Method for controlling alkaloid content in tobacco

Abstract

The present invention provides a method of modulating the alkaloid content of a plant (e.g., a tobacco plant), the method comprising modifying the plant by modulating the activity or expression of a homeodomain-like Myb domain protein. The present invention also provides plants obtainable according to the present invention, as well as the use of a homeodomain-like Myb domain protein to modulate the alkaloid content of tobacco cells, plants, plant propagation material, harvested leaves, processed tobacco, or tobacco products.

Description

[Technical Field]

[0001] The present invention relates to a method for modulating the alkaloid content of a plant or part thereof, or a cell or cell culture. The present invention also relates to a method for modulating the expression and / or activity of a polypeptide that modulates alkaloid content in a plant. Alternatively, the present invention provides a method for modulating the expression and / or activity of a gene encoding a polypeptide that modulates alkaloid content in a plant. The present invention also relates to constructs that can be used to modulate the polypeptide. The present invention further relates to plant cells and plants modified to achieve modulation of alkaloid content. The present invention also relates to the use of such modulated plants in tobacco industry products, including harvested leaves and combustible smoking articles, processed from such modulated plants. [Background technology]

[0002] Alkaloids are a group of naturally occurring compounds that contain primarily basic nitrogen atoms and are produced by a wide variety of organisms, including bacteria, fungi, plants, and animals.

[0003] Alkaloids can be classified according to the similarity of their carbon skeletons, for example, into indole-like, isoquinoline-like, and pyridine-like. Pyridine derivatives are a class of monomeric alkaloids, including simple derivatives of pyridine, polycyclic fused and non-fused pyridine derivatives, and sesquiterpene pyridine derivatives. Examples include nicotine, nornicotine, pseudooxynicotine, anabasine, myosmine, and anatabine.

[0004] Most of the known biological functions of alkaloids are defense-related. Neuroactive molecules, such as caffeine, cocaine, morphine, and nicotine, act as defensive compounds against invading predators. The accumulation of these alkaloids is the result of signaling cascades that monitor gene expression, enzyme activity, and alkaloid concentrations. Fine-tuning the alkaloid content in plants involves negative feedback loops and degradation pathways.

[0005] Nicotine occurs naturally in several plants but is found at the highest levels in tobacco plants. Cultivated tobacco produces 2-4% of the alkaloid by total dry weight. Nicotine is produced in wild and cultivated Nicotiana species and plays an important role in plant defense against herbivores and insects (Voelckel et al. (2001) Oecologia 127(2): 274-280, incorporated herein by reference). Nicotine accounts for approximately 90% of the total alkaloid content. The remaining 10% of the alkaloid pool is made up of the mostly structurally related compounds nornicotine, anatabine, anabasine, and pseudooxynicotine (PON).

[0006] Regulation of alkaloid content in tobacco is complex. Several factors, including genotype, environment, fertilization, and agricultural practices (e.g., topping), affect alkaloid levels in tobacco plants. Several key regulators of nicotine biosynthesis have been well characterized. For example, putrescine N-methyltransferase (PMT), which plays a pivotal role in this pathway, is activated by members of the ethylene responsive factor (ERF) superfamily, the largest transcription factor family in the tobacco genome (Rushton et al. (2008) Plant Physiol. 147(1): 280-295, incorporated herein by reference).

[0007] Tobacco pyridine alkaloids are precursors of tobacco-specific nitrosamines (TSNAs) formed during post-harvest leaf curing. The four major TSNAs found in cured tobacco leaves are N'-nitrosonornicotine (NNN), N'-nitrosoanatabine (NAT), N'-nitrosoanabasine (NAB), and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK). During post-harvest leaf curing, reactions between pyridine alkaloids and nitrosated species lead to the formation of TSNAs. NNK likely serves as a direct precursor in the synthesis of the TSNA NNK (Bush et al., 2001, incorporated herein by reference). Reducing the production and accumulation of TSNAs is crucial: the CYP82E family of nicotine demethylase genes is one of the major regulators of nicotine conversion to nornicotine, and altering their activity or accumulation can result in reduced NNN levels.

[0008] As described in the Examples, the present inventors sought to investigate genes involved in alkaloid and / or TSNA precursor synthesis in order to regulate alkaloid content in plants, for example, to reduce TSNA content in tobacco. [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] Voelckel et al. (2001) Oecologia 127(2): 274-280 [Non-patent document 2] Rushton et al. (2008) Plant Physiol. 147(1): 280-295 [Non-patent document 3] Bush et al., 2001 Summary of the Invention [Means for solving the problem]

[0010] It has surprisingly been found that modulating the activity or expression of a homeodomain-like, MYB domain protein can modulate the alkaloid content and / or TSNA or TSNA precursor content of a plant. The gene(s) taught herein, such as Nitab4.5_0005842g0010.2, are regulators of alkaloid and TSNA precursor content in cultivated tobacco. In particular, the gene(s) taught herein, such as Nitab4.5_0005842g0010.2, are regulators of alkaloid content in cultivated tobacco. Nitab4.5_0005842g0010.2 encodes a homeodomain-like MYB domain protein according to the present invention. Homologues of Nitab4.5_0005842g0010.2 are provided in Table 1.

[0011] The present invention allows for the production of tobacco industry products with controlled alkaloid content and commercially desirable traits desired by consumers of tobacco industry products. In some instances, consumers may desire products with low levels of alkaloid content. In some instances, consumers may desire products with low levels of TSNA precursors.

[0012] The present invention may be particularly useful in the field of plant molecular agriculture, where plants (such as tobacco and other Nicotiana species) are used for the production of proteins, peptides, and metabolites, e.g., for the production of therapeutics and pharmaceuticals, such as antibiotics, virus-like particles, or neutraceuticals or small molecules. Tobacco has been used for the development of HIV-neutralizing antibodies in an EU-funded project called PharmPlant, and Medicago, Canada, has been working on a tobacco-based platform for the production of virus-like particles for influenza vaccine production.

[0013] Thus, plants according to the invention can be used for molecular farming to reduce or eliminate the presence of nicotinic alkaloids. The use of low-nicotine plants or rootsocks would be beneficial in molecular farming and would reduce downstream processing costs associated with purification.

[0014] The present inventors have surprisingly determined a method for modulating (e.g., decreasing) the alkaloid content of a plant (e.g., a tobacco plant) by modulating (e.g., decreasing) the activity or expression of a homeodomain-like MYB domain protein. The alkaloid content (e.g., the content of one or more of nicotine, nornicotine, PON, anabasine, anatabine, or myosmine, suitably the content of one or more of nicotine, nornicotine, PON, anabasine, or anatabine) of a plant (e.g., a tobacco plant) can be decreased by decreasing the activity or expression of the homeodomain-like MYB domain protein, or increased by increasing the activity or expression of the homeodomain-like MYB domain protein.

[0015] Prior to the present invention, it was not known that modulation of the activity or expression of the homeodomain-like MYB domain proteins described herein could be used to modulate alkaloid content, or to modulate TSNA precursor content, particularly nornicotine, PON, anabasine and / or anatabine content.

[0016] In one aspect, the invention provides a method for modulating (e.g., reducing) the alkaloid content of a tobacco plant or part thereof, or a tobacco plant cell, comprising modifying the plant or plant cell by modulating (e.g., reducing) the activity or expression of a homeodomain-like MYB domain protein.

[0017] In one aspect, the present invention provides a method for modulating (e.g., reducing) the content of tobacco-specific nitrosamines (TSNAs) or precursors of TSNAs in a tobacco plant or plant part thereof, or a tobacco plant cell, comprising modifying the plant or plant cell by modulating (e.g., reducing) the activity or expression of a homeodomain-like MYB domain protein.

[0018] In one aspect, the invention provides a method of producing a plant or part thereof, cell or cell culture, plant propagation material, leaf, cut harvested leaf, treated leaf or cut treated leaf having a modulated (e.g., reduced) alkaloid content, the method comprising modifying the plant or cell culture to decrease the activity or expression of a homeodomain-like MYB domain protein.

[0019] In another aspect, the present invention provides the use of at least one gene encoding a homeodomain-like MYB domain protein for modulating (e.g., reducing) the alkaloid content of a tobacco cell or a tobacco plant or part thereof.

[0020] Suitably, the homeodomain-like MYB domain protein is a) may comprise the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant or functional fragment or orthologue of SEQ ID NO: 3, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3; or b) may be encoded by the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant or functional fragment or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2.

[0021] Suitably, the alkaloid content may be reduced compared to a plant or cell culture that has not been modified to reduce the activity or expression of a homeodomain-like MYB domain protein.

[0022] In one aspect, the invention provides a tobacco plant or part thereof, or a tobacco cell or cell culture that has been modified to reduce the activity or expression of a homeodomain-like MYB domain protein, wherein the tobacco plant or part thereof, or tobacco cell or cell culture has a reduced content of alkaloids and / or TSNA precursors compared to the unmodified plant or unmodified cell or cell culture.

[0023] In one aspect, the present invention provides plant propagation material obtainable (e.g. obtained) from a plant according to the present invention or from a plant or cell or cell culture produced by a method or use according to the present invention.

[0024] Suitably, the alkaloid content of the plant may be reduced compared to a plant or cell culture that has not been modified to modulate the activity or expression of a homeodomain-like MYB domain protein.

[0025] Suitably, the content of one or more alkaloids selected from nicotine, nornicotine, PON, anabasine, myosmine and anatabine may be reduced, and preferably the content of nicotine, nornicotine and / or PON is controlled and reduced.

[0026] Suitably the nicotine content may be reduced.

[0027] In one aspect, the present invention provides the use of a tobacco plant or part thereof, or a tobacco cell or cell culture according to the present invention, or a plant produced by a method according to the present invention, for breeding plants.

[0028] In one aspect, the present invention provides the use of a tobacco plant or part thereof, or a tobacco cell or cell culture according to the present invention, or a plant produced by a method according to the present invention, for the manufacture of a product.

[0029] In one aspect, the present invention provides the use of a tobacco plant or part thereof according to the present invention, or a plant produced by a method according to the present invention, for producing a crop.

[0030] In one aspect, the present invention provides the use of a tobacco plant or part thereof according to the present invention, or a plant produced by a method according to the present invention, for the production of leaves.

[0031] In one aspect, the present invention provides harvested leaves obtainable from a plant according to the invention, or from a plant propagated from propagation material according to the invention, or obtainable from a plant obtained by a use according to the invention, or obtainable from a plant produced by a method according to the invention.

[0032] Suitably, the harvested leaves of the plant may be cut harvested leaves.

[0033] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: obtainable (e.g. obtained) from a plant obtainable from use according to the invention, obtainable (e.g. obtained) by treating plants according to the present invention, obtainable (e.g., obtained) from a plant propagated from plant propagation material according to the invention; or can be obtained (e.g. obtained) by processing harvested leaves of a plant according to the invention, or can be obtained (e.g., obtained) from a plant produced by a method according to the invention Treated leaves, preferably treated tobacco leaves, preferably non-viable treated tobacco leaves, are provided.

[0034] Suitably, the leaves may be treated by drying, fermenting, pasteurising or a combination thereof.

[0035] Suitably, the treated leaves may be cut treated leaves.

[0036] In one aspect, the present invention provides a cured tobacco material made from a plant or part thereof according to the present invention, or harvested leaf according to the present invention, or treated leaf according to the present invention.

[0037] In one aspect, the present invention provides a tobacco blend comprising a dried tobacco material according to the present invention.

[0038] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a tobacco plant or part thereof or a tobacco cell or cell culture according to the present invention; Tobacco plants or parts thereof propagated from tobacco plant propagation material according to the present invention; Harvested leaves of the plant according to the invention; Treated leaves according to the present invention, Tobacco industry products prepared from

[0039] Suitably, the tobacco product may be a combustible smoking article.

[0040] Suitably, the tobacco product may be a smokeless tobacco product.

[0041] Suitably, the tobacco product may be a non-combustible aerosol delivery system, such as a tobacco heating device or an aerosol generating device.

[0042] In one aspect, the present invention provides a combustible smoking article, a non-combustible aerosol delivery system, a smokeless tobacco product, or a tobacco heating device comprising a plant or part thereof or an extract thereof (e.g., a tobacco extract) according to the present invention, or a tobacco cell culture according to the present invention, or a dried tobacco material according to the present invention, or a tobacco blend according to the present invention.

[0043] In one aspect, the present invention provides a method for selecting plants having modulated (e.g., reduced) alkaloid content and / or modulated (e.g., reduced) TSNA or TSNA precursor content, the method comprising the steps of: a) encodes the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant or functional fragment or orthologue of SEQ ID NO: 3, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3; or b) comprising a sequence as set forth in SEQ ID NO: 1 or 2, or a functional variant or functional fragment or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2; The above uses are provided.

[0044] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a) encodes the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant or functional fragment or orthologue of SEQ ID NO: 3, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3; or b) comprising a sequence as set forth in SEQ ID NO: 1 or 2, or a functional variant or functional fragment or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2 A plant mutant carrying a genetic variation in a nucleotide sequence, The genetic variation reduces the activity or expression of a homeodomain-like MYB domain protein, and the mutant plant has a reduced alkaloid content and / or a regulated TSNA or TSNA precursor content compared to a comparable plant that does not carry the genetic variation.

[0045] In one aspect, the present invention provides progeny or seeds of a mutant plant carrying a genetic mutation according to the present invention.

[0046] In one aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a) encodes the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant or functional fragment or orthologue of SEQ ID NO: 3, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3; or b) comprising a sequence as set forth in SEQ ID NO: 1 or 2, or a functional variant or functional fragment or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2 Harvested leaf, processed leaf, or cured tobacco material produced from a plant containing an alteration in a nucleotide sequence, The modification reduces the activity or expression of a homeodomain-like MYB domain protein, and the plant provides harvested leaves, processed leaves, or cured tobacco material having a reduced alkaloid content and / or a regulated TSNA or TSNA precursor content compared to a comparable plant that does not possess the modification in the homeodomain-like MYB domain protein.

[0047] In one aspect, in addition to at least one homeodomain-like MYB domain protein, the activity or expression of at least one Nic1 ERF gene (e.g., any one or more of those in FIG. 5) and / or at least one Nic2 ERF gene (e.g., any one or more of those in FIG. 6) is modulated. Suitably, the at least one Nic1 ERF and / or Nic2 ERF gene may comprise a mutation that reduces its expression and / or activity. In one aspect, in addition to the modulation (e.g., decreased activity and / or expression) of at least one homeodomain-like MYB domain protein, the activity of ERF199 (e.g., SEQ ID NOS: 34-37) is modulated (e.g., decreased). In one aspect, in addition to the modulation (e.g., decreased activity and / or expression) of at least one homeodomain-like MYB domain protein, the activity of ERF189 (e.g., SEQ ID NOS: 38-41) is modulated (e.g., decreased). In one aspect, in addition to modulating (e.g., decreasing activity and / or expression) at least one homeodomain-like MYB domain protein, the activity of ERF199 (e.g., SEQ ID NOS: 34-37) and ERF189 (e.g., SEQ ID NOS: 38-41) is modulated (e.g., decreased). Exemplary sequences of ERF199 and ERF199 are provided in Figures 5-6 (SEQ ID NOS: 34-41). See also WO2018237107, which is incorporated by reference in its entirety. [Brief explanation of the drawings]

[0048] Embodiments of the invention will now be described, by way of example only, with reference to the accompanying drawings, in which: [Figure 1]Figure 1 shows the alkaloid content of 5-week-old TN90 leaves silenced for Nitab4.5_0005842g0010.2. Content is expressed relative to the control, with three biological replicates analyzed by one-way ANOVA and Tukey's multiple comparison post-hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance with P values ​​less than or equal to 0.001. Pyridine alkaloids: nicotine, nornicotine, anabasine (ANAB), anatabine (ANAT), and pseudooxynicotine (PON). [Figure 2-1] ~ [Figure 2-2] FIG. 1 shows the genomic sequence of Nitab4.5_0005842g0010.2 (SEQ ID NO: 1). [Figure 3] FIG. 1 shows the coding sequence of Nitab4.5_0005842g0010.2 (SEQ ID NO: 2). [Figure 4] FIG. 1 shows the amino acid sequence of Nitab4.5_0005842g0010.2 (SEQ ID NO: 3). [Figure 5] FIG. 1 provides a table of Nic1 ERFs. [Figure 6] FIG. 1 provides a table of Nic2 ERFs. [Figure 7] ~ [Figure 14] FIG. 1 shows the sequences of ERF199 (SEQ ID NOs: 34 to 37) and ERF189 (SEQ ID NOs: 38 to 41). [Figure 15-1] ~ [Figure 15-6] FIG. 1 shows the TRV1 sequence used in Example 1, SEQ ID NO: 42. DETAILED DESCRIPTION OF THE INVENTION

[0049] Some sequences disclosed herein contain an "X" or "N" in the nucleotide sequence. The "X" or "N" can be any nucleotide, or a deletion or insertion of one or more nucleotides. For example, in some cases, a string of "X" or "N" is shown. The number of "X" or "N" does not necessarily correlate to the actual number of nucleotides at that position. There may be more or fewer nucleotides than shown as "X" or "N" in the sequence.

[0050] The inventors have shown, for the first time, that by modulating the activity or expression of at least one homeodomain-like MYB domain protein in a plant (e.g., a tobacco plant) or cell (e.g., a tobacco cell), it is possible to modulate the alkaloid and / or TSNA precursor content of the plant (or treated plant) or cell.

[0051] The homologous transcriptional repressor MYB4-like in Arabidopsis thaliana is involved in regulating UV protection. It mediates transcriptional repression of CYP73A5 and regulates the accumulation of the UV-protective compound sinapoylmalate. However, little is known about the function of the transcriptional repressor MYB4-like in N. tabacum. We first demonstrated that knockout of Nitab4.5_0005842g0010.2 reduces pyridine alkaloid content in tobacco plants.

[0052] The present invention provides a method for modulating (e.g., reducing) the alkaloid content of a plant or part thereof, comprising modifying the plant by modulating (e.g., reducing) the activity or expression of at least one homeodomain-like MYB domain protein.

[0053] Also provided is a method for modulating (e.g., reducing) the content of a TSNA precursor in a tobacco plant or part of the plant, the method comprising modifying the plant by modulating (e.g., reducing) the activity or expression of at least one homeodomain-like MYB domain protein.

[0054] The at least one homeodomain-like MYB domain protein may be selected from the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant, functional fragment, or orthologue thereof, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3; alternatively, the at least one homeodomain-like MYB domain protein may be encoded by a sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2.

[0055] In one embodiment, at least two genes encoding a homeodomain-like MYB domain protein are modified, selected from the group consisting of genes encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3 or a functional variant, functional fragment, or orthologue thereof, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3, or genes encoding a homeodomain-like MYB domain protein comprising the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2.

[0056] In one embodiment, at least three, such as at least four, for example at least five, for example at least six, such as at least seven, for example at least eight, for example at least nine, for example ten homeodomain-like MYB domain proteins are modulated, and the homeodomain-like MYB domain proteins comprise the amino acid sequence set forth in SEQ ID NO: 3 or a functional variant, functional fragment or orthologue thereof, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3, or comprise the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2.

[0057] In one aspect, at least one homeodomain-like MYB domain protein comprises or consists of the amino acid sequence set forth in SEQ ID NO: 3 or a functional variant, functional fragment or ortholog thereof, or a sequence having at least 80% identity to SEQ ID NO: 3, or the homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment or ortholog of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2.

[0058] In one aspect, the activity or expression of at least one further gene is modulated. Suitably, at least two (or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine) additional genes selected from Table 1, or sequences with at least 80% sequence identity thereto, may also be modulated.

[0059] "Expression" of a homeodomain-like MYB domain protein may refer to the level of transcription, translation, i.e., protein expression.

[0060] Measuring the level or amount of the gene product can be done by any suitable method, for example, by comparing mRNA transcript levels, protein or peptide levels and / or plant phenotype between a modified plant and a comparable plant that has not been modified according to the present invention.

[0061] As defined herein, the term "comparable product" would be derived from a plant (e.g., a tobacco plant) that has not been modified according to the present invention, but in which all other relevant characteristics (e.g., plant species, growth conditions, method of processing the plant, e.g., tobacco, etc.) are identical. A comparable product according to the present invention may refer, for example, to a plant (e.g., a tobacco plant) or a part thereof, such as a leaf (e.g., tobacco leaf), harvested leaf (e.g., harvested tobacco leaf), cut harvested leaf (e.g., cut harvested tobacco leaf), processed leaf (e.g., processed tobacco leaf), or plant propagation material (e.g., tobacco plant propagation material), or a product comprising said plant or part therefore, e.g., a tobacco industry product, or a combination thereof, that can be obtained or is obtained from a plant that has not been modified according to the present invention to modulate the activity or expression of a gene encoding a homeodomain-like MYB domain protein. In one embodiment, a comparable product does not contain a gene encoding a homeodomain-like MYB domain protein whose activity or expression is modulated.

[0062] The terms "modify" or "modified," as used herein, refer to a plant (e.g., a tobacco plant) or nucleic acid sequence that has been altered or changed. The present invention includes the modification of plants using techniques for the genetic modification of plants or the non-genetic modification of plants. Such methods are well known in the art, and examples of genetic modification techniques include transformation, transgenic, cisgenic, and gene editing methods. Examples of non-genetic modification techniques include fast neutron mutagenesis, chemical mutagenesis, e.g., ethyl methanesulfonate (EMS) mutagenesis, and modern population analysis approaches.

[0063] In one embodiment, natural variants with modified genes encoding homeodomain-like MYB domain proteins are selected and the trait or gene is bred into a second plant that may have a commercially desirable trait.

[0064] In one embodiment, a plant according to the invention is a transgenic plant. In one embodiment, a plant according to the invention is a non-transgenic plant.

[0065] As defined herein, the term "unmodified plant" refers to a plant (e.g., a tobacco plant) that has not been modified in accordance with the present invention, e.g., to modulate the activity or expression of a homeodomain-like MYB domain protein or to modify the nucleic acid sequence of at least one gene encoding a homeodomain-like MYB domain protein, and all other relevant characteristics (e.g., plant species, growing conditions, method of processing tobacco, etc.) are identical. In one embodiment, an unmodified plant is one that does not contain a gene encoding a homeodomain-like MYB domain protein whose activity or expression is being modulated. In one embodiment, an unmodified plant is one that does not contain a modified nucleic acid sequence encoding at least one gene encoding a homeodomain-like MYB domain protein.

[0066] Homeodomain-like MYB domain proteins As used herein, "homeodomain-like MYB domain protein" refers to a protein that contains a homeodomain-like MYB domain.

[0067] An exemplary sequence of a homeodomain-like MYB domain protein from tobacco is shown in SEQ ID NO:3.

[0068] A homeodomain-like MYB domain according to the present invention can be derived from about amino acid 9 to about amino acid 111 of SEQ ID NO: 3. A homeodomain can be identified between about amino acid 13 to about amino acid 63 of SEQ ID NO: 3 and about amino acid 66 to about amino acid 114 of SEQ ID NO: 3.

[0069] Homeodomain-like MYB domain proteins can be identified by comparing the amino acid sequence of the protein of interest with the amino acid sequence of SEQ ID NO: 3. Homeodomain-like MYB domain proteins can be identified by comparing the amino acid sequence of the protein of interest with amino acids 9 to 111 of SEQ ID NO: 3. MYB domains can be identified by comparing the amino acid sequence of the protein of interest with amino acids 9 to 111 of SEQ ID NO: 3. SEQ ID NO: 3 contains DNA binding sites at amino acid residues 70, 99, 100, 102, 103, 105, 106, 107, 109, 110, and 111 of SEQ ID NO: 3.

[0070] An MYB domain can contain one or more DNA binding sites. For example, an MYB domain can contain DNA binding sites corresponding to amino acid residues 70, 99, 100, 102, 103, 105, 106, 107, 109, 110, and 111 of SEQ ID NO:3.

[0071] A homeodomain-like MYB domain protein referred to herein comprises a MYB domain. In one aspect, a MYB domain according to the invention comprises or consists of the amino acid sequence set forth in amino acids 9 to 111 of SEQ ID NO: 3, or a sequence having at least 80% identity thereto, or a functional fragment thereof having DNA binding activity.

[0072] Suitably, a homeodomain-like MYB domain protein may refer to the sequence set forth in amino acids 9 to 111 of SEQ ID NO: 3 or a sequence having at least 80% identity thereto. Suitably, a homeodomain-like MYB domain protein, as used herein, may refer to the sequence which, when aligned with SEQ ID NO: 3, corresponds to amino acids 9 to 111 of SEQ ID NO: 3.

[0073] Domains within the amino acid sequence of a protein can be identified using domain prediction software known in the art. Domains are also described in protein databases such as UniprotKB.

[0074] Without wishing to be bound by theory, it is hypothesized that modulating the content of homeodomain-like MYB domain proteins in plant cells or modulating the activity of homeodomain-like MYB domain proteins in plants will alter the metabolic pathways that produce alkaloids and TSNA precursors, resulting in modulated alkaloid and / or TSNA precursor content.

[0075] In one embodiment, the homeodomain-like MYB domain protein comprises the amino acid sequence set forth as SEQ ID NO: 3 or a sequence having at least 80% identity thereto or a homologue thereof. Suitably, the homologue of SEQ ID NO: 3 may be selected from the group comprising the amino acid sequences provided in Table 1 or a sequence having at least 80% identity thereto.

[0076] In one embodiment, the homeodomain-like MYB domain protein comprises the amino acid sequence set forth as SEQ ID NO: 3, or a sequence having at least 80% identity thereto (preferably, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity thereto). In one embodiment, the homeodomain-like MYB domain protein comprises the amino acid sequence set forth in Table 1, or a sequence having at least 80% identity thereto (preferably, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity thereto).

[0077] In one embodiment, a homeodomain-like MYB domain protein according to the invention comprises or consists of the amino acids set forth as SEQ ID NO: 3. In one embodiment, a homeodomain-like MYB domain protein according to the invention comprises or consists of the amino acids set forth in Table 1.

[0078] Suitably the protein may be derived from Nicotiana tabacum.

[0079] In one embodiment, the homeodomain-like MYB domain protein is encoded by a polynucleotide sequence, the gene (before mutation) comprising the polynucleotide sequence set forth as SEQ ID NO: 1, or a sequence having at least 80% identity thereto, or a homologue thereof. Suitably, the homologue of SEQ ID NO: 1 may be selected from the group comprising the polynucleotide sequences provided in Table 1, or a sequence having at least 80% identity thereto.

[0080] In one embodiment, the homeodomain-like MYB domain protein is encoded by the polynucleotide sequence set forth as SEQ ID NO: 1, or a sequence having at least 80% identity thereto (preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity thereto). In one embodiment, the homeodomain-like MYB domain protein is encoded by the polynucleotide sequence set forth in Table 1, or a sequence having at least 80% identity thereto (preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity thereto).

[0081] In one embodiment, the homeodomain-like MYB domain protein is encoded by a polynucleotide sequence comprising, or consisting of, the polynucleotide sequence set forth as SEQ ID NO: 1. In one embodiment, the homeodomain-like MYB domain protein is encoded by a polynucleotide sequence comprising, or consisting of, the polynucleotide sequence set forth in Table 1.

[0082] In one embodiment, the homeodomain-like MYB domain protein is encoded by a polynucleotide sequence, the gene (before mutation) comprising the polynucleotide sequence set forth as SEQ ID NO: 2, or a sequence having at least 80% identity thereto, or a homologue thereof. Suitably, the homologue of SEQ ID NO: 2 may be selected from the group comprising the polynucleotide sequences provided in Table 1, or a sequence having at least 80% identity thereto.

[0083] In one embodiment, the homeodomain-like MYB domain protein is encoded by the polynucleotide sequence set forth as SEQ ID NO: 2, or a sequence having at least 80% identity thereto (preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity thereto). In one embodiment, the homeodomain-like MYB domain protein is encoded by the polynucleotide sequence set forth in Table 1, or a sequence having at least 80% identity thereto (preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity thereto).

[0084] In one embodiment, the homeodomain-like MYB domain protein is encoded by a polynucleotide sequence comprising, or consisting of, the polynucleotide sequence set forth as SEQ ID NO: 2. In one embodiment, the homeodomain-like MYB domain protein is encoded by a polynucleotide sequence comprising, or consisting of, the polynucleotide sequence set forth in Table 1. [Table 1] JPEG2025511894000002.jpg252170JPEG2025511894000003.jpg252170JPEG202 5511894000004.jpg252170JPEG2025511894000005.jpg252170JPEG20255118940 00006.jpg252170JPEG2025511894000007.jpg252170JPEG2025511894000008.j pg252170JPEG2025511894000009.jpg252170JPEG2025511894000010.jpg252170

[0085] Suitably, proteins for use according to the present invention may be encoded by polynucleotide sequences derived from Nicotiana tabacum.

[0086] In one aspect, the invention provides a method for reducing the alkaloid content of a plant or part or cell thereof (e.g., a plant cell), comprising modifying the plant by reducing or inhibiting the activity or expression of at least one homeodomain-like MYB domain protein.

[0087] In one aspect, the invention provides a method for reducing the alkaloid content of a plant or part thereof or plant cell, said method comprising the step of modifying said plant by reducing or inhibiting the activity or expression of at least one homeodomain-like MYB domain protein, wherein said at least one homeodomain-like MYB domain protein comprises the amino acid sequence set forth as SEQ ID NO: 3, or a sequence having at least 80% identity thereto; or wherein at least one gene encoding the homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity thereto.

[0088] In one aspect, the invention provides a method for reducing the content of TSNA precursors in a plant or part thereof (e.g., a leaf), the method comprising modifying the plant by reducing or inhibiting the activity or expression of at least one homeodomain-like MYB domain protein. Suitably, the method comprises modifying the plant by reducing or inhibiting the activity or expression of at least one homeodomain-like MYB domain protein, wherein the at least one homeodomain-like MYB domain protein comprises the amino acid sequence set forth as SEQ ID NO:3, or a sequence having at least 80% identity thereto, or wherein at least one gene encoding the homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO:1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID NO:1 or 2, or a nucleic acid sequence having at least 80% identity thereto.

[0089] In one aspect, the invention provides a method for reducing the content of TSNA precursors in a plant or part thereof (e.g., a leaf), the method comprising modifying the plant by reducing or inhibiting the activity or expression of at least one homeodomain-like MYB domain protein.

[0090] In one aspect, the present invention provides a method for reducing the content of TSNAs in treated leaves, e.g., dried leaves, comprising: modifying a plant by reducing or inhibiting the activity or expression of at least one homeodomain-like MYB domain protein; harvesting leaves from said plant; and processing, e.g., drying, the harvested leaves. The present invention provides a method comprising:

[0091] Suitably, the method of reducing the content of TSNAs in treated leaves may comprise modifying the plant by reducing or inhibiting the activity or expression of at least one homeodomain-like MYB domain protein, wherein the at least one homeodomain-like MYB domain protein comprises the amino acid sequence set forth as SEQ ID NO: 3, or a sequence having at least 80% identity thereto, or wherein at least one gene encoding the homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity thereto. The terms "reducing" or "inhibiting" (e.g., inhibiting the activity or expression of a homeodomain-like MYB domain protein), as used herein, mean that the activity or expression of a gene encoding a homeodomain-like MYB domain protein is lower or decreased compared to the activity or expression of the gene in a comparable product.

[0092] In one aspect, the invention provides a method for increasing the alkaloid content of a plant or part or cell thereof (e.g., a plant cell), comprising modifying the plant by increasing or enhancing the activity or expression of at least one gene encoding a homeodomain-like MYB domain protein.

[0093] In one aspect, the invention provides a method for increasing the alkaloid content of a plant or part thereof or plant cell, said method comprising modifying said plant by increasing or enhancing the activity or expression of at least one homeodomain-like MYB domain protein, wherein said at least one homeodomain-like MYB domain protein comprises the amino acid sequence set forth as SEQ ID NO: 3, or a sequence having at least 80% identity thereto, or wherein at least one gene encoding a homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity thereto. In one aspect, the invention provides a method for increasing the content of a TSNA precursor in a plant or part thereof (e.g., a leaf), said method comprising modifying said plant by increasing or enhancing the activity or expression of at least one homeodomain-like MYB domain protein.

[0094] In one aspect, the invention provides a method for increasing the content of a TSNA precursor in a plant or part thereof (e.g., a leaf), the method comprising modifying the plant by increasing or enhancing the activity or expression of at least one homeodomain-like MYB domain protein, wherein the at least one homeodomain-like MYB domain protein comprises the amino acid sequence set forth as SEQ ID NO:3, or a sequence having at least 80% identity thereto; or wherein at least one gene encoding the homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO:1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID NO:1 or 2, or a nucleic acid sequence having at least 80% identity thereto.

[0095] The terms "increasing" or "enhancing" (e.g., increasing the activity or expression of a gene encoding a homeodomain-like MYB domain protein), as used herein, mean that the activity or expression of a gene encoding a homeodomain-like MYB domain protein is higher or increased compared to the activity or expression of the gene in a comparable product.

[0096] According to the present invention, the activity or expression of a homeodomain-like MYB domain protein is modulated.

[0097] In one aspect, the invention provides a method for modulating (i.e., increasing or decreasing) the alkaloid content of a plant or part or cell thereof (e.g., a plant cell), comprising modifying the plant by modulating (i.e., increasing or decreasing) the activity of at least one homeodomain-like MYB domain protein.

[0098] The term "activity" refers to any functionality of a homeodomain-like MYB domain protein.

[0099] For example, the ability of a homeodomain-like MYB domain protein to bind to DNA. Methods for measuring such activities, such as DNA binding, are known in the art. For example, techniques for determining DNA-protein interactions include footprinting assays, electrophoretic mobility shift assays, Southwestern blotting, yeast one-hybrid assays, and chromatin immunoprecipitation.

[0100] Modulating the activity of a homeodomain-like MYB domain protein may involve increasing or decreasing the activity of the homeodomain-like MYB domain protein.

[0101] Increasing the activity of a homeodomain-like MYB domain protein refers to enhancing or improving the ability of the homeodomain-like MYB domain protein to perform a particular function compared to a homeodomain-like MYB domain protein in a plant that has not been modified according to the present invention.

[0102] Reducing the activity of a homeodomain-like MYB domain protein refers to reducing, inhibiting, or destroying the ability of the homeodomain-like MYB domain protein to perform a particular function, compared to the homeodomain-like MYB domain protein in a plant that has not been modified according to the present invention. The activity of the homeodomain-like MYB domain protein may be reduced to such an extent that the activity is prevented or eliminated.

[0103] In some embodiments, the activity of the homeodomain-like MYB domain protein may be modulated (i.e., increased or decreased) by at least about 10%, 20%, 30%, or 40%, suitably at least about 50%, 60%, 70%, and more suitably at least about 80%, 90%, 95%, or 100%, compared to the activity of a gene encoding the homeodomain-like MYB domain protein in a plant (e.g., a tobacco plant) that has not been modified according to the present invention. Suitably, the activity may be decreased.

[0104] In some embodiments, the modulated homeodomain-like MYB domain protein exhibits increased or decreased activity compared to the unmodified homeodomain-like MYB domain protein, and may exhibit at least about 1%, at least about 3%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% increased or decreased activity compared to the unmodified homeodomain-like MYB domain protein.

[0105] Techniques for measuring protein activity are known in the art. For example, assays for measuring the enzymatic activity of a protein, such as DNA binding activity, are known.

[0106] In one aspect, the present invention provides a method for modulating (i.e., increasing or decreasing) the alkaloid content of a plant or part or cell thereof (e.g., a plant cell), comprising modifying the plant by modulating (i.e., increasing or decreasing) the expression of at least one homeodomain-like MYB domain protein.

[0107] "Expression" of a gene refers to the extent to which the information encoded in a gene is converted into functionality. The level of gene expression can be equated to the amount of the gene's product present in a cell or organism. A modification that modulates (i.e., increases or decreases) the expression of a gene is one that increases the amount of that gene's product in a plant or cell compared to an unmodified plant or cell.

[0108] In some embodiments, expression of a homeodomain-like MYB domain protein gene is modulated (i.e., increased or decreased) compared to expression of a gene encoding a homeodomain-like MYB domain protein in a plant (e.g., a tobacco plant) that has not been modified according to the present invention.

[0109] In some embodiments, expression of a homeodomain-like MYB domain protein gene may be modulated (i.e., increased or decreased) by at least about 10%, 20%, 30%, or 40%, suitably at least about 50%, 60%, 70%, and more suitably at least about 80%, 90%, 95%, or 100%, compared to expression of a gene encoding a homeodomain-like MYB domain protein in a plant (e.g., a tobacco plant) that has not been modified according to the present invention. Suitably, expression may be decreased.

[0110] In some embodiments, the modulated homeodomain-like MYB domain protein exhibits increased or decreased expression compared to the unmodified homeodomain-like MYB domain protein. The modulated homeodomain-like MYB domain protein may exhibit at least about 1%, at least about 3%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% increased or decreased expression compared to the unmodified homeodomain-like MYB domain protein. Suitably, expression may be decreased.

[0111] Typically, genes are transcribed into mRNA, which is translated into a protein, the final gene product. Proteins may be sequestered in cellular stores and / or degraded. Gene expression can be regulated by modulating any or all of these steps. Thus, in some embodiments, the modification modulates (e.g., decreases) expression of at least one gene encoding a homeodomain-like MYB domain protein in one of the following ways: modulating (e.g., decreasing) transcription from at least one gene encoding a homeodomain-like MYB domain protein; modulating (e.g., decreasing) translation of mRNA from at least one gene encoding a homeodomain-like MYB domain protein; modulating (e.g., decreasing) the release of homeodomain-like MYB domain proteins from intracellular stores; modulating (e.g., increasing) the rate of degradation of homeodomain-like MYB domain proteins, and / or Introducing a mutation that alters the amino acid sequence of the homeodomain-like MYB domain protein to decrease or increase its activity, for example, to decrease the homeodomain-like MYB domain protein activity.

[0112] The expression of a particular gene encoding a homeodomain-like MYB domain protein can be measured by measuring transcription and / or translation of the gene. Methods for measuring transcription are well known in the art and include Northern blot, RNA-Seq, in situ hybridization, DNA microarray, and RT-PCR, among others. Alternatively, gene expression can be measured indirectly by measuring the level of a gene product, e.g., a protein encoded by the gene. For example, the expression of a homeodomain-like MYB domain protein can be determined by Western blot using an antibody specific for the homeodomain-like MYB domain protein to measure the presence of the protein.

[0113] Modification The plant or cell can be modified in any way that modulates the activity or expression of at least one homeodomain-like MYB domain protein. The types of modifications to plants and cells that modulate gene activity or expression and techniques for achieving these modifications are known in the art.

[0114] In some embodiments, the present invention provides methods for reducing the alkaloid content of a plant or part or cell thereof (e.g., a plant cell), comprising modifying the plant by reducing or inhibiting the activity or expression of at least one homeodomain-like MYB domain protein described herein.

[0115] In some embodiments, the present invention provides methods for reducing the content of TSNAs or precursors of TSNAs in a tobacco plant or plant part thereof, comprising modifying the plant or cell culture by reducing the activity or expression of at least one homeodomain-like MYB domain protein described herein.

[0116] Any method known in the art for reducing or inhibiting the activity or expression of a gene or protein can be used in the methods according to the present invention.

[0117] Suitably, the activity or expression of the gene encoding the homeodomain-like MYB domain protein may be reduced, partially inactivated, inhibited, eliminated, knocked out, or lost so that the protein activity, expression, or function of the gene encoding the homeodomain-like MYB domain protein is undetectable.

[0118] In one embodiment, at least one gene encoding a homeodomain-like MYB domain protein is knocked out, in other words, the gene encoding the homeodomain-like MYB domain protein is completely disabled.

[0119] For example, the method may include: providing a mutation in a nucleic acid sequence encoding a protein comprising the amino acid sequence set forth as SEQ ID NO:3 or an amino acid sequence having at least 80% sequence identity thereto; providing a mutation in a regulatory region (e.g., promoter or enhancer) that contributes to controlling the expression of a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, providing an antisense RNA, siRNA, or miRNA that reduces the level of a nucleic acid sequence encoding a protein comprising the amino acid sequence set forth as SEQ ID NO:3 or an amino acid sequence having at least 80% sequence identity thereto; may include:

[0120] Each of the above approaches results in a reduction or prevention of the activity or expression of a protein, wherein the protein comprises the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, or wherein at least one gene encoding a homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity thereto.

[0121] As used herein, the term "mutation" encompasses natural genetic variants or engineered variants. In particular, the term "mutation" refers to a variation in the nucleotide sequence encoding an amino acid sequence or in an amino acid sequence compared to the sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% (preferably at least 85%, preferably at least 90%, preferably at least 93%, preferably at least 95%, preferably at least 98%, preferably at least 99%) sequence identity thereto.

[0122] In one embodiment, the mutation reduces the alkaloid content of the plant. In another embodiment, the mutation reduces the content of at least one TSNA precursor in the plant or part thereof or leaves, for example, harvested or treated leaves. In one embodiment, the mutation reduces the content of one or more TSNAs selected from NNN, NNK, NAT, and NAB, preferably reducing the NNK and / or NNK content in treated leaves. Suitably, the TSNA content is reduced relative to comparable products.

[0123] In one embodiment, a method according to the invention may comprise providing a nucleic acid sequence to a plant or part thereof or a plant cell, said nucleic acid resulting in the reduction or elimination of the activity or expression of at least one homeodomain-like MYB domain protein.

[0124] In one embodiment, a method according to the invention may comprise providing a nucleic acid sequence to a plant or part thereof or a plant cell, said nucleic acid resulting in the modification of the nucleic acid sequence of at least one homeodomain-like MYB domain protein.

[0125] Suitably, the nucleic acid sequence may be introduced into a plant or part thereof or cell. Suitably, an endogenous nucleic acid sequence in the plant or part thereof or cell may be modified (e.g., by gene editing) to encode a polypeptide according to the present invention. For example, the endogenous nucleotide sequence may be modified to reduce the activity or expression of at least one homeodomain-like MYB domain protein.

[0126] In a preferred embodiment, each copy of a protein-encoding nucleic acid sequence present in a plant comprising the sequence set forth as SEQ ID NO:3 or a sequence having at least 80% sequence identity thereto, or wherein at least one gene encoding a homeodomain-like MYB domain protein comprises the nucleotide sequence set forth as SEQ ID NO:1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID NO:1 or 2, or a nucleic acid sequence having at least 80% identity thereto, is modified, e.g., mutated, as defined herein (e.g., each genomic copy of the gene encoding said protein in the plant is mutated). For example, each copy of the gene in the allotetraploid genome of Nicotiana tabacum can be mutated.

[0127] In a preferred embodiment, some or all of the homologs of the homeodomain-like MYB domain proteins described herein are modified, e.g., inhibited or mutated. Suitably, some or all of the homologs listed in Table 1, or corresponding sequences having at least 80% sequence identity thereto, are modified, e.g., inhibited or mutated.

[0128] In some embodiments, the plant or plant cell according to the invention is homozygous. Suitably, the plant or plant cell may be homozygous for the modification, such as the disruption or mutation.

[0129] In some embodiments, plants or plant cells according to the invention express only modified, e.g., mutated, nucleic acids encoding at least one homeodomain-like MYB domain protein. In other words, in some embodiments, no endogenous (or endogenous and functional) proteins are present in plants according to the invention. In other words, if any endogenous proteins are present, they are preferably in an inactive form.

[0130] In one embodiment, the method may comprise providing a mutation in a nucleic acid sequence set forth as SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity thereto, or a homologue of SEQ ID NO: 1 or SEQ ID NO: 2.

[0131] The mutation may alter the plant genome such that the nucleic acid sequence encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3, or an amino acid sequence having at least 80% sequence identity thereto, or a homolog of SEQ ID NO: 3, is deleted in whole or in part, or otherwise modified to inhibit or eliminate the activity of the homeodomain-like MYB domain protein. In some embodiments, the mutation does not alter the level or expression of the protein, but reduces, inhibits, or eliminates the activity of the homeodomain-like MYB domain protein.

[0132] Suitably, the at least one mutation may be in a non-cytoplasmic domain, a cytoplasmic domain, or a transmembrane domain of the homeodomain-like MYB domain protein.

[0133] The mutation may disrupt the nucleic acid sequence encoding a protein comprising the amino acid sequence shown as SEQ ID NO:3 or an amino acid sequence having at least 80% sequence identity thereto, or a homologue of SEQ ID NO:3.

[0134] The interruption may result in the nucleic acid sequence not being transcribed and / or translated.

[0135] The nucleic acid sequence may be disrupted, for example, by deleting or otherwise altering the ATG start codon of the nucleic acid sequence, such that translation of the protein is reduced or prevented.

[0136] The nucleic acid sequence may contain one or more nucleotide changes that reduce or prevent protein expression or affect protein trafficking. For example, protein expression can be reduced or prevented by introducing one or more premature stop codons, frameshifts, splice mutations, or impermissible amino acid substitutions into the open reading frame.

[0137] A premature stop codon refers to a mutation that introduces a stop codon into an open reading frame, preventing translation of the entire amino acid sequence. A premature stop codon can be a TAG ("amber"), TAA ("ochre"), or TGA ("opal" or "umber") codon.

[0138] A frameshift mutation (also called a framing error or reading frameshift) is a mutation caused by the insertion or deletion (insertion or deletion) of several nucleotides in a nucleic acid sequence that is not divisible by three. Due to the triplet nature of gene expression by codons, the insertion or deletion can change the reading frame and result in a completely different translation from the original. Frameshift mutations often cause the mutated codon to code for a different amino acid. Frameshift mutations generally result in the introduction of a premature stop codon.

[0139] Splice variants insert, delete, or change several nucleotides at designated sites where splicing occurs during the processing of precursor messenger RNA into mature messenger RNA. Deletion of a splice site can result in one or more introns remaining in the mature mRNA, leading to the production of an abnormal protein.

[0140] An impermissible amino acid substitution refers to a mutation that results in a non-synonymous amino acid substitution in a protein, which results in a reduced or eliminated function of the protein.

[0141] Any method known in the art for providing mutations in nucleic acid sequences can be used in the methods according to the invention. For example, homologous recombination can be used, in which the relevant nucleic acid sequence is mutated to generate a vector that is used to transform plants or plant cells. Recombinant plants or plant cells that express the mutated sequence can then be selected.

[0142] In one embodiment, the mutation introduces an amino acid substitution that is not tolerated in a protein comprising the amino acid sequence shown as SEQ ID NO: 3, or a sequence having at least 80% sequence identity thereto, or a homologue of SEQ ID NO: 3.

[0143] In some embodiments, the homeodomain-like MYB domain protein may contain a mutation that reduces the expression or activity of the homeodomain-like MYB domain protein.

[0144] The mutations can be codons that encode deletions, splice variants, or impermissible amino acid substitutions.

[0145] In one embodiment, the nucleic acid sequence encoding the homeodomain-like MYB domain protein may be deleted in whole or in part. The deletion may be contiguous or may include multiple sections of the sequence. The deletion preferably removes a sufficient amount of nucleotide sequence such that the nucleic acid sequence no longer encodes a functional homeodomain-like MYB domain protein. A deletion may be complete when 100% of the coding portion of the nucleic acid sequence is absent when compared to the corresponding genome of a comparable unmodified plant. The deletion may, for example, remove at least 50, 60, 70, 80, or 90% of the coding portion of the nucleic acid sequence. Suitably, at least a portion of the protein may be deleted. The deletion may, for example, remove at least 10, 20, 30, 40, 50, 60, 70, 80, or 90% of the coding portion of the protein.

[0146] The deletion may remove at least 10 amino acids (e.g., at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 amino acids) from the homeodomain-like MYB domain protein. Suitably, the deletion may remove at least 10 amino acids (e.g., at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 amino acids) of the homeodomain-like MYB domain protein, wherein the sequence of the homeodomain-like MYB domain protein aligns with SEQ ID NO:3. Suitably, the deletion may remove at least 10 amino acids (e.g. at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 amino acids) from the homeodomain-like MYB domain protein, and the homeodomain-like MYB domain protein before the deletion comprises the amino acid sequence set forth in SEQ ID NO: 3 or a sequence having at least 80% sequence identity thereto, or a homologue of SEQ ID NO: 3. Suitably, the homeodomain-like MYB domain protein before the deletion comprises the amino acid sequence set forth in SEQ ID NO: 3.

[0147] Suitably, a protein for use according to the invention may comprise a truncated homeodomain-like MYB domain protein. Suitably, the truncated protein may be a truncated version of the amino acid sequence set forth in SEQ ID NO: 3 or a sequence having at least 80% sequence identity thereto, or a homologue of SEQ ID NO: 3. Suitably, the truncated protein lacks at least 10 amino acids (e.g. at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 amino acids, at least 100 amino acids, or finally 110 amino acids) from the homeodomain-like MYB domain protein.

[0148] The deletion may remove at least a portion of the domain. The deletion may, for example, remove at least 10, 20, 30, 40, 50, 60, 70, 80, or 90% of the domain. Suitably, the deletion may remove at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, or 90% of the domain. Suitably, the deletion may remove at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, or 80 amino acids of the domain.

[0149] The deletion may remove at least part of the domain. The deletion may, for example, remove at least one or at least two amino acids from the domain. Suitably, the domain may be deleted completely.

[0150] Methods for deleting nucleic acid sequences in plants are known in the art. For example, homologous recombination can be used, in which a vector is generated that lacks the relevant nucleic acid sequence(s) and is used to transform the plant or plant cell. Recombinant plants or plant cells that express the new portion of the sequence can then be selected.

[0151] Plant cells transformed with the vectors described herein can be grown and maintained according to well-known tissue culture methods, for example, by culturing the cells in an appropriate culture medium supplemented with necessary growth factors, e.g., amino acids, plant hormones, vitamins, etc.

[0152] Modifications of nucleic acid sequences can be carried out using targeted mutagenesis (also called targeted nucleotide exchange (TNE) or oligo-directed mutagenesis (ODM)). Targeted mutagenesis methods include, but are not limited to, those employing zinc finger nucleases, TALENs (see WO 2011 / 072246 and WO 2010 / 079430), Cas9-like, Cas9 / crRNA / tracrRNA, Cas9 / gRNA or other CRISPR systems (see WO 2014 / 071006 and WO 2014 / 093622), meganucleases (see WO 2007 / 047859 and WO 2009 / 059195), or targeted mutagenesis methods employing mutagenic oligonucleotides, possibly containing chemically modified nucleotides to enhance mutagenesis using sequence complementarity to genes in plant protoplasts (e.g., KeyBase® or TALENs).

[0153] Alternatively, a mutagenesis system such as TILLING (Targeting Induced Local Lesions IN Genomics; McCallum et al. (2000) Nat. Biotech. 18:455, and McCallum et al. (2000) Plant Physiol. 123, 439-442, both incorporated herein by reference) can be used to generate plant lines containing gene encoding a protein with mutations. TILLING uses traditional chemical mutagenesis (e.g., ethyl methanesulfonate (EMS) mutagenesis to generate random mutations) followed by high-throughput screening for mutations. In this way, plants, seeds, cells, and tissues containing genes with desired mutations can be obtained.

[0154] Methods can include mutagenizing plant seeds (e.g., EMS mutagenesis), pooling plant individuals or DNA, PCR amplification of the region of interest, heteroduplex formation and high-throughput detection, identification of mutant plants, and sequencing of the mutant PCR products. It is understood that other mutagenesis and selection methods can equally be used to generate such modified plants. For example, seeds can be irradiated or chemically treated, and plants can be screened for modified phenotypes.

[0155] Rapid neutron deletion mutagenesis can be used in a reverse genetic context (i.e., using PCR) to identify plant lines that carry deletions in endogenous genes. See, e.g., Ohshima et al. (1998) Virology 213:472-481; Okubara et al. (1994) Genetics 137:867-874; and Quesada et al. (2000) Genetics 154:421-4315, which are incorporated herein by reference.

[0156] In another approach, dominant mutants can be used to induce RNA silencing through gene inversion and recombination of duplicated loci. See, e.g., Kusaba et al. (2003) Plant Cell 15:1455-1467 (incorporated herein by reference).

[0157] Modified plants can be distinguished from unmodified, i.e., wild-type, plants by molecular methods, for example, by the mutation(s) present in the DNA and by modified phenotypic characteristics. Modified plants can be homozygous or heterozygous for the modification. Preferably, modified plants are homozygous for the modification.

[0158] In one embodiment, the method of reducing or preventing the activity or expression of a protein comprising the amino acid sequence set forth as SEQ ID NO: 3, or an amino acid sequence having at least 80% sequence identity thereto, or a homolog of SEQ ID NO: 3, does not include treating the plant with a chemical (e.g., an agricultural chemical).

[0159] Other methods of reducing or preventing expression will be apparent to those skilled in the art and include the use of virus-induced gene silencing (VIGs), microRNA silencing, RNAi, antisense, tDNA insertions, or dominant-negative constructs (or antimorph mutations).

[0160] In one embodiment, expression of a homeodomain-like MYB domain protein, such as a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by virus-induced gene silencing.

[0161] In one embodiment, the expression of a homeodomain-like MYB domain protein, such as a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by a microRNA.

[0162] In one embodiment, expression of a homeodomain-like MYB domain protein, such as a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by RNAi.

[0163] In one embodiment, expression of a homeodomain-like MYB domain protein, such as a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, may be reduced or eliminated by antisense suppression.

[0164] In one embodiment, expression of a homeodomain-like MYB domain protein, such as a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by sense suppression.

[0165] In one embodiment, expression of a homeodomain-like MYB domain protein, such as a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by tDNA insertion.

[0166] In one embodiment, expression of a homeodomain-like MYB domain protein, such as a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, may be reduced or eliminated by a dominant-negative construct (or antimorph mutation).

[0167] In one embodiment, the expression of a homeodomain-like MYB domain protein, such as a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by a targeted mutagenesis-based system.

[0168] In one embodiment, expression of a homeodomain-like MYB domain protein, such as a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3, or an amino acid sequence having at least 80% sequence identity thereto, can be reduced or eliminated by gene editing, e.g., a CRISPR-based system.

[0169] In one embodiment, expression of a gene encoding a protein comprising the amino acid sequence set forth as SEQ ID NO: 3 or an amino acid sequence having at least 80% sequence identity thereto may be reduced or eliminated by zinc finger nucleases, TALENs, meganucleases, mutagenic oligonucleotides or TILLING.

[0170] In some embodiments, the present invention provides a method for increasing the alkaloid content of a plant or part thereof or a cell (e.g., a plant cell), comprising modifying the plant by increasing or enhancing the activity or expression of at least one homeodomain-like MYB domain protein.

[0171] Any method known in the art for increasing or enhancing gene activity or expression can be used in the methods according to the present invention.

[0172] In some embodiments, the method may comprise overexpressing at least one gene encoding a homeodomain-like MYB domain protein. Suitably, the method may comprise expressing one or more additional copies of the at least one gene encoding the homeodomain-like MYB domain protein in the plant or cell. Suitably, the method may comprise modifying an endogenous copy of the at least one gene encoding the homeodomain-like MYB domain protein such that its expression is increased. The method may comprise mutating the coding sequence of the at least one gene encoding the homeodomain-like MYB domain protein. The method may comprise mutating a regulatory sequence that controls expression of the at least one gene encoding the homeodomain-like MYB domain protein.

[0173] Suitably, the method may comprise transforming cells of a plant (e.g., a tobacco plant) with a genetic construct encoding at least one homeodomain-like MYB domain protein comprising the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant, functional fragment, or orthologue thereof, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3; or wherein at least one gene encoding the homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2; or a nucleotide sequence encoding a protein capable of promoting or enhancing at least one endogenous homeodomain-like MYB domain protein. It will be appreciated that each of these options results in increased activity and expression of the polypeptide encoded by the at least one homeodomain-like MYB domain protein. The method may comprise regenerating a plant from the transformed cells. Provided is the use of a genetic construct capable of increasing the activity and / or expression of a polypeptide encoded by at least one gene encoding a homeodomain-like MYB domain protein to increase the alkaloid content (e.g., nicotine content) in a plant or part thereof or cell transformed with the construct.

[0174] The genetic construct may encode a polypeptide comprising amino acid sequence SEQ ID NO:3 or a functional variant or functional fragment or ortholog thereof or a sequence having at least 80% identity to SEQ ID NO:3, or comprises the nucleotide sequence set forth in SEQ ID NO:1 or 2 or a functional variant or functional fragment or ortholog of SEQ ID NO:1 or 2 or a nucleic acid sequence having at least 80% identity to SEQ ID NO:1 or 2.

[0175] In another embodiment, the present invention relates to a method for increasing the alkaloid content of a plant or part thereof or a cell, comprising modifying said plant or cell by increasing the activity of at least one homeodomain-like MYB domain protein.

[0176] In one embodiment, the activity of at least one gene encoding a homeodomain-like MYB domain protein may be increased by introducing (or providing) a mutation in at least one gene encoding the homeodomain-like MYB domain protein.

[0177] Suitably, the activity of at least one gene encoding a homeodomain-like MYB domain protein may be increased by introducing a mutation into at least one gene encoding a homeodomain-like MYB domain protein that comprises the amino acid sequence set forth in SEQ ID NO: 3 or a functional variant, functional fragment, or orthologue thereof, or a sequence having at least 80% identity to SEQ ID NO: 3, or wherein at least one gene encoding a homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2.

[0178] In some embodiments, the activity or expression of at least one homeodomain-like MYB domain protein is increased, thereby: modulating (e.g., increasing) transcription from at least one gene encoding a homeodomain-like MYB domain protein; modulating (e.g., increasing) translation of mRNA from at least one gene encoding a homeodomain-like MYB domain protein; modulating (e.g., increasing) the release of homeodomain-like MYB domain proteins from intracellular stores, and / or Regulating (e.g., decreasing) the rate of degradation of homeodomain-like MYB domain proteins Modifications that increase the alkaloid content by one of the following:

[0179] Alkaloid Content In one embodiment, the present invention provides a method for modulating the alkaloid content of a plant (e.g., a tobacco plant) or part thereof, comprising modifying the plant by modulating the activity or expression of at least one homeodomain-like MYB domain protein.

[0180] The term "modulate" is used herein to mean either to increase or to decrease.

[0181] The term "increasing the alkaloid content" is used herein to mean that the alkaloid content in a product of the invention (e.g., a plant, a part thereof (e.g., a leaf), a treated leaf, or a product made from the plant (e.g., a tobacco industry product)) is higher compared to a comparable product that has not been modified according to the invention.

[0182] The term "reducing the alkaloid content" is used herein to mean that the alkaloid content in a product of the invention (e.g., a plant, a part thereof (e.g., a leaf), a treated leaf, or a product made from the plant (e.g., a tobacco industry product)) is lower compared to a comparable product that has not been modified according to the invention.

[0183] In some embodiments, modulating alkaloid content refers to increasing the alkaloid content, wherein the activity or expression of at least one homeodomain-like MYB domain protein is increased (e.g., the protein is overexpressed).

[0184] In some embodiments, modulating alkaloid content refers to a decrease in alkaloid content, where the expression of at least one homeodomain-like MYB domain protein is reduced, inhibited, or eliminated.

[0185] In a further embodiment, the alkaloid content is measured from leaves. In one embodiment, the alkaloid content is measured from green leaves. In a further embodiment, the alkaloid content is measured from dried leaves, for example, from air-cured, flue-cured, fire-cured, or sun-cured leaves. In a further embodiment, the alkaloid content is measured from flue-cured leaves. In a further embodiment, the alkaloid content is measured from air-dried leaves.

[0186] The term "alkaloid content" is used herein to mean the concentration and / or total amount of the entire group of compounds classified as alkaloids, or the concentration and / or total amount of one or more compounds classified as alkaloids. Alkaloids typically present in tobacco include nornicotine, PON, anatabine, anabasine, nicotine, and myosmine. In some embodiments, the content of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, anabasine, and myosmine is adjusted, for example, two or three or more alkaloids, for example, three or four or more alkaloids, for example, four or five or more alkaloids, for example, five or six or more alkaloids, for example, all six alkaloids. In some embodiments, the content of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, anabasine, and myosmine, such as two or three or more alkaloids, for example, three or four or more alkaloids, for example, four or five or more alkaloids, for example, five or six or more alkaloids, for example, all six alkaloids, is increased. In some embodiments, the content of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, anabasine, and myosmine, such as two or three or more alkaloids, for example, three or four or more alkaloids, for example, four or five or more alkaloids, for example, five or six or more alkaloids, for example, all six alkaloids, is decreased. In some embodiments, the total alkaloid content of the plant or cell is modulated. In some embodiments, the total alkaloid content is increased. In some embodiments, the total alkaloid content is increased.

[0187] Any method known in the art for determining alkaloid concentration and / or total content can be used. One preferred method for analyzing alkaloid content includes analysis by gas chromatography-flame ionization detection (GC-FID) or by reversed-phase high performance liquid chromatography with tandem mass spectrometry (LC-MS / MS).

[0188] In one embodiment, there is provided a method for producing a plant (e.g., a tobacco plant) or part thereof, plant propagation material (e.g., tobacco plant propagation material), cell (e.g., tobacco cell), leaf (e.g., tobacco leaf), harvested leaf (e.g., harvested tobacco leaf), cut harvested leaf (e.g., cut harvested tobacco leaf), processed leaf (e.g., processed tobacco leaf), cut and processed leaf (e.g., cut and processed tobacco leaf), product (e.g., tobacco industry product) comprising said plant or or part thereof, or combination thereof, obtainable by or obtained from a plant of the invention having modulated alkaloid content, the method comprising the step of modifying said plant to modulate the activity or expression of a homeodomain-like MYB domain protein. The adjusted alkaloid content can be determined by comparing the alkaloid content in a plant (e.g., a tobacco plant) or part thereof, plant propagation material (e.g., tobacco plant propagation material), cell (e.g., tobacco cell), leaf (e.g., tobacco leaf), harvested leaf (e.g., harvested tobacco leaf), cut harvested leaf (e.g., cut harvested tobacco leaf), processed leaf (e.g., processed tobacco leaf), cut and processed leaf (e.g., processed cut tobacco leaf), a product comprising a plant of the invention or part thereof, e.g., a tobacco industry product, or a combination thereof, with a comparable product.

[0189] Suitably, the alkaloid content can be adjusted in a plant, for example, a tobacco plant, for example, a modified tobacco plant. Suitably, the alkaloid content can be adjusted in leaves (e.g., tobacco leaves, for example, tobacco leaves from a modified tobacco plant). Suitably, the alkaloid content can be adjusted in harvested leaves (e.g., tobacco harvested leaves from a modified tobacco plant). Suitably, the alkaloid content can be adjusted in cut harvested leaves (e.g., cut tobacco harvested leaves from a modified tobacco plant). Suitably, the alkaloid content can be adjusted in processed leaves (e.g., processed tobacco leaves, for example, processed tobacco leaves from a modified tobacco plant). Suitably, the alkaloid content can be adjusted in cut and processed leaves (e.g., cut and processed tobacco leaves, for example, cut and processed tobacco leaves from a modified tobacco plant). Suitably, the alkaloid content can be adjusted in cured leaves (e.g., cured tobacco leaves from a modified tobacco plant). Suitably, the alkaloid content can be modulated in an extract of green leaves (e.g., green tobacco leaves from modified tobacco plants). Suitably, the alkaloid content can be modulated in a product comprising a plant of the invention or a part thereof (e.g., a tobacco industry product, e.g., a tobacco industry product produced from a modified tobacco plant or a part thereof). Suitably, the alkaloid content can be modulated in any of the above products or combinations thereof. Suitably, the modulated alkaloid content can be an increased alkaloid content. Suitably, the modulated alkaloid content can be a decreased alkaloid content (e.g., a decreased nornicotine and / or PON content).

[0190] In one embodiment, the content of one or more alkaloids selected from nornicotine, PON, anatabine, and anabasine is reduced. In one embodiment, the content of nornicotine is reduced. In one embodiment, the content of PON is reduced. In one embodiment, the content of anatabine is reduced. In one embodiment, the content of anabasine is reduced.

[0191] In one embodiment, the nicotine content of the modified plant (e.g., tobacco plant), plant propagation material (e.g., tobacco plant propagation material), leaf (e.g., tobacco leaf), harvested leaf (e.g., harvested tobacco leaf), cut harvested leaf (e.g., cut harvested tobacco leaf), processed leaf (e.g., processed tobacco leaf), cut processed leaf (e.g., processed cut tobacco leaf), or tobacco industry product from the modified tobacco plant is not substantially reduced. Suitably, the nicotine content is at least 85% (e.g., at least 90%, e.g., at least 95%, e.g., at least 98%, e.g., at least 99%) of the nicotine content of a comparable product.

[0192] In one embodiment, the alkaloid content of a plant (e.g., a tobacco plant) or portion thereof may be modulated by at least 0.5, 1.5, 2, 3, or 4-fold, respectively, when compared to the alkaloid content of a plant (e.g., a tobacco plant) or portion thereof grown under similar growth conditions that has not been modified to modulate the activity or expression of at least one gene encoding a homeodomain-like MYB domain protein. Suitably, the alkaloid content may be modulated by about 0.5-fold to about 4-fold. Suitably, the alkaloid content may be modulated by about 4-fold. Suitably, the modification may be an increase or decrease in alkaloid content. Suitably, the modulation may be of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, anabasine, and myosmine. Suitably, the modulation may be of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, and anabasine. Suitably, the nornicotine content may be reduced. Suitably, the PON content may be reduced. Suitably, the anatabine content may be reduced. Suitably, the anabasine content may be reduced.

[0193] In one embodiment of the present invention, the alkaloid content of a plant (e.g., a tobacco plant) or portion thereof may be modulated by at least 1%, 2%, 5%, 8%, 10%, 12%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to a plant (e.g., a tobacco plant) or portion thereof that has not been modified according to the present invention. In one embodiment, the alkaloid content may be modulated by at least 30% compared to the unmodified plant or portion thereof. In one embodiment, the alkaloid content may be modulated by at least 40% compared to the unmodified plant or portion thereof. In one embodiment, the alkaloid content may be modulated by at least 50% compared to the unmodified plant or portion thereof. In one embodiment, the alkaloid content may be modulated by at least 60% compared to the unmodified plant or portion thereof. Modulation may be an increase or decrease in alkaloid content compared to the unmodified plant (e.g., a tobacco plant) or portion thereof.

[0194] Suitably, the modulation may be modulation of the total alkaloid content. Suitably, the modulation may be of one or more alkaloids selected from nornicotine, nicotine, PON, anatabine, anabasine, and myosmine. Suitably, the modulation may be of one or more alkaloids selected from nicotine, nornicotine, PON, anatabine, and anabasine. Suitably, the modulation may be modulation of the nornicotine content, for example, a reduction in the nornicotine content. Suitably, the modulation may be modulation of the anabasine content, for example, a reduction in the anabasine content. Suitably, the modulation may be modulation of the PON content, for example, a reduction in the PON content. Suitably, the modulation may be modulation of the anatabine content, for example, a reduction in the anatabine content.

[0195] Suitably, modulation may be of more than one alkaloid selected from nicotine, nornicotine, PON, anatabine, anabasine and myosmine, such as two or three or more alkaloids, for example three or four or more alkaloids, such as four or five or more alkaloids, for example five or six or more alkaloids, for example all six alkaloids.

[0196] In some embodiments, the alkaloid content of the plant may be adjusted between about 5% and about 100%, between about 10% and about 90%, between about 20% and about 80%, between about 30% and about 70%, between about 40% and 60%, between about 40% and 50%, or between about 50% and 60%.

[0197] Tobacco-specific nitrosamine (TSNA) content In one embodiment, the present invention provides a method for reducing the content of at least one TSNA precursor in a plant (e.g., a tobacco plant) or part thereof, or in a tobacco cell. Suitably, the method may comprise modifying the plant by modulating the activity or expression of at least one homeodomain-like MYB domain protein. In one embodiment, the present invention provides a method for producing treated leaves having reduced TSNA content (e.g., relative to a comparable product). The method for producing treated leaves having reduced TSNA content comprises: modifying a plant by reducing or inhibiting the activity or expression of at least one homeodomain-like MYB domain protein; harvesting leaves from said plant; and processing the harvested leaves, e.g., drying them. may include:

[0198] TSNAs can be measured in processed tobacco, such as cured tobacco or reconstituted tobacco. In one embodiment, TSNA content is measured and / or altered (e.g., reduced) in a cured tobacco plant or part thereof (e.g., in cured tobacco leaves).

[0199] The term "tobacco-specific nitrosamine" or "TSNA," as used herein, has its ordinary meaning in the art, i.e., a nitrosamine found only in tobacco industry products or other nicotine-containing products. Suitably, the at least one tobacco-specific nitrosamine may be N'-nitrosonornicotine (NNN), 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), N'-nitrosoanatabine (NAT), or N-nitrosoanabasine (NAB).

[0200] The term "precursor thereof," when used in connection with at least one tobacco-specific nitrosamine, refers to one or more chemicals or compounds in the tobacco plant that cause the formation of, or are involved in, the nitrosation reaction that leads to the production of, the tobacco-specific nitrosamine.

[0201] In one embodiment, the TSNA may be one or more selected from the group consisting of N'-nitrosonornicotine (NNN), 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), N'-nitrosoanatabine (NAT), and N'-nitrosoanabasine (NAB). Suitably, the at least one tobacco-specific nitrosamine may be NNK or NNN. In one embodiment, the tobacco-specific nitrosamine is NNN. In another embodiment, the tobacco-specific nitrosamine is NNK.

[0202] In one embodiment, the precursor of the TSNA is one or more of the group selected from nornicotine, anabasine, anatabine, and an oxidized derivative of nicotine, such as pseudooxynicotine (PON).

[0203] In one embodiment, the TSNA is N'-nitrosonornicotine (NNN) and / or the precursor is nornicotine. In one embodiment, the content of NNN is reduced. In one embodiment, the content of nornicotine is reduced. In one embodiment, the content of NNN and nornicotine is reduced.

[0204] In one embodiment, the TSNA is 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and / or the precursor is PON. In one embodiment, the content of NNK is reduced. In one embodiment, the content of PON is reduced. In one embodiment, the content of NNK and PON is reduced.

[0205] In one embodiment, the TSNA is N'-nitrosoanatabine (NAT) and / or the precursor is anatabine. In one embodiment, the content of NAT is reduced. In one embodiment, the content of anatabine is reduced. In one embodiment, the content of NAT and anatabine is reduced.

[0206] In one embodiment, the TSNA is N'-nitrosoanabasine (NAB) and / or the precursor is anabasine.

[0207] In one embodiment, the content of NAB is reduced. In one embodiment, the content of nornicotine is reduced. In one embodiment, the content of NAB and anabasine is reduced.

[0208] Precursors of TSNAs (e.g., NNK, NNN, NAB, and / or NAT) can be measured, for example, in green tobacco leaves prior to treatment, e.g., prior to curing. In one embodiment, precursors of TSNAs (e.g., NNK, NNN, NAB, and / or NAT) are measured and / or altered (e.g., reduced) in green tobacco leaves prior to treatment, e.g., prior to curing.

[0209] In one embodiment, practicing the method and / or use of the present invention results in a reduction of at least one TSNA or precursor thereof in a modified tobacco plant (or part thereof) when compared to a tobacco plant (or part thereof) that has not been modified according to the present invention.

[0210] The terms "reducing at least one TSNA or precursor thereof" or "reduction of at least one TSNA or precursor thereof" are used herein to mean that the concentration and / or total content of at least one TSNA or precursor thereof in a product, method or use of the invention is lower relative to a comparable product, method or use. For example, a comparable tobacco industry product would be derived from a tobacco plant that has not been modified according to the invention, but in which all other relevant characteristics (e.g., plant species, growing conditions, method of processing the tobacco, etc.) are identical.

[0211] Any method known in the art for determining the concentration and / or level of at least one TSNA or its precursor can be used. In particular, such a method can include the addition of a deuterium-labeled internal standard, aqueous extraction and filtration, followed by analysis using reversed-phase high-performance liquid chromatography (LC-MS / MS) with the possibility of using tandem mass spectrometry. Other examples for determining the concentration and / or level of precursors of tobacco-specific nitrosamines include the CORESTA recommended method CRM-72: Determination of Tobacco Specific Nitrosamines in Tobacco and Tobacco Products by LC-MS / MS; the CRM developed in ISO / DIS 21766; or methods such as those detailed in Wagner et al. (2005) Analytical Chemistry 77(4), 1001-1006, all of which are incorporated herein by reference.

[0212] Suitably, the concentration and / or total content of at least one tobacco-specific nitrosamine or precursor thereof can be reduced by practicing the methods and / or uses of the present invention. Suitably, the concentration and / or level of at least one tobacco-specific nitrosamine or precursor thereof can be reduced in a tobacco plant of the present invention (e.g., obtainable or obtained by the methods and / or uses of the present invention) when compared to the concentration and / or level of at least one tobacco-specific nitrosamine or precursor thereof in a tobacco plant that has not been modified according to the present invention.

[0213] The concentration and / or total content of at least one tobacco-specific nitrosamine or precursor thereof in tobacco leaves, harvested leaves, processed tobacco leaves, tobacco industry products, or combinations thereof obtainable or obtained from a tobacco plant (or tobacco plant part or tobacco cell culture) of the present invention can be reduced when compared to tobacco leaves, harvested leaves, processed tobacco leaves, tobacco industry products, or combinations thereof obtainable or obtained from a tobacco plant (or tobacco plant part or tobacco cell culture) that has not been modified according to the present invention.

[0214] Suitably, the concentration and / or total content of at least one tobacco-specific nitrosamine or precursor thereof may be reduced in the treated tobacco leaves.

[0215] Suitably, the concentration and / or level of at least one tobacco-specific nitrosamine or precursor thereof in a tobacco industry product may be reduced.

[0216] In one embodiment, at least one tobacco-specific nitrosamine or precursor thereof can be reduced by at least about 1%, at least about 3%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, or at least about 50%. In some embodiments, at least one tobacco-specific nitrosamine or precursor thereof can be reduced by between about 5% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, or between about 40% and 50%.

[0217] In the context of treated (e.g., cured) tobacco leaves (e.g., cured or reconstituted), at least one tobacco-specific nitrosamine or precursor thereof can be reduced by between about 5000 ng / g and about 50 ng / g, between about 4000 ng / g and about 100 ng / g, between about 3000 ng / g and 500 ng / g, or between 2000 ng / g and 1000 ng / g. In some embodiments, at least one tobacco-specific nitrosamine or precursor thereof can be reduced by at least about 5000 ng / g, at least about 4000 ng / g, at least about 3000 ng / g, at least about 2000 ng / g, at least about 1000 ng / g, at least about 500 ng / g, at least about 100 ng / g, or at least about 50 ng / g.

[0218] Biomass generation In some cases, it may be desirable to produce plants or biomass with high alkaloid levels, e.g., high levels of nicotine content, so that the nicotine can be purified to produce pure nicotine products, e.g., for use in devices that utilize nicotine-containing liquids (e.g., e-cigarettes) or in tobacco heating devices. For example, producing nicotine in this manner could reduce the cost of nicotine extraction for the production of e-liquids for e-cigarettes.

[0219] In one aspect, the present invention provides a method for producing biomass, comprising: Growing cells that have been engineered to modulate (e.g., increase) the activity or expression of a homeodomain-like MYB domain protein under conditions that produce biomass. Suitably, the activity or expression of the homeodomain-like MYB domain protein may be increased to increase the concentration and / or total nicotine content.

[0220] In one embodiment, the invention provides a method for producing biomass with an altered (e.g., increased) concentration and / or total nicotine content, comprising growing cells that have been engineered to increase the activity or expression of at least one homeodomain-like MYB domain protein, wherein the at least one homeodomain-like MYB domain protein comprises the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant, functional fragment, or ortholog thereof, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homolog of SEQ ID NO: 3; or wherein the at least one homeodomain-like MYB domain protein comprises the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homolog of SEQ ID NO: 1 or 2.

[0221] The cells can be engineered by any method known in the art to alter the activity or expression of at least one homeodomain-like MYB domain protein. Suitably, the cells can be engineered to express an exogenous gene encoding the homeodomain-like MYB domain protein. Suitably, the cells can be engineered to overexpress the gene encoding the homeodomain-like MYB domain protein.

[0222] Suitably, the biomass may contain a higher concentration and / or total content of nicotine compared to biomass produced by a comparable cell that has not been modified in accordance with the present invention.

[0223] Suitably, the cells for use in biomass production may be plant cells, for example tobacco cells.

[0224] Suitably, the cells for use in biomass production may be yeast cells.

[0225] In one embodiment, the cell (e.g., yeast cell) can be further modified to include one or more sequences that increase nicotinic alkaloid biosynthesis. Suitably, these one or more sequences can be incorporated into a nucleic acid construct that is suitable for cell (e.g., yeast cell) transformation. The one or more sequences can be overexpressed in the cell (e.g., yeast cell). The sequences can be selected from one or more of the following genes: : MPO (or methylputrescine oxidase or MPO1 or MPO2), A622 (or isoflavone reductase-like protein or isoflavone reductase homolog or isoflavone reductase-like protein), BBL (or berberine bridge enzyme or berberine bridge enzyme-like or BBE or NBBl), PMT (or putrescine N-methyltransferase or putrescine methyltransferase or S-adenosyl-L-methionine:putrescine N-methyltransferase or PMT or PMT1 or PMT2 or PMT3 or PMT4), and QPT (or quinolinate phosphoribosyltransferase). In one embodiment, the sequence may be selected from one or more of the following genes: BBL, A622, PMT, and MPO (MPO1 or MPO2). Suitable genes for modification in this manner may be taught, for example, in U.S. Patent No. 2016032299, incorporated herein by reference.

[0226] commercially desirable traits In one embodiment, the plants of the invention have an altered (e.g., increased or decreased) total alkaloid content and / or an altered (e.g., increased or decreased) content of one or more alkaloids, while at least maintaining flavor characteristics and / or other commercially desirable traits. Suitably, the plants of the invention may have a reduced total alkaloid content and / or a reduced content of one or more alkaloids, while at least maintaining flavor characteristics and / or other commercially desirable traits.

[0227] In one embodiment, a plant of the present invention produces leaves of a similar grade and / or quality to a plant that has not been modified according to the present invention.

[0228] In one embodiment, a plant of the present invention has reduced nornicotine and / or PON and / or anabasine and / or anatabine content without a significant change in the flavor profile of the plant (e.g., compared to the same plant not modified according to the present invention).

[0229] In one embodiment, a plant of the invention has reduced TSNA precursor content without significant alteration (e.g., reduction) of other commercially desirable traits of the plant (e.g., compared to the same plant not modified in accordance with the invention). In particular, the yield of the modified plant is preferably not reduced compared to the same plant not modified in accordance with the invention.

[0230] Thus, in one embodiment, the methods and uses of the present invention relate to reducing TSNA precursor content while maintaining flavor characteristics and / or other commercially desirable traits (eg, yield).

[0231] The term "commercially desirable trait", as used herein, includes traits such as yield, mature plant height, number of harvestable leaves, average node length, cutter leaf length, cutter leaf width, quality (e.g. leaf quality, suitably dry leaf quality), abiotic (e.g. drought) stress tolerance, herbicide tolerance and / or biotic (e.g. insect, bacterial or fungal) stress tolerance.

[0232] Leaf quality can be measured based on the color, texture, and aroma of the dried leaves, for example, according to the grades and standards of the United States Department of Agriculture (USDA).

[0233] Tobacco grades are assessed based on factors including, but not limited to, petiole position, leaf size, leaf color, leaf uniformity and integrity, maturity, texture, elasticity, gloss (related to the intensity and depth of coloration and brilliance of the leaf), hygroscopicity (the ability of the tobacco leaf to absorb and retain environmental moisture), and green shade or appearance.

[0234] Leaf grades can be determined using standard methods known in the art, for example, using the official standard grades issued by the Agricultural Marketing Service of the United States Department of Agriculture (7 USC § 511). For example, official standard grades for burley tobacco (U.S. Type 31 and foreign Type 93), effective November 5, 1990 (55 FR 40645); official standard grades for flue-cured tobacco (U.S. Types 11, 12, 13, 14, and foreign Type 92), effective March 27, 1989 (54 FR 7925); official standard grades for Pennsylvania seed leaf tobacco (U.S. Type 41), effective January 8, 1965 (29 FR 16854); official standard grades for Ohio cigar leaf tobacco (U.S. Types 42, 43, and 44), effective December 8, 1963 (28 FR 11719 and 28 FR 11926); official standard grades for Wisconsin cigar binder tobacco (U.S. Types 54 and 55), effective November 20, 1969 (34 FR 17061); Official Standard Grades for Wisconsin Cigar Binder Tobacco (U.S. Types 54 and 55), effective November 20, 1969 (34 FR 17061); Official Standard Grades for Georgia and Florida Shade-Grown Cigar-Wrapper Tobacco (U.S. Type 62), effective April 1971. USDA grade index values ​​can be determined according to industry-recognized grade indexes. See, e.g., Bowman et al. (1988) Tobacco Science, 32:39-40; Legacy Tobacco Document Library (Bates Document #523267826-523267833, July 1, 1988, Memorandum on the Proposed Burley Tobacco Grade Index); and Miller et al. (1990) Tobacco Intern., 192:55-57 (all of the foregoing references are incorporated herein in their entirety).

[0235] In one embodiment, the USDA Grade Index is a numerical representation of the received federal grade, ranging from 0 to 100, and is a weighted average of all petiole positions. A higher grade index indicates higher quality. Alternatively, leaf grade can be determined by hyperspectral imaging. See, for example, International Publication No. WO 2011 / 027315 (incorporated herein by reference).

[0236] In one embodiment, the tobacco plants of the present invention provide commercially acceptable grades of tobacco.

[0237] Suitably, the tobacco plants of the present invention provide commercially acceptable grades of cured tobacco.

[0238] In one embodiment, a tobacco plant of the present invention is capable of producing leaves having a USDA grading index value that is at least about 70% of the USDA grading index value of a leaf of a comparable plant when grown under similar growing conditions. Suitably, the tobacco plants disclosed herein may be capable of producing leaves having a USDA grading index value that is at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 98% of the USDA grading index value of a control plant when grown under similar growing conditions. Suitably, the tobacco plants disclosed herein may be capable of producing leaves having a USDA Grade Index value of between 65% and 130%, between 70% and 130%, between 75% and 130%, between 80% and 130%, between 85% and 130%, between 90% and 130%, between 95% and 130%, between 100% and 130%, between 105% and 130%, between 110% and 130%, between 115% and 130%, or between 120% and 130% of the USDA Grade Index value of a comparable plant.

[0239] In one aspect, tobacco plants of the present invention are capable of producing leaves having a USDA Grade Index value of at least 50. Suitably, tobacco plants disclosed herein may be capable of producing leaves having a USDA Grade Index value of 55 or greater, 60 or greater, 65 or greater, 70 or greater, 75 or greater, 80 or greater, 85 or greater, 90 or greater, and 95 or greater.

[0240] Unless otherwise specified, as used herein, tobacco yield refers to cured leaf yield calculated based on the weight of cured tobacco leaf per acre under standard field conditions according to standard agricultural and curing practices.

[0241] In one embodiment, a plant (e.g., a tobacco plant) of the present invention has a yield of between 50% and 150%, between 55% and 145%, between 60% and 140%, between 65% and 135%, between 70% and 130%, between 75% and 125%, between 80% and 120%, between 85% and 115%, between 90% and 110%, between 95% and 105%, between 50% and 100%, between 55% and 100%, between 60% and 100%, between 65% and 100% of the yield of a comparable plant grown under similar field conditions. %, between 70% and 100%, between 75% and 100%, between 80% and 100%, between 85% and 100%, between 90% and 100%, between 95% and 100%, between 100% and 150%, between 105% and 150%, between 110% and 150%, between 115% and 150%, between 120% and 150%, between 125% and 150%, between 130% and 150%, between 135% and 150%, between 140% and 150% or between 145% and 150%.

[0242] In another aspect, the yield of a plant of the invention (e.g., a tobacco plant) is approximately 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 times the yield of a comparable plant grown under similar field conditions.

[0243] In another aspect, the yield of tobacco plants of the present invention is comparable to the yield of comparable flue-cured plants when grown under similar field conditions.

[0244] In one embodiment, the tobacco plants of the present invention provide a yield selected from the group consisting of about between 1200 and 3500 pounds / acre, between 1300 and 3400 pounds / acre, between 1400 and 3300 pounds / acre, between 1500 and 3200 pounds / acre, between 1600 and 3100 pounds / acre, between 1700 and 3000 pounds / acre, between 1800 and 2900 pounds / acre, between 1900 and 2800 pounds / acre, between 2000 and 2700 pounds / acre, between 2100 and 2600 pounds / acre, between 2200 and 2500 pounds / acre, and between 2300 and 2400 pounds / acre.

[0245] In another embodiment, the tobacco plants of the present invention have a yield of between about 1200 and 3500 lbs / acre, between 1300 and 3500 lbs / acre, between 1400 and 3500 lbs / acre, between 1500 and 3500 lbs / acre, between 1600 and 3500 lbs / acre, between 1700 and 3500 lbs / acre, between 1800 and 3500 lbs / acre, between 1900 and 3500 lbs / acre, between 2000 and 3500 lbs / acre, between 2100 and 3500 lbs / acre, The present invention provides a yield selected from the group consisting of between 2200 and 3500 lbs / acre, between 2300 and 3500 lbs / acre, between 2400 and 3500 lbs / acre, between 2500 and 3500 lbs / acre, between 2600 and 3500 lbs / acre, between 2700 and 3500 lbs / acre, between 2800 and 3500 lbs / acre, between 2900 and 3500 lbs / acre, between 3000 and 3500 lbs / acre and between 3100 and 3500 lbs / acre.

[0246] In further embodiments, the tobacco plants of the present invention produce between about 1200 and 3500 pounds per acre, between 1200 and 3400 pounds per acre, between 1200 and 3300 pounds per acre, between 1200 and 3200 pounds per acre, between 1200 and 3100 pounds per acre, between 1200 and 3000 pounds per acre, between 1200 and 2900 pounds per acre, between 1200 and 2800 pounds per acre, between 1200 and 2700 pounds per acre, between 1200 and 2600 pounds per acre, between 1200 and 2500 pounds per acre. In some embodiments, the yield is selected from the group consisting of between 1200 and 2400 lbs / acre, between 1200 and 2300 lbs / acre, between 1200 and 2200 lbs / acre, between 1200 and 2100 lbs / acre, between 1200 and 2000 lbs / acre, between 1200 and 1900 lbs / acre, between 1200 and 1800 lbs / acre, between 1200 and 1700 lbs / acre, between 1200 and 1600 lbs / acre, between 1200 and 1500 lbs / acre, and between 1200 and 1400 lbs / acre.

[0247] plant breeding In one embodiment, the present invention provides a. crossing a donor plant having altered (e.g., reduced) nicotine content and / or altered (e.g., reduced) TSNA precursor content, and wherein the activity or expression of at least one homeodomain-like MYB domain protein according to the present invention is modulated (e.g., reduced) in the donor plant according to the present invention, with a recipient tobacco plant having an unaltered nicotine content or unaltered TSNA precursor content and commercially desirable traits; b. isolating genetic material from the progeny of the donor plant crossed with the recipient plant; and c. performing molecular marker-assisted selection using molecular markers, identifying an introgressed region containing a mutation in a polynucleotide sequence encoding a protein as defined in ia; performing molecular marker assisted selection, The present invention provides a method for producing a plant with altered alkaloid content and / or altered TSNA precursor content, comprising:

[0248] Suitably, the activity or expression of a protein comprising the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant, functional fragment, or orthologue thereof, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3, or a protein encoded by the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2, is modulated in the donor plant when compared to an equivalent plant. Suitably, the method reduces alkaloid content and / or TSNA precursor content. Suitably, the alkaloid content and / or TSNA precursor content is reduced and the activity or expression of the homeodomain-like MYB domain protein is reduced or inhibited.

[0249] Molecular marker-assisted selection may involve performing PCR to identify introgressed nucleic acid sequences containing mutations that modulate the activity or expression of a protein comprising the amino acid sequence set forth in SEQ ID NO: 3, or an amino acid sequence having at least 80% identity thereto.

[0250] tobacco plant The present invention provides methods, uses directed to plants (eg, tobacco plants), as well as cells (eg, tobacco cells), cell cultures, plants (eg, tobacco plants), and plant propagation material.

[0251] As used herein, the term "tobacco plant" refers to plants of the genus Nicotiana that are used in the production of tobacco industry products. Non-limiting examples of suitable "tobacco" plants include N. tabacum and N. rustica (e.g., N. tabacum L., LA B21, LN KY171, TI 1406, Basma, Galpao, Perique, Beinhart 1000-1, and Petico).

[0252] Tobacco materials can be derived from or obtained from various Nicotiana tabacum types, commonly known as burley, flue or bright, and dark. In some embodiments, the tobacco material is derived from a burley, Virginia, or dark tobacco plant. The tobacco plant can be selected from burley, rare, specialty, expanded, or the like.

[0253] The use of tobacco cultivars and elite tobacco cultivars is also contemplated herein. Tobacco plants for use herein may therefore be of Nicotiana species or elite tobacco cultivars. Particularly useful Nicotiana tabacum species include flue-cured Virginia types, Burley types, and Oriental types.

[0254] One of the snowflakes is the 1st of the 2nd Material No.: L. No. Ti1068 AA37-1.B 13P Xanthi(Mitchell-Mor) KT D#3 107 Bel-W3 79-615 Samsun Holmes NN BU21×Sheet Parado's license plate is F4, number 97, KTRDC#2 page 49, KTRDC#4 page 1 10, バーレー21, PM016, KTRDC#5 KY 160 SI, KTRDC#7 FCA, KTRDC#6 TN 86 SI, PM021, K 149, K 326, K 346, K 358, K 394, K 399, K 730, KY 10, KY 14, KY 160, KY 17, KY 8959, KY 9, KY 907, MD 609, McNair 373, NC 2000, PG 01, PG 04, P01, P02, P03, RG 11, RG 17, RG 8, Speight G-28, TN 86, TN 90, VA 509, AS44, Banquet A1, Basma Drama B84 / 31, Basma I Study ZP4 / B, Basma Xanthi BX 2A, Batek, Besuki Jember, C104, Coker 319, Coker 347, Creole Missionary, PM092, Delcrest, Djebel 81, DVH 405, Galpao Comum, HB04P, Hicks Broadleaf, Kabakulak Elassona, PM102, Kutsage E1, KY 14×L8, KY 171, LA BU 21, McNair 944, NC 2326, NC 71, NC 297, NC 3, PVH 03, PVH 09, PVH 19, PVH 21 10, Red Russian, Samsun, Saplak, Simmaba, Talgar 28, PM132, Wislica, Yayaldag, NC 4, TR Madole, Prilep HC-72、Prilep P23、Prilep PB 156 / 1、Prilep P12-2 / 1、About JK-48、About JB125 / 3, ΤΙ-1068, KDH-960, TI-1070, TW136, PM204, PM205, Basma, TKF 4028, L8, TKF 2002, TN 90, GR141, Basma xanthi, GR149, GR153, and Petit Havana.

[0255] Non-limiting examples of species or cultivars are: BD 64, CC 101, CC 200, CC 27, CC 301, CC 400, CC 500, CC 600, CC 700, CC 800, CC 900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CD 263, DF91 1, DT 538 LC, Galpao tobacco, GL 26H, GL 350, GL 600, GL 737, GL 939, GL 973, HB 04P, HB 04P LC, HB3307PLC, Hybrid 403LC, Hybrid 404LC, Hybrid 501 LC, K 149, K 326, K 346, K 358, K394, K 399, K 730, KDH 959, KT 200, KT204LC, KY10, KY14, KY 160, KY 17, KY 171, KY 907, KY907LC, KTY14xL8 LC, Little Crittenden, McNair 373, McNair 944, msKY 14xL8, Narrow Leaf Madole, Narrow Leaf Madole LC, NBH 98, N-126, N-777LC, N-7371 LC, NC 100, NC 102, NC 2000, NC 291, NC 297, NC 299, NC 3, NC 4, NC 5, NC 6, NC7, NC 606, NC 71, NC 72, NC 810, NC BH 129, N.C. 2002, Neal Smith Madole, OXFORD 207, PD 7302 LC, PD 7309 LC, PD 7312 LC "Periq'e" Tobacco, PVH03, PVH09, PVH19, PVH50, PVH51, R 610, R 630, R 7-1 1, R 7-12, RG 17, RG 81, RG H51, RGH 4, RGH 51, RS 1410, Speight 168, Speight 172, Speight 179, Speight 210, Speight 220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight G-70, Speight H-6, Speight H20, Speight NF3, Tl 1406, Tl 1269, TN86, TN86LC, TN 90, TN 97, TN97LC, TN D94, TN D950, TR (Tom Rosson) Madole, VA 309, VA359, AA 37-1, B 13P, Xanthi (Mitchell-Mor), Bel-W3, 79-615, Samsung Holmes NN, KTRDC number 2 hybrid 49, Burley 21, KY 8959, KY 9, MD 609, PG 01, PG 04, P01, P02, P03, RG 1 1, RG 8, VA 509, AS44, Banket A1, Basma Drama B84 / 31, Basma I Zichna ZP4 / B, Basma Xanthi BX 2A, Batek, Besuki Jember, C104, Coker 347, Criollo Misionero, Delcrest, Djebel 81, DVH 405, Galpao Comum, HB04P, Hicks Broadleaf, Kabakulak Elassona, Kutsage E1, LA BU 21, NC 2326, NC 297, PVH 21 10, Red Russian, Samsun, Saplak, Simmaba, Talgar 28, Wislica, Yayaldag, Prilep HC-72, Prilep P23, Prilep PB 156 / 1, Prilep P12-2 / 1, Yaka JK-48, Yaka JB 125 / 3, TI-1068, KDH-960, Tl-1070, TW136, Basma, TKF 4028, L8, TKF 2002, GR141, Basma xanthi, GR149, GR153, Petit Havana. Less converted variants of the above are also contemplated, even if not specifically identified herein.

[0256] The tobacco plant may be burley, flue-cured Virginia, or oriental.

[0257] In one embodiment, the plant propagation material can be obtained from a plant of the invention (eg, a tobacco plant).

[0258] As used herein, "plant propagation material" refers to any plant matter obtained from a plant from which further plants can be generated. Suitably, the plant propagation material may be selected from seeds, plant callus, and plant mass. Suitably, the plant propagation material may be seeds. Suitably, the plant propagation material may be plant callus. Suitably, the plant propagation material may be plant mass.

[0259] In one embodiment, cells (eg, tobacco cells), cell cultures, tobacco plants, and / or plant propagation material are obtainable (eg, obtainable) by methods according to the invention.

[0260] Suitably, tobacco plants according to the present invention that have been modified to modulate (e.g., decrease) the activity or expression of at least one homeodomain-like MYB domain protein may have a modulated (e.g., decreased) nicotine content when compared to an unmodified tobacco plant. Suitably, tobacco plants according to the present invention that have been modified to decrease or inhibit the activity or expression of at least one homeodomain-like MYB domain protein may have a decreased nicotine content when compared to an unmodified tobacco plant.

[0261] Suitably, tobacco plants according to the present invention may have a modulated (e.g., reduced) content of TSNA precursors when compared to unmodified tobacco plants, where the tobacco plants have been modified to modulate (e.g., reduce) the activity or expression of at least one homeodomain-like MYB domain protein.

[0262] Suitably, tobacco plants according to the present invention that have been modified to reduce or inhibit the activity or expression of at least one homeodomain-like MYB domain protein may have a reduced TSNA precursor content when compared to unmodified tobacco plants.

[0263] In one embodiment, a tobacco plant according to the invention comprises a tobacco cell of the invention.

[0264] In another embodiment, plant propagation material can be obtained (eg, can be obtained) from a tobacco plant of the present invention.

[0265] In one embodiment, there is provided a use of a tobacco plant described herein for breeding tobacco plants.

[0266] The present invention also provides, in another embodiment, the use of the tobacco plant of the previous embodiment for producing a tobacco industry product.

[0267] In another embodiment, there is provided a use of a tobacco plant of the present invention to produce a crop.

[0268] In one embodiment, there is provided a use of a cell as provided in the previous embodiment for producing a tobacco industry product.

[0269] In one embodiment, the invention provides a cell culture (eg, an in vitro culture).

[0270] The tobacco cell culture may be a cell suspension culture. These in vitro cultured cells may be incorporated into tobacco industry products, for example, as a replacement for traditional tobacco particles, shreds, fine-cut or long-cut tobacco flakes, as an additive component, or as both a replacement and an additive. Suitably, the cell culture is capable of producing nicotine.

[0271] In one embodiment there is provided the use of a cell culture, such as a harvested and / or processed cell culture, according to the invention for producing a tobacco industry product.

[0272] Tobacco cells harvested from in vitro culture can be dried, eg, freeze-dried, eg, to produce a powder.

[0273] In one embodiment, the cell culture is a tobacco cell culture. Those skilled in the art will recognize known methods for establishing in vitro cultures of tobacco cells. By way of example only, the following methods may be used: collecting seeds from desired tobacco plants, sterilizing the outside of these seeds to remove undesirable organisms, planting the seeds to grow desired tobacco plants, removing tissue from the tobacco plants (e.g., from tobacco stems) to use as explants, establishing callus cultures from the tobacco explants, establishing cell suspension cultures from the callus cultures, and harvesting culture material (e.g., including tobacco cells) to produce tobacco cell cultures.

[0274] Tobacco cells can be harvested by a variety of methods, including filtration, e.g., vacuum filtration. The sample can be washed in a filter by adding water, and the remaining liquid is removed by filtration, e.g., vacuum filtration.

[0275] The harvested tobacco cell culture can be further processed, for example, dried, e.g., air-dried and / or freeze-dried. The harvested tobacco cell culture or the dried harvested tobacco cell culture or an extract thereof can be incorporated into tobacco industry products according to the present invention.

[0276] In one embodiment, the present invention provides a plant (e.g., a tobacco plant) or part thereof for use in molecular agriculture. Suitably, a plant or part thereof modified according to the present invention can be used in the production of proteins such as therapeutic substances, e.g., antibiotics, virus-like particles, nutraceuticals, or small molecules.

[0277] In one embodiment, the invention provides a method for producing a protein (e.g., a therapeutic protein), comprising modifying a plant or part thereof capable of producing said protein (e.g., a therapeutic protein) by modulating (e.g., decreasing) the activity or expression of at least one homeodomain-like MYB domain protein having the amino acid sequence set forth in SEQ ID NO: 3, or a functional variant, functional fragment, or ortholog thereof, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homolog of SEQ ID NO: 3, or at least one homeodomain-like MYB domain protein comprising the nucleotide sequence set forth in SEQ ID NO: 1 or 2, or a functional variant, functional fragment, or ortholog of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homolog of SEQ ID NO: 1 or 2, and culturing the plant under conditions sufficient to allow production of the protein (e.g., a therapeutic protein).

[0278] product The present invention also provides products obtainable or obtained from plants according to the invention. Products are provided that are obtainable or obtained from plants in which the activity or expression of a homeodomain-like MYB domain protein is modulated.

[0279] In one embodiment, an article of manufacture may comprise a construct of the invention that modulates the activity or expression of at least one homeodomain-like MYB domain protein as defined herein, hi one embodiment, an article of manufacture may comprise a construct of the invention that modulates the nucleic acid sequence of at least one homeodomain-like MYB domain protein as defined herein.

[0280] The present invention also provides products obtainable or obtained from tobacco according to the present invention.

[0281] In one embodiment, there is provided a use of a tobacco plant of the present invention for producing tobacco leaves.

[0282] Suitably, the tobacco leaves may be subjected to downstream applications such as treatment.

[0283] Thus, in one embodiment, use of the foregoing embodiments may provide treated tobacco leaves. Suitably, the tobacco leaves may be dried, fermented, pasteurized, or a combination thereof. In another embodiment, the tobacco leaves may be cut. In some embodiments, the tobacco leaves may be cut before or after being dried, fermented, pasteurized, or a combination thereof.

[0284] In one embodiment, the present invention provides harvested leaves of a tobacco plant of the present invention.

[0285] In a further embodiment, harvested leaves can be obtained (eg, can be obtained) from tobacco plants propagated from propagation material of the present invention.

[0286] In another embodiment there is provided a harvested leaf obtainable from the method or use of the present invention.

[0287] Suitably, the harvested leaves may be cut harvested leaves.

[0288] In some embodiments, the harvested leaves may contain viable tobacco cells. In other embodiments, the harvested leaves may be subjected to further processing.

[0289] Processed tobacco leaves are also provided.

[0290] The treated tobacco leaves may be obtained from a tobacco plant of the present invention. Suitably, the treated tobacco leaves may be obtained from a tobacco plant obtained according to any method and / or use of the present invention.

[0291] Suitably, the treated leaves may have a reduced content of one or more TSNAs selected from NNN, NNK, NAT, and NAB. Suitably, the content of NNN may be reduced. Suitably, the content of NNK may be reduced. Suitably, the content of NAT may be reduced. Suitably, the content of NAB may be reduced. Suitably, the reduction in TSNA content is compared to an equivalent product that has not been modified according to the present invention.

[0292] In another embodiment, the treated tobacco leaves can be obtained (eg, obtained) from tobacco plants propagated from tobacco plant propagation material according to the present invention.

[0293] The treated tobacco leaves of the present invention can be obtained (eg, obtained) by treating the harvested leaves of the present invention.

[0294] As used herein, the term "treated tobacco leaf" refers to tobacco leaf that has undergone one or more processing steps that tobacco undergoes in the art. "Processed tobacco leaf" is free or substantially free of viable cells.

[0295] The term "viable cells" refers to cells that are capable of proliferation and / or metabolically active. Thus, when a cell is said to be not alive, also called "non-viable," the cell does not exhibit the characteristics of a viable cell.

[0296] The term "substantially no viable cells" means that less than about 5% of the total cells are viable, preferably less than about 3%, more preferably less than about 1%, and even more preferably less than about 0.1% of the total cells are viable.

[0297] In one embodiment, the treated tobacco leaves may be processed by one or more of curing, fermentation, and / or pasteurization.

[0298] Suitably, the treated tobacco leaves may be treated by drying.

[0299] The tobacco leaves may be dried by any method known in the art, hi one embodiment, the tobacco leaves may be dried by one or more drying methods selected from the group consisting of air drying, flame drying, flue drying, and sun drying.

[0300] Suitably, the tobacco leaves may be air-dried.

[0301] Air-curing is typically done by hanging tobacco leaves to dry in well-ventilated barns, usually over a period of 4 to 8 weeks. Air-curing is particularly suited to burley tobacco.

[0302] Suitably, tobacco leaves may be flue-cured, which is typically done by hanging the leaves in large barns where hardwood is kept burning with continuous or intermittent low-smoke smoke, and usually takes between 3 days and 10 weeks, depending on the treatment and tobacco.

[0303] In another embodiment, tobacco leaves can be flue-cured. Flue-curing can involve wrapping tobacco leaves into tobacco sticks and hanging them from stepped poles in a drying barn. The barn usually has a flue leading from an externally fueled firebox. This typically results in heat-cured tobacco without exposure to smoke. Typically, the temperature is increased slowly during the drying process, and the entire process takes approximately one week.

[0304] Suitably, the tobacco leaves may be sun-cured, a process that typically involves exposing uncoated tobacco to sunlight.

[0305] Suitably, the treated tobacco leaves may be treated by fermentation.

[0306] Fermentation can be carried out in any manner known in the art. Typically, during fermentation, tobacco leaves are stacked into a dry tobacco pile (bulk), which is covered, for example, with burlap to retain moisture. The combination of residual moisture inside the leaves and the weight of the tobacco generates natural heat, which mellows the tobacco. The temperature at the center of the bulk is monitored once a day. In some methods, the entire bulk is opened weekly. The leaves are then removed, shaken, and moistened, and the bulk is rotated to replace the inner and outer leaves of the bulk, bringing the bottom leaves to the top. This ensures even fermentation throughout the bulk. The additional moisture on the leaves and the actual rotation of the leaves themselves generates heat, releasing the tobacco's natural ammonia and reducing nicotine, while also darkening the color and improving the tobacco's aroma. Typically, the fermentation process continues for up to six months, depending on the tobacco species, the position and thickness of the petiole on the leaf, and the intended use of the leaf.

[0307] Suitably, the processed tobacco leaf may be treated by pasteurization, which may be particularly preferred when the tobacco leaf is used to make smokeless tobacco industry products, most preferably snus.

[0308] Pasteurization of tobacco leaves can be carried out by any method known in the art, for example, as detailed in J Foulds, L Ramstrom, M Burke, K Fagerstrom. Effect of smokeless tobacco (snus) on smoking and public health in Sweden Tobacco Control (2003) 12: 349-359, the teachings of which are incorporated herein by reference.

[0309] In the production of snus, pasteurization is typically performed by heat treating tobacco with steam (reaching a temperature of approximately 100°C) for 24-36 hours. This results in a nearly sterile product, and without wishing to be bound by theory, one of the consequences of this is thought to be limiting further TSNA formation.

[0310] In one embodiment, the pasteurization may be steam pasteurization.

[0311] In some embodiments, the treated tobacco leaf may be cut. The treated tobacco leaf may be cut before or after treatment. Suitably, the treated tobacco leaf may be cut after treatment.

[0312] In one embodiment, the use of the foregoing embodiments may provide reconstituted tobacco.

[0313] In one embodiment, a reconstituted tobacco is provided.

[0314] As used herein, "reconstituted" refers to tobacco material produced from tobacco leaves remaining after processing, which may also be called recon, which is recycled or homogenized sheet tobacco. Reconstituted tobacco allows for the production of consistent, high-quality blends and allows for the control of the ratios of individual components.

[0315] Reconstituted tobacco can be nanofiber recon (nanofibers can be extracted in solid or liquid form), paper recon (which uses stems, flakes, and midribs as raw materials), or slurry-type recon (which uses a mixture of fines and tobacco stems ground into a powder and mixed with water and a vegetable binder, and the soluble residue is formed into a sheet by extracting the water).

[0316] Any method known in the art can be used to make reconstituted tobacco, see, for example, CORESTA Congress, Sapporo, 2012, Smoke Science / Product Technology Groups, SSPT 12 (incorporated herein by reference).

[0317] In some embodiments, tobacco plants, harvested tobacco plant leaves, and / or processed tobacco leaves can be used to extract nicotine.Nicotine extraction can be performed using any method known in the art.For example, a method for extracting nicotine from tobacco is taught in U.S. Patent No. 2,162,738, which is incorporated herein by reference.

[0318] In one aspect, the present invention provides a cured tobacco material made from a tobacco plant or part thereof according to the present invention.

[0319] Suitably, the cured tobacco may have a reduced content of one or more TSNAs selected from NNK, NNN, NAT, and NAB. Suitably, the NNN content may be reduced. Suitably, the NNK content may be reduced. Suitably, the NAT content may be reduced. Suitably, the NAB content may be reduced. Suitably, the reduced TSNA content is compared to an equivalent product that has not been modified according to the present invention.

[0320] In another aspect, the present invention provides a tobacco blend comprising tobacco material produced from a tobacco plant or part thereof in accordance with the present invention or from a tobacco cell culture in accordance with the present invention. In one aspect, the present invention provides a tobacco blend comprising a dried tobacco material in accordance with the present invention.

[0321] Suitably, a tobacco blend according to the present invention may comprise approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% tobacco derived from a tobacco plant or part thereof according to the present invention or a tobacco cell culture according to the present invention. Suitably, a tobacco blend may comprise approximately 10% tobacco derived from a tobacco plant or part thereof according to the present invention or a tobacco cell culture according to the present invention. Suitably, a tobacco blend may comprise approximately 20% tobacco derived from a tobacco plant or part thereof according to the present invention or a tobacco cell culture according to the present invention. Suitably, a tobacco blend may comprise approximately 30% tobacco derived from a tobacco plant or part thereof according to the present invention or a tobacco cell culture according to the present invention. Suitably, a tobacco blend may comprise approximately 40% tobacco derived from a tobacco plant or part thereof according to the present invention or a tobacco cell culture according to the present invention. Suitably, the tobacco blend may comprise approximately 50% tobacco derived from a tobacco plant or part thereof in accordance with the present invention or a tobacco cell culture in accordance with the present invention. Suitably, the tobacco blend may comprise approximately 60% tobacco derived from a tobacco plant or part thereof in accordance with the present invention or a tobacco cell culture in accordance with the present invention. Suitably, the tobacco blend may comprise approximately 70% tobacco derived from a tobacco plant or part thereof in accordance with the present invention or a tobacco cell culture in accordance with the present invention. Suitably, the tobacco blend may comprise approximately 80% tobacco derived from a tobacco plant or part thereof in accordance with the present invention or a tobacco cell culture in accordance with the present invention. Suitably, the tobacco blend may comprise approximately 90% tobacco derived from a tobacco plant or part thereof in accordance with the present invention or a tobacco cell culture in accordance with the present invention.

[0322] In one embodiment, a tobacco blend product of the present invention comprises at least about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 95 dry weight percent cured tobacco from a tobacco plant or portion thereof in accordance with the present invention or from a tobacco cell culture in accordance with the present invention.

[0323] Suitably, the dried tobacco material may be air-dried. Suitably, the dried tobacco material may be flue-dried. Suitably, the dried tobacco material may be sun-dried. Suitably, the dried tobacco material may be flame-dried.

[0324] Tobacco industry products or smoking articles according to the present invention may comprise tobacco material (e.g., dried tobacco material or reconstituted tobacco material) according to the present invention.

[0325] In another aspect, the present invention provides a tobacco industry product.

[0326] In one embodiment, the tobacco industry product according to the present invention may be a blended tobacco industry product. Suitably, the tobacco blend may comprise a dried tobacco material according to the present invention.

[0327] In one embodiment, tobacco industry products can be prepared from tobacco plants or parts thereof of the present invention.

[0328] Suitably, tobacco plants or parts thereof can be propagated from tobacco plant propagation material according to the present invention.

[0329] As used herein, the term "part thereof," in the context of a tobacco plant, refers to a part of the tobacco plant. Suitably, the "part thereof" may be the leaves, roots, or stems of the tobacco plant, or the flowers. Suitably, the "part thereof" may be the leaves, roots, or stems of the tobacco plant.

[0330] Tobacco Industry Products As used herein, the term "tobacco industry products" includes combustible smoking articles such as cigarettes, cigarillos, cigars, pipe or hand-rolled tobacco (whether based on tobacco, tobacco derivatives, expanded tobacco, reconstituted tobacco, tobacco substitutes, or other smokable materials), non-combustible aerosol delivery systems, such as heating products that release compounds from a substrate material without combustion, such as hybrid systems for generating aerosols from combinations of substrate materials, e.g., hybrid systems containing liquid, gel, or solid substrates, and aerosolizable substrate materials used in conjunction with these aerosol delivery systems; and aerosol-free delivery articles that may or may not deliver nicotine, such as lozenges, gums, patches, respirable powder-containing articles, and smokeless tobacco industry products such as snuff and snuff.

[0331] In one embodiment, a tobacco industry product can be prepared from (eg, can include) a tobacco plant or part thereof of the present invention.

[0332] Suitably, tobacco plants or parts thereof can be propagated from tobacco plant propagation material according to the present invention.

[0333] As used herein, the term "part thereof" in the context of a tobacco plant refers to a part of the tobacco plant. Preferably, the "part thereof" is a leaf of the tobacco plant.

[0334] In another embodiment, tobacco industry products can be prepared from the harvested leaves of the present invention.

[0335] In a further embodiment, tobacco industry products can be prepared from the treated tobacco leaves of the present invention.

[0336] Suitably, tobacco industry products may be prepared from tobacco leaves that have been treated by one or more of curing, fermentation, and / or pasteurization.

[0337] Suitably, the tobacco industry product may comprise cut tobacco leaves, which may have been processed as per the previous embodiments.

[0338] In another embodiment, tobacco industry products can be prepared from tobacco cell cultures according to the present invention.

[0339] In another embodiment, tobacco industry products may be prepared from (eg, may include) dried tobacco material according to the present invention.

[0340] In another embodiment, tobacco industry products may be prepared from (eg, may include) tobacco blends according to the present invention.

[0341] In one embodiment, the tobacco industry product may be a smoking article.

[0342] As used herein, the term "smoking article" may include smokable products such as cigarettes, cigarettes, cigars, and cigarillos, whether based on tobacco, tobacco derivatives, expanded tobacco, reconstituted tobacco, or tobacco substitutes.

[0343] In another embodiment, the tobacco industry product may be a smokeless tobacco industry product.

[0344] As used herein, the term "smokeless tobacco industry product" refers to a tobacco industry product that is designed not to produce smoke and / or be burned.

[0345] Smokeless tobacco industry products (including heat-not-burn materials) may contain tobacco in any form, including dry particles, flakes, granules, powders, or slurries that are placed on, mixed with, surrounded by, or combined with other components in any form, such as flakes, films, tabs, foams, or beads.

[0346] In one embodiment, the smokeless tobacco industry products may include snus, snuff, chewing tobacco, or the like.

[0347] In one embodiment, the tobacco industry product is a combustible smoking article selected from the group consisting of cigarettes, cigarillos, and cigars.

[0348] In one embodiment, the tobacco industry product comprises one or more components of a combustible smoking article, such as a filter, a filter rod, a filter rod segment, tobacco, a tobacco rod, a tobacco rod segment, a splint, an additive-releasing component, e.g., a capsule, a thread, a bead, a paper, e.g., plug wrap, tipping paper, or cigarette paper.

[0349] In one embodiment, the tobacco industry product is a non-combustible aerosol delivery system.

[0350] In one embodiment, the tobacco industry product includes one or more components of a non-combustible aerosol delivery system, such as a heater and an aerosolizable substrate.

[0351] In one embodiment, the aerosol delivery system is an electronic cigarette, also known as a vaping device.

[0352] In one embodiment, the electronic cigarette includes a heater, a power source capable of providing power to the heater, an aerosolizable substrate such as a liquid or gel, a housing, and optionally a mouthpiece.

[0353] In one embodiment, the aerosolizable substrate is contained in a substrate container, hi one embodiment, the substrate container is combined with or includes a heater.

[0354] In one embodiment, the tobacco industry product is a heating product that releases one or more compounds by heating, without burning, a substrate material. The substrate material is an aerosolizable material, which may be, for example, tobacco or other non-tobacco products that may or may not contain nicotine. In one embodiment, the heating product is a tobacco heating product.

[0355] In one embodiment, the heating product is an electronic device.

[0356] In one embodiment, the tobacco heating product includes a heater, a power source capable of supplying power to the heater, and an aerosolizable substrate, such as a solid or gel-like material.

[0357] In one embodiment, the heating product is a non-electronic product.

[0358] In one embodiment, the heating product includes an aerosolizable substrate, such as a solid or gel-like material, and a heat source that can provide thermal energy to the aerosolizable substrate without any electronic means, for example by burning a combustible material, such as charcoal.

[0359] In one embodiment, the heating product also includes a filter capable of filtering the aerosol generated by heating the aerosolizable substrate.

[0360] In some embodiments, the aerosolizable substrate material may include a vapor or aerosol generating agent or a humectant such as glycerol, propylene glycol, triacetin, or diethylene glycol.

[0361] In one embodiment, the tobacco industry product is a hybrid system for generating an aerosol by heating, without combustion, a combination of substrate materials. The substrate materials may include, for example, solids, liquids, or gels, which may or may not contain nicotine. In one embodiment, the hybrid system includes a liquid or gel substrate and a solid substrate. The solid substrate may be, for example, tobacco or other non-tobacco products, which may or may not contain nicotine. In one embodiment, the hybrid system includes a liquid or gel substrate and tobacco.

[0362] In a further embodiment, the tobacco industry product may be a tobacco heating device or a hybrid device or an electronic cigarette or the like.

[0363] Typically, in tobacco heating or hybrid devices, the aerosol is generated by the conduction of heat from a heat source to a physically separate aerosol-forming substrate or material that may be located within, around, or downstream from the heat source. During smoking, volatile compounds are released from the aerosol-forming substrate by heat conduction from the heat source and are carried along with the air drawn through the smoking article. As the released compounds cool, they condense to form an aerosol, which is inhaled by the user.

[0364] Aerosol-generating articles and devices for consuming or smoking tobacco heating devices are known in the art. These may include, for example, electrically heated aerosol-generating devices, in which the aerosol is generated by the conduction of heat from one or more electrical heating elements of the aerosol-generating device to an aerosol-forming substrate of the tobacco heating device.

[0365] Suitably, the tobacco heating device may be an aerosol generating device.

[0366] Preferably, the tobacco heating device may be a heated device, which are known in the art and release compounds by heating tobacco without burning it.

[0367] Examples of suitable heated devices may be those taught in WO 2013 / 034459 or GB 2515502, which are incorporated herein by reference.

[0368] In one embodiment, the aerosol-forming substrate of the tobacco heating device may be a tobacco industry product according to the present invention.

[0369] In one embodiment, the tobacco heating device may be a hybrid device.

[0370] Polynucleotides / Polypeptides / Constructs In certain embodiments of the present invention, constructs that modulate the activity or expression of at least one homeodomain-like MYB domain protein described herein may be transformed into plant cells, suitably under the direction of a promoter.

[0371] In certain embodiments of the present invention, a construct that reduces (i.e., inhibits) the activity or expression of at least one homeodomain-like MYB domain protein described herein can be transformed into a plant cell under the direction of a promoter. For example, the genetic construct can be a gene editing construct or can include an RNAi molecule, which can include a small interfering RNA (siRNA) molecule or a short hairpin loop (shRNA) molecule.

[0372] In certain embodiments of the invention, a construct that increases the activity or expression of a gene encoding a homeodomain-like MYB domain protein described herein, e.g., a construct encoding a gene encoding a homeodomain-like MYB domain protein, such as an endogenous homeodomain-like MYB domain protein, can be transformed into a plant cell, suitably under the direction of a promoter.

[0373] The construct can be introduced into a plant according to the present invention using an appropriate vector, such as a plant transformation vector. The plant transformation vector may include an expression cassette including, in the transcriptional direction, a promoter sequence, a construct sequence targeting a gene encoding a homeodomain-like MYB domain protein described herein, and optionally a 3' untranslated terminator sequence containing a termination signal for RNA polymerase and a polyadenylation signal for polyadenylation. The promoter sequence may be present in one or more copies, and such copies may be identical to or variants of the promoter sequences described above. Terminator sequences may be obtained from plant, bacterial, or viral genes. Suitable terminator sequences include, for example, the pea rbcS E9 terminator sequence, the nos terminator sequence derived from the nopaline synthase gene of Agrobacterium tumefaciens, and the 35S terminator sequence derived from the cauliflower mosaic virus. Those skilled in the art will readily recognize other suitable terminator sequences.

[0374] Constructs of the present invention may also include gene expression enhancing mechanisms to increase promoter strength. An example of such an enhancer element is that derived from a portion of the promoter of the pea plastocyanin gene, the subject of International Patent Application WO 97 / 20056, incorporated herein by reference. Suitable enhancer elements may be, for example, the nos enhancer element derived from the nopaline synthase gene of Agrobacterium tumefaciens and the 35S enhancer element derived from the cauliflower mosaic virus.

[0375] These regulatory regions may be derived from the same gene as the promoter DNA sequence, or may be derived from different genes, either from Nicotiana tabacum or other organisms, such as Solanaceae or Cestroideae. All regulatory regions should be operable in the cells of the tissue to be transformed.

[0376] The promoter DNA sequence may be derived from the desired gene, e.g., the gene that the promoter is intended to direct, e.g., a gene encoding a homeodomain-like MYB domain protein according to the invention, the same gene as the coding sequence used in the present invention, or may be derived from a different gene, e.g., from Nicotiana tabacum or another organism, e.g., from a Solanaceae plant or from the subfamily Noctuidae.

[0377] The expression cassette can be incorporated into a basic plant transformation vector such as pBIN 19 Plus, pBI 101, pKYLX71:35S2, pCAMBIA2300, or other suitable plant transformation vectors known in the art. The plant transformation vector will contain such sequences in addition to the expression cassette as they are necessary for the transformation process. These sequences may include Agrobacterium vir genes, one or more T-DNA border sequences, and a selectable marker or other means of identifying transgenic plant cells.

[0378] The term "expression vector or plant transformation vector" refers to a construct capable of in vivo or in vitro expression. Preferably, the expression vector is integrated into the genome of an organism. In one embodiment, the vector of the invention expresses a protein, such as a homeodomain-like MYB domain protein described herein. The term "integrated" preferably relates to stable integration into the genome.

[0379] Techniques for transforming plants are well known in the art and include, for example, Agrobacterium-mediated transformation. The basic principle in the construction of genetically modified plants is to insert genetic information into the plant genome to obtain stable maintenance of the inserted genetic material. An overview of the general techniques can be found in the articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol

[1991] 42:205-225) and Christon (AgroFood-Industry Hi-Tech March / April 1994 17-27), which are incorporated herein by reference.

[0380] Typically, in Agrobacterium-mediated transformation, a binary vector carrying the desired foreign DNA, i.e., a construct according to the present invention, is transferred from an appropriate Agrobacterium strain to a target plant by co-cultivating Agrobacterium with an explant derived from the target plant. The transformed plant tissue is then regenerated on a selective medium containing a selectable marker and a plant growth hormone. An alternative method is the floral dip method (Clough & Bent, 1998 Plant J. 1998 Dec;16(6):735-43, incorporated herein by reference), in which flower buds of intact plants are contacted with a suspension of an Agrobacterium strain containing a chimeric gene, and after seed production, transformed individuals are germinated and identified by growth on a selective medium. Direct infection of plant tissue with Agrobacterium is a widely used and simple technique, which is described in Butcher et al. (1980) Tissue Culture Methods for Plant Pathologists, eds.: DS Ingrams and JP Helgeson, 203-208, incorporated herein by reference.

[0381] Additional suitable transformation methods include direct gene transfer into protoplasts using, for example, polyethylene glycol or electroporation techniques, particle guns, microinjection, and silicon carbide fibers. Transformation of plants using ballistic transformation and the generation of fertile transgenic maize plants by silicon carbide whisker-mediated transformation are taught in Frame et al. (1994) The Plant Journal 6(6): 941-948, which is incorporated herein by reference, and viral transformation techniques are taught, for example, in Meyer et al. (1992) Mol. Gen. Genet. 231(3): 345-352, which is incorporated herein by reference. The use of cassava mosaic virus as a vector system for plants is taught in Meyer et al. (1992) Gene 110: 213-217, which is incorporated herein by reference. Further teachings on plant transformation can be found in EP 0 449 375, which is incorporated herein by reference.

[0382] In a further aspect, the present invention relates to a vector system that carries a construct and introduces it into the genome of an organism such as a plant, suitably a tobacco plant. The vector system may include one vector, but may also include two vectors. In the case of two vectors, the vector system is usually called a binary vector system. Binary vector systems are described in more detail in Gynheung et al. (1980) Binary Vectors, Plant Molecular Biology Manual A3, 1-19, which is incorporated herein by reference.

[0383] One widely used plant cell transformation system uses the Ti plasmid from Agrobacterium tumefaciens or the Ri plasmid from Agrobacterium rhizogenes, as described by An et al. (1986) Plant Physiol. 81, 301-305, and Butcher et al. (1980) Tissue Culture Methods for Plant Pathologists eds.: DS Ingrams and JP Helgeson, 203-208, which are incorporated herein by reference. After each method of introduction of a desired exogenous gene in plants according to the present invention, the presence and / or insertion of additional DNA sequences may be necessary. The use of T-DNA for the transformation of plant cells has been intensively studied and is described in EP 120516 A1, Hoekema (1985) The Binary Plant Vector System, Offset-drukkerij Kanters BB, Amsterdam Chapter V, Fraley et al. Crit. Rev. Plant Sci. 4:1-46, and An et al. (1985) EMBO J 4: 277-284, all of which are incorporated herein by reference.

[0384] Plant cells transformed with constructs that modulate the activity or expression of at least one homeodomain-like MYB domain protein can be grown and maintained according to well-known tissue culture methods, for example, by culturing the cells in an appropriate culture medium supplemented with essential growth factors such as amino acids, plant hormones, vitamins, etc.

[0385] The term "transgenic plant" in the context of the present invention includes any plant comprising a construct that modulates the activity or expression of at least one homeodomain-like MYB domain protein according to the present invention. Thus, a transgenic plant is a plant that has been transformed with a construct according to the present invention. Preferably, the transgenic plant exhibits a modulated (e.g., reduced) alkaloid content and / or a modulated (e.g., reduced) TSNA precursor content according to the present invention. The term "transgenic plant" does not refer to a native nucleotide coding sequence in its natural environment, i.e., under the control of its native promoter (which is also in its natural environment).

[0386] In one embodiment, a gene, construct, plant transformation vector, or plant cell encoding a homeodomain-like MYB domain protein according to the invention is in isolated form. The term "isolated" means that the sequence is at least substantially free from at least one other component with which the sequence is naturally associated and found in nature in its natural state.

[0387] In one embodiment, a gene, construct, plant transformation vector, or plant cell encoding a homeodomain-like MYB domain protein in accordance with the invention is in purified form. The term "purified" means in a relatively pure state, e.g., at least about 90% pure, or at least about 95% pure, or at least about 98% pure.

[0388] As used herein, the term "nucleotide sequence" refers to an oligonucleotide or polynucleotide sequence, as well as variants, homologs, fragments, and derivatives thereof (such as portions thereof). Nucleotide sequences may be of genomic, synthetic, or recombinant origin, and they may be double-stranded or single-stranded, representing either the sense or antisense strand.

[0389] The term "nucleotide sequence" in relation to the present invention includes genomic DNA, cDNA, synthetic DNA, and RNA. Preferably, the nucleotide sequence refers to a DNA sequence, more preferably a cDNA sequence, encoding the present invention.

[0390] In a preferred embodiment, the nucleotide sequence, i.e., the gene encoding the homeodomain-like MYB domain protein according to the invention, as it relates to and is itself within the scope of the present invention, includes the native nucleotide sequence in its natural environment and linked to naturally associated sequences (also in their natural environment). For ease of reference, we refer to this preferred embodiment as the "native nucleotide sequence." In this regard, the term "native nucleotide sequence" refers to the entire nucleotide sequence in its native environment and operably linked to the entire promoter with which it is naturally associated (which promoter is also in its native environment).

[0391] The nucleotide sequence for use in the present invention can be present in a vector in which the nucleotide sequence is operably linked to a regulatory sequence capable of providing expression of the nucleotide sequence by a suitable host organism. The construct for use in the present invention can be transformed into a suitable host cell as described herein to provide expression of the polypeptide of the present invention. The selection of a vector, such as a plasmid, cosmid, or phage vector, often depends on the host cell into which it will be introduced. The vector can be used in vitro, for example, to produce RNA, or can be used to transfect, transform, transduce, or infect host cells.

[0392] In some applications, the nucleotide sequence for use in the present invention is operably linked to a regulatory sequence that is capable of providing for expression of the nucleotide sequence by, for example, a selected host cell. By way of example, the present invention encompasses a vector comprising the nucleotide sequence of a gene encoding a homeodomain-like MYB domain protein described herein operably linked to such a regulatory sequence; i.e., the vector is an expression vector.

[0393] The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

[0394] The term "regulatory sequence" includes promoters and enhancers and other expression regulation signals. The term "promoter" is used in its normal sense in the art, e.g., an RNA polymerase binding site. The nucleotide sequence in the construct encoding the homeodomain-like MYB domain protein may be operably linked to at least one promoter.

[0395] The term "construct" is synonymous with terms such as "cassette" or "vector," and includes a nucleotide sequence for use in accordance with the present invention linked directly or indirectly to a promoter.

[0396] An example of an indirect linkage is the provision of a suitable spacer group, such as an intron sequence, such as the Sh1-intron or ADH intron, between the promoter and the nucleotide sequence of the invention. The same applies to the term "fused" in the context of the present invention, which includes direct or indirect linkage. In some cases, the term does not refer to the natural combination of a wild-type gene promoter and a nucleotide sequence encoding a protein normally associated therewith, when both are in their natural environment. The construct may further contain or express a marker, which allows for the selection of the genetic construct.

[0397] In some embodiments, the promoter may be operably linked to a nucleotide sequence in a construct or vector used to regulate the concentration and / or total content of nicotine in a cell or cell culture or a tobacco plant or portion thereof.

[0398] In some embodiments, the promoter may be selected from the group consisting of a constitutive promoter, a tissue-specific promoter, a developmentally-regulated promoter, and an inducible promoter.

[0399] In one embodiment, the promoter may be a constitutive promoter.

[0400] A constitutive promoter directs expression of a gene throughout different parts of the plant continuously during plant development, although the gene may not be expressed at the same level in all cell types. Examples of known constitutive promoters include those associated with the cauliflower mosaic virus 35S transcript (Odell JT, Nagy F, Chua NH. (1985). Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature. 313 810-2), the rice actin 1 gene (Zhang W, McElroy D, Wu R. (1991). Analysis of rice Act1 5' region activity in transgenic rice plants. Plant Cell 3 1155-65), and the maize ubiquitin 1 gene (Cornejo MJ, Luth D, Blankenship KM, Anderson OD, Blechl AE. (1993). Activity of a maize ubiquitin promoter in transgenic rice. Plant Molec. Biol. 23 567-81). Constitutive promoters such as the Carnation Etched Ring Virus (CERV) promoter (Hull R, Sadler J, Longstaff M (1986) (CaMV / 35S), figwort mosaic virus 35S promoter. The sequence of carnation etched ring virus DNA: comparison with cauliflower mosaic virus and retroviruses. EMBO Journal, 5(2):3083-3090).

[0401] The constitutive promoter may be selected from the carnation etched ring virus (CERV) promoter, the cauliflower mosaic virus (CaMV) 35S promoter, the promoter derived from the rice actin 1 gene or the maize ubiquitin 1 gene.

[0402] The promoter can be a tissue-specific promoter. A tissue-specific promoter is one that directs the expression of a gene in a part (or a few parts) of a plant, usually throughout the life of those plant parts. The category of tissue-specific promoters generally includes promoters whose specificity is not absolute, i.e., these promoters can direct expression at lower levels in tissues other than the preferred tissue. Tissue-specific promoters include the phaseolin promoter, legumin b4 promoter, usp promoter, sbp promoter, ST-LS1 promoter, and B33 (patatin class I promoter).

[0403] In another embodiment, the promoter may be a developmentally-regulated promoter.

[0404] A developmentally-regulated promoter directs a change in expression of a gene in one or more parts of a plant at a particular time during plant development. The gene may be expressed at different (usually lower) levels in that plant part at other times and may also be expressed in other plant parts.

[0405] In one embodiment, the promoter may be an inducible promoter.

[0406] An inducible promoter can direct gene expression in response to an inducer. In the absence of the inducer, the gene is not expressed. The inducer can act directly on the promoter sequence or by counteracting the effects of a repressor molecule. Inducers can be chemicals such as metabolites, proteins, growth regulators (such as auxin and salicylic acid, which activate the OCS promoter), or toxic elements; physiological stresses such as heat, light (such as the soybean SSU promoter), wounding (e.g., the nos, nopaline synthase promoter), or osmotic stress; or the indirect result of the action of pathogens or pests. Developmentally regulated promoters can be described as specific types of inducible promoters that respond to endogenous inducers produced by the plant or to environmental stimuli at specific points in the plant's life cycle. Examples of known inducible promoters include those associated with wound responses, such as those described by Warner SA, Scott R, Draper J. ((1993) Plant J. 3 191-201), those associated with temperature responses as disclosed by Benfey and Chua (1989) (Benfey, PN, and Chua, NH. ((1989) Science 244 174-181), and those that are chemically induced, as described by Gatz ((1995) Methods in Cell Biol. 50 411-424).

[0407] Nucleotide sequences encoding either proteins having the specific properties of genes encoding homeodomain-like MYB domain proteins as defined herein or proteins suitable for modification can be identified and / or isolated and / or purified from any cell or organism that produces said proteins. Various methods for identifying and / or isolating and / or purifying nucleotide sequences are well known in the art. By way of example, once a suitable sequence has been identified and / or isolated and / or purified, PCR amplification techniques can be used to prepare two or more sequences.

[0408] In yet a further alternative, nucleotide sequences encoding homeodomain-like MYB domain proteins can be prepared synthetically by established standard methods, such as the phosphoramidite method described by Beucage et al. (1981) Tetrahedron Letters 22, 1859-1869, incorporated herein by reference, or the method described by Matthes et al. (1984) EMBO J. 3, 801-805, incorporated herein by reference. In the phosphoramidite method, oligonucleotides are synthesized, for example, in an automatic DNA synthesizer, purified, annealed, ligated, and cloned into an appropriate vector.

[0409] As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein." In some cases, the term "amino acid sequence" is synonymous with the term "peptide." In some cases, the term "amino acid sequence" is synonymous with the term "enzyme."

[0410] The present invention also encompasses the use of amino acid sequences or any nucleotide sequences of polypeptides having the specific properties defined herein, i.e., sequences having a degree of sequence identity or sequence homology with genes encoding homeodomain-like MYB domain proteins (hereinafter referred to as "homologous sequences"). Here, the term "homolog" refers to an entity having a degree of homology with the subject amino acid sequence and the subject nucleotide sequence. Here, the term "homology" can be considered equivalent to "identity."

[0411] Homologous amino acid and / or nucleotide sequences and / or fragments should provide and / or encode polypeptides that retain and / or enhance the functional activity of the homeodomain-like MYB domain protein. Typically, a homologous sequence will contain or encode, for example, the same catalytic site as the amino acid sequence of interest. Although homology can be considered in terms of similarity (i.e., amino acid residues with similar chemical properties / functions), in the context of the present invention, it is preferred to express homology in terms of sequence identity. Homologous sequences typically retain functional domains or motifs.

[0412] In one embodiment, a homologous sequence comprises an amino acid or nucleotide sequence that has one, two, or more additions, deletions, and / or substitutions compared to the reference sequence.

[0413] In one embodiment, homologs of the homeodomain-like MYB domain protein SEQ ID NO: 3 are provided in Table 1. The present invention extends to the use of the homologs listed in Table 1, and sequences having at least 80% sequence identity thereto.

[0414] Sequence identity Comparison of sequence identity can be performed by eye, or more commonly, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the percent homology between two or more sequences. The percent homology or percent identity can be calculated over contiguous sequences, i.e., one sequence is aligned with the other, and each amino acid in one sequence is directly compared, one residue at a time, to the corresponding amino acid in the other sequence. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively small number of residues.

[0415] While this is a very simple and consistent method, it fails to take into account, for example, that in an otherwise identical pair of sequences, a single insertion or deletion at a subsequent amino acid residue can upset the alignment and thus significantly reduce the percent homology when a full alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into account possible insertions and deletions without unduly penalizing the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to maximize local homology.

[0416] However, these more sophisticated methods assign a "gap penalty" to each gap that occurs in the alignment, such that, given the same number of identical amino acids, sequence alignments with as few gaps as possible (which reflects a higher relatedness between the two compared sequences) will achieve a higher score than those with many gaps. "Affine gap costs" are typically used, which impose a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue within the gap. This is the most commonly used gap scoring system. High gap penalties naturally result in optimized alignments with fewer gaps. Most alignment programs allow the gap penalty to be modified. However, when using such software for sequence comparisons, it is preferred to use the default values.

[0417] Calculation of maximum percent homology therefore first requires providing an optimal alignment, taking into account gap penalties. A suitable computer program for performing such an alignment is Vector NTI (Invitrogen Corp.). Examples of software capable of performing sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al. (1999) Short Protocols in Molecular Biology, 4th Ed - Chapter 18), BLAST2 (see FEMS Microbiol Lett 1999 174(2): 247-50, FEMS Microbiol Lett 1999 177(1): 187-8, and tatiana@ncbi.nlm.nih.gov), FASTA (Altschul et al. 1990 J. Mol. Biol. 403-410), and AlignX. At least BLAST, BLAST2, and FASTA are available for offline and online searching (see Ausubel et al. 1999, pages 7-58 to 7-60).

[0418] Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pairwise comparison. Instead, a scaled similarity score matrix is ​​generally used, which assigns a score to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix, which is the default matrix for the BLAST suite of programs. Vector NTI programs typically use either published default values, or, if provided, a custom symbol comparison table (see user manual for further details). For some applications, it is preferred to use the default values ​​of the Vector NTI package.

[0419] Alternatively, the percentage homology can be calculated using the multiple alignment feature in Vector NTI (Invitrogen Corp.), based on an algorithm similar to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73(1), 237-244). Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

[0420] If gap penalties are used in determining sequence identity, the following parameters are preferably used for pairwise alignments:

[0421] [Table 2]

[0422] [Table 3]

[0423] In one embodiment, CLUSTAL can be used with the gap penalties and gap extensions set forth above. In some embodiments, the gap penalties used for BLAST or CLUSTAL alignments can differ from those detailed above. Those skilled in the art will appreciate that standard parameters for performing BLAST and CLUSTAL alignments can change periodically, and that at any given time, appropriate parameters can be selected based on the detailed standard parameters for the BLAST or CLUSTAL alignment algorithm.

[0424] Suitably, the degree of identity for nucleotide sequences is determined over at least 50 contiguous nucleotides, preferably over at least 60 contiguous nucleotides, preferably over at least 70 contiguous nucleotides, preferably over at least 80 contiguous nucleotides, preferably over at least 90 contiguous nucleotides, preferably over at least 100 contiguous nucleotides, preferably over at least 150 contiguous nucleotides, preferably over at least 200 contiguous nucleotides, preferably over at least 250 contiguous nucleotides, preferably over at least 300 contiguous nucleotides, preferably over at least 350 contiguous nucleotides, preferably over at least 400 contiguous nucleotides, preferably over at least 450 contiguous nucleotides, preferably over at least 500 contiguous nucleotides, preferably over at least 550 contiguous nucleotides, preferably over at least 600 contiguous nucleotides, preferably over at least 650 contiguous nucleotides, or preferably over at least 700 contiguous nucleotides.

[0425] Suitably, the degree of identity for nucleotide, cDNA, cds or amino acid sequences may be determined over the entire sequence.

[0426] The sequences may also have deletions, insertions, or substitutions of amino acid residues that result in silent changes and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues, so long as the secondary binding activity of the substance is maintained. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids with uncharged polar head groups with similar hydrophilicity values ​​include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

[0427] Conservative substitutions can be made, for example, according to the following table: Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other.

[0428] [Table 4]

[0429] The present invention also encompasses homologous substitutions (both substitution and replacement are used herein to mean the replacement of an existing amino acid residue with an alternative residue) that may occur, i.e., basic for basic, acidic for acidic, polar for polar, etc. Non-homologous substitutions may also occur, i.e., the substitution of one class of residue for another class of residue, or the inclusion instead of an unnatural amino acid, such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine, and phenylglycine.

[0430] The replacement also * and alpha-disubstituted * Amino acids, N-alkyl amino acids * , lactic acid * , halide derivatives of natural amino acids, e.g., trifluorotyrosine * , p-Cl-phenylalanine * , p-Br-phenylalanine * , pI-phenylalanine * , L-allyl-glycine * , β-alanine * , L-α-aminobutyric acid * , L-γ-aminobutyric acid * , L-α-aminoisobutyric acid * , L-ε-aminocaproic acid # , 7-aminoheptanoic acid * , L-methionine sulfone #* , L-norleucine *, L-norvaline * , p-nitro-L-phenylalanine * , L-hydroxyproline # , L-thioproline * , methyl derivatives of phenylalanine (Phe), e.g., 4-methyl-Phe * , Pentamethyl-Phe * , L-Phe(4-amino) # , L-Tyr(methyl) * , L-Phe(4-isopropyl) * , L-Tic (1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid) * , L-diaminopropionic acid # , and L-Phe(4-benzyl) * This can be achieved with unnatural amino acids, including * is used for the purposes of the above discussion (for homologous or non-homologous substitutions) to indicate the hydrophobicity of the derivative, while # is used to indicate the hydrophilicity of the derivative, and # * indicates amphiphilic characteristics.

[0431] Variant amino acid sequences may contain, in addition to amino acid spacers such as glycine or β-alanine residues, suitable spacer groups, including alkyl groups such as methyl, ethyl, or propyl groups, that may be inserted between any two amino acid residues in the sequence. A further variation involves the presence of one or more amino acid residues in peptoid form, as will be well understood by those skilled in the art. For the avoidance of doubt, the term "peptoid form" is used to refer to variant amino acid residues in which the nitrogen atom of the residue has an α-carbon substituent rather than an α-carbon. Methods for preparing peptides in peptoid form are known in the art, e.g., Simon et al. (1992) PNAS 89(20), 9367-9371, and Horwell (1995) Trends Biotechnol. 13(4), 132-134.

[0432] Nucleotide sequences for use in the present invention may contain synthetic or modified nucleotides. Several different types of modifications to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, and / or the addition of acridine or polylysine chains at the 3' and / or 5' ends of the molecule. For purposes of the present invention, it is understood that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications may be made to enhance the in vivo activity or life span of the nucleotide sequences of the present invention.

[0433] The present invention also encompasses sequences that are complementary to the nucleic acid sequences of the present invention, or sequences that can hybridize to either the sequences of the present invention or to sequences complementary thereto. As used herein, the term "hybridization" includes "the process by which a strand of nucleic acid joins with a complementary strand through base pairing" and the amplification process carried out in polymerase chain reaction (PCR) techniques.

[0434] The present invention also relates to nucleotide sequences that can hybridize to the nucleotide sequences of the present invention (including complementary sequences of the sequences presented herein). Preferably, hybridization is determined under stringent conditions (e.g., 50°C and 0.2xSSC {1xSSC = 0.15M NaCl, 0.015M NaCitrate, pH 7.0}). More preferably, hybridization is determined under high stringency conditions (e.g., 65°C and 0.1xSSC {1xSSC = 0.15M NaCl, 0.015M NaCitrate, pH 7.0}).

[0435] Reviews of general techniques used in plant transformation can be found in articles such as Potrykus et al. (1991) Annu Rev Plant Physiol. Plant Mol. Biol. 42:205-225, and Christou et al. (1994) Agro-Food-Industry Hi-Tech March / April 17-27, which are incorporated herein by reference. Further teachings on plant transformation can be found in European Patent Application Publication No. 0 449 375, which is incorporated herein by reference.

[0436] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994), and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide those of ordinary skill in the art with a general dictionary of many of the terms used in this disclosure.

[0437] The present disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present disclosure. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, all nucleic acid sequences are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.

[0438] The headings provided herein are not limitations of the various aspects or embodiments of the disclosure that may be incorporated by reference in their entirety. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0439] Amino acids are described herein using the amino acid name, three-letter abbreviation, or one-letter abbreviation. The term "protein" as used herein includes proteins, polypeptides, and peptides. As used herein, the term "amino acid sequence" is synonymous with the term "polypeptide" and / or the term "protein." In some cases, the term "amino acid sequence" is synonymous with the term "peptide." In some cases, the term "amino acid sequence" is synonymous with the term "enzyme."

[0440] In this disclosure and claims, conventional one-letter and three-letter codes for amino acid residues may be used. The three-letter codes for amino acids are as defined in accordance with the IUPACIUB Joint Commission on Biochemical Nomenclature (JCBN). It is also understood that due to the degeneracy of the genetic code, a polypeptide may be coded for by more than one nucleotide sequence.

[0441] Other definitions of terms can be found throughout the specification. Before describing exemplary embodiments in more detail, it should be understood that the present disclosure is not limited to the particular embodiments described, and as such may, of course, vary. It is also understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure is limited only by the appended claims.

[0442] Where a range of values ​​is provided, unless the context clearly indicates otherwise, each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limit of that range is also specifically disclosed. Each smaller range between any stated or intervening value in a stated range and any other stated or intervening value within that stated range is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in or excluded from the range, and each range including either limit, neither limit, or both limits within that smaller range, subject to any specifically excluded limit in the stated range, is also encompassed within the disclosure. When a stated range includes one or both of the limits, ranges excluding either or both of the included limits are also included within the disclosure.

[0443] It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, reference to an "enzyme" or a "homeodomain-like MYB domain protein" includes a plurality of such candidate substances and equivalents thereof known to those skilled in the art, and so forth.

[0444] advantage Surprisingly, it has been found that by modulating the activity or expression of the homeodomain-like MYB domain proteins taught herein, which act as positive regulators of alkaloid content in tobacco, it is possible to modulate the alkaloid and / or TSNA precursor content of the plant, thereby producing tobacco industry products that have modulated (e.g., reduced) alkaloid content and / or reduced TSNA precursor content and commercially desirable traits desired by consumers of tobacco industry products.

[0445] The present inventors have surprisingly determined a method for modulating the alkaloid and / or TSNA precursor content of a plant (e.g., a tobacco plant) by modulating the activity or expression of a homeodomain-like MYB domain protein. The alkaloid or TSNA precursor content of a plant (e.g., a tobacco plant) can be reduced by reducing or inhibiting the activity or expression of a homeodomain-like MYB domain protein described herein. Prior to the present invention, it was not known that modulation of the activity or expression of a homeodomain-like MYB domain protein described herein could be used to modulate the alkaloid and / or TSNA precursor content of a plant (e.g., a tobacco plant).

[0446] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application, and nothing herein should be construed as an admission that such publications constitute prior art to the claims appended hereto. [Example] [Example]

[0447] "Virus-induced gene silencing (VIGS) of Nitab4.5_0005842g0010.2 reduces alkaloid content in leaves" Virus-induced gene silencing (VIGS) For virus-induced gene silencing, a 300 nucleotide cDNA fragment of Nitab4.5_0005842g0010.2: TACTAAGTGAGGATCAAGTAAAGGATGAAGAGAATTGTACAAATAAGACCTCAATGTTGCAGATACCGTCAGCTGGATTAATGGACCAACCATTTCACCTGACTAATAGTAGAAGTTTTAACAGTGAGGTAAATGGACAATTAACAGAAG CTTCAAAAGACGAATTTGTAAGCAAACAGGTATTTGATCTTCTGTATATTCATGAATTCCAAGCCAATGTAAATCCGAATGGGTATAATTCAGAAATATTAGCTCAATACCAGCAAAATATGAGACCTAATGATCATCGTCAGAGCGAAT (TRV2: SEQ ID NO: 43) The vector was synthesized and cloned into pTV00 (between the EcoRI and XhoI sites) using the In-Fusion cloning kit. The plasmid was then transformed into A. tumefaciens GV3101.

[0448] Both TRV vectors containing the target nucleotide sequence (TRV RNA1, SEQ ID NO: 42) and (TRV RNA2) were propagated separately in A. tumefaciens. These cultures were mixed (1:1) and syringe-infiltrated into 2-week-old TN90 plants. Silencing efficacy was assessed by evaluating the expression level of the target gene 5 weeks after viral infection.

[0449] Silencing VIGS assays were performed as previously described (Ratcliff et al., 2001) Ratcliff, F et al., (2001), The Plant Journal, 25: 237-245 (incorporated herein by reference). Briefly, independent cultures of A. tumefaciens GV3101 harboring the TRV2 and TRV1 plasmids were grown overnight in LB medium supplemented with the appropriate antibiotics. The cultures were resuspended in VIGS buffer (10 mM morpholineethanesulfonic acid, pH 5.6, 10 mM MgCl2, and 100 μM acetosyringone) and the optical density was measured at OD. 600 The cultures were adjusted to a pH of 1.0 and incubated overnight at room temperature in the dark. These cultures were mixed (1:1) and syringe-infiltrated into 2-week-old TN90 plants. Silencing efficacy was assessed by evaluating the expression level of the target gene 2 weeks after virus infection. TRV-luciferase was used as a negative control, and TRV-PDS (reduced chlorophyll content in silenced leaves) was used as a phenotypic silencing control.

[0450] Alkaloid measurement The relative content of pyridine alkaloids was determined by reversed-phase high-performance liquid chromatography with tandem mass spectrometry (LC-MS / MS). Chromatographic separation was performed using a Gemini-NX column (100 mm × 3.0 mm, 3 μm particle size, Phenomenex), and gradient chromatographic separation was performed using 6.5 mM ammonium acetate buffer (aq) (pH 10) and methanol.

[0451] The mass spectrometer was operated in electrospray (ESI) positive mode using scheduled MRM data acquisition. Two MRM transitions were monitored for each analyte and one for the isotopically labeled internal standard.

[0452] [Table 5]

[0453] result Alkaloid content of 5-week-old TN90 leaves silenced for Nitab4.5_0005842g0010.2. Content is expressed relative to control, with three biological replicates analyzed by one-way ANOVA and Tukey's multiple comparison post-hoc test. Values ​​are shown as mean ± SEM. Asterisks indicate statistical significance with P values ​​less than or equal to 0.001. Pyridine alkaloids: nicotine, nornicotine, anabasine (ANAB), anatabine (ANAT), pseudooxynicotine (PON).

[0454] VIGS of Nitab4.5_0005842g0010.2 resulted in a reduction in alkaloid content in the leaves, particularly nicotine, nornicotine, anabasine, PON, and anatabine.

[0455] conclusion Nitab4.5_0005842g0010.2 is a positive regulator of alkaloid content in tobacco, especially in leaves, and is a regulator of pyridine alkaloids. [Example]

[0456] "Homolog Test" The effect of homologues of SEQ ID NO: 3, ie those listed in Table 1, is tested in the assays described in the Examples above.

Claims

1. A method for regulating (e.g., reducing) the alkaloid content of a tobacco plant or part thereof, or a tobacco plant cell, comprising the step of modifying the plant or plant cell by regulating (e.g., reducing) the activity or expression of a homeodomain-like MYB domain protein.

2. A method for regulating (e.g., reducing) the content of tobacco-specific nitrosamines (TSNAs) or precursors of TSNAs in a tobacco plant or plant part thereof, or a tobacco plant cell, comprising modifying the plant or plant cell by regulating (e.g., reducing) the activity or expression of a homeodomain-like MYB domain protein.

3. A method for producing a plant or part thereof, cell or cell culture, plant propagation material, leaf, cut harvested leaf, treated leaf, or cut treated leaf having modulated (e.g. reduced) alkaloid content, the method comprising modifying the plant or cell culture to reduce the activity or expression of a homeodomain-like MYB domain protein.

4. Use of at least one gene encoding a homeodomain-like MYB domain protein for modulating (eg, decreasing) the alkaloid content of a tobacco cell or a tobacco plant or part thereof.

5. A homeodomain-like MYB domain protein, a) comprising the amino acid sequence shown in SEQ ID NO: 3, or a functional variant or a functional fragment or an orthologue of SEQ ID NO: 3, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3, or b) encoded by the nucleotide sequence shown in SEQ ID NO: 1 or 2, or a functional variant or a functional fragment or an orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2; The method or use according to any one of claims 1 to 4.

6. 6. The method or use of any one of claims 1 to 5, wherein the alkaloid content is reduced compared to a plant or cell culture that has not been modified to reduce the activity or expression of the homeodomain-like MYB domain protein.

7. A tobacco plant or part thereof, or a tobacco cell or cell culture, which has been modified to reduce the activity or expression of a homeodomain-like MYB domain protein, and which has a reduced content of alkaloids and / or TSNA precursors compared to an unmodified plant or unmodified cell or cell culture.

8. Plant propagation material obtainable (eg obtained) from a plant according to claim 7 or from a plant or a cell or cell culture produced by the method or use according to any of claims 1 to 6.

9. 9. The method or use according to any one of claims 1 to 6, or the plant or part thereof, or cell or cell culture according to claim 7, or the plant propagation material according to claim 8, wherein the alkaloid content of the plant is reduced compared to a plant or cell culture that has not been modified to modulate the activity or expression of a homeodomain-like MYB domain protein.

10. 10. A method or use according to any one of claims 1 to 6 and 9, a tobacco plant or part thereof or a tobacco cell or cell culture according to claim 7 or 9, or a plant propagation material according to claim 8, in which the content of one or more alkaloids selected from nicotine, nornicotine, PON, anabasine, myosmine and anatabine is reduced, preferably the content of nicotine, nornicotine and / or PON is regulated and reduced.

11. 11. The method or use of claim 10, a tobacco plant or part thereof, or a tobacco cell or tobacco cell culture according to claim 10, or a plant propagation material according to claim 10, which has a reduced nicotine content.

12. Use of a tobacco plant or part thereof, or a tobacco cell or cell culture, according to any one of claims 7 and 9 to 11, or a plant produced by the method according to any one of claims 1 to 6 and 9 to 11, for breeding plants.

13. 12. Use of a tobacco plant or part thereof, or a tobacco cell or cell culture, according to any one of claims 7 and 9 to 11, or a plant produced by the method according to any one of claims 1 to 6 and 9 to 11, for the manufacture of a product.

14. Use of a tobacco plant or part thereof according to any one of claims 7 and 9 to 11, or a plant produced by the method according to any one of claims 1 to 6 and 9 to 11, for producing a crop.

15. Use of a tobacco plant or part thereof according to any one of claims 7 and 9 to 11, or a plant produced by the method according to any one of claims 1 to 6 and 9 to 11, for the production of leaves.

16. Harvested leaves of a plant according to any one of claims 7 and 9 to 11, or obtainable from a plant propagated from the propagation material according to any one of claims 8 to 11, or obtainable from a plant obtained by the use according to any one of claims 4 to 6 and 9 to 11, or obtainable from a plant produced by the method according to any one of claims 1 to 6 and 9 to 11.

17. 17. Harvested leaves of the plant of claim 16, which are cut harvested leaves.

18. obtainable (e.g. obtained) from a plant obtainable from the use according to any one of claims 4 to 6 and 9 to 11; or which are obtainable (e.g. obtained) by treating a plant according to any one of claims 7 and 9 to 11; obtainable (e.g. obtained) from a plant propagated from a plant propagation material according to any one of claims 8 to 11; or obtainable (e.g. obtained) by processing harvested leaves of a plant according to claim 16 or 17; or Obtainable (e.g. obtained) from a plant produced by the method according to any one of claims 1 to 6 and 9 to 11. Treated leaves, preferably treated tobacco leaves, preferably treated non-viable tobacco leaves.

19. 20. The treated leaves of claim 18, wherein the leaves are treated by drying, fermenting, pasteurizing or a combination thereof.

20. The treated leaves according to claim 18 or 19, which are cut treated leaves.

21. A dried tobacco material made from a plant or part thereof according to any one of claims 7 and 9 to 11, or from harvested leaves according to claims 16 or 17, or from treated leaves according to any one of claims 18 to 20.

22. 22. A tobacco blend comprising the dry tobacco material of claim 21.

23. A tobacco plant or a part thereof, or a tobacco cell or cell culture according to any one of claims 7 and 9 to 11, A tobacco plant or part thereof propagated from the tobacco plant propagation material of claim 8. Harvested leaves of the plant according to claim 16 or 17. The treated leaves according to any one of claims 18 to 20. Tobacco industry products prepared from.

24. 24. The tobacco industry product of claim 23, which is a combustible smoking article.

25. 24. The tobacco industry product of claim 23 which is a smokeless tobacco product.

26. 24. The tobacco product of claim 23, which is a non-combustible aerosol delivery system, such as a tobacco heating device or an aerosol generating device.

27. A combustible smoking article, a non-combustible aerosol delivery system, a smokeless tobacco product, or a tobacco heating device comprising a plant or part thereof or an extract thereof (e.g., a tobacco extract) according to any one of claims 7 and 9 to 11, or a tobacco cell culture according to any one of claims 7 and 9 to 11, or a dried tobacco material according to claim 21, or a tobacco blend according to claim 22.

28. 1. Use of a nucleotide sequence encoding a homeodomain-like MYB domain protein for the selection of plants having modulated (e.g., reduced) alkaloid content and / or modulated (e.g., reduced) TSNA or TSNA precursor content, comprising: a) encoding the amino acid sequence shown in SEQ ID NO: 3, or a functional variant or a functional fragment or an orthologue of SEQ ID NO: 3, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3, or b) comprising a sequence as set forth in SEQ ID NO: 1 or 2, or a functional variant or a functional fragment or an orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2; The above uses.

29. a) encoding the amino acid sequence shown in SEQ ID NO: 3, or a functional variant or a functional fragment or an orthologue of SEQ ID NO: 3, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3, or b) comprising a sequence as set forth in SEQ ID NO: 1 or 2, or a functional variant or a functional fragment or an orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2 A plant mutant carrying a genetic variation in a nucleotide sequence, The mutant, wherein the genetic mutation reduces the activity or expression of a homeodomain-like MYB domain protein, and the mutant plant has reduced alkaloid content and / or regulated TSNA or TSNA precursor content compared to a comparable plant that does not carry the genetic mutation.

30. 30. Progeny or seed of a mutant plant carrying the genetic mutation of claim 29.

31. a) encoding the amino acid sequence shown in SEQ ID NO: 3, or a functional variant or a functional fragment or an orthologue of SEQ ID NO: 3, or a sequence having at least 80% identity to SEQ ID NO: 3, or a homologue of SEQ ID NO: 3, or b) comprising a sequence as set forth in SEQ ID NO: 1 or 2, or a functional variant or a functional fragment or an orthologue of SEQ ID NO: 1 or 2, or a nucleic acid sequence having at least 80% identity to SEQ ID NO: 1 or 2, or a homologue of SEQ ID NO: 1 or 2 Harvested leaves, processed leaves, or cured tobacco material produced from a plant containing an alteration in a nucleotide sequence, The harvested leaves, processed leaves, or cured tobacco material, wherein the modification reduces the activity or expression of a homeodomain-like MYB domain protein, and the plant has a reduced alkaloid content and / or a regulated TSNA or TSNA precursor content compared to a comparable plant that does not possess the modification in the homeodomain-like MYB domain protein.

Images