Methods for Treating GNAQ- and GNA11-Driven Diseases

JP2025509242A5Pending Publication Date: 2026-03-16THE FRANCIS CRICK INST LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-03-07
Publication Date
2026-03-16

AI Technical Summary

Technical Problem

The prior art is difficult to effectively treat clinical conditions caused by GNAQ and GNA11 mutations, including cancer, Sturge Weber syndrome (SWS), dermal vascular nevus (PPV), extensive skin melanin (EDM), and congenital hemangioma, especially the lack of effective treatments for these diseases.

Method used

By designing a nucleic acid molecule with sequences that are completely or highly similar to GNAQ or GNA11 mRNA, thereby inhibiting the expression of these mutant GNAQ or GNA11. The nucleic acid molecule can be single-stranded or double-stranded with a targeting sequence targeting a specific mutation to improve its inhibitory efficacy.

Benefits of technology

This method can effectively inhibit the expression of mutant GNAQ or GNA11, thereby potentially correcting the cellular signal disorder caused by these mutations, providing a potential therapeutic option not only for the above diseases, but also for other diseases driven by GNAQ or GNA11 mutations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present invention relates to novel compositions and methods for treating clinical conditions resulting from somatic GNAQ and GNA11 mutations, including cancer, Sturge-Weber syndrome (SWS), pigmented vascular phakomatosis (PPV), extensive cutaneous melanosis (EDM), and congenital hemangiomas (including rapidly involuting congenital hemangiomas (RICH), partially involuting congenital hemangiomas (PICH), and non-involuting congenital hemangiomas (NICH)).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to novel compositions and methods for treating clinical conditions resulting from somatic GNAQ and GNA11 mutations, including cancer, Sturge-Weber syndrome (SWS), pigmented vascular phakomatosis (PPV), extensive cutaneous melanosis (EDM), and congenital hemangiomas (including rapidly involuting congenital hemangiomas (RICH), partially involuting congenital hemangiomas (PICH), and non-involuting congenital hemangiomas (NICH)). [Background technology]

[0002] Sturge-Weber syndrome (SWS), pigmented vascular nevus (PPV), and atypical and / or extensive cutaneous melanosis (EDM) form a spectrum of rare congenital disorders of blood vessels and / or pigmentation. SWS is classically purely vascular, presenting with port-wine stain birthmark, leptomeningeal angiomatosis, and glaucoma. PPV (a type with cutaneous melanosis [1, 2]) has these same vascular features, but also ocular and / or cutaneous melanosis (severe "Mongolian" blue spots) and excess risk of melanoma. EDM represents the purely pigmented end of this vascular pigmented disease spectrum. Neurovascular abnormalities in SWS and PPV can cause neurodevelopmental disorders, seizures, headaches, and stroke-like episodes [3]. Symptoms often worsen in the first year of life and are thought to be related to cerebral perfusion defects as well as seizure-related damage. Such frequent postnatal progression suggests a time period for targeting therapy.

[0003] Over the past decade, it has been discovered that SWS, PPV, and EDM are most often caused by postzygotic mosaic variants in either the gene GNAQ or the homologous gene GNA11 [4, 5, 6, 7]. Pathogenic variants are heterozygous in affected cells, indicating a dominant disease mechanism. GNAQ variants are dominant in SWS and EDM, whereas GNAQ and GNA11 are more evenly represented in PPV. Variants almost universally affect codon 183 of each gene, although variants affecting codon 209 have also been described. GNAQ variants have been found abundantly in endothelial cells from SWS patients [8], supporting the idea that the vascular phenotype is likely a disorder of vascular progenitor cells, as clinically suggested by embryonic vascular patterning [9]. However, PPV and EDM likely originate from the same genetic variant occurring in different embryonic progenitor cells. Variants in GNA11, mainly affecting codon 209, have also been described in congenital hemangiomas, benign vascular tumors that may or may not regress spontaneously after birth (RICH, PICH, and NICH variants, rapidly involuting, noninvoluting, and partially involuting)

[10] , as well as other tumors of the vascular system

[11] .

[0004] Somatic GNAQ and GNA11 mutations have also been described in a wide variety of non-congenital tumors, including both benign and malignant tumors, particularly uveal, leptomeningeal, and hepatic tumors [12, 13]. In contrast to somatic, germline mutations in GNA11 affecting codons other than 183 and 209 have been described in types of familial hypocalcemia and hypercalcemia

[14] . Finally, genetic variants in the gene GNA11 are known to cause familial hypocalcemia and hypercalcemia by affecting intracellular calcium signaling [15, 16], but in the clear and specific context of binding to the calcium-sensing receptor (CaSR) in the parathyroid gland.

[0005] Despite the understanding of the genetic etiology, there are relatively few studies on the molecular pathogenesis of the spectrum, especially mosaic mutations. In vitro studies of disease variants affecting codons 183 and 209 have demonstrated that they induce basal activation of the MAPK signaling pathway; however, these studies have been limited primarily to modeling in HEK cells, an embryonic kidney-derived lineage, [4, 5], although they demonstrated activation of MAPK in primary human endothelial and melanocyte cells harboring the 183 or 209 variants

[11] . A recent study in human umbilical vein (HUVEC) endothelial cells did not confirm MAPK activation

[17] . The only animal modeling of these variants published to date (in zebrafish) recapitulated the pigmentary phenotype under a melanocyte-specific promoter, without modeling of the vascular phenotype [5]. An animal model of germline GNA11 mutations recapitulates the autosomal dominant hypocalcemic phenotype

[18] .

[0006] Without being bound by any particular hypothesis principle, we considered that the pathogenesis and / or progression of neurovascular disease in SWS and PPV may be related to impaired local or systemic calcium homeostasis caused by abnormal intracellular calcium signaling in endothelial variant cells. This hypothesis was based on several observations. First, neurovascular wall calcification progresses over time, leading to the classic vascular "tramline" sign first described on plain cranial radiographs

[19] . Second, the proteins encoded by the GNAQ and GNA11 genes (G subunit αq and 11, respectively) are known regulators of intracellular calcium signaling. Activation of G proteins downstream of G protein-coupled receptors (GPCRs) in physiological conditions leads to the generation of inositol triphosphate (IP3) and the opening of intracellular IP3-dependent calcium channels in the endoplasmic reticulum (ER) [20, 21]. ER drainage then triggers the replenishment of calcium stores via activation of calcium release-activated channels (CRAC) and intracellular influx of extracellular calcium. Also, a putative causative variant in the gene GNB2, which encodes the α subunit of the G protein that interacts with Gαq and Gα11, was recently reported in a single SWS patient who did not have mutations in GNAQ and GNA11

[17] , further highlighting the importance of alterations in the G protein pathway in the pathogenesis of these diseases. However, this pathway has not previously been studied in the context of these genetic variants.

[0007] Therefore, the inventors sought to address the problem of the lack of treatment options for patients by exploring the biology of the disease. The inventors investigated the effect of pathogenic SWS and PPV variants on calcium homeostasis by combining calcium metabolic profiling of patients with in vitro biochemical characterization of calcium signaling in cell models. The inventors then evaluated new approaches to correct the mutation-dependent signaling defects that would provide novel treatments for these diseases, as well as all other diseases caused by and / or driven by and / or dependent on GNAQ or GNA11 germline, mosaic, or somatic genetic variants. Summary of the Invention

[0008] The present invention provides a nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, the first strand comprising a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding GNAQ or GNA11.

[0009] In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence that has at least 90% identity to an isometric portion of an mRNA encoding a gain-of-function variant of GNAQ or GNA11. In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence that has at least 90% identity to an isometric portion of an mRNA encoding a gain-of-function variant of GNAQ. In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence that has at least 90% identity to an isometric portion of an mRNA encoding a gain-of-function variant of GNAQ. In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence that has at least 90% identity to an isometric portion of an mRNA encoding a gain-of-function variant of GNA11. In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence that has at least 90% identity to an isometric portion of an mRNA encoding a gain-of-function variant of GNA11.

[0010] In some embodiments, the first chain is comprised of 10-40 linked nucleosides. In some embodiments, the first chain is comprised of 10-30 linked nucleosides. In some embodiments, the first chain is comprised of 15-30 linked nucleosides. In some embodiments, the first chain is comprised of 15-25 linked nucleosides. In some embodiments, the first chain is comprised of 15-20 linked nucleosides. In some embodiments, the first chain is comprised of 10-20 linked nucleosides. In some embodiments, the first chain is comprised of 20-30 linked nucleosides. In some embodiments, the first chain is comprised of 20-25 linked nucleosides. In some embodiments, the first chain is comprised of 21 linked nucleosides.

[0011] In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence that has at least 95% identity with an isometric portion of an mRNA encoding a variant GNAQ p.(R183Q), p.(R183G), p.(R183L), or p.(R183*). In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence that has 100% identity with an isometric portion of an mRNA encoding a variant GNAQ p.(R183Q), p.(R183G), p.(R183L), or p.(R183*). In some embodiments, the nucleic acid molecule is capable of inhibiting expression of variant GNAQ p.(R183Q / G / L / *) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the nucleic acid molecule inhibits expression of variant GNAQ p.(R183Q / G / L / *) in vitro to a greater extent than inhibiting expression of wild-type GNAQ in vitro. In some embodiments, the nucleic acid molecule can partially or completely rescue aberrant cell differentiation signaling in cells expressing variant GNAQ p.(R183Q / G / L / *).

[0012] In some embodiments, the variant GNAQ p.(R183Q) is caused by a c.G548A mutation in the GNAQ genomic sequence. In some embodiments, the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 13-18. In some embodiments, the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 13-18. In some embodiments, the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 13-18.

[0013] In some embodiments, the variant GNAQ p.(R183G) is caused by a c.C547G mutation in the GNAQ genomic sequence. In some embodiments, the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 33-38. In some embodiments, the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 33-38. In some embodiments, the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 33-38.

[0014] In some embodiments, the variant GNAQ p.(R183L) is caused by a c.G548T mutation in the GNAQ genomic sequence. In some embodiments, the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 45-50. In some embodiments, the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 45-50. In some embodiments, the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 45-50.

[0015] In some embodiments, the variant GNAQ p.(R183*) is caused by a c.C547T mutation in the GNAQ genomic sequence. In some embodiments, the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 57-62. In some embodiments, the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 57-62. In some embodiments, the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 57-62.

[0016] In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence that has at least 95% identity with an isometric portion of the mRNA encoding the variant GNA11 p.(R183C) or p.(R183H). In some embodiments, the first strand comprises a sequence that is fully complementary to a sequence that has 100% identity with an isometric portion of the mRNA encoding the variant GNA11 p.(R183C) or p.(R183H). In some embodiments, the nucleic acid molecule can inhibit the expression of the variant GNA11 p.(R183C / H) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the nucleic acid molecule inhibits the expression of the variant GNA11 p.(R183C / H) in vitro to a greater extent than inhibiting the expression of wild-type GNA11 in vitro. In some embodiments, the nucleic acid molecule is capable of partially or completely relieving aberrant cell differentiation signaling in cells expressing variant GNA11 p.(R183C / H).

[0017] In some embodiments, the variant GNA11 p.(R183C) is caused by a c.C547T mutation in the GNA11 genomic sequence. In some embodiments, the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 19-24. In some embodiments, the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 19-24. In some embodiments, the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 19-24.

[0018] In some embodiments, the variant GNA11 p.(R183C) is caused by the c.546_547delinsTT mutation in the GNA11 genomic sequence. In some embodiments, the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 69-74. In some embodiments, the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 69-74. In some embodiments, the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 69-74.

[0019] In some embodiments, the variant GNA11 p.(R183H) is caused by a c.G548A mutation in the GNA11 genomic sequence. In some embodiments, the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 81-86. In some embodiments, the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 81-86. In some embodiments, the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 81-86.

[0020] In some embodiments, the nucleic acid molecule is a single-stranded nucleic acid molecule. In some embodiments, the nucleic acid molecule is a double-stranded nucleic acid molecule.

[0021] In some embodiments, the double-stranded nucleic acid molecule comprises a second strand of 10-50 linked nucleosides, the second strand being at least partially complementary to the first strand. In some embodiments, the second strand is at least 80% complementary to the first strand. In some embodiments, the second strand is at least 90% complementary to the first strand. In some embodiments, the second strand is at least 95% complementary to the first strand. In some embodiments, the second strand is fully complementary to the first strand. In some embodiments, the second strand is comprised of 10-40 linked nucleosides. In some embodiments, the second strand is comprised of 10-30 linked nucleosides. In some embodiments, the second strand is comprised of 15-30 linked nucleosides. In some embodiments, the second strand is comprised of 15-25 linked nucleosides.

[0022] In some embodiments, the second strand is comprised of 15-20 linked nucleosides. In some embodiments, the second strand is comprised of 10-20 linked nucleosides. In some embodiments, the second strand is comprised of 20-30 linked nucleosides. In some embodiments, the second strand is comprised of 20-25 linked nucleosides. In some embodiments, the second strand is comprised of 21 linked nucleosides.

[0023] In some embodiments, the first strand is longer than the second strand. In some embodiments, the nucleic acid comprises an overhang at the 3' end of the first strand of 1, 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 3' end of the first strand of 2 nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 5' end of the first strand of 1, 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 5' end of the first strand of 2 nucleosides.

[0024] In some embodiments, the second strand is longer than the first strand. In some embodiments, the nucleic acid comprises an overhang at the 3' end of the second strand of 1, 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 3' end of the second strand of two nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 5' end of the second strand of 1, 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at the 5' end of the second strand of two nucleosides. In some embodiments, the nucleic acid comprises an overhang at both the 5' end and the 3' end of the first strand of 1, 2, 3, 4, 5 or more nucleosides. In some embodiments, the nucleic acid comprises an overhang at both the 5' end and the 3' end of the first strand of two nucleosides. In some embodiments, the overhang comprises two thymine nucleotides (TT). In some embodiments, the overhang consists of two thymine nucleotides (TT).

[0025] In some embodiments, the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17, and SEQ ID NO:6 and SEQ ID NO:18. In some embodiments, the nucleic acid molecule comprises a first strand and a second strand consisting of ...

[0026] In some embodiments, the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:7 and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NO:20, SEQ ID NO:9 and SEQ ID NO:21, SEQ ID NO:10 and SEQ ID NO:22, SEQ ID NO:11 and SEQ ID NO:23, and SEQ ID NO:12 and SEQ ID NO:24. In some embodiments, the nucleic acid molecule comprises a first strand and a second strand consisting of ...

[0027] In some embodiments, the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NO:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37, and SEQ ID NO:32 and SEQ ID NO:38. In some embodiments, the nucleic acid molecule comprises a first strand and a second strand consisting of ...

[0028] In some embodiments, the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NO:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49, and SEQ ID NO:44 and SEQ ID NO:50. In some embodiments, the nucleic acid molecule comprises a first strand and a second strand consisting of ...

[0029] In some embodiments, the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NO:60, SEQ ID NO:55 and SEQ ID NO:61, and SEQ ID NO:56 and SEQ ID NO:62. In some embodiments, the nucleic acid molecule comprises a first strand and a second strand consisting of ...

[0030] In some embodiments, the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NO:70, SEQ ID NO:65 and SEQ ID NO:71, SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73, and SEQ ID NO:68 and SEQ ID NO:74. In some embodiments, the nucleic acid molecule comprises a first strand and a second strand consisting of ...

[0031] In some embodiments, the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:75 and SEQ ID NO:81, SEQ ID NO:76 and SEQ ID NO:82, SEQ ID NO:77 and SEQ ID NO:83, SEQ ID NO:78 and SEQ ID NO:84, SEQ ID NO:79 and SEQ ID NO:85, and SEQ ID NO:80 and SEQ ID NO:86. In some embodiments, the nucleic acid molecule comprises a first strand and a second strand consisting of ...

[0032] The present invention also provides a compound comprising a nucleic acid molecule according to the present invention and a targeting moiety. In some embodiments, the targeting moiety comprises a lipid nanoparticle, a liposome, an exosome, an antibody or fragment thereof, an antigen-binding domain or fragment thereof, a peptide, a cell-penetrating peptide, a conjugate group, or any combination thereof. In some embodiments, the targeting moiety comprises a conjugate group, and the conjugate group comprises one or more carbohydrates. In some embodiments, the conjugate group comprises a monosaccharide, a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, a polysaccharide, a modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L-mannopyranose, D-arabinose, L-galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, aD-mannofuranose, β-D -Mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, α-D-galactofuranose tosamine, N-acetylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycoloyl-α-neuraminic acid, 5-thio-β-D-glucose copyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,5-anhydro-D-allonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose.

[0033] In some embodiments, the targeting moiety is linked to the 3' end of the second strand. In some embodiments, the targeting moiety is linked to the 5' end of the second strand. In some embodiments, the targeting moiety is linked to the 5' end of the first strand. In some embodiments, the targeting moiety is linked to the 3' end of the first strand.

[0034] In some embodiments, at least one nucleoside of the nucleic acid comprises a modified sugar. In some embodiments, at least one internucleoside linkage of the nucleic acid is a modified internucleoside linkage. In some embodiments, the modified internucleoside linkage is a phosphorothioate or phosphorodithioate internucleoside linkage. In some embodiments, the nucleic acid comprises 1-40 phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments, the nucleic acid comprises 1-30 phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments, the nucleic acid comprises 1-20 phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments, the nucleic acid comprises 1-10 phosphorothioate or phosphorodithioate internucleoside linkages.

[0035] In some embodiments, the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO: 89 (GNAQ c.548G>A_p.R183Q), SEQ ID NO: 91 (GNAQ c.547C>G_p.R183G), SEQ ID NO: 93 (GNAQ c.548G>T_p.R183L), SEQ ID NO: 95 (GNAQ c.547C>T_p.R183*), SEQ ID NO: 99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C), and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H).

[0036] The present invention also provides a composition comprising the single-stranded nucleic acid molecule or compound according to the present invention or a salt thereof and at least one of a pharma- ceutically acceptable carrier or diluent.The present invention also provides a prodrug comprising the nucleic acid molecule or compound of the present invention.

[0037] The present invention also provides a nucleic acid molecule comprising a nucleotide sequence encoding a CRISPR guide RNA (gRNA), where the gRNA hybridizes to a target sequence in a cell, where the target sequence encodes a variant allele of GNAQ or GNA11.

[0038] The present invention also provides a CRISPR nuclease system, the system comprising: (a) a promoter operably linked to at least one nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes to a target DNA sequence in a cell of a subject, and the target sequence encodes a variant allele of GNAQ or GNA11; (b) a nucleotide sequence encoding a nuclease (e.g., a Cas nuclease), wherein components (a) and (b) are located on the same or different vectors of the system; The gRNA targets and hybridizes to the target DNA sequence, and the nuclease cleaves the target sequence, altering expression of the variant allele of GNAQ or GNA11.

[0039] In some embodiments, the CRISPR nuclease system is packaged into a single adeno-associated virus (AAV) particle. In some embodiments, the nuclease is codon-optimized for expression in a cell.

[0040] In some embodiments, the promoter is operably linked to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 gRNAs. In some embodiments, the gRNA targets a DNA sequence encoding a variant GNAQ p.(R183Q), p.(R183G), p.(R183L), or p.(R183*). In some embodiments, the gRNA targets a DNA sequence encoding a variant GNA11 p.(R183C) or p.(R183H).

[0041] The present invention also provides a method of treating a patient having a disease or disorder associated with or caused by a variant of GNAQ and / or GNA11, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention. The present invention also provides a method of treating a patient having Sturge-Weber syndrome (SWS), pigmented vascular phakomatosis (PPV), or extensive cutaneous melanosis (EDM), the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention. The present invention also provides a method of treating a patient having a congenital hemangioma, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention. In some embodiments, the congenital hemangioma is a rapidly involuting congenital hemangioma (RICH), a partially involuting congenital hemangioma (PICH), or a non-involuting congenital hemangioma (NICH).

[0042] The present invention also provides a method of treating a patient with cancer, comprising administering to the patient a nucleic acid molecule, a compound, a composition, a prodrug, or a CRISPR nuclease system according to the present invention. In some embodiments, the cancer is selected from the list consisting of adrenal gland cancer, autonomic ganglion cancer, biliary tract cancer, bone cancer, breast cancer, central nervous system cancer, cervical cancer, endometrial cancer, eye cancer, fallopian tube cancer, female genital cancer, gastrointestinal tract cancer, reproductive cancer, hematopoietic cancer, lymphatic system cancer, kidney cancer, colon cancer, liver cancer, lung cancer, meningeal cancer, NS cancer, esophageal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, perineal cancer, peritoneal cancer, pituitary cancer, placental cancer, pleural cancer, prostate cancer, salivary gland cancer, skin cancer, small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thymic cancer, thyroid cancer, upper aerodigestive tract cancer, urinary tract cancer, uterine adnexal cancer, vaginal cancer, and vulvar cancer.

[0043] The present invention also provides a method of treating a patient with melanoma, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention.The present invention also provides a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention for use as a medicament.

[0044] The present invention also provides a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the present invention for use in a method of treating Sturge-Weber Syndrome (SWS), Pigmented Vascular Phemastoides (PPV) or Extensive Cutaneous Melanosis (EDM) in a patient in need of such treatment, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the present invention.

[0045] The invention also provides a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention for use in a method of treating a patient having a congenital hemangioma, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the invention. In some embodiments, the congenital hemangioma is a rapidly involuting congenital hemangioma (RICH), a partially involuting congenital hemangioma (PICH), or a non-involuting congenital hemangioma (NICH).

[0046] The present invention also provides a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the present invention for use in a method of treating cancer in a patient in need of such treatment, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug or CRISPR nuclease system according to the present invention.

[0047] The present invention also provides a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention for use in a method of treating melanoma in a patient in need of such treatment, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention.

[0048] The present invention also provides an expression construct comprising a nucleic acid molecule encoding a nucleic acid molecule, a compound, a composition, a prodrug, or a CRISPR nuclease system according to the present invention. The present invention also provides an isolated nucleic acid molecule encoding a nucleic acid molecule, a compound, a composition, a prodrug, or a CRISPR nuclease system according to the present invention. The present invention also provides a vector comprising an isolated nucleic acid molecule of the present invention. In some embodiments, the vector is a viral vector, a retroviral vector, an expression cassette, or a plasmid. In some embodiments, the vector further comprises an RNA polymerase III or RNA polymerase II promoter. In some embodiments, the RNA polymerase III promoter is a U6 or H1 promoter.

[0049] The present invention also provides a host cell comprising the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to the present invention, the isolated nucleic acid molecule according to the present invention, or the vector according to the present invention. In some embodiments, the host cell is a mammalian host cell. In some embodiments, the host cell is a human host cell.

[0050] In some embodiments, the nucleic acid molecule, compound, composition, or prodrug is formulated for delivery by lipid-based nanoparticles, liposomes, exosomes, polymeric nanoparticles, inorganic nanoparticles, or co-delivery polyelectrolyte nanocomplexes (RTNPs) of ruxolitinib and thalidomide. In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is not packaged for delivery (gymnotic delivery). In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is administered by injection. In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is injected using a microneedle. In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is administered locally.

[0051] In some embodiments, the administration further comprises electroporation or ultrasound.

[0052] In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is conjugated to docosanoic acid (DCA). In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is not packaged for delivery (gymnotic delivery). In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is administered by injection. In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is injected using a microneedle. In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is formulated for delivery by lipid-based nanoparticles and injected using a microneedle. In some embodiments, the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is conjugated to docosanoic acid (DCA) and injected using a microneedle.

[0053] The present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an equal-length portion of a pregenomic RNA and / or mRNA encoding a gain-of-function variant of GNAQ or a gain-of-function variant of GNA11, and the sense strand is at least partially complementary to the antisense strand.

[0054] The present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an equal-length portion of pregenomic RNA and / or mRNA encoding variant GNAQ or variant GNA11, and the sense strand is at least partially complementary to the antisense strand.

[0055] The present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an isometric portion of pregenomic RNA and / or mRNA encoding variant GNAQ p.(R183Q) or variant GNA11 p.(R183C), and the sense strand is at least partially complementary to the antisense strand.

[0056] The present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isometric portion of a pregenomic RNA and / or mRNA encoding variant GNAQ p.(R183Q), and the sense strand is at least partially complementary to the antisense strand.

[0057] The present invention provides a double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an equal length portion of pregenomic RNA and / or mRNA encoding variant GNA11 p.(R183C), and the sense strand is at least partially complementary to the antisense strand.

[0058] In some embodiments, the antisense strand consists of 15-20 linked nucleosides. In some embodiments, the antisense strand consists of 15-25 linked nucleosides. In some embodiments, the antisense strand consists of 20-30 linked nucleosides. In some embodiments, the antisense strand consists of 20-25 linked nucleosides. In some embodiments, the antisense strand consists of 19 linked nucleosides.

[0059] In some embodiments, the antisense strand comprises a sequence that is fully complementary to a sequence that has at least 95% identity with an isometric portion of the pregenomic RNA and / or mRNA encoding the variant GNAQ p.(R183Q) or GNA11 p.(R183C). In some embodiments, the antisense strand comprises a sequence that is fully complementary to a sequence that has 100% identity with an isometric portion of the pregenomic RNA and / or mRNA encoding the variant GNAQ p.(R183Q) or GNA11 p.(R183C).

[0060] In some embodiments, the sense strand is at least 80% complementary to the antisense strand. In some embodiments, the sense strand is at least 90% complementary to the antisense strand. In some embodiments, the sense strand is at least 95% complementary to the antisense strand. In some embodiments, the sense strand is completely complementary to the antisense strand.

[0061] In some embodiments, the double-stranded ribonucleic acid molecule or compound can inhibit the expression of variant GNAQ p.(R183Q) or GNA11 p.(R183C) in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or preferably at least 90%. In some embodiments, the compound can partially or completely rescue the abnormal calcium signaling in cells expressing variant GNAQ p.(R183Q) or GNA11 p.(R183C). In some embodiments, the GNAQ R183Q variant is caused by a c.G548A mutation in the GNAQ genomic sequence. In some embodiments, the antisense strand comprises a sequence that is fully complementary to the c.G548A mutation. In some embodiments, the GNA11 R183C variant is caused by a c.C547T mutation in the GNA11 genomic sequence. In some embodiments, the antisense strand comprises a sequence that is fully complementary to the c.C547T mutation.

[0062] In some embodiments, the antisense strand is longer than the sense strand. In some embodiments, the double-stranded ribonucleic acid molecule has an overhang at the 3' end of the antisense strand of 1, 2, 3, 4, 5 or more nucleosides. In some embodiments, the double-stranded ribonucleic acid molecule has an overhang at the 3' end of the antisense strand of two nucleosides. In some embodiments, the double-stranded ribonucleic acid molecule has an overhang at the 5' end of the antisense strand of 1, 2, 3, 4, 5 or more nucleosides. In some embodiments, the double-stranded ribonucleic acid molecule has an overhang at the 5' end of the antisense strand of two nucleosides.

[0063] In some embodiments, the sense strand is longer than the antisense strand. In some embodiments, the double-stranded ribonucleic acid molecule has an overhang at the 3' end of the sense strand of 1, 2, 3, 4, 5 or more nucleosides. In some embodiments, the double-stranded ribonucleic acid molecule has an overhang at the 3' end of the sense strand of two nucleotides. In some embodiments, the double-stranded ribonucleic acid molecule has an overhang at the 5' end of the sense strand of 1, 2, 3, 4, 5 or more nucleosides. In some embodiments, the double-stranded ribonucleic acid molecule has an overhang at the 5' end of the sense strand of two nucleotides.

[0064] In some embodiments, the sense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC), SEQ ID NO:2 (GCUUAGAGUUCAAGUCCCC), SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA), SEQ ID NO:4 (UUAGAGUUCAAGUCCCCAC), SEQ ID NO:5 (UAGAGUUCAAGUCCCCACC), SEQ ID NO:6 (AGAGUUCAAGUCCCCACCA), SEQ ID NO:7 (GUGCUGCGGGUCUGCGUGC), SEQ ID NO:8 (UGCUGCGGGUCUGCGUGCC), SEQ ID NO:9 (GCUGCGGGUCUGCGUGCCC), SEQ ID NO:10 (CUGCGGGUCUGCGUGCCCA), SEQ ID NO:11 (UGCGGGUCUGCGUGCCCAC), or SEQ ID NO:12 (CGGGUCUGCGUGCCCACCA).

[0065] In some embodiments, the sense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC) or SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA).

[0066] In some embodiments, the sense strand comprises a nucleobase sequence comprising SEQ ID NO: 10 (CUGCGGGUCUGCGUGCCCA).

[0067] In some embodiments, the sense strand consists of a nucleobase sequence comprising any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC), SEQ ID NO:2 (GCUUAGAGUUCAAGUCCCC), SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA), SEQ ID NO:4 (UUAGAGUUCAAGUCCCCAC), SEQ ID NO:5 (UAGAGUUCAAGUCCCCACC), SEQ ID NO:6 (AGAGUUCAAGUCCCCACCA), SEQ ID NO:7 (GUGCUGCGGGUCUGCGUGC), SEQ ID NO:8 (UGCUGCGGGUCUGCGUGCC), SEQ ID NO:9 (GCUGCGGGUCUGCGUGCCC), SEQ ID NO:10 (CUGCGGGUCUGCGUGCCCA), SEQ ID NO:11 (UGCGGGUCUGCGUGCCCAC), or SEQ ID NO:12 (CGGGUCUGCGUGCCCACCA).

[0068] In some embodiments, the sense strand consists of a nucleobase sequence having any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC) or SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA).

[0069] In some embodiments, the sense strand consists of the nucleobase sequence having SEQ ID NO: 10 (CUGCGGGUCUGCGUGCCCA).

[0070] In some embodiments, the antisense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA), SEQ ID NO:14 (GGGGACUUGAACUCUAAGC), SEQ ID NO:15 (UGGGGACUUGAACUCUAAG), SEQ ID NO:16 (GUGGGGACUUGAACUCUAA), SEQ ID NO:17 (GGUGGGGACUUGAACUCUA), SEQ ID NO:18 (UGGUGGGGACUUGAACUCU), SEQ ID NO:19 (GCACGCAGACCCGCAGCAC), SEQ ID NO:20 (GGCACGCAGACCCGCAGCA), SEQ ID NO:21 (GGGCACGCAGACCCGCAGC), SEQ ID NO:22 (UGGGCACGCAGACCCGCAG), SEQ ID NO:23 (GUGGGCACGCAGACCCGCA), SEQ ID NO:24 (UGGUGGGCACGCAGACCCG).

[0071] In some embodiments, the antisense strand comprises a nucleobase sequence comprising any one of SEQ ID NO: 13 (GGGACUUGAACUCUAAGCA) or SEQ ID NO: 15 (UGGGGACUUGAACUCUAAG).

[0072] In some embodiments, the antisense strand comprises a nucleobase sequence comprising SEQ ID NO: 22 (UGGGCACGCAGACCCGCAG).

[0073] In some embodiments, the antisense strand consists of a nucleic acid base sequence having any one of SEQ ID NO: 13 (GGGACUUGAACUCUAAGCA), SEQ ID NO: 14 (GGGGACUUGAACUCUAAGC), SEQ ID NO: 15 (UGGGGACUUGAACUCUAAG), SEQ ID NO: 16 (GUGGGGACUUGAACUCUAA), SEQ ID NO: 17 (GGUGGGGACUUGAACUCUA), SEQ ID NO: 18 (UGGUGGGGACUUGAACUCU), SEQ ID NO: 19 (GCACGCAGACCCGCAGCAC), SEQ ID NO: 20 (GGCACGCAGACCCGCAGCA), SEQ ID NO: 21 (GGGCACGCAGACCCGCAGC), SEQ ID NO: 22 (UGGGCACGCAGACCCGCAG), SEQ ID NO: 23 (GUGGGCACGCAGACCCGCA), SEQ ID NO: 24 (UGGUGGGCACGCAGACCCG).

[0074] In some embodiments, the antisense strand consists of a nucleobase sequence having any one of SEQ ID NO: 13 (GGGACUUGAACUCUAAGCA) or SEQ ID NO: 15 (UGGGGACUUGAACUCUAAG).

[0075] In some embodiments, the antisense strand consists of a nucleobase sequence having SEQ ID NO: 22 (UGGGCACGCAGACCCGCAG).

[0076] In some embodiments, the sense strand comprises a nucleobase sequence comprising SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:13, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:2 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:14, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:15, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:4 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:16, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:5 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:17, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:6 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:18. or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:7 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:19, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:8 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:20, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:9 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:21, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:10 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:22, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:11 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:23, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:12 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:24.

[0077] In some embodiments, the sense strand comprises a nucleobase sequence comprising SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:13, or the sense strand comprises a nucleobase sequence comprising SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:15.

[0078] In some embodiments, the sense strand comprises a nucleobase sequence comprising SEQ ID NO:10 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:22.

[0079] In some embodiments, the sense strand comprises the nucleobase sequence of SEQ ID NO:1 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:13, or the sense strand comprises the nucleobase sequence of SEQ ID NO:2 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:14, or the sense strand comprises the nucleobase sequence of SEQ ID NO:3 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:15, or the sense strand comprises the nucleobase sequence of SEQ ID NO:4 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:16, or the sense strand comprises the nucleobase sequence of SEQ ID NO:5 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:17, or the sense strand comprises the nucleobase sequence of SEQ ID NO:6 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:18. or the sense strand comprises the nucleobase sequence of SEQ ID NO:7 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:19, or the sense strand comprises the nucleobase sequence of SEQ ID NO:8 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:20, or the sense strand comprises the nucleobase sequence of SEQ ID NO:9 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:21, or the sense strand comprises the nucleobase sequence of SEQ ID NO:10 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:22, or the sense strand comprises the nucleobase sequence of SEQ ID NO:11 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:23, or the sense strand comprises the nucleobase sequence of SEQ ID NO:12 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:24.

[0080] In some embodiments, the sense strand comprises the nucleobase sequence of SEQ ID NO:1 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:13, or the sense strand comprises the nucleobase sequence of SEQ ID NO:3 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:15.

[0081] In some embodiments, the sense strand comprises the nucleobase sequence consisting of SEQ ID NO:10 and the antisense strand comprises the nucleobase sequence consisting of SEQ ID NO:22.

[0082] The present invention provides a compound comprising a double-stranded ribonucleic acid molecule according to any preceding claim and a conjugate group. In some embodiments, the conjugate group comprises one or more carbohydrates.

[0083] In some embodiments, the conjugate group is a monosaccharide, a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, a polysaccharide, a modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L-mannopyranose, D-arabinose, L-galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, aD-mannofuranose, β-D -Mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, α-D-galactofuranose tosamine, N-acetylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycoloyl-α-neuraminic acid, 5-thio-β-D-glucose copyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,5-anhydro-D-allonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose.

[0084] In some embodiments, the conjugate group is linked to the 3' end of the sense strand. In some embodiments, the conjugate group is linked to the 5' end of the sense strand. In some embodiments, the conjugate group is linked to the 5' end of the antisense strand. In some embodiments, the conjugate group is linked to the 3' end of the antisense strand.

[0085] In some embodiments, at least one nucleoside comprises a modified sugar. In some embodiments, at least one internucleoside linkage is a modified internucleoside linkage. In some embodiments, the modified internucleoside linkage is a phosphorothioate or phosphorodithioate internucleoside linkage. In some embodiments, the double-stranded ribonucleic acid molecule or compound comprises 1 to 15 phosphorothioate or phosphorodithioate internucleoside linkages.

[0086] The present invention provides a composition comprising a double-stranded ribonucleic acid molecule or compound or a salt thereof according to any preceding claim and at least one of a pharma- ceutically acceptable carrier or diluent.

[0087] The present invention provides a prodrug comprising the double-stranded ribonucleic acid molecule or compound of the present invention.

[0088] The present invention provides a method of treating a patient having a disease or disorder associated with or driven by a variant in GNAQ and / or GNA11, the method comprising administering to the patient a compound or composition that specifically targets a variant GNAQ and / or GNA11 allele.

[0089] The present invention provides a method for treating a patient having a disease or disorder associated with or caused by a variant of GNAQ and / or GNA11, the method comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to the present invention, a composition according to the present invention, or a prodrug according to the present invention.

[0090] The present invention provides a method of treating a patient having Sturge-Weber syndrome (SWS), pigmented vascular phakotosis (PPV), or extensive cutaneous melanosis (EDM), the method comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according to the invention, or a prodrug according to the invention.

[0091] The present invention provides a method for treating a patient having cancer, the method comprising administering to the patient a double-stranded ribonucleic acid molecule or a compound according to the present invention, a composition according to the present invention, or a prodrug according to the present invention.

[0092] The present invention provides a method for treating a patient having melanoma, the method comprising administering to the patient a double-stranded ribonucleic acid molecule or a compound according to the present invention, a composition according to the present invention, or a prodrug according to the present invention.

[0093] The present invention provides a double-stranded ribonucleic acid molecule or a compound according to the present invention, a composition according to the present invention, or a prodrug according to the present invention for use as a medicament.

[0094] The present invention provides a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according to the invention, or a prodrug according to the invention for use in a method of treating Sturge-Weber syndrome (SWS), pigmented leukemia (PPV), or extensive cutaneous melanosis (EDM) in a patient in need of such treatment, the method comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to the invention, a composition according to the invention, or a prodrug according to the invention.

[0095] The present invention provides a double-stranded ribonucleic acid molecule or a compound according to the present invention, a composition according to the present invention, or a prodrug according to the present invention for use in a method of treating cancer in a patient in need of such treatment, the method comprising administering to the patient a double-stranded ribonucleic acid molecule or a compound according to the present invention, a composition according to the present invention, or a prodrug according to the present invention.

[0096] The present invention provides a double-stranded ribonucleic acid molecule or compound according to the present invention, a composition according to the present invention, or a prodrug according to the present invention for use in a method of treating melanoma in a patient in need of such treatment, the method comprising administering to the patient a double-stranded ribonucleic acid molecule or compound according to the present invention, a composition according to the present invention, or a prodrug according to the present invention.

[0097] The present invention provides a method of treating a patient having Sturge-Weber syndrome (SWS), pigmented vascular phakomatosis (PPV), or extensive cutaneous melanosis (EDM), comprising administering to the patient a compound or composition that specifically targets variant alleles of GNAQ and / or GNA11.

[0098] The present invention provides a method of treating a patient with cancer comprising administering to the patient a compound or composition that specifically targets a variant allele of GNAQ and / or GNA11.

[0099] The present invention provides a method of treating a patient with melanoma comprising administering to the patient a compound or composition that specifically targets a variant allele of GNAQ and / or GNA11.

[0100] In some embodiments, the variant allele of GNAQ comprises a mutation that causes a R183Q substitution. In some embodiments, the variant allele of GNA11 comprises a mutation that causes a R183C substitution. In some embodiments, the compound or composition that specifically targets the variant allele of GNAQ and / or GNA11 can inhibit the expression of variant GNAQ or variant GNA11 in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or preferably at least 90%. In some embodiments, the compound or composition that specifically targets the variant allele of GNAQ and / or GNA11 can partially or completely rescue the abnormal calcium signaling in cells expressing variant GNAQ or variant GNA11.

[0101] The present invention provides an expression construct comprising a nucleic acid molecule encoding a double-stranded ribonucleic acid molecule or compound according to the present invention. The present invention provides an isolated nucleic acid molecule encoding a double-stranded ribonucleic acid molecule or compound according to the present invention. The present invention provides a vector comprising an isolated nucleic acid molecule of the present invention. In some embodiments, the vector is a viral vector, a retroviral vector, an expression cassette, or a plasmid. In some embodiments, the vector further comprises an RNA polymerase III or RNA polymerase II promoter. In some embodiments, the RNA polymerase III promoter is a U6 or H1 promoter.

[0102] The present invention provides a host cell comprising a double-stranded ribonucleic acid molecule or compound according to the present invention, an isolated nucleic acid molecule according to the present invention, or a vector according to the present invention. In some embodiments, the host cell is a mammalian host cell. In some embodiments, the host cell is a human host cell.

[0103] In one aspect, instead of being an interfering ribonucleic acid (e.g., siRNA or shRNA) as described above, the RNAi agent may code an interfering ribonucleic acid (e.g., shRNA) as described above. In other words, the RNAi agent may be a transcription template of an interfering ribonucleic acid. Thus, the RNAi agent of the present invention may also include short hairpin RNA (shRNA) and the expression construct that is engineered to express shRNA. Upon expression, shRNA is believed to fold into a stem-loop structure with 3'UU overhangs, and then the ends of these shRNAs are processed, converting shRNA into siRNA-like molecules.

[0104] Microneedles or microneedle patches or microarray patches are micron-scale medical devices used to administer therapeutic agents. Microneedles can also be used for transdermal drug delivery applications, as well as intraocular, intravaginal, enteral, cardiac, vascular, gastrointestinal, and intracochlear delivery of drugs. Microneedles are typically constructed by a variety of methods, including photolithography processes or micromolding. These methods involve etching microstructures into resin or silicon to cast the microneedle. Microneedles are made from a variety of materials ranging from silicon, titanium, stainless steel, and polymers. Some microneedles are made of the drug to be delivered to the body, but are needle-shaped so that they penetrate the skin. Microneedles vary in size, shape, and function, but all are used as an alternative to other delivery methods such as traditional hypodermic needles or other injection devices.

[0105] Microneedles are usually applied via single needles or small arrays. The arrays used are collections of microneedles, from just a few microneedles to hundreds of microneedles, attached to an applicator, sometimes a patch or other solid stamping device. The array is applied to the patient's skin and time is given to allow effective administration of the drug. The size of the individual microneedles can be optimized depending on the desired size of the microneedle, for example, the targeting depth of the microneedle, the strength requirements of the needle to avoid breakage in a particular tissue type, etc.

[0106] Solid microneedles are designed as a two-part system: first, a microneedle array is applied to the skin to create microscopic wells just deep enough to penetrate the outermost layer of the skin, and then drugs are applied via a transdermal patch. Solid microneedles are already used by dermatologists in collagen induction therapy, a method that uses repeated punctures of the skin with microneedles to induce the expression and deposition of the skin proteins collagen and elastin.

[0107] Hollow microneedles are similar to solid microneedles in material. They contain reservoirs that deliver drugs directly to the site. Because drug delivery depends on the flow rate of the microneedle, this type of array can become clogged due to overexpansion or design flaws.

[0108] Coated microneedles are usually designed from polymers or metals. In this method, the drug is applied directly to the microneedle array, rather than through other patches or applicators. Coated microneedles are often covered with other surfactants or thickening agents to ensure that the drug is properly delivered.

[0109] Dissolvable microneedles encapsulate drugs in a non-toxic polymer that dissolves once inside the skin. The polymer allows the drug to be delivered to the skin and can be broken down once inside the body. Polymers such as fibroin, a silk-based protein, can be molded into microneedle-like structures and dissolved once inside the body.

[0110] The hydrogel-forming microneedles have a drug encapsulated in a polymer. The microneedles can penetrate the stratum corneum and imbibe interstitial fluid, resulting in swelling of the polymer. The drug enters the skin from the swollen matrix.

[0111] Different methods of producing lipid-encapsulated RNA nanoparticles are known to those skilled in the art. Techniques are known for preparing lipid-encapsulated RNA nanoparticles using an ethanol injection type process with a static mixer that provides a turbulent environment that is combined with therapeutic molecules after vesicle formation. Other techniques are also known for forming lipid-encapsulated RNA nanoparticles using non-turbulent mixing and a series of continuous stepwise dilutions. Particles can also be formed by spraying lipids in an organic solution pipe through an orifice onto nucleic acid in an aqueous solution flowing through the orifice. The parameters for producing lipid-encapsulated RNA nanoparticles can be modified depending on the desired properties.

[0112] Nano-delivery systems such as the co-delivery polyelectrolyte nanocomplex (RTNP) of ruxolitinib and thalidomide can be engineered to mimic viruses while maintaining the safety of non-viral particles. One approach is to facilitate delivery to specific cell types by incorporating peptides into the particles that have affinity for cell surface receptors or other proteins specific to the cell type of interest. Very often, peptides that target a particular cell type are not yet known, and experiments (e.g., phage display library biopanning) can be used to identify novel amino acid sequences that have affinity for the particular cell type of interest.

[0113] Along with the selection of optimal lipids for this purpose, there is a modular approach to test hypotheses to identify those attributes that best deliver cargo to the cell type of interest

[22] . A recent study used existing literature to design peptides that target receptors on specific cell types in the skin (fibroblasts, melanocytes, and keratinocytes)

[23] . However, we expect that an unbiased approach to identify novel cell-targeting peptides using phage display libraries will reveal the most effective peptides for this purpose. Furthermore, the cells of interest are often pathological and / or different from their closest equivalents in healthy humans. It is therefore important to conduct studies specifically on these cells to most effectively target the nanodelivery system.

[0114] In some embodiments, reconstituted viral envelopes are used to encapsulate and deliver siRNA. Reconstituted membrane vesicles can contain viral spike proteins and additionally added cationic lipids. siRNA-loaded vesicles can be taken up by receptor-mediated endocytosis and avoid endosomal degradation by fusion with endosomal membranes. Functional siRNA delivery has been demonstrated in vitro and in vivo. As with some viral approaches, the drawbacks of the system are the difficulty of repeated administration and limited control over the transduced cell type.

[0115] In some embodiments, DNA encoding siRNA can be delivered by virus for gene silencing in vivo. To improve specificity, the natural tropism of the virus for a particular cell type may be used. In some embodiments, it may be possible to direct the natural tropism of the virus to a therapeutically useful receptor on the surface of the target cell. Examples include retargeting mouse coronavirus to human epidermal growth factor receptor, directing adenovirus to its associated receptor (FGFR1) via fibroblast growth factor ligand for delivery to glioma, or delivering adenovirus to angiogenic endothelium via RGD-peptide binding alpha v-integrin. One particular advantage of the viral delivery approach is the efficient transduction of cells.

[0116] In some embodiments, the compounds of the present invention can be delivered via non-viral delivery.While viral vectors offer many of the desirable features for efficient nucleic acid delivery, non-viral vectors offer other advantages.The key advantages of synthetic vector systems are safety (related to their lack of immunogenicity and low integration frequency) and ease of large-scale production.In addition, they can accommodate a wide variety of nucleic acid sizes and allow for easy modification.

[0117] Non-viral delivery systems may require the incorporation of functional groups into the compounds of the invention. Cationic functional groups are usually required to bind and condense nucleic acids, thereby protecting them against nucleases and (important for siRNA) increasing their apparent molecular weight above the renal clearance cutoff.

[0118] Conjugation of siRNA to docosanoic acid (DCA) allows for productive delivery to all major skin cell types local to the injection site with a single dose. In an ex vivo model of IFN-γ signaling, DCA-siRNA efficiently inhibits the induction of IFN-γ-inducible chemokines CXCL9 and CXCL10 in skin biopsies from the injection site. It has been demonstrated that DCA-siRNA can be engineered for functional gene silencing in the skin, establishing a path toward siRNA therapy of autoimmune skin diseases

[24] .

[0119] Sturge-Weber syndrome (SWS) and pigmented vascular phavosis (PPV) form a spectrum of severe, untreatable rare disorders characterized by vascular malformations of the skin, CNS, and eyes. They are caused by mosaic variants in GNAQ / GNA11, which encodes a Gαq / 11 protein subunit essential for intracellular signaling pathways. How the pathogenic variants affect the vascular endothelium is unclear. The classical finding of progressive neurovascular calcification led to the hypothesis that disruptions in calcium handling may be involved in the pathogenesis of the disease and may be amenable to therapy.

[0120] Thirty-five patients were recruited for whole-body calcium metabolism profiling. Calcium signaling was assessed in two cell models expressing GNAQ (c.548G>A, p.(R183Q)) and GNA11 (c.547C>T, p.(R183C)). siRNA was designed to specifically knockdown the variant allele.

[0121] Sixty percent of patients at baseline had at least one abnormal measurement of calcium metabolism. The most common finding was reduced serum ionized calcium in 43%, which increased significantly with age. The GNAQ / 11 variant conferred prominent constitutive calcium signaling to endothelial cells without activating ERK. GNAQ variant cells further showed an amplified intracellular calcium response to activation of G protein-coupled receptors by thrombin, which increased calcium influx from the extracellular space and replenished intracellular stores. These defects were rescued by siRNA and CRAC channel inhibition, confirming the genetic cause and biological pathways involved.

[0122] Disruption of whole-body calcium homeostasis in a significant proportion of patients has no other demonstrable cause and increases markedly with age, suggesting that this results from chronic GNAQ / 11-driven hyperactivation in mosaic body regions. These data suggest a biological basis for these diseases and identify new therapeutic strategies to combat the neurological phenotype. [Brief description of the drawings]

[0123] [Figure 1]Patients with SWS and PPV have disrupted systemic calcium homeostasis. A. Clinical features of a patient with Sturge-Weber syndrome with capillary malformations of the head involving the severe forehead region, with glaucoma in the right eye. This patient had hypocalcemia with low levels of ionized and total calcium (1.15 mmol / L and 2.08 mmol / L, respectively) and elevated PTH (7.4 pmol / L), consistent with secondary hyperparathyroidism. Age-adjusted ionized calcium reference range: 1.22-1.31 mmol / L, total calcium reference range: 2.19-2.66 mmol / L, PTH reference range: 0.7-5.6 pmol / L. B-C. Contrast-enhanced FLAIR and T1-weighted MR images of a patient with Sturge-Weber syndrome show leptomeningeal angiomatosis (arrows) in the left frontal, parietal, and occipital regions. D. Susceptibility-weighted image (SWI), and E. SWI phase map showing vascular calcification (arrow). This patient had hypocalcemia with low levels of ionized calcium (1.17 mmol / L) and total calcium and PTH within the normal range. Ionized calcium reference range: 1.22-1.31 mmol / L. F. Correlation between age and serum calcium corrected for albumin from a cohort of patients. Linear regression analysis showed a statistically significant negative correlation (p<0.001). G. Correlation between age and urinary calcium / creatinine ratio from a cohort of patients. Linear regression analysis showed a statistically significant negative correlation (p=0.019). [Diagram 2]GNAQ / GNA11 variants cause constitutive activation and amplify thrombin-induced intracellular calcium signaling in endothelial cells. A. TIME recombinant cell lines were assayed for the concentration of IP1 under complete medium and starvation conditions. Graphs represent the mean of two independent experiments. Statistical comparison between conditions was by two-tailed unpaired t-test (****p<0.0001). B. Densitometric analysis performed on three or four independent Western blot experiments on TIME recombinant cell lines in complete medium or after 1 h of acute starvation. Two-tailed unpaired t-tests did not reveal any statistically significant differences between GNAQ or GNA11 WT and variant cell lines in any condition. C. HEK DKO Gαq / 11, CaSR, NFAT-Luc cells were transfected with GNAQWT, GNAQR183Q, GNA11WT, or GNA11R183C constructs and treated with vehicle or three concentrations of extracellular calcium to stimulate CaSR activation and downstream G protein signaling. Luciferase activity was measured 4 hours after stimulation. Graphs represent the mean of three independent experiments. Statistical comparisons between different conditions were performed by two-tailed paired t-test (*p<0.05). D. TIME-GNAQWT or GNAQR183Q were loaded with the intracellular calcium probe Fluo-8 and stimulated with thrombin (1U / Ml) in HBSS standard buffer (yellow and blue lines) or after a prolonged exposure of 100 seconds to HBSS calcium-free buffer (black and red lines). The change in fluorescence over time was recorded and normalized to the maximum and minimum responses to calculate cytosolic [Ca2+]. The graph represents the average of three independent experiments performed with six technical replicates. Statistical testing performed by two-way ANOVA (****p<0.0001). [Diagram 3]CRAC channel inhibition and variant-specific siRNA rescue aberrant calcium signaling in variant cells. A-B. TIME-GNAQWT (A) or -GNAQR183Q (B) were loaded with the intracellular calcium probe Fluo-8 and treated with vehicle or 1 μM CX4620 for 20 min. After treatment, cells were stimulated with thrombin 1 U / ml and fluorescence was recorded for 300 s. These graphs represent the mean of three independent experiments performed with four technical replicates. C. Mean + / - SD deviation of the area under the curve calculated from the three experiments summarized in Figure 1A-B. Statistical comparisons were made by two-tailed paired t-test (ns = not statistically significant, *p = 0.0284). D. TIME-GNAQR183Q or -GNA11R183C were not transfected or were transfected with 10 nM non-targeting siRNA (siSCRA) or 10 nM siRNA for specific silencing of variant alleles (siGNAQmut1 and siGNAQmut3 for targeting GNAQ variant alleles and siGNA11mut4 for silencing GNA11 variant alleles). IP1 concentrations were measured 48 hours after transfection and shown as mean + / - SD of three independent experiments. Statistical comparisons were performed by two-tailed unpaired t-test (**p<0.005). E. TIME cells carrying the GNAQR183Q mutation were transfected with an NFAT-luciferase reporter and stable clones were obtained after antibiotic selection. TIME-GNAQp.(R183Q);NFAT-Luc was transfected with a non-targeting siRNA (siSCRA) or two siRNAs for specific silencing of variant GNAQ alleles (siGNAQmut1 and 3), and luciferase reporter activity was measured 48 hours after transfection in complete medium or after 4 hours of starvation and is shown as the mean + / - SD of the % change of mock-transfected cells in three independent experiments. Statistical comparisons were performed by two-tailed unpaired t-test (*p<0.05; **p<0.01).F. TIME cells carrying GNAQR183Q were transfected with a non-targeting siRNA (siSCRA) or two siRNAs for specific silencing of variant GNAQ alleles. 48 hours after transfection, they were loaded with Fluo-8 intracellular calcium dye and stimulated with thrombin 1U / ml, while the fluorescent signal was recorded at 1 second intervals for up to 300 seconds. The graph represents the mean of three independent experiments. Statistical tests performed by two-way ANOVA (***p<0.001; ****p<0.0001). G. UPMM-1 uveal melanoma cell line carrying GNAQR183Q was transfected with 25nM of a non-targeting siRNA (siSCRA) or two siRNAs for specific silencing of variant GNAQ alleles (siGNAQmut1 and siGNAQmut6). IP1 concentrations were measured 48 hours after transfection and shown as the mean + / - SD of three independent experiments. Statistical comparisons were performed by two-tailed unpaired t-test. [Figure 4] Generation and validation of TIME transgenic cell lines stably expressing GNAQWT, GNAQR183Q, GNA11WT, or GNA11R183C alleles. A. Schematic of lentiviral expression vectors used to infect TIME cell lines and generate stable recombinant derivatives. B. Sanger sequencing was performed on TIME recombinant models using primers annealing to exon 4 of the GNAQ or GNA11 genes. Chromatograms of GNAQ and GNA11 codon 183 to confirm mutations. C. Western blot analysis of TIME parental and TIME untransduced or transduced with GNAQWT, GNAQR183Q, GNA11WT, or GNA11R183C lentiviruses. Cell lysates were probed with the indicated antibodies. D. Western blot analysis of HEK DKO Gαq / 11, CasR, NFAT-Luc cells untransfected or transfected with GNAQWT, GNAQR183Q, GNA11WT, or GNA11R183C pcDNA3.1(+)-N-HA plasmids. Cell lysates were probed with the indicated antibodies to demonstrate equivalent expression of the transgenes. [Diagram 5] Design and testing of siRNAs specific for GNAQ c.548G>A,p.(R183Q). A. Schematic of six siRNAs designed to specifically target the GNAQ c.548G>A allele. B. TIME cells stably expressing either wild-type or p.R183Q HA-tagged Gαq were transfected with 50 nM of siRNA targeting GNAQ c.548G>A.(R183Q) allele and analyzed by Western blot 24 hours after transfection. Lysates were probed with the indicated antibodies. siRNA siGNAQmut#1 and 3 (squares) showed specific knockdown of the variant protein over the wild-type counterpart. C. Densitometric quantification of bands from Western blot experiments similar to those shown in Figure 5A. (mean of three experiments, *p<0.05). D. Schematic of six siRNAs designed to specifically target GNA11 c.547C>T p.(R183C). E. TIME cells stably expressing either wild-type or p.R183C HA-tagged Gα11 were transfected with 25 nM siRNA targeting the GNA11 c.547C>T,p.(R183C) allele and analyzed by Western blot 24 h post-transfection. Lysates were probed with the indicated antibodies. siRNAs siGNA11mut#4 (squares) showed specific knockdown of the variant protein over its wild-type counterpart. F. Densitometric quantification of bands from Western blot experiments similar to those shown in Figure 5C. (mean of three experiments, *p<0.05). [Figure 6]Deep phenotyping and serum calcium metabolic profile of patients in SWS (patients 1–28) and PPV (patients 29–35) *represents patients previously reported in [7]. Abbreviations: MRI: magnetic resonance imaging, F: female, M: male, ADHD: attention deficit hyperactivity disorder, IOP: intraocular pressure, DVA: venous malformation, DMV: deep medullary vein, PTH: parathyroid hormone. Ionized calcium levels were corrected for pH. Pediatric range references for ionized calcium: 1.15–1.41 mmol / L (<2 years), 1.19–1.37 mmol / L (2–5 years), 1.22–1.31 mmol / L (5–15 years). PTH reference range: 0.7–5.6 pmol / L. *In accordance with published guidelines [9], we currently do not perform MRI / MRA in the absence of vascular lesions in the forehead area and neurological symptoms. [Figure 7]Systemic calcium metabolism profiling in patients with SWS and PPV type with cutaneous melanosis. Abbreviations: WT: wild type. Total calcium values ​​were corrected for albumin and ionized calcium was corrected for pH. Age-adjusted ionized calcium reference ranges: 1.15-1.41 mmol / L (<2 years), 1.19-1.37 mmol / L (2-5 years), 1.22-1.31 mmol / L (5-15 years). Age-adjusted total calcium reference ranges: 1.96-2.66 mmol / L (0-5 days of age), 2.17-2.44 mmol / L (5 days of age to 3 years), 2.22-2.51 mmol / L (3-10 years), 2.19-2.66 mmol / L (10-15 years), 2.10-2.55 mmol / L (>15 years). Age-adjusted phosphate reference ranges: 1.5-2.6 mmol / L (0-5 days), 1.2-2.1 mmol / L (5 days-3 years), 1.2-1.8 mmol / L (3-10 years), 1.1-1.75 mmol / L (10-15 years), 0.8-1.45 mmol / L (>15 years). Total vitamin D reference ranges: insufficient (25-50 nmol / L), deficient (<25 nmol / L). PTH reference range: 0.7-5.6 pmol / L. Age and sex-adjusted ALP reference ranges: Female-65-270 U / L (1-7 days old), 65-365 U / L (7 days old-1 month old), 80-425 U / L (1-3 months old), 80-345 U / L (3-6 months old), 60-330 U / L (6-12 months old), 145-320 U / L (1-3 years old), 150-380 U / L (3-6 years old), 175-420 U / L (6-9 years old), 130-560 U / L (9-11 years old), 105-420 U / L (11-13 years old), 70-230 U / L (13-15 years old), 30-126 U / L (>15 years old). Males - 65-270 U / L (1-7 days old), 65-365 U / L (7 days old-1 month old), 80-425 U / L (1-3 months old), 80-345 U / L (3-6 months old), 60-330 U / L (6-12 months old), 145-320 U / L (1-3 years old), 150-380 U / L (3-6 years old), 175-420 U / L (6-9 years old), 135-530 U / L (9-11 years old), 200-495 U / L (11-13 years old), 130-525 U / L (13-15 years old), 30-126 U / L (>15 years old). [Figure 8]In vitro angiogenesis is disrupted by mutant GNAQ and rescued by CRAC channel inhibition. (A) Representative images captured with an EVOS Floid imaging system after Calcein AM staining during in vitro endothelial cell tube formation of TIME cells stably expressing either GNAQ WT or GNAQ R183Q. (B) Quantification of the angiogenesis assay shown in (A) (one representative experiment out of three, mean + / - SD) demonstrates a striking difference between WT and mutant cells in the total network length, defined as the combined length of segments, branches, and isolated elements. Statistical significance calculated using a two-tailed unpaired t-test on three independent experiments (****p<0.0001). (C) Quantification of the angiogenesis assay (total network length defined as the combined length of segments, branches, and isolated elements, 4 experiments) shows a significant difference between vehicle and thrombin (0.3 U / Ml) treated TIME GNAQR183Q, but not statistically significant for TIME GNAQwt. Results shown as the mean of 3 technical replicates for each of 4 independent experiments. Statistical analysis performed by two-tailed paired t-test on 4 independent experiments (ns=not statistically significant, *p=0.0125). (D) Quantification of the angiogenesis assay performed in the presence of thrombin 0.3 U / Ml (total network length defined as the combined length of segments, branches, and isolated elements, 3 experiments) shows a significant difference between vehicle and CM4620 (1 μM) treated TIME GNAQR183Q, but not statistically significant for TIME GNAQwt. Results shown as mean + / - SD of three independent experiments, and statistical analysis performed by two-tailed paired t-test (ns = not statistically significant, *p = 0.04). [Figure 9]Intravascular, perivascular, and parenchymal regional patterns of mineral (calcium) deposition and disruption of calcium homeostasis in patients with GNAQ / GNA11 mosaicism. (A) Image of cortex with widespread foci of calcification. (B) Small cortical vessel (likely capillary) with granular calcification in the wall. (C) White matter vessel surrounded by mineral and fibrosis. (D) White matter vessel with perivascular deposits and granular parenchymal mineral deposition. In each image, arrows indicate examples of mineral deposition. Scale bars: A=500 micrometers B, C, and D=50 micrometers. (E) Graphical representation of abnormal results in calcium profiling studies in a cohort of patients at two different time points, showing intra- and inter-patient variability typical of mosaic disease. (F) Correlation between occurrence of seizures and serum ionized calcium corrected for pH from a cohort of patients. Scatter plots show the mean of the two groups, red dots correspond to ionized calcium measurements below the normal range. Linear regression analysis showed a statistically significant correlation (p=0.05). (G) Correlation between status epilepticus and serum ionized calcium corrected for pH in a cohort of patients. The scatter plot shows the means of the two groups, and red dots correspond to ionized calcium measurements below the normal range. Linear regression analysis showed a statistically significant correlation (p=0.01). [Figure 10]GNAQ and CRAC inhibition in uveal melanoma cells. A. Transfection with two siRNAs silencing the GNAQR183Q mutant allele reduced the expression of the mutant allele in the UPMM1 UM cell line. UPMM1 cells were either not transfected or transfected with a non-targeting control siRNA (siSCRA) or two different GNAQR183Q mutant-specific siRNAs (siGNAQmut3 and siGNAQmut6), and the expression of the mutant allele was measured using previously validated GNAQR183Q mutant-specific primers (forward primer: CAACAAGATGTGCTTAGAGTTCA (SEQ ID NO: 25), reverse primer: CCCTACATCGACCATTCTGAAA (SEQ ID NO: 26). B. Transfection with siRNA silencing GNAQ mutant allele reduced GPCR ligand-induced calcium intracellular accumulation. Cells loaded with Fluo-8 calcium marker were stimulated with GPCR ligand leukotriene D4 (LTD4) and fluorescence was recorded over time. C. Treatment with CRAC channel inhibitor CM4620 reduced GPCR ligand-induced accumulation of intracellular calcium in UPMM1. Cells loaded with Fluo-8 calcium probe were treated with 1, 3, or 10 μM CM4620 and stimulated with GPCR ligand leukotriene D4 (LTD4) and fluorescence was recorded over time. [Figure 11] Correlation of serum levels of various compounds with intact FGF23 or C-terminal FGF23 in SWS / PPV patients [Figure 12] Correlations indicating calcium metabolism function in SWS / PPV patients DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0124] With the discovery of a common genetic cause, GNAQ / 11 mosaic with cutaneous melanosis and EDM, SWS, and PPV types are now understood to be manifestations of the same disease, a spectrum of vascular and / or pigmentary abnormalities affecting the skin, brain, and eyes, with other organs potentially involved. The vascular disease spectrum of SWS and PPV often has a severe and progressive neurological phenotype, with mean and median ages for onset of seizures identified in this study as 1.05 and 0.71 years (range 0.08–5.9 years), respectively, leading to attempts to mitigate exacerbations with prophylactic aspirin and / or antiepileptic drugs

[25] . Calcium deposition in and around the abnormal neurovasculature has long been known to be a hallmark of this disease process. Ultrastructural studies from 50 years ago suggested the composition was calcium apatite phosphate

[26] , and the pattern of crystal growth led the authors to hypothesize that the process originated from the vasculature

[27] . Since then, it is clear that although the development of calcifications has yet to be fully explained, it is likely to be a contributing factor to the underlying chronic anoxic problem of abnormal cerebral vasculature. Indeed, both the extent of intracranial calcifications and the degree of venous hypoperfusion in radiological studies have been correlated with neurological symptoms [28, 29, 30]. Moreover, the clear documentation here on serial brain imaging that calcifications develop over time provides an important potential window for preventing this process and the associated neurological deterioration. Therefore, understanding the biological mechanisms underlying this classic pathological finding is highly desirable and we considered that it may lead to new therapeutic angles.

[0125] We hypothesized that SWS / PPV may be associated with impaired calcium homeostasis due to abnormalities in intracellular calcium signaling in variant cells and local compensatory mechanisms across their cell membranes. Over time, this process may lead to chronic calcium deposition in or around variant tissues and potentially also to impaired whole-body calcium homeostasis. We report here that 43% of this cohort of patients with SWS / PPV had low serum ionized calcium after appropriate correction of pH values, using age-adjusted normal values, and correcting serum vitamin D levels as necessary. In addition, three patients had high serum total calcium values ​​and various abnormalities in PTH, phosphate, and urinary calcium excretion. These observations have not been previously reported in this disease phenotype. These findings not only contribute significantly to our understanding of the disease process, but may also be relevant for clinical management. Calcium is a known stabilizer of excitable membranes, and although serum calcium levels were not abnormal enough to be expected to cause symptoms in healthy individuals, in the context of seizure disorders they may be an important contributing factor. Moreover, in the context of mosaic diseases where only a portion of the cells in the body are affected by the mutation, a measurable systemic effect on calcium strongly suggests that local calcium imbalances, for example around the affected neurovasculature, may be much more extreme. The variability in calcium metabolic profiles would be entirely consistent with mosaic diseases where patients are unique in both the number and location of variant cells. Similar variability in systemic endocrine / metabolic profiling has been previously reported for the GPCR-coupled anterior pituitary pathway in congenital pigmented nevus syndrome (NRAS mosaic)

[31] and is well known in McCune-Albright syndrome (GNAS mosaic).

[0126] Although classically producing "tramlines" in and around blood vessels, calcium deposits have also been described within the brain parenchyma

[27] and were confirmed here. It is currently unclear whether this results from the same process that leads to vascular calcification, e.g., representing calcification of the microvasculature that would not be visible at MRI resolution, or whether it has a separate etiology. Potentially relevant is the well-documented association between intraparenchymal calcification and systemic hypocalcemia due to other causes (reviewed in

[32] ), which raises the possibility that this finding in SWS / PPV may represent a more non-specific complication of metabolic calcium imbalance.

[0127] We then set out to investigate the molecular mechanisms underlying this phenomenon by modeling the effects of GNAQ and GNA11 mutations on calcium homeostasis at the cellular level. We found that the mutations increased basal activation of intracellular calcium signaling in microvascular endothelial cells and increased and prolonged intracellular calcium accumulation after ligand stimulation. Furthermore, the latter is dependent on extracellular calcium influx. Mutation-specific siRNA rescued both aspects of calcium signaling abnormalities in cellular models, linking the genetic abnormality to a functional defect. It is strongly suggested that extracellular calcium influx is mediated through store-operated CRAC calcium channels in the plasma membrane, since treatment with the specific CRAC channel inhibitor CM4620 inhibits the variant cellular response. Finally, we confirm that these variants do not constitutively activate the MAPK pathway in endothelial cells.

[0128] Alterations in calcium influx across cell membranes may provide the beginnings of a broad mechanistic explanation for the disruption of calcium homeostasis observed in patients. Supporting this hypothesis, the most common findings of hypoionized hypocalcemia were statistically correlated with older age in our cohort, suggesting that chronic abnormalities at the cellular level may eventually lead to measurable systemic changes. However, how this occurs will require detailed multi-organ evaluation for variant cells and thorough investigation of the interplay between variant Gαq / Gα11 expression and the calcium-sensing receptor (encoded by CaSR). CaSR is known to be widely expressed in the body and has been implicated in the pathogenesis of vascular disease in other contexts. Although blood pressure was universally normal in this study, a minority of patients had renal vascular anomalies leading to hypertension [6, 7], indicating underlying disease pathology in that anatomical region. The involvement of pigment cells as well as vascular cells in PPV also opens the possibility that the original single-cell mutation may occur prior to purely vascular embryological differentiation, and therefore individuals with PPV may have more extensive internal disease.

[0129] Whatever the ultimate mechanism, calcium supplementation for therapeutic correction of serum calcium is unlikely to be appropriate and could potentially "add fuel to the fire" of variant cellular demand for extracellular calcium. Instead, blockade of CRAC channels may be more appropriate. CM4620 is already in phase II clinical trials (study NCT04195347) for the treatment of pancreatitis, another disease associated with disturbances in local calcium homeostasis and CRAC channel activity

[33] .

[0130] In conclusion, using disease-relevant in vitro models, we confirmed the hypothesis that the primary biological abnormality in GNAQ / 11 variant endothelial cells is the excessive activation of intracellular calcium signaling, which leads to abnormal extracellular calcium influx. The disruption of whole-body calcium homeostasis in a significant proportion of patients has no other demonstrable cause and increases markedly with age, suggesting that this is due to chronically abnormal calcium influx in mosaic body regions. These findings provide a molecular framework for neurovascular calcification and a potential reason for neurological progression over time in SWS and PPV with cutaneous melanosis. Finally, our results pave the way for new potential therapeutic options targeting calcium signaling and CRAC channels.

[0131] definition The following provides certain definitions of terms, technical means, and embodiments used in this specification.

[0132] As used herein, the term "mosaicism" or "genetic mosaicism" refers to a condition in a multicellular organism in which a single organism has multiple genetic lineages as a result of genetic mutations to a single cell during embryonic or fetal development. The descendants of that cell will all contain the same mutation and be present only in those cells. The recent consensus definition is the coexistence of multiple genotypes in an individual derived from a single zygote by the time of birth, producing a disease phenotype

[34] (which may not manifest until some time after birth). Genetic mosaicism can result from many different mechanisms, leading to mosaicism at different genetic levels, for example, mosaicism can be associated with single point mutations or whole chromosome aneuploidies. Mosaic mutations can be passed on to future generations as heterozygous mutations in the germline if two conditions are met - first, that it affects germ cells (which usually cannot be confirmed), and second, that the mutation is compatible with germline life (which is often the case, but not always known from epidemiological studies) [34, 35].

[0133] As used herein, the term "GNAQ" refers to the GNAQ gene, also known as CMC1, G-ALPHA-q, GAQ, SWS, and G protein subunit alpha q (which may consist of or include the exemplary RefSeq human protein sequence: NP_002063 and / or NP_002063.2, RefSeq mouse protein sequence: NP_032165, RefSeq human mRNA sequence: NP_032165, RefSeq mouse mRNA sequence: NM_008139). Guanine nucleotide binding proteins are a family of heterotrimeric proteins that couple cell surface seven transmembrane domain receptors to intracellular signaling pathways. Receptor activation catalyzes the exchange of GDP bound to the inactive G protein alpha subunit for GTP, resulting in a conformational change and dissociation of the complex. G protein alpha and beta-gamma subunits can regulate a variety of cellular effectors. Activation is terminated by a GTPase specific to the G-alpha subunit. G-alpha-q is the alpha subunit of one of the heterotrimeric GTP-binding proteins that mediates the stimulation of phospholipase C-beta.

[0134] As used herein, the term "GNA11" refers to the GNA11 gene, also known as FBH, FBH2, FHH2, GNA-11, HHC2, HYPOC2, G protein subunit alpha 11, and HG1K (which may consist of or include exemplary RefSeq human protein sequence: NP_002058, RefSeq mouse protein sequence: NP_034431, RefSeq human mRNA sequence: NP_034431, RefSeq mouse mRNA sequence: NP_034431).

[0135] The term "gain of function variant" as used herein refers to any mutation in a gene in which the protein encoded by said gene (i.e., the variant protein) has a mutation that confers a new or enhanced function to the protein, either in terms of its intrinsic function or its effect on an interacting molecule or a cascade of molecular interactions that may act through a change in the intrinsic activity of the protein itself or through a change in the interaction with other molecules. A gain of function mutation can be a deletion, addition, or substitution of one or more nucleotides in a gene that causes a change in the function of the encoded protein. In one embodiment, a gain of function mutation changes the function of the variant protein or causes its interaction with other proteins. In another embodiment, a gain of function mutation causes a reduction or elimination of a normal wild-type protein, for example, by the interaction of the modified variant protein with said normal wild-type protein. In another embodiment, a gain of function variant causes an increase or decrease in the normal function of a protein, such that some or all of its activity or its downstream effects are increased or exaggerated or accentuated constitutively and / or under a relevant physiological stimulus.

[0136] The term "variant" can encompass both disease causing genetic mutations and benign mutations that do not affect the function of the gene. It includes all types of DNA changes that produce changes in the protein, such as deletions, additions, or substitutions of one or more nucleotides in a gene that cause a change in the amino acid sequence of the encoded protein.

[0137] An "expression construct" may be, for example, a viral vector, a retroviral vector, an expression cassette, or a plasmid. An expression construct may also have an RNA polymerase II promoter sequence, such as the U6 snRNA promoter of the H1 promoter, or an RNA polymerase II promoter sequence. An expression construct of the present invention includes any construct suitable for use in an appropriate expression system, including, but not limited to, retroviral vectors, linear expression cassettes, plasmids, and viruses or virus-derived vectors known in the art. Such expression constructs may include one or more inducible promoters, RNA Pol III promoter systems (e.g., U6 snRNA promoters or HI RNA polymerase III promoters), or other promoters known in the art. A construct may include one or both strands of an siRNA. An expression construct that expresses both strands may also include a loop structure linking both strands, or each strand may be transcribed separately from a separate promoter within the same construct. Each strand may be transcribed from a separate expression construct.

[0138] As used herein, the term "approximately" or "about" when applied to one or more values ​​of interest refers to a value similar to a stated reference value. In some embodiments, the term "approximately" or "about" refers to a range of values ​​that falls within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%), 6%), 5%, 4%, 3%, 2%, 1%) or less in either direction (greater or less) of the stated reference value, unless otherwise stated or clear from the context (except where such number exceeds 100% of possible values).

[0139] As used herein, the term "amelioration" refers to the prevention, reduction, or alleviation of a condition, or an improvement in a subject's condition or an improvement in disease biomarkers of severity or outcome. Improvement includes, but is not required to include, complete amelioration or complete prevention of a disease state.

[0140] As used herein, the term "comparable" refers to a system, set of conditions, effect, or result that is sufficiently similar to a test system, set of conditions, effect, or result to allow a scientifically valid comparison. Those of skill in the art will recognize and understand which systems, sets of conditions, effects, or results are sufficiently similar to be "comparable" to any particular test system, set of conditions, effect, or result described herein.

[0141] The term "correlated" as used herein has its ordinary meaning of "exhibiting a correlation with." One skilled in the art will understand that two features, items, or values ​​exhibit a correlation with one another when they show a tendency to appear and / or change together. In some embodiments, a correlation is statistically significant when its p-value is less than 0.05, and in some embodiments, a correlation is statistically significant when its p-value is less than 0.01. In some embodiments, the correlation is assessed by regression analysis. In some embodiments, the correlation is a correlation coefficient.

[0142] As used herein, the terms "improve," "increase," or "reduce," or grammatical equivalents, refer to a value relative to a reference (baseline) measurement, such as a measurement in the same individual prior to the initiation of a treatment described herein (e.g., a measurement obtained under comparable conditions), or a measurement in a control individual (or control individuals) in the absence of a treatment described herein.

[0143] As used herein, a "polypeptide" is generally a chain of at least two amino acids linked together by peptide bonds. In some embodiments, a polypeptide may include at least 3-5 amino acids linked to other amino acids by at least one peptide bond. One of skill in the art will understand that a polypeptide may, in some cases, include "unnatural" amino acids or other entities that may nevertheless be optionally incorporated into a polypeptide chain.

[0144] As used herein, the term "protein" refers to a polypeptide (i.e., a chain of at least two amino acids linked together by peptide bonds). A protein may contain moieties other than amino acids (e.g., may be a glycoprotein, proteoglycan, etc.) and / or may be otherwise processed or modified. Those skilled in the art will understand that a "protein" may be a complete polypeptide chain produced by a cell (with or without a signal sequence) or a characteristic portion thereof. Those skilled in the art will understand that a protein may sometimes include two or more polypeptide chains, for example, linked by one or more disulfide bonds or associated by other means. Polypeptides may contain L-amino acids, D-amino acids, or both, and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, etc. In some embodiments, a protein may include natural amino acids, unnatural amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids.

[0145] As used herein, the terms "subject," "individual," or "patient" refer to any organism to which an embodiment of the invention may be used or administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals, such as mice, rats, rabbits, non-human primates, and humans, insects, parasites, etc.). In a preferred embodiment of the invention, the subject is a human.

[0146] As used herein, the term "target cell" or "target tissue" refers to any cell, cell type, tissue, or organism. In preferred embodiments, the target cell or tissue is a vascular cell, a melanocyte cell, and / or any other cell type that contains a mutation.

[0147] As used herein, the term "therapeutic regimen" refers to any method used to partially or completely alleviate, ameliorate, mitigate, inhibit, prevent, delay onset, reduce severity, and / or reduce incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. It may include administration of one or more doses, optionally spaced apart by regular or different time intervals. In some embodiments, a therapeutic regimen is one whose performance is designed to achieve and / or correlates with the achievement of a particular effect (e.g., reduction or elimination of a deleterious condition or disease) (e.g., across a population of relevant cells, tissues, or organisms). In some embodiments, treatment involves administering one or more therapeutic agents simultaneously, sequentially, or at different times, at the same or different times. In some embodiments, a "therapeutic regimen" includes genetic methods such as gene therapy, gene disruption, or other methods known to induce or reduce expression (e.g., transcription, processing, and / or translation of a particular gene product, such as a primary transcript or mRNA).

[0148] As used herein, the term "therapeutically effective amount" refers to an amount of a therapeutic agent that confers a therapeutic effect on the subject being treated at a reasonable benefit / risk ratio applicable to any medical treatment. Such therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., the subject gives an indication of or feels the effect). In some embodiments, "therapeutically effective amount" refers to an amount of a therapeutic agent or composition that is effective to treat, ameliorate, or prevent a particular disease or condition, or that is effective to exhibit a detectable therapeutic or prophylactic effect, such as by improving symptoms associated with the disease, preventing or delaying the onset of the disease, and / or reducing the severity or frequency of symptoms of the disease. Therapeutically effective amounts can usually be administered in a dosing regimen that may include multiple unit doses. For any particular therapeutic agent, the therapeutically effective amount (and / or the appropriate unit dose within an effective dosing regimen) may vary, for example, depending on the route of administration or combination with other drugs. Alternatively, or additionally, the particular therapeutically effective amount (and / or unit dose) for any particular patient may depend on a variety of factors, including the activity of the particular therapeutic agent used; the particular composition used; the age, weight, general health, sex, and diet of the patient; the time of administration, route of administration, and / or excretion or metabolic rate of the particular therapeutic agent used; the duration of treatment; and similar factors well known in the medical arts.

[0149] As used herein, the term "treatment" (also "treat" or "treating") refers to any administration of a therapeutic agent according to a treatment regimen that achieves a desired effect in terms of partially or completely alleviating, ameliorating, relieving, inhibiting, delaying the onset of, reducing the severity of, and / or reducing the occurrence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. In some embodiments, administration of a therapeutic agent according to a treatment regimen correlates with achieving a desired effect. Such treatment may be treatment of a subject who is not showing signs of the relevant disease, disorder, and / or condition and / or a subject who is showing only early signs of the disease, disorder, and / or condition. Alternatively or additionally, such treatment may be treatment of a subject who shows one or more established signs of the relevant disease, disorder, and / or condition. In some embodiments, treatment may be treatment of a subject who has been diagnosed as suffering from the relevant disease, disorder, and / or condition. In some embodiments, treatment may be treatment of a subject who is known to have one or more susceptibility factors that are statistically correlated with an increased risk of developing the relevant disease, disorder, and / or condition.

[0150] As used herein, "antisense compound" refers to an oligomeric compound that can hybridize with target nucleic acid via hydrogen bond.Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotides, siRNA, shRNA, ssRNA, and occupancy-based compounds.

[0151] As used herein, "antisense inhibition" means a reduction in the level of a target nucleic acid in the presence of an antisense compound complementary to the target nucleic acid compared to the level of the target nucleic acid in the absence of the antisense compound.

[0152] As used herein, "antisense mechanisms" are all those mechanisms that involve hybridization of a compound with a target nucleic acid, the result or effect of which is either target degradation or target occupancy, with the concomitant stalling of cellular machinery, including, for example, transcription or splicing. "Antisense oligonucleotide" refers to a single-stranded oligonucleotide having a nucleobase sequence that allows for hybridization to a corresponding region or segment of a target nucleic acid.

[0153] As used herein, "portion" refers to a defined number of consecutive (i.e. linked) nucleobases of a nucleic acid. In some embodiments, a portion is a defined number of consecutive nucleobases of a target nucleic acid. In some embodiments, a portion is a defined number of consecutive nucleobases of an antisense compound.

[0154] As used herein, "prevent" refers to delaying or arresting the onset, development, or progression of a disease, disorder, or condition for a period ranging from minutes to indefinitely. "Prevent" also means reducing the risk of developing a disease, disorder, or condition.

[0155] As used herein, "nucleoside" refers to a compound that includes a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (found in DNA and RNA) and modified nucleosides. Nucleosides can be linked to a phosphate moiety.

[0156] As used herein, "chemical modification" or "chemically modified" refers to the chemical difference of a compound when compared with its naturally occurring counterpart. Chemical modification of oligonucleotides includes nucleoside modification (including modification of sugar moiety and modification of nucleobase) and modification of internucleoside linkage. With respect to oligonucleotides, chemical modification does not include differences in nucleobase sequence only.

[0157] As used herein, "furanosyl" refers to a structure containing a five-membered ring that contains four carbon atoms and one oxygen atom.

[0158] As used herein, a "naturally occurring sugar moiety" refers to a ribofuranosyl found in naturally occurring RNA or a deoxyribofuranosyl found in naturally occurring DNA. A "naturally occurring sugar moiety" as referred to herein is also referred to as an "unmodified sugar moiety." In particular, such a "naturally occurring sugar moiety" or "unmodified sugar moiety" as referred to herein has -H (DNA sugar moiety) or -OH (RNA sugar moiety) at the 2' position of the sugar moiety, and in particular has -H (DNA sugar moiety) at the 2' position of the sugar moiety.

[0159] As used herein, "sugar moiety" means the naturally occurring sugar moiety of a nucleoside or a modified sugar moiety. As used herein, "modified sugar moiety" means a substituted sugar moiety or sugar substitute.

[0160] As used herein, "substituted sugar moiety" refers to a furanosyl that is substituted. Substituted sugar moieties include, but are not limited to, furanosyl that contain substituents at the 2', 3', 5', and / or 4' positions. A particular substituted sugar moiety is a bicyclic sugar moiety.

[0161] As used herein, "2'-substituted sugar moiety" means a furanosyl that contains a substituent at the 2' position other than H or OH. Unless otherwise specified, a 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2'-substituent of the 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring).

[0162] As used herein, "MOE" means -OCH2CH2OCH3.

[0163] As used herein, "2'-F nucleoside" refers to a nucleoside that contains a sugar that contains a fluorine at the 2' position. Unless otherwise specified, the fluorine in the 2'-F nucleoside is at the ribo position (replacing the OH of natural ribose). A duplex of uniformly modified 2'-fluorinated (ribo) oligonucleotide hybridized to an RNA strand is not an RNase H substrate, although the ara analog retains RNase H activity.

[0164] As used herein, the term "sugar surrogate" refers to structures that do not include furanosyl and can replace the naturally occurring sugar moiety of a nucleoside such that the resulting nucleoside subunits can be linked together and / or to other nucleosides to form oligomeric compounds that can hybridize to complementary oligomeric compounds. Such structures include rings that contain a different number of atoms than furanosyl (e.g., 4-, 6-, or 7-membered rings), replacement of the oxygen of furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen), or both a change in the number of atoms and a replacement of the oxygen. Such structures can also include substitutions corresponding to those described for the substituted sugar moiety (e.g., a 6-membered carbocyclic bicyclic sugar surrogate, optionally including additional substituents). Sugar surrogates also include more complex sugar substitutions (e.g., the acyclic systems of peptide nucleic acids). Sugar surrogates include, but are not limited to, morpholino, cyclohexenyl, and cyclohexitol.

[0165] As used herein, "bicyclic sugar moiety" means a modified sugar moiety that includes a 4-7 membered ring (including, but not limited to, furanosyl) that includes a bridge connecting two atoms of the 4-7 membered ring to form a second ring resulting in a bicyclic structure. In some embodiments, the 4-7 membered ring is a sugar ring. In some embodiments, the 4-7 membered ring is a furanosyl. In certain such embodiments, a bridge connects the 2'-carbon and the 4'-carbon of the furanosyl.

[0166] As used herein, "nucleotide" refers to a nucleoside that further comprises a phosphate linking group. As used herein, "linked nucleosides" may or may not be linked by a phosphate bond, and thus includes, but is not limited to, "linked nucleotides." As used herein, "linked nucleosides" are nucleosides that are connected in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0167] As used herein, "nucleobase" refers to a group of atoms that can be linked to a sugar moiety to produce a nucleoside that can be incorporated into an oligonucleotide, and which can bind to a complementary naturally-occurring nucleobase of another oligonucleotide or nucleic acid. The nucleobase can be naturally occurring or modified.

[0168] As used herein, the term "unmodified nucleobase" or "naturally occurring nucleobase" means the naturally occurring heterocyclic nucleobases of RNA or DNA, i.e., the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).

[0169] As used herein, "modified nucleobase" refers to any nucleobase that is not a naturally occurring nucleobase. As used herein, "modified nucleoside" refers to a nucleoside that contains at least one chemical modification compared to a naturally occurring RNA or DNA nucleoside. A modified nucleoside may contain a modified sugar moiety and / or a modified nucleobase.

[0170] As used herein, "bicyclic nucleoside" or "BNA" refers to a nucleoside that includes a bicyclic sugar moiety. As used herein, "locked nucleic acid nucleoside" or "LNA" refers to a nucleoside that includes a bicyclic sugar moiety that includes a 4'-CH2-0-2' bridge. As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a substituent at the 2' position of the sugar moiety other than H or OH. Unless otherwise specified, a 2'-substituted nucleoside is not a bicyclic nucleoside.

[0171] As used herein, "deoxynucleoside" refers to a nucleoside that includes a 2'-H furanosyl sugar moiety found in naturally occurring deoxyribonucleosides (DNA). In some embodiments, the 2'-deoxynucleoside can include a modified nucleobase or can include an RNA nucleobase (uracil).

[0172] As used herein, "oligonucleotide" refers to a compound that includes multiple linked nucleosides. In some embodiments, an oligonucleotide includes one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleosides.

[0173] As used herein, "modified oligonucleotide" means an oligonucleotide containing at least one modified nucleoside and / or at least one modified internucleoside linkage.

[0174] As used herein, "link" or "linking group" means a group of atoms that links two or more other groups together.

[0175] As used herein, "internucleoside linkage" means a covalent bond between adjacent nucleosides in an oligonucleotide.

[0176] As used herein, a "naturally occurring internucleoside linkage" refers to a 3' to 5' phosphodiester linkage. As used herein, a "modified internucleoside linkage" refers to any internucleoside linkage other than a naturally occurring internucleoside linkage. In particular, a "modified internucleoside linkage" referred to herein can include a modified phosphite linking group, such as a phosphorothioate or phosphorodithioate internucleoside linkage.

[0177] As used herein, "terminal internucleoside linkage" means the linkage between the last two nucleosides of an oligonucleotide or a defined region thereof.

[0178] As used herein, "phosphorus linking group" refers to a linking group that includes a phosphorus atom and can include naturally occurring phosphorus linking groups that are present in naturally occurring RNA or DNA (e.g., phosphodiester linking groups) or modified phosphorus linking groups that are not generally present in naturally occurring RNA or DNA (e.g., phosphorothioate or phosphorodithioate linking groups).Thus, phosphorus linking groups include, but are not limited to, phosphodiesters, phosphorothioates, phosphorodithioates, phosphonates, phosphoramidates, phosphorothioamidates, thionoalkylphosphonates, phosphotriesters, thionoalkylphosphotriesters, and boranophosphates.

[0179] As used herein, "phosphorus internucleoside linking group" means a phosphorus linking group that directly links two nucleosides.

[0180] As used herein, "oligomeric compound" refers to a polymeric structure that includes two or more substructures. In some embodiments, the oligomeric compound includes an oligonucleotide, such as a modified oligonucleotide. In some embodiments, the oligomeric compound further includes one or more conjugate groups and / or terminal groups and / or ligands. In some embodiments, the oligomeric compound consists of an oligonucleotide. In some embodiments, the oligomeric compound includes a backbone of one or more linked monomeric sugar moieties, each linked monomeric sugar moiety being directly or indirectly bound to a heterocyclic base moiety. In some embodiments, the oligomeric compound may include a monomeric sugar moiety that is not linked to a heterocyclic base moiety, thereby providing an abasic site.

[0181] As used herein, "terminal group" refers to one or more atoms attached to either the 3' or 5' end, or both, of an oligonucleotide. In some embodiments, a terminal group comprises one or more terminal nucleosides.

[0182] As used herein, "conjugate" or "conjugate group" refers to an atom or group of atoms attached to an oligonucleotide or oligomeric compound. In some embodiments, the conjugate group links a ligand to a modified oligonucleotide or oligomeric compound. In general, conjugate groups can modify one or more properties of the compound to which they are attached, including, but not limited to, pharmacodynamic properties, pharmacokinetic properties, binding properties, absorption properties, intracellular distribution properties, cellular uptake properties, charge properties, and / or clearance properties.

[0183] As used herein, "conjugate linker" or "linker" in the context of a conjugate group refers to a portion of a conjugate group that includes any atom or group of atoms that covalently attaches an oligonucleotide to another portion of the conjugate group. In some embodiments, the point of attachment on an oligomeric compound is the 3'-oxygen atom of the 3'-hydroxyl group of the 3'-terminal nucleoside of an oligonucleotide. In some embodiments, the point of attachment on an oligomeric compound is the 5'-oxygen atom of the 5'-hydroxyl group of the 5'-terminal nucleoside of an oligonucleotide. In some embodiments, the bond for forming the bond to the oligomeric compound is a cleavable bond. In certain such embodiments, such a cleavable bond constitutes all or part of the cleavable moiety.

[0184] In some embodiments, the conjugate group comprises a cleavable moiety (e.g., a cleavable bond or a cleavable nucleoside) and a ligand moiety, such as a carbohydrate cluster moiety (e.g., a N-acetyl-galactosamine (also referred to as "GalNAc") cluster moiety), which may comprise one or more ligands. In some embodiments, the carbohydrate cluster moiety is specified by the number and identity of the ligand. For example, in some embodiments, the carbohydrate cluster moiety comprises two GalNAc groups. For example, in some embodiments, the carbohydrate cluster moiety comprises three GalNAc groups, which is particularly preferred. In some embodiments, the carbohydrate cluster moiety comprises four GalNAc groups. Such a ligand moiety is attached to the oligomeric compound via the cleavable moiety (e.g., a cleavable bond or a cleavable nucleoside). The ligands may be arranged in a linear or branched configuration, such as a biantennary or triantennary configuration.

[0185] As used herein, "cleavable moiety" refers to a bond or group that can be cleaved under physiological conditions. In some embodiments, the cleavable moiety is cleaved inside a cell or a subcellular compartment, such as an endosome or lysosome. In some embodiments, the cleavable moiety is cleaved by an endogenous enzyme, such as a nuclease. In some embodiments, the cleavable moiety comprises an atomic group having one, two, three, four, or five or more cleavable bonds. In some embodiments, the cleavable moiety is a phosphodiester bond.

[0186] As used herein, "cleavable bond" means any chemical bond that can be broken. As used herein, "carbohydrate cluster" means a compound having one or more carbohydrate residues attached to a linker group.

[0187] As used herein, "modified carbohydrate" refers to any carbohydrate that has one or more chemical modifications relative to a naturally occurring carbohydrate. As used herein, "carbohydrate derivative" refers to any compound that can be synthesized using a carbohydrate as a starting material or intermediate.

[0188] As used herein, "carbohydrate" refers to naturally occurring carbohydrates, modified carbohydrates, or carbohydrate derivatives. Carbohydrates are biomolecules that contain carbon (C), hydrogen (H), and oxygen (O) atoms. Carbohydrates can be monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, or polysaccharides, such as one or more galactose moieties, one or more lactose moieties, one or more N-acetyl-galactosamine moieties, and / or one or more mannose moieties. A particularly preferred carbohydrate is the N-acetyl-galactosamine moiety.

[0189] As used herein, "strand" refers to an oligomeric compound comprising linked nucleosides. As used herein, "single strand" or "single-stranded" refers to an oligomeric compound comprising linked nucleosides that are connected in a contiguous sequence without breaks between them. Such a single strand may contain a region of sufficient self-complementarity so as to be capable of forming a stable self-duplex in a hairpin structure.

[0190] As used herein, "hairpin" refers to a single-stranded oligomeric compound that contains a duplex formed by base pairing between sequences in self-complementary, directional opposite strands. As used herein, "hairpin loop" refers to the unpaired loop of linked nucleosides in a hairpin that is generated as a result of hybridization of self-complementary sequences. The resulting structure appears as a loop or U-shape.

[0191] As used herein, "direction" refers to the end-to-end chemical orientation of an oligonucleotide based on the chemical convention of numbering the carbon atoms in the sugar moiety, meaning that there will be a 5' end defined by the 5' carbon of the sugar moiety, and a 3' end defined by the 3' carbon of the sugar moiety. In a duplex or double-stranded oligonucleotide, each strand runs in an opposite 5' to 3' direction to allow base pairing between them.

[0192] As used herein, a "duplex" refers to two or more complementary regions or strands of one or more oligonucleotides hybridized together by non-covalent sequence-specific interactions between them. Most commonly, the hybridization in a duplex will be between the nucleobases adenine (A) and thymine (T), and / or (A) adenine and uracil (U), and / or guanine (G) and cytosine (C). A duplex may be part of a single-stranded structure, self-complementarity may result in hybridization, or may be the result of hybridization between the respective strands in a double-stranded construct.

[0193] As used herein, "double strand" or "double stranded" refers to a pair of oligomeric compounds hybridized to one another. In some embodiments, a double-stranded oligomeric compound comprises a first oligomeric compound and a second oligomeric compound.

[0194] As used herein, "expression" refers to the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, addition of a 5'-cap), and translation.

[0195] As used herein, "transcription" or "transcribed" refers to the first of several steps in DNA-based gene expression in which a target sequence of DNA is copied into RNA (specifically, mRNA) by the enzyme RNA polymerase. During transcription, a DNA sequence is read by RNA polymerase, which produces a complementary, antiparallel RNA sequence called the primary transcript.

[0196] As used herein, "target sequence" refers to a nucleoside sequence to which an oligomeric compound is intended to hybridize to effect a desired activity with respect to a disease or gene function of interest. The oligonucleotide has sufficient complementarity to its target sequence to permit hybridization under physiological conditions.

[0197] As used herein, "nucleobase complementarity" or "complementarity" refers to a nucleobase that can base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In both DNA and RNA, guanine (G) is complementary to cytosine (C). In some embodiments, a complementary nucleobase refers to a nucleobase of an oligomeric compound that can base pair with a nucleobase of its target sequence. For example, if a nucleobase at a specific position of an oligomeric compound can hydrogen bond with a nucleobase at a specific position of a target sequence, the position of the hydrogen bond between the oligomeric compound and the target sequence is considered to be complementary in that nucleobase pair. Nucleobases that contain certain modifications can maintain the ability to pair with the corresponding nucleobase, and thus nucleobase complementarity is still possible.

[0198] As used herein, "non-complementary" refers to a pair of nucleobases that do not form hydrogen bonds with one another. As used herein, "complementary" with respect to an oligomeric compound (e.g., linked nucleosides, oligonucleotides) refers to the ability of such an oligomeric compound, or a region thereof, to hybridize to a target sequence or a region of the oligomeric compound itself through nucleobase complementarity.

[0199] Complementary oligomeric compounds need not have complementary nucleobases at every nucleoside. Rather, some mismatches are tolerated. In some embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In some embodiments, complementary oligomeric compounds or regions are at least 80% complementary. In some embodiments, complementary oligomeric compounds or regions are at least 90% complementary. In some embodiments, complementary oligomeric compounds or regions are at least 95% complementary. In some embodiments, complementary oligomeric compounds or regions are at least 100% complementary.

[0200] As used herein, "self-complementary" with respect to an oligomeric compound means a compound that can fold back on itself to produce a duplex as a result of nucleobase hybridization of internal complementary strand regions. Depending on how close together the strand regions are and / or the length, the compound may form hairpin loops, junctions, bulges, or internal loops.

[0201] As used herein, "mismatch" means a nucleobase of an oligomeric compound that is unable to pair with a nucleobase at a corresponding position of a target sequence or in the oligomeric compound itself when the oligomeric compound and a target sequence and / or the self-complementary region of the oligomeric compound are aligned when the oligomeric compound hybridizes as a result of self-complementarity.

[0202] As used herein, "hybridization" refers to the pairing of complementary oligomeric compounds (e.g., an oligomeric compound and its target sequence). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.

[0203] As used herein, "specifically hybridize" refers to the ability of an oligomeric compound to hybridize to a nucleic acid site with greater affinity than it hybridizes to another nucleic acid site.

[0204] As used herein, "fully complementary" with respect to an oligomeric compound or region thereof means that each nucleobase of an oligomeric compound or region thereof is capable of pairing with a nucleobase of a complementary nucleic acid target sequence or self-complementary region of an oligomeric compound. Thus, a fully complementary oligomeric compound or region thereof does not contain any mismatched or non-hybridizing nucleobases with respect to its target sequence or self-complementary region of an oligomeric compound.

[0205] As used herein, "percent complementarity" refers to the percentage of nucleobases of an oligomeric compound that are complementary to an equal length portion of a target nucleic acid. Percent complementarity is calculated by dividing the number of nucleobases of an oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.

[0206] As used herein, "percent identity" means the number of nucleobases in a first nucleic acid that are the same type (irrespective of chemical modification) as the nucleobase at the corresponding position in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.

[0207] As used herein, "modulation" refers to a change in the amount or quality of a molecule, function, or activity compared to the amount or quality of the molecule, function, or activity prior to modulation. For example, modulation includes changes in either an increase (stimulation or induction) or decrease (inhibition or reduction) of gene expression.

[0208] As used herein, "type of modification" with respect to a nucleoside or a "type" of nucleoside means the chemical modification of the nucleoside and includes modified and unmodified nucleosides. Thus, unless otherwise specified, a "nucleoside having a first type of modification" can be an unmodified nucleoside.

[0209] As used herein, "differentially modified" refers to chemical modifications or chemical substituents that are different from each other, including the absence of modification. Thus, for example, MOE nucleosides and unmodified naturally occurring RNA nucleosides are "differentially modified", even if the naturally occurring nucleosides are unmodified. Similarly, DNA and RNA oligonucleotides are "differentially modified", even if both are naturally occurring unmodified nucleosides. Nucleosides that are the same but contain different nucleobases are not differentially modified. For example, nucleosides that contain 2'-OMe modified sugar moieties and unmodified adenine nucleobases, and nucleosides that contain 2'-OMe modified sugar moieties and unmodified thymine nucleobases are not differentially modified.

[0210] As used herein, "same type of modification" refers to modifications that are the same as each other, including the absence of modification.Thus, for example, two unmodified RNA nucleosides have "same type of modification", even if the RNA nucleosides are unmodified.Such nucleosides that have the same type of modification can contain different nucleobases.

[0211] As used herein, a "region" or "regions" or a "portion" or "portions" refers to a plurality of linked nucleosides having a function or characteristic as defined herein, particularly with reference to the claims and definitions provided herein. Typically, such a region or portion comprises at least 10, at least 11, at least 12, or at least 13 linked nucleosides. For example, such a region may comprise 13-20 linked nucleosides, e.g., 13-16 or 18-20 linked nucleosides. Typically, a first region as defined herein consists essentially of 18-20 nucleosides and a second region as defined herein consists essentially of 13-16 linked nucleosides.

[0212] As used herein, "a pharma- ceutically acceptable carrier or diluent" means any substance suitable for use in administration to an animal. In some embodiments, the pharma- ceutically acceptable carrier or diluent is a sterile saline solution. In some embodiments, such a sterile saline solution is a pharmaceutical grade saline solution.

[0213] As used herein, "substituent" and "substituent group" refer to an atom or group that replaces an atom or group of a named parent compound. For example, a substituent of a modified nucleoside is any atom or group that is different from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'-substituent is any atom or group at the 2' position of a nucleoside other than H or OH). The substituent may be protected or unprotected. In some embodiments, the compounds of the present disclosure have a substituent at one or more positions of the parent compound. The substituent may also be further substituted with other substituents and may be attached to the parent compound directly or through a linking group such as an oxygen, alkyl, or hydrocarbyl group.

[0214] Such substituents may also be present as modifications of the sugar moiety, particularly as a substituent present at the 2' position of the sugar moiety. Unless otherwise specified, groups suitable for use as substituents include, but are not limited to, one or more of halo, hydroxyl, alkyl, alkenyl, alkynyl, acyl, carboxyl, alkoxy, alkoxyalkylene, and amino substituents. Certain substituents described herein may represent modifications directly attached to the ring of the sugar moiety (such as halo, fluoro, etc., attached directly to the sugar ring) or indirectly attached to the ring of the sugar moiety by an oxygen linking atom that is itself directly linked to the sugar moiety (e.g., an alkoxyalkylene (e.g., methoxymethylene) attached to an oxygen atom, providing a MOE substituent as described herein attached to the 2' position of the sugar moiety as a whole).

[0215] As used herein, "alkyl" as used herein means a saturated straight or branched chain monovalent C1-6 hydrocarbon radical, with methyl being the most preferred alkyl as the 2'-position substituent of the sugar moiety. The alkyl group is typically attached to the 2'-position oxygen linking atom of the sugar, thus providing, overall, an -Oalkyl substituent, such as an -OCH3 substituent, on the sugar moiety of the oligomeric compounds according to the invention. This will be well understood by those skilled in the art.

[0216] As used herein, "alkylene" refers to a saturated linear or branched divalent hydrocarbon radical of the general formula -CH-, where n is 1 to 6. Methylene or ethylene are preferred alkylenes.

[0217] As used herein, "alkenyl" refers to a straight or branched unsaturated monovalent C2-6 hydrocarbon radical, with ethenyl or propenyl being the most preferred alkenyl as a substituent at the 2' position of the sugar moiety. As is well understood in the art, the degree of unsaturation present in the alkenyl radical is the presence of at least one carbon-carbon double bond. The alkenyl group is typically attached to the oxygen-linked atom at the 2' position of the sugar, thus providing, overall, an -O alkenyl substituent, such as -OCH2CH=CH2 substituent on the sugar moiety of the oligomeric compound according to the present invention. This will be well understood by those skilled in the art.

[0218] As used herein, "alkynyl" refers to a straight or branched unsaturated C2-6 hydrocarbon radical, with ethynyl being the most preferred alkynyl as a substituent at the 2' position of the sugar moiety. As is well understood in the art, the degree of unsaturation present in the alkynyl radical is the presence of at least one carbon-carbon triple bond. The alkynyl group is typically attached to the 2' oxygen-linked atom of the sugar, thus providing, overall, an -O alkynyl substituent on the sugar moiety of the oligomeric compound according to the present invention. This will be well understood by those skilled in the art.

[0219] As used herein, "carboxyl" is a radical having the general formula -CO2H.

[0220] As used herein, "acyl" means a radical formed by removal of a hydroxyl group from a carboxyl radical, as defined herein, and having the general formula -C(O)-X, where X is typically C1-6 alkyl.

[0221] As used herein, "alkoxy" refers to a radical formed between an alkyl group, such as a C1-6 alkyl group, and an oxygen atom, which is used to attach the alkoxy group to a parent molecule (e.g., at the 2' position of a sugar moiety) or to another group, such as an alkylene group, as defined herein. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, and tert-butoxy. Alkoxy groups as used herein may optionally include further substituents.

[0222] As used herein, alkoxyalkylene refers to an alkoxy group, as defined herein, attached to an alkylene group, as defined herein, where the oxygen atom of the alkoxy group is attached to the alkylene group, and the alkylene is attached to the parent molecule. The alkylene group is typically attached to the oxygen linking atom at the 2' position of the sugar, thus providing, overall, an -O alkylene alkoxy substituent, such as -OCH2CH2OCH3 substituent on the sugar portion of the oligomeric compound according to the present invention. This is well understood by those skilled in the art and is generally referred to as an MOE substituent, as defined herein and known in the art.

[0223] As used herein, "amino" includes primary, secondary, and tertiary amino groups. As used herein, "halo" and "halogen" mean an atom selected from fluorine, chlorine, bromine, and iodine.

[0224] It will also be understood that the nucleic acid molecules or compounds described herein may have one or more non-hybridizing nucleosides (overhangs) at one or both ends of one or both strands and / or one or more internal non-hybridizing nucleosides (mismatches) if there is sufficient complementarity to maintain hybridization under physiologically relevant conditions. Alternatively, the oligomeric compounds described herein may be blunt ended on at least one end.

[0225] As used herein, the term "comprising" means including the specified method steps or elements, but such steps or elements are not inclusive of an exclusive list, and thus means that additional steps or elements may be present.

[0226] Furthermore, to the extent the term "includes" is used in either the detailed description or the claims, such term is intended to be inclusive in the same manner as the term "comprising" is interpreted when the term "comprising" is used as a transitional term in a claim.

[0227] Pharmaceutical Compositions of Drugs As used herein, a "pharmaceutical composition" refers to a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition can include one or more active agents and a sterile aqueous solution.

[0228] As used herein, "pharmaceutically acceptable salts" means physiologically and pharma- ceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereon.

[0229] Other aspects of the invention also relate to a medicinal product or diagnostic aid comprising a composition according to the invention or a nucleic acid according to the invention and, where applicable, suitable excipients and additives (e.g. saline, stabilizers or protease inhibitors).

[0230] Antisense Mechanism In some embodiments, antisense compounds have chemically modified subunits arranged in patterns or motifs to confer on the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

[0231] Chimeric antisense compounds typically contain at least one region modified to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of the chimeric antisense compound may impart another desirable property, for example, serving as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

[0232] Antisense activity can result from any mechanism involving hybridization of an antisense compound (e.g., an oligonucleotide) to a target nucleic acid, which ultimately results in a biological effect. In some embodiments, the amount and / or activity of the target nucleic acid is modulated. In some embodiments, the amount and / or activity of the target nucleic acid is decreased. In some embodiments, hybridization of an antisense compound to a target nucleic acid ultimately results in target nucleic acid degradation. In some embodiments, hybridization of an antisense compound to a target nucleic acid does not result in target nucleic acid degradation. In certain such embodiments, the presence (occupancy) of an antisense compound hybridized to a target nucleic acid results in modulation of antisense activity. In some embodiments, antisense compounds with specific chemical motifs or patterns of chemical modifications are particularly suitable for utilizing one or more mechanisms. In some embodiments, antisense compounds function through more than one mechanism and / or through a mechanism that has not yet been elucidated. Thus, the antisense compounds described herein are not limited by a specific mechanism.

[0233] Antisense mechanisms include, but are not limited to, RNaseH-mediated antisense, RNAi mechanisms (utilizing the RISC pathway, including, but not limited to, siRNA, ssRNA, and microRNA mechanisms), and occupancy-based mechanisms. A particular antisense compound may act through two or more such mechanisms and / or additional mechanisms.

[0234] RNaseH-mediated antisense. In some embodiments, antisense activity results, at least in part, from degradation of target RNA by RNaseH. RNaseH is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds that are "DNA-like" can induce RNaseH activity in mammalian cells. Thus, antisense compounds that include at least a portion of DNA or DNA-like nucleosides can activate RNaseH, resulting in cleavage of the target nucleic acid. In some embodiments, antisense compounds that utilize RNaseH include one or more modified nucleosides. In some embodiments, such antisense compounds include at least one block of 1-8 modified nucleosides. In certain such embodiments, the modified nucleosides do not support RNaseH activity. In some embodiments, such antisense compounds are gapmers as described herein.

[0235] RNAi compounds. In some embodiments, the antisense compounds are interfering RNA compounds (RNAi), including double-stranded RNA compounds (also referred to as short interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds act at least in part through the RISC pathway to degrade and / or sequester target nucleic acids (and thus include microRNA / microRNA mimic compounds). In some embodiments, the antisense compounds contain modifications that make them particularly suitable for such mechanisms.

[0236] Conjugates In some embodiments, the disclosure provides a conjugated antisense compound. In some embodiments, the disclosure provides a conjugated antisense compound comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In some embodiments, the disclosure provides a method comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In some embodiments, the disclosure provides a method comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide and reducing the amount or activity of the nucleic acid transcript in the cell.

[0237] Asialoglycoprotein receptor (ASGP-R) has been described previously. See, for example, Park et al., PNAS vol.102, No.47, pp17125-17129 (2005). Such receptors are expressed on liver cells, particularly hepatocytes. Furthermore, it has been shown that compounds containing a cluster of three N-acetylgalactosamine (GalNAc) ligands can bind to ASGP-R, resulting in the uptake of the compounds into cells. See, for example, Khorev et al., Bioorganic and Medicinal Chemistry, 16, 9, pp5216-5231 (May 2008).

[0238] Thus, such conjugates containing GalNAc clusters have been used to promote the uptake of certain compounds into liver cells, especially hepatocytes. For example, it has been shown that certain GalNAc-containing conjugates increase the activity of double-stranded siRNA compounds in liver cells in vivo. In such cases, GalNAc-containing conjugates typically bind to the sense strand of the siRNA duplex. The sense strand is discarded before the antisense strand finally hybridizes with the target nucleic acid, so there is little concern that the conjugate will interfere with activity. Disclosed herein are conjugated single-stranded antisense compounds that have improved efficacy in liver cells in vivo compared to the same antisense compound lacking the conjugate.

[0239] In some embodiments, the conjugate group herein comprises a cleavable moiety. As mentioned above, without wishing to be bound by the mechanism, it is logical that the conjugate needs to remain on the compound long enough to provide enhanced uptake, but then some portion of the conjugate, or ideally all of it, is cleaved to release the parent compound (e.g., antisense compound) in its most active form. In some embodiments, the cleavable moiety is a cleavable nucleoside. Such embodiments take advantage of endogenous nucleases in cells by linking the remainder of the conjugate (cluster) to the antisense oligonucleotide via a nucleoside through one or more cleavable bonds, such as that of a phosphodiester bond. In some embodiments, the cluster is linked to the cleavable nucleoside via a phosphodiester bond. In some embodiments, the cleavable nucleoside is linked to the antisense oligonucleotide (antisense compound) by a phosphodiester bond. In some embodiments, the conjugate group may comprise two or three cleavable nucleosides. In such embodiments, such cleavable nucleosides are linked to each other in antisense compounds and / or clusters via cleavable bonds (e.g., phosphodiester bonds). Certain conjugates herein do not contain cleavable nucleosides, but instead contain cleavable bonds. It has been shown that sufficient cleavage of the conjugate from the oligonucleotide is provided by at least one bond (cleavable bond) that is vulnerable to cleavage in cells.

[0240] In some embodiments, the conjugated antisense compound is a prodrug. Such a prodrug is administered to an animal and is eventually metabolized to a more active form. For example, the conjugated antisense compound is cleaved to remove all or a portion of the conjugate, resulting in an active (or more active) form of the antisense compound lacking all or a portion of the conjugate.

[0241] In some embodiments, the conjugate is attached to the 5' end of the oligonucleotide. Certain such 5' conjugates are cleaved more efficiently than counterparts with a similar conjugate group attached to the 3' end. In some embodiments, improved activity may correlate with improved cleavage. In some embodiments, oligonucleotides containing a conjugate at the 5' end have higher efficacy than oligonucleotides containing a conjugate at the 3' end. In some embodiments, oligonucleotides containing a conjugate at the 3' end have higher efficacy than oligonucleotides containing a conjugate at the 5' end. The 5' attachment makes the oligonucleotide easier to synthesize.

[0242] Typically, oligonucleotides are synthesized on a solid support in the 3' to 5' direction. To make a 3' conjugated oligonucleotide, typically a pre-conjugated 3' nucleoside is attached to a solid support, and then the oligonucleotide is constructed as usual. However, attaching the conjugated nucleoside to a solid support complicates the synthesis. Furthermore, using that approach, the conjugate is then present throughout the synthesis of the oligonucleotide and may be degraded during subsequent steps, or may limit the types of reactions and reagents that can be used. Using the structures and techniques described herein for 5' conjugated oligonucleotides, the oligonucleotide can be synthesized using standard automated techniques, and the conjugate can be introduced with the last (most 5') nucleoside or after the oligonucleotide is cleaved from the solid support.

[0243] In view of the technical field and this disclosure, a person skilled in the art can easily make any of the conjugates and conjugate oligonucleotides herein.Furthermore, the synthesis of certain such conjugates and conjugate oligonucleotides disclosed herein is easier and / or requires fewer steps, and therefore is less expensive than the synthesis of previously disclosed conjugates, providing advantages in manufacturing.For example, the synthesis of certain conjugate groups comprises fewer synthesis steps compared to the aforementioned conjugate groups, resulting in increased yields.

[0244] Conjugate Linker In some embodiments, the conjugate group comprises a linker. In certain such embodiments, the linker is covalently attached to a cleavable moiety. In certain such embodiments, the linker is covalently attached to the antisense oligonucleotide. In some embodiments, the linker is covalently attached to a cell targeting moiety. In some embodiments, the linker further comprises a covalent bond to a solid support. In some embodiments, the linker further comprises a covalent bond to a protein binding moiety. In some embodiments, the linker further comprises a covalent bond to a solid support and further comprises a covalent bond to a protein binding moiety. In some embodiments, the linker comprises multiple positions for attachment of a linked ligand. In some embodiments, the linker comprises multiple positions for attachment of a tethered ligand and is not attached to a branching group. In some embodiments, the linker further comprises one or more cleavable bonds. In some embodiments, the conjugate group does not comprise a linker.

[0245] In some embodiments, the linker comprises at least a linear group and comprises a group selected from an alkyl, amide, disulfide, polyethylene glycol, ether, thioether (-S-), and hydroxylamino (-ON(H)-) group. In some embodiments, the linear group comprises a group selected from an alkyl, amide, and ether group. In some embodiments, the linear group comprises a group selected from an alkyl and ether group. In some embodiments, the linear group comprises at least one phosphorus linking group. In some embodiments, the linear group comprises at least one phosphodiester group. In some embodiments, the linear group comprises at least one neutral linking group. In some embodiments, the linear group is covalently attached to the cell targeting moiety and the cleavable moiety. In some embodiments, the linear group is covalently attached to the cell targeting moiety and the antisense oligonucleotide. In some embodiments, the linear group is covalently attached to the cell targeting moiety, the cleavable moiety, and the solid support. In some embodiments, the linear group is covalently attached to the cell targeting moiety, the cleavable moiety, the solid support, and the protein binding moiety. In some embodiments, the linear group includes one or more cleavable bonds.

[0246] In some embodiments, the linker comprises a linear group covalently bonded to the scaffold group. In some embodiments, the scaffold comprises a branched aliphatic group and comprises a group selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino groups. In some embodiments, the scaffold comprises a branched aliphatic group and comprises a group selected from alkyl, amide, and ether groups. In some embodiments, the scaffold comprises at least one monocyclic or polycyclic ring system. In some embodiments, the scaffold comprises at least two monocyclic or polycyclic ring systems. In some embodiments, the linear group is covalently bonded to the scaffold group, and the scaffold group is covalently bonded to the cleavable moiety and the linker. In some embodiments, the linear group is covalently bonded to the scaffold group, and the scaffold group is covalently bonded to the cleavable moiety, the linker, and the solid support. In some embodiments, the linear group is covalently bonded to the scaffold group, and the scaffold group is covalently bonded to the cleavable moiety, the linker, and the solid support. In some embodiments, the linear group is covalently attached to a scaffold group, which is covalently attached to the cleavable moiety, the linker, the protein binding moiety, and the solid support. In some embodiments, the scaffold group comprises one or more cleavable bonds.

[0247] In some embodiments, the linker comprises a protein binding moiety. In some embodiments, the protein binding moiety is a lipid, such as cholesterol, cholic acid, adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-0(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, 03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenoic acid, dimethoxytrimethylol, 1,3-bis-0(hexadecyl)glycer ... In some embodiments, the protein-binding moiety may be a C, C-glycerol, or phenoxazine, a vitamin (e.g., folate, vitamin A, vitamin E, biotin, pyridoxal), a peptide, a carbohydrate (e.g., monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide), an endosomolytic component, a steroid (e.g., uvaol, hesigenin, diosgenin), a terpene (e.g., a triterpene, e.g., sarsasapogenin, friedelin, epifriedelanol-derivatized lithocholic acid), or a cationic lipid. 16 ~C 22 long chain saturated or unsaturated fatty acids, cholesterol, cholic acid, vitamin E, adamantane, or 1-pentafluoropropyl.

[0248] Combination therapy In some embodiments, the invention features a composition (e.g., one or more compositions, formulations, or dosage formulations) or pharmaceutical combination comprising a double-stranded ribonucleic acid molecule or a compound or composition comprising a double-stranded ribonucleic acid molecule, a conjugate according to the invention, and a second therapeutic agent. In some embodiments, the invention features a composition (e.g., one or more compositions, formulations, or dosage formulations) or pharmaceutical combination comprising a therapeutic agent according to the invention and a second therapeutic agent.

[0249] In some embodiments, the composition comprises a pharma- ceutically acceptable carrier or diluent. In some embodiments, the double-stranded ribonucleic acid molecule or the compound comprising the double-stranded ribonucleic acid molecule, and the conjugate, and the second agent can be present in a single composition or as two or more different compositions. The double-stranded ribonucleic acid molecule or the compound comprising the double-stranded ribonucleic acid molecule, and the conjugate, and the second agent can be administered via the same or different administration routes. The double-stranded ribonucleic acid molecule or the compound comprising the double-stranded ribonucleic acid molecule, and the conjugate, and the second agent can be administered simultaneously or sequentially. In some embodiments, the pharmaceutical combination comprises the double-stranded ribonucleic acid molecule or the compound comprising the double-stranded ribonucleic acid molecule, and the conjugate, and the second agent, separately or together.

[0250] Route of administration The agent or pharmaceutical composition may be administered by different routes, including orally, parenterally, sublingually, intradermally, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, intrapleurally, intravenously, intraarterially, intraperitoneally, subcutaneously, intramuscularly, intranasally, intrathecally, and / or intraarticularly, or combinations thereof. In some embodiments, the agent or pharmaceutical composition is administered orally. In some embodiments, the agent or pharmaceutical composition is administered intravenously. In some embodiments, the agent or pharmaceutical composition is administered via microneedle injection. In some embodiments, the agent or pharmaceutical composition is administered via microneedle injection into the dermis. In some embodiments, the agent or pharmaceutical composition may be formulated in lipid nanoparticles and administered via microneedle injection.

[0251] The present invention is further illustrated in the following examples. It should be understood that these examples, while showing embodiments of the present invention, are provided only as illustrations. From the above discussion and these examples, those skilled in the art can ascertain the essential features of the present invention, and can make various changes and modifications to the present invention to adapt to various uses and conditions without departing from the spirit and scope thereof. Thus, in addition to those shown and described herein, various modifications of the present invention will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. EXAMPLES

[0252] Materials and Methods Patient cohort Thirty-six patients with a clinical diagnosis of SWS or PPV were prospectively recruited from a single institution with written informed consent from their parents or guardians and approval from the local research ethics committee. Clinical and radiological phenotyping of cutaneous, neurological, and ocular manifestations, as well as blood and urinary calcium metabolic profile analyses were performed.

[0253] Skin features recorded were the presence or absence of capillary malformations (port-wine stains with or without ischemic nevus), cutaneous melanosis, and involvement of the forehead region by vascular and / or pigmented lesions. The percentage of the body covered by capillary malformations was estimated using the Lund-Browder chart. Other features recorded were head circumference, overgrowth or undergrowth of other body regions, skeletal and endocrinological abnormalities, blood pressure, neurological and ophthalmological phenotype. A retrospective review of all brain computed tomography (CT, n = 6) and magnetic resonance imaging (MRI, n = 32) studies, including gradient echo imaging (i.e., T2*, susceptibility weighted imaging or (if the former was unavailable) b0 maps of diffusion weighted sequences), was performed by one radiologist.

[0254] Blood indices measured were ionized calcium, total calcium, phosphate, magnesium, parathyroid hormone (PTH), active vitamin D, and urea and electrolytes. The urinary index measured was the calcium:creatinine ratio.

[0255] Genotyping of affected tissue from 4 mm skin punch biopsies was offered to the entire cohort. DNA was extracted from whole skin using standard methods and targeted panel sequencing was performed for all coding sequences of GNAQ and GNA11 to an average depth of 1500x using Illumina technology. Genotyping was accepted by 15 patients and is representative of previous cohort publications [4, 6, 7] (n=8 GNAQ, n=5 GNA11, n=2 WT).

[0256] statistical analysis Binary logistic regression analysis was performed to identify associations between serum hypocalcemia and the variables age, sex, intracranial calcification, and affected skin area using p-value significance adjusted for multiple testing using SPSS v.26. Differences between means were analyzed by unpaired or paired t-tests assuming equal variances. Time-signal intensity curves were compared by two-way analysis of variance (ANOVA).

[0257] cell line hTERT-immortalized microvascular endothelial cells (TIME-ATCC CRL-4025TM, "TIME" cells) and their transgenic derivatives were maintained in EBMTM-2 Endothelial Cell Growth Basal Medium 2 (Lonza CC-3156) supplemented with EGMTM-2 BulletKit (Lonza CC-3162) and 3% fetal bovine serum (Gibco).

[0258] TIME cells were transduced with lentiviral vectors to induce stable expression of HA-tagged forms of GNAQ WT, GNAQ p.(R183Q), GNA11 WT, and GNA11 p.(R183C) cDNAs (Figure 4), and we confirmed the presence of the mutations in genomic DNA by Sanger sequencing (Figure 4B). The transduced systems expressed WT or HA-tagged variant forms of the transgenes at similar levels, and the total expression of the GNAQ-encoded protein Gαq in both GNAQ transgenic models was close to the endogenous expression observed in parental TIME cells (Figure 4C).

[0259] HEK DKO Gαq / 11;CasR;NFAT-Luc cells were derived as follows: HEK DKO Gαq / 11

[36] lacks functional GNAQ and GNA11 genes, was engineered to stably integrate an NFAT-luciferase calcium reporter, and overexpressed the calcium-sensing receptor (CaSR). CaSR senses calcium as an extracellular ligand and signals downstream through Gαq and Gα11 to activate the intracellular calcium pathway. HEK DKO Gαq / 11;CaSR;NFAT-Luc were maintained in DMEM-Glutamax™ medium (Thermo Fisher) containing 10% fetal bovine serum (Gibco), 400 μg / mL Geneticin™ (Thermo Fisher), and 100 μg / mL hygromycin (Thermo Fisher).

[0260] Plasmids and Reagents GNAQ WT, GNAQ c.548G>A,p.(R183Q), GNA11 WT, and GNA11 c.547C>T,p.(R183C) cDNAs were synthesized and cloned into pcDNA3.1+N-HA plasmid, fused in frame with an HA tag (Genscript) at their N-terminus. The luciferase ORF was excised from pLenti PGK V5-LUC Puro (Addgene 21471) by combined restriction digestion with SalI and XbaI, and the HA-tagged GNAQ / 11 cDNA was amplified and cloned into the digested pLenti vector using the In-Fusion HD Cloning Kit (Takara Bio catalog 638947) according to the online primer design tool and the manufacturer's instructions. The following antibodies were used: anti-phospho-ERK T202 / Y204 (catalog 9101, 1:1000) and anti-ERK (catalog 9107, 1:1000) from Cell Signaling Technology; anti-vinculin (catalog MA5-11690, 1:3000) from Invitrogen, anti-HA (clone 16B12, catalog 901501, 1:2000) from BioLegend, and anti-Gαq (catalog sc-136181, 1:200) from Santa Cruz Biotechnology. CM4620 was obtained from MedChemExpress (catalog HY-101942).

[0261] Production and transduction of lentiviral particles Lentiviral particles were produced by transfecting HEK293T cells in 10 cm tissue culture dishes with 0.93 μg pCMV-VSVG, 2.79 μg delta-8.2 (Addgene), and 3.72 μg pLenti GNAQWT, GNAQR183Q, GNA11WT, or GNA11R183C mixture (Lipofectamine™, Invitrogen). 48 hours after transfection, viral particles in the supernatant were harvested and stored at −80° C. TIME cells were transduced with GNAQWT, GNAQR183Q, GNA11WT, or GNA11R183C lentiviral particles in 6-well tissue culture dishes in the presence of 8 μg / mL polybrene and then selected using 4 μg / Ml puromycin.

[0262] IP1 assay Intracellular concentrations of inositol monophosphate (IP1), a downstream metabolite of inositol triphosphate, a major mediator of intracellular calcium signals, were quantified in TIME transgenic cells using the HTRF-IP-One kit (Cisbio Bioassays) according to the manufacturer's instructions. For IP-One experiments after GNAQ or GNA11 variant silencing, TIME cells were transfected with siRNA in antibiotic-free complete medium, medium was replaced 18 h post-transfection, and IP-One assays were performed 48 h post-transfection. Briefly, TIME cells were trypsinized, cell pellets were resuspended in complete medium, and transferred to 384-well microtiter plates at a density of 50,000 cells / 7 μl per well, with a total of 5–6 wells used as technical replicates for each experimental condition. 7 μl of stimulation buffer was then added to each well. After 90 min incubation at 37° C., 3 μl of IP1-d2 conjugate and 3 μl of europium cryptate-labeled anti-IP1 antibody dissolved in lysis buffer were added to the cells. After 1 h incubation at room temperature in the dark, the fluorescence in each well was measured sequentially at 620 nm and 665 nm by a TecanSpark® plate reader.

[0263] Luciferase assay HEK DKO Gαq / 11;CaSR;NFAT-Luc cells were seeded in 96-well plates at a density of 10,000 cells / well and transfected with pcDNA3.1 GNAQ WT , GNAQ R183Q , GNA11 WT , or GNA11 R183C Plasmids (40ng, 5ng, 5ng, and 4ng of constructs were used, respectively) were transfected (Lipofectamine™ 2000) to obtain similar expression levels of cDNA. The day after transfection, cells were starved for 16 hours with DMEM containing 25mM HEPES, 0.45mM CaCl2, and 0.01% FBS. After starvation, cells were treated with different concentrations of calcium chloride in calcium-free DMEM-25mM HEPES for 4 hours, and then lysates were harvested in passive lysis buffer (Promega). Lysates were transferred to a 96-well assay plate, and firefly luciferase activity from individual wells was measured by adding luciferase assay reagent (Promega catalog E1501) according to the manufacturer's instructions using a plate reader equipped with an automatic injector (PHERAstar®).

[0264] Fluo-8AM assay Cells were seeded at a density of 8000 cells / well in 96-well plates and incubated the next day in 2 μM Fluo-8AM-HBSS for 60 min at 37° C., after which the dye-containing solution was replaced with HBSS and incubated for an additional 30 min at room temperature. Cells were stimulated with a 10x solution of thrombin in HBSS (final concentration 1 U / ml) and fluorescence (excitation 490 nM / emission 525 nM) was recorded every second using a plate reader equipped with an automatic injector (PHERAstar®).

[0265] For experiments in HBSS-free buffer, cells were incubated in calcium-free HBSS for 100 seconds before stimulation with thrombin.

[0266] For analysis of siRNA-treated cells, cells were transfected 48 h prior to Fluo-8AM loading.

[0267] Cytosolic calcium concentration was calculated using the following: [Ca2+]c=KD(F-Fmin) / (Fmax-F), where KD is the dissociation constant of Fluo-8 for Ca2+ (389 nM), and Fmax and Fmin are the maximum and minimum fluorescence values ​​determined, respectively, after addition of CaCl2 (10 mM) and Triton (0.1%) in HBSS, or BAPTA (10 mM) and Triton (0.1%) in Ca2+-free HBSS.

[0268] Design and testing of mutation-specific siRNAs Six siRNAs that specifically anneal to the variant GNAQ c.548G>A,p.(R183Q) were synthesized with the following sense strand sequences: siGNAQmut #1: UGCUUAGAGUUCAAGUCCC[dT][dT]; siGNAQmut #2: GCUUAGAGUUCAAGUCCCC[dT][dT]; siGNAQmut #3: CUUAGAGUUCAAGUCCCCA[dT][dT]; siGNAQmut #4: UUAGAGUUCAAGUCCCCAC[dT][dT]; siGNAQmut #5: UAGAGUUCAAGUCCCCACC[dT][dT]; siGNAQmut #6: AGAGUUCAAGUCCCCACCA[dT][dT].

[0269] Six siRNAs that specifically anneal to the variant GNA11 c.547C>T,p.(R183C) were synthesized with the following sense strand sequences: siGNA11mut #1: GUGCUGCGGGUCUGCGUGC[dT][dT]; siGNA11mut #2: UGCUGCGGGUCUGCGUGCC[dT][dT]; siGNA11mut #3: GCUGCGGGUCUGCGUGCCC[dT][dT]; siGNA11mut #4: CUGCGGGUCUGCGUGCCCA[dT][dT]; siGNA11mut #5: UGCGGGUCUGCGUGCCCAC[dT][dT]; siGNA11mut #6: CGGGUCUGCGUGCCCACCA[dT][dT].

[0270] TIME transgenic cells were transfected with siRNA using Lipofectamine RNAiMAX™ (Invitrogen) according to the manufacturer's instructions.

[0271] Two of six siRNAs designed to anneal specifically to the variant GNAQ transcript showed specific knockdown of variant Gαq while sparing production of the WTGNAQ transgene (Figure 5A-B). The same specificity was observed for one of six siRNAs targeting the variant GNA11 transcript (Figure 5A-B).

[0272] Example 1 - Systemic calcium homeostasis is disrupted in SWS and PPV patients Thirty-six patients were recruited, 18 were female, 29 were SWS patients, and 7 were PPV patients. The mean and median ages were 8.3 and 9.4 years, respectively (range 0.7-16.0). Phenotype and blood index data are summarized in Figures 6 and 7.

[0273] At baseline, 64% (23 / 36) of patients had at least one abnormal measurement of calcium metabolism (defined as pH-corrected ionized calcium, albumin-corrected total calcium, PTH, phosphate, magnesium, active vitamin D, and urinary calcium:creatinine ratio). The most common finding was low serum ionized calcium in 43% (13 / 30). The second most common finding was high PTH in 15% (5 / 34) with high (n=1), normal (n=2), and low (n=2) ionized calcium. Urinary calcium excretion was abnormal in 18% (5 / 28), high in three and low in two. Only two patients had abnormal phosphate, one high and one low. Magnesium levels were generally normal, and there were no abnormal problems with urea and electrolytes. We initially considered the possibility of interference with vitamin D levels by antiepileptic drugs, but only two patients had low vitamin D and we used post-supplementation measurements in all analyses. Linear regression modeling of total serum corrected calcium showed a significant negative association with increasing age (p<0.001), no association with gender, and no association with affected skin surface area. This was despite the known increase in baseline reference ranges for calcium with increasing age in childhood. Linear regression of urinary calcium:creatinine ratio with age alone showed the same significant negative association with increasing age (P=0.019).

[0274] The mean and median estimated body surface area affected by capillary malformations were 11% (range: 0.0–43.0) and 7%, respectively, although estimates of body surface area are known to be inaccurate. No patients had hypertension or macrocephaly, but one had microcephaly. Thirty-three percent had asymmetric growth (10 / 33 overgrowth and 1 / 33 undergrowth). Intracranial calcifications were detectable in 50% of patients (Figure 1D–E), and in some patients there was clear evidence of new appearance of these lesions over time.

[0275] Example 2 - GNAQ / GNA11 variants cause constitutive activation of intracellular calcium signaling in endothelial cells Basal calcium signaling was significantly increased in both GNAQR183Q and GNA11R183C variant TIME cells compared to wild-type (WT) controls, as indicated by the sharp increase in IP-One accumulation in both complete and nutrient-deprived media (Figure 2A). On the other hand, basal MAPK pathway activation was not significantly different between GNAQ variant and WT TIME cells, or between GNA11 variant and WT TIME cells, as indicated by Western blot analysis of ERK phosphorylation in both complete and starved media (Figure 2B).

[0276] To verify our findings in a cell system without interference from endogenous Gαq and Gα11, we used HEK DKO Gαq / 11;CaSR;NFAT-Luc cells, a model in which endogenous GNAQ and GNA11 genes are knocked out and calcium-sensing receptor (CaSR) is overexpressed. Then, the above GNAQR183Q, GNAQWT, GNA11R183C, or GNA11WT cDNA constructs were transfected into this second model system using their respective expression vectors (Figure 4D). Thus, this model uses calcium as an extracellular GCPR ligand to lead to intracellular calcium signaling.

[0277] As expected in the absence of endogenous GNAQ / GNA11, untransfected cells did not respond to extracellular calcium stimulation, whereas transfected cells showed an increase in luciferase signal after treatment with the ligand, validating this model (Figure 2C). In the absence of extracellular calcium stimulation ("vehicle" condition in Figure 2C), cells transfected with variant GNAQ or GNA11 showed a statistically significant increase in NFAT-driven luciferase signal compared to their WT counterparts, confirming that these mutations induce a basal constitutive activation of calcium signaling.

[0278] Example 3 - Variant GNAQ amplifies thrombin-induced intracellular calcium signaling in endothelial cells only in the presence of extracellular calcium The kinetics of calcium signaling activation in TIME cells upon GPCR ligand stimulation was studied using the GNAQR183Q model, as the most common mutation identified in patients. Thrombin was used as a typical GPCR stimulant to activate Gαq signaling in endothelial cells

[37] . Mutant cells showed a marked increase and prolonged increase in the levels of intracellular calcium compared to WT cells after thrombin stimulation. Strikingly, this difference was completely abolished by removing calcium from the extracellular buffer (Figure 2D), identifying the influx of extracellular calcium as the source of the abnormal signal.

[0279] Example 4 - CRAC channel inhibition and variant-specific siRNA rescues aberrant calcium signaling in variant cells.

[0280] We hypothesized that increased activation of calcium signaling downstream of variant Gαq drives extracellular calcium influx through the CRAC channel in the plasma membrane. In support of this, treatment of cells with CM4620, a specific inhibitor of the CRAC channel, significantly rescued the prolonged calcium intracellular peak in GNAQ variant cells (Figure 3B-C), whereas it had limited effect on thrombin-induced calcium signaling in TIME GNAQWT (Figure 3A).

[0281] As further molecular tools to study the biological effects of these mutations, we designed siRNAs to specifically knockdown the GNAQ c.548G>A,p.(R183Q) or GNA11 c.547C>T,p.(R183C) transcripts while leaving the WT allele intact (Figure 5A-D).

[0282] All variant-specific siRNAs rescued constitutive basal calcium signaling activation in TIME GNAQR183Q or TIME GNA11R183C cells, as measured by IP-One assay (Figure 3D), and in a GNAQ p.(R183Q) variant uveal melanoma cell line called UPMM-1 (Figure 3G). To validate this key result, a second assay was used to engineer TIME GNAQR183Q cells to stably incorporate an NFAT-luciferase calcium signaling reporter (Figure 3E). Treatment with variant-specific siRNAs again normalized basal calcium signaling.

[0283] To confirm the role of GNAQ mutations in modifying responses to GPCR ligands, we transfected TIME GNAQR183Q with variant-specific oligos and measured intracellular calcium accumulation after thrombin stimulation. With respect to constitutive signaling, the abnormally prolonged response of TIME GNAQ variant cells to thrombin was rescued by silencing the variant transcript (Figure 3F), strongly linking this mutation to all aspects of signaling abnormalities.

[0284] Example 5 - In vitro angiogenesis is disrupted by mutant GNAQ and rescued by inhibition of CRAC channels Angiogenesis was assessed using a standard in vitro angiogenesis assay using the TIME endothelial cell model

[38] . GNAQR183Q cells exhibited severely impaired tubule formation in the basement membrane matrix (Figure 8A-B), linking this mutation to the pathogenesis of vascular malformations. Furthermore, GPCR activation of thrombin disrupted angiogenesis more in GNAQR183Q than in GNAQWT (Figure 8C). Treatment with the CRAC channel inhibitor CM4620 improved tubule formation specifically in GNAQR183Q, but not in GNAQWT (Figure 8D), strongly suggesting that abnormal calcium signaling is induced by the GNAQ mutation and is responsible for the vascular malformations.

[0285] Example 6 - Serum ionized calcium significantly inversely correlates with seizures, status epilepticus, and antiepileptic drugs. Linear regression modeling of total serum corrected calcium showed a significant negative association with increasing age (p=0.001) (Figure 1F) and no association with affected skin surface area. Linear regression of urinary calcium:creatinine ratio with age alone showed the same significant negative association with increasing age (p=0.001), as did serum magnesium and phosphate (both p<0.001). We then modeled the most common adverse event, patient seizures, using ionized calcium, the most common serum abnormality. This showed a significant inverse correlation (p=0.013) between serum pH corrected ionized calcium levels and the presence of seizures (Figure 9F) and status epilepticus (Figure 9G) (p=0.017). Significant associations were also seen between ionized calcium and use of levetiracetam (p=0.02) and oxcarbazepine (p=0.003), but not other antiepileptic medications. No association was found between prophylactic aspirin use and the occurrence of seizures in this cohort. No significant differences were found between men and women for the main abnormal calcium metabolism parameters. Given the cohort size, the statistical contribution of different diagnostic markers and genotypes was not modeled, but this may be of interest in the future.

[0286] Example 7 - SWS / PPV patients have variable serum ionized calcium levels but normal 25-hydroxy-vitamin D levels. Three patients had low 25-hydroxy-vitamin D at the first measurement and were given oral supplementation and resampled before the cohort results were analyzed. Based on their corrected background, 74% (31 / 42) of patients at first sampling had at least one abnormal measurement of calcium metabolism, defined herein as pH-corrected ionized calcium, albumin-corrected total calcium, parathyroid hormone (PTH), phosphate, magnesium, 25-hydroxy-vitamin D, alkaline phosphatase (ALP), and urinary calcium:creatinine ratio. The most common findings were moderately low serum ionized calcium in 41% (15 / 37), high PTH in 17% (7 / 42), and urinary calcium excretion appropriately adjusted for abnormal serum levels in 17% (5 / 30). We performed repeat sampling in 26 and 10 patients (at two and three sampling time points, respectively) (Figure 7). This showed that the levels of abnormal measurements varied within patients, but the overall proportion of abnormal results in the cohort at each time point was similar (69% and 80% at two and three sampling time points, respectively). Reflecting this, expected interrelationships between parameters (e.g., inverse levels of serum calcium and PTH) did not always hold within individuals at specific time points, but they were clearly related in a regular manner when considering the measurements of the cohort as a whole (Figure 11A).

[0287] To further elucidate these profiles, we measured intact and C-terminal fibroblast growth factor 23 (iFGF23 and cFGF23) and 1,25-dihydroxy-vitamin D in patients who consented to retesting and for whom adequate samples could be obtained (Figure 7). cFGF23 was high in 9 / 20 (mean 105.9 RU / mL, range 23-355), with 17 / 18 having normal iFGF23, normal 1,25-dihydroxyvitamin D, and phosphate concentrations. Of note, cFGF23 and iFGF23 levels showed opposite correlations with different physiological parameters, with only iFGF23 showing a statistically significant negative correlation with 1,25-dihydroxyvitamin D (Figure 11). 1,25-dihydroxyvitamin D was low in 7 / 20 (mean 129.6 pmol / L, range 53-218), with all having normal 25-hydroxyvitamin D levels.

[0288] Example 8 - SWS / PPV patients do not have major abnormalities in calcium metabolism in the thyroid, kidney, and skeletal systems Due to mosaic variability in inter- and intra-patient measurements, associations between key calcium metabolism parameters were modeled at the cohort level. PTH showed the expected inverse correlation with serum Ca (Figure 12A), urinary Ca / Cr ratios increased appropriately with increasing serum Ca (Figure 12B), iFGF23 and 1,25-dihydroxyvitamin D showed the expected inverse correlation (Figure 12C), but no correlation was observed between 1,25-dihydroxyvitamin D and PTH (Figure 12D). This lack of relationship between PTH and 1,25-dihydroxyvitamin D indicates that iFGF23 may be a physiological regulator of 1,25-dihydroxyvitamin D in these patients. Estimated glomerular filtration rate (E-GFR) measurements were normal throughout (Figure 7), as were blood pressure measurements (where available) (n=39). In 11 patients with hypocalcemia, whole-body DEXA scans were normal and borderline abnormal except for one head scan (Z score = -1.9).

[0289] Equivalents and Scope Those skilled in the art will appreciate that the present invention is defined by the appended claims, and not by the specific embodiment examples or other descriptions contained herein.

[0290] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0291] Unless otherwise defined above, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. In general, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, genetics, and protein and nucleic acid chemistry described herein, and the techniques thereof, are well known and commonly used in the art, or according to manufacturer's specifications.

[0292] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application should not be construed as an admission that such reference is available as prior art to the present invention. To the extent section headings are used, they should not be construed as necessarily limiting.

[0293] [Table 1] TIFF2025509242000003.tif252170TIFF2025509242000004.tif250170TIFF2025509242000005.tif25017 0TIFF2025509242000006.tif254170TIFF2025509242000007.tif254170TIFF2025509242000008.tif29170

[0294] The present application also provides the following embodiments: 1. A nucleic acid molecule comprising a first strand of 10 to 50 linked nucleosides, the first strand comprising a sequence that is completely complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding GNAQ or GNA11. 2. The nucleic acid molecule described in embodiment 1, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of GNAQ or GNA11. 3. The nucleic acid molecule of any preceding embodiment, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding GNAQ. 4. The nucleic acid molecule of any preceding embodiment, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of an mRNA encoding a gain-of-function variant of GNAQ. 5. The nucleic acid molecule of embodiment 1 or 2, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an equal length portion of the mRNA encoding GNA11. 6. A nucleic acid molecule described in any one of embodiments 1, 2, or 5, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an equal-length portion of an mRNA encoding a gain-of-function variant of GNA11. 7. The nucleic acid molecule of any preceding embodiment, wherein the first strand consists of 10-40 linked nucleosides. 8. The nucleic acid molecule of any preceding embodiment, wherein the first strand consists of 10-30 linked nucleosides. 9. The nucleic acid molecule of any preceding embodiment, wherein the first strand consists of 15-30 linked nucleosides. 10. The nucleic acid molecule of any preceding embodiment, wherein the first strand consists of 15-25 linked nucleosides. 11. The nucleic acid molecule of any preceding embodiment, wherein the first strand consists of 15-20 linked nucleosides. 12. The nucleic acid molecule of any preceding embodiment, wherein the first strand consists of 10-20 linked nucleosides. 13. The nucleic acid molecule of any preceding embodiment, wherein the first strand consists of 20-30 linked nucleosides. 14. The nucleic acid molecule of any preceding embodiment, wherein the first strand consists of 20-25 linked nucleosides. 15. The nucleic acid molecule of any preceding embodiment, wherein the first strand consists of 21 linked nucleosides. 16. The nucleic acid molecule of any preceding embodiment, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant GNAQ p.(R183Q), p.(R183G), p.(R183L), or p.(R183*). 17. The nucleic acid molecule of any preceding embodiment, wherein the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding the variant GNAQ p.(R183Q), p.(R183G), p.(R183L), or p.(R183*). 18. The nucleic acid molecule of any preceding embodiment, wherein the nucleic acid molecule is capable of inhibiting expression of variant GNAQ p.(R183Q / G / L / *) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. 19. The nucleic acid molecule of any preceding embodiment, wherein the nucleic acid molecule inhibits expression of variant GNAQ p.(R183Q / G / L / *) in vitro to a greater extent compared to inhibiting expression of wild-type GNAQ in vitro. 20. The nucleic acid molecule of any preceding embodiment, wherein the nucleic acid molecule is capable of partially or fully rescuing aberrant cell differentiation signaling in cells expressing variant GNAQ p.(R183Q / G / L / *). 21. A nucleic acid molecule according to any one of embodiments 16 to 20, wherein the variant GNAQ p.(R183Q) is caused by the c.G548A mutation in the GNAQ genomic sequence. 22. The nucleic acid molecule of embodiment 21, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 13-18. 23. The nucleic acid molecule of embodiment 21 or 22, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 13 to 18. 24. A nucleic acid molecule according to any one of embodiments 21 to 23, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 13 to 18. 25. A nucleic acid molecule described in any one of embodiments 16 to 20, wherein the variant GNAQ p.(R183G) is caused by the c.C547G mutation in the GNAQ genomic sequence. 26. The nucleic acid molecule of embodiment 25, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 33-38. 27. The nucleic acid molecule of embodiment 25 or 26, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 33 to 38. 28. A nucleic acid molecule according to any one of embodiments 25 to 27, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 33 to 38. 29. A nucleic acid molecule described in any one of embodiments 16 to 20, wherein the variant GNAQ p.(R183L) is caused by the c.G548T mutation in the GNAQ genomic sequence. 30. The nucleic acid molecule of embodiment 29, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 45-50. 31. The nucleic acid molecule of embodiment 29 or 30, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 45 to 50. 32. The nucleic acid molecule of embodiment 29 or 30, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 45 to 50. 33. A nucleic acid molecule according to any one of embodiments 16 to 20, wherein the variant GNAQ p.(R183*) is caused by the c.C547T mutation in the GNAQ genomic sequence. 34. The nucleic acid molecule of embodiment 33, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 57-62. 35. The nucleic acid molecule of embodiment 33 or 34, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 57 to 62. 36. A nucleic acid molecule according to any one of embodiments 33 to 35, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 57 to 62. 37. A nucleic acid molecule according to any one of embodiments 1 to 2 or 5 to 15, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity to an equal length portion of an mRNA encoding variant GNA11 p.(R183C) or p.(R183H). 38. A nucleic acid molecule according to any one of embodiments 1-2 or 5-15 or 37, wherein the first strand comprises a sequence that is fully complementary to a sequence having 100% identity to an equal length portion of an mRNA encoding variant GNA11 p.(R183C) or p.(R183H). 39. The nucleic acid molecule of any one of embodiments 1-2 or 5-15 or 37-38, wherein the nucleic acid molecule is capable of inhibiting expression of variant GNA11 p.(R183C / H) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. 40. A nucleic acid molecule described in any one of embodiments 1-2, 5-15, or 37-39, wherein the nucleic acid molecule inhibits expression of variant GNA11 p.(R183C / H) in vitro to a greater extent than inhibiting expression of wild-type GNA11 in vitro. 41. A nucleic acid molecule described in any one of embodiments 1-2, or 5-15, or 37-40, wherein the nucleic acid molecule is capable of partially or completely rescuing aberrant cell differentiation signaling in cells expressing variant GNA11 p.(R183C / H). 42. A nucleic acid molecule described in any one of embodiments 37 to 41, wherein the variant GNA11 p.(R183C) is caused by the c.C547T mutation in the GNA11 genomic sequence. 43. The nucleic acid molecule of embodiment 42, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 19-24. 44. The nucleic acid molecule of embodiment 42 or 43, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 19 to 24. 45. A nucleic acid molecule according to any one of embodiments 42 to 44, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 19 to 24. 46. ​​A nucleic acid molecule described in any one of embodiments 37 to 41, wherein the variant GNA11 p.(R183C) is caused by the c.546_547delinsTT mutation in the GNA11 genomic sequence. 47. The nucleic acid molecule of embodiment 46, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 69-74. 48. The nucleic acid molecule of embodiment 46 or 47, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 69 to 74. 49. A nucleic acid molecule described in any one of embodiments 46 to 48, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 69 to 74. 50. A nucleic acid molecule described in any one of embodiments 37 to 41, wherein the variant GNA11 p.(R183H) is caused by the c.G548A mutation in the GNA11 genomic sequence. 51. The nucleic acid molecule of embodiment 50, wherein the first strand comprises a sequence having at least 80%, at least 90%, or at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 81-86. 52. The nucleic acid molecule of embodiment 50 or 51, wherein the first strand comprises a sequence selected from the group consisting of SEQ ID NOs: 81 to 86. 53. A nucleic acid molecule according to any one of embodiments 50 to 52, wherein the first strand consists of a sequence selected from the group consisting of SEQ ID NOs: 81 to 86. 54. The nucleic acid molecule of any preceding embodiment, wherein the nucleic acid molecule is a single-stranded nucleic acid molecule. 55. A nucleic acid molecule described in any one of embodiments 1 to 54, wherein the nucleic acid molecule is a double-stranded nucleic acid molecule. 56. The nucleic acid molecule of embodiment 55, wherein the double-stranded nucleic acid molecule comprises a second strand of 10 to 50 linked nucleosides, the second strand being at least partially complementary to the first strand. 57. The nucleic acid molecule of embodiment 56, wherein the second strand is at least 80% complementary to the first strand. 58. The nucleic acid molecule of embodiment 56 or 57, wherein the second strand is at least 90% complementary to the first strand. 59. The nucleic acid molecule of any one of embodiments 56 to 58, wherein the second strand is at least 95% complementary to the first strand. 60. The nucleic acid molecule of any one of embodiments 56 to 59, wherein the second strand is perfectly complementary to the first strand. 61. A nucleic acid molecule according to any one of embodiments 56 to 60, wherein the second strand consists of 10 to 40 linked nucleosides. 62. A nucleic acid molecule according to any one of embodiments 56 to 60, wherein the second strand consists of 10 to 30 linked nucleosides. 63. A nucleic acid molecule according to any one of embodiments 56 to 60, wherein the second strand consists of 15 to 30 linked nucleosides. 64. A nucleic acid molecule according to any one of embodiments 56 to 60, wherein the second strand consists of 15 to 25 linked nucleosides. 65. A nucleic acid molecule according to any one of embodiments 56 to 60, wherein the second strand consists of 15 to 20 linked nucleosides. 66. A nucleic acid molecule according to any one of embodiments 56 to 60, wherein the second strand consists of 10 to 20 linked nucleosides. 67. A nucleic acid molecule according to any one of embodiments 56 to 60, wherein the second strand consists of 20 to 30 linked nucleosides. 68. A nucleic acid molecule according to any one of embodiments 56 to 60, wherein the second strand consists of 20 to 25 linked nucleosides. 69. A nucleic acid molecule according to any one of embodiments 56 to 60, wherein the second strand consists of 21 linked nucleosides. 70. The nucleic acid molecule of any one of embodiments 56 to 69, wherein the first strand is longer than the second strand. 71. A nucleic acid molecule described in any one of embodiments 56 to 70, having an overhang at the 3' end of the first strand of 1, 2, 3, 4, 5 or more nucleosides. 72. A nucleic acid molecule described in any one of embodiments 56 to 71, having an overhang at the 3' end of the first strand of two nucleosides. 73. A nucleic acid molecule according to any one of embodiments 56 to 72, having an overhang at the 5' end of the first strand of 1, 2, 3, 4, 5 or more nucleosides. 74. A nucleic acid molecule described in any one of embodiments 56 to 73, having an overhang at the 5' end of the first strand of two nucleosides. 75. The nucleic acid molecule of any one of embodiments 56 to 69, wherein the second strand is longer than the first strand. 76. The nucleic acid molecule of any one of embodiments 56 to 69 or 75, having an overhang at the 3' end of the second strand of 1, 2, 3, 4, 5 or more nucleosides. 77. A nucleic acid molecule described in any one of embodiments 56 to 69 or 75 to 76, having an overhang at the 3' end of the second strand of two nucleosides. 78. A nucleic acid molecule according to any one of embodiments 56-69 or 75-77, having an overhang at the 5' end of the second strand of 1, 2, 3, 4, 5 or more nucleosides. 79. A nucleic acid molecule described in any one of embodiments 56-69 or 75-78, having an overhang at the 5' end of the second strand of two nucleosides. 80. A nucleic acid molecule described in any one of embodiments 56-69 or 75-79, having overhangs at both the 5' and 3' ends of the first strand of 1, 2, 3, 4, 5 or more nucleosides. 81. A nucleic acid molecule described in any one of embodiments 56 to 69 or 75 to 80, having overhangs at both the 5' and 3' ends of the first strand of two nucleosides. 82. A nucleic acid molecule described in any one of embodiments 71 to 74 or 75 to 81, wherein the overhang comprises two thymine nucleotides (TT). 83. A nucleic acid molecule described in any one of embodiments 71 to 74 or 75 to 81, wherein the overhang consists of two thymine nucleotides (TT). 84. The nucleic acid molecule of any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17, and SEQ ID NO:6 and SEQ ID NO:18. 85. A nucleic acid molecule described in any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17, and SEQ ID NO:6 and SEQ ID NO:18. 86. A nucleic acid molecule described in any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:1 and SEQ ID NO:13, SEQ ID NO:2 and SEQ ID NO:14, SEQ ID NO:3 and SEQ ID NO:15, SEQ ID NO:4 and SEQ ID NO:16, SEQ ID NO:5 and SEQ ID NO:17, and SEQ ID NO:6 and SEQ ID NO:18. 87. The nucleic acid molecule of any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:7 and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NO:20, SEQ ID NO:9 and SEQ ID NO:21, SEQ ID NO:10 and SEQ ID NO:22, SEQ ID NO:11 and SEQ ID NO:23, and SEQ ID NO:12 and SEQ ID NO:24. 88. A nucleic acid molecule described in any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:7 and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NO:20, SEQ ID NO:9 and SEQ ID NO:21, SEQ ID NO:10 and SEQ ID NO:22, SEQ ID NO:11 and SEQ ID NO:23, and SEQ ID NO:12 and SEQ ID NO:24. 89. A nucleic acid molecule described in any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:7 and SEQ ID NO:19, SEQ ID NO:8 and SEQ ID NO:20, SEQ ID NO:9 and SEQ ID NO:21, SEQ ID NO:10 and SEQ ID NO:22, SEQ ID NO:11 and SEQ ID NO:23, and SEQ ID NO:12 and SEQ ID NO:24. 90. The nucleic acid molecule of any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NO:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37, and SEQ ID NO:32 and SEQ ID NO:38. 91. A nucleic acid molecule described in any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NO:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37, and SEQ ID NO:32 and SEQ ID NO:38. 92. A nucleic acid molecule described in any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:27 and SEQ ID NO:33, SEQ ID NO:28 and SEQ ID NO:34, SEQ ID NO:29 and SEQ ID NO:35, SEQ ID NO:30 and SEQ ID NO:36, SEQ ID NO:31 and SEQ ID NO:37, and SEQ ID NO:32 and SEQ ID NO:38. 93. The nucleic acid molecule of any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NO:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49, and SEQ ID NO:44 and SEQ ID NO:50. 94. The nucleic acid molecule according to any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NO:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49, and SEQ ID NO:44 and SEQ ID NO:50. 95. The nucleic acid molecule according to any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:39 and SEQ ID NO:45, SEQ ID NO:40 and SEQ ID NO:46, SEQ ID NO:41 and SEQ ID NO:47, SEQ ID NO:42 and SEQ ID NO:48, SEQ ID NO:43 and SEQ ID NO:49, and SEQ ID NO:44 and SEQ ID NO:50. 96. The nucleic acid molecule according to any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NO:60, SEQ ID NO:55 and SEQ ID NO:61, and SEQ ID NO:56 and SEQ ID NO:62. 97. The nucleic acid molecule according to any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NO:60, SEQ ID NO:55 and SEQ ID NO:61, and SEQ ID NO:56 and SEQ ID NO:62. 98. The nucleic acid molecule according to any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:51 and SEQ ID NO:57, SEQ ID NO:52 and SEQ ID NO:58, SEQ ID NO:53 and SEQ ID NO:59, SEQ ID NO:54 and SEQ ID NO:60, SEQ ID NO:55 and SEQ ID NO:61, and SEQ ID NO:56 and SEQ ID NO:62. 99. The nucleic acid molecule of any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NO:70, SEQ ID NO:65 and SEQ ID NO:71, SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73, and SEQ ID NO:68 and SEQ ID NO:74. 100. The nucleic acid molecule according to any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NO:70, SEQ ID NO:65 and SEQ ID NO:71, SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73, and SEQ ID NO:68 and SEQ ID NO:74. 101. The nucleic acid molecule according to any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:63 and SEQ ID NO:69, SEQ ID NO:64 and SEQ ID NO:70, SEQ ID NO:65 and SEQ ID NO:71, SEQ ID NO:66 and SEQ ID NO:72, SEQ ID NO:67 and SEQ ID NO:73, and SEQ ID NO:68 and SEQ ID NO:74. 102. The nucleic acid molecule of any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand comprising a pair of sequences selected from the list consisting of: SEQ ID NO:75 and SEQ ID NO:81, SEQ ID NO:76 and SEQ ID NO:82, SEQ ID NO:77 and SEQ ID NO:83, SEQ ID NO:78 and SEQ ID NO:84, SEQ ID NO:79 and SEQ ID NO:85, and SEQ ID NO:80 and SEQ ID NO:86. 103. The nucleic acid molecule according to any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO:75 and SEQ ID NO:81, SEQ ID NO:76 and SEQ ID NO:82, SEQ ID NO:77 and SEQ ID NO:83, SEQ ID NO:78 and SEQ ID NO:84, SEQ ID NO:79 and SEQ ID NO:85, and SEQ ID NO:80 and SEQ ID NO:86. 104. A nucleic acid molecule described in any one of embodiments 55 to 83, wherein the nucleic acid molecule comprises a first strand and a second strand consisting of a pair of sequences selected from the list consisting of: SEQ ID NO: 75 and SEQ ID NO: 81, SEQ ID NO: 76 and SEQ ID NO: 82, SEQ ID NO: 77 and SEQ ID NO: 83, SEQ ID NO: 78 and SEQ ID NO: 84, SEQ ID NO: 79 and SEQ ID NO: 85, and SEQ ID NO: 80 and SEQ ID NO: 86. 105. A compound comprising a nucleic acid molecule of any preceding embodiment and a targeting moiety. 106. The compound of embodiment 105, wherein the targeting moiety comprises a lipid nanoparticle, a liposome, an exosome, an antibody or fragment thereof, an antigen-binding domain or fragment thereof, a peptide, a cell-penetrating peptide, a conjugate group, or any combination thereof. 107. The compound of embodiment 105 or 106, wherein the targeting moiety comprises a conjugate group, and the conjugate group comprises one or more carbohydrates. 108. The conjugate group is a monosaccharide, a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, a polysaccharide, a modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L-mannopyranose, D-arabinose, L-galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, aD-mannofuranose, β-D-mannofuranose, α-D -Mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, α-D-galactosamine, N-acetylgalactosamine, Tosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycoloyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2,3, The compound of embodiment 107, comprising 4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-aD-gluco-heptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose. 109. The compound of any one of embodiments 105-108, wherein the targeting moiety is linked to the 3' end of the second strand. 110. The compound of any one of embodiments 105-108, wherein the targeting moiety is linked to the 5' end of the second strand. 111. The compound of any one of embodiments 105-108, wherein the targeting moiety is linked to the 5' end of the first strand. 112. The compound of any one of embodiments 105-108, wherein the targeting moiety is linked to the 3' end of the first strand. 113. The nucleic acid molecule or compound of any preceding embodiment, wherein at least one nucleoside comprises a modified sugar. 114. The nucleic acid molecule or compound of any preceding embodiment, wherein at least one internucleoside linkage is a modified internucleoside linkage. 115. The nucleic acid molecule or compound according to embodiment 114, wherein the modified internucleoside linkage is a phosphorothioate or phosphorodithioate internucleoside linkage. 116. The nucleic acid molecule or compound according to embodiment 114 or 115, comprising 1 to 40 phosphorothioate or phosphorodithioate internucleoside linkages. 117. The nucleic acid molecule or compound according to embodiment 114 or 115, comprising 1 to 30 phosphorothioate or phosphorodithioate internucleoside linkages. 118. The nucleic acid molecule or compound according to embodiment 114 or 115, comprising 1 to 20 phosphorothioate or phosphorodithioate internucleoside linkages. 119. The nucleic acid molecule or compound according to embodiment 114 or 115, comprising 1 to 10 phosphorothioate or phosphorodithioate internucleoside linkages. 120. The nucleic acid molecule of any preceding embodiment, wherein the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO: 89 (GNAQ c.548G>A_p.R183Q), SEQ ID NO: 91 (GNAQ c.547C>G_p.R183G), SEQ ID NO: 93 (GNAQ c.548G>T_p.R183L), SEQ ID NO: 95 (GNAQ c.547C>T_p.R183*), SEQ ID NO: 99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C), and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H). 121. A composition comprising a single-stranded nucleic acid molecule or compound or a salt thereof according to any preceding embodiment, and at least one of a pharma- ceutically acceptable carrier or diluent. 122. A prodrug comprising a nucleic acid molecule or compound described in any one of embodiments 1 to 120. 123. A nucleic acid molecule comprising a nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes to a target sequence in a cell, and the target sequence encodes a variant allele of GNAQ or GNA11. 124. A CRISPR nuclease system comprising: (a) a promoter operably linked to at least one nucleotide sequence encoding a CRISPR guide RNA (gRNA), wherein the gRNA hybridizes to a target DNA sequence in a cell of a subject, and the target sequence encodes a variant allele of GNAQ or GNA11; (b) a nucleotide sequence encoding a nuclease (e.g., a Cas nuclease), wherein components (a) and (b) are located on the same or different vectors of the system; A CRISPR nuclease system in which the gRNA targets and hybridizes to a target DNA sequence, and the nuclease cleaves the target sequence to alter expression of a variant allele of GNAQ or GNA11. 125. The CRISPR nuclease system of embodiment 124, wherein the system is packaged into a single adeno-associated virus (AAV) particle. 126. The CRISPR nuclease system of embodiment 124 or 125, wherein the nuclease is codon-optimized for expression in the cell. 127. A CRISPR nuclease system described in any one of embodiments 124 to 126, wherein the promoter is operably linked to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 gRNAs. 128. A CRISPR nuclease system described in any one of embodiments 124 to 127, wherein the gRNA targets a DNA sequence encoding the variant GNAQ p.(R183Q), p.(R183G), p.(R183L), or p.(R183*). 129. A CRISPR nuclease system described in any one of embodiments 124 to 128, wherein the gRNA targets a DNA sequence encoding variant GNA11 p.(R183C) or p.(R183H). 130. A method for treating a patient having a disease or disorder associated with or driven by a variant in GNAQ and / or GNA11, comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 131. A method for treating a patient having Sturge-Weber syndrome (SWS), pigmented vascular nevus (PPV), or extensive cutaneous melanosis (EDM), comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 132. A method for treating a patient having a congenital hemangioma, comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 133. The method of embodiment 132, wherein the congenital hemangioma is a rapidly involuting congenital hemangioma (RICH), a partially involuting congenital hemangioma (PICH), or a non-involuting congenital hemangioma (NICH). 134. A method for treating a patient having cancer, comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 135. The method of embodiment 230, wherein the cancer is selected from the list consisting of adrenal gland cancer, autonomic ganglion cancer, biliary tract cancer, bone cancer, breast cancer, central nervous system cancer, cervical cancer, endometrial cancer, eye cancer, fallopian tube cancer, female genital tract cancer, gastrointestinal tract cancer, reproductive tract cancer, hematopoietic cancer, lymphatic system cancer, kidney cancer, colon cancer, liver cancer, lung cancer, meningeal cancer, NS cancer, esophageal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, perineal cancer, peritoneal cancer, pituitary cancer, placental cancer, pleural cancer, prostate cancer, salivary gland cancer, skin cancer, small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thymic cancer, thyroid cancer, upper aerodigestive tract cancer, urinary tract cancer, uterine adnexal cancer, vaginal cancer, and vulvar cancer. 136. A method for treating a patient having melanoma, comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 137. A nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129 for use as a pharmaceutical. 138. A nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129 for use in a method for treating Sturge-Weber syndrome (SWS), pigmented vascular nevus (PPV), or extensive cutaneous melanosis (EDM) in a patient in need of such treatment, the method comprising administering to the patient the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 139. A nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129 for use in a method for treating a patient having a congenital hemangioma, the method comprising administering to a patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 140. The nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system for use according to embodiment 139, wherein the congenital hemangioma is a rapidly involuting congenital hemangioma (RICH), a partially involuting congenital hemangioma (PICH), or a non-involuting congenital hemangioma (NICH). 141. A nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129 for use in a method for treating cancer in a patient in need of such treatment, the method comprising administering to the patient a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 142. A nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129 for use in a method for treating melanoma in a patient in need of such treatment, the method comprising administering to the patient the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 143. An expression construct comprising a nucleic acid molecule encoding a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 144. An isolated nucleic acid molecule encoding a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129. 145. A vector comprising the isolated nucleic acid molecule described in embodiment 144. 146. The vector described in embodiment 144, which is a viral vector, a retroviral vector, an expression cassette, or a plasmid. 147. The vector described in embodiment 144 or 145, further comprising an RNA polymerase III or RNA polymerase II promoter. 148. The vector described in embodiment 147, wherein the RNA polymerase III promoter is a U6 or H1 promoter. 149. A host cell comprising a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 1 to 129, an isolated nucleic acid molecule described in embodiment 144, or a vector described in any one of embodiments 145 to 148. 150. The host cell of embodiment 149, which is a mammalian host cell. 151. A host cell described in embodiment 149 or 150, which is a human host cell. 152. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system according to any one of embodiments 130 to 142, wherein the nucleic acid molecule, compound, composition, or prodrug is formulated for delivery by lipid-based nanoparticles, liposomes, exosomes, polymeric nanoparticles, inorganic nanoparticles, or co-delivery polyelectrolyte nanocomplexes (RTNPs) of ruxolitinib and thalidomide. 153. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, described in any one of embodiments 130 to 142, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is not packaged for delivery (gymnotic delivery). 154. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, described in any one of embodiments 130 to 142 or 254 to 257, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is administered by injection. 155. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, described in any one of embodiments 130 to 142 or 254 to 258, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is injected using a microneedle. 156. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, described in any one of embodiments 130 to 142 or 254 to 260, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is administered locally. 157. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, according to any one of embodiments 130-142 or 254-262, wherein administration further comprises electroporation or ultrasound. 158. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system described in any one of embodiments 130 to 142 or 254 to 262, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is conjugated to docosanoic acid (DCA). 159. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, described in any one of embodiments 130 to 142 or 254 to 262, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is not packaged for delivery (gymnotic delivery). 160. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, described in any one of embodiments 130 to 142 or 254 to 262, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is administered by injection. 161. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, described in any one of embodiments 130 to 142 or 254 to 262, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is injected using a microneedle. 162. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, according to any one of embodiments 130-142 or 254-262, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is formulated for delivery by lipid-based nanoparticles and injected using a microneedle. 163. A method for use, or a nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system, described in any one of embodiments 130 to 142 or 254 to 262, wherein the nucleic acid molecule, compound, composition, prodrug, or CRISPR nuclease system is conjugated to docosanoic acid (DCA) and injected using a microneedle. 164. A double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15-30 linked nucleosides and an antisense strand consisting of 15-30 linked nucleosides, wherein the antisense strand comprises a sequence that is fully complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and / or mRNA encoding a gain-of-function variant of GNAQ or a gain-of-function variant of GNA11, and the sense strand is at least partially complementary to the antisense strand. 165. A double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15-30 linked nucleosides and an antisense strand consisting of 15-30 linked nucleosides, wherein the antisense strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an equal length portion of a pregenomic RNA and / or mRNA encoding a variant GNAQ or variant GNA11, and the sense strand is at least partially complementary to the antisense strand. 166. A double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15 to 30 linked nucleosides and an antisense strand consisting of 15 to 30 linked nucleosides, wherein the antisense strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an equal length portion of pregenomic RNA and / or mRNA encoding variant GNAQ p.(R183Q) or variant GNA11 p.(R183C), and the sense strand is at least partially complementary to the antisense strand. 167. A double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15-30 linked nucleosides and an antisense strand consisting of 15-30 linked nucleosides, wherein the antisense strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isometric portion of a pregenomic RNA and / or mRNA encoding variant GNAQ p.(R183Q), and the sense strand is at least partially complementary to the antisense strand. 168. A double-stranded ribonucleic acid molecule comprising a sense strand consisting of 15-30 linked nucleosides and an antisense strand consisting of 15-30 linked nucleosides, wherein the antisense strand comprises a sequence that is completely complementary to a sequence having at least 90% identity to an equal length portion of pregenomic RNA and / or mRNA encoding variant GNA11 p.(R183C), and the sense strand is at least partially complementary to the antisense strand. 169. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand consists of 15-20 linked nucleosides. 170. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand consists of 15-25 linked nucleosides. 171. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand consists of 20-30 linked nucleosides. 172. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand consists of 20-25 linked nucleosides. 173. A double-stranded ribonucleic acid molecule according to any one of embodiments 164 to 170, wherein the antisense strand consists of 19 linked nucleosides. 174. The double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein the first strand comprises a sequence that is fully complementary to a sequence having at least 95% identity to an equal length portion of the pregenomic RNA and / or mRNA encoding the variant GNAQ p.(R183Q) or GNA11 p.(R183C). 175. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand comprises a sequence that is fully complementary to a sequence having 100% identity with an equal length portion of the pregenomic RNA and / or mRNA encoding the variant GNAQ p.(R183Q) or GNA11 p.(R183C). 176. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand is at least 80% complementary to the antisense strand. 177. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand is at least 90% complementary to the antisense strand. 178. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand is at least 95% complementary to the antisense strand. 179. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand is perfectly complementary to the antisense strand. 180. The double-stranded ribonucleic acid molecule according to any preceding embodiment, wherein the compound is capable of inhibiting expression of variant GNAQ p.(R183Q) or GNA11 p.(R183C) in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or preferably at least 90%. 181. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the compound is capable of partially or fully relieving aberrant calcium signaling in cells expressing variant GNAQ p.(R183Q) or GNA11 p.(R183C). 182. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the GNAQ R183Q variant is caused by a c.G548A mutation in the GNAQ genomic sequence. 183. The double-stranded ribonucleic acid molecule of embodiment 182, wherein the antisense strand comprises a sequence that is perfectly complementary to the c.G548A mutation. 184. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the GNA11 R183C variant is caused by a c.C547T mutation in the GNA11 genomic sequence. 185. The double-stranded ribonucleic acid molecule of embodiment 184, wherein the antisense strand comprises a sequence that is perfectly complementary to the c.C547T mutation. 186. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand is longer than the sense strand. 187. The double-stranded ribonucleic acid molecule of any preceding embodiment, having an overhang at the 3' end of the antisense strand of 1, 2, 3, 4, 5 or more nucleosides. 188. The double-stranded ribonucleic acid molecule of any preceding embodiment, having an overhang at the 3' end of the antisense strand of two nucleosides. 189. The double-stranded ribonucleic acid molecule of any preceding embodiment, having an overhang at the 5' end of the antisense strand of 1, 2, 3, 4, 5 or more nucleosides. 190. The double-stranded ribonucleic acid molecule of any preceding embodiment, having an overhang at the 5' end of the antisense strand of two nucleosides. 191. A double-stranded ribonucleic acid molecule according to any one of embodiments 164 to 180, wherein the sense strand is longer than the antisense strand. 192. The double-stranded ribonucleic acid molecule of embodiment 191, having an overhang at the 3' end of the sense strand of 1, 2, 3, 4, 5 or more nucleosides. 193. The double-stranded ribonucleic acid molecule according to embodiment 191 or 192, having an overhang at the 3' end of the sense strand of two nucleosides. 194. A double-stranded ribonucleic acid molecule according to any one of embodiments 191 to 193, having an overhang at the 5' end of the sense strand of 1, 2, 3, 4, 5 or more nucleosides. 195. A double-stranded ribonucleic acid molecule according to any one of embodiments 191 to 194, having an overhang at the 5' end of the sense strand of two nucleosides. 196. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC), SEQ ID NO:2 (GCUUAGAGUUCAAGUCCCC), SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA), SEQ ID NO:4 (UUAGAGUUCAAGUCCCCAC), SEQ ID NO:5 (UAGAGUUCAAGUCCCCACC), SEQ ID NO:6 (AGAGUUCAAGUCCCCACCA), SEQ ID NO:7 (GUGCUGCGGGUCUGCGUGC), SEQ ID NO:8 (UGCUGCGGGUCUGCGUGCC), SEQ ID NO:9 (GCUGCGGGUCUGCGUGCCC), SEQ ID NO:10 (CUGCGGGUCUGCGUGCCCA), SEQ ID NO:11 (UGCGGGUCUGCGUGCCCAC), or SEQ ID NO:12 (CGGGUCUGCGUGCCCACCA). 197. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC) or SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA). 198. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand comprises a nucleobase sequence comprising SEQ ID NO: 10 (CUGCGGGUCUGCGUGCCCA). 199. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand consists of a nucleobase sequence having any one of SEQ ID NO:1 (UGCUUAGAGUUCAAGUCCC), SEQ ID NO:2 (GCUUAGAGUUCAAGUCCCC), SEQ ID NO:3 (CUUAGAGUUCAAGUCCCCA), SEQ ID NO:4 (UUAGAGUUCAAGUCCCCAC), SEQ ID NO:5 (UAGAGUUCAAGUCCCCACC), SEQ ID NO:6 (AGAGUUCAAGUCCCCACCA), SEQ ID NO:7 (GUGCUGCGGGUCUGCGUGC), SEQ ID NO:8 (UGCUGCGGGUCUGCGUGCC), SEQ ID NO:9 (GCUGCGGGUCUGCGUGCCC), SEQ ID NO:10 (CUGCGGGUCUGCGUGCCCA), SEQ ID NO:11 (UGCGGGUCUGCGUGCCCAC), or SEQ ID NO:12 (CGGGUCUGCGUGCCCACCA). 200. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand consists of a nucleobase sequence having any one of SEQ ID NO: 1 (UGCUUAGAGUUCAAGUCCC) or SEQ ID NO: 3 (CUUAGAGUUCAAGUCCCCA). 201. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand consists of the nucleobase sequence having SEQ ID NO: 10 (CUGCGGGUCUGCGUGCCCA). 202. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand comprises a nucleobase sequence comprising any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA), SEQ ID NO:14 (GGGGACUUGAACUCUAAGC), SEQ ID NO:15 (UGGGGACUUGAACUCUAAG), SEQ ID NO:16 (GUGGGGACUUGAACUCUAA), SEQ ID NO:17 (GGUGGGGACUUGAACUCUA), SEQ ID NO:18 (UGGUGGGGACUUGAACUCU), SEQ ID NO:19 (GCACGCAGACCCGCAGCAC), SEQ ID NO:20 (GGCACGCAGACCCGCAGCA), SEQ ID NO:21 (GGGCACGCAGACCCGCAGC), SEQ ID NO:22 (UGGGCACGCAGACCCGCAG), SEQ ID NO:23 (GUGGGCACGCAGACCCGCA), SEQ ID NO:24 (UGGUGGGCACGCAGACCCG). 203. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand comprises a nucleobase sequence comprising any one of SEQ ID NO: 13 (GGGACUUGAACUCUAAGCA) or SEQ ID NO: 15 (UGGGGACUUGAACUCUAAG). 204. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand comprises a nucleobase sequence comprising SEQ ID NO: 22 (UGGGCACGCAGACCCGCAG). 205. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand consists of a nucleobase sequence having any one of SEQ ID NO:13 (GGGACUUGAACUCUAAGCA), SEQ ID NO:14 (GGGGACUUGAACUCUAAGC), SEQ ID NO:15 (UGGGGACUUGAACUCUAAG), SEQ ID NO:16 (GUGGGGACUUGAACUCUAA), SEQ ID NO:17 (GGUGGGGACUUGAACUCUA), SEQ ID NO:18 (UGGUGGGGACUUGAACUCU), SEQ ID NO:19 (GCACGCAGACCCGCAGCAC), SEQ ID NO:20 (GGCACGCAGACCCGCAGCA), SEQ ID NO:21 (GGGCACGCAGACCCGCAGC), SEQ ID NO:22 (UGGGCACGCAGACCCGCAG), SEQ ID NO:23 (GUGGGCACGCAGACCCGCA), SEQ ID NO:24 (UGGUGGGCACGCAGACCCGCG). 206. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand consists of a nucleobase sequence having any one of SEQ ID NO: 13 (GGGACUUGAACUCUAAGCA) or SEQ ID NO: 15 (UGGGGACUUGAACUCUAAG). 207. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the antisense strand consists of the nucleobase sequence having SEQ ID NO: 22 (UGGGCACGCAGACCCGCAG). 208. a. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:13; or b. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:2 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:14; or c. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:15; or d. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:4 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:16; or e. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:5 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:17; or f. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:6 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:18; or g. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:7 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:19; or h. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:8 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:20; or i. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:9 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:21; or j. the sense strand comprises a nucleobase sequence comprising SEQ ID NO: 10 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO: 22; or k. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:11 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:23; or l. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand comprises a nucleobase sequence comprising SEQ ID NO:12 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:24. 209. a. the sense strand comprises a nucleobase sequence comprising SEQ ID NO:1 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:13; or b. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand comprises a nucleobase sequence comprising SEQ ID NO:3 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO:15. 210. a. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand comprises a nucleobase sequence comprising SEQ ID NO: 10 and the antisense strand comprises a nucleobase sequence comprising SEQ ID NO: 22. 211. a. the sense strand comprises the nucleobase sequence of SEQ ID NO:1 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:13; or b. the sense strand comprises the nucleobase sequence of SEQ ID NO:2 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:14; or c. the sense strand comprises the nucleobase sequence of SEQ ID NO:3 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:15; or d. the sense strand comprises the nucleobase sequence of SEQ ID NO:4 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:16; or e. the sense strand comprises the nucleobase sequence of SEQ ID NO:5 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:17; or f. the sense strand comprises the nucleobase sequence of SEQ ID NO:6 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:18; or g. the sense strand comprises the nucleobase sequence of SEQ ID NO:7 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:19; or h. the sense strand comprises the nucleobase sequence of SEQ ID NO:8 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:20; or i. the sense strand comprises the nucleobase sequence of SEQ ID NO:9 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:21; or j. the sense strand comprises the nucleobase sequence of SEQ ID NO: 10 and the antisense strand comprises the nucleobase sequence of SEQ ID NO: 22; or k. the sense strand comprises the nucleobase sequence of SEQ ID NO:11 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:23; or l. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand comprises the nucleobase sequence of SEQ ID NO:12 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:24. 212. a. the sense strand comprises the nucleobase sequence of SEQ ID NO:1 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:13; or b. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand comprises the nucleobase sequence of SEQ ID NO:3 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:15. 213. a. The double-stranded ribonucleic acid molecule of any preceding embodiment, wherein the sense strand comprises the nucleobase sequence of SEQ ID NO:10 and the antisense strand comprises the nucleobase sequence of SEQ ID NO:22. 214. A compound comprising a double-stranded ribonucleic acid molecule according to any preceding embodiment and a conjugate group. 215. The compound of embodiment 214, wherein the conjugate group comprises one or more carbohydrates. 216. The conjugate group is a monosaccharide, a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, a polysaccharide, a modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L-mannopyranose, D-arabinose, L-galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, aD-mannofuranose, β-D-mannofuranose, α- ... Mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, α-D-galactosamine, N-acetylgalactosamine amine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycoloyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2,3,4-trimethyl-D-glucopyranose The compound according to embodiment 214 or 215, comprising -O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-aD-gluco-heptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose. 217. The compound of any one of embodiments 214-216, wherein the conjugate group is linked to the 3'-end of the sense strand. 218. The compound of any one of embodiments 214-216, wherein the conjugate group is linked to the 5'-end of the sense strand. 219. The compound of any one of embodiments 214-216, wherein the conjugate group is linked to the 5'-end of the antisense strand. 220. The compound of any one of embodiments 214-216, wherein the conjugate group is linked to the 3'-end of the antisense strand. 221. The double-stranded ribonucleic acid molecule or compound of any preceding embodiment, wherein at least one nucleoside comprises a modified sugar. 222. The double-stranded ribonucleic acid molecule or compound according to any preceding embodiment, wherein at least one internucleoside linkage is a modified internucleoside linkage. 223. The double-stranded ribonucleic acid molecule or compound according to embodiment 222, wherein the modified internucleoside linkage is a phosphorothioate or phosphorodithioate internucleoside linkage. 224. The double-stranded ribonucleic acid molecule or compound according to embodiment 222 or 223, comprising 1 to 15 phosphorothioate or phosphorodithioate internucleoside linkages. 225. A composition comprising a double-stranded ribonucleic acid molecule or compound or a salt thereof according to any preceding embodiment, and at least one of a pharma- ceutically acceptable carrier or diluent. 226. A prodrug comprising a double-stranded ribonucleic acid molecule or compound described in any one of embodiments 1 to 224. 227. A method of treating a patient having a disease or disorder associated with or driven by a variant in GNAQ and / or GNA11, comprising administering to the patient a compound or composition that specifically targets a variant GNAQ and / or GNA11 allele. 228. A method for treating a patient having a disease or disorder associated with or driven by a variant in GNAQ and / or GNA11, comprising administering to the patient a double-stranded ribonucleic acid molecule or compound described in any one of embodiments 1 to 224, a composition described in embodiment 225, or a prodrug described in embodiment 226. 229. A method for treating a patient having Sturge-Weber syndrome (SWS), pigmented vascular nevus (PPV), or extensive cutaneous melanosis (EDM), comprising administering to the patient a double-stranded ribonucleic acid molecule or compound described in any one of embodiments 1 to 224, a composition described in embodiment 225, or a prodrug described in embodiment 226. 230. A method for treating a patient having cancer, comprising administering to the patient a double-stranded ribonucleic acid molecule or compound described in any one of embodiments 1 to 224, a composition described in embodiment 225, or a prodrug described in embodiment 226. 231. The method of embodiment 230, wherein the cancer is selected from the list consisting of adrenal gland cancer, autonomic ganglion cancer, biliary tract cancer, bone cancer, breast cancer, central nervous system cancer, cervical cancer, endometrial cancer, eye cancer, fallopian tube cancer, female genital tract cancer, gastrointestinal tract cancer, reproductive tract cancer, hematopoietic cancer, lymphatic system cancer, kidney cancer, colon cancer, liver cancer, lung cancer, meningeal cancer, NS cancer, esophageal cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, perineal cancer, peritoneal cancer, pituitary cancer, placental cancer, pleural cancer, prostate cancer, salivary gland cancer, skin cancer, small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thymic cancer, thyroid cancer, upper aerodigestive tract cancer, urinary tract cancer, uterine adnexal cancer, vaginal cancer, and vulvar cancer. 232. A method for treating a patient having melanoma, comprising administering to the patient a double-stranded ribonucleic acid molecule or compound described in any one of embodiments 1 to 224, a composition described in embodiment 225, or a prodrug described in embodiment 226. 233. A double-stranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224, a composition according to embodiment 225, or a prodrug according to embodiment 226, for use as a medicament. 234. A double-stranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224, a composition according to embodiment 225, or a prodrug according to embodiment 226 for use in a method for treating Sturge-Weber syndrome (SWS), pigmented vascular nevus (PPV), or extensive cutaneous melanosis (EDM) in a patient in need of such treatment, the method comprising administering to a patient the compound according to any one of embodiments 1 to 224, the composition according to embodiment 225, or the prodrug according to embodiment 226. 235. A double-stranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224, a composition according to embodiment 225, or a prodrug according to embodiment 226 for use in a method for treating cancer in a patient in need of such treatment, the method comprising administering to a patient the compound according to any one of embodiments 1 to 224, the composition according to embodiment 225, or the prodrug according to embodiment 226. 236. A double-stranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224, a composition according to embodiment 225, or a prodrug according to embodiment 226 for use in a method for treating melanoma in a patient in need of such treatment, the method comprising administering to a patient the compound according to any one of embodiments 1 to 224, the composition according to embodiment 225, or the prodrug according to embodiment 226. 237. A method of treating a patient having Sturge-Weber syndrome (SWS), pigmented vascular phakomatosis (PPV), or extensive cutaneous melanosis (EDM), comprising administering to the patient a compound or composition that specifically targets variant alleles of GNAQ and / or GNA11. 238. A method of treating a patient having cancer, comprising administering to the patient a compound or composition that specifically targets a variant allele of GNAQ and / or GNA11. 239. A method of treating a patient having melanoma, comprising administering to the patient a compound or composition that specifically targets a variant allele of GNAQ and / or GNA11. 240. The method of embodiment 239, wherein the melanoma is uveal melanoma, cutaneous melanoma, or meningeal malignancy. 241. The method of any one of embodiments 237 to 239, wherein the variant allele of GNAQ contains a mutation that causes an R183Q substitution. 242. The method of any one of embodiments 237 to 239, wherein the variant allele of GNA11 contains a mutation that causes an R183C substitution. 243. The method of any one of embodiments 237 to 242, wherein the compound or composition specifically targeting a variant allele of GNAQ and / or GNA11 is capable of inhibiting expression of variant GNAQ or variant GNA11 in vitro by at least 50%, at least 60%, at least 70%, at least 80%, or preferably at least 90%. 244. A method according to any one of embodiments 237 to 243, wherein a compound or composition that specifically targets a variant allele of GNAQ and / or GNA11 can partially or completely rescue aberrant calcium signaling in cells expressing variant GNAQ or variant GNA11. 245. An expression construct comprising a nucleic acid molecule encoding a double-stranded ribonucleic acid molecule or a compound according to any one of embodiments 1 to 224. 246. An isolated nucleic acid molecule encoding a double-stranded ribonucleic acid molecule or compound according to any one of embodiments 1 to 224. 247. A vector comprising the isolated nucleic acid molecule described in embodiment 246. 248. The vector described in embodiment 247, which is a viral vector, a retroviral vector, an expression cassette, or a plasmid. 249. The vector of embodiment 247 or 248, further comprising an RNA polymerase III or RNA polymerase II promoter. 250. The vector of embodiment 249, wherein the RNA polymerase III promoter is a U6 or H1 promoter. 251. A host cell comprising a double-stranded ribonucleic acid molecule or compound described in any one of embodiments 1 to 224, an isolated nucleic acid molecule described in embodiment 246, or a vector described in any one of embodiments 247 to 250. 252. The host cell of embodiment 251, which is a mammalian host cell. 253. The host cell of embodiment 251 or 252, which is a human host cell. 254. A method, or a double-stranded nucleic acid molecule, compound, composition, or prodrug for use according to any one of embodiments 164 to 244, wherein the double-stranded nucleic acid molecule, compound, composition, or prodrug is formulated for delivery by lipid-based nanoparticles, liposomes, exosomes, polymeric nanoparticles, inorganic nanoparticles, or co-delivery polyelectrolyte nanocomplexes (RTNPs) of ruxolitinib and thalidomide. 255. A method, or a double-stranded nucleic acid molecule, compound, composition, or prodrug, for use according to any one of embodiments 164 to 244, wherein the double-stranded nucleic acid molecule, compound, composition, or prodrug is formulated for delivery by lipid-based nanoparticles. 256. A method, or a double-stranded nucleic acid molecule, compound, composition, or prodrug, for use according to any one of embodiments 164 to 244, wherein the double-stranded nucleic acid molecule, compound, composition, or prodrug is conjugated to docosanoic acid (DCA). 257. A method or a double-stranded nucleic acid molecule, compound, composition, or prodrug for use according to any one of embodiments 164 to 244, wherein the double-stranded nucleic acid molecule, compound, composition, or prodrug is not packaged for delivery (gymnotic delivery). 258. A method, or a double-stranded nucleic acid molecule, compound, composition, or prodrug for use according to any one of embodiments 164 to 244 or 254 to 257, wherein the double-stranded nucleic acid molecule, compound, composition, or prodrug is administered by injection. 259. A method or a double-stranded nucleic acid molecule, compound, composition, or prodrug for use according to any one of embodiments 164 to 244 or 254 to 258, wherein the double-stranded nucleic acid molecule, compound, composition, or prodrug is injected using a microneedle. 260. A method, or a double-stranded nucleic acid molecule, compound, composition, or prodrug for use according to any one of embodiments 164 to 244 or 254 to 259, wherein the double-stranded nucleic acid molecule, compound, composition, or prodrug is formulated for delivery by lipid-based nanoparticles and injected using a microneedle. 261. A method, or a double-stranded nucleic acid molecule, compound, composition, or prodrug for use according to any one of embodiments 164 to 244 or 254 to 260, wherein the double-stranded nucleic acid molecule, compound, composition, or prodrug is conjugated to docosanoic acid (DCA) and injected using a microneedle. 262. A method, or a double-stranded nucleic acid molecule, compound, composition, or prodrug for use according to any one of embodiments 164 to 244 or 254 to 261, wherein the nucleic acid molecule, compound, composition, or prodrug is administered locally. 263. A method, or a double-stranded nucleic acid molecule, compound, composition, or prodrug for use according to any one of embodiments 164-244 or 254-262, wherein the administration further comprises electroporation or ultrasound.

[0295] References [1] Hasegawa Y, Yasuhara, M. A variant of phakomatosis pigmentovascularis. Skin Research 1979;21:178-86. [2] Happle R. Phacomatosis pigmentovascularis revisited and reclassified. Archives of dermatology 2005;141:385-8. [3] Comi AM. Sturge-Weber syndrome and epilepsy: an argument for aggressive seizure management in these patients. Expert Rev Neurother 2007;7:951-6. [4] Shirley MD, Tang H, Gallione CJ, et al.Sturge-Weber syndrome and port-wine stains caused by somatic mutation in GNAQ. N Engl J Med 2013;368:1971-9. [5] Thomas AC, Zeng Z, Riviere JB, et al.Mosaic Activating Mutations in GNA11 and GNAQ Are Associated with Phakomatosis Pigmentovascularis and Extensive Dermal Melanocytosis. The Journal of investigative dermatology 2016;136(4):770-8. [6] Jordan M, Carmignac V, Sorlin A, et al.Reverse Phenotyping in Patients with Skin Capillary Malformations and Mosaic GNAQ or GNA11 Mutations Defines a Clinical Spectrum with Genotype-Phenotype Correlation. The Journal of investigative dermatology 2020;140:1106-10 e2. [7] Polubothu S, Al-Olabi L, Carmen Del Boente M, et al.GNA11 Mutation as a Cause of Sturge-Weber Syndrome: Expansion of the Phenotypic Spectrum of Galpha / 11 Mosaicism and the Associated Clinical Diagnoses. The Journal of investigative dermatology 2020;140:1110-3. [8] Huang L, Couto JA, Pinto A, et al.Somatic GNAQ Mutation is Enriched in Brain Endothelial Cells in Sturge-Weber Syndrome. Pediatr Neurol 2017;67:59-63. [9] Waelchli R, Aylett SE, Robinson K, Chong WK, Martinez AE, Kinsler VA. New vascular classification of port-wine stains: improving prediction of Sturge-Weber risk. Br J Dermatol 2014;171:861-7.

[10] Ayturk UM, Couto JA, Hann S, et al.Somatic Activating Mutations in GNAQ and GNA11 Are Associated with Congenital Hemangioma. American journal of human genetics 2016;98:789-95.

[11] Lim YH, Bacchiocchi A, Qiu J, et al.GNA14 Somatic Mutation Causes Congenital and Sporadic Vascular Tumors by MAPK Activation. American journal of human genetics 2016;99:443-50.

[12] Forbes SA, Beare D, Gunasekaran P, et al.COSMIC: exploring the world’s knowledge of somatic mutations in human cancer. Nucleic acids research 2015;43:D805-11.

[13] Zhou J, Azizan EAB, Cabrera CP, et al.Somatic mutations of GNA11 and GNAQ in CTNNB1-mutant aldosterone-producing adenomas presenting in puberty, pregnancy or menopause. Nature genetics 2021;53:1360-72.

[14] Nesbit MA, Hannan FM, Howles SA, et al.Mutations affecting G-protein subunit alpha11 in hypercalcemia and hypocalcemia. The New England journal of medicine 2013;368:2476-86.

[15] Wettschureck N, Lee E, Libutti SK, Offermanns S, Robey PG, Spiegel AM. Parathyroid-specific double knockout of Gq and G11 alpha-subunits leads to a phenotype resembling germline knockout of the extracellular Ca2+ -sensing receptor. Mol Endocrinol 2007;21:274-80.

[16] Nesbit MA, Hannan FM, Howles SA, et al.Mutations affecting G-protein subunit alpha11 in hypercalcemia and hypocalcemia. N Engl J Med 2013;368:2476-86.

[17] Fjaer R, Marciniak K, Sundnes O, et al.A novel somatic mutation in GNB2 provides new insights to the pathogenesis of Sturge-Weber syndrome. Human molecular genetics 2021;30:1919-31.

[18] Gorvin CM, Hannan FM, Howles SA, et al.Galpha11 mutation in mice causes hypocalcemia rectifiable by calcilytic therapy. JCI Insight 2017;2:e91103.

[19] Weber FP. Right-sided hemi-hypotrophy resulting from right-sided congenital spastic hemiplegia, with a morbid condition of the left side of the brain, revealed by radiograms. J Neurol Psychopathol 1922;3:134-9.

[20] Michell RH. Inositol phospholipids and cell surface receptor function. Biochim Biophys Acta 1975;415:81-47.

[21] Michell RH, Kirk CJ, Jones LM, Downes CP, Creba JA. The stimulation of inositol lipid metabolism that accompanies calcium mobilization in stimulated cells: defined characteristics and unanswered questions. Philos Trans R Soc Lond B Biol Sci 1981;296:123-38.

[22] Hart, Multifunctional nanocomplexes for gene transfer and gene therapy. Cell Biol Toxicol.2010 Feb;26(1):69-81. doi:10.1007 / s10565-009-9141-y. Epub 2010 Feb 3.

[23] Jung Hyeon Cho, Jeong Yi Kang, Seulgi Kim, Hwi Ra Baek, Junoh Kim, Kwang-Suk Jang, Jin Woong Kim. Skin protein-derived peptide-conjugated vesicular nanocargos for selected skin cell targeting and consequent activation. J Mater Chem B.2021 Jun 23;9(24):4956-4962. doi:10.1039 / d1tb00935d

[24] Qi Tang, Jacquelyn Sousa, Dimas Echeverria, Xueli Fan, Ying-Chao Hsueh, Khashayar Afshari, Nicholas MeHugh, David A. Cooper, Lorenc Vangjeli, Kathryn Monopoli, Ken Okamura, Annabelle Biscans, Adam Clauss, John E. Harris, Anastasia Khvorova, RNAi-based modulation of IFN-γ signaling in skin, Molecular Therapy, Volume 30, Issue 8, 2022, Pages 2709-2721.

[25] Day AM, Hammill AM, Juhasz C, et al.Hypothesis: Presymptomatic treatment of Sturge-Weber Syndrome With Aspirin and Antiepileptic Drugs May Delay Seizure Onset. Pediatric neurology 2019;90:8-12.

[26] Guseo A. Ultrastructure of calcification in Sturge-Weber Disease. Virchows Arch A Pathol Anat Histol 1975;366:353-6.

[27] Di Trapani G, Di Rocco C, Abbamondi AL, Caldarelli M, Pocchiari M. Light microscopy and ultrastructural studies of Sturge-Weber disease. Childs Brain 1982;9:23-36.

[28] Lin DD, Barker PB, Hatfield LA, Comi AM. Dynamic MR perfusion and proton MR spectroscopic imaging in Sturge-Weber syndrome: correlation with neurological symptoms. J Magn Reson Imaging 2006;24:274-81.

[29] Kelley TM, Hatfield LA, Lin DD, Comi AM. Quantitative analysis of cerebral cortical atrophy and correlation with clinical severity in unilateral Sturge-Weber syndrome. J Child Neurol 2005;20:867-70.

[30] Pilli VK, Behen ME, Hu J, et al.Clinical and metabolic correlates of cerebral calcifications in Sturge-Weber syndrome. Developmental medicine and child neurology 2017;59:952-8.

[31] Waelchli R, Williams J, Cole T, et al.Growth and hormone profiling in children with congenital melanocytic naevi. The British journal of dermatology 2015;173:1471-8.

[32] Cooper MS, Gittoes NJ. Diagnosis and management of hypocalcaemia. BMJ 2008;336:1298-302.

[33] Gerasimenko JV, Gryshchenko O, Ferdek PE, et al.Ca2+ release-activated Ca2+ channel blockade as a potential tool in antipancreatitis therapy. Proc Natl Acad Sci U S A 2013;110:13186-91.

[34] Kinsler VA, Boccara O, Fraitag S, Torrelo A, Vabres P, Diociauti A. Mosaic abnormalities of the skin - review and guidelines from the European Reference Network for rare skin diseases (ERN-Skin). The British journal of dermatology 2019.

[35] Happle R. Lethal genes surviving by mosaicism: a possible explanation for sporadic birth defects involving the skin. Journal of the American Academy of Dermatology 1987;16:899-906.

[36] Schrage R, Schmitz AL, Gaffal E, et al.The experimental power of FR900359 to study Gq-regulated biological processes. Nat Commun 2015;6:10156.

[37] Korhonen H, Fisslthaler B, Moers A, et al.Anaphylactic shock depends on endothelial Gq / G11. J Exp Med 2009;206:411-20.

[38] I. Arnaoutova, H. K. Kleinman, In vitro angiogenesis: endothelial cell tube formation on gelled basement membrane extract. Nat Protoc 5, 628-635 (2010).

Claims

1. A nucleic acid molecule comprising a first chain of 10 to 50 linked nucleosides, wherein the first chain contains a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding GNAQ or GNA11.

2. The nucleic acid molecule according to claim 1, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a gain-of-function variant of GNAQ.

3. The nucleic acid molecule according to claim 1, wherein the first strand comprises a sequence that is completely complementary to a sequence having at least 90% identity with an isolength portion of mRNA encoding a gain-of-function variant of GNA11.

4. The nucleic acid molecule according to any one of claims 1 to 3, wherein the first chain consists of 20 to 25 linked nucleosides, and optionally the first chain consists of 21 linked nucleosides.

5. (i) The first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding a variant GNAQ p. (R183Q), p. (R183G), p. (R183L), or p. (R183*), (ii) The nucleic acid molecule can inhibit the expression of variant GNAQ p. (R183Q / G / L / *) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. (iii) The nucleic acid molecule inhibits the expression of variant GNAQ p. (R183Q / G / L / *) in vitro to a greater extent than the inhibition of wild-type GNAQ expression in vitro, and / or (iv) The variant GNAQ p. (R183Q) is caused by the c. G548A mutation in the GNAQ genome sequence, Optionally, the first strand includes a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of sequence numbers 13 to 18. The nucleic acid molecule according to claim 1 or 2.

6. (i) The first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding a variant GNAQ p. (R183Q), p. (R183G), p. (R183L), or p. (R183*), (ii) The nucleic acid molecule can inhibit the expression of variant GNAQ p. (R183Q / G / L / *) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. (iii) The nucleic acid molecule inhibits the expression of variant GNAQ p. (R183Q / G / L / *) in vitro to a greater extent than the inhibition of wild-type GNAQ expression in vitro, and / or (iv) The variant GNAQ p. (R183Q) is caused by the c. G548A mutation in the GNAQ genome sequence, Optionally, the first strand includes a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of sequence numbers 13 to 18. The nucleic acid molecule according to claim 4.

7. (i) The first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding variant GNA11 p. (R183C) or p. (R183H), (ii) The nucleic acid molecule can inhibit the expression of variant GNA11 p. (R183C / H) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. (iii) The nucleic acid molecule inhibits the expression of variant GNA11 p. (R183C / H) in vitro to a greater extent than the inhibition of wild-type GNA11 expression in vitro, and / or (iv) The variant GNA11 p. (R183C) is caused by the c. C547T mutation in the GNA11 genome sequence. Optionally, the first strand includes a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 19 to 24. The nucleic acid molecule according to claim 1 or 3.

8. (i) The first strand comprises a sequence that is completely complementary to a sequence having at least 95% identity with an isolength portion of mRNA encoding variant GNA11 p. (R183C) or p. (R183H), (ii) The nucleic acid molecule can inhibit the expression of variant GNA11 p. (R183C / H) in vitro by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. (iii) The nucleic acid molecule inhibits the expression of variant GNA11 p. (R183C / H) in vitro to a greater extent than the inhibition of wild-type GNA11 expression in vitro, and / or (iv) The variant GNA11 p. (R183C) is caused by the c. C547T mutation in the GNA11 genome sequence. Optionally, the first strand includes a sequence having at least 80%, at least 90%, or at least 95% identity with a sequence selected from the group consisting of SEQ ID NOs: 19 to 24. The nucleic acid molecule according to claim 4.

9. The nucleic acid molecule according to any one of claims 1 to 3, 6, and 8, wherein the nucleic acid molecule is a single-stranded nucleic acid molecule.

10. The nucleic acid molecule according to claim 4, wherein the nucleic acid molecule is a single-stranded nucleic acid molecule.

11. The nucleic acid molecule according to claim 5, wherein the nucleic acid molecule is a single-stranded nucleic acid molecule.

12. The nucleic acid molecule according to claim 7, wherein the nucleic acid molecule is a single-stranded nucleic acid molecule.

13. The nucleic acid molecule is a double-stranded nucleic acid molecule, Optionally, (i) the double-stranded nucleic acid molecule comprises a second chain of 10 to 50 linked nucleosides, wherein the second chain is at least partially complementary to the first chain. (ii) The second chain is at least 95% complementary to the first chain, (iii) Having overhangs at both the 5' and 3' ends of the first chain of 1, 2, 3, 4, or 5 or more nucleosides, and / or (iv) Having overhangs at both the 5' and 3' ends of the first strand of two nucleosides, optionally, the overhangs comprising two thymine nucleotides (TT), A nucleic acid molecule according to any one of claims 1 to 3, 6, and 8.

14. The nucleic acid molecule is a double-stranded nucleic acid molecule, Optionally, (i) the double-stranded nucleic acid molecule comprises a second chain of 10 to 50 linked nucleosides, wherein the second chain is at least partially complementary to the first chain. (ii) The second chain is at least 95% complementary to the first chain, (iii) Having overhangs at both the 5' and 3' ends of the first chain of 1, 2, 3, 4, or 5 or more nucleosides, and / or (iv) Having overhangs at both the 5' and 3' ends of the first strand of two nucleosides, optionally, the overhangs comprising two thymine nucleotides (TT), The nucleic acid molecule according to claim 4.

15. The nucleic acid molecule is a double-stranded nucleic acid molecule, Optionally, (i) the double-stranded nucleic acid molecule comprises a second chain of 10 to 50 linked nucleosides, wherein the second chain is at least partially complementary to the first chain. (ii) The second chain is at least 95% complementary to the first chain, (iii) Having overhangs at both the 5' and 3' ends of the first chain of 1, 2, 3, 4, or 5 or more nucleosides, and / or (iv) Having overhangs at both the 5' and 3' ends of the first strand of two nucleosides, optionally, the overhangs comprising two thymine nucleotides (TT), The nucleic acid molecule according to claim 5.

16. The nucleic acid molecule is a double-stranded nucleic acid molecule, Optionally, (i) the double-stranded nucleic acid molecule comprises a second chain of 10 to 50 linked nucleosides, wherein the second chain is at least partially complementary to the first chain. (ii) The second chain is at least 95% complementary to the first chain, (iii) Having overhangs at both the 5' and 3' ends of the first chain of 1, 2, 3, 4, or 5 or more nucleosides, and / or (iv) Having overhangs at both the 5' and 3' ends of the first strand of two nucleosides, optionally, the overhangs comprising two thymine nucleotides (TT), The nucleic acid molecule according to claim 7.

17. (i) at least one nucleoside comprises a modified sugar, (ii) At least one nucleoside bond is a modified nucleoside bond, and / or (iii) the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO: 89 (GNAQc.548G>A_p.R183Q), SEQ ID NO: 91 (GNAQc.547C>G_p.R183G), SEQ ID NO: 93 (GNAQc.548G>T_p.R183L), SEQ ID NO: 95 (GNAQc.547C>T_p.R183*), SEQ ID NO: 99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C), and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H). A nucleic acid molecule according to any one of claims 1 to 3, 6, 8, 10 to 12, and 14 to 16.

18. (i) at least one nucleoside comprises a modified sugar, (ii) At least one nucleoside bond is a modified nucleoside bond, and / or (iii) the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO: 89 (GNAQc.548G>A_p.R183Q), SEQ ID NO: 91 (GNAQc.547C>G_p.R183G), SEQ ID NO: 93 (GNAQc.548G>T_p.R183L), SEQ ID NO: 95 (GNAQc.547C>T_p.R183*), SEQ ID NO: 99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C), and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H). The nucleic acid molecule according to claim 4.

19. (i) at least one nucleoside comprises a modified sugar, (ii) At least one nucleoside bond is a modified nucleoside bond, and / or (iii) the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO: 89 (GNAQc.548G>A_p.R183Q), SEQ ID NO: 91 (GNAQc.547C>G_p.R183G), SEQ ID NO: 93 (GNAQc.548G>T_p.R183L), SEQ ID NO: 95 (GNAQc.547C>T_p.R183*), SEQ ID NO: 99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C), and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H). The nucleic acid molecule according to claim 5.

20. (i) at least one nucleoside comprises a modified sugar, (ii) At least one nucleoside bond is a modified nucleoside bond, and / or (iii) the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO: 89 (GNAQc.548G>A_p.R183Q), SEQ ID NO: 91 (GNAQc.547C>G_p.R183G), SEQ ID NO: 93 (GNAQc.548G>T_p.R183L), SEQ ID NO: 95 (GNAQc.547C>T_p.R183*), SEQ ID NO: 99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C), and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H). The nucleic acid molecule according to claim 7.

21. (i) at least one nucleoside comprises a modified sugar, (ii) At least one nucleoside bond is a modified nucleoside bond, and / or (iii) the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO: 89 (GNAQc.548G>A_p.R183Q), SEQ ID NO: 91 (GNAQc.547C>G_p.R183G), SEQ ID NO: 93 (GNAQc.548G>T_p.R183L), SEQ ID NO: 95 (GNAQc.547C>T_p.R183*), SEQ ID NO: 99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C), and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H). The nucleic acid molecule according to claim 9.

22. (i) at least one nucleoside comprises a modified sugar, (ii) At least one nucleoside bond is a modified nucleoside bond, and / or (iii) the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO: 89 (GNAQc.548G>A_p.R183Q), SEQ ID NO: 91 (GNAQc.547C>G_p.R183G), SEQ ID NO: 93 (GNAQc.548G>T_p.R183L), SEQ ID NO: 95 (GNAQc.547C>T_p.R183*), SEQ ID NO: 99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C), and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H). The nucleic acid molecule according to claim 11.

23. (i) at least one nucleoside comprises a modified sugar, (ii) At least one nucleoside bond is a modified nucleoside bond, and / or (iii) the nucleic acid molecule specifically targets a DNA sequence selected from the list consisting of SEQ ID NO: 89 (GNAQc.548G>A_p.R183Q), SEQ ID NO: 91 (GNAQc.547C>G_p.R183G), SEQ ID NO: 93 (GNAQc.548G>T_p.R183L), SEQ ID NO: 95 (GNAQc.547C>T_p.R183*), SEQ ID NO: 99 (GNA11 c.547C>T_p.R183C), SEQ ID NO: 101 (GNA11 c.546_547delinsTT_p.R183C), and SEQ ID NO: 103 (GNA11 c.548G>A_p.R183H). The nucleic acid molecule according to claim 13.

24. comprising a nucleic acid molecule according to any one of claims 1 to 3, 6, 8, 10 to 12, 14 to 16 and 18 to 23, and a targeting moiety, Selectively, the targeting portion comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof, and / or The targeting portion includes a conjugate group, and the conjugate group includes one or more carbohydrates. compound.

25. comprising the nucleic acid molecule described in Claim 4 and a targeting portion, Selectively, the targeting portion comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof, and / or The targeting portion includes a conjugate group, and the conjugate group includes one or more carbohydrates. compound.

26. comprising the nucleic acid molecule according to claim 5 and a targeting portion, Selectively, the targeting portion comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof, and / or The targeting portion includes a conjugate group, and the conjugate group includes one or more carbohydrates. compound.

27. ​​comprising the nucleic acid molecule according to claim 7 and a targeting portion, Selectively, the targeting portion comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof, and / or The targeting portion includes a conjugate group, and the conjugate group includes one or more carbohydrates. compound.

28. comprising the nucleic acid molecule according to claim 9 and a targeting moiety, Selectively, the targeting portion comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof, and / or The targeting portion includes a conjugate group, and the conjugate group includes one or more carbohydrates. compound.

29. comprising the nucleic acid molecule described in claim 13 and a targeting portion, Selectively, the targeting portion comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof, and / or The targeting portion includes a conjugate group, and the conjugate group includes one or more carbohydrates. compound.

30. comprising the nucleic acid molecule described in Claim 17 and a targeting portion, Selectively, the targeting portion comprises lipid nanoparticles, liposomes, exosomes, antibodies or fragments thereof, antigen-binding domains or fragments thereof, peptides, cell-permeable peptides, conjugate groups, or any combination thereof, and / or The targeting portion includes a conjugate group, and the conjugate group includes one or more carbohydrates. compound.

31. A composition comprising a nucleic acid molecule or compound or a salt thereof according to any one of claims 1 to 3, 6, 8, 10 to 12, 14 to 16, 18 to 23 and 25 to 30, and at least one of pharmaceutically acceptable carriers or diluents.

32. A composition comprising a nucleic acid molecule or a salt thereof as described in Claim 4, and at least one of a pharmaceutically acceptable carrier or diluent.

33. A composition comprising a nucleic acid molecule or a salt thereof as described in Claim 5, and at least one of a pharmaceutically acceptable carrier or diluent.

34. A composition comprising a nucleic acid molecule or a salt thereof as described in Claim 7, and at least one of a pharmaceutically acceptable carrier or diluent.

35. A composition comprising a nucleic acid molecule or a salt thereof as described in Claim 9, and at least one of a pharmaceutically acceptable carrier or diluent.

36. A composition comprising a nucleic acid molecule or a salt thereof as described in Claim 13, and at least one of a pharmaceutically acceptable carrier or diluent.

37. A composition comprising a nucleic acid molecule or a salt thereof as described in Claim 17, and at least one of a pharmaceutically acceptable carrier or diluent.

38. A composition comprising the compound or a salt thereof described in Claim 24, and at least one of pharmaceutically acceptable carriers or diluents.

39. A composition according to any one of claims 32 to 38 for treating a patient having a disease or disorder associated with or driven by the overexpression of GNAQ or GNA11.

40. The composition according to claim 31 for treating a patient having a disease or disorder associated with or driven by the overexpression of GNAQ or GNA11.

41. A composition according to any one of claims 32 to 38 for treating a patient having Sturge-Weber syndrome (SWS), pigmented vascular nevus (PPV), or widespread melanosis (EDM).

42. The composition according to claim 31 for treating a patient having Sturge-Weber syndrome (SWS), pigmented vascular nevus (PPV), or widespread melanosis (EDM).