RNA sensors in live cells using ADAR editing for sense-response applications

Abstract

1. A method for expressing a protein in a target cell, comprising binding said target cell with a sensor RNA comprising: (ia) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to a target RNA, the sensor nucleotide sequence comprising a stem-loop sequence comprising one or more editable codons; and / or (ib) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to a 3'UTR of a target RNA, the sensor nucleotide sequence comprising one or more editable codons; and (ii) a second nucleotide sequence encoding a first cleavage domain, and (iii) a third nucleotide sequence encoding an output protein; where the target RNA is present in the target cell.

Description

[Technical field]

[0001] Government Rights

[0002] This invention was made with government support under Contract GRFP awarded by the National Science Foundation and Contract EB027723 awarded by the National Institutes of Health. The Government has certain rights in the invention. CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] Pursuant to 35 U.S.C. § 119(e), this application claims priority to the filing date of U.S. Provisional Patent Application Serial No. 63 / 313,423, filed February 24, 2022, the disclosure of which is incorporated herein by reference.

[0004] Sequence Listing

[0005] The sequence listing is provided in a txt file titled Sequence Listing XML "STAN-1939WO_SEQ_LIST", created on Feb. 24, 2023. The contents of the txt file "Sequence Listing XML" are incorporated herein by reference in their entirety. [Background technology]

[0006] Although single-cell transcriptomics often serves as the de facto way to define cell types and states, targeting cells based on their RNA profiles remains challenging. RNA sense response systems allow, for example, the identification and destruction of harmful cells (e.g., in cancer and autoimmune diseases) or the experimental manipulation of specific cells in complex environments (e.g., in the nervous and immune systems). Available RNA sensing techniques are either limited to miRNAs or require carefully designed functional RNA structures such as ribozymes, guide RNAs, and internal ribosomal entry sites. For the latter, the natural response of cells to double-stranded RNA (dsRNA) represents an additional confounding factor. dsRNA editing by adenosine deaminases acting on RNA (ADARs) allows the editing of specific RNAs. Summary of the Invention [Problem to be solved by the invention]

[0007] Provided herein are methods and kits for utilizing ADAR editing to detect target RNA and express proteins in target cells. [Means for solving the problem]

[0008] overview

[0009] The present disclosure provides a method for expressing a protein in a target cell, the method comprising binding the target cell with a sensor RNA comprising: (ia) a first nucleotide sequence comprising a sensor nucleotide sequence reverse-complementary to a target RNA, wherein the sensor nucleotide sequence comprises a stem-loop sequence comprising one or more editable codons, or (ib) a first nucleotide sequence consisting of a sensor nucleotide sequence reverse-complementary to a 3'UTR of a target RNA, wherein the sensor nucleotide sequence comprises one or more editable codons, (ii) a second nucleotide sequence encoding a first cleavage domain, and (iii) a third nucleotide sequence encoding an output protein; wherein the target RNA is present in the target cell.

[0010] The present disclosure provides a method of detecting a target RNA, the method comprising: (a) combining a biological sample with a sensor RNA comprising: (i) a first nucleotide sequence encoding a marker protein, (ii) a second nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to a 3'UTR of the target RNA, where the sensor nucleotide sequence comprises a stop codon, (iii) a third nucleotide sequence encoding a second cleavage domain, and (iv) a fourth nucleotide sequence encoding an output protein; and (b) assaying for the presence of the output protein in the biological sample.

[0011] The present disclosure also provides a method for detecting a target RNA in a biological sample, the method comprising: (a) combining the biological sample with a sensor RNA comprising: (i) a first nucleotide sequence comprising a stem-loop sequence comprising one or more stop codons, (ii) a second nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to the target RNA, (iii) a third nucleotide sequence encoding a first cleavage domain, and (iv) a fourth nucleotide sequence encoding an output protein; and (b) assaying for the presence of the output protein in the biological sample.

[0012] The present disclosure provides a method for detecting a target RNA in a biological sample, the method comprising: (a) combining the biological sample with a sensor RNA comprising: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to the target RNA, where the sensor nucleotide sequence comprises a start codon; and (ii) a second nucleotide sequence encoding an output protein; and (b) assaying for the presence of the output protein in the biological sample.

[0013] The present disclosure provides a method for detecting a target RNA in a biological sample, the method comprising: (a) combining the biological sample with a sensor RNA comprising: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to the target RNA, where the sensor nucleotide sequence comprises an AUA sequence; and (ii) a second nucleotide sequence encoding an output protein; and (b) assaying for the presence of the output protein in the biological sample.

[0014] Kits for practicing the subject methods are also provided.

[0015] Brief explanation of the figure

[0016] The invention is best understood from the following detailed description when read in conjunction with the accompanying drawings, in which: It is emphasized that, according to common practice, the various features of the drawings are not to scale. Conversely, the dimensions of the various features have been arbitrarily expanded or reduced for clarity. The drawings include the following figures: [Brief description of the drawings]

[0017] [Figure 1-1] Figures 1A-1L. Modular live RNA sensing using ADAR editing. a) RADAR expresses an output protein upon input RNA binding to the sensor sequence, triggering ADAR-mediated editing of the upstream stop codon. [Figure 1-2]b) Sensor 1 detects transfected Trigger (target RNA) 1 but not unmatched Trigger 2 in human cells and is enhanced by ADAR1p150 when assayed by flow cytometry. c) RADAR output is strongly correlated with input amount. d) An alternative output is Cre recombinase; the reporter is turned on by Cre-mediated inversion and lower amounts of reporter result in higher fold activation. [Figure 1-3] e) RADAR detects genomically integrated doxycycline-inducible triggers. f) RADAR detects subsequences within the native 3'UTR. [Figure 1-4] g) RADAR detects endogenous heat shock-inducible genes via 3'UTR sensors or endogenously expressed genes regulated by siRNA knockdown. [Figure 1-5] h) The sensor can be scaled down to 72bp. [Figure 1-6] i) The "split" design allows detection of a smaller core sequence. j) Detection of a trigger sequence within the CDS. [Figure 1-7] k) RADAR covers 85% of the genome. [Figure 1-8] l) RADAR is enriched with an ADAR designed to bind sensor mRNA only via the MS2-MCP interaction. Chimeric ADARs do not promote editing of sensors that do not contain MS2. MS2 can be placed in the 3'UTR of the sensor or in close proximity to the dsRNA-forming sensor region. In all figures, the mean output fluorescence intensity in cells gated at high transfection efficiency is reported (relative within a given experiment) unless otherwise noted. Each point represents one biological replicate and the horizontal line indicates the mean of the data for each group. Significance was determined by two-tailed Student's t-test with Bonferroni correction.

[0018] [Figure 2-1]Figure 2A-2E. Unique features and potential applications of RADAR. a) Cell classifier showing stable performance in triplicates. b) OR logic. c) AND logic. [Figure 2-2] d) RADAR distinguishes between double- and single-nucleotide variants. [Figure 2-3] e) Function of RADAR in plants. Representative plant images.

[0019] [Figure 3-1] Figures 3A-3G. a) Flow cytometry gating overview. [Figure 3-2] b) The ratio of mean output fluorescence between triggered and non-triggered conditions depends on the marker gate chosen. Two-dimensional density plot showing output (EGFP fluorescence, GFP-A) as a function of transfection marker level (mCherry fluorescence, mCherry-A). Grey bands indicate the selected gates, as in subplot a. Traces show the average EGFP fluorescence in small mCherry fluorescence bins. Points show the average of the selected gates. Each replicate is a separate trace, but the 2D histogram combines all replicates. The rightmost column overlays all replicates. Black lines indicate the average across replicates, width indicates gate. Mean values ​​match those shown in main Fig. 1c. [Figure 3-3]c) Enhancer choice affects baseline signal, with SFFV giving the lowest baseline signal (EGFP fluorescence in the absence of trigger). Promoter mutants were combined with the sensor using overlap extension PCR and transfected as linear fragments. d) Confirmation of ADAR editing by Sanger sequencing. e) In ADAR-deficient cells, RADAR is not functional unless ADAR is provided. f) The p150 isoform of ADAR1 was the best ADAR to improve the dynamic range of RADAR output. g) ADAR levels modulate sensor output. Purple numbers indicate fold difference with no ADAR and trigger, pink numbers indicate fold difference with no ADAR and trigger, and black numbers indicate fold activation with trigger.

[0020] [Figure 4-1] Figures 4A-4I. a) Inducible triggers show incomplete repression, as EGFP is detectable even in the absence of inducer. Parental (no EGFP) or inducible EGFP-integrated cells were transfected with an irrelevant sensor (mTagBFP2 transfection marker, mCherry output) and ADAR1-p150, and average EGFP expression was measured. b) Calibration curves for varying amounts of plasmid DNA of the constructs used to generate inducible-EGFP integrated cell lines. In the plots, orange and blue (two replicates) overlap and appear as grey. c) Estimates of the average number of mRNA molecules per cell in inducer-EGFP integrated cells with and without the addition of inducer. [Figure 4-2] d) Trigger sequences located in the CDS perform less well than the exact same sequence located in the 3'UTR. [Figure 4-3] e) The 3' UTR sensor has no significant effect on the expression of the trigger protein (EGFP fluorescence). f) The sensor in the CDS sequence has only a small effect on the expression of the trigger mRNA protein (1.14-fold decrease in EGFP fluorescence). [Figure 4-4]g) Increased benefit of the latest sensor designs on the percentage of genes with at least 1, 6, and 51 sensor candidates compared to only the 90bp 3'UTR sensors. h) Mouse transcriptome analysis with the expanded set of sensor designs. [Figure 4-5] i) Split-triggered RADAR sensors are triggered more strongly when the split is on the same transcript ("1:2") rather than on separate transcripts ("1,2").

[0021] [Diagram 5] FIG. 5 shows an exemplary sensor RNA that contains an editable start codon.

[0022] [Figure 6] FIG. 6 shows an exemplary sensor RNA that contains an editable non-start (AUA) codon.

[0023] [Figure 7] FIG. 7 shows an exemplary sensor RNA that contains a stem-loop with an editable codon.

[0024] [Figure 8] Figure 8. Varying Ψ% (pseudouridine percentage) in sensor IVT mRNA using UAG or UGA stop codons in the sensor. Using 100% Ψ results in a significant decrease in fold activation. Intermediate levels of pseudouridine incorporation are tolerable. Analysis of high transfection marker levels (mCherry, part of sensor mRNA) and trigger positive cells (BFP).

[0025] [Figure 9] Figure 9 Sensor performance as a function of mCherry (sensor) level from the same dataset as in Figure 8 .

[0026] [Figure 10]Figure 10. Mean output fluorescence at high sensor levels for all 64 NNN sequences in the trigger opposite the UAG stop codon of the sensor. "-" indicates the negative control.

[0027] [Figure 11] Figure 11. The data from Figure 10 are presented in various ways, varying which position ("n") is indicated across the rows. The average output fluorescence at high sensor levels is logged for all 64 NNN sequences in the trigger opposite the UAG stop codon of the sensor.

[0028] [Figure 12] Figure 12 Fold expression differences between the two trigger sequences.

[0029] [Figure 13] Figure 13. Proportion of NNN-NNN pairs with on / off ratios above a given threshold. For example, 249 pairs of NNN(on)-NNN(off) triggers can be distinguished with the “on” state being at least 50 times more likely than the “off” state.

[0030] [Figure 14] Figure 14. Proportion of NNN-NNN pairs with on / off ratios above a given threshold that differ by only a single nucleotide. For example, 11 pairs of NNN(on)-NNN(off) triggers have an on / off ratio at least 50-fold higher than the off state and can be distinguished by only one position in the trigger sequence that differs.

[0031] [Figure 15] Figure 15. Mismatches near the 5'CCA 3' sequence of the trigger RNA do not affect the sensor performance. "none" - perfect complementarity; "-" - no input; "-1b" - mismatch immediately after 5' of CCA; "+2b" - mismatch after one base match at 3' of CCA.

[0032] [Figure 16]Figure 16. Examples of ModulADAR mechanisms using the UAG stop codon and alternatives for the UGA and UAA stop codons.

[0033] [Figure 17] FIG. 17 ModulADAR effectively detects mRNA input with a 40-fold increase in mean fluorescence in highly transfected cells.

[0034] [Figure 18] FIG. 18 uORFs function best upon overexpression of ADAR2.

[0035] [Figure 19] Figure 19 uORFs detecting U6-drive RNA and a positive control (AUG in the uORF was mutated to GUG).

[0036] [Figure 20] Fig. 20 Improving uORF performance by removing output stops that are in-frame with uORFs and generating longer uORFs.

[0037] [Figure 21] FIG. 21. Exemplary uORF designs where the input RNA is expressed (becomes mRNA) from a conventional promoter.

[0038] [Figure 22] Figure 22. An example of an AUG radar mechanism

[0039] [Figure 23] Figure 23. AUG RADAR with typical mRNA input.

[0040] [Figure 24] Figure 24 AUA RADAR sensor of U6-expressing RNA overexpressing ADAR2.

[0041] [Diagram 25]Figure 25. ModulADAR with an editable stem-loop enables a two-input OR gate constructed from a single molecule that can separately bind two different inputs.

[0042] [Figure 26] Figure 26. Examples of sensor RNA designs.

[0043] [Figure 27] Figure 27. Examples of ModulADAR stem-loop mutants derived from the native ADAR editing site with modifications including, but not limited to, removing the unedited in-frame stop codon, shortening the stem of the stem-loop, changing the identity of the editable stop codon and the mismatch opposite it. From left to right, top to bottom, SEQ ID NOs: 1-8

[0044] [Figure 28] FIG. 28. Evaluation of example ModulADAR stem-loop mutants derived from the native ADAR editing site.

[0045] [Figure 29] Figure 29. ModulADAR design example for a single molecule OR gate. Definition DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0046] Before describing the exemplary embodiments in more detail, the following definitions are set forth to illustrate and define the meaning and scope of terms used herein.

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED., John Wiley and Sons, New York (1994), and Hale & Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide those skilled in the art with the general meaning of many terms used herein. Nevertheless, for clarity and ease of reference, certain terms are defined below.

[0048] As used herein, the term "about" denotes a range of numerical values ​​preceded by the term. As used herein, the term "about" is used to provide literal support for the exact numerical value preceded by the term, as well as a numerical value that is near or approximately the numerical value preceded by the term. In determining whether a number is near or approximately a specifically recited number, the near or non-approximate number may be a number that is substantially equivalent to the specifically recited number in the context in which it is presented.

[0049] It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "RNA sensor" refers to one or more RNA sensors, i.e., a single RNA sensor or multiple RNA sensors. It should be further noted that the claims may be drafted to exclude any element. As such, this statement is intended as a predicate for using exclusive language such as "only," "only," and the like in connection with the recitation of claim elements, or for using a "negative" limitation.

[0050] The terms "polynucleotide" and "nucleic acid" are used interchangeably herein and refer to a polymer of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The terms "polynucleotide" and "nucleic acid", as applied to the described embodiments, should be understood to include single-stranded (such as sense or antisense) and double-stranded polynucleotides.

[0051] "Hybridizable" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA, DNA) "anneals" or "hybridizes" to another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to a complementary nucleic acid) by forming non-covalent bonds, i.e., Watson-Crick base pairs and / or G / U base pairs. Standard Watson-Crick base pairs include adenine / adenosine (A) with thymidine / thymidine (T), A with uracil / uridine (U), and guanine / guanosine (G) with cytosine / cytidine (C). Inosine (I) base pairs with cytosine / cytidine. Additionally, the term is used in hybridization between two RNA molecules (e.g., dsRNA), and hybridization between DNA and RNA molecules (e.g., when a DNA target nucleic acid base pairs with a guide RNA): G can also base pair with U. For example, G / U base pairing is partially responsible for the degeneracy (i.e., redundancy) of the genetic code in the relationship between anticodon base pairing of tRNA and codons of mRNA. Thus, in the context of the present disclosure, G (e.g., in the protein-binding segment of a guide RNA molecule (e.g., a dsRNA duplex); G in a target nucleic acid (e.g., a target DNA or RNA) that base pairs with a sensor RNA) is considered to be complementary to both U and C. For example, if a G / U base pair occurs at a given nucleotide position in the protein-binding segment of a sensor RNA molecule (e.g., a dsRNA duplex), the position is not considered non-complementary, but instead is considered complementary.

[0052] Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, which are variables well known in the art. The greater the degree of complementarity between two nucleotide sequences, the greater the melting temperature (Tm) value of the hybrid of nucleic acids with those sequences. Typically, the length of a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

[0053] It is understood that a polynucleotide does not need to be 100% complementary to the base sequence of the target nucleic acid to specifically hybridize. Furthermore, a polynucleotide may hybridize on one or more segments where no intervening or adjacent segments are involved in the hybridization event (e.g., loop or hairpin structures, "bulges", etc.). A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it hybridizes. For example, an antisense nucleic acid in which 18 nucleotides out of 20 nucleotides of an antisense compound are complementary to a target region and thus specifically hybridize exhibits 90% complementarity. The remaining non-complementary nucleotides may be clustered or interspersed with complementary nucleotides and do not need to be contiguous with each other or with complementary nucleotides. The percentage of complementarity between specific stretches of nucleic acid sequences within a nucleic acid can be determined using any convenient method, such as using the BLAST program (Basic Local Alignment Search Tool) or PowerBLAST program (Altschul et al. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), or the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis), for example using the default settings using the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

[0054] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length, and can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.

[0055] The term "naturally-occurring" as applied herein to a nucleic acid, protein, cell, or organism refers to a nucleic acid, protein, cell, or organism that exists in nature. For example, a polypeptide or polynucleotide sequence that has been isolated from a naturally occurring organism (including a virus) and that has not been intentionally modified by man in the laboratory is naturally-occurring.

[0056] The term "exogenous" as applied to a nucleic acid or protein herein refers to a nucleic acid or protein that is not normally or naturally present in and / or produced by a given bacterium, organism, or cell in nature. As used herein, the term "endogenous nucleic acid" refers to a nucleic acid that is normally found in and / or produced by a given bacterium, organism, or cell in nature. An "endogenous nucleic acid" is also referred to as a "native nucleic acid" or a nucleic acid that is "native" to a given bacterium, organism, or cell. As used herein, the term "endogenous polypeptide" refers to a polypeptide that is normally found in and / or produced by a given bacterium, organism, or cell in nature.

[0057] "Recombinant" as used herein means that a particular nucleic acid or protein is the product of various combinations of cloning, restriction, and / or ligation steps, resulting in a construct having structural coding or non-coding sequences that are distinct from the endogenous nucleic acid found in natural systems. In general, DNA sequences encoding structural coding sequences can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of synthetic oligonucleotides, providing a synthetic nucleic acid expressible from a recombinant transcription unit contained within a cell, or in a cell-free transcription and translation system. Such sequences can be provided in the form of an open reading frame uninterrupted by internal non-translated sequences (introns) normally present in eukaryotic genes. Genomic DNA containing the relevant sequences can also be used to form recombinant genes or transcription units. Sequences of non-translated DNA can be present 5' or 3' from the open reading frame, provided such sequences do not interfere with manipulation or expression of the coding region.

[0058] Thus, for example, the terms "recombinant" nucleic acid and "recombinant" protein refer to something that does not exist in nature, e.g., something that has been created by artificially combining two separate sequence segments through human intervention. This artificial combination is often achieved by the artificial manipulation of isolated nucleic acid segments, either by chemical synthesis means or by genetic engineering techniques, etc. This is usually done to replace codons with redundant codons that code for the same or a conservative amino acid, while usually introducing or removing sequence recognition sites. Alternatively, nucleic acid segments with desired functions may be joined to create a desired combination of functions. This artificial combination is often achieved by the artificial manipulation of isolated nucleic acid segments, either by chemical synthesis means or by genetic engineering techniques, etc.

[0059] By "construct" or "vector" is meant a recombinant nucleic acid, generally a recombinant DNA, generated for the expression and / or propagation of a nucleotide sequence of interest or used in the construction of other recombinant nucleotide sequences.

[0060] The terms "transformation" or "transfection" refer to a permanent or transient genetic change induced in a cell following the introduction of nucleic acid (i.e., DNA and / or RNA exogenous to the cell). The genetic change ("modification") can be achieved by integrating the new DNA into the genome of the host cell or by maintaining the new DNA transiently or stably as an episomal element. If the cell is eukaryotic, a permanent genetic change is generally achieved by introducing DNA into the genome of the cell. Suitable methods of genetic modification include viral infection, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate precipitation, and direct microinjection. The choice of method generally depends on the type of cell being transformed and the context in which the transformation is being performed (i.e., in vitro, ex vivo, in vivo). A general discussion of these methods can be found in Ausubel et al, Short Protocols in Molecular Biology, 3rd ed, Wiley & Sons, 1995.

[0061] The terms "regulatory region" and "regulatory element," used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, proteolytic signals, translational start and stop codons, translation initiation sites, splice enhancer / donor / branch / acceptor sites, that provide and / or regulate the expression of a coding sequence and / or the production of an encoded polypeptide in a host cell. As used herein, a "promoter sequence" or "promoter" is a DNA regulatory region that is capable of binding / recruiting RNA polymerase (e.g., via a transcription initiation complex) and initiating transcription of a downstream (3' direction) sequence (e.g., a protein-coding ("coding") or non-protein-coding ("non-coding") sequence). The promoter may be a constitutively active promoter (e.g., a promoter that is constitutively active / "ON" state), an inducible promoter (e.g., a promoter whose active / "ON" or inactive / "OFF" state is controlled by an external stimulus, e.g., a particular temperature, compound, the presence of a protein), a spatially restricted promoter (e.g., a tissue-specific promoter, a cell-type specific promoter, etc.), a temporally restricted promoter (e.g., the promoter is in the "ON" or "OFF" state at a particular stage, tissue-specific promoter, cell-type specific promoter, etc.), and / or a temporally restricted promoter (e.g., a particular stage of embryonic development, or a particular stage of a biological process, e.g., the hair follicle cycle in mice).

[0062] "Operably linked" refers to a juxtaposition in a relationship permitting the components thus described to function in their intended manner. For example, a promoter is operably linked to a nucleotide sequence (e.g., a protein-coding sequence, e.g., a sequence encoding an mRNA; a non-protein-coding sequence, e.g., a sequence encoding an Shh protein; etc.) if the promoter affects its transcription and / or expression.

[0063] The term "adenosine deaminase acting on RNA" or "ADAR" refers to an enzyme that catalyzes the hydrolytic C6 deamination of adenosine (A) to generate inosine (I) in double-stranded RNA substrates. ADARs preferentially edit mismatched sites in double-stranded RNA, with mismatches containing adenosine and cytosine being edited more efficiently than other mismatches. Editing by ADARs results in a replacement of a nucleotide in the RNA, as purine I, generated as a result of the deamination, is recognized as G instead of A by both ribosomes during translational decoding of mRNA and by RNA-dependent polymerases during RNA replication. The term "ADAR" encompasses all known types of ADARs, such as ADAR1 (ADAR) or ADAR2 (ADARB2).

[0064] As used herein, "ADAR1" refers to an adenosine deaminase that acts on RNA and catalyzes the hydrolytic C6 deamination of adenosine (A) to produce inosine (I) in double-stranded RNA substrates. There are two isoforms of ADAR1, p150 and p110. The term "ADAR1" includes ADAR1 from various species. The amino acid sequences of ADAR1 from various species have been published. For example, GenBank Accession Nos. NP_001102 (Homo sapiens ADAR1 p150), NP_001180424.1 (Homo sapiens ADAR1 p110), NP_001139768 (Mus musculus ADAR1 p150), NP_001033676 (Musculus ADAR1 p110). As used herein, the term "ADAR1" also encompasses fragments, fusion proteins, and variants (e.g., variants having one or more amino acid substitutions, additions, deletions, and / or insertions) that retain ADAR1 enzymatic activity.

[0065] As used herein, "ADAR2" refers to an adenosine deaminase that acts on RNA and catalyzes the hydrolytic C6 deamination of adenosine (A) to produce inosine (I) in double-stranded RNA substrates. ADAR2 is localized only in the nucleus. The term "ADAR2" includes ADAR2 from various species. The amino acid sequences of ADAR2 from various species have been published. For example, GenBank Accession Nos. NP_056648.1 (Homo sapiens ADAR2), NP_001020008.1 (Mus musculus ADAR2), ACO52474.1 (Doryteuthis opalescens ADAR2). As used herein, the term "ADAR2" also encompasses fragments, fusion proteins, and variants (e.g., variants with one or more amino acid substitutions, additions, deletions, and / or insertions) that retain ADAR2 enzyme activity.

[0066] The term "sample" as used herein refers to a substance or mixture of substances, usually in the form of a fluid, i.e., aqueous solution, containing one or more components of interest. Samples may be derived from a variety of sources, including food, environmental materials, biological samples, solids (such as tissues and body fluids), and the like. This includes, but is not limited to, plasma, serum, cerebrospinal fluid, semen, lymphatic fluid, outer layer of skin, respiratory tract, and the like. For example, plasma, serum, cerebrospinal fluid, semen, lymphatic fluid, skin, respiratory tract, intestine, external urogenital tract, tears, saliva, milk, blood cells, tumors, organs, and even samples of in vitro cell culture components (including, but not limited to, conditioned media resulting from growth of cells in cell culture media, putative virally infected cells, recombinant cells, and cellular components). In certain embodiments of the method, the sample comprises cells. In certain embodiments of the method, the cells are in vitro. In certain embodiments of the method, the cells are in vivo.

[0067] The term "biological sample" encompasses clinical or non-clinical samples, including tissue obtained by surgical resection, tissue obtained by biopsy, cultured cells, cell supernatants, cell lysates, tissue samples, organs, bone marrow, blood, plasma, serum, and the like. Biological samples include, for example, samples containing polynucleotides and / or polypeptides obtained from a patient's sample cells (e.g., cell lysates or other cell extracts containing polynucleotides and / or polypeptides); and samples containing a patient's sample cells. Biological samples containing sample cells from a patient can also include normal, non-diseased cells. Biological samples are taken from plants or animals. Biological samples can be of any species. In certain embodiments of the method, the biological sample comprises cells. In certain embodiments of the method, the cells are in vitro. In certain embodiments of the method, the cells are in vivo.

[0068] The term "editable codon" as used herein refers to a three nucleotide sequence that can be edited by an ADAR protein or a derivative thereof. The codon can be a start codon, a stop codon, or an AUA codon. The codon includes a sequence that includes an adenosine base. Generally, in the methods disclosed herein, the editable codon is a start codon that is edited to become a non-start codon, a stop codon that is edited to become a non-stop codon, or a non-start codon that is edited to become a start codon (i.e., AUA). Detailed Description

[0069] Before various embodiments are described, it is to be understood that the teachings of the present disclosure are not limited to particular embodiments described, which may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, as the scope of the present teachings will be limited only by the appended claims.

[0070] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described in any way. While the present teachings have been described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those skilled in the art.

[0071] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present teachings, some exemplary methods and materials are described below.

[0072] The citation of a publication is for its disclosure prior to the filing date and should not be construed as an admission that the claims are not entitled to antedate such publication by virtue of prior invention. Further, the publication dates provided may be different from the actual publication dates that can be independently confirmed.

[0073] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has distinct components and features which may be readily separated from or combined with the features of other embodiments without departing from the scope or spirit of the present teachings. Methods described may be carried out in the order of events described or in any other order which is logically possible.

[0074] All patents and publications referred to herein, including all sequences disclosed within such patents and publications, are expressly incorporated by reference.

[0075] Where a range of values ​​is stated, unless the context clearly indicates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limit of that range, and any other stated or intervening value within that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where one or both of the limits are included in the stated range, ranges excluding either or both of those included limits are also included in the invention.

[0076] It is understood that certain features of the invention that are described for clarity in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, various features of the invention that are described for brevity in the context of a single embodiment may also be provided separately or in any suitable subcombination. All combinations of the embodiments according to the invention are specifically embraced by the invention and are disclosed herein as if each combination were individually and expressly disclosed herein. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the invention and are disclosed herein as if each and every such subcombination were individually and expressly disclosed herein.

[0077] To further explain the present invention, a method for detecting a target RNA is first described. Then, a method for expressing a protein of interest is described. A kit is also described. Method for detecting a target RNA

[0078] As summarized above, a method for detecting a target RNA in a biological sample is provided, the method comprising: (a) combining the biological sample with a sensor RNA; and (b) assaying for the presence of an output protein associated with detection by the target RNA. In some embodiments, the biological sample is a cell.

[0079] The target RNA can be any RNA. For example, the target RNA includes, but is not limited to, mRNA, long non-coding RNA, transfer RNA, ribosomal RNA, small RNA such as microRNA, small interfering RNA, small nucleolar RNA, and the like. In certain embodiments, the target RNA can be differentially expressed in different tissues, cell types, or cell states, and detection of the target RNA can be used to identify the tissue type, cell type, or cell state. In some embodiments, the target RNA can be a genetic variant of a gene. In such cases, the genetic variant can be a predictor of disease or a predisposition factor to disease, such as oncogenic variants or variants associated with increased susceptibility to pathogens. In some embodiments, the methods of the present disclosure can be used to detect point mutations associated with the development of diseases, such as cancer, neurodegenerative diseases, autoimmune diseases, and the like. In some embodiments, the methods of the present disclosure can detect small indels, single nucleotide polymorphisms (SNPs) or variants, multi-nucleotide variants, or di-nucleotide variants, and the like. In some embodiments, the methods of the present disclosure can detect and distinguish copy number variation variants within and between biological samples. The target RNA may also be a gene fusion that may be predictive of cancer in general or a specific type of cancer. The target RNA may also be a specific splice variant (isoform) of a gene.

[0080] In some embodiments, the sensor RNA comprises: (i) a first nucleotide sequence encoding a marker protein, (ii) a second nucleotide sequence encoding a first cleavage domain, (iii) a third nucleotide sequence comprising a sensor nucleotide sequence that is reverse complementary to the target RNA, where the sensor nucleotide sequence comprises one or more stop codons, (iv) a fourth nucleotide sequence encoding a second cleavage domain, and (v) a fifth nucleotide sequence encoding an output protein.

[0081] In some embodiments, the sensor RNA comprises: (i) a first nucleotide sequence encoding a marker protein, (ii) a second nucleotide sequence encoding a cleavage domain, (iii) a third nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to the 3'UTR of a target RNA, where the sensor nucleotide sequence comprises one or more stop codons, (iv) a fourth nucleotide sequence encoding a second cleavage domain, and (v) a fifth nucleotide sequence encoding an output protein.

[0082] In some embodiments, the sensor RNA comprises: (i) a first nucleotide sequence comprising a stem-loop sequence comprising one or more stop codons, (ii) a second nucleotide sequence comprising a sensor nucleotide sequence that is reverse complementary to the target RNA, (iii) a third nucleotide sequence encoding a cleavage domain, and (iv) a fourth nucleotide sequence encoding an output protein.

[0083] In some embodiments, the sensor RNA comprises: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse complementary to a target RNA, where the sensor nucleotide sequence comprises a stem-loop sequence that includes one or more stop codons, (ii) a second nucleotide sequence encoding a cleavage domain, and (iii) a third nucleotide sequence encoding an output protein.

[0084] In some embodiments, the sensor RNA comprises: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse complementary to a target RNA, (ii) a second nucleotide sequence comprising a stem-loop sequence comprising one or more stop codons, (iii) a third nucleotide sequence encoding a cleavage domain, and (iv) a fourth nucleotide sequence encoding an output protein.

[0085] In some embodiments, the sensor RNA has one or more stop codons that contain at least one base that is mismatched with 1) the sequence in the stem loop opposite the stop codon, or 2) the sequence in the target RNA. The at least one base that is mismatched is generally no more than two bases that are mismatched. In one embodiment, the sensor RNA has one or more stop codons that contain 1) the sequence in the stem loop opposite the stop codon, or 2) only one base that is mismatched with the sequence in the target RNA. In some embodiments, the sensor RNA has no mismatched bases.

[0086] In certain embodiments, the sensor RNA comprises a first nucleotide sequence through a third, fourth or fifth nucleotide sequence in order (i.e., the fifth nucleotide sequence follows a fourth nucleotide sequence which follows a third nucleotide sequence which follows a second nucleotide sequence which follows the first nucleotide sequence). In some embodiments, the sensor RNA comprises a first nucleotide sequence through a third, fourth or fifth nucleotide sequence that is not in the above order.

[0087] The sensor RNA of the present disclosure comprises a sensor nucleotide sequence or stem-loop sequence that includes one or more stop codons followed by a nucleotide sequence that codes for an output protein. In some embodiments, the sensor RNA comprises one or more stop codons that include at least one base that mismatches with the target RNA or the sequence in the stem-loop. In some embodiments, the sensor RNA does not include a mismatch with the target RNA. In the presence of the target RNA, the sensor nucleotide sequence of the sensor RNA hybridizes to the target RNA, thereby forming a double-stranded RNA molecule that can recruit an ADAR protein. The double-stranded RNA can include a stop codon with or without a mismatch, or the stop codon can be within the stem-loop of the sensor RNA. The ADAR protein then edits the adenosine base in the stop codon of the sensor RNA to an inosine base. This editing removes the stop codon, and an output protein is produced from the sensor RNA in the biological sample. When the sensor RNA comprises a nucleotide sequence comprising a stem-loop sequence that comprises a stop codon, any stem-loop sequence can be used. In some embodiments, the stem-loop comprises a natural editing site. A natural editing site is a site in a nucleotide sequence that is edited in nature. Natural editing sites are known in the art and are described, for example, in Gabay et al. (Nat Commun. 2022 Mar 4; 13(1): 1184), which is specifically incorporated herein by reference. Examples of naturally occurring editing sites include, but are not limited to, GRIA2, GRIA3, IGFBP7, NEIL1, FLNA, GRIK2, CDK13, GABRA3, GLI1, SPEG.HTR2C, GRIA4, CYFIP2, CADPS, CADPS, RICTOR, COG3, GRIK1, COPA, HBE1, SON, FLNB, MAGEL2, NOVA1, PNMT, WASH1, LAT, DACT3, FXYD5, ZNF717, ZNF551 ​​CAPS1, etc. Naturally occurring editing sites are also disclosed in Table 1 below. In some embodiments, the stem-loop sequence is a GluR-B stem-loop or a modified variant thereof. In some embodiments, the stem comprises a naturally occurring editing site and the loop is a synthetic sequence. In some embodiments, the sequence of the stem is altered compared to the naturally occurring editing site by adding or removing nucleotides to add or remove mismatches. In some embodiments, the sequence modification adds or removes an additional stop codon. In some embodiments, the stem-loop sequence comprises the following stem-loop from CAPS1: CAAGGUCAAUGAGGAGAUGUACAGAAAUACAAUCCUGUACAUCUUAGCAUGACCCAC (SEQ ID NO: 1; CAPS1 variant 2). In some embodiments, the stem-loop sequence comprises the stem-loop from CAPS1: CAAGGUCAAUGAGGAGAUGUACAUAAUACAAUGUGUACAUCUUCUAGCAUGACCCAC (SEQ ID NO: 2; CAPS1 variant 3).In some embodiments, the stem-loop sequence comprises the following stem-loop from GLI1: CCCAACCUCUGUCUACUCACCACAGCCCCAGCAUCACUGUGAAUGCUGCCAUGUGCUAGGGCUACAGGAAGCCAGAAGUUGG (SEQ ID NO: 3; GLI1 variant 4). In some embodiments, the stem-loop sequence comprises the following stem-loop from GLI1: CUCACCACAGCCCCAGCAUCACUGUGAAUGCUGCCAUGGAUGCUAGGGCUACAGGA (SEQ ID NO: 4; GLI1 variant 5). In some embodiments, the stem-loop sequence comprises the following stem-loop from GABRA3: AAGUGGCAUAUGCGACGGCCAUGGACUGGUCAUAGCCGUCUGUUAUGCCU (SEQ ID NO: 5; GABRA3 variant 6). In some embodiments, the stem loop sequence comprises the following stem loop from GABRA3: UGGCAUAUGCGACGGCCAUGGACUGGUCAUAGCCGUCUGUUAUG (SEQ ID NO: 6; GABRA3 variant 7). In some embodiments, the stem loop sequence comprises the following stem loop from GLURB: CAUUAAGGUGGUGGAAUAGUAUACAAAGUAUCCCACCUACCCUGAUG (SEQ ID NO: 7; GLURB variant 8). In some embodiments, the stem loop sequence comprises the following stem loop from GLURB: CAUUAAGGUGGUGGAAUAGUAUACAAAGUAUCCCACCUACCCCGAUG (SEQ ID NO: 8; GLURB variant 9). In some embodiments, the stem-loop sequence consists of the following stem-loop from GLURB: UCCGUUAGGUGGGAAUAGUAAUACAAAGUAUCCCACCUACCCAGACG (SEQ ID NO: 9; GLURB variant 1).

[0088] Natural Editing Site [Table 1-1]

[0089] [Table 1-2]

[0090] [Table 1-3]

[0091] [Table 1-4]

[0092] When the sensor RNA comprises a nucleotide sequence that includes a stem-loop sequence that includes a stop codon, the length of the stem-loop may be limited. For example, the stem-loop is 50 bp or less, 40 bp or less, 30 bp or less, or 20 bp or less. In one embodiment, the length of the stem-loop is 18-50 bps.

[0093] Sensor RNAs containing a nucleotide sequence that includes a stem-loop sequence that includes an editable codon have certain advantages over sensor RNAs that do not include such stem-loop sequences, as disclosed in International Application PCT / US2022 / 033459. This is because ADARs have separate domains for RNA editing (catalytic domain) and dsRNA binding. First, sensor RNAs containing a nucleotide sequence that includes a stem-loop sequence that includes an editable codon separate the sequence to be edited (e.g., a stop codon) from the sequence that recruits the ADAR protein (i.e., the dsRNA segment formed when the sensor nucleotide sequence hybridizes to the target RNA). In general, if the editable codon of the sensor RNA is UAG (a stop codon) and there is only one mismatch of the stop codon to the target RNA, the target RNA should have a CCA sequence (or a sequence that is reverse-complementary to another stop codon with one mismatch to the stop codon). The presence of a CCA sequence (or a sequence that corresponds to another codon that can be edited) potentially limits the number of possible target RNAs. For example, CCA or equivalent sequences may only be present in highly structured parts of target RNA, only in coding sequences, or in protein-binding parts of target RNA. Sensors with stem loops greatly expand the range of suitable subsequences, allowing problematic target RNA subsequences to be avoided and efficient ones to be utilized instead. Some embodiments that distinguish gene fusions or splice variants require flexibility in the selection of target RNA subsequences, which stem loop design provides. Second, ADAR editing is largely sequence agnostic, but there is a small bias, mainly driven by catalytic domains, that extends beyond editable codons. Catalytic domain driven biases are known in the art and are described, for example, by Kuttan et al. (Proc Natl Acad Sci US A. 2012 Nov 27;109(48):E3295-304), which is specifically incorporated herein by reference.The editing site of the sensor RNA may be dictated by a target RNA that prevents optimization of the editing site (i.e., a stop codon or a non-stop codon as disclosed herein). By separating the editing site from the sensor nucleotide sequence that hybridizes to the target RNA, the editing site and the sensor nucleotide sequence can be optimized separately.

[0094] In some embodiments, the sensor RNA comprises a non-start codon instead of a stop codon. In these embodiments, the sensor RNA comprises: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to the target RNA, the sensor nucleotide sequence comprising a non-start codon (e.g., AUA) that comprises at least one base that mismatches with the target RNA sequence; (ii) a second nucleotide sequence encoding a second cleavage domain; and (iii) a third nucleotide sequence encoding an output protein. In the presence of the target RNA, the sensor RNA hybridizes to the target RNA to form a double-stranded RNA molecule that comprises one or more base mismatches in the non-start codon or elsewhere. The ADAR protein then edits the adenosine base in the non-start codon (e.g., AUA to AUI) of the sensor RNA to an inosine base. This editing converts the non-start codon to a start codon, and an output protein is generated from the sensor RNA in the biological sample.

[0095] In some embodiments, the sensor RNA has a start codon instead of a stop codon. In these embodiments, the sensor RNA has: (i) a first nucleotide sequence having a sensor nucleotide sequence that is reverse-complementary to the target RNA, the sensor nucleotide sequence having a start codon (e.g., AUG) with at least one base mismatched with the target RNA sequence, and (ii) a second nucleotide sequence encoding an output protein, the sequence encoding the output protein having a start codon. In the presence of the target RNA, the sensor RNA hybridizes to the target RNA to form a double-stranded RNA molecule with one or more base mismatches in the start codon or elsewhere. The ADAR protein then edits the adenosine base in the start codon (e.g., AUG to IUG) of the sensor RNA to an inosine base. This editing converts the start codon to a non-start codon, and an output protein is produced from the sensor RNA in the biological sample. Before editing, the presence of the first start codon in the sensor nucleotide sequence represents an upstream reading frame that suppresses expression of a downstream reading frame. After editing, the upstream reading frame is removed and the downstream reading frame is expressed to produce the output protein.

[0096] When the sensor RNA contains a start codon instead of a stop codon, the upstream reading frame as described above may have certain characteristics. In some embodiments, the length of the upstream reading frame is shorter than the downstream reading frame. In some embodiments, the length of the upstream reading frame is longer than the downstream reading frame. In one embodiment, the length of the upstream reading frame is approximately the same as the length of the downstream reading frame.

[0097] In some embodiments, the sensor RNA comprises a start codon instead of a stop codon. In these embodiments, the sensor RNA comprises: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to the target RNA, the sensor nucleotide sequence comprising a start codon (e.g., AUG) that comprises at least one base that mismatches with the target RNA sequence, and (ii) a second nucleotide sequence that encodes an output protein. In the presence of the target RNA, the sensor RNA hybridizes to the target RNA to form a double-stranded RNA molecule that comprises one or more base mismatches in the start codon or elsewhere. The ADAR protein then edits the adenosine base in the start codon (e.g., AUG to IUG) of the sensor RNA to an inosine base. This edit converts the start codon to a non-start codon, preventing the production of the output protein. In this embodiment, the output protein is produced only in the absence of the target RNA.

[0098] In some embodiments, the sensor RNA comprises a splice site in front of the output protein. In these embodiments, the ADAR protein edits the codon of the splice site, thereby removing the splice site and leading to the production of the output protein. In some embodiments, the ADAR protein edits the non-splice site and converts it to a splice site, thereby inactivating the production of the output protein.

[0099] In some cases, it is desirable to reduce the immunogenicity of the sensor RNA. Methods for reducing the immunogenicity of RNA are known in the art and are described, for example, in Starostina et al. (Vaccines (Basel). 2021 May 3; 9 (5): 452), which is specifically incorporated herein by reference. In general, methods for reducing the immunogenicity of the sensor RNA include incorporating modified ribonucleic acids into the sensor RNA. Modified ribonucleic acids that find use in the present disclosure include, but are not limited to, methylcytosine, pseudouridine, methyladenosine, and the like. In some embodiments, the methylcytosine is 5-methylcytosine. In some embodiments, the pseudouridine is N1-methyl-pseudouridine. In some embodiments, the methyladenosine is N6-methyladenosine. In some embodiments, the methyladenosine is N1-methyladenosine. In some embodiments, a portion of the nucleotides present in the sensor RNA are composed of modified ribonucleic acids. For example, a portion of the uridines of the sensor RNA are replaced with pseudouridines. When uridine in the sensor RNA is replaced with pseudouridine, a certain percentage of uridine is replaced with pseudouridine. For example, about 1-10%, about 10-20%, about 20-30%, about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, 80-90%, or 90% or more of uridine is replaced with pseudouridine. In one embodiment, 75% or less of uridine in the sensor RNA is replaced with pseudouridine. In one embodiment, the sensor sequence does not have pseudouridine.

[0100] When the sensor RNA contains pseudouridine, the pseudouridine may be present at a specific location. In some embodiments, the pseudouridine is not adjacent to the adenosine targeted by ADAR editing. In some embodiments, the pseudouridine is not included in the sensor sequence that hybridizes with the target RNA. When the sensor RNA contains pseudouridine, the sensor may contain a specific stop codon. In some embodiments, the stop codon used is UGA. When the UGA stop codon is used, the adenosine of UGA may be followed by a specific nucleotide. In some embodiments, the adenosine of UGA is followed by a guanosine, resulting in a nucleotide sequence of UGAG.

[0101] In some embodiments, the sensor nucleotide sequence includes a base that mismatches an adenosine base in the target RNA that is not within the start or stop codon. In some embodiments, the mismatched base prevents editing of an adenosine that is not within the stop or start codon.

[0102] In some embodiments, the sensor nucleotide sequence comprises one or more editing-inducible elements (EIEs). Suitable EIEs that find use in the present disclosure are disclosed in Uzonyi et al. (Mol Cell. 2021 Jun 3; 81(11):2374-2387) and Danan-Gotthold et al. (Genome Biol. 2017 Oct 23; 18(1):196).

[0103] The marker protein of the present disclosure can be any marker protein useful for detecting the presence of a sensor mRNA in a biological sample. For example, the marker protein can be a fluorescent protein or a luminescent protein. Non-limiting examples of useful fluorescent proteins include, but are not limited to, GFP, EBFP, Azurite, Cerulean, mCFP, Turquoise, ECFP, mKeima-Red, TagCFP, AmCyan, mTFP, TurboGFP, TagGFP, EGFP, TagYFP, EYFP, Topaz, Venus, mCitrine, TurboYFP, mOrange, TurboRFP, tdTomato, TagRFP, dsRed2, mRFP, mCherry, mPlum mRaspberry, mScarlet, and the like. Examples of luminescent proteins include, but are not limited to, Cypridinia luciferase, Gaussia luciferase, Renilla luciferase, Phontinus luciferase, Luciola luciferase, Pyrophorus luciferase, Phrixothrix luciferase, and the like. In some embodiments, the marker protein is the first half of the output protein. In these embodiments, the sequence encoding the marker protein produces the first half of the output protein, which may not function without the second half of the output protein in the absence of the target RNA. In the presence of the target RNA, the second half of the output protein is produced. When the second half of the output protein is produced in the presence of the first half of the output protein, the two proteins can form a functional output protein. In these embodiments, the first half of the output protein is the N-terminus of the output protein, and the second half of the output protein is the C-terminus of the output protein.

[0104] In certain embodiments, the sensor RNA comprises a nucleotide sequence encoding a cleavage domain. Cleavage domains that find use in the present disclosure include, but are not limited to, HIV-1 protease cleavage domain, TEV cleavage domain, preScission protease cleavage domain, HCV protease cleavage domain, RecA cleavage domain, self-cleavage domain, and the like. When a self-cleaving domain is used, the self-cleaving domain may be a 2A self-cleaving domain. 2A self-cleaving domains that find use in the present disclosure include T2A, P2A, E2A, and F2A, which are described in Szymczak-Workman et al. (Cold Spring Harb Protoc. 2012 Feb 1; 2012(2):199-204). In some embodiments, the sensor RNA comprises a first and a second cleavage domain. When the sensor RNA comprises a first cleavage domain and a second cleavage domain, the cleavage domains may be of the same type or different types. For example, the first cleavage domain may be a P2A self-cleavage domain and the second cleavage domain may also be a P2A self-cleavage domain, or the first cleavage domain may be a P2A self-cleavage domain and the second cleavage domain may be a T2A self-cleavage domain, or any combination thereof.

[0105] The sensor nucleotide sequence of the present disclosure may be reverse complementary to any region of the target RNA. In certain embodiments, the sensor nucleotide sequence is reverse complementary to the 3'UTR of the target RNA. In some embodiments, the sensor nucleotide sequence is reverse complementary to the 5'UTR of the target RNA. In certain embodiments, the sensor nucleotide sequence is reverse complementary to a coding sequence of the target RNA. In some embodiments, the sensor nucleotide sequence is reverse complementary to an exon of the target RNA. In some embodiments, the sensor nucleotide sequence is reverse complementary to an intron of the target RNA. In some embodiments, the sensor nucleotide sequence is reverse complementary to two separate non-contiguous regions of the same target RNA. For example, the sensor nucleotide sequence can be reverse complementary to two separate regions of the 5'UTR of the target RNA, to two separate regions of the coding sequence of the target RNA, to two separate regions of the 5'UTR of the target RNA, to a region of the 5'UTR and a region of the coding sequence of the target RNA, to a region of the coding sequence and a region of the 3'UTR of the target RNA, or to a region of the 5'UTR and a region of the 3'UTR of the target RNA. In some embodiments, the sensor RNA is reverse complementary to two or more different target RNAs.

[0106] Sensor RNAs with sensor nucleotide sequences reverse-complementary to the 3' or 5' UTR have certain advantages compared to sensor RNAs reverse-complementary to a coding sequence (CDS), as disclosed in International Application PCT / US2022 / 033459. First, ADAR editing is more efficient in UTRs compared to CDSs, because translating ribosomes may destabilize dsRNA. The increased efficiency is shown in Figure 4D. Second, RADARs are less likely to inhibit the production of proteins encoded by target RNAs, because 1) dsRNA formation in UTRs but not in CDSs does not affect translating ribosomes, and 2) bystander editing occurring in UTRs of target RNAs is less likely to cause deleterious consequences because the coding sequence is not edited.

[0107] The sensor nucleotide sequence of the present disclosure may be of any length as deemed necessary for sufficient specificity for the target RNA. For example, the sensor nucleotide sequence may be less than about 50 nucleotides, about 50 to 60, about 60 to 70, about 70 to 80, about 80 to 90, about 90 to 100, about 100 to 110, about 110 to 120, about 120 to 130, about 130 to 140, about 140 to 150, about 150 to 160, about 160 to 170, about 170 to 180, about 180 to 190, about 190 to 200, about 200 to 210, about 210 to 220, about 220 to 230, about 230 to 240, about 240 to 250, about 250 to 260, about 260 to 270, about 280 to 290, about 300 to 310, about 310 to 320, about 320 to 330, about 330 to 340, about 340 to 350, about 350 to 360, about 360 to 370, about 370 to 380, about 380 to 390, about 390 to 400, about 400 to 410, about 420 to 430, about 440 to 450, about 450 to 460, about 460 to 470, about 480 to 490, about 490 to 500, about 500 to 500, about 500 to 500, about 500 to 500, about The nucleic acid sequence is 270, about 270-280, about 280-290, about 290-300, about 300-310, about 310-320, about 320-330, about 330-340, about 340-350, about 350-360, about 360-370, about 370-380, about 380-390, about 390-400, about 400-410, about 410-420, about 420-430, about 430-440, about 440-450, about 450-460, about 460-470, about 470-480, about 480-490, about 490-500 or more nucleotides in length.

[0108] When the sensor nucleotide sequence is reverse complementary to two non-contiguous regions in the target RNA, the distance between the two non-contiguous regions of the target can be any length. For example, the distance between the two non-contiguous regions of the target can be less than about 50 nucleotides, about 50 to 60, about 60 to 70, about 70 to 80, about 80 to 90, about 90 to 100, about 100 to 150, about 150 to 200, about 200 to 250, about 250 to 300, about 300 to 350, about 350 to 400, about 400 to 450, about 450 to 500, or more than 500 nucleotides.

[0109] When the sensor nucleotide sequence is reverse complementary to two non-contiguous regions in the target RNA, the nucleotide sequence of the sensor nucleotide that is reverse complementary to the first of the two non-contiguous regions with the target RNA can be of any length. For example, the nucleotide sequence of the sensor nucleotide that is reverse complementary to the first of the two non-contiguous regions can be less than about 20 nucleotides, about 20 to 30, about 30 to 40, about 40 to 50, about 50 to 60, about 60 to 70, about 70 to 80, about 80 to 90, about 90 to 100, about 100 to 110, about 110 to 120, about 120 to 130, about 130 to 140, about 140 to 150, about 150 to 160, about 160 to 170, about 170 to 180, about 180 to 190, about 190 to 200, about 200 to 210, about 210 to 220, about 220 to 230, about 230 to 240, and about 240 to 250, about 250 to 260, about 260 to 270, about 270 to 280, about 280 to 290, about 290 to 300, about 300 to 310, about 310 to 320, about 320 to 330, about 330 to 340, about 340 to 350, about 350 to 360, about 360 to 370, about 370 to 380, about 380 to 390, about 390 to 400, about 400 to 410, about 410 to 420, about 420 to 430, about 430 to 440, about 440 to 450, about 450 to 460, about 460 to 470, about 470 to 480, about 480 to 490, about 490 to 500 or more nucleotides in length.

[0110] When the sensor nucleotide sequence is reverse complementary to two regions that are non-contiguous with the target RNA, the nucleotide sequence of the sensor nucleotide that is reverse complementary to the second of the two regions that are non-contiguous with the target RNA can be of any length. For example, the nucleotide sequence of the sensor nucleotide that is reverse complementary to the second of the two non-contiguous regions can be less than about 20 nucleotides, about 20 to 30, about 30 to 40, about 40 to 50, about 50 to 60, about 60 to 70, about 70 to 80, about 80 to 90, about 90 to 100, about 100 to 110, about 110 to 120, about 120 to 130, about 130 to 140, about 140 to 150, about 150 to 160, about 160 to 170, about 170 to 180, about 180 to 190, about 190 to 200, about 200 to 210, about 210 to 220, about 220 to 230, about 230 to 240, and about 240 to 250, about 250 to 260, about 260 to 270, about 270 to 280, about 280 to 290, about 290 to 300, about 300 to 310, about 310 to 320, about 320 to 330, about 330 to 340, about 340 to 350, about 350 to 360, about 360 to 370, about 370 to 380, about 380 to 390, about 390 to 400, about 400 to 410, about 410 to 420, about 420 to 430, about 430 to 440, about 440 to 450, about 450 to 460, about 460 to 470, about 470 to 480, about 480 to 490, about 490 to 500 or more nucleotides in length.

[0111] The sensor nucleotide sequence or stem loop of the present disclosure can include any stop or start codon that contains an adenosine residue.For example, the stop codon of the sensor nucleotide sequence is UAG, UAA, or UGA.Generally, the stop codon of the present disclosure is in frame with the coding sequence of the output protein, so that the output protein is produced when the stop codon is edited.

[0112] The output protein of the present disclosure can be any desired output protein. Examples of output proteins of the present disclosure include, but are not limited to, fluorescent proteins, genome modification proteins, transcription factors, killing factors, toxins, antigens, T cell receptors, enzymes, therapeutic proteins, cytokines, chemokines, growth factors, signaling peptides, chimeric antigen receptors (CARs), and the like. Output proteins can be secreted, transmembrane, or membrane-bound. If the output protein is to be transported to a specific location within a biological sample, the coding sequence of the output protein is preceded by a nucleotide sequence encoding an appropriate signal peptide, such as those described in Owji et al. (Eur J Cell Biol. 2018 Aug;97(6):422-441).

[0113] When the output protein is a genome-modifying protein, the genome-modifying protein may include, but is not limited to, a CRE recombinase or a variant thereof, a meganuclease or a variant thereof, a zinc finger nuclease or a variant thereof, a CRISPR / Cas-9 nuclease or a variant thereof, a modified Cas9 nickase fused to a reverse transcriptase (i.e., a genome-modifying protein used in prime editing), a TAL effector nuclease or a variant thereof, etc. Methods of prime editing are known in the art, see, for example, Scholefield et al. (Gene Ther. 2021 Aug;28(7-8):396-401).

[0114] When the output protein is a transcription factor, the transcription factor includes, but is not limited to, jun, fos, max, mad, serum response factor (SRF), AP-1, AP2, myb, MyoD, myogenin, ETS-box containing proteins, TFE3, E2F, ATF1, ATF2, ATF3, ATF4, ZF5, NFAT, CREB, 5 HNF4, C / EBP, SP1, CCAAT-box binding proteins, interferon regulatory factor (IRF-1), Wilms tumor protein, ETS binding proteins, STAT, GATA-box binding proteins, e.g., GAT A-3, forkhead family of winged helix proteins, and the like.

[0115] When the output protein is a killing factor, the killing factor includes, but is not limited to, a caspase, such as tumor necrosis factor alpha (TNFa), Fas ligand (FasL), caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10, caspase 11, caspase 12, caspase 13 or a mutant thereof.

[0116] When the output protein is a therapeutic protein, the therapeutic protein may be, but is not limited to, hormones and growth and differentiation factors, which may include, but are not limited to, insulin, glucagon, growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GHRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angioprotein netin, angiostatin, granulocyte colony stimulating factor (GCSF), erythroprotein netin (EPO), connective tissue growth factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), transforming growth factor alpha. (TGFa), platelet-derived growth factor (PDGF), insulin growth factor I and II (IGF-1 and IGF-11), any one of the transforming growth factor 13-superfamily including TGFI3, any one of the bone morphogenetic proteins (BMPs) including activin, inhibin, or BMP1-15, any one of the heregulin / neuregulin / ARIA / neural differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4 / 5, ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF), neuturin, agrin, any one of the semaphorin / collapsin family, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrin, noggin, sonic hedgehog, and tyrosine hydroxylase.

[0117] When the output protein is a cytokine, the cytokine may be, but is not limited to, IL-1-like, IL-1α, IL-1β, IL-1RA, IL-18, CD132, IL-2, IL-4, IL-7, IL-9, IL-13, CD1243, 132, IL-15, CD131, IL-3, IL-5, GM-CSF, IL-6-like, IL-6, IL-11, G-CSF, IL-12, LIF, OSM, IL-10-like, IL-10, IL-11, IL-12, IL-10 ... L-20, IL-14, IL-16, IL-17, IFN-α, IFN-β, IFN-γ, CD154, LT-β, ​​TNF-α, TNF-β, 4-1BBL, APRIL, CD70, CD153, CD178, G ITRL, LIGHT, OX40L, TALL-1, TRAIL, TWEAK, TRANCE, TGF-β1, TGF-β2, TGF-β3, Epo, Tpo, Flt-3L, SCF, M-CSF, MSP, etc.

[0118] When the output protein is a chemokine, the chemokine can include, but is not limited to, XCL1, XCL2, CCL1, CCL2, CCL3, CCL4, CCL5, CCL7, CCL8, CCL11, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CX3CL1, etc.

[0119] In certain embodiments, when the output polypeptide is a CAR, the extracellular binding domain of the CAR has a single chain antibody. The single chain antibody is a monoclonal single chain antibody, a chimeric single chain antibody, a humanized single chain antibody, a fully human single chain antibody, etc. In one non-limiting example, the single chain antibody is a single chain variable fragment (scFv). Suitable CAR extracellular binding domains include those described in Labanieh et al. (2018 Nature Biomedical Engineering 2:377-391), specifically incorporated herein by reference. In some embodiments, the extracellular binding domain of the CAR is a single chain version (e.g., an scFv version) of an antibody approved by the U.S. Food and Drug Administration and / or the European Medicines Agency (EMA) for use as a therapeutic antibody, such as for inducing antibody-dependent cellular cytotoxicity (ADCC) of certain disease-related cells in patients. Non-limiting examples of single chain antibodies that can be employed when the protein of interest is a CAR include single chain versions (e.g., scFv versions) of Abecatumumab, Adecatumumab, Ascrinvacumab, Cixutumumab, Conatumumab, Daratumumab, Drozitumab, Duligotumab, Durvalumab, Dusigitumab, Enfortumab, Enoticumab, Figitumumab, Ganitumab, Glembatumumab, Intetumumab, Ipilimumab, Iratumumab, Single chain versions of ab (e.g. scFv versions), such as Icrucumab, Lexatumumab, Lucatumumab, Mapatumumab, Narnatumab, Necitumab, Nesvacumab, Ofatumumab, Olaratumab, Panitumumab, Patritumumab, Pritumumab, Radretumab, Ramucirumab, Rilotumumab, Robatumumab, Seribantumab, Tarextumab, Teprotumumab, Tovetumab, Vantictumab, Vesencumab, Votumab,Zalutumumab, Flanvotumab, Altumomab, Anatumomab, Arcitumomab, Bectumomab, Blinatumomab, Detumomab, Ibritumomab, Minretumomab, Mitumoma b、Moxetumomab、Naptumomab、Nofetumomab、Pemtumomab、Pintumomab、Racotumomab、Satumomab、Solitomab、Taplitumomab、Tenatumomab、Tositumom ab、Tremelimumab、Abagovomab、Igovomab、Oregovomab、Capromab、Edrecolomab、Nacolomab、Amatuximab、Bavituximab、Brentuximab、Cetuximab、De rlotuximab is available inシマブ、ジレントキシマブ、インンツキシマブ、イサツキシマブ、マルゲツキシマブ、リツキシマブ、シルトキシマブ、ウブリツキシマブ、エクロメキシマブ、アビツズマブ、アレムツズマブ、ベバシズマブ、 Citatuzumab, Clivatuzumab, Dacetuzumab, D emcizumab、Dalotuzumab、Denintuzumab、Elotuzumab、Emactuzumab、Emib etuzumab、Enoblituzumab、Etaracizumab、Farletuzumab、Ficlatuzumab、Gemtuzumab、Imgatuzumab、Inotuzumab、Labetuzumab、Lifastuzumab、Lint uzumab、Lorvotuzumab、Lumretuzumab、Matuzumab、Milatuzumab、Nimotuzumab、Obinutuzumab、Ocaratuzumab、Otlertuzumab、Onartuzumab、Oportuz umab、Parsatuzumab、Pertuzumab、Pinatuzumab、Polatuzumab、Sibrotuzumab、Simtuzumab、Tacatuzumab、Tigatuzumab、Trastuzumab、Tucotuzumab、Vandortuzumab, Vanucizumab, Veltuzumab, Vorsetuzumab, Sofituzumab, Catumaxomab, Ertumaxomab, Depatuxizumab, Ontuxizumab, Blontuvetmab, Tamtuvetmab, or antigen-binding variants thereof.

[0120] The output protein may further comprise a tag used to detect the protein after production of the protein. For example, the tag may include, but is not limited to, a fluorescent protein, such as green fluorescent protein (GFP), YFP, RFP, CFP, mCherry, tdTomato, etc.; a histidine tag, such as a 6XHis tag; a hemagglutinin (HA) tag; a FLAG tag; a Myc tag, etc.

[0121] In some embodiments, the detection is quantitative or qualitative. For example, detection of target RNA may be correlated with the amount of output protein produced. In some embodiments, the amount of output protein is linear relative to the amount of target RNA. In some embodiments, the amount of output protein is logarithmic relative to the amount of target RNA. The disclosed method can quantitatively detect changes in expression of a particular gene through detection of target RNA. For example, changes in target RNA of 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 5000-fold, 100000-fold, 50000-fold, 100000-fold, or more can be detected.

[0122] Aspects of the present disclosure include assaying for the presence of an output protein in a biological sample. In some embodiments, assaying for the output protein uses immunoblotting. In some embodiments, assaying for the output protein includes microscopy. When the assay includes microscopy, the output protein may be conjugated to or may be a fluorescent or luminescent protein. In some embodiments, assaying for the presence of the output protein uses flow cytometry. When the assay includes flow cytometry, fluorescence activated cell sorting is used.

[0123] The methods of the present disclosure also include combining the biological sample with the sensor RNA. The combining can be done by any convenient method known in the art. In some embodiments, the combining includes transfecting the biological sample with a recombinant vector that includes the sensor RNA. When the biological sample is transfected with a recombinant vector, the recombinant vector includes, but is not limited to, a plasmid, a viral vector, a cosmid, an artificial chromosome, and the like. In some embodiments, the combining includes contacting the biological sample with lipid nanoparticles that include the sensor RNA. The lipid nanoparticles can be prepared as described in Hou et al. (Nat Rev Mater. 2021;6(12):1078-1094).

[0124] If one wishes to transfect biological samples such as cells, one can engineer the cells to express the sensor RNA using vectors such as plasmids, viral vectors, cosmids, artificial chromosomes, etc. Protocols of interest include those described in published PCT application W01999 / 041258, the disclosure of which is incorporated herein by reference.

[0125] Depending on the nature of the cells and / or expression construct, protocols of interest include electroporation, particle gun techniques, calcium phosphate precipitation, direct microinjection, viral infection, etc. The choice of method generally depends on the type of cell being transformed and the context in which the transformation is performed (i.e., in vitro, ex vivo, in vivo). A general discussion of these methods is provided in Ausubel, et al, Short Protocols in Molecular Biology, 3rd ed, Wiley & Sons, 1995. In some embodiments, lipofectamine and calcium-mediated gene transfer techniques are used. After the nucleic acid of interest is introduced into the cells, they can be incubated for about 1-24 hours, typically at 37°C, and optionally under selection, to allow expression of the sensor RNA. In mammalian target cells, many virus-based expression systems are available to express the sensor RNA. When adenovirus is used as the expression vector, the sensor RNA sequence of interest can be ligated to the adenoviral transcription / translation control complex, e.g., the late promoter and tripartite leader sequence. The chimeric gene is inserted into the adenovirus genome by in vitro or in vivo recombination. Insertion into a non-essential region of the viral genome (e.g., E1 or E3 region) results in a recombinant virus that is viable and capable of expressing the chimeric protein in infected hosts. (See, e.g., Logan & Shenk, Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Efficiency of expression can be improved by incorporation of appropriate transcription enhancer elements and / or transcription terminators. (See, e.g., Bittner et al., Methods in Enzymol. 153:51-544 (1987)).

[0126] In some embodiments, the viral vector is a recombinant adeno-associated viral (AAV) vector. AAV vectors are DNA viruses of relatively small size that can be stably and site-specifically integrated into the genome of infected cells. They can infect a variety of cells without affecting cell growth, morphology, or differentiation, and do not appear to be involved in human pathology. The AAV genome has been cloned, sequenced, and characterized. It consists of about 4,700 bases, and has inverted terminal repeat (ITR) regions of about 145 bases at both ends, which serve as the origin of viral replication. That is, the left part of the genome contains the rep gene involved in viral replication and expression of viral genes, and the right part contains the cap gene encoding the viral capsid protein.

[0127] The application of AAV as a gene therapy vector has been developing rapidly in recent years. Wild-type AAV can infect dividing and non-dividing cells and tissues of mammals, including humans, at relatively high titers, and can also integrate into specific sites (on the long arm of chromosome 19) in human cells (Kotin et al, Proc. Natl. Acad. Sci. 1990, USA. 87: 2211-2215; Samulski et al, EMBO J., 1991. 10: 3941-3950, the disclosures of which are incorporated herein by reference in their entirety). AAV vectors that do not have the rep and cap genes lose the specificity of site-specific integration, but may still mediate long-term stable expression of foreign genes. AAV vectors exist in two forms in cells: one is an episomal form that is extrachromosomal, and the other is one that is integrated into the chromosome, with the former being the predominant form. Furthermore, AAV has not been found to be associated with any human disease, and no changes in biological properties resulting from integration have been observed. There are 16 AAV serotypes reported in the literature, designated AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16 (Ursula Bantel-Schaal, Hajo Delius and Harald zur Hausen.J. Viral., 1999.73: 939-947).

[0128] AAV vectors can be prepared in a convenient manner. Adeno-associated viruses of any serotype are suitable (see, e.g., Blacklow, pp. 165-174 of "Parvovirus and Human Disease" J. R. Pattison, ed. (1988); Rose, Comprehensive Virology 3:1, 1974; P. Tattersall "The Evolution of Parvovirus Taxonomy" In Parvovirus (J.R. Kerr, S.F. Cotmore. M.E. Bloom, R.M. Linden, C.R. Parrish, Eds.p 5-14, Rudder Arnold, London, UK (2006); and DE Bowles, JE Rabinowitz, RJ Samulski "The Genus Dependovirus" (J.R. Kerr, S.F. Cotmore. M.E. Bloom, R.M. Linden, C.R. Parrish, Eds.) p 15-23, Rudder Arnold, London, UK (2006), the disclosures of which are incorporated herein by reference in their entireties). Methods for purifying vectors are described, for example, in U.S. Patent Nos. 6,566,118, 6,989,264, 6,995,006, and WO / 1999 / 011764 entitled "Methods for Generation High Titer Helper-free Helper-free". Nos. 6,566,118, 6,989,264, and 6,995,006, as well as WO / 1999 / 011764 entitled "Methods for Generating High Titer Helper-free Preparation of Recombinant AAV Vectors", the disclosures of which are incorporated herein by reference in their entirety. Preparation of hybrid vectors is described, for example, in PCT Application No. PCTIUS2005 / 027091, the disclosures of which are incorporated herein by reference in their entirety.The use of AAV-derived viral vectors for gene transfer in vitro and in vivo has been described (see, e.g., International Patent Application Publication Nos. WO 91 / 18088 and WO 93 / 09239; U.S. Pat. Nos. 4,797,368, 6,596,535, 5,139,941; and European Patent No. 0488528). These publications describe various AAV-derived constructs in which the rep and / or cap genes have been deleted and replaced with a gene of interest, and the use of these constructs to introduce the gene of interest in vitro (in cultured cells) or in vivo (directly into the organism). Replication-defective recombinant AAV according to the present invention can be prepared by co-transfecting a plasmid containing a nucleic acid sequence of interest flanked by two AAV inverted terminal repeat (ITR) regions with a plasmid carrying the AAV encapsulation genes (rep and cap genes) into a cell line infected with a human helper virus (e.g., adenovirus). The resulting AAV recombinant is purified by standard techniques.

[0129] In some embodiments, the vector(s) for use in the methods of the invention are encapsulated in a viral particle (e.g., including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16). Thus, the invention includes recombinant viral particles (recombinant, since they contain a recombinant polynucleotide) that contain any of the vectors described herein. Methods for producing such particles are known in the art and are described in U.S. Pat. Nos. 5,647,878 and 6,596,535.

[0130] When biological sample is transfected with the recombinant vector containing the sensor RNA, the sensor RNA is operably linked to the promoter.Suitable promoters of the present disclosure include but are not limited to SFFV promoter, hEF1a, CMV promoter or its mutant, inducible promoter, CMV-tetO promoter, tissue or cell specific promoter, etc.

[0131] In some embodiments of the present disclosure, the sensor RNA comprises one or more MS2 hairpins. In some embodiments, the sensor RNA comprises one or more MS2 hairpins. For example, the sensor RNA can comprise 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or 10 or more. In some embodiments, the sensor RNA comprises one or more TAR RNA elements. For example, the sensor RNA can comprise 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or 10 or more. In some aspects, the sensor RNA comprises one or more BoxB stem loops. For example, the sensor RNA can comprise 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or 10 or more. In some embodiments, the sensor RNA comprises an MS2 hairpin and a BoxB stem loop, an MS2 hairpin and a TAR RNA element, or a BoxB stem loop and a TAR RNA element.

[0132] In some embodiments, the method for detecting target RNA further comprises binding biological sample with ADAR protein or its coding sequence.The ADAR protein can be any kind of ADAR protein.For example, the ADAR protein can include, but is not limited to, artificial ADAR protein such as ADAR (ADAR1), ADAR p110, ADAR p150, ADAR2, the protein containing deaminase domain of ADAR2 or its variant and MS2 RNA binding protein (MCP), artificial ADAR protein lacking nuclear localization sequence, artificial ADAR protein containing nuclear export sequence, artificial ADAR protein containing one or more dsRNA binding domains from multiple different ADAR proteins, artificial ADAR protein containing TAR RNA binding protein, artificial ADAR protein containing Lambda N peptide, split artificial ADAR protein, where N-terminus and C-terminus of deaminase domain are produced separately, and two halves bind to each other in the presence of target RNA, etc. Suitable engineered ADAR proteins are described in Katrekar et al. (Nat Methods. 2019 Mar;16(3):239-242.), Biswas et al. (iScience. 2020 Jul 24;23(7):101318), Matthews et al. (Nat Struct Mol Biol. 2016 May;23(5):426-33), Cox et al. (Science. 2017 Nov 24;358(6366):1019-1027) or Kuttan et al. (Proc Natl Acad Sci US A. 2012 Nov 27;109(48):E3295-304). Split engineered ADAR proteins are described in Katrekar et al. (Elife. 2022 Jan 19;11:e75555). When the sensor RNA contains a start codon instead of a stop codon, a specific ADAR protein can be used. In some embodiments, when the sensor RNA contains a start codon instead of a stop codon, the ADAR protein is ADAR2.

[0133] In some embodiments, RNA editing proteins other than ADAR are used.For example, Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) family proteins can be used.Examples of suitable APOBEC proteins include, but are not limited to, APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4, etc.

[0134] In some embodiments, the sensor RNA further comprises a nucleotide sequence encoding any of the above-mentioned ADAR proteins, followed by a nucleotide sequence comprising a cleavage domain, and the nucleotide sequence comprising the cleavage domain is after the nucleotide sequence encoding the output protein. In some embodiments, the ADAR protein is used as the first nucleotide sequence instead of the marker protein.

[0135] In some embodiments, the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that is reverse-complementary to the second target RNA, and the sensor nucleotide sequence comprises a second stop codon that differs in sequence from the first and second target RNA. In some embodiments, a stop codon that comprises at least one base that mismatches with the second target RNA sequence is used. In some embodiments, the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that is reverse-complementary to the second target RNA, and the sensor nucleotide sequence comprises a start codon. In some embodiments, the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that is reverse-complementary to the second target RNA, and the sensor nucleotide sequence comprises an editable non-start codon at the start codon. In some embodiments, the stop codon, start codon, or non-start codon comprises at least one base that mismatches with the second target RNA sequence. In some embodiments, the stop, start, or non-start codon is included together with a stem-loop sequence included in the second sensor nucleotide sequence. In some embodiments, a biological sample is combined with two or more sensor RNAs that detect two or more different target RNAs.

[0136] In some embodiments, the method for detecting the target RNA further comprises binding the biological sample with a protein that specifically localizes the sensor RNA to the location of the target RNA. For example, the protein that specifically localizes the sensor RNA to the location of the target RNA is a dCas9 or dCas13 protein with a guide RNA (in the case of dCas9) or a target RNA directly (in the case of dCas13) directed to the genomic locus corresponding to the target RNA. In some embodiments, the dCas9 or dCas13 is engineered to link to MCP, TAR RNA binding protein, or lambda N peptide. Method for expressing a protein in a target cell

[0137] As summarized above, a method of expressing a protein in a target cell is provided, the method comprising binding the cell with a sensor RNA as described above, wherein the target RNA is present within the target cell.

[0138] The target RNA to which the sensor RNA hybridizes is optionally determined by the target cell. In some embodiments, the target cell is a cell in a particular disease state. In such instances, the target cell comprises a target RNA that is specific to the disease state or is more abundant in cells in a particular disease state, such as cancer cells. The cell may be in any disease state. In some embodiments, the target cell is a particular cell type. In such instances, the target cell comprises a target RNA that is specific to that cell type or is more abundant in cells of the particular cell type. The type of cell is not important.

[0139] Cells of any origin are candidate cells to be combined with the sensor RNA of the present disclosure. Non-limiting examples of candidate cell types include connective tissue elements such as fibroblasts, skeletal tissue (bone and cartilage), skeletal muscle, cardiac muscle, smooth muscle, epithelial tissue (liver, lung, breast, skin, bladder, kidney, etc.), neural cells (glia and neurons), endocrine cells (adrenal, pituitary, pancreatic islet cells), bone marrow cells, melanocytes, and many different types of hematopoietic cells. Suitable cells can also be cells representative of a particular body tissue of the subject. Types of body tissue include, but are not limited to, blood, muscle, nerve, brain, heart, lung, liver, pancreas, spleen, thymus, esophagus, stomach, intestine, kidney, testis, ovary, hair, skin, bone, breast, uterus, bladder, spinal cord, various body fluids, etc.

[0140] Cells suitable for use in the subject method include cells of various subject hosts. Generally, such subject hosts are "mammals" or "mammals", terms used broadly to refer to organisms belonging to the class Mammalia, including carnivora (e.g., dogs and cats), rodents (e.g., mice, guinea pigs, rats), and primates (e.g., humans, chimpanzees, monkeys). In many cases, the subject host is a human. In certain embodiments, the subject host is a plant.

[0141] In certain embodiments, the method for expressing target protein in target cell further comprises combining biological sample with ADAR protein or its coding sequence.ADAR protein can be any kind of ADAR protein.For example, ADAR protein can include, but is not limited to, ADAR (ADAR1), ADAR p110, ADAR p150, ADAR2, the protein containing deaminase domain of ADAR2 or its mutant, and artificial ADAR protein such as MS2 RNA binding protein MCP. Suitable engineered ADAR proteins are described by Katrekar et al. (Nat Methods. 2019 Mar;16(3):239-242.), Biswas et al. (iScience. 2020 Jul 24;23(7):101318), Matthews et al. (Nat Struct Mol Biol. 2016 May;23(5):426-33), Cox et al. (Science. 2017 Nov 24;358(6366):1019-1027) or Kuttan et al. (Proc Natl Acad Sci US A. 2012 Nov 27;109(48):E3295-304).

[0142] The method of expressing a protein in a target cell includes combining the target cell with a sensor RNA. The combining can be performed by any convenient method known in the art. In some embodiments, the combining includes transfecting the biological sample with a recombinant vector that includes the sensor RNA. When the biological sample is transfected with a recombinant vector, the recombinant vector includes, but is not limited to, a plasmid, a viral vector, a cosmid, an artificial chromosome, and the like. In some embodiments, the combining includes contacting the biological sample with lipid nanoparticles that include the sensor RNA. Lipid nanoparticles can be prepared as described in Hou et al. (Nat Rev Mater. 2021;6(12):1078-1094).

[0143] If one wishes to transfect biological samples such as cells, one can engineer the cells to express the sensor RNA using vectors such as plasmids, viral vectors, cosmids, and artificial chromosomes.

[0144] The protein expressed in the target cell is the output protein encoded by the sensor RNA. The output protein of the sensor RNA can be any of the output proteins described above. In some embodiments, the output protein treats a disease or condition associated with the target RNA in the target cell.

[0145] In some embodiments, the methods of the disclosure can be used to produce a target protein in the absence of cells. In these embodiments, the cell-free system includes a biological sample, a sensor RNA, and an ADAR protein. The biological sample can include any target RNA. For example, the biological sample can be a sample that includes viral material, such as viral RNA, where detection of the viral RNA leads to production of an output protein. Suitable cell-free systems include those described in Kuruma et al. (Nat Protoc. 2015 Sep;10(9):1328-44) and Lavickova et al. (ACS Synth Biol. Methods of Treating a Disease or Condition

[0146] Methods for expressing proteins in target cells can also be used to treat diseases and conditions. In the methods disclosed herein, the protein expressed in the target cell can promote survival of the target cell or promote death of the cell. For example, where a disease or condition is associated with pathogen-infected cells or cancer cells, it may be desirable to promote death of such cells. In embodiments where death of the target cell is desired, the output protein encoded by the sensor RNA can be any output protein that promotes cell death. Output proteins that promote cell death include, but are not limited to, toxins, tumor necrosis factor alpha (TNFa), Fas ligand (FasL), caspases such as caspase 1, caspase 2, caspase 3, caspase 4, caspase 5, caspase 6, caspase 7, caspase 8, caspase 9, caspase 10, caspase 11, caspase 12, caspase 13 or variants thereof.

[0147] In addition, when a disease or condition is associated with cells infected with a pathogen or cancer cells, it may be desirable to activate immune cells that target the infected or cancer cells. Immune cells generally include white blood cells (leukocytes), which are derived from hematopoietic stem cells (HSCs) produced in the bone marrow. Immune cells also include, for example, lymphocytes (T cells, B cells, natural killer (NK) cells), bone marrow-derived cells (neutrophils, eosinophils, basophils, monocytes, macrophages, dendritic cells). T cells include T helper cells (CD4 + cells), cytotoxic T cells (CD8 + These include all types of immune cells that express CD3, including CD8 T cells, T regulatory cells (Tregs), and gamma delta T cells. + These include T cells, natural killer (NK) cells, and neutrophils, and these cells can mediate cytotoxic responses.

[0148] In embodiments where activation of an immune cell is desired, the target RNA to which the sensor RNA is directed may be a target RNA that is specifically expressed in an immune cell. In embodiments where activation of an immune cell is desired, the sensor RNA may include a sequence that encodes an output protein that regulates the activation or activity of the immune cell. Non-limiting examples of output proteins that activate immune cells include chimeric antigen receptors, as described above, or IL-1-like, IL-1α, IL-1β, IL-1RA, IL-18, CD132, IL-2, IL-4, IL-7, IL-9, IL-13, CD1243, IL-132, IL-15, CD131, IL-3, IL-5, GM-CSF, IL-6-like, IL-6, IL-11, G-CSF, IL-12, LIF, OSM, IL-10-like, IL-10, IL-20, IL-14, IL-16, IL-17, IFN-α, IFN-β, IFN-γ, CD154, LT-β, ​​TNF-α, TNF-β, 4-1BBL. , APRIL, CD70, CD153, CD178, GITRL, LIGHT, OX40L, TALL-1, TRAIL, TWEAK, TRANCE, TGF-β1, TGF-β2, TGF-β3, Epo, Tpo, Flt-3L, SCF, M-CSF, MSP, etc.

[0149] When a disease or condition is associated with the expression of a non-functional protein, a protein with reduced function, or aberrant activity compared to a non-disease state, it is desirable to have a sensor RNA that is targeted to diseased cells, such that upon contact with a diseased cell containing the target RNA, the cell produces an output protein, which is a fully functional form of the non-functional, reduced function, or aberrantly functioning protein.

[0150] Where a disease or condition is associated with the degradation of tissue, it may be desirable to promote the growth or regeneration of that tissue. In embodiments where the disease or condition is associated with the degradation of tissue, it may be desirable to have a sensor RNA that is targeted to diseased cells, such that upon contact with diseased cells containing the target RNA, the cells will produce an output protein that promotes the growth or regeneration of tissue. Non-limiting examples of output proteins that promote tissue growth or regrowth include hormones, growth and differentiation factors, including but not limited to insulin, glucagon, growth hormone (GH), parathyroid hormone (PTH), growth hormone releasing factor (GHRF), follicle stimulating hormone (FSH), luteinizing hormone (LH), human chorionic gonadotropin (hCG), vascular endothelial growth factor (VEGF), angioprotein netin, angiostatin, granulocyte colony stimulating factor (GCSF), erythroprotein netin (EPO), connective tissue growth factor (CTGF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), transforming growth factor alpha. (TGFa), platelet-derived growth factor (PDGF), insulin growth factor I and II (IGF-1 and IGF-11), any one of the transforming growth factor 13-superfamily including TGFI3, any one of the bone morphogenetic proteins (BMPs) including activin, inhibin, or BMP1-15, any one of the heregulin / neuregulin / ARIA / neural differentiation factor (NDF) family of growth factors, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophins NT-3 and NT-4 / 5, ciliary neurotrophic factor (CNTF), glial cell line-derived neurotrophic factor (GDNF), neuturin, agrin, any one of the semaphorin / collapsin family, netrin-1 and netrin-2, hepatocyte growth factor (HGF), ephrin, noggin, sonic hedgehog, and tyrosine hydroxylase.

[0151] Given the diversity of cellular activities that can be modulated by the use of the subject sensor RNA, the instant therapeutic method can be utilized in a variety of applications. By way of non-limiting example, the instant method can find use in therapies directed to a variety of diseases, including, but not limited to, Acanthamoeba infections, Acinetobacter infections, Adenovirus infections, ADHD (attention deficit / hyperactivity disorder), AIDS (acquired immune deficiency syndrome), ALS (amyotrophic lateral sclerosis), Alzheimer's disease, amebiasis, enteritis (Entamoeba histolytica infections), Anaplasmosis (humans), Anemia, Angiostrongylus infections, Animal-associated diseases, Anisakiasis infections (anisakiasis), Anthrax, Aortic aneurysm, Aortic dissection, Arenavirus infections, Arthritis (e.g., childhood arthritis, fibromyalgia, gout, Lupus (SLE), osteoarthritis, rheumatoid arthritis, etc.), Ascariasis, Aspergillosis, Asthma, Attention-deficit / hyperactivity disorder, Autism, Avian influenza, B virus infections (herpes B virus), B. cepacia infection, Burkholderia cepacia infection, Babesiosis, bacterial meningitis, bacterial vaginosis (BV), Balamuthia mandrillaris infection, Balamuthia mandrillaris infection, Balantidiosis, Baylisascaris infection, bilharzia, birth defects, black lung (coal workers' pneumoconiosis), Blastocystis hominis infection, Blastocystis hominis infection, Rastocystis infection, Blastomycosis, Hemorrhagic disease, Blood disease, Body lice (Body lice), Borrelia burgdorferi infection, Botulism (Clostridium botulinum), Bovine spongiform encephalopathy (BSE), Brainard's diarrhea, Breast cancer, Bronchitis, Brucella infection (Brucella disease), Brucellosis, Burkholderia cepacia infection (B. cepacia infection), Burkholderia mallei, Burkholderia pseudomalleipseudomallei infection, Campylobacter infection (campylobacteriosis), campylobacteriosis, cancer (e.g. colon cancer, gynecological cancer, lung cancer, prostate cancer, skin cancer, etc.), candidiasis (candidiasis), canine influenza, capillary infection (capillary angiopathy), capillary angiopathy, carbapenem-resistant Klebsiella pneumonia (CRKP), cat flea tapeworm, selaria dermatitis, cerebral palsy, cervical cancer, Chagas disease (Trypanosoma cruzi infection), chickenpox (varicella), Chikungunya fever (CHIKV), childhood arthritis, German measles (rubella virus), measles, mumps, rotavirus infection, chlamydia (Chlamydia trachomatis infection), Chlamydia pneumoniae infection, Chlamydia trachomatis disease, cholera (Vibrio cholerae infection), chronic fatigue syndrome (CFS), chronic obstructive pulmonary disease (COPD), ciguatera fish toxin, ciguatoxin, classical Creutzfeldt-Jakob disease, clonorchiasis, clonorchiasis infection, Clostridium botulinum, Clostridium difficile infection, Clostridium perfringens infection, Clostridium tetani infection, blood clotting disorder, CMV (cytomegalovirus infection), coal workers' pneumoconiosis, coccidioidomycosis, colon cancer, cold, conjunctivitis, Cooley's anemia, COPD (chronic obstructive pulmonary disease), Corynebacterium diphtheria infection, Coxiella burnetii infection, Creutzfeldt-Jakob disease, CRKP (carbapenem-resistant Klebsiella pneumonia), Crohn's disease, putococcosis, cryptosporidiosis, cryptosporidiosis, cyclospora infection, cyclosporosis, cysticercosis, cystoisospora infection, cystoisosporaiasis, cytomegalovirus infection (CMV), dengue fever (DF), dengue hemorrhagic fever (DHF), dermatophytes, dermatosis, diabetes, diamond anemia (DBA), diantamoebafragilis Infection, Diphtheria (Corynebacterium diphtheriae Infection), Diphyllobotryosis, Diphyllobotryum Infection (Diphyllobotryosis), Dipyridium Infection, Dog Flea Tapeworm, Down Syndrome (Trisomy 21), Drachunculiasis, Dwarf Tapeworm (Hymenolepis Infection), E. coli Infection, Ear Infection (Otitis Media), Eastern Equine Encephalitis (EEE), Ebola Hemorrhagic Fever, Echinococcosis, Ehrlichiosis, Elephantiasis, Encephalitis (Mosquito-borne and Tick-borne), Entamoeba histolytica Infection, Enterobius vermicularis infection, enterovirus infection (non-polio), epidemic typhoid, epilepsy, Epstein-Barr virus infection (EBV infection), Escherichia coli infection, extensively drug-resistant tuberculosis (XDR tuberculosis), fasciola infection (fasciolosis), fasciolopsis infection (fasciolopsis), fibromyalgia, fifth disease (parvovirus B19 infection), flavoring-related lung disease, folliculitis, food-related illness, Clostridium perfringens infection, fragile X syndrome, Francisella tularensis infection, genital candidiasis (vulvar candidiasis (VVC) )), genital herpes (herpes simplex virus infection), genital warts, German measles (rubella virus), Giardia infection (giardiasis), Granders (Burkholderia mallei), Gonococcal infection (gonococcal infection), Gout, Granulomatous amebic encephalitis (GAE), Group A streptococcal infection (GAS), Group B streptococcal infection (GBS), Dracunculiasis, Gynecological cancer (e.g., cervical cancer, ovarian cancer, uterine cancer, vaginal cancer, vulvar cancer, etc.), Novel influenza, Vaginal cancer, Vulvar cancer. H1N1 Influenza, Haemophilus influenzae Infection (Hib Infection), Hand, Foot and Mouth Disease (HFMD), Leprosy, Hantavirus Pulmonary Syndrome (HPS), Head Lice (Capitulum Infection), Heart Disease (Cardiovascular Health), Heat Stress, Hemochromatosis, Hemophilia, Hendra Virus Infection, Herpes B Virus, Herpes Simplex Virus Infection, Heterophyes Infection, Haemophilus influenzae Infection, High Blood Pressure, Histoplasmosiscapsulatum Disease), Histoplasmosis (Histoplasma capsulatum Disease), Hot-bath rash (Pseudomonas dermatitis infection), HPV infection (Human papillomavirus infection), Human erlichiosis, Human immunodeficiency virus, Human papillomavirus infection (HPV infection), Hymenolepis infection, Hypertension, Hyperthermia, Hypothermia, Contagious impetigo, Infectious mononucleosis, Inflammatory bowel disease (IBD), Influenza, Avian influenza, H1N1 influenza, Pandemic influenza, Seasonal influenza, Swine influenza, Invasive candidiasis, Iron overload (hemochromatosis), Isospora infection (isosporosis), Japanese encephalitis, Jaundice, K.pneumoniae (Klebsiella pneumoniae), Kala-Azar, Kawasaki syndrome (KS), Kernicterus, Klebsiellapneumoniae (K. pneumoniae), La Crosse encephalitis (LAC), La Crosse encephalitis virus (LACV), Lassa fever, latex allergy, lead poisoning, Legionnaires' disease (Legionnaires' disease), Leishmania infection (Leishmaniasis), Leprosy, Leptospirosis (Leptospirosis), Leukemia, Lice, Listeria infection (Listeriosis), Listeriosis, Liver disease and hepatitis, Loa infection, Lockjaw, Lou Gehrig's disease, Lung cancer, Lupus (SLE) (Systemic lupus erythematosus), Lyme disease Borrelia burgdorferi infection, lymphatic filariasis, lymphedema, lymphocytic chorionitis (LCMV), lymphogranulomatous infection (LGV), malaria, Marburg hemorrhagic fever, measles, Burkholderia pseudomallei infection, meningitis, meningococcal disease, methicillin-resistant Staphylococcus aureus (MRSA), micronutrient deficiencies, microsporidiosis, molluscum contagiosum, monkey B virus, monkeypox, Morgellons, mosquito-borne disease, myxomycosis, multidrug-resistant tuberculosis (MDR tuberculosis), mumps , Mycobacterium abscessus infection, Mycobacterium avium complex (MAC), Mycoplasma pneumoniae infection, myositis, Naegleria infection (primary amebic meningoencephalitis (PAM)), necrotizing fasciitis, neglected tropical diseases (NTDs), gonorrhea, neurocysticercosis, new variant Creutzfeldt-Jakob disease, neonatal jaundice (Kernichterus), Nipah virus encephalitis, nocardiosis, non-polioenterovirus infections, non-pathogenic (harmless) intestinal protozoa, norovirus infection, Norwalk-like virus (NLV), pandemic influenza H1N1, Onchocerciasis, Opisthorchis infection, Oral cancer, Orf virus, Oropharyngeal candidiasis (OPC), Osteoarthritis (OA), Osteoporosis, Otitis media, Ovarian cancer, Pandemic influenza, Paragonimiasis, Parasitic diseases, Parvovirus B19 infection, Head and neck pediculosis, Body and neck pediculosis, Pelvic inflammatory disease (PID), Peripheral arterial disease (PAD), Whooping cough, Filariasis, Pink eye (conjunctivitis), Pinworm infection (Enterobius vermicularis infection), Plague (Yersiniapestis infection), Pneumocystis jirovecii pneumonia, pneumonia, polio infection (polio meningitis infection), Pontiac fever, prion disease (transmissible spongiform encephalopathy (TSE)), prostate cancer, Pseudomonas dermatitis infection, platybite disease, hair lice pulmonary hypertension, Q fever (Coxiella burnetii infection), rabies, raccoon roundworm infection (Baylisascaris infection), rat bite fever (RBF) (Streptobacillus moniliformis infection), Recreational Water Influenza (RWI), Relapsing Fever, Respiratory Syncytial Virus (RSV), Rheumatoid Arthritis (RA), Rickettsia rickettsii infection, Rift Valley Fever (RVF), Ringworm (Dermatophytes), Animal Ringworm, River Blindness (Onchocerciasis), Rocky Mountain Spotted Fever (RMSF) (Rickettsia rickettsii infection), Rotavirus Infection, RVF (Rift Valley Fever), RWI (Recreational Water Disease), Salmonellosis, Scabies, Scarlet Fever, Schistosomias, Seasonal Flu, Severe Acute Respiratory Syndrome, Sexually Transmitted Diseases (STDs) (e.g., Bacterial Vaginosis (BV), Chlamydia, Genital Herpes, Gonorrhea, Human Papillomavirus Infection, Pelvic Inflammatory Disease, Syphilis, Trichomoniasis, HIV / AIDS, etc.), Shigella infection (dysentery), Shingles (Varicella zoster virus (VZV)), Sickle cell disease, Single gene disorder, Sinus infection (sinusitis), Skin cancer, Sleeping sickness (African trypanosomiasis), Smallpox (Variola major and Variola minor), Stomatitis (Orf virus), Southern tick-associated exanthema (STARI), Spina bifida (myelomeningocele), Sporotrichosis, Spotted fever group rickettsia (SFGR), St. Louis Encephalitis, Staphylococcus aureus infection, Streptobacillusmoniliformis infection, streptococcal infection, pneumococcal infection, stroke, Strongyloides infection (Strongyloidosis), sudden infant death syndrome (SIDS), swimmer's itch (Selaria dermatitis), swine flu, syphilis (Treponema pallidum infection), systemic lupus erythematosus, tapeworm infection (Taenia infection), testicular cancer, tetanus disease (Clostridium tetani infection), thrush (oropharyngeal candidiasis (OPC)), tick-borne relapsing fever, tick-borne diseases (e.g., anaplasmosis, babesiosis, ehrlichiosis, Lyme disease, Tourette syndrome (TS), toxic shock syndrome (TSS), toxocariasis (Toxocara infection), toxoplasmosis (Toxoplasma infection), trachoma infection, transmissible spongiform encephalopathy (TSE), traumatic brain injury (TBI), trichomoniasis (Trichomonas infection), tuberculosis (Mycobacterium tuberculosis infection), tularemia (Francisella tularensis infection), typhoid fever (Salmonella typhi infection), uterine cancer, vaginal cancer and vulvar cancer, vancomycin-intermediate / resistant Staphylococcus aureus infection (VISA / VRSA), vancomycin-resistant Enterococcus infection (VRE), variant Creutzfeldt-Jakob disease (vCJD), Varicella zoster virus infection, Variola major and minor, Vibrio cholerae infection, Vibrio parahaemolyticus infection, Vibrio vulnificus infection These include infectious diseases, viral gastroenteritis, viral hemorrhagic fever (VHF), viral hepatitis, viral meningitis (aseptic meningitis), von Willebrand's disease, vulvovaginal candidiasis (VVC), West Nile virus infection, Western equine encephalitis infection, Trichuriasis, Whitmore's disease, whooping cough, leukemia virus-related virus infection, yellow fever, Yersinia pestis infection, yersiniosis (Yersinia enterocolitica infection), zoonotic hookworm disease, and zygomycosis.

[0152] In some embodiments, therapeutic methods utilizing one or more sensor RNAs of the present disclosure may be utilized in the treatment of cancer. Cancer treatments that may include the use of one or more proteolytically cleavable polypeptides of the instant disclosure are varied and include, for example, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), adrenocortical carcinoma, AIDS-related cancers (e.g., Kaposi's sarcoma, lymphoma, etc.), anal cancer, adnexal cancer, astrocytoma, atypical teratoma / rhabdomyoma, basal cell carcinoma, cholangiocarcinoma (extrahepatic), bladder cancer, bone cancer (Ewing's sarcoma, osteosarcoma, malignant fibrous histiocytoma, etc.), brain stem glioma, brain tumors. (e.g., astrocytoma, central nervous system germ cell tumor, craniopharyngioma, ependymoma, etc.), breast cancer (e.g., female breast cancer, male breast cancer, pediatric breast cancer, etc.), bronchial tumor, Burkitt's lymphoma, carcinoid tumor (pediatric, digestive system, etc.), cancer of unknown primary, cardiac (myocardial) tumor, central nervous system (e.g., atypical teratoma / rhabdomyosarcoma, germ cell tumor, lymphoma, etc.), cervical cancer, childhood cancer, chordoma, chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), chronic myeloproliferative neoplasms, colorectal cancer, colon cancer, craniopharyngioma, cutaneous T-cell lymphoma, duct (e.g., bile duct, extrahepatic, etc.), occult ductal carcinoma (DCIS), embryonal tumors, endometrial cancer, ependymoma, esophageal cancer, elastic neuroblastoma, Ewing's sarcoma, extracranial germ cell tumors, extramaxillary germ cell tumors, extrahepatic bile duct cancer, eye cancer (e.g., intraocular melanoma, retinoblastoma, etc.), osteofibrous histiocytoma (malignant, osteosarcoma, etc.), gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors (GIST), germ cell tumors (extracranial germ cell tumors, extramaxillary germ cell tumors, etc.), extracranial, extragonadal, ovarian, testicular, etc.), gestational trophoblastic disease, glioma, hairy cell leukemia, head and neck cancer, cardiac cancer, hepatocellular carcinoma, histiocytosis (Langerhans cell, etc., Langerhans cell tumor, etc.), Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, pancreatic islet cell tumors (pancreatic neuroendocrine tumors, etc.), Kaposi's sarcoma, kidney cancer (renal cell tumor, Wilms' tumor, childhood kidney tumor, etc.), Langerhans cell histiocytosis, laryngeal cancer, leukemia (e.g.Acute lymphoblastic (ALL), acute myeloid (AML), chronic lymphocytic (CLL), chronic myeloid (CML), hairy cell, etc.), lip and oral cavity cancer, liver cancer (primary), localized lobular carcinoma (LCIS), lung cancer (e.g., non-small cell carcinoma, small cell carcinoma, etc.), lymphoma (AIDS-related, Burkitt's carcinoma, cutaneous T-cell carcinoma, Hodgkin's carcinoma, non-Hodgkin's carcinoma, primary central nervous system (CNS) cancer, etc.), macroglobulinemia, Breast cancer (e.g. Waldenstrom's disease), male breast cancer, malignant fibrous histiocytoma and osteosarcoma of bone, melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous cell cervical cancer of unknown primary site, midline duct carcinoma associated with NUT gene, oral cancer, multiple endocrine neoplasia syndrome, multiple myeloma / plasma cell neoplasm, mycosis fungoides, myelodysplastic syndrome, myelodysplastic / myeloproliferative neoplasm, myeloid leukemia (e.g. g., Chronic (CML), etc.), Myeloid Leukemia (eg, Acute (AML), etc.), Myeloproliferative Neoplasms (eg, Chronic, etc.), Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Non-Hodgkin Lymphoma, Non-Small Cell Lung Cancer, Oral Cancer, Oral Cavity Cancer (eg, lip, etc.), Oropharyngeal Cancer, Osteosarcoma and Malignant Fibrous Histiocytoma of Bone, Ovarian Cancer (e.g. epithelial tumor, germ cell tumor, low malignant potential tumor, etc.), Pancreatic Cancer. Pancreatic cancer, pancreatic neuroendocrine tumors (islet cell tumors), papillomatosis, paraganglioma, paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pituitary tumor, pleuropulmonary blastoma, primary central nervous system (CNS) lymphoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, renal pelvis and ureter cancer, transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma (e.g., pancreatic cancer, pancreatic fibrosis ...,Ewing's sarcoma, Kaposi's sarcoma, osteosarcoma, rhabdomyosarcoma, soft tissue sarcoma, uterine sarcoma, etc.), Sezary syndrome, skin cancer (e.g. childhood cancer, melanoma, Merkel cell carcinoma, non-melanoma, etc.), small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous cell cervical cancer (e.g. gastric cancer, T-cell lymphoma, testicular cancer, pharyngeal cancer, thymoma and thymic cancer, thyroid cancer, renal pelvis and ureteral transitional cell carcinoma, ureter and renal pelvis cancer, urethral cancer, uterine cancer (endometrial cancer, etc.), uterine cancer (uterine cancer, etc.), endometrial cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia, Wilms' tumor, etc. Composition.

[0153] The present disclosure also describes compositions for carrying out the method. Generally, the subject compositions can have a sensor RNA as described above in addition to a pharma- ceutically acceptable excipient. In some embodiments, the subject compositions include ancillary agents for treating any of the above diseases or conditions.

[0154] The compositions of the present disclosure may be administered by any suitable means, including topical, oral, parenteral, pulmonary, and nasal administration. Parenteral infusions include intramuscular, intravenous (bolus or slow drip), intraarterial, intraperitoneal, intrathecal, and subcutaneous administration. The agents may be administered in any manner that is medically acceptable. This includes parenteral injections, such as intravenous, intravascular, intraarterial, subcutaneous, intramuscular, intratumoral, intraperitoneal, intraventricular, and intradural, as well as oral, nasal, ophthalmic, rectal, and topical. Sustained release administration is also specifically included in the present disclosure, including by means of depot injections and erodible implants.

[0155] As mentioned above, the sensor RNA can be formulated with a pharma- ceutically acceptable carrier (one or more organic or inorganic components, natural or synthetic, with which the subject agent is combined to facilitate its application). Suitable carriers include sterile saline, but other aqueous and non-aqueous isotonic sterile solutions and suspensions known to be pharma- ceutically acceptable are known to those skilled in the art. An "effective amount" refers to an amount that can ameliorate or slow the progression of a disease, degenerative or damaging condition. An effective amount is determined on an individual basis, in part, taking into account the condition being treated and the results desired. An effective amount can be determined by one of ordinary skill in the art using such factors without more than routine experimentation.

[0156] The compositions can be administered in unit dosage form and can be prepared by any method known in the art. Such methods include combining the agent with a pharma- ceutically acceptable carrier or diluent, which constitutes one or more accessory ingredients. The pharma- ceutically acceptable carrier is selected based on the chosen route of administration and standard pharmaceutical practice. Each carrier must be "pharmaceutically acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the subject. The carrier may be solid or liquid, and the type is generally selected based on the type of administration being used.

[0157] Depending on the individual and condition being treated and the route of administration, the active agent may be administered in a dose of 0.01 mg to 500 mg per kg of body weight per day, e.g., about 20 mg per day for an average person, with the dose being appropriately adjusted for pediatric formulations.

[0158] In some embodiments, the composition is formulated in an aqueous buffer. Suitable aqueous buffers include, but are not limited to, acetate, succinate, citrate, and phosphate buffers, and vary in strength from 5 mM to 100 mM. In some embodiments, the aqueous buffer contains a reagent that provides an isotonic solution. Such reagents include, but are not limited to, sodium chloride, sugars, such as mannitol, dextrose, and sucrose. In some embodiments, the aqueous buffer further contains a non-ionic surfactant, such as polysorbate 20 or 80. Optionally, the composition can further contain a preservative. Suitable preservatives include, but are not limited to, benzyl alcohol, phenol, chlorobutanol, and benzalkonium chloride. In many cases, the composition is stored at about 4° C. The pharmaceutical composition can also be lyophilized, which generally includes a cryoprotectant, such as sucrose, trehalose, lactose, maltose, and mannitol. Lyophilized formulations can be stored for long periods at room temperature.

[0159] The composition can be prepared as an injectable in liquid solution or suspension; solid forms suitable for dissolving or suspending in liquid vehicles prior to injection can also be prepared. The formulation can also be emulsified or encapsulated in liposomes or microparticles such as polylactides, polyglycolides, copolymers, etc., to enhance adjuvant effect, as described above. Langer, Science 249:1527, 1990 and Hanes, Advanced Drug Delivery Reviews 28: 97-119, 1997. The composition of the present invention can be administered in the form of a depot injectable or implant formulation, which is formulated in such a way that it allows sustained or pulsatile release of the active ingredient. The pharmaceutical composition is generally sterile, substantially isotonic, and formulated in full compliance with the Good Manufacturing Practices (GMP) of the United States Food and Drug Administration (FDA).

[0160] As noted above, the compositions may also contain an adjunct agent for treating any of the diseases or conditions described above. When the disease or condition is cancer, the second agent is a chemotherapeutic agent. Chemotherapeutic agents that find use in the present disclosure include, but are not limited to, Abitrexate (methotrexate injection), Abraxane (paclitaxel injection), Adcetris (brentuximab vedotin injection), Adriamycin (doxorubicin), Adrucil injection (5-FU (fluorouracil)), Afinitor (everolimus), Afinitor Disperz (everolimus), Alimta (PEMET), and others. EXED), Alkeran Injection (Melphalan Injection), Alkeran Tablets (Melphalan), Aredia (Pamidronate), Arimidex (Anastrozole), Aromasin (Exemestane), Alanon (Nelarabine), Arzerra (Ofatumumab Injection), Avastin (Bevacizumab), Bexxar (Tositumomab), BiCNU (Carmustine), Blenoxane (Bleomycin), Bosulif (Bosutinib), Busul fex injection (Busulfan injection), Campath (alemtuzumab), Camptosar (irinotecan), Caprelsa (vandetanib), Casodex (bicalutamide), CeeNU (lomustine), CeeNU Dose Pack (lomustine), Cerubidine (daunorubicin), Clolar (clofarabine injection), Cometriq (cabozantinib), Cosmegen (dactinomycin), CytosarU (cytarabine), Cytoxan, Cytoxan Injection (cyclophosphamide injection), Dacogen (decitabine), DaunoXome (daunorubicin lipid complex injection), Decadron (dexamethasone), DepoCyt (cytarabine lipid complex injection), Dexamethasone Intensol (dexamethasone), DexpakTaperpak (dexamethasone), Dosefrez (docetaxel), Doxil (doxorubicin lipid complex injection), Droxia (hydroxyurea), DTIC (decalvagin), Eligard (leuprolide), Elence (Erence (epirubicin)), Eloxatin (Eloxatin (oxaliplatin)), Elspar (asparaginase), Emcyto (estramustine), Erbitux (cetuximab), Erivage (vismodegib), Erwinaze (asparaginase Erwinia chrysanthemi), Ethyol (Amifostine), Etopophos (Etoposide injection), Eulexin (Flutamide), Fareston (Toremifene), Faslodex (Fulvestrant), Femara (Letrozole), Firmagon (Degarelix injection), Fludara (Fludarabine), Folex (Methotrexate injection), Folotyn (Praratrexate injection), FUDR (Floxuridine), Gemzar (Gemcitabine), Gilotrif (Afatinib), Gleevec (Imatinib mesylate), Gliadel Wafer (Carmustine wafer), Halaven (Eribulin injection), Herceptin (Trastuzumab), Hexalen (Altretamine), Hycamtin (Topotecan), Hydrea (Hydroxyurea), lclusig (Ponatinib), Idamycin PFS (Idarubicin), Ifex (Ifosfamide), Inlyta (Axitinib), Intron A alfab (Interferon alfa-2a), Iressa (Gefitinib), Istodax (Romidepsin injection), Ixempra (Ixabepilone injection), Jakafi (Ruxolitinib), Jevtana (Cabazitaxelinjection), Kadcyla (ado-trastuzumab emtansine), Kyprolis (carfilzomib), Leukeran (chlorambucil), Leukin (sargramostim), Leystatin (cladribine), Lupron (leuprolide), Lupron Depot (leuprolide), Lupron Depot PED (leuprolide), Rhizodren (mitotane), Marchivo Kit (vincristine lipid complex injection), Matulan (procarbamide), Zin), Megase (megestrol), Mekinist (trametinib), Mesnex (mesna), Mesnex (mesna injection), Metastron (strontium-89 chloride), Mexate (methotrexate injection), Mustargen (mechlorethamine), Mutamycin (mitomycin), Myleran (busulfan), Mylotarg (gemtuzumab ozogamicin), Navelbine (vinorelbine), ), Neosar injection (cyclophosphamide injection), Neulasta (filgrastim), Neulasta (pegfilgrastim), Neupogen (filgrastim), Nexavar (sorafenib), Nilandrone (nilurutamide), Nipent (pentostatin), Nolvadex (tamoxifen), Novantrone (mitoxantrone), Oncaspar (pegaspargase), Oncovin (vincristine), Ontak (deniroxine) Diftitox), Onxol (paclitaxel injection), Panretin (alitretinoin), Paraplatin (carboplatin), Perjeta (pertuzumab injection), Platinol (cisplatin), Platinol (cisplatin injection), PlatinolAQ (cisplatin injection), PlatinolAQ (cisplatin injection), Pomalyst (pomalidomide), PrednisoneIntensol (Prednisone), Proleukin (Aldesleukin), Prinethol (Mercaptopurine), Reclast (Zoledronic Acid), Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Rituxan (Rituximab), Roferon A Alpha (Interferon Alpha-2a), Rubex (Doxorubicin), Sandostatin (Octreotide), Sandostatin LAR Depot (Octreotide), Soltamox (Tamoxifen), Sprycel (Dasatinib), StellaPred (Prednisone), StellaPred DS (Prednisone), Stivarga (Regorafenib), Supprelin LA (Histrelin Implant), Sutent (Sunitinib), Sylatron (Peginterferon Alfa-2b Injection (Sylatron), Synribo (Omacetaxine Injection), Tabloid (Thioguanine), Taflina (Dabrafenib), Tarceva (Erlotinib), Targretin Capsules (Bexarotene), Tasigna (Decarbazine), Taxol (Paclitaxel Injection), Taxotere (Docetaxel), Temodar (Temozolomide), Temodar (Temozolomide Injection), Tepadina (Thio-Tepa), Thalomid (Thalidomide), TheraCys BCG (BCG), Thioplex (Thio-Tepa), TICE BCG (BCG), Toposar (etoposide injection), Torisel (temsirolimus), Treanda (bendamustine hydrochloride), Trelstar (triptorelin injection), Trexall (methotrexate), Trisenox (arsenic trioxide), Tykerb (lapatinib), Valstar (intravesical valbicin), Vantas (histrelin implant), Vectibix (panitumumab), Velban (vinblastine), Velcade (bortezomib), Vepesid (etoposide), Vepesid (etoposide injection), Vesanoid (tretinoin), Vidaza (azacitidine), Vincasar PFS (vincristine), Vincrex (vincristine), Votrient (pazopanib), Vumon (teniposide), WellcovorinIV (Leucovorin injection), Xalkori (Crizotinib), Xeloda (Capecitabine), Xtandi (Enzalutamide), Yervoy (Ipilimumab injection), Zaltrap (Ziv-aflibercept injection), Zanosar (Streptozocin), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zoladex (Goserelin), Zolinza (Vorinostat), Zometa (Zoledronic These include immune checkpoint inhibitors such as nivolumab, pembrolizumab / MK-3475, pidilizumab, and AMP-224 that target PD-1; and BMS-935559, MEDI4736, MPDL3280A, and MSB0010718C that target PD-L1, and those that target CTLA-4, such as ipilimumab.

[0161] If the illness or condition is associated with an infection, the secondary agent will be an antibiotic. Antibiotics that find use in the present disclosure include, but are not limited to, antibiotics from the classes of aminoglycosides; carbapenems; penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, and the like; penicillins in combination with β-lactamase inhibitors; cephalosporins, such as cefaclor, cefazolin, cefuroxime, moxalactam, and the like; tetracyclines; cephalosporins; quinolones; lincomycins; macrolides; sulfonamides; glycopeptides (anti-infective antibiotics vancomycin, teicoplanin, telavantin, ramoplanin, decaplanin, and the like). Derivatives of vancomycin include, for example, oritavancin and dalbavancin, both lipoglycopeptides. Telavancin is a semisynthetic lipoglycopeptide derivative of vancomycin (FDA approved in 2009). Other vancomycin analogs are disclosed, for example, in WO 2015022335 A1 and Chen et al. (2003) PNAS 100(10):5658-5663, each of which is specifically incorporated herein by reference. Non-limiting examples of antibiotics include vancomycin, linezolid, azithromycin, daptomycin, colistin, eperezolid, fusidic acid, rifampicin, tetracycline, fidaxomicin, clindamycin, lincomycin, rifalazil, clarithromycin, and the like. Kitz

[0162] Also provided is a kit for carrying out the method according to the present disclosure.Generally, the subject kit can include sensor RNA as described above.Sensor RNA can be included in lipid nanoparticles or can be included in recombinant vector as described above.In some cases, the kit further includes ADAR protein or its coding sequence.When the kit includes ADAR coding sequence, it can be in recombinant vector as described above.When the kit includes ADAR protein or its coding sequence, the ADAR protein can be any ADAR protein described above.

[0163] In some cases, the kit may further comprise a positive control and / or a negative control. The positive control may be in the form of a biological sample that contains target RNA, a sensor RNA that contains an edited codon (i.e., a stop codon that is edited to be a non-stop codon, or a start codon that is edited to be a non-start codon, or a non-start codon that is edited to be a start codon), or a sensor RNA that contains the nucleotide sequence of target RNA. The negative control may be in the form of a biological sample that does not contain target RNA.

[0164] The subject kit can include any combination of components for carrying out the methods of the present disclosure. The components of the subject kit can be present as a mixture or as separate entities. In some cases, the components are present as a lyophilized mixture. In some cases, the components are present as a liquid mixture. The components of the subject kit can be in the same container or separate containers and can be combined in any combination.

[0165] The subject kits may further include instructions for carrying out the subject methods (in certain embodiments). These instructions may be present in one or more of the subject kits in a variety of forms. These instructions are one form in which they may be present as information printed on a suitable medium or substrate, such as a piece of paper or strips of paper on which the information is printed, the kit packaging, a package insert, and the like. Yet another form of these instructions is a computer readable medium on which the information is recorded, such as a diskette, a compact disc (CD), a flash drive, and the like. Yet another form of these instructions is a website address for accessing the information at a remote site via the Internet. Examples of Use

[0166] The following examples are provided to provide those of skill in the art with a complete disclosure and description of how to make and use the invention, and are not intended to limit the scope of what the inventors regard as the invention, nor are they intended to represent the following experiments as all or only experimental. Efforts have been made to ensure accuracy with respect to numbers used (amounts, temperatures, etc.), but some experimental error or deviation must be accounted for. Unless otherwise noted, parts are parts by weight, molecular weight is weight average molecular weight, temperature is degrees Celsius, and pressure is at or near atmospheric pressure. Standard abbreviations may be used, such as bp, base pairs; kb, kilobases; pl, picoliters; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acids; nt, nucleotides; im, intramuscular (ly); ip, intraperitoneal (ly); sc, subcutaneous (ly); and the like. Example 1

[0167] RADAR sensors are inspired by recent advances in RNA editing (Katrekar, D. et al. Methods 16, 239-242; Qu, L. et al. (2019) Nat. Biotechnol.37, 1059-1069; Merkle, T. et al. (2019) Nat. Biotechnol.37, 133-138; Reautschnig, P. et al. (2022) Nat. Biotechnol.1-10). They consist of three parts: a marker coding sequence, a sensor sequence that is complementary to the target RNA of interest (the "trigger" or "target") but has a C:A mismatch that promotes editing at a central UAG stop codon (alternative pairings can also be used), and an output coding sequence (Fig. 1a). The stop codon inhibits translation of the output CDS so that only the marker (e.g. mCherry) is expressed. In the presence of a trigger, double-stranded RNA (dsRNA) is formed, which recruits ADARs to edit the adenosine (A) of UAG to inosine (I), allowing translation of the downstream CDS (e.g., EGFP). A “self-cleaving” 2A sequence (Loughran, G. et al. (2017) RNA NY N 23, 1285-1289) insulates the flanking CDS from the variable sense sequence. To find trigger sequences, we first focused on the 3’ untranslated region (UTR), because compared to trigger sequences contained in CDSs, they do not encounter translating ribosomes that could affect or be affected by dsRNA, and any changes that occur in the 3’UTR as a result of unintended ADAR editing are less likely to cause deleterious consequences. Most human (57%) and mouse (73%) genes have at least one reported 90-bp trigger candidate 3’UTR variant.

[0168] We first validated RADAR in human embryonic kidney (HEK) cells using a de novo designed trigger T1 embedded in the 3'UTR of the co-transgene (Fig. 1b). The output of the corresponding sensor S1 is dependent on ADAR and is most enhanced by the p150 isoform of ADAR1 (Fig. 1b, Fig. 3d-g). We found that the S1 output was strongly correlated with the T1 plasmid input over two orders of magnitude and was approximately a linear function (Fig. 1c). RADAR output is modular, as Cre recombinase, a useful tool in neurobiology (Luo, L. et al. (2018) Neuron 98, 256-281), can be utilized as an alternative output (Fig. 1d).

[0169] We then validated RADAR in a scenario closer to our final use case. First, in addition to a transiently introduced trigger plasmid, output increased in response to doxycycline-induced expression of T1 embedded in the 3'UTR of genomically integrated EGFP (Fig. 1e). EGFP levels were not adversely affected by the presence of S1 (Fig. 4e). Second, to test whether our design would work in the complex context of the native 3'UTR, we took advantage of mouse-human orthogonality to design a sensor, SBdnf, against a partial sequence within the 2.9 kb 3'UTR of mouse Bdnf for an explicit test. We observed a significant response of SBdnf to the Bdnf 3' UTR expressed in HEK cells (Fig. 1f). Finally, we examined a sensor against the 3'UTR of DNAJB1, a member of the hsp40 heat shock response protein family. While the T1 sensor was unaffected, the output of SDNAJB1 was significantly increased by heat shock (Fig. 1g). This suggests that SDNAJB1 specifically detects endogenous DNAJB1 expression. We further evaluated a GAPDH sensor and demonstrated that the sensor could detect the change in GAPDH levels following siRNA knockdown (Fig. 1g).

[0170] We next explored strategies to expand coverage of the human / mouse transcriptome. First, we observed that the performance of RADAR was largely maintained up to 72bp dsRNA when using the 3'UTR of Bdnf (Fig. 1h). Second, inspired by the results of a study showing that ADAR enzymes tolerate or even benefit from the destruction of target dsRNA (Uzonyi, A. et al. Cell), we verified that the signal from the non-functional 36bp sensor could be rescued by introducing an additional 54bp sequence complementary to another part of the long Bdnf 3'UTR, forming a "split" design (Fig. 1i). Such split designs offer great flexibility for several scenarios: skipping undesirable reverse-complementary stop codons, skipping complex secondary structures, miRNA binding sites, or other functional features of the trigger RNA, distinguishing between homologs that share a CCA-containing sequence but have unique regions present elsewhere, and detecting gene fusions or alternatively spliced ​​transcripts where the unique junction cannot be directly sensed (no CCA in the vicinity of the junction). Finally, although less ideal than the 3'UTR sensor (Figure 4d-f), we validated that the CDS sensor for EGFP (SEGFP) showed a significant response to trigger induction (Figure 1j), providing an alternative if needed but at the same time reaffirming our initial prioritization of the 3'UTR.

[0171] Combining the ability to shorten sensors, use split designs, and sense CDSs, over 85% of human (Fig. 1k, Fig. 4g) and mouse (Fig. 4h) genes have at least one candidate trigger sequence that fits RADAR.

[0172] Overexpression of ADARs significantly improves the dynamic range of RADARs, but can result in deleterious side effects. To ameliorate this potential issue, we utilized an artificial version of ADARs ("ADAR(DD)-MCP") that contains only the mutant deaminase domain of ADAR2 and the MS2 RNA-binding protein MCP (Katrekar, D. et al. (2019) Nat. Methods 16, 239-242; Biswas, J. et al. (2020) iScience 23, 101318). By combining this enzyme with the MS2 sensor, we achieved a similar dynamic range as overexpression of ADAR1p150 (Fig. 1l). Importantly, ADAR(DD)-MCP did not affect the original MS2-deficient sensor (Fig. 1l), suggesting that this "orthogonal" ADAR is less able to edit endogenous dsRNA structures.

[0173] RADAR has several unique features and potential applications. For example, RADAR can be used for cell sorting (Fig. 2a). RADAR can also integrate multiple inputs using OR and logic (Fig. 2b, 2c). For the latter, two sensor sequences can simply be concatenated such that both stop codons must be edited for output expression.

[0174] Cellular states are often defined not only by RNA expression levels, especially in medical contexts, but also by the presence of novel RNA sequences. We exploited the unique capabilities of RADAR to sense the latter. First, because ADAR is sensitive to the identity of the bases surrounding edited adenosines (Qu, L. et al. Biotechnol. 37, 1059-1069), RADAR is uniquely suited to discriminate specific short genetic variants. As a demonstration, we developed a single-base discriminator (Fig. 2d) as well as two common oncogenic mutations in TP53 associated with distinct invasive traits in cancer cells (Yoshikawa, K. et al. Res. 31, 401-411) (Fig. 2d). We found that ~5% of known or likely pathogenic variants reported in ClinVar could be distinguished from wild-type alleles using RADAR. Second, because gene fusions drive many cancers (Gao, Q. et al. (2018) Cell Rep. 23, 227-238.e3), the split design provides a way to sense such fusions. We confirmed that the sensor responds better to split trigger sequences present on the same transcript compared to the same trigger sequences on separate transcripts (Figure 4i), suggesting the feasibility of a fusion-specific sensor.

[0175] The mutant pair with 10 on / off ratios shown in Fig. 2d [Table 2-1]

[0176] [Table 2-2]

[0177] [Table 2-3]

[0178] [Table 2-4]

[0179]

Table 2-5

[0180]

Table 2-6

[0181]

Table 2-7

[0182]

Table 2-8

[0183]

Table 2-9

[0184]

Table 2-10

[0185]

Table 2-11

[0186]

Table 2-12

[0187]

Table 2-13

[0188]

Table 2-14

[0189] [Table 2-15]

[0190] [Table 2-16]

[0191] [Table 2-17]

[0192] [Table 2-18]

[0193] [Table 2-19]

[0194] [Table 2-20]

[0195] Finally, to demonstrate that RADAR is a self-contained module, we evaluated RADAR in plants, an organism that lacks endogenous ADARs. Without any optimization other than switching to a plant promoter and vector, we observed an increase in fluorescence output in response to a matching T1 trigger compared to a non-matching trigger in the Nicotiana benthamiana model system (Figure 2e).

[0196] Here, we demonstrate that ADAR editing can be exploited to create modular, programmable molecular devices capable of sensing a wide variety of RNAs. One of the key directions for future improvements of RADAR is to increase the input sensitivity to accommodate more endogenous RNA expression levels (Fig. 4a-c). Designing new sensors is straightforward thanks to the base pairing rules. Plasmids encoding new sensors can be generated in 2 days after receiving short oligonucleotides using standard techniques. Since all RADAR components are deliverable via mRNA, a wide range of existing RNA synthetic biology tools (Dykstra, PB et al. (2022) Nat.Rev. Genet.1-14) as well as advances in RNA nanotechnology (Groves, B. et al.Nanotechnol.11, 287-294) can be combined with RADAR to generate cell classifiers, research tools, and smart dynamic therapeutics. For example, RADAR sensors can be used to track and study the process of cells becoming infected by viruses, transforming from normal cells to precancerous, cancerous, metastatic, or senescent cells. By integrating multiple inputs, RADAR allows high specificity and low off-target effects for downstream interventions. It is particularly suitable for increasing the specificity of RNA-based vaccinations and gene therapies, the power of which was recently demonstrated during the pandemic. RADAR can be loaded onto viruses and other genetic vectors to achieve cell-type specific expression, thus eliminating the need for promoter identification, a major hurdle in incorporating new organisms into bioengineering and genetics-driven research.

[0197] The methods herein have numerous possible applications. RADAR can be used for feedback gene editing, where a gene editing enzyme can be turned off when a mutation of interest is detected, reducing off-target editing. RADAR can be used for feedback gene expression for gene therapy, where a transcription factor can be produced either positively or negatively in response to the gene it controls. This allows precise control over the expression level of that gene. RADAR can be used for markerless cell therapy screening. In cell therapy, cells must be faithfully edited / engineered, but this is often difficult to achieve without a selectable marker (which is undesirable to use in most cases). RADAR can be used to temporarily select cells of interest. RADAR can be used to detect plant pathogens such as viruses. RADAR can be used to deliver oncolytics and senolytics, killing diseased cells. RADAR can be used to engineer cells based on cell type or state. For example, we might sense markers of T cell exhaustion to modify the behavior of a T cell therapy, or detect whether a cell is a suitable dendritic cell to express an antigen for a "tolerizing vaccine" (antigens expressed by certain dendritic cells make the body tolerant to it, so this is a kind of allergy treatment). For example, alphaviruses and rabies viruses have been engineered for various purposes, including self-amplifying RNA vaccines and therapeutics such as cancer treatments, and our system could be used to control it, for example to regulate dosage or longevity by negative feedback). Our system could be part of an RNA virus package or a separate co-delivered module. For example, in a cell infected with a retrovirus like HIV, we might not want to express an RNA-based therapy. So our system could detect the presence of HIV RNA and shut it down so that the RNA does not integrate into the genome. (Of course, we could also administer therapeutics or inhibitors to latently infected HIV).RADAR can also be used for in vitro fertilization screening of fertilized eggs.

[0198] Generating plasmids. Plasmids were generated using standard molecular cloning methods, including InFusion of linearized plasmids and PCR fragments, and restriction ligation of linearized fragments and annealed phosphorylated oligonucleotides. A complete list of plasmids and associated maps is in Table 3. Plasmids are available upon request from the corresponding author and will be deposited at Addgene. Human ADAR plasmids and ADAR1 knockout cell lines were generously provided by Prof. Billy Lee. Cre and Cre reporter plasmids were kindly provided by Prof. Li-Kun Luo. pUBC_stdMCP_serinemod_E488QADAR_p2A_yGFP ("ADAR(DD)-MCP") was a gift from Robert Singer (Addgene plasmid # 154787;).

[0199] List of plasmids used [Table 3-1]

[0200] [Table 3-2]

[0201] [Table 3-3]

[0202] Tissue culture. Flp-In T-REx Human Embryonic Kidney (HEK) 293 cells were purchased from Thermo Scientific (catalog number R78007). Cells were cultured in Dulbecco's Modified Eagle's Medium supplemented with 10% fetal bovine serum (Fisher Scientific catalog #FB12999102) under standard culture conditions (37°C, 5% CO2) in a humidity-controlled incubator. Cells were cultured in Dulbecco's Modified Eagle's Medium supplemented with 1 mM sodium pyruvate (EMD Millipore catalog #TMS-005-C), 1x penicillin-streptomycin (Genesee catalog #25-512), 2 mM L-glutamine (Genesee catalog #25-509), 1x MEM non-essential amino acids (Genesee catalog #25-536) under standard culture conditions (37°C, 5% CO2). To induce expression of specific constructs, 100ng / mL doxycycline was added at the time of transfection. Cell lines containing inducible triggers were generated by transfecting constructs into the PiggyBac backbone together with PiggyBac integrase (4:1) and adding 50ug / mL hygromycin for selection when reseeding into 10cm dishes 2 days after transfection.

[0203] Transient transfections. HEK 293 cells were cultured under standard culture conditions in 24-well or 96-well tissue culture treated plates. When cells were 70-90% confluent, cells were transiently transfected with plasmid constructs using jetOPTIMUSR DNA transfection reagent (Polyplus catalog # 117-15) according to the manufacturer's instructions, using 0.375 uL of reagent per 50 uL of jetOPTIMUS buffer for 500 ng DNA transfection in 24-well format and 0.13 uL of reagent per 12.5 uL of buffer for 130 ng DNA transfection in 96-well format. All transfections are detailed in Table 4. Table 4. Transfections were performed. 24-well format: Seed approximately 100,000 cells. Dissolve 0.375 uL of jetOptimus reagent in 50 uL of jetOptimus buffer and use for transfection the next day. 500ng total DNA per condition, remainder filler plasmid. 96-well format: Seed approximately 25,000 cells. Dissolve 0.13uL jetOptimus reagent in 12.5uL jetOptimus buffer for transfection the next day. 130ng total DNA per condition, remainder filler plasmid. Infiltrated plants: Agrobacteria were electroporated separately with each plasmid. Overnight inoculations were confirmed by colony PCR. Cultures were diluted to OD 0.9 and equal volumes were combined for infiltration.

[0204] [Table 4-1-1]

[0205] [Table 4-1-2]

[0206] [Table 4-1-3]

[0207]

Table 4-1-4

[0208]

Table 4-1-5

[0209]

Table 4-1-6

[0210]

Table 4-1-7

[0211]

Table 4-1-8

[0212]

Table 4-1-9

[0213]

Table 4-1-10

[0214]

Table 4-1-11

[0215]

Table 4-1-12

[0216]

Table 4-1-13

[0217] [Table 4-1-14]

[0218] [Table 4-1-15]

[0219] [Table 4-1-16]

[0220] Flow cytometry and data analysis. Approximately 48 hours after transfection, cells were harvested by trypsinization and suspended in flow buffer (HBSS + 2.5mg / mL bovine serum albumin). After 40um filtration, cells were analyzed by flow cytometry (Biorad ZE5 Cell Analyzer) and data were processed with the cytoflow Python package. An overview of gating and analysis is shown in Figure 3a and 3b.

[0221] RNA extraction and reverse transcription. HEK293T cells grown in 24-well plates were spun down and RNA was extracted using the following kits: RNAasy mini kit (Qiagen), RNase-Free DNase Set (Qiagen), and QIAshredder (Qiagen). After extraction, 500 ng was analyzed on a 1% agarose gel to assess RNA quality. 500 ng of purified RNA was reverse transcribed using iScript cDNA synthesis (Biorad). cDNA was sent to Genewiez / Azenta with matching primers for Sanger sequencing.

[0222] qPCR measurements. qPCR was performed using SYBR-Green in a QuantStudio3 (Applied Biosystems). RNA estimates were calculated based on a standard curve of purified plasmid and normalized to the Ct threshold. The primer pair sequences for GFP (Signagen) and normalization gene (β-actin) were as follows: GFP-F AAGCAGAAGAACGGCATCAA (SEQ ID NO: 10), GFP-r TCCAGCAGGACCATGTGATC (SEQ ID NO: 11), β-actin-F CGTCCACCGCAAATGCTT (SEQ ID NO: 12), β-actin-R GTTTTCTGCGCAAGTTAGTTGT (SEQ ID NO: 13).

[0223] Leaf infiltration and analysis. Three Nicotiana benthamiana leaves were infiltrated with Agrobacterium transformed separately with RADAR components (sensor and human ADAR1p150) and their matched or unrelated triggers. Quantification based on the average of mean fluorescence intensity from six rectangular areas per infiltration spot. EGFP (output) fluorescence was normalized using mCherry (marker) fluorescence intensity.

[0224] Statistical analysis was performed. Values ​​are reported as the mean from at least three biological replicates, representative of two independent biological experiments. In experiments comparing two groups, a two-tailed Student's t-test with Bonferroni correction was used to assess significance.

[0225] Bioinformatics We analyzed all genes with annotated 3'UTRs in the human genome in search of trigger sequences that fit the RADAR design. Then, we also considered all genes with CDS annotations. 3'UTR and CDS sequences were obtained from Ensembl Biomart. Candidates had to have a 5'CCA 3' sequence (which is paired with the 5'UAG 3' of the sensor) flanked by a sufficiently long sequence. Furthermore, the trigger sequence had to be unique (assessed by mapping to the genome) and the sensor sequence had to be readily synthesizable (no homopolymer runs and GC content 35-80%). We used the hg38 genome build for human transcriptome analysis and the GRCm39 build for murine transcriptome analysis. We used the blastn tool version 2.9.0+ with the arguments -task blastn -evalue 1, with further filtering by alignment length (minimum 30 matches) and position (must overlap with central CCA or alternative sequence). Results from overlapping alternative chromosomes were removed. Some designs were discarded due to the presence of pseudogenes or other repeat regions that may or may not be expressed as RNA. Because sequences other than the UAG:CCA pair can be efficiently edited, we also analyzed candidate trigger sequences centered on GCA, UCA, and CAA sequences.

[0226] The 20211025 release of ClinVar was used to analyze the detectability of known and likely pathogenic variants, assuming that UAG can be edited if paired with any of CAA, CUA, CGA, ACA, UCA, GCA, CCA, CCU, or CCC. (Qu, L. et al. (2019) Nat.Biotechnol.37, 1059-1069). The alternative and reference alleles were padded with one base on each side based on the hg38 reference genome. A variant was considered distinguishable by RADAR if the padded alternative allele contained one of the editing-triggering variants, but the padded reference gene did not. Example 2 Standard Radar

[0227] In vitro transcribed mRNA and pseudouridine incorporation. The RADAR design does not require any special modifications (i.e., the mRNA can be produced in cells from DNA plasmids or in vitro using standard nucleotides), but in some cases modifications can prevent this.

[0228] One such modification is pseudouridine (Ψ), especially N1-methyl-pseudouridine, which is used to reduce the immunogenicity of synthetic mRNA. Typically, in IVT mRNA, all uridine (U) bases are replaced with pseudouridine by supplying the modified nucleoside triphosphate instead of UTP in the reaction. However, Ψ negatively impacts ADAR editing. Moreover, it is particularly unfavorable for RADARs, as it increases stop codon readthrough. The off state appears less "off" due to increased readthrough, and the on state appears less "on" due to reduced editing.

[0229] ΨAG may be particularly affected in terms of editing, since if a UAG stop codon is used, there will be increased base stacking between Ψ and A, preventing the necessary A base inversion. A UGA stop codon, especially when followed by a G (UGAg), may be helpful in this case. Although ΨGAg does not place the modified base directly next to the A, the 5'G also reduces A editing. In addition to affecting the catalytic portion of ADAR editing, Ψ also affects the dsRNA binding ability of ADARs.

[0230] To generate IVT mRNA, we amplified sensor or trigger plasmids containing a T7 promoter, TEV 5' leader UTR, and hybrid 3' UTR, and added a 120-base polyA tail. PCR amplicons were purified and IVT reactions were performed using CleanCap AG reagent, ATP, GTP, CTP, and T7 polymerase as template in the presence of mouse RNase inhibitor. Fidelity of IVT mRNA was checked on gel, DNA was removed with DNase I, and mRNA was purified using the QIAgen RNeasy mini kit. mRNA was transfected with 500 ng of total mRNA per well in a 24-well format using the TransIT-mRNA kit, and flow cytometry was performed after 20 hours. ADARs were not overexpressed in the mRNA experiments, which relied only on wild-type expression levels of ADAR1 in HEK293 cells. The trigger was located in the 3'UTR of BFP, and a control sequence was used for the "no input" condition; in both conditions, 200 ng of sensor and 300 ng of BFP mRNA (with either matched or mismatched trigger sequences) were administered.

[0231] Upon full incorporation of pseudouridine, the functionality of the sensor was indeed greatly diminished, by both an increased baseline and a reduced trigger-dependent activation, but it was not lost completely (Figs. 8 and 10). However, satisfactory performance could be obtained by using intermediate levels of random pseudouridine.

[0232] Analysis of UAG:NNN. To understand the detection capability of nucleotide variants (single- and multi-nucleotide variants, SNVs and MNVs), we examined all 5'NNN 3' trigger sequences opposite the UAG stop codon.

[0233] The triggering ability of 64 5'NNN 3' sequences differs in the two logs (Fig. 10 and Fig. 11). The 64 × 64 NNN-NNN pairing matrices can be compared, one of which is in the "off" state and the other in the "on" state. The output fluorescence levels must be sufficiently different to distinguish the two states. The difference with the on-off activation ratio (Fig. 12) was characteristic. Many of the 4,096 NNN-NNN pairs can be distinguished by a high on-off ratio (Fig. 6). Specifically, many of the 576 NNN-NNN pairs that differ at only one position (i.e., SNVs) can also be distinguished by a high on-off ratio (Fig. 13).

[0234] Effect of bulges near UAG / CCA. Mismatches were inserted near the CCA:UAG pair in the trigger strand. None of the mismatches tested, either 5' or 3', had a strong effect on the performance of the sensor (Figure 15). ModulADAR / "OffsetRADAR"

[0235] Previously termed "offset RADAR," this mechanism separates the canonical RADARs from their RNA binding and RNA editing functions.

[0236] The sensor consists of: (1) a UAG / UGA / UAA stop codon in a stem-loop surrounded by sequences complementary to the trigger RNA, (2) a 2A tag, and (3) an output protein. An optional marker+2A tag can be added in front of the sensor RNA.

[0237] The mechanism sensor and trigger form dsRNA around the stem-loop, which recruits the ADAR, which then edits out the stop codon within the stem-loop to allow translation of the downstream output.

[0238] Stem-loops can be selected from naturally occurring ADAR editing sites or from library screens. Importantly, the stem-loop must not be edited without the formation of an extended dsRNA; otherwise, the dsRNA will be edited by the ADAR without being formed. The stem-loop is usually located in the center of the sequence complementary to the trigger RNA, but this position can be varied (e.g., 5' of the complementary region, 3' of the complementary region, or somewhere in between).

[0239] This is the key to the novelty, as such a design was not anticipated in international application PCT / US2022 / 033459 or in Qian et al.'s Nature 2022.

[0240] Portions of stem-loops from natural ADAR editing substrates have previously been incorporated into guide RNAs for the purpose of editing endogenous RNAs (as opposed to editing foreign RNAs such as the sensor RNAs described here) (e.g., Fukuda et al., 2013). However, whereas the stem-loops in those examples were truncated to include the portion that interacts with the ADAR dsRNA-binding domain, here the stem-loop is truncated to the portion that interacts with and is edited by the ADAR catalytic domain. Other types of stem-loops that are not targets for ADAR editing have also been introduced into other guide RNAs for the purpose of recruiting artificial ADAR enzymes to edit endogenous RNAs; such stem-loops include MS2 hairpins to recruit MCP-ADAR(DD)s (e.g., Azad et al., Gene Therapy 2017 and International Application PCT / US2022 / 033459) or Cas13-binding hairpins to recruit dCas13b-ADAR(DD)s (e.g., Cox et al., Science However, in those applications, the stem-loop does not function as an editing substrate containing an editable codon as in this case, but is used to recruit an artificial ADAR, whereas in ModulADAR, the dsRNA formed by the sensor and trigger RNA recruits a native ADAR.

[0241] A major advantage of varying the editing substrate is that editing can be deeply optimized separately from binding. ADAR enzymes have a dsRNA-binding domain with poor substrate specificity and a separate catalytic deaminase domain with some substrate preference. In a standard RADAR setup, the sensor dsRNA around the editing site is determined by the sequence of the trigger RNA, so optimization of ADAR binding and editing is joint. In a standard setup, the UAG stop codon is chosen because it is the most robust, especially when immediately paired with CCA. In ModulADAR designs, other stop codons can be utilized, which may be advantageous, for example, because UAA stop codons generally have less readthrough than UAG, or UGA (UGAG, especially if followed by G) may be less susceptible to uridine modification than UAG.

[0242] In standard designs, each sequence must have a CCA (or a small number of alternatives) that base pairs with UAG for efficient editing, but there is no such requirement here.

[0243] In principle, such an approach (separating ADAR binding and editing) can also be applied to the "uORF", "AUA", and "AUG" approaches described in this disclosure. A list of natural editing targets with suitable motifs that can be used in each case is prioritized. By making the editing substrate an independent, trigger-independent, separate sequence, motifs larger than 3 bases before the stop codon can be used. For example, a strong Kozak sequence can be included before the non-start codon (AUA) or start codon (AUG), without the need to find the reverse complement of such a sequence in the trigger RNA, as would be necessary if editing occurred in a duplex formed by the sensor RNA and the trigger RNA.

[0244] Selection of the stem-loop The choice of the stem-loop containing the stop codon is crucial: successful editing should occur when the ADAR is localized by the formation of dsRNA, but not in the absence of the additional dsRNA formed by the sensor and trigger.

[0245] One source of stem-loops is natural editing sites. These stem-loops generally have stems long enough for the dsRNA-binding domain of ADAR enzymes to bind. For use in ModulADAR, the stem needs to be shortened to only the portion that binds the catalytic domain of ADAR.

[0246] The stem loop should be inserted into the sensor such that UAG is in-frame with the coding sequence. Natural editing sites containing UGA or UAA also exist. In sequences containing UAA, both As should be naturally edited. Any other in-frame stop codons should be deleted. They may be left in if they are efficiently edited by colocalization of ADAR.

[0247] Natural editing sites in the human genome have been catalogued (Gabay et al., Nature Communications 2022), specifically from the GLURB, CAPS1, GLI1, GABRA3, and HT2RC genes.

[0248] Stem-loops are generated in the library and evaluated for performance. Based on the available structures, the contact area of ​​the ADAR2 deaminase domain is about 12 bp, so the stems tested in this method should be about 9-30 bp, where the size of the stem refers to the base-paired portion of the stem-loop. Results

[0249] Basic characterization. The ModulADAR design works well when the stem-loop from GLURB (aka GLUR2, GRIA2) is placed in the center of the complementary region (Figure 17). Further refinements were made by exploring other natural editing sites placed within the sensor nucleotide sequence from genes including CAPS1, GLI1, and GABRA3 (Figures 27 and 28). For example, stem-loop mutant #4 (intact GLI1) and stem-loop mutant #5 (truncated GLI1) show reduced performance due to increased trigger-independent signaling (Figure 28). By shortening the stem, editing becomes conditional on the dsRNA formed by the sensor and trigger, as envisioned in the ModulADAR design. A similar, albeit smaller, trend was observed for the two mutants from GABRA3, with the long stem-loop mutant #6 showing a higher baseline than the short one #7 (Figure 28). Importantly, the conditions in the presence of the trigger are similar in these comparisons, again supporting a mechanism in which the dsRNA formed by the sensor and trigger (which is the same in these comparisons) recruits the ADAR, followed by editing of the substrate that is part of the stem-loop. Changing the stop codon of the stem-loop from GLURB to UAA did not work (Figure 28), likely due to the need to edit two adenosines. Adding a mismatch so that both adenosines of the UAA codon are opposite cytosines did not improve performance. Alternatively, one could use a natural site with a UAA sequence, for example as found in HT2RC. The CAPS1 gene has a natural editing site with a UGA subsequence, which we used here to evaluate the third stop codon option (Figure 28).

[0250] OR logic. OR logic in the standard case (without editable stem-loops) is achieved by co-delivering two separate RNAs with different inputs. That is, if you have two inputs, A and B, the output dose from just "A" is about 50%, the output dose from just "B" is about 50%, and the output dose from both "A" and "B" is 100%.

[0251] The ModulADAR technology allows us to create a one-molecule OR gate where the output from all cases (only "A", only "B", or both "A" and "B") is nearly the same (Figure 25). This is not possible when editing occurs in the dsRNA duplex, which requires the use of two different molecules as described above. uORF Radar

[0252] The sensor consists of: (1) an AUG surrounded by sequences complementary to the trigger RNA; (2) an output (with an AUG). The first AUG is critically offset from the output AUG, so that the first reading frame acts as an "upstream open reading frame" and inhibits translation from the start codon of the output AUG.

[0253] Mechanism The first AUG is configured to be edited into an IUG upon dsRNA formation. The IUG (GUG) is no longer an initiation codon, turning off the upstream reading frame and allowing the downstream frame to be translated.

[0254] Ideally, the upstream reading frame is long, approximately the same length as the correct downstream reading frame, and there should be no other AUGs in the sensor sequence.

[0255] Two uORFs can be placed in series to make an AND gate (both inputs must be present to remove both uORFs).

[0256] result

[0257] Basic characterization using nuclear localization trigger RNA. The uORF machinery works best with overexpression of ADAR2 (Figure 18). The uORF machinery achieved approximately 29% of the positive control level (Figure 19). The output of the uORF machinery is greatly improved by removing the stop codon from the output protein that is in frame with the uORF, such that the uORF generates a long reading frame (Figure 20). Placing two uORFs in tandem results in an AND gate. AUG radar

[0258] This design is derived from the "uORF" design, but rather than editing an upstream reading frame, it directly edits the AUG in the output reading frame.

[0259] The sensor consists of: (1) an AUG start codon surrounded by sequences complementary to the trigger RNA, (2) a 2A tag, and (3) an output. All components are in frame with each other.

[0260] The mechanism AUG is configured to be edited to IUG upon dsRNA formation. IUG(GUG) is no longer an initiation codon, disabling translation of the output protein.

[0261] Here, the output is turned off in response to the input ("NOT X" type logic), whereas in other designs the output is turned on in response to the input.

[0262] There should be no in-frame AUG sequences in the sensor that would allow functional production of the output protein. There should be no in-frame stop codons downstream of the AUG.

[0263] AUG RADAR is similar to uORF RADAR, except that there is no second downstream reading frame, and the "upstream" reading frame contains the desired output.

[0264] Basic characterization. The AUG mechanism operates on cytoplasmic trigger mRNAs (i.e., typical mRNAs). AUA Radar

[0265] The sensor consists of: (1) an AUA surrounded by sequences complementary to the trigger RNA, (2) a 2A tag, and (3) an output (without AUG). All components are in frame with each other.

[0266] The mechanism AUI (AUG) functions as an initiation codon, allowing the translation of an output protein that would otherwise not be translated.

[0267] There should be no in-frame AUG sequences within the sensor that would allow functional production of the output protein. The sensor should not have an in-frame stop codon downstream of the AUA.

[0268] It helps that they have a long overlapping reading frame separate from the main frame, which stabilizes the RNA in its "off" state.

[0269] Placing two AUA sensors in series achieves the OR logic with a single RNA strand (versus two RNA strands in standard RADAR designs).

[0270] This is a basic characterization. The AUA mechanism works best with overexpression of ADAR2 (Figure 24).

[0271] It is also possible to mix and match different varieties for different logic functions. Under RADAR there is the standard RADAR and ModulADAR.

[0272] Sensor Architecture Combination [Table 4-2] References 1. Kulkarni, A., Anderson, A.G., Merullo, D.P. & Konopka, G. Curr. Opin. Biotechnol. 58, 129-136 (2019). 2. Xie, Z., Liu, S. J., Bleris, L. & Benenson, Y. Nucleic Acids Res. 38, 2692-2701 (2010). 3. Xie, Z., Wroblewska, L., Prochazka, L., Weiss, R. & Benenson, Y. Science 333, 1307-1311 (2011). 4. Han, S. et al. Mol. Ther. - Nucleic Acids 27, 797-809 (2022). 5. Ying, Z.-M., Wang, F., Chu, X., Yu, R.-Q. & Jiang, J.-H. Angew. Chem. Int. Ed. 59, 18599-18604 (2020). 6. Lin, J., Wang, W.-J., Wang, Y., Liu, Y. & Xu, L. J. Am. Chem. Soc. 143, 19834-19843 (2021). 7. Hochrein, L.M., Li, H. & Pierce, N.A. ACS Synth. Biol. (2021).doi:10.1021 / acssynbio.1c00037 8. Zhao, E. M. et al. Nat. Biotechnol. 1-7 (2021).doi:10.1038 / s41587-021-01068-2 9. Hur, S. Annu. Rev. Immunol. 37, 349-375 (2019). 10. Gatsiou, A., Vlachogiannis, N., Lunella, F.F., Sachse, M. & Stellos, K. Antioxid. Redox Signal. 29, 846-863 (2017). 11. Goodman, R.A., Macbeth, M.R. & Beal, P.A. Adenosine Deaminases Act. RNA ADARs -- Ed. 1-33 (2012).doi:10.1007 / 82_2011_144 12. Gallo, A., Vukic, D., Michalik, D., O'Connell, M.A. & Keegan, L.P. Hum. Genet. 136,1265-1278 (2017). 13. Wang, Y., Zheng, Y. & Beal, P. A. The Enzymes 41, 215-268 (2017). 14. Katrekar, D. et al. Nat. Methods 16, 239-242 (2019). 15. Qu, L. et al. Nat. Biotechnol. 37, 1059-1069 (2019). 16. Merkle, T. et al. Nat. Biotechnol. 37, 133-138 (2019). 17. Reautschnig, P. et al. Nat. Biotechnol. 1-10 (2022).doi:10.1038 / s41587-021-01105-0 18. Loughran, G., Howard, M. T., Firth, A. E. & Atkins, J. F. RNA NY N 23, 1285-1289 (2017). 19. Luo, L., Callaway, E. M. & Svoboda, K. Neuron 98, 256-281 (2018). 20. Uzonyi, A. et al. Mol. Cell (2021).doi:10.1016 / j.molcel.2021.03.024 21. Biswas, J., Rahman, R., Gupta, V., Rosbash, M. & Singer, RH iScience 23, 101318 (2020). 22. Yoshikawa, K. et al. Biomed. Res. 31, 401-411 (2010). 23. Gao, Q. et al. Cell Rep. 23, 227-238.e3 (2018). 24. Dykstra, PB, Kaplan, M. & Smolke, CD Nat. Rev. Genet. 1-14 (2022).doi:10.1038 / s41576-021-00436-7 25. Groves, B. et al. Nat. Nanotechnol. 11, 287-294 (2016).

[0273] Notwithstanding any claims that may be appended, the disclosure described herein is also described by the following clauses: 1. A method for detecting a target RNA in a biological sample, the method comprising: (a) combining the biological sample with a sensor RNA comprising: (i) a first nucleotide sequence consisting of a stem-loop sequence comprising one or more stop codons, (ii) a second nucleotide sequence consisting of a sensor nucleotide sequence that is reverse complementary to the target RNA, (iii) a third nucleotide sequence encoding a first cleavage domain, and (iv) a fourth nucleotide sequence encoding an output protein; and (b) assaying for the presence of the output protein in the biological sample. 2. The method of claim 1, wherein the one or more stop codons comprise at least one base that mismatches with a sequence in a stem loop opposite the one or more stop codons. 3. The method of clause 1 or 2, further comprising: (i) a fifth nucleotide sequence constituting a second cleavage domain, said fifth nucleotide sequence preceding said first nucleotide sequence; and (ii) a sixth nucleotide sequence consisting of a nucleotide sequence encoding a marker protein, wherein the sixth nucleotide sequence precedes the fifth nucleotide sequence. 4. The method according to any one of clauses 1 to 3, wherein the cleavage domain is a 2A self-cleavage domain. 5. The method of claim 4, wherein the 2A self-cleavage domain is selected from the group of T2A, P2A, E2A and F2A. 6. The method of any one of clauses 1 to 5, wherein the stem-loop is a GluR-B stem-loop or a modified variant thereof. 7. The method according to any one of clauses 1 to 6, wherein the length of the stem loop is 18 to 60 base pairs. 8. The method of any one of clauses 1 to 7, wherein the sensor nucleotide sequence is 60 nucleotides or more in length. 9. The method of any one of clauses 1 to 8, wherein the target RNA is encoded by a gene variant, including a gene fusion, a splice variant, or a single nucleotide polymorphism. 10. The method of any one of clauses 1 to 9, wherein the sensor nucleotide is reverse complementary to the 3'UTR of the target RNA. 11. The method according to any one of clauses 1 to 10, wherein the marker protein is a fluorescent protein or a luminescent protein. 12. The method according to any one of claims 1 to 11, wherein the output protein is selected from a fluorescent protein, a genome modifying protein, a transcription factor, a killing factor, a toxin, an antigen, a T cell receptor, a therapeutic protein and an enzyme. 13. The method according to any one of clauses 1 to 12, wherein the detection is quantitative or qualitative. 14. The method according to any one of clauses 1 to 13, wherein the biological sample is a cell. 15. The method of any one of clauses 1 to 14, wherein binding to the biological sample comprises contacting the biological sample with a lipid nanoparticle containing the sensor RNA, or an adeno-associated virus containing the sensor RNA (the AAV vector includes the sensor RNA). 16. The method of any one of clauses 1 to 14, wherein combining with the biological sample comprises transfecting the biological sample with a recombinant vector comprising the sensor RNA. 17. The method of claim 16, wherein the recombinant vector is selected from the group consisting of a plasmid, a viral vector, a cosmid, and an artificial chromosome. 18. The method of any one of claims 1 to 17, wherein assaying for the presence of the output protein comprises using immunoblotting. 19. The method of any one of claims 1 to 17, wherein assaying for the presence of the output protein comprises using microscopy. 20. The method of any one of claims 1 to 17, wherein assaying for the presence of the output protein comprises using flow cytometry. 21. The method of any one of clauses 1 to 20, wherein the sensor RNA comprises one or more MS2 hairpins. 22. The method of any one of clauses 1 to 21, wherein the sensor nucleotide sequence is reverse complementary to two or more non-contiguous sequences within a single target RNA. 23. The method of any one of clauses 1 to 22, wherein the sensor nucleotide sequence is reverse complementary to two or more different target RNAs. 24. The method of any of clauses 1-23, wherein the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that is reverse-complementary to a second target RNA, the first and second target RNAs differing in sequence. 25. The method of claim 24, wherein the second sensor nucleotide sequence comprises a second stop codon. 26. The method of claim 24, wherein the second sensor nucleotide sequence consists of a stem-loop sequence including one or more stop codons or start codons. 27. The method of any of clauses 1 to 26, further comprising combining the biological sample with an adenosine deaminase acting on RNA (ADAR) protein or its coding sequence. 28 ADAR proteins include ADAR2 and ADAR p110 or ADAR p150 28. The method according to clause 27, wherein 29. The method of claim 27, wherein the ADAR protein is a modified ADAR comprising an ADAR deaminase domain and an MS2 binding domain. 30. The method of any one of clauses 1 to 29, wherein the biological sample is combined with two or more sensor RNAs that detect two or more target RNAs. 31. The method of any one of clauses 1 to 20, wherein the sensor RNA comprises one or more pseudouridines. 32. The method of claim 31, wherein 75% or less of the uridines in the sensor RNA are pseudouridines. 33. The method according to any one of clauses 31 to 32, wherein the pseudouridine is N1-methyl-pseudouridine. 34. The method of any one of clauses 1 to 33, wherein the stop codon is UGA. 35. The method according to claim 34, wherein the adenosine of the UGA stop codon is followed by a guanosine. 36. The method of any one of clauses 31 to 35, wherein the pseudouridine is not adjacent to the adenosine at the stop codon of the sensor nucleotide sequence. 37 A method for detecting a target RNA in a biological sample, the method comprising: (a) combining the biological sample with a sensor RNA comprising: (i) a first nucleotide sequence consisting of a sensor nucleotide sequence that is reverse complementary to the target RNA, the sensor nucleotide sequence consisting of a stem-loop sequence including one or more stop codons, (ii) a second nucleotide sequence encoding a first cleavage domain, and (iii) a third nucleotide sequence encoding an output protein; and (b) assaying for the presence of the output protein in the biological sample. 38. The method of claim 37, further comprising: (i) a fourth nucleotide sequence constituting a second cleavage domain, wherein the fourth nucleotide sequence precedes the first nucleotide sequence; and (ii) a fifth nucleotide sequence consisting of a nucleotide sequence encoding a marker protein, wherein the fifth nucleotide sequence precedes the fourth nucleotide sequence. 39. The method of clauses 37-38, wherein the one or more stop codons comprise at least one base that mismatches with a sequence in the stem loop opposite the one or more stop codons. 40. The method of any of items 37 to 39, wherein the cleavage domain is a 2A self-cleavage domain. 41. The method of claim 40, wherein the 2A self-cleavage domain is selected from the group of T2A, P2A, E2A and F2A. 42. The method of any of items 37 to 41, wherein the stem-loop is a GluR-B stem-loop or an engineered variant thereof. 43. The method of any one of clauses 37 to 42, wherein the length of the stem loop is 9 to 24 base pairs. 44. The method of any one of clauses 37 to 43, wherein the sensor nucleotide sequence is 60 nucleotides or more in length. 45. The method of any of clauses 37 to 44, wherein the target RNA is encoded by a gene variant, including a gene fusion, a splice variant, or a single nucleotide polymorphism. 46. ​​The method of any of clauses 37 to 45, wherein the sensor nucleotide is reverse complementary to the 3'UTR of the target RNA. 47. The method according to any one of claims 37 to 46, wherein the marker protein is a fluorescent protein or a luminescent protein. 48. The method according to any of items 37 to 47, wherein the output protein is selected from a fluorescent protein, a genome modifying protein, a transcription factor, a killing factor, a toxin, an antigen, a T cell receptor, a therapeutic protein and an enzyme. 49. The method of any one of clauses 37 to 48, wherein the detection is quantitative or qualitative. 50. A method according to any one of items 37 to 49, wherein the biological sample is a cell. 51. The method of any of clauses 37 to 50, wherein binding to the biological sample comprises contacting the biological sample with lipid nanoparticles containing the sensor RNA or an adeno-associated virus containing the sensor RNA (the AAV vector includes the sensor RNA). 52. The method of any of clauses 37-51, wherein combining with the biological sample comprises transfecting the biological sample with a recombinant vector comprising the sensor RNA. 53. The method of claim 52, wherein the recombinant vector is selected from the group consisting of a plasmid, a viral vector, a cosmid, and an artificial chromosome. 54. The method of any of claims 37 to 53, wherein assaying for the presence of the output protein comprises using immunoblotting. 55. The method of any of claims 37 to 54, wherein assaying for the presence of the output protein comprises using microscopy. 56. The method of any of claims 37 to 55, wherein assaying for the presence of the output protein comprises using flow cytometry. 57. The method of any one of clauses 37 to 56, wherein the sensor RNA comprises one or more MS2 hairpins. 58. The method of any of items 37 to 57, wherein the sensor nucleotide sequence is reverse complementary to two or more non-contiguous sequences within a single target RNA. 59. The method of any of clauses 37 to 58, wherein the sensor nucleotide sequence is reverse complementary to two or more different target RNAs. 60. The method of any of clauses 37-59, wherein the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that is reverse-complementary to a second target RNA, the first and second target RNAs differing in sequence. 61. The method of claim 60, wherein the second sensor nucleotide sequence comprises a second stop codon or a first start codon. 62. The method of claim 60, wherein the second sensor nucleotide sequence consists of a stem-loop sequence including one or more stop codons or start codons. 63. The method of any of clauses 37-62, further comprising combining the biological sample with an adenosine deaminase acting on RNA (ADAR) protein or its coding sequence. 64 ADAR proteins are ADAR2 or ADAR p150 64. The method according to claim 63, 65. The method of claim 63, wherein the ADAR protein is a modified ADAR comprising an ADAR deaminase domain and an MS2 binding domain. 66. A method according to any one of items 37 to 65, in which the biological sample is combined with two or more sensor RNAs that detect two or more target RNAs. 67. A method according to any one of items 37 to 66, wherein the sensor RNA comprises one or more pseudouridines. 68. The method according to paragraph 67, wherein 75% or less of the uridines in the sensor RNA are pseudouridines. 69. The method of any one of clauses 37 to 68, wherein the pseudouridine is N1-methyl-pseudouridine. 70. The method of any one of items 37 to 69, wherein the stop codon is UGA. 71 The method according to clause 70, wherein the adenosine of the UGA stop codon is followed by a guanosine. 72. A method according to any of paragraphs 67 to 71, wherein the pseudouridine is not adjacent to the adenosine at the stop codon of the sensor nucleotide sequence. 73 A method for detecting a target RNA in a biological sample, the method comprising: (a) combining the biological sample with a sensor RNA comprising: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to a 3'UTR of the target RNA, the sensor nucleotide sequence comprising one or more stop codons, (ii) a second nucleotide sequence encoding a first cleavage domain, and (iii) a third nucleotide sequence encoding an output protein; and (b) assaying for the presence of the output protein in the biological sample. 74. The method of claim 73, further comprising: (i) a fourth nucleotide sequence constituting a second cleavage domain, the fourth nucleotide sequence preceding the first nucleotide sequence; and (ii) a fifth nucleotide sequence consisting of a nucleotide sequence encoding a marker protein, the fifth nucleotide sequence preceding the fourth nucleotide sequence. 75. The method of any of clauses 73-74, wherein the one or more stop codons comprise at least one base that mismatches with the 3'UTR of the target mRNA sequence. 76. The method of any of clauses 73 to 75, wherein the cleavage domain is a 2A self-cleavage domain. 77. The method of claim 76, wherein said 2A self-cleavage domain is selected from the group of T2A, P2A, E2A and F2A. 78. The method of any of clauses 73 to 77, further comprising a fifth nucleotide sequence comprising a second cleavage domain, the fifth nucleotide sequence preceding the second nucleotide sequence. 79. The method of any one of clauses 73 to 78, wherein the sensor nucleotide sequence is 60 nucleotides or more in length. 80. The method of any of clauses 73-79, wherein the target RNA is encoded by a gene variant, including a gene fusion, a splice variant, or a single nucleotide polymorphism. 81. The method according to any one of clauses 73 to 80, wherein the marker protein is a fluorescent protein or a luminescent protein. 82. The method according to any of items 73 to 81, wherein the output protein is selected from a fluorescent protein, a genome modifying protein, a transcription factor, a killing factor, a toxin, an antigen, a T cell receptor, a therapeutic protein and an enzyme. 83. The method of any of clauses 73 to 82, wherein the detection is quantitative or qualitative. 84. The method according to any one of items 73 to 83, wherein the biological sample is a cell. 85. A method according to any of items 73 to 84, wherein binding to the biological sample comprises contacting the biological sample with lipid nanoparticles containing the sensor RNA or an adeno-associated virus containing the sensor RNA (the AAV vector contains the sensor RNA). 86. The method of any of clauses 73-85, wherein combining with the biological sample comprises transfecting the biological sample with a recombinant vector comprising the sensor RNA. 87. The method of claim 86, wherein the recombinant vector is selected from the group consisting of a plasmid, a viral vector, a cosmid, and an artificial chromosome. 88. The method of any of clauses 73-87, wherein assaying for the presence of the output protein comprises using immunoblotting. 89. The method of any of clauses 73-88, wherein assaying for the presence of the output protein comprises using microscopy. 90. The method of any of clauses 73-89, wherein assaying for the presence of the output protein comprises using flow cytometry. 91. The method of any one of clauses 73 to 90, wherein the sensor RNA comprises one or more MS2 hairpins. 92. The method of any of clauses 73-91, wherein the sensor nucleotide sequence is reverse complementary to two or more non-contiguous sequences within a single target RNA. 93. The method of any of clauses 73 to 92, wherein the sensor nucleotide sequence is reverse complementary to two or more different target RNAs. 94. The method of any of items 73 to 93, wherein the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that is reverse complementary to a second target RNA, the first and second target RNAs differing in sequence. 95. The method of claim 94, wherein the second senor nucleotide sequence comprises a second stop codon or a first start codon. 96. The method of claim 94, wherein the second sensor nucleotide sequence consists of a stem-loop sequence including one or more stop codons or start codons. 97. The method of any of clauses 73-96, further comprising binding the biological sample to an adenosine deaminase acting on RNA (ADAR) protein or its coding sequence. 98 ADAR proteins are ADAR2 or ADAR p150 98. The method according to claim 97, 99. The method of claim 98, wherein the ADAR protein is a modified ADAR comprising an ADAR deaminase domain and an MS2 binding domain. 100. The method of any of items 73 to 99, wherein the biological sample is combined with two or more sensor RNAs that detect two or more target RNAs. 101. The method of any one of claims 73 to 100, wherein the sensor RNA comprises one or more pseudouridines. 102. The method of claim 101, wherein 75% or less of the uridines in the sensor RNA are pseudouridines. 103. The method of any one of clauses 101 to 102, wherein the pseudouridine is N1-methyl-pseudouridine. 104. The method of any of items 73 to 103, wherein the stop codon is UGA. 105. The method according to paragraph 104, wherein the adenosine of the UGA stop codon is followed by a guanosine. 106. The method of any of items 104 to 105, wherein the pseudouridine is not adjacent to the adenosine in the stop codon of the sensor nucleotide sequence. 107 A method for detecting a target RNA in a biological sample, the method comprising: (a) combining the biological sample with a sensor RNA comprising: (i) a first nucleotide sequence comprising a sensor nucleotide sequence that is reverse-complementary to the target RNA, the sensor nucleotide sequence comprising a start codon; and (ii) a second nucleotide sequence encoding an output protein; and (b) assaying for the presence of the output protein in the biological sample. 108. The method of clause 107, wherein the sequence encoding the output protein includes a start codon. 109. The method according to any of items 107 to 108, wherein the start codon in the sensor sequence contains at least one base that mismatches with the target RNA sequence. 110. The method of any of items 107-109, further comprising: (i) a third nucleotide sequence comprising a first cleavage domain, wherein the third nucleotide sequence is between the first nucleotide sequence and the second nucleotide sequence. 112. The method of any of clauses 107 to 110, wherein the sensor nucleotide sequence is 70 nucleotides or more in length. 113. The method of any of items 107 to 112, wherein the target RNA is encoded by a gene variant, including a gene fusion, a splice variant, or a single nucleotide polymorphism. 114. The method according to any of items 107 to 113, wherein the output protein is selected from a fluorescent protein, a genome modifying protein, a transcription factor, a killing factor, a toxin, an antigen, a T cell receptor, a therapeutic protein and an enzyme. 115. The method according to any one of claims 107 to 114, wherein the detection is quantitative or qualitative. 116. The method according to any one of items 107 to 115, wherein the biological sample is a cell. 117. The method of any of claims 107 to 116, wherein combining with the biological sample comprises contacting the biological sample with lipid nanoparticles comprising the sensor RNA or an adeno-associated virus comprising the sensor RNA (the AAV vector comprises the sensor RNA). 118. The method of any of items 107-117, wherein combining with a biological sample comprises transfecting the biological sample with a recombinant vector comprising the sensor RNA. 119. The method of clause 118, wherein the recombinant vector is selected from the group consisting of a plasmid, a viral vector, a cosmid, and an artificial chromosome. 120. The method of any of clauses 107-119, wherein assaying for the presence of the output protein comprises using immunoblotting. 121. The method of any one of claims 107 to 120, wherein assaying for the presence of the output protein comprises using microscopy. 122. The method of any of paragraphs 107-121, wherein assaying for the presence of the output protein comprises using flow cytometry. 123. The method of any of items 107 to 122, wherein the sensor RNA comprises one or more MS2 hairpins. 124. The method of any of items 107 to 123, wherein the sensor nucleotide sequence is reverse complementary to two or more non-contiguous sequences within a single target RNA. 125. A method according to any of items 107 to 124, wherein the sensor nucleotide sequence is reverse complementary to two or more different target RNAs. 126. The method of any of items 107 to 125, wherein the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that is reverse complementary to a second target RNA, the first and second target RNAs differing in sequence. 127. The method of claim 126, wherein the second sensor nucleotide sequence comprises a second stop codon or a first start codon. 128. The method of claim 126, wherein the second sensor nucleotide sequence comprises a stem-loop sequence including one or more stop codons or start codons. 129. The method of any of paragraphs 107-128, further comprising combining the biological sample with an adenosine deaminase acting on RNA (ADAR) protein or its coding sequence. 130 ADAR proteins are ADAR2 or ADAR p150 129. The method according to claim 129, 131. The method of claim 130, wherein the ADAR protein is a modified ADAR comprising an ADAR deaminase domain and an MS2 binding domain. 132. The method according to any one of items 107 to 131, wherein the biological sample is combined with two or more sensor RNAs that detect two or more target RNAs. 133 A method for detecting a target RNA in a biological sample, the method comprising: (a) combining the biological sample with a sensor RNA comprising: (i) a first nucleotide sequence consisting of a sensor nucleotide sequence that is reverse complementary to the target RNA, the sensor nucleotide sequence consisting of an AUA sequence; and (ii) a second nucleotide sequence encoding an output protein; and (b) assaying for the presence of the output protein in the biological sample. 134. The method of clause 133, wherein the AUA sequence comprises at least one base that mismatches with the target RNA sequence. 135. The method of any of clauses 133-134, further comprising: (i) a third nucleotide sequence comprising a first cleavage domain, said third nucleotide sequence being between said first nucleotide sequence and said second nucleotide sequence. 137. The method of any of clauses 133 to 135, wherein the sensor nucleotide sequence is 70 nucleotides or more in length. 138. The method of any of clauses 133 to 137, wherein the target RNA is encoded by a gene variant, including a gene fusion, a splice variant, or a single nucleotide polymorphism. 139. The method of any of clauses 133 to 138, wherein the output protein is selected from a fluorescent protein, a genome modifying protein, a transcription factor, a killing factor, a toxin, an antigen, a T cell receptor, a therapeutic protein and an enzyme. 140. The method of any of clauses 133 to 139, wherein the detection is quantitative or qualitative. 141. The method of any of clauses 133-140, wherein the biological sample is a cell. 142. The method of any of clauses 133-141, wherein combining with the biological sample comprises contacting the biological sample with lipid nanoparticles comprising the sensor RNA or an adeno-associated virus comprising the sensor RNA (wherein the AAV vector comprises the sensor RNA). 143. The method of any of clauses 133-142, wherein combining with the biological sample comprises transfecting the biological sample with a recombinant vector comprising the sensor RNA. 144. The method of claim 143, wherein the recombinant vector is selected from the group consisting of a plasmid, a viral vector, a cosmid, and an artificial chromosome. 145. The method of any of clauses 133-144, wherein assaying for the presence of the output protein comprises using immunoblotting. 146. The method of any of clauses 133-145, wherein assaying for the presence of the output protein comprises using microscopy. 147. The method of any of clauses 133-146, wherein assaying for the presence of the output protein comprises using flow cytometry. 148. The method of any of clauses 133-147, wherein the sensor RNA comprises one or more MS2 hairpins. 149. The method of any of clauses 133-148, wherein the sensor nucleotide sequence is reverse complementary to two or more non-contiguous sequences within a single target RNA. 150. The method of any of clauses 133-149, wherein the sensor nucleotide sequence is reverse complementary to two or more different target RNAs. 151. The method of any of clauses 133-150, wherein the sensor RNA further comprises a nucleotide sequence encoding a second sensor nucleotide sequence that is reverse complementary to a second target RNA, the first target RNA and the second target RNA differing in sequence. 152. The method of claim 151, wherein the second senor nucleotide sequence comprises a stop codon or a start codon. 153. The method of clause 151, wherein the second sensor nucleotide sequence comprises a stem-loop sequence including one or more stop codons or start codons. 154. The method of any of clauses 133-153, further comprising combining the biological sample with an adenosine deaminase acting on RNA (ADAR) protein or its coding sequence. 155 ADAR proteins are ADAR2 or ADAR p150 155. The method according to claim 154, 156. The method of claim 155, wherein the ADAR protein is a modified ADAR comprising an ADAR deaminase domain and an MS2 binding domain. 157. The method of any of clauses 133-156, wherein the biological sample is combined with two or more sensor RNAs that detect two or more target RNAs. 158 A method for expressing a protein in a target cell, comprising binding the cell with a sensor RNA according to any of the preceding clauses, wherein the target RNA is present in the target cell. 159. The method of clause 158, further comprising binding the cell to an ADAR protein or its coding sequence. 160 ADAR proteins are p150 159. The method according to claim 158 or 159, 161. The method of claim 158, wherein the ADAR protein is a modified ADAR protein comprising an ADAR deaminase domain and an MS2 binding domain. 162. The method according to any of items 158 to 161, wherein binding to the cell comprises contacting the cell with a lipid nanoparticle comprising the sensor RNA or an adeno-associated virus comprising the sensor RNA (the AAV vector comprises the sensor RNA). 163. The method of any of clauses 158 to 162, wherein binding to the cell comprises transfecting the cell with a recombinant vector comprising the sensor RNA. 164. The method of any of items 158 to 163, wherein the target RNA is associated with a disease or pathology. 165. The method of any of paragraphs 158-164, wherein the output protein treats a disease or condition. 166. The method of any of items 158 to 165, wherein the target RNA is encoded by a gene variant, including a gene fusion, a splice variant, or a single nucleotide polymorphism. 167. The method of clause 166, wherein the recombinant vector is selected from the group consisting of a plasmid, a viral vector, a cosmid and an artificial chromosome. 168 A recombinant vector comprising a sensor RNA according to any one of the preceding paragraphs. 169. The recombinant vector according to item 168, wherein the recombinant vector is selected from the group consisting of a plasmid, a viral vector, a cosmid and an artificial chromosome. 170 A kit comprising a sensor RNA according to any of the preceding clauses. 171. The kit of clause 170, further comprising an ADAR protein or its coding sequence. 172 ADAR proteins are p150 172. The kit according to claim 171, 173. The kit according to clause 171, wherein the ADAR protein is a modified ADAR protein comprising an ADAR deaminase domain and an MS2 binding domain. 174. A kit according to any of clauses 170 to 173, further comprising a biological sample containing the target RNA and a biological sample not containing the target RNA. 175. The method of any one of clauses 1 to 36, wherein combining comprises administering to a patient. 176. The method of any of items 37-72, wherein combining comprises administering sensor RNA to the patient. 177 The method of any of paragraphs 73-107, wherein combining comprises administering sensor RNA to the patient. 178. The method of any of items 107-132, wherein combining comprises administering sensor RNA to the patient. 179 The method of any of clauses 133-167, wherein combining comprises administering a sensor RNA to the patient.

[0274] In at least some of the embodiments described above, one or more elements used in one embodiment may be used interchangeably in another embodiment unless such substitution is technically infeasible. Those skilled in the art will appreciate that various other omissions, additions, and modifications may be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and variations are intended to fall within the scope of the subject matter defined by the appended claims.

[0275] In general, those skilled in the art will understand that the terms used in this specification, and particularly in the appended claims (e.g., the body of the appended claims), are generally intended as "open" terms (e.g., the term "comprises" should be interpreted as "including but not limited to," the term "having" should be interpreted as "having at least," the term "including" should be interpreted as "including but not limited to," etc.). As those skilled in the art will further appreciate, if a specific number of introduced claim recitations is intended, such intent will be expressly set forth in the claims, and in the absence of such recitation, such intent does not exist. For example, as an aid to understanding, the following appended claims may include the use of the introductory phrases "at least one" and "one or more" to introduce the claim recitations. However, the use of such phrases should not be construed as meaning that the introduction of a claim reference with the indefinite article "a" or "an" limits a particular claim that includes such an introduced claim reference to embodiments that include only one such reference; "a" and / or "an" should be construed to mean "at least one" or "one or more." In addition, even if a specific number of introduced claims is explicitly recited, one of ordinary skill in the art will recognize that such recitation should be construed to mean at least the recited number of times (e.g., the bare recitation of "two repetitions" without other modifiers means at least two repetitions, or more than two repetitions). Additionally, when phrases similar to "such as at least one of A, B, and C" are used, such configurations are generally intended in the sense that one of ordinary skill in the art would understand the phrase (e.g., "a system having at least one of A, B, and C" includes, but is not limited to, systems having A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.).When phrases similar to "at least one of A, B, or C, etc." are used, such configurations are generally intended in the sense that one of ordinary skill in the art would understand the phrase (e.g., "a system having at least one of A, B, or C" includes, but is not limited to, a system having A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). One of ordinary skill in the art will further appreciate that virtually any conjunction word and / or phrase presenting two or more alternative terms, whether in the specification, claims, or drawings, should be understood to contemplate the possibility of including either term, either term, or both terms. For example, the phrase "A or B" is understood to include the possibility of "A" or "B," or "A and B."

[0276] In addition, where features or aspects of the disclosure are described in terms of a Markush group, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual members or subgroups of members of the Markush group.

[0277] As will be appreciated by those of skill in the art, all ranges disclosed herein encompass all possible subranges and combinations of subranges thereof for any purpose, such as providing a written description. Any range listed can be broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. of the same range and can be readily recognized as being fully described. As a non-limiting example, each range discussed herein can be readily divided into a lower third, middle third, upper third, etc. As will also be appreciated by those of skill in the art, phrases such as "up to," "at least," "greater than," "less than," etc., all refer to ranges that are inclusive of the recited numbers and can then be broken down into subranges as described above. Finally, as will be appreciated by those of skill in the art, ranges include individual members. Thus, for example, a group having 1-3 molded articles refers to a group having 1, 2, or 3 molded articles. Similarly, a group having 1-5 articles refers to a group having 1, 2, 3, 4, 5, etc. articles.

[0278] Although the foregoing invention has been described in some detail by way of illustration and example, for purposes of clarity of understanding, it will be readily apparent to those skilled in the art in light of the teachings of this invention that certain changes and modifications can be made without departing from the spirit or scope of the appended claims.

[0279] Thus, the foregoing merely describes the principles of the invention. It will be appreciated that those skilled in the art can devise various arrangements that embody the principles of the invention and are within its spirit and scope, although not expressly described or illustrated herein. Furthermore, all examples and conditional statements described herein are intended primarily to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to further develop the art, and are not intended to be limited to such specifically described examples and conditions. Furthermore, all statements herein that describe the principles, aspects, and embodiments of the invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Moreover, such equivalents are intended to include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Furthermore, nothing disclosed herein is intended to be made public, regardless of whether such disclosure is expressly set forth in the claims.

[0280] Accordingly, the scope of the present invention is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims. In the claims, 35 USC §112(f) or 35 USC §112(6) is expressly defined to be invoked with respect to a limitation in a claim only if the exact words "means for" or the exact words "step for" appear at the beginning of that limitation in the claim, and 35 USC §112(f) or 35 USC §112(6) is not invoked if that exact wording is not used in the limitation in the claim.

Claims

1. A single-stranded ribonucleic acid (ssRNA) sensor comprising the following: (a) First area including the following: (i) A nucleotide sequence configured to hybridize to a target ribonucleic acid (RNA); and (ii) Stem loop arrays containing one or more editable codons; and (b) A second region containing a protein-coding sequence.

2. An ssRNA sensor according to claim 1, wherein the one or more editable codons further include a stop codon.

3. An ssRNA sensor according to claim 2, wherein the stop codon includes 5'-UGA-3', 5'-UAA-3', or 5'-UAG-3'.

4. An ssRNA sensor according to claim 1, wherein the one or more editable codons further include a start codon.

5. An ssRNA sensor according to claim 1, wherein the stem-loop sequence further comprises a Kozak sequence operably linked to the start codon.

6. An ssRNA sensor according to claim 1, further comprising a non-stop and non-start codon, wherein the one or more editable codons are editable so that they become start codons by the components of the target cell.

7. An ssRNA sensor according to claim 6, further comprising a Kozak sequence in which the stem-loop sequence is operably linked to the non-stop and non-start codon.

8. An ssRNA sensor according to claim 6 or 7, wherein the non-stop and non-start codon further comprises 5'-AUA-3'.

9. An ssRNA sensor according to claim 1, wherein the nucleotide sequence is configured to hybridize with the untranslated region (UTR) of the target RNA.

10. An ssRNA sensor according to claim 1, wherein the protein comprises a toxin, a lethal element, a T cell receptor, or a chimeric antigen receptor.

11. An ssRNA sensor according to claim 1, wherein the protein comprises a fluorescent protein, a genome-modified protein, a transcription factor, an antigen, a therapeutic protein, or an enzyme.

12. An ssRNA sensor according to claim 1, wherein the target RNA is messenger RNA (mRNA), long non-coding RNA (lncRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), microRNA (miRNA), or nucleolar small RNA (snoRNA).

13. An ssRNA sensor according to claim 1, wherein the stem of the stem-loop sequence is at least 12 base pairs long.

14. An ssRNA sensor according to claim 1, comprising a fusion gene encoding the target RNA.

15. An ssRNA sensor according to claim 1, wherein the nucleotide sequence configured to hybridize to the target RNA in (a) and (i) is configured to hybridize to two or more discontinuous sequences in the target RNA.

16. A composition comprising the ssRNA sensor according to claim 1 and a cell containing the target RNA.

17. A pharmaceutical composition comprising the ssRNA sensor according to claim 1 and a pharmaceutically acceptable excipient.

18. Methods including the following: (a) Steps to combine target cells with sensor RNA: (A) First area including the following: (i) a nucleotide sequence configured to hybridize to the target RNA of the target cell; and (ii) Stem loop arrays containing one or more editable codons; and (B) A second region containing the sequence encoding the protein; and, (b) The step of subjecting the sensor RNA to conditions sufficient for the following: (i) the first region of the sensor RNA to hybridize with the target RNA; and (ii) editing of the one or more editable codons to occur.

19. A method according to claim 18, further comprising, in (b), providing the sensor RNA under conditions sufficient to cause editing of the one or more editable codons, such that the editing of the editable codons impairs the expression of the second region of the sensor RNA.

20. A method according to claim 18, further comprising, in (b), providing the sensor RNA under conditions sufficient to cause editing of the one or more editable codons, wherein the editing of the editable codons promotes the expression of the second region of the sensor RNA.

21. A method according to claim 18, wherein combining the target cells with the sensor RNA comprises combining the target cells with lipid nanoparticles containing the sensor RNA.

22. A method according to claim 18, further comprising, prior to (a), subjecting an adeno-associated viral vector (AAV) encoding the sensor RNA to conditions sufficient to transcribe the sensor RNA from the AAV encoding the sensor RNA.

23. A method according to claim 18, further comprising (b) providing the sensor RNA to conditions sufficient to cause editing of the one or more editable codons using an adenosine deaminosease (ADAR) that acts on RNA.

Images