mM to about 25 mM.
[0170] The pharmaceutical composition may also include a bulking agent. Exemplary bulking agents include, but are not limited to, sugars, polyols, and (PVP K24). Exemplary polyols include, but are not limited to, polyhydroxy hydrocarbons, monosaccharides, disaccharides, and trisaccharides. Some exemplary polyols include, but are not limited to, sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose, and dextran. In some embodiments, the polyol is sorbitol, sucrose, or mannitol. In some embodiments, the bulking agent is sorbitol. In some embodiments, the bulking agent is sucrose. In some embodiments, the bulking agent is mannitol. In some embodiments, the bulking agent is trehalose, e.g., anhydrous trehalose. In some embodiments, the bulking agent is dextran, e.g., dextran T40 and / or dextran T10.
[0171] When present, the bulking agent may be present at a concentration of about 0.5% (w / v) to about 10% (w / v). For example, the composition may contain a bulking agent, such as a polyol or povidone (PVP K24), at a concentration of about 1% (w / v) to about 7.5% (w / v), e.g., about 1% (w / v) to about 4% (w / v) or about 4% (w / v) to about 6% (w / v).
[0172] In some embodiments, the composition comprises glycerol, sorbitol, sucrose, or mannitol at a concentration of about 1% (w / v) to about 10% (w / v). In some embodiments, the composition comprises glycerol, sorbitol, sucrose, or mannitol at a concentration of about 1% (w / v) to about 10% (w / v). In some embodiments, the composition comprises sorbitol at a concentration of about 3% (w / v) to about 6% (w / v). In some embodiments, the composition comprises sorbitol at a concentration of about 1% (w / v), about 2% (w / v), about 3% (w / v), about 4% (w / v), about 5% (w / v), about 6% (w / v), about 7% (w / v), about 8% (w / v), about 9% (w / v), or about 10% (w / v). In some embodiments, the composition comprises sucrose at a concentration of about 3% (w / v) to about 6% (w / v). In some embodiments, the composition comprises sucrose at a concentration of about 1% (w / v), about 2% (w / v), about 3% (w / v), about 4% (w / v), about 5% (w / v), about 6% (w / v), about 7% (w / v), about 8% (w / v), about 9% (w / v), or about 10% (w / v). In some embodiments, the composition comprises mannitol at a concentration of about 3% (w / v) to about 6% (w / v). In some embodiments, the composition comprises mannitol at a concentration of about 1% (w / v), about 2% (w / v), about 3% (w / v), about 4% (w / v), about 5% (w / v), about 6% (w / v), about 7% (w / v), about 8% (w / v), about 9% (w / v), or about 10% (w / v).
[0173] The composition may also contain a nonionic surfactant, which may be selected from the group consisting of polyoxyethylene fatty alcohol ethers, polyoxyethylene alkylphenyl ethers, polyoxyethylene-polyoxypropylene block copolymers, alkylglucosides, alkylphenol ethoxylates, preferably polysorbates, polyoxyethylene alkylphenyl ethers, and any combination thereof. Non-limiting examples of suitable nonionic surfactants include polyoxyethylene (12) isooctylphenyl ether (e.g., IGEPAL® CA-270 polyoxyethylene (12) isooctylphenyl ether), polyoxyethylene sorbitan monooleate (e.g., TWEEN® 80 polyoxyethylene sorbitan monooleate), polyethylene glycol octadecyl ether (e.g., Brij® S20 polyethylene glycol octadecyl ether), seed oil surfactants (e.g., Ecosurf™ SA-15 seed oil surfactant), poloxamer 188 (a copolymer of polyoxyethylene and polyoxypropylene), nonylphenol ethoxylate (e.g., Tergitol™ NP-10 nonylphenol ethoxylate), and combinations thereof.In some embodiments, the nonionic surfactant is selected from the group consisting of TWEEN® 60 nonionic detergent, PPG-PEG-PPG Pluronic® 10R5, Pluronic® F-68 (PF 68), polyoxyethylene (18) tridecyl ether, polyoxyethylene (12) tridecyl ether, MERPOL SH surfactant, MERPOL OJ surfactant, MERPOL HCS surfactant, poloxamer P188, poloxamer P407, poloxamer P 338, IGEPAL CO-720, IGEPAL CO-630, IGEPAL CA-720, Brij® S20, Brij® S10, Brij® 010, Brij® Cl0, BRIJ® 020, ECOSURF EH-9, ECOSURF EH-14, TERGITOL 15-S-7, ECOSURF SA-15, TERGITOL15-S-9, TERGITOL 15-S-12, TERGITOL L-64, TERGITOL NP-7, TERGITOL NP-8, TERGITOL NP-9, TERGITOL NP-9.5, TERGITOL NP-10, TERGITOL NP-11, TERGITOL NP-12, TERGITOL NP-13, polysorbate 20, and any combination thereof. In some embodiments, the nonionic surfactant is poloxamer P 188, poloxamer P407, Pluronic® F-68, Ecosurf SA-15, Brij® S20, Tergitol NP-10, IGEPAL CA 720, or Tween® 80. In some embodiments, the composition is substantially free of nonionic surfactants. In some embodiments, the non-ionic surfactant is not a polysorbate, such as Tween® 80 (also called polysorbate 80 or PS80).
[0174] When present, the nonionic surfactant may be present at a concentration of about 0.0001% (w / v) to about 0.01% (w / v). For example, the composition may include a nonionic surfactant at a concentration of about 0.0005% (w / v) to about 0.0015% (w / v). In some embodiments, the composition may include a nonionic surfactant at a concentration of about 0.0001% (w / v), about 0.0002% (w / v), about 0.0003% (w / v), about 0.0004% (w / v), about 0.0005% (w / v), about 0.0006% (w / v), about 0.0007% (w / v), about 0.0008% (w / v), about 0.0009% (w / v), about 0.001% (w / v), or about 0.001% (w / v). (w / v), about 0.002% (w / v), about 0.003% (w / v), about 0.004% (w / v), about 0.005% (w / v), about 0.006% (w / v), about 0.007% (w / v), about 0.008% (w / v), about 0.009% (w / v), or about 0.01% (w / v). In some preferred embodiments, the composition comprises a non-ionic surfactant at a concentration of about 0.0005% (w / v) or about 0.001% (w / v).
[0175] In some embodiments, the composition comprises, in addition to rAAV, a buffer (e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, α-ketoglutaric acid, carbonate buffer), a bulking agent (e.g., a polyol, such as sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose, and dextran), and a non-ionic surfactant (e.g., poloxamer P 188, poloxamer P407, Pluronic® F-68, Ecosurf SA-15, Brij® S20, Tergitol NP-10, IGEPAL CA 720, or Tween® 80).
[0176] In some embodiments, the composition comprises, in addition to rAAV, a buffer (e.g., PBS, Tris.HCl, phosphate, citric acid, histidine, tromethamine, succinic acid, malic acid, α-ketoglutaric acid, carbonate buffer), a bulking agent (e.g., a polyol, such as sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose, and dextran), a non-ionic surfactant (e.g., poloxamer P 188, poloxamer P407, Pluronic® F-68, Ecosurf SA-15, Brij® S20, Tergitol NP-10, IGEPAL CA 720, or Tween® 80), and a multivalent ion (e.g., a multivalent ion selected from the group consisting of calcium, citrate, sulfate, and magnesium).
[0177] In some embodiments, the composition comprises, in addition to rAAV, a buffer (e.g., PBS, Tris.HCl, phosphate, citrate, histidine, tromethamine, succinate, malate, α-ketoglutarate, carbonate buffer), a bulking agent (e.g., a polyol, such as sorbitol, mannitol, glycerol, propylene glycol, polyethylene glycol, dulcitol, sucrose, lactose, maltose, trehalose, and dextran), and a multivalent ion (e.g., a multivalent ion selected from the group consisting of calcium, citrate, sulfate, and magnesium).
[0178] It should be noted that any one of the specific buffers or groups of buffers listed in the description of compositions can be used together with any one of the specific bulking agents or groups of bulking agents listed in the description of compositions, and with any one of the specific nonionic surfactants or groups of surfactants listed in the description of compositions, and with any one of the specific polyvalent ions and groups of polyvalent ions listed in the description of compositions.Similarly, any one of the specific bulking agents or groups of bulking agents listed in the description of compositions can be used together with any one of the specific buffers or groups of buffering agents listed in the description of compositions, and with any one of the specific nonionic surfactants or groups of surfactants listed in the description of compositions, and with any one of the specific polyvalent ions and groups of polyvalent ions listed in the description of compositions. Similarly, any specific nonionic surfactant or surfactant group listed in the composition description can be used with any one of the specific buffers or buffer groups listed in the composition description, and with any one of the specific bulking agents or bulking agents listed in the composition description, and with any one of the specific multivalent ions and multivalent ion groups listed in the composition description.Also, any specific multivalent ions and multivalent ion groups listed in the composition description can be used with any one of the specific buffers or buffer groups listed in the composition description, and with any one of the specific bulking agents or bulking agents listed in the composition description, and with any one of the specific nonionic surfactants or surfactant groups listed in the composition description.In other words, all individual specific combinations of buffers, buffer groups, bulking agents, bulking agents, nonionic surfactants, nonionic surfactant groups, multivalent ions and multivalent ion groups listed in the composition description are specifically contemplated.
[0179] Exemplary Compositions In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 7.4, about 200 mM NaCl, about 5 mM KCl, about 1% (w / v) mannitol, and about 0.0005% (w / v) IGEPAL CA 720. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0180] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 20 mM phosphate pH 7.4, about 300 mM NaCl, about 3 mM KCl, about 3% (w / v) mannitol, and about 0.001% (w / v) Brij® S20. The particle concentration of the rAAV described herein is about 1.0×10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0181] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 20 mM phosphate pH 7.4, about 300 mM NaCl, about 3 mM KCl, about 3% (w / v) sorbitol, and about 0.001% (w / v) Ecosurf SA-15. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0182] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 7.4, about 350 mM NaCl, about 2.7 mM KCl, about 5% (w / v) sorbitol, and about 0.001% (w / v) poloxamer 188. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0183] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 6.95-7.2, about 137 mM NaCl, about 2.7 mM KCl, about 0.9 mM CaCl, about 0.5 mM MgCl, and about 0.001% (w / v) Pluronic® F-68. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0184] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 7.3, about 180 mM NaCl, about 2.7 mM KCl, about 5% (w / v) sorbitol, and about 0.001% (w / v) poloxamer 188. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0185] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 15 mM phosphate pH 7.4, about 375 mM NaCl, about 3.5 mM KCl, about 5% (w / v) sorbitol, and about 0.0005% (w / v) Tergitol NP-10. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0186] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 15 mM phosphate pH 7.4, about 375 mM NaCl, about 3.5 mM KCl, about 3% (w / v) glycerol, and about 0.0005% (w / v) Tween® 80. The particle concentration of the rAAV described herein is about 1.0×10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0187] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 7.6, about 137 mM NaCl, about 2.7 mM KCl, about 5% (w / v) sorbitol, and about 0.01% Pluronic® F-68. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0188] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 7.4, about 137 mM NaCl, about 2.7 mM KCl, about 5% (w / v) sorbitol, about 0.01% Pluronic® F-68, and about 20 mM MgSO4. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0189] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 7.6, about 137 mM NaCl, about 2.7 mM KCl, about 5% (w / v) mannitol, and about 0.01% Pluronic® F-68. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0190] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 7.3, about 137 mM NaCl, about 2.7 mM KCl, about 5% (w / v) mannitol, about 0.01% Pluronic® F-68, and about 20 mM MgSO4. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0191] In some embodiments, the composition, e.g., pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 7.4, about 137 mM NaCl, about 2.7 mM KCl, about 5% (w / v) sorbitol, and about 20 mM MgSO4. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0192] In some embodiments, the composition, e.g., pharmaceutical composition, comprises an rAAV comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in addition to about 10 mM phosphate pH 7.4, about 137 mM NaCl, about 2.7 mM KCl, about 5% (w / v) mannitol, and about 20 mM MgSO4. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0193] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises a recombinant AAV vector (rAAV) comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in 10 mM phosphate pH 7.4, 200 mM NaCl, 5 mM KCl, 1% (w / v) mannitol, 0.0005% (w / v) IGEPAL CA 720 in a fill volume of 5 ml. In some embodiments, the fill volume is 1 ml, 2 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9 ml, or 10 ml. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0194] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises a recombinant AAV vector (rAAV) comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in 20 mM phosphate pH 7.4, 300 mM NaCl, 3 mM KCl, 3% (w / v) mannitol, 0.001% (w / v) Brij® S20 in a fill volume of 5 ml. In some embodiments, the fill volume is 1 ml, 2 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9 ml, or 10 ml. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 The particle concentration of the rAAV described herein is approximately 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0195] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises a recombinant AAV vector (rAAV) comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in 20 mM phosphate pH 7.4, 300 mM NaCl, 3 mM KCl, 3% (w / v) sorbitol, 0.001% (w / v) Ecosurf SA-15 in a fill volume of 5 ml. In some embodiments, the fill volume is 1 ml, 2 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9 ml, or 10 ml. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 1013 ~Approx. 1.0×10 14 vg / mL.
[0196] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises a recombinant AAV vector (rAAV) comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in 10 mM phosphate pH 7.4, 350 mM NaCl, 2.7 mM KCl, 5% (w / v) sorbitol, 0.001% (w / v) poloxamer 188 in a fill volume of 5 ml. In some embodiments, the fill volume is 1 ml, 2 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9 ml, or 10 ml. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0197] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises a recombinant AAV vector (rAAV) comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in 15 mM phosphate pH 7.4, 375 mM NaCl, 3.5 mM KCl, 5% (w / v) sorbitol, 0.0005% (w / v) Tergitol NP-10 in a fill volume of 5 ml. In some embodiments, the fill volume is 1 ml, 2 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9 ml, or 10 ml. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0198] In some embodiments, a composition, e.g., a pharmaceutical composition, comprises a recombinant AAV vector (rAAV) comprising human GAA (hGAA), e.g., AAV8-LSP-hGAA, in 15 mM phosphate pH 7.4, 375 mM NaCl, 3.5 mM KCl, 3% (w / v) glycerol, 0.0005% (w / v) Tween® 80 in a fill volume of 5 ml. In some embodiments, the fill volume is 1 ml, 2 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9 ml, or 10 ml. The particle concentration of the rAAV described herein is about 1.0 x 10 13 vg / mL ~ approx. 1.0×10 14 vg / mL, or approximately 2.0 × 10 13 vg / ml ~ approx. 1.0×10 14 vg / mL, or approximately 2.5 × 10 13 ~Approx. 1.0×10 14 vg / mL.
[0199] Additional exemplary compositions / compositions comprising rAAV are described in International Publication No. WO2022159679, the contents of which are incorporated herein by reference in their entirety.
[0200] All compositions can be stored at or below -60°C.
[0201] II. Suitable Subjects for Treatment A. Pompe disease The recombinant AAV expressing the GAA protein disclosed herein can be used in methods for treating Pompe disease. Pompe disease is a rare genetic disorder caused by a deficiency of acid alpha-glucosidase (GAA), an enzyme necessary for breaking down glycogen, a storage form of sugar used for energy. Pompe disease is also known as glycogen storage disease type II, GSD II, type II glycogen storage disease, glycogen storage disease type II, acid maltase deficiency, alpha-1,4-glucosidase deficiency, diffuse glycogenic cardiac hypertrophy, and generalized glycogen storage disease cardiac type. Glycogen accumulation causes progressive muscle weakness (myopathy) throughout the body, affecting various body tissues, particularly the heart, skeletal muscles, liver, respiratory system, and nervous system.
[0202] Glycogen storage disease type II, also known as Pompe disease, is a rare metabolic disorder inherited in an autosomal recessive manner caused by a deficiency of the lysosomal enzyme acid α-glucosidase (GAA). This disorder results in the accumulation of lysosomal glycogen and the destruction of skeletal, smooth, and cardiac muscles. Pompe disease ranges in severity from a severe infantile-onset myopathy accompanied by severe hypotonia and hypertrophic cardiomyopathy (infantile-onset Pompe disease [IOPD]) to late-onset myopathy (LOPD). The deficiency in GAA can vary from complete to partial deficiency, which correlates with clinical severity. LOPD presents with proximal lower limb weakness and, in some cases, respiratory insufficiency without significant cardiac involvement, which can progress to fatal respiratory failure.
[0203] Early-onset (or infantile, IOPD) is the result of complete or near-complete deficiency of GAA. Symptoms begin within the first few months of life and progress rapidly, with feeding problems, poor weight gain, muscle weakness, floppiness, and head lag. Respiratory distress is often complicated by lung infections. The heart is grossly enlarged. Many infants with Pompe disease also have an enlarged tongue. If not treated with Lumizyme, most babies die from cardiac or respiratory complications before their first birthday.
[0204] Late-onset (or young-adult, LOPD) Pompe disease is the result of a partial deficiency of GAA. Onset can be as early as the first decade of childhood or as late as the sixth decade of adulthood and is therefore characterized as slowly progressive. The primary symptom is proximal muscle weakness that progresses to respiratory weakness and, after several years of persistence, death from respiratory failure. The heart is usually not involved.
[0205] The clinical manifestations of Pompe disease vary widely depending on the age of disease onset and residual GAA activity. Residual GAA activity correlates with both the amount and tissue distribution of glycogen stores and the severity of the disease. Infantile-onset Pompe disease (<1% of normal GAA activity) is the most severe form and is characterized by hypotonia, generalized muscle weakness, and hypertrophic cardiomyopathy, as well as massive glycogen accumulation in the heart and other muscle tissues. Death usually occurs within the first year of life due to cardiopulmonary failure. Juvenile-onset (1-10% of normal GAA activity) and adult-onset (10-40% of normal GAA activity) Pompe disease are more clinically heterogeneous, with more variability in age of onset, clinical presentation, and disease progression. Juvenile- and adult-onset Pompe disease are generally characterized by the absence of severe cardiac involvement, a later age of onset, and slower disease progression, but ultimately, respiratory or limb muscle involvement leads to significant morbidity and mortality. Life expectancy can vary, but death generally occurs due to respiratory failure.
[0206] In any embodiment of the methods disclosed herein, suitable GAA enzymes for treating Pompe disease include wild-type human GAA or fragments or sequence variants thereof that retain the ability to cleave the α1-4 linkage of linear oligosaccharides. In some embodiments of the methods and compositions disclosed herein, the GAA protein is encoded by a wild-type GAA nucleic acid sequence, such as SEQ ID NO: 11 or SEQ ID NO: 72, as disclosed in International Application WO2021102107, which is incorporated herein by reference. In some embodiments of the methods and compositions disclosed herein, the GAA protein is encoded by a codon-optimized GAA nucleic acid sequence, for example, for one or more of (1) enhanced in vivo expression, (2) reduced CpG islands, or (3) reduced innate immune response. In some embodiments of the methods and compositions disclosed herein, the GAA protein is encoded by any nucleic acid sequence selected from codon-optimized GAA nucleic acid sequences, such as SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75 and SEQ ID NO: 76 or SEQ ID NO: 182 disclosed in International Application WO2021102107, which is incorporated herein by reference, or any nucleic acid sequence having at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 or SEQ ID NO: 182 disclosed in International Application WO2021102107, which is incorporated herein by reference.
[0207] In some embodiments of the methods and compositions disclosed herein, the rAAV vectors described herein transduce the subject's liver and secrete hGAA polypeptides into the blood, which perfuse the patient's tissues, where the hGAA polypeptides are taken up by cells and transported to lysosomes, where the GAA enzyme acts to eliminate material accumulated in lysosomes due to enzyme deficiency. For lysosomal enzyme replacement therapy to be effective, the therapeutic enzyme must be delivered to the lysosomes of the appropriate cells in the tissue where the storage deficiency occurs.
[0208] In some embodiments, upon administration, the AAV vector selectively expresses and secretes GAA from transduced hepatocytes. The primary mechanism of action of the AAV vector expressing the hGAA polypeptide disclosed herein is to secrete continuous low levels of endogenous GAA from the liver into the systemic circulation to provide therapeutic exposure levels of GAA to tissues (e.g., muscle, but not exclusively to muscle), resulting in glycogen removal and restoration of cellular structure and function.
[0209] B. Increased GAA Activity in Subjects with Pompe Disease In any embodiment of the methods disclosed herein, administration of the AAV vector expressing GAA results in delivery of GAA to muscle and can be by any suitable method, including intravenous, intraarterial, and / or intraperitoneal administration. Exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via aerosol), buccal (e.g., sublingual), intravaginal, intrathecal, intraocular, transdermal, intrauterine (or intraocular), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal muscle, diaphragm muscle, and / or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g., to both skin and mucosal surfaces, including respiratory tract surfaces, and transdermal administration), intralymphatic, etc., as well as direct injection into a tissue or organ (e.g., into the liver, skeletal muscle, cardiac muscle, diaphragm muscle, or brain). The most suitable route in any given case will depend on the nature and severity of the condition being treated and / or prevented, and on the nature of the particular vector being used.
[0210] In some embodiments of one or more aspects of the present invention, the AAV vector expressing GAA is administered into the cephalic vein by an IV catheter.In some embodiments, the composition containing the AAV vector is infused in a volume of 20 mL over approximately 30 minutes.The infusion can be preceded by a 10 mL flush with lactated Ringer's solution, and can be further followed by a 40 mL flush with lactated Ringer's solution.The flush and the vector can be administered at a rate of 60 mL / hour.
[0211] In any embodiment of the methods disclosed herein, the AAV vector expressing the GAA disclosed herein is administered to skeletal muscles, including but not limited to, the limbs (e.g., upper arms, forearms, thighs, and / or lower legs), back, neck, head (e.g., tongue), chest, abdomen, pelvis / perineum, and / or fingers. Suitable skeletal muscles that can be injected are disclosed in International Application WO2021102107, the entire contents of which are incorporated herein by reference.
[0212] In any embodiment of the methods disclosed herein, the rAAV vector and / or rAAV genome is administered to the subject's skeletal muscle, liver, diaphragm, ribs, and / or cardiac muscle cells. For example, a conventional syringe and needle can be used to inject an rAAV virion suspension into an animal. Parenteral administration of the rAAV vector and / or rAAV genome by injection can be performed, for example, by bolus injection or continuous infusion. The injectable formulation may be presented in unit dosage form, for example, in an ampule or multi-dose container with an added preservative. The composition may take the form of a suspension, solution, or emulsion in an oily or aqueous vehicle, and may contain pharmaceutical formulation agents such as suspending agents, stabilizers, and / or dispersing agents. Alternatively, the rAAV vector and / or rAAV genome disclosed herein may be in powder form (e.g., lyophilized) for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use.
[0213] In certain embodiments, more than one administration (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc., or more administrations) may be used to achieve the desired level of GAA expression over various intervals, e.g., hours, days, weeks, months, years, etc. Dosing may be single dosage or cumulative (continuous dosing) and can be readily determined by one of skill in the art. As disclosed herein, it is envisioned that treatment of Pompe disease by the methods disclosed herein comprises a one-time administration of an effective dose of a pharmaceutical composition comprising an AAV vector encoding a GAA polypeptide.
[0214] However, in alternative embodiments, treatment of a subject with Pompe disease may include multiple administrations of a pharmaceutical composition comprising an AAV vector encoding a GAA polypeptide if the subject is not receiving long-term ERT, where multiple administrations can be administered over a range of time periods, such as once a year, or every six months, or about every two years, or about every three years, or about every four years, or about every five years, or once at intervals longer than five years. The timing of administration can vary from individual to individual, depending on factors such as the severity of the individual's symptoms. For example, in some embodiments, an effective dose of an AAV vector encoding a GAA polypeptide disclosed herein can be administered to an individual once a year, or once every two years, or once every six months for an indefinite period, or until the individual no longer requires treatment. Those skilled in the art will recognize that an individual's condition can be monitored throughout the course of treatment, and the effective amount of the AAV vector encoding a GAA polypeptide disclosed herein administered can be adjusted accordingly.
[0215] Injectables containing AAV vectors encoding the GAA polypeptides disclosed herein can be prepared in any conventional form, such as a liquid solution or suspension, a solid form suitable for solution or suspension in a liquid prior to injection, or an emulsion. Alternatively, AAV vectors encoding the GAA polypeptides disclosed herein can be administered in a localized rather than systemic manner, for example, in a depot or sustained-release formulation. Furthermore, viral vectors and / or viral capsids can be delivered by being attached to a surgically implantable matrix (e.g., as described in U.S. Patent Publication No. US-2004-0013645-A1). In some embodiments, AAV vectors encoding the GAA polypeptides disclosed herein can be administered to a subject's lungs by any suitable means, optionally by administering an aerosol suspension of inhalable particles composed of viral vectors and / or viral capsids, which the subject inhales. The inhalable particles can be liquid or solid. Aerosols of liquid particles comprising viral vectors and / or viral capsids can be generated by any suitable means, such as using a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as known to those skilled in the art. See, e.g., U.S. Patent No. 4,501,729. Aerosols of solid particles comprising viral vectors and / or capsids can similarly be generated using any solid particulate pharmaceutical aerosol generator, by techniques known in the pharmaceutical arts.
[0216] In some embodiments, an AAV vector encoding a GAA polypeptide disclosed herein can be formulated in a solvent, emulsion, or other diluent in an amount sufficient to dissolve the rAAV vector disclosed herein. In other aspects of this embodiment, the rAAV vector and / or rAAV genome encoding the GAA polypeptides disclosed herein may be formulated in an amount of solvent, emulsion, or diluent that is, for example, less than about 90% (v / v), less than about 80% (v / v), less than about 70% (v / v), less than about 65% (v / v), less than about 60% (v / v), less than about 55% (v / v), less than about 50% (v / v), less than about 45% (v / v), less than about 40% (v / v), less than about 35% (v / v), less than about 30% (v / v), less than about 25% (v / v), less than about 20% (v / v), less than about 15% (v / v), less than about 10% (v / v), less than about 5% (v / v), or less than about 1% (v / v).In other embodiments, the rAAV vector and / or rAAV genome encoding the GAA polypeptides disclosed herein are present in a concentration of, for example, about 1% (v / v) to 90% (v / v), about 1% (v / v) to 70% (v / v), about 1% (v / v) to 60% (v / v), about 1% (v / v) to 50% (v / v), about 1% (v / v) to 40% (v / v), about 1% (v / v), or about 1% (v / v). v / v)~30%(v / v), approx. 1%(v / v)~20%(v / v), approx. 1%(v / v)~10%(v / v), approx. 2%(v / v)~50%(v / v), approx. 2%(v / v)~ 40%(v / v), approx. 2%(v / v)~30%(v / v), approx. 2%(v / v)~20%(v / v), approx. 2%(v / v)~10%(v / v), approx. 4%(v / v)~50%(v / v), approx. 4%(v / v)~40%(v / v), approx. 4%(v / v)~30%(v / v), approx. 4%(v / v)~20%(v / v), approx. 4%(v / v)~10%(v / v), approx. 6 %(v / v)~50%(v / v), approx. 6%(v / v)~40%(v / v), approx. 6%(v / v)~30%(v / v), approx. 6%(v / v)~20%(v / v), approx. 6%(v / v) The composition may contain a solvent, emulsion, or other diluent in an amount ranging from about 8% (v / v) to 10% (v / v), about 8% (v / v) to 50% (v / v), about 8% (v / v) to 40% (v / v), about 8% (v / v) to 30% (v / v), about 8% (v / v) to 20% (v / v), about 8% (v / v) to 15% (v / v), or about 8% (v / v) to 12% (v / v).
[0217] In any embodiment of the methods disclosed herein, the AAV vector encoding the GAA polypeptide can be any of a variety of vectors, including, but not limited to, AAV3b capsid (SEQ ID NO: 44); AAV3b265D capsid (SEQ ID NO: 46), AAV3b The AAV may be of any serotype, including one encapsulated in any AAV3b capsid selected from an ST(S663V+T492V) capsid (SEQ ID NO: 48), an AAV3b265D549A capsid (SEQ ID NO: 50); an AAV3b549A capsid (SEQ ID NO: 52); an AAV3bQ263Y capsid (SEQ ID NO: 54) or an AAV3bSASTG capsid (i.e., an AAV3b capsid containing the Q263A / T265 mutation), wherein SEQ ID NOs: 44, 46, 48, 50, 52 and 54 are disclosed in International Application WO2021102107, which is incorporated herein by reference.
[0218] To facilitate the delivery of the AAV vector encoding the GAA polypeptide disclosed herein, it can be mixed with carrier or excipient.Carriers and excipients that can be used include saline (particularly sterile pyrogen-free saline), saline buffer (for example, citrate buffer, phosphate buffer, acetate buffer and bicarbonate buffer), amino acids, urea, alcohol, ascorbic acid, phospholipids, proteins (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol and glycerol.USP-grade carriers and excipients are particularly useful for the delivery of virions to human subjects.
[0219] In addition to the formulations described above, the AAV vector encoding the GAA polypeptide disclosed herein can also be formulated as a depot preparation.Such long-acting formulations can be administered by implantation (for example, subcutaneously or intramuscularly) or by IM injection.Therefore, for example, the rAAV vector and / or rAAV genome disclosed herein can be formulated with suitable polymeric or hydrophobic materials (for example, as an emulsion in acceptable oil) or ion exchange resin, or as a poorly soluble derivative.
[0220] In any embodiment of the methods disclosed herein, the method is directed to treating Pompe disease resulting from a deficiency of GAA in a subject, wherein an AAV vector encoding a GAA polypeptide disclosed herein is administered to a patient suffering from Pompe disease, and following administration, GAA is secreted from cells in the liver, and there is uptake of the secreted GAA by cells in skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue, or a combination thereof, and the uptake of the secreted GAA results in a reduction of lysosomal glycogen storage in tissues, including, but not limited to, muscle. In some embodiments, the AAV vector encoding the GAA polypeptide disclosed herein is encapsulated in a capsid, for example, any AAV3b capsid selected from an AAV3b capsid (SEQ ID NO: 44); an AAV3b265D capsid (SEQ ID NO: 46), an AAV3b ST(S663V+T492V) capsid (SEQ ID NO: 48), an AAV3b265D549A capsid (SEQ ID NO: 50); an AAV3b549A capsid (SEQ ID NO: 52); or an AAV3bQ263Y capsid (SEQ ID NO: 54), the sequences of which are disclosed in International Application WO2021102107, the sequences of which are incorporated herein by reference.
[0221] In certain embodiments, at least about 1.6 x 10 per dose 12 ~Approx. 4.0×10 12 vg / kg is administered in a pharmaceutically acceptable carrier. In further embodiments, the dosage of viral vector and / or capsid administered to a subject depends on the mode of administration, the severity and type of Pompe disease (i.e., LOPD or IOPD) to be treated and / or prevented, the condition, age, and sex of the individual subject, as well as the particular viral vector or capsid, nucleic acid encoding the GAA polypeptide to be delivered, etc., and can be determined in a routine manner. Exemplary doses to achieve a therapeutic effect are at least about 1.5 x 10 11 vg / kg, or at least about 1.5 × 10 12 vg / kg, or at least about 4.0 × 10 12The potency is 1.6 x 10 vg / kg. It is contemplated that the dose to achieve the therapeutic effect disclosed herein can also be determined by the strength of the liver-specific promoter (LSP) operably linked to the nucleic acid encoding the GAA polypeptide, as well as the specific signal sequence and the ability of the cell to cleave the signal sequence when secreted from the cell. In contrast, the dose of AAV encoding the GAA polypeptide disclosed herein is about 1.6 x 10 when the liver-specific promoter is stronger than the LPS used in the AAV8-LSPhGAA vector exemplified in the Examples herein. 12 Although the dose of AAV can be lower than 100 mg / mL, the dose of AAV must be titrated and determined based on the level of GAA expressed in the cells, as determined by the transduction efficiency of the AAV capsid and LSP, and the ability of the cells to secrete the expressed GAA polypeptide, to avoid accumulation of GAA in the transfected cells and any associated cytotoxicity.
[0222] In another aspect, disclosed herein is a method for treating Pompe disease by administering a nucleic acid encoding GAA to a cell, comprising contacting the cell with the rAAV vector and / or rAAV genome disclosed herein under conditions in which the nucleic acid is introduced into the cell and expressed to produce GAA.In some embodiments, the cell is an in vivo cell.In some embodiments, the cell is an in vivo mammalian cell.
[0223] C. Increased motor neuron function in mammals In any embodiment of the methods disclosed herein, AAV vectors encoding the GAA polypeptides disclosed herein are useful in methods for increasing phrenic nerve activity in mammals with Pompe disease and / or insufficient GAA levels. For example, an AAV vector encoding a GAA polypeptide disclosed herein, e.g., a rAAV vector and / or rAAV genome encapsulated in a capsid, e.g., any AAV3b capsid selected from an AAV8 or AAV3b capsid (SEQ ID NO: 44); an AAV3b265D capsid (SEQ ID NO: 46), an AAV3b ST(S663V+T492V) capsid (SEQ ID NO: 48), an AAV3b265D549A capsid (SEQ ID NO: 50); an AAV3b549A capsid (SEQ ID NO: 52); or an AAV3bQ263Y capsid (SEQ ID NO: 54), the sequences of which are disclosed in International Application WO2021102107, the sequences of which are incorporated herein by reference, can be administered to the central nervous system (e.g., neurons). In another embodiment, retrograde transport of an AAV vector encoding a GAA polypeptide disclosed herein from the diaphragm (or other muscle) to the phrenic nerve or other motor neuron can result in biochemical and physiological correction of Pompe disease. These same principles can be applied to other neurodegenerative diseases.
[0224] In certain embodiments, the rAAV capsid of the rAAV virion used to treat Pompe disease is any of those listed in Table 1 disclosed in International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety, and is used to treat Pompe disease, and is characterized by a reduction in any one or more of the following symptoms in patients with Pompe disease, e.g., by at least 10%, at least 15%, compared to patients not receiving the same treatment: (i) a feeling of weakness in the patient's lower extremities, including the legs, trunk, and / or arms; (ii) shortness of breath, difficulty moving, lung infections, severe curvature of the spine, difficulty breathing during sleep, enlarged liver, enlarged tongue, and / or stiff joints; (iii) a reduction in the risk of developing Pompe disease by at least 10%, at least 15%, compared to patients not receiving the same treatment. , at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% reduction in AAV8 or AAV3, or AAV3b (including but not limited to AAV3b serotypes AAV3b265D, AAV3b265D549A, AAV3b549A, AAV3bQ263Y, AAV3bSASTG (i.e., AAV3b capsid containing the Q263A / T265 mutation) serotypes).In other aspects of this embodiment, AAV GAA of any serotype may reduce any one or more of the following: (i) a feeling of weakness in the patient's lower extremities, including the legs, trunk, and / or arms; (ii) shortness of breath, difficulty moving, lung infections, severe curvature of the spine, difficulty breathing during sleep, enlarged liver, enlarged tongue, and / or stiff joints; (iii) a decrease in any one or more of the following systems in patients with Pompe disease, compared to the same untreated patient, for example, by about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, or The concentration can be reduced by 0%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%.
[0225] In any embodiment of the methods and compositions disclosed herein, at least one symptom associated with Pompe disease or at least one adverse side effect associated with Pompe disease is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, and the severity of at least one symptom associated with Pompe disease or at least one adverse side effect is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In another embodiment, the reduction in at least one symptom associated with Pompe disease or at least one adverse side effect associated with Pompe disease is about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 9 ... % to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%.
[0226] III. Recombinant AAV expressing GAA In all aspects disclosed herein, recombinant AAV (rAAV) vectors and constructs for rAAV for delivering GAA polypeptides to subjects in the methods for treating Pompe disease disclosed herein are disclosed in International Publications WO2020102645 and WO2021102107, both of which are incorporated by reference in their entireties.
[0227] As disclosed herein, one aspect of the technology relates to a method for treating Pompe disease using an rAAV vector comprising a capsid and a nucleotide sequence within the capsid referred to as the "rAAV vector genome." The rAAV vector genome (also referred to as the "rAAV genome") comprises multiple elements, including, but not limited to, two inverted terminal repeats (ITRs, e.g., 5'-ITR and 3'-ITR), with additional elements located between the ITRs including a promoter, a heterologous gene encoding a GAA polypeptide, and a polyA tail.
[0228] In some embodiments, the rAAV genome disclosed herein comprises a promoter, e.g., a liver-specific promoter sequence disclosed herein, operably linked to a heterologous nucleic acid encoding an alpha-glucosidase (GAA) polypeptide, located between the 5' and 3' ITR sequences, and a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide. In one embodiment, the heterologous nucleic acid sequence can optionally further comprise one or more of the following elements: an intron sequence, a nucleic acid encoding a secretory signal peptide, and a polyA sequence.
[0229] A. Alpha-glucosidase (GAA) polypeptide The GAA gene (NM_000152.3) is approximately 18.3 kilobases (kb) long and contains 20 exons (Dasouki et al. 2014). Its complementary DNA has a coding sequence of 2,859 nucleotides encoding an immature 952-amino acid enzyme. GAA is synthesized as a membrane-bound, catalytically inactive precursor (relative to its natural substrate, glycogen) sequestered in the endoplasmic reticulum. It undergoes glycosylation in the Golgi complex and is subsequently transported to the (minor) secretory pathway or lysosomes, where it is trimmed in a stepwise process at both the amino and carboxyl termini. Phosphorylation of mannose residues ensures efficient transport of the enzyme to lysosomes via the mannose 6-phosphate receptor. In the lysosome, GAA catalyzes the hydrolysis of the α1→4 glycosidic linkage in glycogen to glucose in a low hydrogen potential (pH) environment. Specificity for the natural substrate (glycogen) is acquired during its maturation.
[0230] Many normal allelic variants exist in GAA, accounting for three known alloenzymes (GAA1, GAA2, and GAA4). Over 450 mutations in GAA have been reported in individuals with Pompe disease. Nonsense mutations, large and small gene rearrangements, and splicing defects have been observed, with many mutations potentially specific to families, geographic regions, or ethnicities. Mutation combinations that result in either complete or near-complete absence of GAA enzyme activity (typically <1% of normal activity in skin fibroblasts) are more commonly seen in individuals with IOPD, while those combinations that allow partial enzyme activity (approximately 2-40% of normal activity in skin fibroblasts) typically present with LOPD symptoms. GAA mutations result in messenger RNA instability and / or severely truncated acid α-glucosidase or an enzyme with significantly reduced activity. Impaired or absent GAA function leads to the accumulation of glycogen in the lysosomes and cytoplasm of multiple tissues, resulting in the destruction of skeletal, smooth, and cardiac muscle. The effects of the enzyme deficiency may extend to the vesicular system linked to lysosomes and may also affect receptors, such as glucose transporter 4, that cycle through these organelles. Evidence also showed a failure of productive autophagy and a progressive accumulation of autophagosomes that disrupted the contractile apparatus of muscle fibers, which correlated with the lack of correction in skeletal muscle during ERT.
[0231] Alpha-glucosidase (GAA) polypeptide is a member of family 31 of glycoside hydrolyases. Human GAA is synthesized as a 110 kDa precursor (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The mature form of the enzyme is a mixture of 70 and 76 kDa monomers (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The precursor enzyme has seven potential glycosylation sites, four of which are retained in the mature enzyme (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The proteolytic cleavage events that produce the mature enzyme occur in late endosomes or lysosomes (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31).
[0232] The rAAV vector genome can encode a GAA polypeptide, which can include, for example, amino acid residues 40-952 of human GAA, or a smaller portion, such as amino acid residues 40-790.
[0233] The C-terminal 160 amino acids are absent from the 70- and 76-kDa mature GAA polypeptide species. However, certain Pompe alleles, such as Val949Asp, that result in a complete loss of GAA activity map to this region (Becker et al. (1998) J. Hum. Genet. 62:991). The phenotype of this mutant indicates that the C-terminal portion of the protein, although not part of the 70- or 76-kDa species, plays an important role in the function of the protein. It has also been reported that the C-terminal portion of the protein is cleaved from the rest of the protein during processing but remains associated with the major species (Moreland et al. (Nov. 1, 2004) J. Biol. Chem., Manuscript 404008200). Therefore, the C-terminal residues may play a direct role in the catalytic activity of the protein and / or may be involved in promoting proper folding of the N-terminal portion of the protein.
[0234] The native GAA gene encodes a precursor polypeptide with a signal sequence and adjacent putative transmembrane domain, a trefoil domain (PFAM PF00088) (Thim (1989) FEBS Lett. 250:85), a cysteine-rich domain of approximately 45 amino acids containing three disulfide bonds, a domain defined by the 70 / 76 kDa mature polypeptide, and a C-terminal domain. It has been reported that both the trefoil domain and the C-terminal domain are required for the production of functional GAA, and that the C-terminal domain may interact with the trefoil domain during protein folding, possibly promoting proper disulfide bond formation in the trefoil domain.
[0235] GAA polypeptides are described in U.S. Patents 5,962,313 and 6,537,785, the entire contents of which are incorporated herein by reference. Those skilled in the art will recognize specific positions in GAA to which a secretory signal peptide (SS) can be fused. Thus, in one aspect, the present invention relates to a GAA fusion protein in which SS is fused to amino acids 40, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of human GAA of SEQ ID NO: 10, or modified GAA proteins of SEQ ID NOs: 170-174, or portions thereof, as disclosed in International Application WO2021102107.
[0236] In some embodiments of the methods and compositions disclosed herein, the human GAA protein expressed by AAV comprises a human GAA protein starting with any of the amino acids of SEQ ID NO: 10, or a fragment or variant thereof, such as a human GAA protein starting with any of residues selected from 40, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 10 or SEQ ID NOs: 170-174, as disclosed in International Application WO2021102107, which is incorporated herein by reference. In some embodiments of the methods and compositions disclosed herein, the human GAA protein expressed by AAV comprises the amino acid sequence of SEQ ID NO: 10, or a protein that is at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical to SEQ ID NO: 10 or SEQ ID NOs: 170-174, as disclosed in International Application WO2021102107, which is incorporated herein by reference. In some embodiments of the methods and compositions disclosed herein, the human GAA protein expressed by AAV comprises an amino acid sequence of a human GAA protein starting at any of residues selected from 40, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 10 or SEQ ID NOs: 170-174, as disclosed in International Application WO2021102107, which is incorporated herein by reference, or a protein at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical thereto.In some embodiments, the human GAA protein expressed by the AAV comprises an amino acid starting at any of residues selected from 40, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of either SEQ ID NO: 170 (modGAA; H199R, R223H) or SEQ ID NO: 171 (modGAA; H199R, R223H, H201L), or a protein at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical thereto, wherein SEQ ID NOs: 170 and 171 are disclosed in international application WO2021102107.
[0237] In some embodiments, the human GAA protein expressed by the AAV comprises the GAA polypeptide of SEQ ID NO: 600, or a protein at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical to SEQ ID NO: 600 or a fragment of SEQ ID NO: 600, wherein the fragment begins at any of residues selected from 40, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 600 (modGAA; H199R, R223H, V780I), or a protein at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% identical to SEQ ID NO: 600, wherein SEQ ID NO: 600 has the amino acid sequence: [ka]
[0238] (i) Modified GAA (modGAA) In some embodiments, the cognate leader sequence of GAA (i.e., amino acids 1-27 of SEQ ID NO: 175 or SEQ ID NO: 170 as disclosed in International Application WO2021102107) is replaced with the non-endogenous signal sequence of SEQ ID NO: 176 (also referred to herein as the "leader sequence"), or an IL2 wild-type leader peptide (SEQ ID NO: 178), a modified IL2 leader peptide (SEQ ID NO: 180), or a leader peptide with at least 90% sequence identity to SEQ ID NO: 176, 178, or 180, wherein SEQ ID NO: 176, 178, or 180 are disclosed in International Application WO2021102107, which is incorporated herein in its entirety.
[0239] In some embodiments, the modified human GAA protein comprises a polypeptide having at least one modification selected from H199R, R223H, V780R, V780I, or H201L of SEQ ID NO: 10, as disclosed in International Application WO2021102107, the entire contents of which are incorporated herein, or a variant at least 80%, 90%, 95%, or 99% homologous to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 amino acids of SEQ ID NO: 10 having at least one of these modifications. In some embodiments, the modified human GAA protein comprises a polypeptide comprising at least two modifications selected from H199R, R223H, V780R, V780I, or H201L of SEQ ID NO: 10 as disclosed in International Application WO2021102107, or a variant at least 80%, 90%, 95%, or 99% homologous to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 amino acids of SEQ ID NO: 10 having at least two of these modifications. In some embodiments, the modified human GAA protein comprises a polypeptide having three modifications selected from H199R, R223H, V780R, V780I, and H201L of SEQ ID NO: 10 (GAA-H199R-H201L-R223H or GAA-H199R-H201L-V780R), or a variant at least 80%, 90%, 95%, or 99% homologous to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 amino acids of SEQ ID NO: 10 disclosed in International Application WO2021102107 having these three modifications.
[0240] In some embodiments, the cognate GAA leader peptide (also referred to as the "signal sequence") at amino acids 1-27 of SEQ ID NO: 10 (i.e., MGVRHPPCSHRLLAVCALVSLATAALL, SEQ ID NO: 175, as disclosed in International Application WO2021102107) is replaced with a different signal peptide (leader peptide). For example, the cognate leader peptide of GAA (SEQ ID NO: 175) is replaced with (i) an IgG1 leader peptide (referred to herein as "201 leader peptide" or "201lp") having the amino acid sequence of MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 176) encoded by the nucleic acid sequence of SEQ ID NO: 177, (ii) wtIL2 lp:MYRMQLLSCIALSLALVTNS (SEQ ID NO: 178) encoded by the nucleic acid sequence of SEQ ID NO: 179, or (iii) mutIL2 lp:MYRMQLLSCIALSLALVTNS encoded by the nucleic acid sequence of SEQ ID NO: 181. [ka] In some embodiments, the cognate GAA leader peptide (SEQ ID NO: 175) remains present and may be replaced with an additional signal peptide, such as the signal peptides AAT, FN1, IgG1 leader peptide having the amino acid sequence MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 176) encoded by the nucleic acid sequence of SEQ ID NO: 177 (referred to herein as "201 leader peptide" or "201lp") disclosed in International Application WO2021102107, (ii) wtIL2 lp:MYRMQLLSCIALSLALVTNS (SEQ ID NO: 178) encoded by the nucleic acid sequence of SEQ ID NO: 179, or (iii) mutIL2 lp: [ka] One or more of the following will be added.
[0241] In some embodiments, GAA is modified to add or remove glycosylation sites, such as N-linked glycosylation sites, O-linked glycosylation sites, or both. In certain embodiments, the addition or removal of glycosylation sites is achieved by N-terminal deletion, C-terminal deletion, internal deletion, random point mutagenesis, or site-directed mutagenesis. In some embodiments, exemplary GAA modifications include the addition of one or more asparagine (Asn) residues, or one or more mutations resulting in asparagine (Asn) residues, or the deletion of one or more asparagine (Asn) residues. In certain embodiments, all or some of the N-linked and / or O-linked glycosylation sites present in GAA are mutated. In some embodiments, GAA modifications provide information regarding the biological activity, physical structure, and / or substrate binding potential of GAA. (ii) a nucleic acid encoding GAA
[0242] In some embodiments, the rAAV genome useful in the methods for treating Pompe disease disclosed herein comprises a heterologous nucleic acid sequence encoding a secretory signal peptide fused in frame to the 3' end of the GAA nucleic acid sequence encoding the entire GAA polypeptide (e.g., the N-terminal / catalytic domain and the C-terminal domain). For example, the heterologous nucleic acid sequence encoding the secretory signal peptide is fused in frame to the 3' end of the GAA nucleic acid sequence encoding the 70 kDa and 76 kDa GAA polypeptides, and both of these polypeptides are expressed from the rAAV genome when the rAAV vector transduces a mammalian cell. In some embodiments, the expression of the GAA nucleic acid can be driven by two promoters in the rAAV genome, or by one promoter driving the expression of a bicistronic construct.
[0243] In some embodiments of the methods and compositions disclosed herein, the rAAV vector comprises a nucleic acid sequence encoding a GAA protein that is a wild-type GAA nucleic acid sequence disclosed in International Application WO2021102107, the entirety of which is incorporated herein by reference, e.g., SEQ ID NO: 11 or SEQ ID NO: 72 or SEQ ID NO: 182. In some embodiments of the methods and compositions disclosed herein, the rAAV vector comprises a nucleic acid sequence encoding a GAA protein that is a codon-optimized GAA nucleic acid sequence for any one or more of: (i) enhanced expression in vivo, (ii) reduced CpG islands, or (iii) reduced innate immune response. Exemplary codon-optimized GAA nucleic acid sequences encompassed for use in the methods and rAAV compositions disclosed herein can be selected from any of SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, or SEQ ID NO:182 disclosed in International Application WO2021102107, or a nucleic acid sequence having at least 60%, or 70%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, or SEQ ID NO:182. B. Secretory signal peptide
[0244] The native GAA signal peptide is not cleaved in the ER, thereby causing the native GAA polypeptide to be membrane-bound in the ER (Tsuji et al. (1987) Biochem. Int. 15(5):945-952). Disruption of membrane association of GAA can be achieved by replacing the endogenous (or cognate) GAA signal peptide (and, optionally, adjacent sequences) with an alternative signal peptide for GAA.
[0245] Thus, in representative embodiments, the rAAV vectors and rAAV genomes useful in the methods for treating Pompe disease disclosed herein further comprise a heterologous nucleic acid encoding a GAA polypeptide attached to a heterologous nucleic acid sequence that is transferred into a target cell and encodes a secretory signal peptide in place of the endogenous GAA signal peptide. The heterologous nucleic acid is operably associated with a segment encoding the secretory signal peptide such that, upon transcription and translation, a fusion polypeptide is produced containing a secretory signal sequence operably associated with (e.g., directing the secretion of) the GAA polypeptide.
[0246] In some embodiments, the AAV vector encodes a GAA polypeptide comprising an endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 10) (also referred to as the "native GAA" or "cognate GAA" signal peptide). In some embodiments, the AAV vector encodes a GAA polypeptide comprising an endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 10, as disclosed in International Application WO2021102107) (also referred to as the "native GAA" or "cognate GAA" signal peptide) and an additional heterologous (non-native) signal sequence. In some embodiments, the GAA polypeptide lacking the endogenous signal peptide of amino acids 1-27 of GAA is fused to a secretion signal. In some embodiments of the compositions and methods described herein, the secretion signal serves the general purpose of assisting the secretion of the GAA polypeptide from liver cells into the blood, where it can be transported and targeted to lysosomes in mammalian cells, e.g., human cardiac and skeletal muscle cells, as described herein. In some embodiments, the heterologous secretory signal is selected from any of the AAT signal peptide, fibronectin signal peptide (FN1), GAA signal peptide, or active fragments of the AAT, FN1, or GAA signal peptides that have secretory signal activity.
[0247] In some embodiments, the secretory signal peptide is heterologous (i.e., foreign or exogenous) to the polypeptide of interest. For example, the heterologous secretory signal peptide is a fibronectin secretory signal peptide, and the polypeptide of interest is not fibronectin. In some embodiments, the secretory signal peptide is selected from the AAT signal peptide, the fibronectin signal peptide (FN1), or an active fragment of the AAT, FN1, or GAA signal peptide that has secretory signal activity. In alternative embodiments, the secretory signal peptide is not heterologous to GAA, i.e., the signal peptide is the GAA signal peptide (i.e., residues 1-27 of the native GAA polypeptide).
[0248] In some embodiments, the cognate GAA signal peptide at amino acids 1-27 of SEQ ID NO: 10 (i.e., MGVRHPPCSHRLLAVCALVSLATAALL, SEQ ID NO: 175) is replaced with a different or heterologous leader peptide. For example, the cognate leader peptide of GAA (SEQ ID NO: 175) is (i) an IgG1 leader peptide (referred to herein as "201 leader peptide" or "201lp") having the amino acid sequence of MEFGLSWVFLVALLKGVQCE (SEQ ID NO: 176) encoded by the nucleic acid sequence of SEQ ID NO: 177, (ii) wtIL2 lp:MYRMQLLSCIALSLALVTNS (SEQ ID NO: 178) encoded by the nucleic acid sequence of SEQ ID NO: 179, or (iii) mutIL2 lp:MYRMQLLSCIALSLALVTNS encoded by the nucleic acid sequence of SEQ ID NO: 181. [ka] or a leader peptide having at least 90% sequence identity to any of SEQ ID NOs: 176, 178 or 180.
[0249] Generally, the secretory signal peptide is at the amino-terminus (N-terminus) of the GAA polypeptide (i.e., the nucleic acid segment encoding the secretory signal peptide is 5' to the heterologous nucleic acid encoding the GAA peptide in the rAAV vectors or rAAV genomes disclosed herein). Alternatively, the secretory signal can be at the carboxyl-terminus or embedded within the GAA polypeptide, so long as the secretory signal is operably associated therewith and directs secretion of the GAA polypeptide or GAA fusion polypeptide of interest from the cell (either with or without cleavage of the signal peptide from the GAA polypeptide).
[0250] The secretory signal is operably associated with the GAA polypeptide to target it to the secretory pathway. In other words, the secretory signal is operably associated with the GAA polypeptide so that it is secreted from the cell at a higher level (i.e., in greater amounts) than in the absence of the secretory signal peptide. Generally, when a signal peptide is attached, typically at least about 20%, 30%, 40%, 50%, 70%, 80%, 85%, 90%, 95% or more of the GAA polypeptide is secreted from the cell compared to the absence of the secretory signal peptide. In other embodiments, essentially all of the detectable polypeptide (single and / or in the form of a fusion polypeptide) is secreted from the cell.
[0251] The phrase "secreted from the cell" means that the polypeptide may be secreted into any compartment (e.g., body fluid or space) outside the cell, including, but not limited to, the interstitial space, blood, lymph, cerebrospinal fluid, renal tubules, respiratory tract (e.g., alveoli, bronchioles, bronchi, nasal cavity, etc.), gastrointestinal tract (e.g., esophagus, stomach, small intestine, colon, etc.), vitreous humor of the eye, and endolymphatic fluid of the cochlea.
[0252] Thus, in some embodiments, an AAV expressing GAA useful in the methods for treating Pompe disease disclosed herein comprises 5'ITR and 3'ITR sequences, and a liver-specific promoter operably linked to a heterologous nucleic acid encoding a secretory peptide, located between the 5'ITR and 3'ITR, and a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide (i.e., the heterologous nucleic acid encodes a GAA polypeptide comprising a signal peptide-GAA polypeptide).
[0253] In an alternative embodiment, the GAA-expressing AAV useful in the methods for treating Pompe disease disclosed herein comprises 5'ITR and 3'ITR sequences, and a promoter operably linked to a heterologous nucleic acid encoding a secreted peptide, located between the 5'ITR and 3'ITR, and a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide.
[0254] Generally, secretory signal peptides are cleaved in the endoplasmic reticulum, and in some embodiments, the secretory signal peptide is cleaved from the GAA polypeptide before secretion. However, as long as the secretion of the GAA polypeptide from the cell is enhanced and the GAA polypeptide is functional, it is not necessary for the secretory signal peptide to be cleaved. Therefore, in some embodiments, the secretory signal peptide is partially or completely retained.
[0255] In some embodiments, the rAAV genome or isolated nucleic acid disclosed herein comprises a nucleic acid encoding a chimeric polypeptide comprising a GAA polypeptide operably linked to a secretory signal peptide, wherein the chimeric polypeptide is expressed and produced from a cell transduced with the rAAV vector, and the GAA polypeptide is secreted from the cell. The GAA polypeptide may be secreted after cleavage of all or part of the secretory signal peptide. Alternatively, the GAA polypeptide may retain the secretory signal peptide (i.e., the secretory signal is not cleaved). Thus, in this context, a "GAA polypeptide" may be a chimeric polypeptide comprising a secretory peptide.
[0256] Numerous secreted proteins and sequences that direct their secretion from cells are known in the art and are disclosed in U.S. Patent 9,873,868, which is incorporated herein by reference in its entirety. Exemplary secreted proteins (and their secretion signals) include, but are not limited to, erythropoietin, coagulation factor IX, cystatin, lactotransferrin, plasma protease C1 inhibitor, apolipoproteins (e.g., APO A, C, E), MCP-1, α-2-HS-glycoprotein, α-1-microglobulin, complement (e.g., C1Q, C3), vitronectin, lymphotoxin-α, azurocidin, VIP, metalloproteinase inhibitor 2, glypican-1, pancreatic hormones, clusterin, hepatocyte growth factor, insulin, α-1-antichymotrypsin, growth hormone, type IV collagenase, guanylin, properdin, proenkephalin A, inhibin β (e.g., A chain), prealbumin, angiogenin, lutropin (e.g., β chain), insulin-like growth factor binding protein 1 and 2, proactivator polypeptide, fibrinogen (e.g., β chain), gastric triacylglycerol lipase, midkine, neutrophil defensin 1, 2, and 3, α-1-antitrypsin, matrix gla-protein, α-tryptase, bile salt-activated lipase, chymotrypsinogen B, elastin, IG lambda chain V region, platelet factor 4 variant, chromogranin A, WNT-1 proto-oncogene protein, oncostatin M, β-neoendorphin-dynorphin, von Willebrand factor, plasma serine protease inhibitor, serum amyloid A protein, nidogen, fibronectin, rennin, osteonectin, histatin 3, phospholipase A2, cartilage matrix protein, GM-CSF, matrilysin, neuroendocrine protein 7B2, placental protein 11, gelsolin, M-CSF, transcobalamin I, lactase-phlorizin hydrolase, elastase 2B, pepsinogen A, MIP1-beta, prolactin, trypsinogen II, gastrin-releasing peptide II, atrial natriuretic factor, secretory alkaline phosphatase, pancreatic alpha-amylase, secretogranin I, beta-casein, serotransferrin, tissue factor pathway inhibitor, follitropin beta chain, coagulation factor XII, growth hormone-releasing factor, prostate seminal plasma protein, interleukins (e.g., 2, 3, 4, 5, 9, 11), inhibin (e.g., alpha chain), angiotensinogen, thyroglobulin, IG heavy or light chain, plasminogen activator inhibitor-1, lysozyme C, plasminogen activator, anti-leukoproteinase 1, statherin, fibrin-1, isoform B, uromodulin, thyroxine-binding globulin, axonin-1, endometrial alpha-2 globulin, interferons (e.g., alpha, beta, gamma), beta-2-microglobulin, procholecystokinin, progastricsin, prostatic acid phosphatase, bone sialoprotein II, colipase, Alzheimer's amyloid A4 protein, PDGF (e.g., A or or B chain), coagulation factor V, triacylglycerol lipase, haptoglobin-2, corticosteroid-binding globulin, triacylglycerol lipase, prorelaxin H2, follistatin 1 and 2, platelet glycoprotein IX, GCSF, VEGF, heparin cofactor II, antithrombin-III, leukemia inhibitory factor, interstitial collagenase, pleiotrophin, small inducible cytokine A1, melanin-concentrating hormone, angiotensin-converting enzyme, pancreatic trypsin inhibitor, coagulation factor VIII These include: α-fetoprotein, α-lactalbumin, senogelin II, kappa-casein, glucagon, thyrotropin beta chain, transcobalamin II, thrombospondin 1, parathyroid hormone, vasopressin, copeptin, tissue factor, motilin, MPIF-1, kininogen, neuroendocrine convertase 2, stem cell factor, procollagen α1 chain, plasma kallikrein, keratinocyte growth factor, as well as any other secreted hormones, growth factors, cytokines, enzymes, clotting factors, milk proteins, immunoglobulin chains, etc.
[0257] In some embodiments, other secretory signal peptides encoded by the rAAV genomes and in the rAAV vectors disclosed herein can be selected from, but are not limited to, secretory signal sequences from prepro-cathepsin L (e.g., GenBank Accession Nos. KHRTL, NP_037288; NP_034114, AAB81616, AAA39984, P07154, CAA68691; the disclosures of which are incorporated herein by reference in their entireties), and prepro-alpha type 2 collagen (e.g., GenBank Accession Nos. CAA98969, CAA26320, CGHU2S, NP_000080, BAA25383, P08123; the disclosures of which are incorporated herein by reference in their entireties), and allelic variations, modifications, and functional fragments thereof (as discussed above with respect to the fibronectin secretory signal sequence). Exemplary secretory signal sequences include those for preprocathepsin L (Rattus norvegicus, MTPLLLLAVLCLGTALA [SEQ ID NO: 27]; Accession No. CAA68691) and for prepro-alpha type 2 collagen (Homo sapiens, MLSFVDTRTLLLLAVTLCLATC [SEQ ID NO: 28]; Accession No. CAA98969). Longer amino acid sequences containing full-length secretory signal sequences from preprocathepsin L and prepro-alpha type 2 collagen, or functional fragments thereof (as discussed above with respect to the fibronectin secretory signal sequence), are also encompassed.
[0258] In some embodiments, the secretory signal peptide is derived, in part or in whole, from a secretory polypeptide produced by liver cells. In some embodiments, the secretory signal peptide may further be synthetic or artificial, in whole or in part. Synthetic or artificial secretory signal peptides are known in the art; see, e.g., Barash et al., "Human secretory signal peptide description by hidden Markov model and generation of a strong artificial signal peptide for secreted protein expression," Biochem. Biophys. Res. Comm. 294:835-42 (2002), the disclosure of which is incorporated herein in its entirety. In certain embodiments, the secretory signal peptide comprises, consists essentially of, or consists of the artificial secretory signal: MWWRLWWLLLLLLLLWPMVWA (SEQ ID NO: 29), or a variant thereof with 1, 2, 3, 4, or 5 amino acid substitutions (optionally conservative amino acid substitutions, where conservative amino acid substitutions are known in the art).
[0259] Exemplary signal peptides for use in the methods and compositions disclosed herein can be selected from any of the signal peptides disclosed in Table 2, or functional variants thereof. Exemplary signal peptides are fibronectin (FN1) or AAT. In some embodiments of the methods and compositions disclosed herein, the rAAV vector composition includes a nucleic acid encoding a secretory signal peptide, for example, a nucleic acid encoding a secretory signal peptide selected from the AAT signal peptide (e.g., SEQ ID NO: 17), the fibronectin signal peptide (FN1) (e.g., SEQ ID NOs: 18-21), the GAA signal peptide, the hIGF2 signal peptide (e.g., SEQ ID NO: 22), or an active fragment thereof having secretory signal activity, for example, a nucleic acid encoding an amino acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NOs: 17-22, where SEQ ID NOs: 17-22 are disclosed in International Application WO2021102107, which is incorporated herein by reference.
[0260] In some embodiments of the methods and compositions disclosed herein, the nucleic acid encoding the secretion signal is selected from any of SEQ ID NOs: 17, 81-21, 22-26, or a nucleic acid sequence having at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to any of SEQ ID NOs: 17 or 22-26, wherein SEQ ID NOs: 17 and 22-26 are disclosed in International Application WO2021102107, which is incorporated herein by reference.
[0261] Fibronectin secretory signal peptide:
[0262] In some embodiments, the secretory signal peptide is a fibronectin secretory signal peptide, which term includes modifications of the naturally occurring sequence (as described in more detail below).
[0263] In some embodiments, the secretory signal peptide is a fibronectin signal peptide, such as a human fibronectin signal sequence or a rat fibronectin-derived signal sequence. Fibronectin (FN1) signal sequences and modified FN1 signal peptides encompassed for use in the rAAV genomes and rAAV vectors described herein are disclosed in U.S. Patent No. 7,071,172, the entire contents of which are incorporated herein by reference, and in Provisional Application No. 62 / 937,556 filed November 19, 2019, or Table 3 of International Application WO2021102107, the entire contents of which are incorporated herein by reference. Exemplary fibronectin secretory signal sequences include, but are not limited to, those listed in Table 1 of U.S. Patent No. 7,071,172, the entire contents of which are incorporated herein by reference.
[0264] [Table 2-1]
[0265] Peptidase cleavage site
[0266] In some embodiments, one or more exogenous peptidase cleavage sites can be inserted into the secretory signal peptide-GAA polypeptide, for example, between the secretory signal peptide and the GAA polypeptide. In certain embodiments, an autoprotease (e.g., foot-and-mouth disease virus 2A autoprotease) is inserted between the secretory signal peptide and the GAA polypeptide. In other embodiments, a protease recognition site that can be controlled by the addition of an exogenous protease is used (e.g., a Lys-Arg recognition site for trypsin, a Lys-Arg recognition site for Aspergillus KEX2-like protease, a recognition site for a metalloprotease, a recognition site for a serine protease, etc.). Modifications of GAA polypeptides that delete or inactivate native protease sites are disclosed in U.S. Provisional Application No. 62,937,556 and International Application WO2021102107, filed November 19, 2019, which are incorporated herein by reference.
[0267] C. Spacer and fusion junction of the GAA polypeptide When GAA is expressed with a non-GAA secretory signal peptide (e.g., an SS-GAA polypeptide), the signal peptide can be fused directly to the GAA polypeptide or separated from the GAA polypeptide by a linker. An amino acid linker (also referred to herein as a "spacer") incorporates one or more amino acids other than those that appear at that position in the native protein. Spacers generally can be designed to be flexible or to interpose a structure, such as an a-helix, between two protein moieties.
[0268] Thus, in some embodiments of the methods and compositions disclosed herein, the recombinant AAV vector comprises a heterologous nucleic acid sequence encoding a GAA polypeptide, and the GAA protein further comprises a spacer comprising a nucleotide sequence at least one amino acid in length positioned at the N-terminus of the GAA polypeptide.
[0269] In one embodiment, the spacer is at least 50% identical to the sequence GGGTVGDDDDK (SEQ ID NO: 35).
[0270] In some embodiments, the spacer or linker can be relatively short, e.g., at least 1, 2, 3, 4, or 5 amino acids, or, e.g., the sequence Gly-Ala-Pro (SEQ ID NO: 31) or Gly-Gly-Gly-Gly-Gly-Pro (SEQ ID NO: 32), or can be longer, e.g., 5-10 amino acids in length, or 10-25 amino acids in length, etc. For example, a flexible repeat linker of 3-4 copies of the sequence (GGGGS (SEQ ID NO: 33)) and an a-helical repeat linker of 2-5 copies of the sequence (EAAAK (SEQ ID NO: 34)) have been described (Arai et al. (2004) Proteins: Structure, Function and Bioinformatics 57:829-838).
[0271] The use of another linker, GGGTVGDDDDK (SEQ ID NO: 35), has also been reported (DiFalco et al. (1997) Biochem. J. 326:407-413) and is encompassed for use. Linkers incorporating the a-helix portion of a human serum protein can be used to minimize the immunogenicity of the linker region.
[0272] In some embodiments, the spacer is encoded by the nucleic acid GGC GCG CCG (SEQ ID NO: 30), which encodes an amino acid spacer comprising the amino acids GAP or Gly-Ala-Pro (SEQ ID NO: 31).
[0273] The site of the fusion junction in the GAA polypeptide for fusing to one of the signal peptides (to create an SS-GAA fusion protein) should be carefully selected to promote proper folding and activity of each polypeptide in the fusion protein and to prevent premature separation of the signal peptide from the GAA polypeptide.
[0274] In some embodiments, the spacer has a helical structure. In another specific embodiment, the spacer is at least 50% identical to the sequence GGGTVGDDDDK (SEQ ID NO: 35). In some embodiments of the methods and compositions disclosed herein, the spacer is SEQ ID NO: 31 (encoded by the nucleic acid of SEQ ID NO: 30). In some embodiments of the methods and compositions disclosed herein, the spacer is selected from any of SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, or SEQ ID NO: 35.
[0275] In some embodiments, a signal peptide can be fused directly or via a spacer to amino acid 40 or 70 of GAA, a position that allows for protein expression, catalytic activity of the GAA protein, and proper secretion of the GAA polypeptide, as described herein in the Examples. Alternatively, a signal sequence or signal peptide can be fused at or near a cleavage site that separates the C-terminal domain of GAA from the mature polypeptide. This allows for the synthesis of a GAA protein with an internal signal peptide, which can be cleaved to release the mature polypeptide or C-terminal domain from the signal sequence, as needed, depending on the placement of the cleavage site. Alternatively, the mature polypeptide can be synthesized as a fusion protein at about position 791 without incorporating a C-terminal signal peptide sequence into the open reading frame of the expression construct.
[0276] To facilitate folding of the signal peptide, the GAA amino acid residue adjacent to the fusion junction can be modified. For example, because the GAA cysteine residue may interfere with proper folding of the signal peptide, the terminal GAA cysteine 952 can be deleted or replaced with serine to accommodate a C-terminal signal peptide. The signal peptide can also be fused just before the final Cys952. The penultimate Cys938 can be changed to proline in conjunction with mutation of the final Cys952 to serine.
[0277] D.CS array In some embodiments of the methods and compositions disclosed herein, the recombinant AAV vector comprises a heterologous nucleic acid sequence further comprising a collagen stability (CS) sequence located 3' of the nucleic acid encoding the GAA polypeptide and 5' of the 3' ITR sequence. In some embodiments, the rAAV genome disclosed herein comprises a heterologous nucleic acid sequence that can optionally include a collagen stability sequence (CS or CSS) located 3' of the GAA gene and 5' of the polyA signal. In some embodiments, the CS sequence can be replaced by the 3' UTR sequence disclosed herein.
[0278] Exemplary collagen stabilization sequences include CCCAGCCCACTTTTCCCCAA (SEQ ID NO: 65), or a sequence with at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. Exemplary collagen stabilization sequences can have the amino acid sequence of PSPLFP (SEQ ID NO: 66), or an amino acid sequence with at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. CS sequences are disclosed in Holick and Liebhaber, Proc. Nat. Acad. Sci. 94: 2410-2414, 1997 (see, e.g., Figure 3, page 5205), which is incorporated herein by reference in its entirety.
[0279] E. Liver-specific promoter (LSP) In some embodiments, to achieve an appropriate level of GAA expression, the rAAV genotype includes a liver-specific promoter (LSP). The LSP enables expression of an operably linked gene in the liver and, in some embodiments, may be an inducible LSP. In some embodiments, the LSP is located 5' upstream and operably linked to a heterologous nucleic acid sequence encoding a GAA protein. Exemplary liver-specific promoters useful in AAVs for treating Pompe using the methods disclosed herein are disclosed in International Publication Nos. WO2020102645 and WO2021102107, the entire contents of which are incorporated herein by reference. Exemplary liver-specific promoters include, but are not limited to, the transthyretin promoter (TTR), the LSP promoter (LSP), and synthetic liver-specific promoters.
[0280] In some embodiments of the methods and compositions disclosed herein, the promoter is a liver-specific promoter (LSP), and can be selected from any liver-specific promoter, including, but not limited to, the transthyretin promoter (TTR), the liver-specific promoter (LSP), for example, as disclosed in 5,863,541 (TTR promoter), or the LSP promoter (PNAS; 96: 3906-3910, 1999. See, for example, p. 3906, Materials and Methods, rAAV construction), or a synthetic liver promoter, the entire contents of which are incorporated herein by reference.Other liver promoters, such as synthetic liver promoters, can be used.
[0281] In some embodiments, the promoter is the LP1 promoter (SEQ ID NO: 432 as disclosed in WO2021102107, the entire contents of which are incorporated herein by reference), or a variant having at least a sequence of at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
[0282] In some embodiments, the TTR promoter is a truncated TTR promoter, including, for example, SEQ ID NO: 12, as disclosed in International Publication No. WO2020102645, the entire contents of which are incorporated herein by reference, or a variant having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto.
[0283] In some embodiments, the LSP is a TBG promoter, including, for example, SEQ ID NO: 435, as disclosed in International Publication No. WO2021102107, the entire contents of which are incorporated herein by reference, or a variant having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
[0284] Other liver-specific promoters include, but are not limited to, promoters for LDL receptor, factor VIII, factor IX, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC), and α-antitrypsin (hAAT), as well as the HCB promoter. Other liver-specific promoters include the AFP (alpha fetal protein) gene promoter and albumin gene promoter disclosed in EP Patent Publication No. 0415731, the α-1 antitrypsin gene promoter disclosed in Rettenger, Proc. Natl. Acad. Sci. 91 (1994) 1460-1464, the fibrinogen gene promoter, the APO-A1 (apolipoprotein A1) gene promoter, and promoter genes for liver transferases such as SGOT, SGPT, and g-glutamyltransferase. See also PCT Patent Publications Nos. 2001 / 0051611 and WO90 / 07936 and WO91 / 02805, which are incorporated herein by reference in their entireties. In some embodiments, the liver-specific promoter is a recombinant liver-specific promoter, for example, as disclosed in US20170326256A1, which is incorporated herein by reference in its entirety.
[0285] In some embodiments, the liver-specific promoter is a hepatitis B X gene promoter and a hepatitis B core protein promoter. In some embodiments, liver-specific promoters can be used with their respective enhancers. The enhancer element can be linked to either the 5' or 3' end of the nucleic acid encoding the GAA polypeptide. The hepatitis B X gene promoter and its enhancer can be obtained from the viral genome as a 332-base pair EcoRV-NcoI DNA fragment using the method described by Twu, J Virol. 61 (1987) 3448-3453. The hepatitis B core protein promoter can be obtained from the viral genome as a 584-base pair BamHI-Bglll DNA fragment using the method described by Gerlach, Virol 189 (1992) 59-66. It may be necessary to remove the negative regulatory sequence in the BamHI-Bglll fragment before inserting it.
[0286] In some embodiments, the synthetic liver-specific promoter is selected from any of SEQ ID NOs: 86, 91-96, or 146-150, or 270-430, or a nucleic acid sequence at least 80%, or at least 90%, or 95% identical thereto or a source regulatory nucleic acid sequence, as disclosed in International Application WO2021102107, the entire contents of which are incorporated herein by reference.
[0287] In some embodiments, the liver-specific promoter (LSP) in an AAV expressing GAA useful in the methods for treating Pompe disease disclosed herein is SEQ ID NO:86 (CRM 0412), SEQ ID NO:91 (SP0412), or SEQ ID NO:92 (SP0422), SEQ ID NO:93 (SP0239), SEQ ID NO:94 (SP0265), SEQ ID NO:95 (SP0240), or SEQ ID NO:96 (SP0246), or SEQ ID NO:146 (SP0265-UTR), SEQ ID NO:147 (SP0239-UTR), SEQ ID NO:148 (SP0240-UTR), SEQ ID NO:149 (SP0246-UTR), or SEQ ID NO:150 (SP0133-UTR), as disclosed in the international application. 1-A1-UTR), or a functional fragment or variant thereof, or any LSP selected from SEQ ID NOs: 270-341 or 342-430, or a functional fragment or variant thereof, wherein SEQ ID NOs: 86, 91-96, or 146-150, or 270-430 are disclosed in International Application WO2021102107, the entire contents of which are incorporated herein by reference.
[0288] In some embodiments, the rAAV vector genome can include one or more constitutive promoters, such as viral promoters or promoters from mammalian genes that are generally active in promoting transcription.
[0289] It is assumed that the liver-specific promoter used for expressing GAA polypeptide is selected in combination with or in conjunction with the selection of signal sequence.In particular, without wishing to be bound by theory, when a strong liver-specific promoter is selected, the signal sequence should be selected to be sufficient to secrete the GAA expressed outside the cell, in order to avoid the accumulation of GAA in cells and any related cytotoxicity, and / or to avoid the occurrence of anti-GAA antibody.
[0290] The LSP is selected in conjunction with a signal sequence, so that the strength of the liver-specific promoter (LSP) operably linked to the nucleic acid encoding the GAA polypeptide can be offset with the ability of the cell to secrete the expressed GAA protein. Therefore, if the liver-specific promoter is strong, the specific signal sequence must be sufficiently effective to allow the expressed GAA to be secreted from the cell so as not to accumulate GAA, cause cytotoxicity, and / or induce an immune response. Therefore, the cellular secretory pathway and the selected signal sequence must be able to match the level of GAA expressed by AAV, where the level of GAA expression depends on both the AAV transduction efficiency (determined by AAV dosage and capsid) and the strength of the liver-specific promoter.
[0291] In some embodiments of the methods for treating Pompe disease disclosed herein, the synthetic liver-specific promoter useful in the AAV vector is any LSP promoter disclosed in Table 4 of International Application WO2021102107, or selected from SEQ ID NOs: 86, 91-96, 146-150 of International Application WO2021102107, or selected from SEQ ID NOs: 270-341 or 342-430 of International Application WO2021102107. Any LSP selected, the synthetic liver-specific promoter is capable of driving liver-specific transgene expression and has activity in liver cells that is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TTR promoter comprising SEQ ID NO: 431 of International Application WO2021102107.
[0292] In some embodiments of the methods for treating Pompe disease disclosed herein, the synthetic liver-specific promoter is any LSP promoter selected from the LSPs disclosed herein in Table 4 of International Application WO2021102107, or SEQ ID NOs: 86, 91-96, 146-150 disclosed in International Application WO2021102107, or SEQ ID NOs: 270-341 or 342-430 disclosed in International Application WO2021102107. The synthetic liver-specific promoter is selected from any of any LSPs, wherein the synthetic liver-specific promoter is capable of driving liver-specific transgene expression and has activity in liver cells that is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TBG promoter of SEQ ID NO: 435 disclosed in International Application WO2021102107.
[0293] In some embodiments, the liver-specific promoter that is a functional variant of a given promoter element preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and even more preferably 100% of its activity (compared to a reference promoter that comprises an unmodified promoter element). Suitable assays for assessing liver-specific promoter activity are disclosed in Examples 12 and 13 of International Application WO2021102107, the entire contents of which are incorporated herein by reference.
[0294] F. Regulatory and Intronic Sequences In some embodiments, the liver-specific promoter described above is operably linked to one or more additional regulatory sequences.For example, the additional regulatory sequence can enhance expression compared with the liver-specific promoter that is not operably linked to the additional regulatory sequence.Generally, it is preferred that the additional regulatory sequence does not substantially reduce the specificity of the liver-specific promoter.
[0295] For example, a liver-specific promoter can be operably linked to a sequence encoding a UTR (e.g., 5' and / or 3' UTR), an intron, etc. In some embodiments, a liver-specific promoter is operably linked to a sequence encoding a UTR, for example, a 5' UTR. The 5' UTR can contain various elements that can regulate gene expression. The 5' UTR in a natural gene begins at the transcription start site and ends one nucleotide before the start codon of the coding region. It should be noted that the 5' UTR referred to herein can be the entire naturally occurring 5' UTR or a portion of a naturally occurring 5' UTR. The 5' UTR can also be partially or entirely synthetic. In eukaryotes, 5' UTRs have a median length of approximately 150 nt, but in some cases, they can be significantly longer. Regulatory sequences that can be found in 5' UTRs are disclosed in International Application WO2021102107, the entire contents of which are incorporated herein by reference.
[0296] Introns in 5'UTR are involved in the regulation of gene expression and mRNA nuclear export. In some embodiments, the liver-specific promoter described above is operably linked to a sequence encoding a 5'UTR derived from a CMV major immediate early gene (CMV-IE gene). For example, the 5'UTR derived from a CMV-IE gene preferably comprises CMV-IE gene exon 1 and CMV-IE gene exon 1, or a portion thereof. In some cases, the promoter element may be modified in consideration of linking to the 5'UTR, for example, the sequence downstream of the transcription start site (TSS) in the promoter element may be removed (e.g., replaced with 5'UTR).
[0297] The CMV-IE 5'UTR is described in Simari, et al., Molecular Medicine 4: 700-706, 1998, "Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene," which is incorporated herein by reference. Variants of the CMV-IE 5'UTR sequence discussed in Simari et al. are also set forth in WO2002 / 031137, which is incorporated herein by reference, and the regulatory sequences disclosed therein can also be used. Other UTRs that can be used in combination with promoters are known in the art, for example, in Leppek, K., Das, R. & Bama, M., "Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them," Nat Rev Mol Cell Biol 19, 158-174 (2018), which is incorporated herein by reference.
[0298] In some embodiments, the sequence encoding the 5'UTR comprises SEQ ID NO: 145, as disclosed in International Application WO2021102107, or a functional variant thereof. In some embodiments, the functional variant may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. SEQ ID NO: 145 encodes the CMV-IE 5'UTR.
[0299] In some embodiments, the 5' UTR contains a nucleic acid motif that functions as a protein translation initiation site, e.g., a sequence that defines a Kozak sequence in the produced mRNA. For example, in some embodiments, the sequence encoding the 5' UTR contains the sequence motif GCCACC (SEQ ID NO: 153) at or near its 3' end. Other Kozak sequences or other protein translation initiation sites can be used as known in the art (e.g., Marilyn Kozak, "Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes," Cell, Vol. 44, 283-292, January 31, 1986; Marilyn Kozak, "At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cells," J. Mol. Rid. (1987) 196, 947-950; Marilyn Kozak, "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs," Nucleic Acids Research. Vol. 15 (20) 1987, all of which are incorporated herein by reference). A protein translation initiation site (eg, a Kozak sequence) is preferably located immediately adjacent to the start codon.
[0300] In some embodiments, the sequence encoding the 5'UTR comprises SEQ ID NO: 438, as disclosed in International Application WO2021102107, or a functional variant thereof. In some embodiments, the functional variant may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. The 5'UTR comprises the 6 nucleotides of SEQ ID NO: 153, as disclosed in International Application WO2021102107, which defines a Kozak sequence at the 3' end of the CMV-IE 5'UTR.
[0301] In some embodiments, the rAAV expressing GAA for use in the methods for treating Pompe disclosed herein comprises an intron sequence located 3' of the promoter sequence and 5' of the secretory signal peptide.The intron sequence functions to increase one or more of mRNA stability, mRNA transport from the nucleus, and / or the expression and / or regulation of the expressed GAA polypeptide.In alternative embodiments, the rAAV genotype does not comprise an intron sequence.
[0302] In some embodiments, the intron sequence is an MVM intron sequence, such as, but not limited to, the intron sequence of SEQ ID NO: 13 disclosed in International Publication WO2020102645, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.
[0303] In some embodiments, the intron sequence is an HBB2 intron sequence, such as, but not limited to, the intron sequence of SEQ ID NO: 14 disclosed in International Publication WO2020102645, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto.
[0304] In some embodiments of the methods and compositions disclosed herein, the recombinant AAV vector comprises a heterologous nucleic acid sequence further comprising an intron sequence located 5' of a sequence encoding a secretory signal peptide and 3' of the promoter. In some embodiments, the intron sequence comprises an MVM sequence or an HBB2 sequence, wherein the MVM sequence comprises the nucleic acid sequence of SEQ ID NO: 13 disclosed in International Publication WO2020102645, or a nucleic acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO: 13, and the HBB2 sequence comprises the nucleic acid sequence of SEQ ID NO: 14 disclosed in International Publication WO2020102645, or a nucleic acid sequence having at least about 75%, 80%, 85%, 90%, 95%, 98%, or 99% sequence identity to SEQ ID NO: 14.
[0305] In some embodiments, the rAAV genotype comprises an intron sequence selected from the group consisting of a human beta globin b2 (or HBB2) intron, a FIX intron, a chicken beta-globin intron, and an SV40 intron. In some embodiments, the intron is optionally a modified HBB2 intron (e.g., see SEQ ID NO: 17 in WO2018046774A1), a modified FIX intron (e.g., see SEQ ID NO: 19 in WO2018046774A1), or a modified chicken beta-globin intron (e.g., see SEQ ID NO: 21 in WO2018046774A1), or a modified intron such as the modified HBB2 or FIX introns disclosed in WO2015 / 162302, the entire contents of which are incorporated herein by reference.
[0306] G. PolyA In some embodiments, the rAAV vector genome comprises at least one polyA tail located 3' and downstream of the heterologous nucleic acid gene encoding a GAA polypeptide. In some embodiments, the polyA signal is 3' of a stability sequence or CS sequence as defined herein. Any polyA sequence can be used, including, but not limited to, hGH polyA, synpA polyA, etc. In some embodiments, the polyA is a synthetic polyA sequence. In some embodiments, the rAAV vector genome comprises two polyA tails, for example, an hGH polyA sequence and another polyA sequence, wherein a spacer nucleic acid sequence is located between the two polyA sequences. In some embodiments, the rAAV genome comprises the following elements 3' of the nucleic acid encoding a GAA polypeptide, or alternatively, 3' of the CS sequence: a first polyA sequence, a spacer nucleic acid sequence (between 100 and 400 bp or about 250 bp), a second polyA sequence, a spacer nucleic acid sequence, and a 3' ITR. In some embodiments, the first and second polyA sequences are hGH polyA sequences, and in some embodiments, the first and second polyA sequences are synthetic polyA sequences. In some embodiments, the first polyA sequence is an hGH polyA sequence and the second polyA sequence is a synthetic sequence, or vice versa; that is, in alternative embodiments, the first polyA sequence is a synthetic polyA sequence and the second polyA sequence is an hGH polyA sequence. An exemplary polyA sequence is, for example, SEQ ID NO: 15 (hGH polyA sequence) disclosed in International Publication WO2021102107, or a polyA nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity to SEQ ID NO: 15 disclosed in International Application WO2021102107. In some embodiments, hGH polysequences encompassed for use are described in Anderson et al. J. Biol. Chem 264(14); 8222-8229, 1989 (see, e.g., page 8223, column 2, paragraph 1), which is incorporated herein by reference in its entirety. In one embodiment, a recombinant AAV disclosed herein comprises a transcription terminator signal sequence or transcription pause signal sequence in its genome in reverse orientation between the polyA and the 3' ITR.In one embodiment, a recombinant AAV disclosed herein comprises a transcription terminator signal sequence or a transcription pause signal sequence in its genome in the 3'-5' orientation between the polyA and the 3' ITR.
[0307] In some embodiments, the polyA tail can be engineered to stabilize RNA transcripts transcribed from the rAAV vector genome, including transcripts for heterologous genes, which in one embodiment are GAA; in alternative embodiments, the polyA tail can be engineered to contain destabilizing elements.
[0308] In some embodiments of the method for treating Pompe disease disclosed herein, the recombinant AAV vector comprises at least one polyA sequence located 3' of the nucleic acid encoding the GAA gene and 5' of the 3' ITR sequence.In some embodiments, the polyA is a full-length polyA (fl-polyA) sequence.In some embodiments, the polyA is a truncated polyA sequence disclosed in International Publication No. WO2021102107, the entire contents of which are incorporated herein.
[0309] In some embodiments, the polyA tail can be engineered to be a destabilizing element by altering the length of the polyA tail. In some embodiments, the polyA tail can be lengthened or shortened. In some embodiments, the 3' untranslated region comprises the GAA 3' UTR (SEQ ID NO: 85) or 3' UTR (SEQ ID NO: 77) disclosed in International Application WO2021102107, which is incorporated herein by reference in its entirety.
[0310] In another embodiment, the destabilizing element is a microRNA (miRNA) that has the ability to silence (repress translation and promote degradation) RNA transcripts that encode heterologous genes to which the miRNA binds. In certain embodiments, the addition or deletion of a seed region within the polyA tail can increase or decrease expression of a protein, such as a GAA protein or modified GAA polypeptide.
[0311] In another embodiment, a seed region can be engineered into the 3' untranslated region located between the heterologous gene and the polyA tail. In a further embodiment, the destabilizing agent can be an siRNA. The coding region for the siRNA can be included in the rAAV vector genome and is generally located 3' downstream of the polyA tail.
[0312] In all aspects of the methods for treating Pompe disease disclosed herein, the rAAV genome may also include a stuffer DNA nucleic acid sequence. An exemplary stuffer DNA sequence is SEQ ID NO: 71, as disclosed in International Application WO2021102107, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide sequence identity thereto. In some embodiments, the stuffer sequence is located, for example, 3' of the polyA tail and 5' of the 3' ITR sequence. In some embodiments, the stuffer DNA sequence comprises a synthetic polyadenylation signal in reverse orientation.
[0313] In some embodiments, a stuffer nucleic acid sequence (also referred to as a "spacer" nucleic acid fragment) can be located between the polyA sequence and the 3' ITR (i.e., the stuffer nucleic acid sequence is located 3' of the polyA sequence and 5' of the 3' ITR) (see, e.g., Figures 7-8). Such stuffer nucleic acid sequences can be about 30 bp, 50 bp, 75 bp, 100 bp, 150 bp, 200 bp, 250 bp, 300 bp, or longer than 300 bp. In some embodiments of the methods and compositions disclosed herein, the stuffer nucleic acid fragment is between 20-50 bp, 50-100 bp, 100-200 bp, 200-300 bp, 300-500 bp, or any integer between 20-500 bp. Exemplary stuffer (or spacer) nucleic acid sequences can be selected from SEQ ID NO: 16, SEQ ID NO: 71, or SEQ ID NO: 78 disclosed in International Application WO2021102107, or any of the nucleic acid sequences that are at least about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identical to SEQ ID NO: 16, or SEQ ID NO: 71, or SEQ ID NO: 78 disclosed in International Application WO2021102107.
[0314] H.AAV ITR The rAAV vectors or genomes disclosed herein for use in methods for treating Pompe disease can include AAV ITRs that have desirable properties and can be designed to modulate the activity of, and cellular responses to, vectors into which the ITRs are incorporated. In another embodiment, the AAV ITRs are synthetic AAV ITRs that have desirable properties and can be designed to manipulate the activity of, and cellular responses to, vectors containing one or two synthetic ITRs, as shown, for example, in U.S. Patent No. 9,447,433, which is incorporated herein by reference.
[0315] In some embodiments, the 5' ITR of an AAV-GAA vector of the compositions and methods described herein has the nucleotide sequence TGGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 601). In some embodiments, the 3' ITR of an AAV-GAA vector of the compositions and methods described herein has the nucleotide sequence AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGCGCAGAGAGGGACAGATCCG (SEQ ID NO: 602).
[0316] In another embodiment, the ITR exhibits altered transcriptional activity compared to a naturally occurring ITR, such as ITR2 from AAV2. The ITR2 sequence is known to have promoter activity in nature. It also has termination activity similar to a poly(A) sequence in nature. The minimal functional ITR of the present invention exhibits transcriptional activity, albeit at a reduced level compared to ITR2, as shown in the Examples. Thus, in some embodiments, the ITR is transcriptionally functional. In other embodiments, the ITR is transcriptionally defective. In certain embodiments, the ITR can act as a transcriptional insulator, for example, preventing transcription of a transgenic cassette present in the vector when the vector is integrated into a host chromosome.
[0317] One aspect of the present invention relates to an rAAV vector genome comprising at least one synthetic AAV ITR, wherein the nucleotide sequence of one or more transcription factor binding sites in the ITR has been deleted and / or substituted compared to the sequence of a naturally occurring AAV ITR, such as ITR2. In some embodiments, this is a minimal functional ITR in which one or more transcription factor binding sites have been deleted and / or substituted. In some embodiments, at least one transcription factor binding site has been deleted and / or substituted, for example, at least five or more, or ten or more, transcription factor binding sites have been deleted and / or substituted, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 transcription factor binding sites have been deleted and / or substituted.
[0318] In another embodiment, an rAAV vector comprising the rAAV vector genome described herein comprises a polynucleotide containing at least one synthetic AAV ITR, in which one or more CpG islands (a cytosine base immediately followed by a guanine base (CpG), where cytosines in such a configuration tend to be methylated), which typically occur at or near the transcription start site in the ITR, have been deleted and / or substituted. In certain embodiments, deleting or reducing the number of CpG islands can reduce the immunogenicity of the rAAV vector. This results from the reduced or complete inhibition of TLR-9 binding to the rAAV vector DNA sequence, which occurs in the CpG islands. It is also well known that methylation of CpG motifs leads to transcriptional silencing. Removal of CpG motifs in the ITR is expected to result in reduced TLR-9 recognition and / or reduced methylation, and therefore reduced transgene silencing. In some embodiments, this is a minimal functional ITR in which one or more CpG islands have been deleted and / or replaced. In certain embodiments, AAV ITR2 is known to contain 16 CpG islands, one or more of which, or all 16 of which may be deleted.
[0319] In some embodiments, at least one CpG motif has been deleted and / or substituted, for example at least four or more, or eight or more CpG motifs, for example at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 CpG motifs.
[0320] In another embodiment, the synthetic ITR comprises, consists essentially of, or consists of one of the nucleotide sequences listed in Table 7. In other embodiments, the synthetic ITR comprises, consists essentially of, or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, to any one of the nucleotide sequences listed in Table 7. In some embodiments, the ITR is a sequence disclosed in Figure 1 of Samulski et al., 1983, Cell, 33; 135-143 (see Samulski et al, 1983), which discloses modified ITR sequences in Figure 1. In some embodiments, the ITR sequence comprises or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, to one of the ITR sequences in Figure 1 disclosed in Samulski et al., 1993. In some embodiments, the ITR comprises or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or 99.5% identical, to the pSM 609 right ITR sequence (lacking 9 bp) disclosed in the middle panel of Figure 1 disclosed in Samulski et al., 1983. In some embodiments, the ITR comprises a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or 99.5% identical, to the ITR sequence of any of SEQ ID NOs: 446-449.
[0321] In some embodiments, the ITR sequence, e.g., the right ITR (or 3'ITR), is SEQ ID NO: 442, or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or 99.5% identical to SEQ ID NO: 442. In some embodiments, the ITR sequence, e.g., the left ITR (or 5'ITR), is SEQ ID NO: 446, or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99%, or 99.5% identical to SEQ ID NO: 446.
[0322] [Table 7-1] [Table 7-2]
[0323] IV. Vectors and Virions In one embodiment, the rAAV vector (also referred to as a rAAV virion) disclosed herein comprises a capsid protein and an rAAV genome within the capsid protein. The rAAV capsid of the rAAV virion used to treat Pompe disease is any of those listed in Table 1 disclosed in USSN 62 / 937,556 (PCT / US2020 / 061223; WO2021 / 102107), filed November 19, 2019, which is incorporated herein by reference in its entirety, or any combination thereof.
[0324] In one embodiment, the rAAV capsid of the rAAV virion used to treat Pompe disease is any of those listed in Table 1, which is disclosed in International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety. In one embodiment, the rAAV capsid of the rAAV virion used to treat Pompe disease is an AAV8 capsid. In one embodiment, the rAAV vector is an rAAV8 vector.
[0325] In one embodiment, the AAV vector (also referred to as a rAAV virion) disclosed herein comprises any of the capsid proteins disclosed in WO2019 / 241324, the entire contents of which are specifically incorporated herein by reference. In some embodiments, the rAAV vector comprises a liver-specific capsid, such as a liver-specific capsid selected from XL32 and XL32.1, which are disclosed in WO2019 / 241324, the entire contents of which are incorporated herein by reference. In some embodiments, the rAAV vector is AAVXL32 or AAVXL32.1, which are disclosed in WO2019 / 241324, the entire contents of which are incorporated herein by reference.
[0326] Exemplary chimeric or variant capsid proteins that can be used as AAV capsids in the rAAV vectors described herein can be selected from Table 2 from U.S. Provisional Application No. 62,937,556, filed November 19, 2019, which is specifically incorporated herein by reference, or can be used in any combination with wild-type capsid proteins and / or other chimeric or variant capsid proteins now known or later identified, each of which is incorporated herein by reference. In some embodiments, the rAAV vectors encompassed for use are chimeric vectors, e.g., as disclosed in US Pat. No. 9,012,224 and US Pat. No. 7,892,809, which are incorporated herein by reference in their entireties.
[0327] In some embodiments, the rAAV vector is a haploid rAAV vector as disclosed in U.S. Patent Application Nos. US2018 / 0371496 and PCT / US18 / 22725, or a polyploid rAAV vector as disclosed, for example, in PCT / US2018 / 044632 filed July 31, 2018, and U.S. Patent Application No. 16 / 151,110, each of which is incorporated by reference herein in its entirety. In some embodiments, the rAAV vector is an rAAV3 vector as disclosed in WO2017 / 106236 and WO2017 / 106236, each of which is incorporated by reference herein in its entirety.
[0328] In certain embodiments, the rAAV is an AAVXL32 or AAVXL32.1 AAV vector, as disclosed in WO2019 / 241324, the entirety of which is incorporated herein by reference. In some embodiments, the rAAV vector comprises a capsid as disclosed in WO2019241324A1 or International Patent Application PCT / US2019 / 036676, the entirety of which is incorporated herein by reference. In some embodiments, the AAV vector is an AAV8 vector or a rational haploid comprising an AAV8 capsid protein. In some embodiments, the recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector, or a polyploid AAV vector. In some embodiments, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or an AAV vector derived from any AAV serotype, for example, any AAV serotype disclosed in Table 1 disclosed in International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety.
[0329] In some embodiments, the rAAV vector useful in the treatment of Pompe disease disclosed herein is an AAV3b capsid.The AAV3b capsid that can be used is described in International Application Nos. 2017 / 106236, 9,012,224, and 7,892,809, and International Application No. PCT / US19 / 61653 filed on November 15, 2019, and International Application Nos. WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety.In addition, the AAV3b capsid of the AAV vector that can be used in the methods disclosed herein is described in International Publication Nos. WO2020 / 102645 and WO2021102107, each of which is incorporated herein by reference in its entirety.
[0330] In some embodiments, the AAV3b capsid comprises SEQ ID NO: 44, which is disclosed in International Publication Nos. WO2020 / 102645 and WO2021102107. In certain embodiments, an AAV capsid used in the treatment of Pompe disease may be a modified AAV capsid derived in whole or in part from the AAV capsid set forth in SEQ ID NO: 44. In some embodiments, amino acids from the AAV3b capsid set forth in SEQ ID NO: 44 may be or have been substituted with amino acids from another capsid of a different AAV serotype, and the substituted and / or inserted amino acids may be from any AAV serotype and may include either naturally occurring or partially or fully synthetic amino acids.
[0331] In another embodiment, the AAV capsid used in the treatment of Pompe disease is an AAV3b265D capsid. In this specific embodiment, the AAV3b265D capsid comprises a modification in the amino acid sequence of the two-fold axial loop of the AAV3b capsid by replacing the amino acid G265 of the AAV3b capsid with D265. In some embodiments, the AAV3b265D capsid comprises SEQ ID NO: 46. However, the modified viral capsid of the present invention is not limited to the AAV capsid set forth in SEQ ID NO: 46 in International Publication WO2020 / 102645 and WO2021102107. In some embodiments, the amino acids derived from AAV3b265D set forth in SEQ ID NO: 46 can be or are substituted with amino acids derived from capsids of AAVs of different serotypes, and the substituted and / or inserted amino acids can be derived from any AAV serotype and can include either naturally occurring or partially or completely synthetic amino acids.
[0332] In another embodiment, the rAAV vector useful in the treatment of Pompe disease disclosed herein is an AAV3b265D549A capsid.In this specific embodiment, the AAV3b265D549A capsid comprises a modification in the amino acid sequence of the two-fold axial loop of the AAV3b capsid, by replacing the amino acid G265 of the AAV3b capsid with D265 and replacing the amino acid T549 of the AAV3b capsid with A549.In some embodiments, the AAV3b265D549A capsid herein comprises SEQ ID NO: 50, which is disclosed in International Publication WO2020 / 102645 and WO2021102107.However, the modified viral capsid of the present invention is not limited to the AAV capsid shown in SEQ ID NO: 50. In some embodiments, amino acids from AAV3b265D549A set forth in SEQ ID NO:50 can be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids can be from any AAV serotype and can include either naturally occurring or partially or fully synthetic amino acids. In some embodiments, amino acids from AAV3bSASTG (i.e., an AAV3b capsid containing the Q263A / T265 mutations) can be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids can be from any AAV serotype and can include either naturally occurring or partially or fully synthetic amino acids.
[0333] In another embodiment, the rAAV vector useful in the treatment of Pompe disease disclosed herein is an AAV3b549A capsid.In this particular embodiment, the AAV3b549A capsid comprises a modification in the amino acid sequence of the two-fold axial loop of the AAV3b capsid by replacing the amino acid T549 of the AAV3b capsid with A549.In some embodiments, the AAV3b549A capsid herein comprises SEQ ID NO: 52, which is disclosed in International Publication WO2020 / 102645 and WO2021102107.However, the modified viral capsid of the present invention is not limited to the AAV capsid shown in SEQ ID NO: 52. In some embodiments, amino acids from AAV3b549A set forth in SEQ ID NO:52 can be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids can be from any AAV serotype and can include either naturally occurring or partially or fully synthetic amino acids.
[0334] In another embodiment, the rAAV vector useful in the treatment of Pompe disease disclosed herein is an AAV3bQ263Y capsid.In this specific embodiment, the AAV3bQ263Y capsid comprises a modification in the amino acid sequence of the 2-fold axial loop of the AAV3b capsid by replacing the amino acid Q263 of the AAV3b capsid with Y263.In some embodiments, the AAV3b549A capsid herein comprises SEQ ID NO: 54, as disclosed in International Publication WO2020 / 102645 and WO2021102107.However, the modified viral capsid of the present invention is not limited to the AAV capsid shown in SEQ ID NO: 54. In some embodiments, amino acids from AAV3bQ263Y as set forth in SEQ ID NO: 54 may be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids may be from any AAV serotype and may include either naturally occurring or partially or fully synthetic amino acids.
[0335] In another embodiment, the rAAV vectors useful in treating Pompe disease disclosed herein are of the AAV3bSASTG serotype or comprise an AAV3bSASTG capsid. In this particular embodiment, the AAV3bSASTG capsid contains modifications in the amino acid sequence to include the SASTG mutation; in particular, the AAV3b capsid was modified to resemble the AAV2 Q263A / T265 subvariant by introducing these modifications at analogous positions in the AAV3b capsid (Messina EL, et al., Adeno-associated viral vectors based on serotype 3b use components of the fibroblast growth factor receptor signaling complex for efficient transduction. Hum. Gene Ther. 2012 Oct: 23(10):1031-4; Piacentino III, Valentino, et al. "X-linked inhibitor of apoptosis protein-mediated attenuation of apoptosis, using a novel cardiac-enhanced adeno-associated viral vector." Human gene therapy 23.6 (2012): 635-646). Thus, in some embodiments, the rAAV vectors useful in treating Pompe disease disclosed herein are of the AAV3bSASTG serotype or comprise an AAV3bSASTG capsid, including an AAV3b Q263A / T265 capsid. In some embodiments, amino acids from AAV3bSASTG can be or are substituted with amino acids from a capsid from an AAV of a different serotype, and the substituted and / or inserted amino acids can be from any AAV serotype and can include either naturally occurring or partially or fully synthetic amino acids.
[0336] To facilitate their introduction into cells, rAAV vector genomes useful in the present invention are recombinant nucleic acid constructs containing (1) a heterologous sequence to be expressed (in one embodiment, a polynucleotide encoding a GAA polypeptide) and (2) viral sequence elements that facilitate the integration and expression of the heterologous gene. The viral sequence elements may include sequences of the AAV vector genome (e.g., functional ITRs) required in cis for DNA replication and packaging into AAV capsids. In some embodiments, the heterologous gene encodes GAA, which is useful for correcting GAA deficiency in patients suffering from Pompe disease. In some embodiments, such rAAV vector genomes may also contain a marker or reporter gene. In some embodiments, the rAAV vector genome may have one or more of the AAV3b wild-type (WT) cis genes replaced or deleted, in whole or in part, but retain functional flanking ITR sequences.
[0337] V. Optimized rAAV Vector Genome In some embodiments of the methods and compositions disclosed herein, an optimized rAAV vector genome is generated from any of the elements disclosed herein in any combination, including a nucleic acid sequence encoding a promoter, ITRs, a polyA tail, an element that can increase or decrease expression of a heterologous gene, and in one embodiment, a nucleic acid sequence that has been codon-optimized for expression of the GAA protein in vivo (i.e., coGAA or codon-optimized GAA), and optionally, one or more elements that reduce immunogenicity. Such optimized rAAV vector genomes can be used with any AAV capsid that has tropism for the tissues and cells in which the rAAV vector genome is transduced and expressed.
[0338] In some embodiments, the rAAV genome lacks the AAV P5 promoter or a fragment thereof that is typically located upstream of the liver-specific promoter disclosed herein. Typically, the P5 promoter controls the expression of the AAV rep / cap proteins during AAV replication. In some embodiments, this P5 promoter fragment is present in the rAAV vector disclosed herein and contains predicted transcription factor binding sites, such as cyclic AMP response element-binding protein 3 (CREB3), which can be activated by endoplasmic reticulum (ER) / Golgi stress (Sampieri 2019), activating transcription factor 2 (ATF2), and is also involved in stress responses (Watson 2017), and nuclear receptor subfamily 1 group I member 2 (NR1I2) (also known as pregnane X receptor [PXR]), which is known to be enriched in the liver and activated by other molecules, including pregnane steroids, rifampin, and dexamethasone (NR1I2_HGNC) (Xing 2020). Therefore, in some embodiments, the AAV P5 promoter fragment in the rAAV genome is removed without affecting the intended performance of the GAA cassette.In some embodiments, the rAAV vector also contains an RNA polymerase II termination sequence located between the polyA signal and the 3'ITR.An exemplary termination sequence is SEQ ID NO:450, which introduces two termination codons and one restriction site (e.g., XhoI) replaces TAG, and is located immediately downstream of the last encoded amino acid of hGAA and immediately upstream of the 3'UTR.
[0339] VI.Definitions The following terms are used in the description and appended claims.
[0340] The terms "a," "an," "the," and similar references used in the context of describing the present invention (particularly in the context of the claims below) should be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Furthermore, ordinal designations such as "first," "second," and "third" with respect to specified elements are used to distinguish between elements and do not indicate or imply a required or limiting number of such elements, or a particular location or order of such elements, unless specifically stated otherwise. All methods described herein can be performed in any suitable order, unless otherwise indicated herein or clearly contradicted otherwise by context. The use of any and all examples or exemplary language (e.g., "such as") provided herein is intended merely to better clarify the invention and does not pose a limitation on the scope of the otherwise claimed invention. No language herein should be construed as indicating any non-claimed element essential to the practice of the invention.
[0341] Furthermore, the term "about," as used herein, when referring to a measurable value, e.g., a quantity such as the length of a polynucleotide or polypeptide sequence, a dose, a time, a temperature, etc., is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the stated amount.
[0342] Also, as used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the absence of a combination when interpreted alternatively ("or").
[0343] As used herein, the transitional phrase "consisting essentially of" means that the scope of a claim should be construed to include the specified materials or steps recited in the claim and "which do not materially affect the basic and novel characteristics" of the claimed invention. See In re Herz, 537 F.2d 549, 551-52, 190 USPQ 461,463 (CCPA 1976) (emphasis in original); see also MPEP § 2111.03. Thus, the term "consisting essentially of," when used in the claims of the present invention, is not intended to be construed as equivalent to "comprise." It is specifically intended that the various features of the invention described herein may be used in any combination unless the context dictates otherwise.
[0344] When denoting a mathematical quantity, the use of E immediately followed by a number shall be interpreted as if the number after the E were a superscript. For example, 5E11 is 5E 11 is intended to represent the same quantity as
[0345] The present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein may be excluded or omitted.
[0346] To further illustrate, for example, when the specification indicates that a particular amino acid can be selected from A, G, I, L, and / or V, this term also indicates that the amino acid can be selected from any subset of these amino acids, e.g., A, G, I, or L; A, G, I, or V; A or G; L only; etc., as if each such subcombination were expressly set forth herein. Such terms also indicate that one or more of the specified amino acids can be surrendered (e.g., by a negative proviso). For example, in certain embodiments, an amino acid is not A, G, or I; is not A; is not G or V; etc., as if each such possible surrender were expressly set forth herein.
[0347] The term "parvovirus," as used herein, encompasses the Parvoviridae family, which includes autonomously replicating parvoviruses and dependoviruses. Autonomous parvoviruses include members of the Parvovirus, Erythrovirus, Densovirus, Iteravirus, and Contravirus genera. Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mice, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, H1 parvovirus, Muscovy duck parvovirus, B19 virus, and any other autonomous parvoviruses now known or later discovered. Other autonomous parvoviruses are known to those skilled in the art. See, for example, Bernard N. Fields et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers).
[0348] As used herein, the term "adeno-associated virus" (AAV) includes, but is not limited to, AAV types 1, 2, 3 (including 3A and 3B), 4, 5, 6, 7, 8, 9, 10, 11, avian, bovine, canine, equine, ovine, and any other AAV now known or later discovered. See, e.g., BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). Several relatively new AAV serotypes and clades have been identified (see, e.g., Gao et al., (2004) J. Virology 78:6381-6388; Morris et al., (2004) Virology 33-:375- 383); and also Table 1 in U.S. Provisional Application No. 62,937,556, filed November 19, 2019, each of which is incorporated herein in its entirety, and Table 1 in International Applications WO2020 / 102645 and WO2020 / 102667.
[0349] The genome sequences of various serotypes of AAV and autonomous parvoviruses, as well as the sequences of native inverted terminal repeats (ITRs), Rep proteins and capsid subunits, are known in the art.Such sequences can be found in literature or in public databases such as GenBank.For example, GenBank accession numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC_001701, NC_001510, NC_006152, NC_006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275 , J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, NC_001358, NC_001540, AF513851, AF513852, AY530579; the disclosures of which are incorporated by reference herein for their teaching of nucleic acid and amino acid sequences of parvoviruses and AAV.For example, Srivistava et al., (1983) J Virology 45:555;Chiarini et al., (1998) J. Virology 71:6823;Chiarini et al., (1999) J. Virology 73:1309;Bantel-Schaal et al., (1999) J. Virology 73:939;Xiao et al., (1999) J. Virology 73:3994;Muramatsu et al., (1996) Virology 221:208;Shade et al., (1986) J. Viral. 58:921;Gao et al., (2002) Proc. Nat. Acad. Sci. USA 99:11854;Morris et al., (2004) Virology 33-:375-383; International Patent Publications WO00 / 28061, WO99 / 61601, WO98 / 11244; and U.S. Patent No. 6,156,303, the disclosures of which are incorporated herein by reference for teaching the nucleic acid and amino acid sequences of parvoviruses and AAV. See also Tables 1 and 5 disclosed in International Patent Publication No. 62,937,556, filed November 19, 2019, or Table 1 disclosed in International Applications WO2020 / 102645 and WO2020 / 102667, each of which is incorporated herein in its entirety. The capsid structure of autonomous parvoviruses and AAV is described in more detail in Bernard N. Fields et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).See also the descriptions of the crystal structures of AAV2 (Xie et al., (2002) Proc. Nat. Acad. Sci. 99:10405-10), AAV4 (Padron et al., (2005) J. Viral. 79: 5047-58), AAV5 (Walters et al., (2004) J. Viral. 78: 3361-71), and CPV (Xie et al., (1996) J. Mal. Biol. 6:497-520 and Tsao et al., (1991) Science 251: 1456-64).
[0350] The term "tropism," as used herein, refers to the preferential entry of a virus into certain cells or tissues, and optionally, the subsequent expression (e.g., transcription, and optionally, translation) of sequences carried by the viral genome in the cell, e.g., for recombinant viruses, expression of a heterologous nucleic acid of interest.
[0351] As used herein, "systemic tropism" and "systemic transduction" (and equivalent terms) indicate that the viral capsids or viral vectors of the invention exhibit tropism for and / or transduce tissues throughout the body (e.g., brain, lung, skeletal muscle, heart, liver, kidney and / or pancreas).
[0352] As used herein, "selective tropism" or "specific tropism" refers to the delivery of a viral vector to, and / or the specific transduction of, a particular target cell and / or a particular tissue.
[0353] Unless otherwise indicated, "efficient transduction" or "efficient tropism," or similar terms, can be determined by reference to a suitable control (e.g., at least about 50%, 60%, 70%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 500%, or more of the transduction or tropism, respectively, of the control). In certain embodiments, the viral vector efficiently transduces or has efficient tropism for liver cells and muscle cells. Suitable controls will depend on a variety of factors, including the desired tropism and / or transduction profile.
[0354] Similarly, whether a virus "does not efficiently transduce" or "does not have efficient tropism" for a target tissue, or similar terms, can be determined by reference to a suitable control. In certain embodiments, the viral vector does not efficiently transduce (i.e., does not have efficient tropism for) kidney, gonadal, and / or germ cells. In certain embodiments, transduction (e.g., undesired transduction) of a tissue (e.g., kidney) is 20% or less, 10% or less, 5% or less, 1% or less, 0.1% or less of the level of transduction of a desired target tissue (e.g., liver, skeletal muscle, diaphragm muscle, cardiac muscle, and / or cells of the central nervous system).
[0355] As used herein, the term "polypeptide" encompasses both peptides and proteins, unless otherwise indicated.
[0356] A "polynucleotide" is a sequence of nucleotide bases, which may be RNA, DNA, or a DNA-RNA hybrid sequence (containing both naturally occurring and non-naturally occurring nucleotides), but in representative embodiments is either a single-stranded or double-stranded DNA sequence.
[0357] The terms "heterologous nucleotide sequence" and "heterologous nucleic acid molecule" are used interchangeably herein to refer to a nucleic acid sequence that does not naturally occur in a virus. Generally, a heterologous nucleic acid molecule or heterologous nucleotide sequence comprises an open reading frame encoding a polypeptide and / or untranslated RNA of interest (e.g., for delivery to a cell and / or subject).
[0358] A "chimeric nucleic acid" comprises two or more nucleic acid sequences covalently linked together to encode a fusion polypeptide. The nucleic acid can be DNA, RNA, or a hybrid thereof.
[0359] The term "fusion polypeptide" comprises two or more polypeptides covalently linked together, typically by peptide bonds.
[0360] As used herein, an "isolated" polynucleotide (e.g., "isolated DNA" or "isolated RNA") means a polynucleotide that is at least partially separated from other components of a naturally occurring organism or virus, e.g., at least a portion of a cellular or viral structural component, or other polypeptide or nucleic acid, with which the polynucleotide is typically found in association. In representative embodiments, the "isolated" nucleotide is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold, or more, compared to the starting material.
[0361] Similarly, an "isolated" polypeptide refers to a polypeptide that is at least partially separated from other components of a naturally occurring organism or virus, e.g., cellular or viral structural components, or at least a portion of other polypeptides or nucleic acids, with which the polypeptide is typically found in association. In representative embodiments, an "isolated" polypeptide is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold, or more, compared to the starting material.
[0362] An "isolated cell" refers to a cell that has been separated from other components that are normally associated with it in its natural state. For example, an isolated cell can be a cell in culture medium and / or a cell in a pharmaceutically acceptable carrier of the present invention. As such, the isolated cell can be delivered and / or introduced into a subject. In some embodiments, the isolated cell can be a cell that has been removed from a subject, manipulated ex vivo as described herein, and then returned to the subject.
[0363] The population of virions can be generated by any of the methods described herein. In one embodiment, the population comprises at least 10 1 In one embodiment, the population is at least 10 2 virions, at least 10 3 virions, at least 10 4 virions, at least 10 5 virions, at least 10 6 virions, at least 10 7 virions, at least 10 8 virions, at least 10 9 virions, at least 10 10 virions, at least 10 11 virions, at least 10 12 virions, at least 10 13 virions, at least 10 14 virions, at least 10 15 virions, at least 10 16 virions, or at least 10 17 A population of virions can be heterogeneous or homogeneous (e.g., substantially homogeneous or completely homogeneous).
[0364] A "substantially homogeneous population," as the term is used herein, refers to a population of nearly identical virions with few to no contaminating virions (non-identical) therein. A substantially homogeneous population is at least 90% identical virions (e.g., desired virions), and can be at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% identical virions.
[0365] A population of virions that is completely homogeneous contains only identical virions.
[0366] As used herein, "isolating" or "purifying" (or grammatical equivalents) a viral vector or viral particle or population of viral particles means that the viral vector or viral particle or population of viral particles is at least partially separated from at least some of the other components in the starting material. In representative embodiments, the "isolated" or "purified" viral vector or viral particle or population of viral particles is at least about 10-fold, 100-fold, 1000-fold, 10,000-fold, or more concentrated compared to the starting material.
[0367] Unless otherwise indicated, "efficient transduction" or "efficient tropism," or similar terms, can be determined by reference to a suitable control (e.g., at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 500%, or more of the transduction or tropism of the control, respectively). In certain embodiments, the viral vector efficiently transduces or has efficient tropism for neurons and cardiomyocytes. A suitable control will depend on a variety of factors, including the desired tropism and / or transduction profile.
[0368] A "therapeutic polypeptide" is a polypeptide that is capable of alleviating, reducing, preventing, delaying, and / or stabilizing symptoms resulting from the absence or deficiency of a protein in a cell or subject, and / or that otherwise confers a benefit to the subject, e.g., enzyme replacement to reduce or eliminate symptoms of a disease, or improved viability of a graft, or induction of an immune response.
[0369] The terms "heterologous nucleotide sequence" and "heterologous nucleic acid molecule" are used interchangeably herein to refer to a nucleic acid sequence that does not naturally occur in a virus. Generally, a heterologous nucleic acid molecule or heterologous nucleotide sequence comprises an open reading frame encoding a polypeptide and / or non-translated RNA of interest (e.g., for delivery to a cell and / or subject), such as a GAA polypeptide.
[0370] As used herein, the terms "viral vector," "vector," or "gene delivery vector" refer to a viral (e.g., AAV) particle that functions as a nucleic acid delivery vehicle and contains a vector genome (e.g., viral DNA [vDNA]) packaged within the virion. Alternatively, in some contexts, the term "vector" may be used to refer to the vector genome / vDNA alone.
[0371] A "rAAV vector genome" or "rAAV genome" is an AAV genome (i.e., vDNA) containing one or more heterologous nucleic acid sequences. rAAV vectors generally require only inverted terminal repeats (TRs) in cis to generate virus. All other viral sequences can be dispensed with and supplied in trans (Muzyczka, (1992) Curr. Topics Microbial. Immunol. 158:97). Typically, rAAV vector genomes retain only one or more TR sequences to maximize the size of the transgene that can be efficiently packaged by the vector. Coding sequences for structural and nonstructural proteins can be provided in trans (e.g., from a vector such as a plasmid or by stable integration of sequences into packaging cells). In embodiments of the invention, the rAAV vector genome comprises at least one ITR sequence (e.g., an AAV TR sequence), and optionally two ITRs (e.g., two AAV TRs), which are typically located at the 5' and 3' ends of the vector genome and flank, but do not have to be contiguous with, the heterologous nucleic acid. The TRs may be the same as or different from one another.
[0372] The term "terminal repeat sequence" or "TR" includes any viral or synthetic terminal repeat sequence that forms a hairpin structure and functions as an inverted terminal repeat sequence (i.e., an ITR that mediates a desired function, such as replication, viral packaging, integration, and / or proviral rescue). A TR can be an AAV TR or a non-AAV TR. For example, non-AAV TR sequences, such as those of other parvoviruses (e.g., canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19), or any other suitable viral sequence (e.g., an SV40 hairpin that serves as an SV40 origin of replication), can be used as a TR, which can be further modified by truncation, substitution, deletion, insertion, and / or addition. Furthermore, a TR can be partially or completely synthetic, such as the "double D sequence" described in U.S. Pat. No. 5,478,745 to Samulski et al.
[0373] "AAV terminal repeats" or "AAV TRs," including "AAV inverted terminal repeats" or "AAV ITRs," can be derived from any AAV, including, but not limited to, serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, or any other AAV now known or later discovered. AAV terminal repeats need not have native terminal repeat sequences (e.g., the native AAV TR or AAV ITR sequences may be altered by insertions, deletions, truncations, and / or missense mutations), so long as the terminal repeats mediate the desired function, such as replication, viral packaging, integration, and / or proviral rescue.
[0374] The AAV proteins VP1, VP2, and VP3 are capsid proteins that interact together to form the icosahedral symmetric AAV capsid. VP1.5 is an AAV capsid protein described in U.S. Publication No. 2014 / 0037585.
[0375] The viral vectors of the present invention may further be "targeted" viral vectors (e.g., having a directed tropism) and / or "hybrid" parvoviruses (i.e., in which the viral TR and viral capsid are derived from different parvoviruses) as described in International Patent Publication WO 00 / 28004 and Chao et al., (2000) Molecular Therapy 2:619.
[0376] The viral vectors of the present invention may further be double-stranded parvovirus particles as described in International Patent Publication WO 01 / 92551, the disclosure of which is incorporated herein by reference in its entirety. Thus, in some embodiments, a double-stranded (duplex) genome may be packaged into a viral capsid of the present invention.
[0377] Recombinant AAV vectors expressing human GAA can be produced by a triple transfection method using closed-ended linear double-stranded DNA molecules lacking bacterial backbone sequences, for example, as described in PCT / US2021 / 013689, published as WO / 2021 / 146591, which is incorporated by reference herein in its entirety.
[0378] In some embodiments of the invention, an rAAV comprising SEQ ID NO:606 encoding hGAA (set forth in SEQ ID NO:600) is produced using plasmid DNA as a starting material. In some embodiments of the invention, an rAAV comprising SEQ ID NO:606 encoding hGAA (set forth in SEQ ID NO:600) is produced using closed-ended linear double-stranded DNA as a starting material.
[0379] In addition, the viral capsid or genomic elements may contain other modifications, including insertions, deletions and / or substitutions.
[0380] As used herein, a "chimeric" capsid protein refers to an AAV capsid protein (e.g., any one or more of VP1, VP2, or VP3) that has been modified by the substitution of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residues in the amino acid sequence of the capsid protein relative to the wild-type, as well as the insertion and / or deletion of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) amino acid residues in the amino acid sequence relative to the wild-type. In some embodiments, complete or partial domains, functional regions, epitopes, etc. from one AAV serotype can be replaced with corresponding wild-type domains, functional regions, epitopes, etc. from a different AAV serotype, in any combination, to generate a chimeric capsid protein of the invention. The production of chimeric capsid proteins can be carried out according to protocols well known in the art, and a significant number of chimeric capsid proteins that can be included in the capsids of the invention have been described in the literature and herein.
[0381] As used herein, the term "haploid AAV" refers to the AAVs described in International Application WO2018 / 170310 or U.S. Application US2018 / 037149, the entire contents of which are incorporated herein by reference. In some embodiments, the population of virions is a haploid AAV population from which virion particles can be assembled, wherein at least one viral protein from the group consisting of AAV capsid proteins VP1, VP2, and VP3 is different from at least one of the other viral proteins and is necessary to form virion particles capable of encapsulating the AAV genome. For each viral protein present (VP1, VP2, and / or VP3), the protein is of the same type (e.g., all AAV2 VP1). In one example, at least one of the viral proteins is a chimeric viral protein, and at least one of the other two viral proteins is not chimeric. In one embodiment, VP1 and VP2 are chimeric, and only VP3 is not chimeric. For example, only viral particles composed of VP1 / VP2 derived from chimeric AAV2 / 8 (N-terminus of AAV2 and C-terminus of AAV8) paired with VP3 derived from AAV2, or only chimeric VP1 / VP2 28m-2P3 (N-terminus of AAV8 without mutation of VP3 start codon and C-terminus of AAV2) paired with VP3 derived from AAV2. In another embodiment, only VP3 is chimeric, and VP1 and VP2 are not chimeric. In another embodiment, at least one viral protein is derived from a completely different serotype. For example, only chimeric VP1 / VP2 28m-2P3 paired with VP3 derived from AAV3. In another example, no chimera exists.
[0382] The term "hybrid" AAV vector or parvovirus refers to an rAAV vector in which the viral TR or ITR and viral capsid are derived from different parvoviruses.Hybrid vectors are described in International Patent Publication WO00 / 28004 and Chao et al., (2000) Molecular Therapy 2:619.For example, hybrid AAV vectors typically contain sufficient adenovirus 5' and 3' cis-ITR sequences (i.e., adenovirus long terminal repeat and PAC sequences) for adenovirus replication and packaging.
[0383] The term "polyploid AAV" refers to an AAV vector that is composed of capsids from two or more AAV serotypes and can take advantage of individual serotypes, e.g., for higher transduction, while in certain embodiments eliminating parental tropism.
[0384] The term "GAA" or "GAA polypeptide," as used herein, refers to mature (about 76 or about 67 kDa) and precursor (e.g., about 110 kDa) GAA, as well as modified (e.g., truncated or mutated by insertion, deletion, and / or substitution) GAA proteins or fragments thereof that retain biological function (i.e., have at least one biological activity of the native GAA protein, e.g., be able to hydrolyze glycogen, as defined above), and GAA variants (e.g., GAA II described by Kunita et al., (1997) Biochemica et Biophysica Acta 1362:269; GAA polymorphisms and SNPs are described in Hirschhorn, R. and Reuser, AJ (2001) in The Metabolic and Molecular Basis for Inherited Disease (Scriver, CR, Beaudet. AL, Sly, WS & Valle, D. Eds.), pp. 3389-3419, McGraw-Hill, New York (see pages 3403-3405); each of which is incorporated herein by reference in its entirety. Any GAA coding sequence known in the art may be used, see, e.g., the coding sequence of Figures 8 and 9; GenBank Accession No. NM_00152, and Hoefsloot et al., (1988) EMBO J. 7:1697 and Van Hove et al., (1996) Proc. Natl. Acad. Sci. USA 93:65 (human), GenBank Accession No. NM_008064 (mouse), and Kunita et al., (1997) Biochemica et Biophysics Acta 1362:269 (quail); the disclosures of which are incorporated herein by reference for their teaching of coding and non-coding sequences of GAA.The terms "GAA" or "hGAA" or "rhGAA" are used interchangeably to refer to a nucleic acid encoding human GAA or a human GAA polypeptide.
[0385] The term "targeting peptide", also referred to as "targeting sequence", as used herein, is intended to refer to a peptide that targets a specific intracellular compartment, for example, mammalian lysosomes. The targeting peptides encompassed for use herein are mannose-6-phosphate-independent lysosome-targeting peptides. An exemplary targeting sequence is the IGF2 targeting peptide disclosed herein.
[0386] The term "signal sequence" is used interchangeably herein with the terms "secretory signal sequence" or "leader sequence" or "signal peptide," or variations thereof, and is intended to refer to an amino acid sequence (as defined above) that functions to enhance secretion of an operably linked polypeptide (e.g., a GAA peptide) from a cell compared to the level of secretion seen with the native polypeptide. As defined above, "enhanced" secretion means that the relative proportion of a GAA polypeptide synthesized by a cell that is secreted from the cell is increased; it is not necessary that the absolute amount of secreted protein is also increased. In certain embodiments of the invention, essentially all (i.e., at least 95%, 97%, 98%, 99%, or more) of the GAA polypeptide is secreted. However, it is not necessary that essentially all or even a majority of the GAA polypeptide be secreted, as long as the level of secretion is enhanced compared to the native GAA polypeptide. Exemplary leader sequences include, but are not limited to, the native GAA leader sequence (also referred to as the cognate GAA leader sequence or endogenous GAA signal sequence), the AAT sequence, IL2(1-3), the IL2 leader sequence (IL2 wt), the modified IL2 leader sequence (IL2 mut), fibronectin (FN1; also referred to as FBN) or IgG leader sequence, or functional variants thereof, as disclosed herein.
[0387] As used herein, the term "amino acid" encompasses any naturally occurring amino acid, modified forms thereof, and synthetic amino acids. Naturally occurring levorotatory (L-) amino acids are disclosed in Table 2 of U.S. Publication No. 2018 / 0371496, the entire contents of which are incorporated herein. Alternatively, the amino acid may be a modified amino acid residue (non-limiting examples are shown in Table 4 of U.S. Publication No. 2018 / 0371496) and / or an amino acid modified by post-translational modification (e.g., acetylation, amidation, formylation, hydroxylation, methylation, phosphorylation, or sulfation). Furthermore, non-naturally occurring amino acids may be "unnatural" amino acids as described by Wang et al., Annu Rev Biophys Biomol Struct. 35:225-49 (2006). These unnatural amino acids can be advantageously used to chemically link a molecule of interest to an AAV capsid protein.
[0388] To further illustrate, for example, when the specification indicates that a particular amino acid can be selected from A, G, I, L, and / or V, this term also indicates that the amino acid can be selected from any subset of these amino acids, e.g., A, G, I, or L; A, G, I, or V; A or G; L only; etc., as if each such subcombination were expressly set forth herein. Such terms also indicate that one or more of the specified amino acids can be surrendered (e.g., by a negative proviso). For example, in certain embodiments, an amino acid is not A, G, or I; is not A; is not G or V; etc., as if each such possible surrender were expressly set forth herein.
[0389] As used herein, the term "promoter" generally refers to a region of DNA located upstream of the nucleic acid sequence to be transcribed, which is necessary for transcription to occur, i.e., initiates transcription. Promoters allow the appropriate activation or repression of the transcription of the coding sequence under their control. Promoters typically contain specific sequences that are recognized and bound by multiple TFs. TFs bind to the promoter sequence, resulting in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of a gene. A large number of promoters are known in the art.
[0390] The term "synthetic promoter," as used herein, refers to a promoter that does not occur in nature. Portions of a synthetic promoter may occur in nature (e.g., a minimal promoter), but a synthetic promoter as a complete entity does not occur in nature.
[0391] As used herein, a "minimal promoter" (also known as a "core promoter") refers to a short DNA segment that is inactive or largely inactive by itself but can mediate transcription when combined with other transcriptional regulatory elements. Minimal promoter sequences can be derived from a variety of different sources, including prokaryotic and eukaryotic genes. Examples of minimal promoters are discussed above and include the dopamine beta-hydroxylase gene minimal promoter, the cytomegalovirus (CMV) immediate-early gene minimal promoter (CMV-MP), and the herpes thymidine kinase minimal promoter (MinTK). Minimal promoters typically contain a transcription start site (TSS) and immediately upstream elements, a binding site for RNA polymerase II, and general transcription factor binding sites (often a TATA box).
[0392] As used herein, "proximal promoter" refers to a minimal promoter plus the adjacent sequence upstream of the gene that tends to contain the primary regulatory element. This often extends approximately 250 base pairs upstream of the TSS and includes specific TFBS. The proximal promoter may be a naturally occurring liver-specific proximal promoter. However, the proximal promoter may also be synthetic.
[0393] A "functional variant" of a promoter or other nucleic acid sequence in the context of the present invention is a variant of the reference sequence that retains the ability to function in the same manner as the reference sequence, for example, a liver-specific promoter. Alternative terms for such functional variants include "biological equivalents" or "equivalents."
[0394] The term "liver-specific" or "liver-specific expression," when referring to a promoter, refers to the ability of the promoter to enhance or drive expression of a gene in the liver (or in liver-derived cells) in a preferential or predominant manner compared to other tissues (e.g., spleen, muscle, heart, lung, and brain). The expression of the gene can be in the form of mRNA or protein. In some embodiments, liver-specific expression is such that there is negligible expression in other (i.e., non-liver) tissues or cells, i.e., expression is highly liver-specific. In some embodiments, a liver-specific promoter drives expression preferentially in the liver, but can also drive expression of a gene at a lower level in another tissue of interest, such as muscle.
[0395] Therefore, those skilled in the art can easily determine whether any variant of the liver-specific promoters listed above remains functional (i.e., it is a functional variant as defined above). For example, any given promoter to be evaluated can be operably linked to a minimal promoter (e.g., located upstream of CMV-MP), and the promoter's ability to drive liver-specific expression of a gene (typically a reporter gene) is measured. Similarly, the ability of a promoter to drive liver-specific expression can be easily evaluated by those skilled in the art (e.g., as described in the Examples below). The expression level of a gene driven by a variant of a reference promoter can be compared with the expression level driven by a reference sequence. In some embodiments, if the liver-specific expression level driven by the variant promoter is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% of the expression level driven by the reference promoter, it can be said that the variant remains functional. Suitable nucleic acid constructs and reporter assays for evaluating enhanced liver-specific expression can be easily constructed, and the examples shown below provide suitable methodologies.
[0396] Liver specificity can be identified, where the expression of a gene (e.g., a therapeutic gene or a reporter gene) occurs preferentially or predominantly in liver-derived cells. Preferential or predominant expression can be defined, for example, when the expression level is significantly higher in liver-derived cells than in other types of cells (i.e., non-liver-derived cells). For example, the expression in liver-derived cells is preferably at least 5 times higher than in non-liver cells, preferably at least 10 times higher than in non-liver cells, and in some cases, may be 50 times or higher. Conveniently, liver-specific expression can be demonstrated by comparing the expression level in liver cell lines (e.g., liver-derived cell lines such as Huh7 and / or HepG2 cells) or primary liver cells with the expression level in kidney-derived cell lines (e.g., HEK-293), cervical tissue-derived cell lines (e.g., HeLa) and / or lung-derived cell lines (e.g., A549).
[0397] The synthetic liver-specific promoters of the present invention are preferably suitable for promoting expression in the liver of a subject, for example for driving liver-specific expression of a transgene, preferably a therapeutic transgene.
[0398] Preferred synthetic liver-specific promoters of the present invention are suitable for driving expression of liver-specific transgenes and have activity in liver cells that is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TBG promoter (see, for example, SEQ ID NO: 435 disclosed in International Application WO2021102107).
[0399] The synthetic liver-specific promoters of the present invention are suitable for promoting liver-specific expression at levels that are preferably at least 1.5-fold higher in liver-derived cells than the CMV-IE promoter (see, e.g., SEQ ID NO: 433 disclosed in International Application WO2021102107), and preferably at least 2-fold higher than the CMV promoter in liver-derived cells (e.g., HEK-293, HeLa and / or A549 cells).
[0400] Terms such as "identity" and "identical" refer to the sequence similarity between two polymer molecules, for example, two nucleic acid molecules, such as two DNA molecules. Sequence alignment and sequence identity determination can be performed, for example, using the Basic Local Alignment Search Tool (BLAST), originally described by Altschul et al. 1990 (J Mol Biol 215: 403-10), for example, the "Blast2 sequence" algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247-250).
[0401] The term "synthetic," as used herein, refers to a nucleic acid molecule that does not exist in nature. Synthetic nucleic acid expression constructs of the present invention are produced artificially, typically by recombinant technology. Such synthetic nucleic acids may contain naturally occurring sequences (e.g., promoters, enhancers, introns, and other such regulatory sequences), but these are present in a context that does not occur in nature. For example, a synthetic gene (or portion of a gene) typically contains one or more nucleic acid sequences that are not naturally contiguous (chimeric sequences) and / or may include substitutions, insertions, and deletions, as well as combinations thereof.
[0402] "Spacer sequence" or "spacer" as used herein refers to a nucleic acid sequence that separates two functional nucleic acid sequences. It can have essentially any sequence, provided that it does not prevent the functional nucleic acid sequence (e.g., cis-regulatory element) from functioning as desired (for example, this may occur when it contains a silencer sequence, preventing the binding of desired transcription factors). Typically, it is non-functional, since it only exists to separate adjacent functional nucleic acid sequences from each other.
[0403] The term "pharmaceutically acceptable," as used herein, is consistent with the art and means compatible with the other ingredients of a pharmaceutical composition and not deleterious to the recipient thereof.
[0404] The terms "treat," "treating," or "treatment of" (and grammatical variations thereof) mean reducing the severity of, at least partially improving, or stabilizing the subject's condition, and / or achieving some relief, alleviation, reduction, or stabilization of at least one clinical symptom, and / or there is a delay in the progression of the disease or disorder.
[0405] The terms "prevent," "preventing," and "prevention" (and grammatical variations thereof) refer to preventing and / or delaying the onset of, and / or reducing the severity of, the onset of a disease, disorder, and / or clinical symptom in a subject compared to that which would occur in the absence of the methods of the present invention. Prevention can be complete, e.g., the complete absence of a disease, disorder, and / or clinical symptom. Prevention can also be partial, such that the severity of the appearance and / or onset of a disease, disorder, and / or clinical symptom in a subject is substantially less than that which would occur in the absence of the present invention.
[0406] " Therapeutic effective amount " as used herein is an amount sufficient to provide some improvement or benefit to the subject.In other words, " therapeutic effective amount " is an amount that provides some relief, alleviation, reduction or stabilization of at least one clinical symptom in the subject.Those skilled in the art will recognize that the therapeutic effect does not need to be complete or curative, as long as some benefit is provided to the subject.
[0407] A "prophylactically effective" amount, as used herein, is an amount sufficient to prevent and / or delay the onset of a disease, disorder, and / or clinical symptoms in a subject, and / or reduce the severity of and / or delay the onset of a disease, disorder, and / or clinical symptoms in a subject, compared to that which would occur in the absence of the method of the present invention. One of skill in the art will recognize that the level of prevention need not be complete, as long as some preventative benefit is provided to the subject.
[0408] The phrase "therapeutically effective amount" and similar phrases refer to a dose or plasma concentration in a subject that provides the desired specific pharmacological effect, for example, expressing a therapeutic gene in the liver and secreting it into plasma.Even if such a dosage is considered to be a therapeutically effective amount by those skilled in the art, it is emphasized that a therapeutically effective amount may not always be effective for treating the conditions described herein.The therapeutically effective amount can vary based on the route and dosage form of administration, the age and weight of the subject, and / or the disease or condition being treated.
[0409] The terms "individual," "subject," and "patient" are used interchangeably and refer to any individual subject having a disease or condition requiring treatment. For purposes of this disclosure, a subject may be a primate, preferably a human, or another mammal, such as a dog, cat, horse, pig, goat, or cow.
[0410] Additional patents incorporated by reference herein that relate to, disclose, or describe AAV or certain aspects of AAV, including DNA vectors containing a gene of interest to be expressed, are U.S. Patent Nos. 6,491,907; 7,229,823; 7,790,154; 7,201898; 7,071,172; 7,892,809; 7,867,484; 8,889,641; 9,169,494; 9,169,492; 9,441,206; 9,409,953; and 9,447,433; 9,592,247; and 9,737,618.
[0411] The invention may be as defined in any one of the following numbered paragraphs: 1. A method of treating Pompe disease in a subject, comprising administering to a subject a therapeutically effective amount of 4.0E 12 A method comprising administering to a subject being treated for Pompe disease with long-term GAA enzyme replacement therapy (ERT) a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector whose genome comprises a heterologous nucleic acid sequence encoding a polypeptide comprising an expressible form of an alpha-glucosidase (GAA) polypeptide, at a dosage of 0.05 mg / kg or less, wherein the heterologous nucleic acid is operably linked to a liver-specific promoter, and wherein administration of the long-term GAA enzyme replacement therapy (ERT) is discontinued by at least 26 weeks after administration of the recombinant AAV, and the subject obtains a serum level of GAA expressed by the AAV with pharmacological activity that is at least 165 nmol / ml / hour within at least 2 weeks of administration. 2. The method according to i...
Claims
1. 1. A pharmaceutical composition for treating Pompe disease in a subject, the pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding a polypeptide comprising an expressible form of an alpha-glucosidase (GAA) polypeptide, the pharmaceutical composition being administered to a subject being treated for Pompe disease with long-term GAA enzyme replacement therapy (ERT) at a dosage of the AAV vector of 4.0E12 vg / kg or less, the heterologous nucleic acid being operably linked to a liver-specific promoter, the administration of long-term GAA enzyme replacement therapy (ERT) being discontinued by at least 26 weeks after administration of the recombinant AAV, and the subject obtaining a serum level of GAA expressed by the AAV with a pharmacological activity of at least 165 nmol / ml / hr within at least 2 weeks of administration.
2. 2. The pharmaceutical composition of claim 1, wherein the Pompe disease is late-onset Pompe disease (LOPD) or infantile-onset Pompe disease (IOPD).
3. 10. The pharmaceutical composition of claim 1, wherein the subject has previously received long-term administration of ERT for Pompe disease.
4. 4. The pharmaceutical composition of claim 3, wherein the administration of ERT in the subject is discontinued simultaneously with or before the administration of the AAV vector.
5. 5. The pharmaceutical composition of claim 4, wherein the administration of ERT is stopped on the same day (d1) as or at least the day before the administration of the AAV vector.
6. 4. The pharmaceutical composition of claim 3, wherein the administration of ERT is discontinued after the administration of the AAV vector.
7. 7. The pharmaceutical composition of claim 6, wherein the administration of ERT is discontinued during a period from about day 0 after the administration of the AAV vector to about 26 weeks after the administration.
8. 7. The pharmaceutical composition of claim 6, wherein the administration of ERT is discontinued about 24 weeks or about 26 weeks after the administration of the AAV vector.
9. 9. The pharmaceutical composition of any one of claims 1, 2, 4 to 8, wherein complementary ERT is administered after an extended period of time following the administration of the AAV vector and further following the cessation of the administration of the long-term ERT.
10. 10. The pharmaceutical composition of claim 9, wherein the extended period is about 25 weeks, about 97 weeks, or about 107 weeks after the administration of the AAV vector.
11. 10. The pharmaceutical composition of claim 9, wherein the extended period is at least one year after the administration of the AAV vector.
12. 10. The pharmaceutical composition of claim 9, wherein the extended period is between 12 and 18 months after the administration of the AAV vector.
13. 10. The pharmaceutical composition of claim 9, wherein the extended period is at least six months after the administration of the AAV vector.
14. 10. The pharmaceutical composition of claim 9, wherein the complementary ERT is administered less frequently and / or in a lower dosage than the administration of the long-term ERT.
15. 15. The pharmaceutical composition of claim 14, wherein the complementary ERT is administered at regular intervals.
16. 16. The pharmaceutical composition of claim 15, wherein the complementary ERT is suspended for an extended period of at least 10 weeks.
17. The pharmaceutical composition of claim 14, wherein the complementary ERT administration is sporadic.
18. 10. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition comprises a dose of rAAV between 1.6E12 vg / kg and 3.2E12 vg / kg.
19. 2. The pharmaceutical composition of claim 1, wherein the dose of rAAV is sufficient to express GAA and achieve clinical stability in the subject in one or more symptoms of Pompe disease, wherein clinical stability is selected from the group consisting of: a) no more than a 15% decrease in forced vital capacity (FVC) over two consecutive assessments measured more than three months apart; b) no more than a 12% decrease in 6MWT over two consecutive assessments measured more than three months apart; and c) no more than a 43% decrease in 6MWT over two consecutive assessments measured more than three months apart.
20. 10. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition comprises a dose of rAAV sufficient to achieve serum levels of hGAA expressed by the rAAV in a pharmacologically active range of at least about 165 to ≦2,260 nmol / ml / hr.
21. 2. The pharmaceutical composition of claim 1, wherein the heterologous nucleic acid sequence encoding the GAA polypeptide further comprises a nucleic acid encoding a secretory signal peptide located 5' to the nucleic acid encoding the GAA polypeptide.
22. 22. The pharmaceutical composition of claim 21, wherein the signal sequence is an endogenous GAA signal sequence fused to the 5' end of the nucleic acid encoding the GAA polypeptide.
23. 22. The pharmaceutical composition of claim 21, wherein the signal sequence is a heterologous signal sequence fused to the 5' end of the nucleic acid encoding the GAA polypeptide.
24. 24. The pharmaceutical composition of claim 23, wherein the heterologous signal sequence is selected from the group consisting of fibronectin (FN1), IL2WT, 201IgG, IL2mut, AAT, preprocathepsin L, and pre-pro-alpha type 2 collagen.
25. 9. The pharmaceutical composition of any one of claims 1, 2, 4-8, wherein the nucleic acid sequence encodes a wild-type or modified GAA polypeptide.
26. 9. The pharmaceutical composition of any one of claims 1, 2, 4 to 8, wherein the nucleic acid sequence encoding the GAA polypeptide is a human GAA gene or a human codon-optimized GAA gene (coGAA) or a modified GAA nucleic acid sequence.
27. 9. The pharmaceutical composition of any one of claims 1, 2, 4-8, wherein the nucleic acid sequence encoding the GAA polypeptide encodes a GAA polypeptide containing at least one, at least two, at least three, or at least all four amino acid modifications selected from H201L, H199R, R223H, V780I, or V780R of SEQ ID NO:
10.
28. 9. The pharmaceutical composition of any one of claims 1, 2, 4-8, wherein the heterologous nucleic acid sequence encodes a GAA polypeptide having the amino acid sequence of SEQ ID NO:600, or a functional variant or functional fragment thereof having at least 90%, 95%, or 99% of the activity of SEQ ID NO:
600.
29. 9. The pharmaceutical composition of any one of claims 1, 2, 4-8, wherein the heterologous nucleic acid sequence encoding a GAA polypeptide is located between a 5' ITR sequence and a 3' ITR sequence.
30. 9. The pharmaceutical composition of any one of claims 1, 2, 4-8, wherein the AAV vector further comprises in its genome at least one poly A sequence located between the 3' end of the nucleic acid encoding the GAA gene and the 5' end of the 3' ITR sequence.
31. 30. The pharmaceutical composition of claim 29, wherein the ITR comprises an insertion, deletion, or substitution.
32. 32. The pharmaceutical composition of claim 31, wherein one or more CpG islands in the ITRs have been removed.
33. The pharmaceutical composition according to any one of claims 1, 2, 4 to 8, wherein the recombinant AAV vector is a chimeric AAV vector, a haploid AAV vector, a hybrid AAV vector or a polyploid AAV vector.
34. The pharmaceutical composition according to any one of claims 1, 2, and 4 to 8, wherein the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or an AAV vector derived from any AAV serotype.
35. 9. The pharmaceutical composition of any one of claims 1, 2, 4 to 8, wherein the recombinant AAV vector is selected from the group consisting of AAV3b, an AAVXL32 vector, an AAVXL32.1 vector, an AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein.
36. 36. The pharmaceutical composition of claim 35, wherein the AAV3b serotype comprises one or more mutations in the capsid protein selected from any of 265D, 549A, Q263Y.
37. 37. The pharmaceutical composition of claim 36, wherein the AAV3b serotype is selected from any of AAV3b265D, AAV3b265D549A, AAV3b549A, or AAV3bQ263Y, or AAV3bSASTG.
38. The pharmaceutical composition of any one of claims 1, 2, 4 to 8, wherein the recombinant AAV vector is of serotype AAV8 or comprises at least one AAV8 capsid protein.
39. A pharmaceutical composition described in any one of claims 1, 2, 4 to 8, characterized in that the pharmaceutical composition is administered in combination with an immunosuppressant, and the immunosuppressant is administered to the subject for a specified period of time.
40. 40. The pharmaceutical composition of claim 39, wherein the subject is administered an immunosuppressant at a first dose for a first period of time, the first period beginning the day before or the day of the administration of the AAV vector.
41. 40. The pharmaceutical composition of claim 39, wherein the subject is administered an immunosuppressant in tapered doses, each tapered dose being administered for a defined period of time following the first period of administration of the immunosuppressant at the first dose.
42. 42. The pharmaceutical composition of claim 41, wherein the subject is administered the immunosuppressant at a first dose for four weeks, followed by one week of each tapering dose.
43. The pharmaceutical composition according to any one of claims 1, 2, 4 to 8, characterized in that the subject is not administered an immunosuppressant drug.
44. 9. The pharmaceutical composition of any one of claims 1, 2, 4-8, wherein the pharmaceutical composition further comprises a pharmaceutically acceptable carrier but lacks GAA ERT.
45. 9. The pharmaceutical composition of any one of claims 1, 2, 4-8, wherein the GAA polypeptide is secreted from the liver of the subject, thereby resulting in uptake of the secreted GAA by skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue, or a combination thereof, which results in reduced lysosomal glycogen storage in the tissue.
46. 46. The pharmaceutical composition of claim 45, wherein the reduction in lysosomal glycogen storage in the tissue results in a reduction in Pompe disease symptoms and / or a clinically stable reduction in lysosomal glycogen storage in the subject.
47. 9. The pharmaceutical composition of any one of claims 1, 2, 4 to 8, wherein the administration is selected from the group consisting of intramuscular, subcutaneous, intraspinal, intracisternal, intrathecal, intravenous, and combinations thereof.
48. The pharmaceutical composition of any one of claims 1, 2, 4 to 8, wherein T cell reactivity against the vector capsid is substantially low.
49. 49. The pharmaceutical composition of claim 48, wherein the T cell reactivity is below a threshold range of >40 to <129 / sfu / million.
50. 1. A pharmaceutical composition for reducing or eliminating the clinical need for GAA enzyme replacement therapy (ERT) in a subject with Pompe disease, the pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding a polypeptide comprising an expressible form of an alpha-glucosidase (GAA) polypeptide, the pharmaceutical composition being administered to the subject at a dosage of the AAV vector of 4.0E12 vg / kg or less, the heterologous nucleic acid being operably linked to a liver-specific promoter, and the subject achieving serum levels of GAA expressed by the AAV in the pharmacologically active range of 165 to ≦2,260 nmol / ml / hr within at least two weeks of administration.
51. 51. The pharmaceutical composition of claim 50, wherein the frequency of administration of the GAA ERT and / or the dosage of the GAA ERT administered is reduced by at least 20% one year after administration of the AAV vector compared to one year prior to said administration.
52. 51. The pharmaceutical composition of claim 50, wherein the level and / or rate of clinical decline in the subject over time upon cessation of ERT is reduced by at least 50%.
53. 53. The pharmaceutical composition of any of claims 50-52, wherein ERT can be discontinued for extended periods without substantial clinical decline.
54. 54. The pharmaceutical composition of claim 53, wherein the extended period is selected from the group consisting of 2 to 3 weeks, 1 to 3 months, 3 to 6 months, 6 to 12 months, 12 months to 1.5 years, and 1 year to 2 years.
55. 53. The pharmaceutical composition of any one of claims 1, 2, 4-8, or 50-52, wherein GAA activity in muscle is increased by at least 2-fold over the level before administration of the AAV vector.
56. 53. The pharmaceutical composition of any one of claims 1, 2, 4-8, or 50-52, wherein GAA activity in muscle is increased by at least 2-fold over levels after the long-term ERT has been discontinued for at least about 24 weeks.
57. 53. The pharmaceutical composition of any one of claims 1, 2, 4-8 or 50-52, wherein there is no substantial increase in serum levels of liver alanine aminotransferase (ALT) enzyme following administration of the AAV vector.
58. 1. A pharmaceutical composition for treating Pompe disease in a subject, the pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome a heterologous nucleic acid sequence encoding a polypeptide comprising an expressible form of an alpha-glucosidase (GAA) polypeptide, the pharmaceutical composition being administered to a subject being treated for Pompe disease with long-term GAA enzyme replacement therapy (ERT) at a dosage of between about 1.6e12 vg / kg and about 1.6e13 vg / kg of the AAV vector, the heterologous nucleic acid being operably linked to a liver-specific promoter, the administration of long-term GAA enzyme replacement therapy (ERT) is discontinued on the same day (d1), the day after, or at least the day before, the administration of the recombinant AAV, and the subject obtains a serum level of GAA expressed by the AAV with a pharmacological activity that is at least 165 nmol / ml / hr within at least two weeks of administration.
59. 59. The pharmaceutical composition of claim 58, wherein the subject is administered methotrexate and prednisone for immune modulation.
60. 60. The pharmaceutical composition of claim 59, wherein methotrexate is administered at a starting dose of 30 mg or less per week.
61. 61. The pharmaceutical composition of claim 60, wherein methotrexate is administered at a starting dose of between about 5 and 30 mg / week.
62. 62. The pharmaceutical composition of claim 61, wherein the methotrexate is administered at a starting dose of between 5 and 7.5 mg / week.