Antitumor antibodies

Abstract

Provided herein is an antibody that targets tumors, and the binding of the antibody to tumors depends on the expression of one or more glycosyltransferases in tumors.These antibodies preferentially bind to tumor tissues compared to normal tissues.Such antibodies are used in methods for inhibiting the proliferation of tumor cells.

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims priority to U.S. Provisional Application No. 63 / 362,520, filed April 5, 2022, and U.S. Provisional Application No. 63 / 374,682, filed September 6, 2022. The entire contents of each provisional application are incorporated herein by reference for all purposes. [Background technology]

[0002] (Cancer treatment field) This application relates to therapeutic antibodies for the treatment of various cancers.

[0003] Protein glycosylation is one of the most complex and common post-translational modifications, representing the enzymatic addition of carbohydrate chains called glycans. Glycan-specific antibodies can be detected during childhood, even without immunization by infection and vaccination. The expression of glycans and glycan-specific antibodies may change during cancer progression. Glycans and glycan-specific antibodies have been suggested to serve as diagnostic and prognostic markers for cancer (Tikhonov et al.,Glycan-specific antibodies as potential cancer biomarkers: a focus on microarray application,Clinical Chemistry and Laboratory Medicine(CCLM)(2019)Vol.58:Issue10). However, most of the known glycans are found in cancer patients and healthy individuals, so the utility of glycans in cancer treatment has not been thoroughly studied. Summary of the Invention

[0004] In some embodiments, provided herein are antibodies that bind to tumors, where binding of the antibody to the tumor is dependent on expression of one or more glycosyltransferases in the tumor, one of the one or more glycosyltransferases having N-acetyl-galactosaminyltransferase activity.

[0005] In some embodiments, one of the one or more glycosyltransferases has fucosyltransferase activity. In some embodiments, the glycosyltransferase with N-acetyl-galactosaminyltransferase activity is selected from the group consisting of B4GALNT3 and B4GALNT4. In some embodiments, one of the one or more glycosyltransferases with fucosyltransferase activity is selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0006] In some embodiments, the tumor expresses tumor-associated glycans. In some embodiments, the tumor-associated glycans are extracellular glycans. In some embodiments, the one or more glycosyltransferases are selected from the group consisting of B4GALNT3 and B4GALNT4. In some embodiments, the one or more glycosyltransferases are selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11. In some embodiments, the glycosyltransferase is FUT4. In some embodiments, the glycosyltransferase is B4GALNT3. In some embodiments, the presence of tumor-associated glycans is dependent on the expression of B4GALNT3 and FUT4 in the tumor. In some embodiments, the antibody preferentially binds to tumor tissue over normal tissue. In some embodiments, the antibody is internalized by tumor cells upon contact with the tumor.

[0007] In some embodiments, the antibody binds to a tumor and comprises a heavy chain variable region comprising an HCDR1, HCDR2, and / or HCDR3 amino acid sequence listed in Table 1, or a variant of the HCDR1, HCDR2, and / or HCDR3 amino acid sequence with one, two, three, four, five or more amino acid substitutions, and / or a light chain variable region comprising an LCDR1, LCDR2, and / or LCDR3 amino acid sequence listed in Table 2, or a variant of the LCDR1, LCDR2, and / or LCDR3 amino acid sequence with one, two, three, four, five or more amino acid substitutions.

[0008] AB-00 6410、AB-011110、AB-011111、AB-011 366、AB-011367、AB-011368、AB-011369、AB-011370、AB-011371、AB-01137 2、AB-011373、AB-011374、AB-011375、AB-011376、AB-011622、AB-011623、 AB-011624、AB-011625、AB-011626、AB-011627、AB-011628、AB-011781、AB- 011782、AB-011783、AB-011784、AB-011785、AB-011786、AB-011787、AB-01 1788、AB-011789、AB-011790、AB-011791、AB-011792、AB-011793、AB-0117 94、AB-011795、AB-011796、AB-011797、AB-011798、AB-011799、AB-011800 、AB-011801、AB-011802、AB-011803、AB-011804、AB-011805、AB-011806、AB -011807、AB-011808、AB-011809、AB-011810、AB-011811、AB-011812、AB-0 11813、AB-011814、AB-011815、AB-011816、AB-011817、AB-011818、AB-011 819、AB-011820、AB-011821、AB-011822、AB-011823、AB-011824、AB-01182 5、AB-011826、AB-011827、AB-011828、AB-011829、AB-011830、AB-011831、A B-011832、AB-011833、AB-011834、AB-011835、AB-011836、AB-011837、AB- 011838、AB-011839、AB-011840、AB-011841、AB-011842、AB-011843、AB-01 1844、AB-011845、AB-011846、AB-011847、AB-011848、AB-011849、AB-0118 50、AB-011851、AB-011852、AB-011853、AB-011854、AB-011855、AB-011856、The antibody comprises all six CDRs of an antibody selected from the group consisting of AB-011857, AB-011858, AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, and AB-011873.

[0009] In some embodiments, the antibody comprises a VH region comprising a VH amino acid sequence of Table 3 or an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the VH amino acid sequence of Table 3, and / or the antibody comprises a VL region comprising a VL amino acid sequence of Table 3 and an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the VL amino acid sequence of Table 3.

[0010] About 367、AB-011368、AB-011369、AB-011370、AB-011371、AB-011372、AB-01137 3、AB-011374、AB-011375、AB-01137、AB-011622、AB-011623、AB-011624、A B-011625、AB-011626、AB-011627、AB-011628、AB-011781、AB-011782、AB- 011783、AB-011784、AB-011785、AB-011786、AB-011787、AB-011788、AB-01 1789、AB-011790、AB-011791、AB-011792、AB-011793、AB-011794、AB-0117 95、AB-011796、AB-011797、AB-011798、AB-011799、AB-011800、AB-011801 、AB-011802、AB-011803、AB-011804、AB-011805、AB-011806、AB-011807、AB -011808、AB-011809、AB-011810、AB-011811、AB-011812、AB-011813、AB-0 11814、AB-011815、AB-011816、AB-011817、AB-011818、AB-011819、AB-011 820、AB-011821、AB-011822、AB-011823、AB-011824、AB-011825、AB-01182 6、AB-011827、AB-011828、AB-011829、AB-011830、AB-011831、AB-011832、A B-011833、AB-011834、AB-011835、AB-011836、AB-011837、AB-011838、AB- 011839、AB-011840、AB-011841、AB-011842、AB-011843、AB-011844、AB-01 1845、AB-011846、AB-011847、AB-011848、AB-011849、AB-011850、AB-0118 51、AB-011852、AB-011853、AB-011854、AB-011855、AB-011856、AB-011857、The antibody comprises both the VH and VL of an antibody selected from the group consisting of AB-011858, AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, AB-011873 and variants thereof. In some embodiments, the antibody comprises both the VH and VL of an antibody selected from the group consisting of AB-011110, AB-011788, AB-011789, AB-011794, AB-011367, and AB-011861. The present disclosure also provides antibodies that compete for binding with any of the above antibodies.

[0011] Also provided herein is an immunoconjugate comprising the antibody disclosed above and a cytotoxic agent. In some embodiments, the cytotoxic agent is an auristatin. In some embodiments, the cytotoxic agent is ZymeLink™ auristatin (ZLA).

[0012] In some embodiments, the immunoconjugate has formula (I) or (II):

[0013] [ka] where L is a cleavable linker, n is the drug-to-antibody ratio (DAR) and is an integer from 1 to 12, and Ab is an antibody disclosed herein; or

[0014] [ka]

[0015] where n is the drug-antibody ratio (DAR) and is an integer from 1 to 12, and Ab is an antibody disclosed herein.

[0016] The present specification also provides the V H Sequence and / or V L Provided herein is a polynucleotide encoding a polypeptide comprising the sequence.Also provided herein is an expression vector comprising the polynucleotide.Also provided herein is a host cell comprising the expression vector.Also provided herein is a pharmaceutical composition comprising an antibody of the immunoconjugate and a pharma- ceutically acceptable carrier.

[0017] Also provided herein are methods of treating a cancer patient, the methods comprising administering to the patient an immunoconjugate or antibody.

[0018] Also provided herein is a method for identifying a patient having a tumor suitable for treatment with an antibody, wherein binding of the antibody to the tumor is dependent on expression of one or more glycotransferases in the tumor, one of the one or more glycosyltransferases having N-acetyl-galactosaminyltransferase activity, the method comprising contacting a tumor sample from the patient with an antibody disclosed herein and detecting binding of the antibody to the tumor sample, wherein detection of binding identifies a patient having a tumor suitable for treatment with the antibody.

[0019] Also provided herein is a method for selecting an anti-tumor antibody, the method comprising: (1) contacting a candidate antibody with a tumor cell (or a lysate thereof) or a control cell (or a lysate thereof), the tumor cell (or a lysate thereof) (i) containing one or more glycosyltransferases in the tumor, one of the one or more glycosyltransferases having N-acetyl-galactosaminyltransferase activity; (2) detecting binding of the candidate antibody to the tumor cell (or a lysate thereof) or the control cell (or a lysate thereof); and (3) selecting the candidate antibody as an anti-tumor antibody if binding of the candidate antibody to the tumor cell (or a lysate thereof) is greater than binding of the candidate antibody to the control cell (or a lysate thereof).

[0020] Also provided herein is the use of the antibodies or immunoconjugates disclosed herein for a method of treating cancer. [Brief description of the drawings]

[0021] [Figure 1] 1 is a graph showing that AB-006410 binds strongly to the human cancer cell line LoVo, while binding of the same antibody to glycosyltransferase-inhibited LoVo cells is reduced. [Figure 2A] 1 is a graph showing reduced binding of AB-006410 in cells engineered to knock out glycosyltransferase B4GALNT3 by CRISPR. [Figure 2B] 1 is a graph showing reduced binding of AB-006410 in cells engineered by CRISPR to knock out the glycosyltransferase FUT4. [Figure 3A] FIG. 1 is a graph showing enhanced binding of AB-006410 (B) in A549 cells in which the glycan profile was altered by overexpression of B4GALNT3 and FUT4 compared to unaltered cells (A). [Figure 3B] FIG. 1 is a graph showing enhanced binding of AB-006410 (B) in A549 cells in which the glycan profile was altered by overexpression of B4GALNT3 and FUT4 compared to unaltered cells (A). [Figure 3C] FIG. 13 is a graph showing enhanced binding of AB-011110 (D) in A549 cells in which the glycan profile was altered by overexpression of B4GALNT3 and FUT4 compared to unaltered cells (C). [Figure 3D] FIG. 13 is a graph showing enhanced binding of AB-011110 (D) in A549 cells in which the glycan profile was altered by overexpression of B4GALNT3 and FUT4 compared to unaltered cells (C). [Figure 4]1 is a graph showing flow cytometry analysis of binding of AB-006410 to isolated human colorectal cancer tumor cells. [Diagram 5] FIG. 1 shows that variant AB-011111 showed the same reactivity profile as AB-006410 against colorectal cancer tumor tissue. [Figure 6A] FIG. 1 shows the tumor-specific reactivity of AB-006410 against multiple human cancer types. [Figure 6B] FIG. 1 shows the tumor-specific reactivity of AB-006410, AB-011110, and AB-011628 against colorectal and pancreatic cancer. [Figure 7] 1 is a graph showing ADC activity of glycan-binding agents against LoVo cells in the context of cetuximab Fv. [Figure 8] FIG. 13 is a graph showing ADC cytotoxicity of variants AB-011110 and AB-011111 of parent AB-006410. [Figure 9A] FIG. 1 is a graph showing the cytotoxicity of AB-006410-auristatin ZymeLink™ ADC (AB-006410-ZLA) against LoVo cells, with cetuximab-auristatin ZymeLink™ ADC (cetuximab-ZLA) included as a positive control and isotype-auristatin ZymeLink™ ADC (isotype-ZLA) included as a negative control. [Figure 9B] 1 is a graph showing the cytotoxicity of various glycan-binding agents as Auristatin-Zymelink™ ADC constructs against LoVo cells. [Figure 9C] 1 is a graph showing the cytotoxicity of various glycan-binding agents as Auristatin-Zymelink™ ADC constructs against LoVo cells. [Figure 10]FIG. 1 is a graph showing tumor inhibition by AB-006410-AuristatinZymeLink™ ADC construct (AB6410-Zyme), with cetuximab-AuristatinZymeLink™ ADC (Cetuximab-zyme) included as a positive control and isotype-AuristatinZymeLink™ ADC (Isotype-Zyme) included as a negative control. [Figure 11A-1] 1 is a table showing the alignment and CDR assignments of AB-006410 and various other glycan binders. [Figure 11A-2] 1 is a table showing the alignment and CDR assignments of AB-006410 and various other glycan binders. [Figure 11B] 1 is a table showing the alignment and CDR assignments of AB-006410 and various other glycan binders. [Figure 11C-1] 1 is a table showing the alignment and CDR assignments of AB-006410 and various other glycan binders. [Figure 11C-2] 1 is a table showing the alignment and CDR assignments of AB-006410 and various other glycan binders. [Figure 11D] 1 is a table showing the alignment and CDR assignments of AB-006410 and various other glycan binders. [Figure 12] 1 is a graph showing that overexpression of B4GALNT3 and FUT4 in A549 cells sensitizes these cells to AB-006410-ADC-mediated cell death. [Figure 13] Immunofluorescence staining of colorectal cancer tissue sections with AB-006410, B4GALNT3, and FUT4 antibodies. The upper right corner of each image labeled "AB-006410" or "B4GALNT3" shows an enlarged version of the content in the box. [Figure 14] Graph showing flow cytometry analysis of binding of AB-006410 variants to CRC cell lines, namely, LoVo, HT29, LS174T. [Figure 15] 1 is a graph showing flow cytometry analysis of AB-006410 internalization in HT55, LoVo, and NUGC4 cells, where the top panel shows the signal from AB-006410 internalized within the cells and the bottom panel shows the signal from surface-bound AB-006410. [Figure 16] FIG. 1 shows the structures of glycans containing LacdiNAc. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] As used herein, the singular forms "a," "an," and "the" include plural referents unless the content dictates otherwise. Thus, for example, reference to an "antibody" optionally includes a combination of two or more such molecules, and so forth.

[0023] As used herein, the term "about" refers to the normal error range for the respective value, readily known to one of ordinary skill in the art, e.g., ±20%, ±10%, or ±5% within the intended meaning of the stated value.

[0024] As used herein, the term "antibody" refers to an isolated or recombinant binding agent that contains the necessary variable region sequence to specifically bind to an antigen epitope. Thus, as used herein, an "antibody" is any form of antibody of any class or subclass or fragment thereof that exhibits the desired biological activity, such as binding to a specific target antigen. Thus, "antibody" is used in the broadest sense and specifically covers monoclonal antibodies (including full-length monoclonal antibodies), human antibodies, chimeric antibodies, nanobodies, diabodies, multispecific antibodies (e.g., bispecific antibodies), antibody fragments (including but not limited to scFv, Fab, etc.), as long as they exhibit the desired biological activity.

[0025] An "antibody fragment" includes a portion of an intact antibody, such as the antigen-binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, Fv fragments, diabodies, linear antibodies (e.g., Zapata et al., Protein Eng. 8(10)):1057-1062(1995)), single-chain antibody molecules (e.g., scFv), and multispecific antibodies formed from antibody fragments. Papain digestion of an antibody produces two identical antigen-binding fragments, called "Fab" fragments (each with a single antigen-binding site), and a remaining "Fc" fragment, reflecting its ability to crystallize readily. Pepsin treatment produces an F(ab')2 fragment with two antigen-binding sites and still capable of cross-linking antigen.

[0026] As used herein, the term "tumor targeting" or "tumor targeting" with respect to an antibody refers to an antibody that preferentially binds to tumor tissue over normal tissue. In some embodiments, the normal tissue is adjacent to the tumor and is referred to as tumor-adjacent tissue or TAT. In some embodiments, tumor-targeting antibodies also reduce tumor growth rate, tumor size, invasion, and / or metastasis through direct or indirect effects on tumor cells.

[0027] As used herein, a "V region" refers to an antibody variable region domain that includes framework 1, CDR1, framework 2, CDR2, and framework 3 segments (including CDR3 and framework 4). A heavy chain V region, i.e., a V H is the result of a rearrangement of the V gene (HV), D gene (HD), and J gene (HJ) during B cell differentiation, called V(D)J recombination. L is the result of rearrangement of the V gene (LV) and J gene (LJ).

[0028] As used herein, "complementarity-determining region (CDR)" refers to the three hypervariable regions (HVRs) in each chain that interrupt the four "framework" regions established by the light and heavy chain variable regions. The CDRs are primarily responsible for binding to an epitope of an antigen. The CDRs of each chain are designated CDR1, CDR2, and CDR3, numbered sequentially from the N-terminus, and are also identified by the chain in which they are located. Thus, the V H CDR3 (HCDR3) is located in the variable domain of the heavy chain of the antibody in which it is found, whereas V L CDR3 (LCDR3) is the CDR3 from the variable domain of the light chain of the antibody in which it is located. When referring to CDR sequences, the term "CDR" is used interchangeably with "HVR."

[0029] The amino acid sequences of the CDRs and framework regions can be determined using various definitions known in the art, such as, for example, Kabat, Chothia, the international ImMunoGeneTics database (IMGT), and AbM (see, for example, Chothia & Lesk, 1987, Canonical structures for the hypervariable regions of immunoglobulins. J. Mol. Biol. 196, 901-917; Chothia C. et al., 1989, Conformations of immunoglobulin hypervariable regions. Nature 342, 877-883; Chothia C. et al., 1992, Structural repertoire of the human VH segments J. Mol. Biol. 227, 799-817; Al-Lazikani et al., J. Mol. Biol. 1997, 273(4)).Definitions of antigen binding sites are described in: Ruiz et al., IMGT, International Immunogene Database, Nucleic Acids Res., 28, 219-221 (2000), and Lefranc, M.-P. IMGT, International Immunogene Database, Nucleic Acids Res. Jan 1;29(1):207-9 (2001); MacCallum et al., Antibody-antigen interactions: Contact analysis and binding site topography, J. Mol. Biol., 262(5), 732-745 (1996); and Martin et al, Proc. Natl Acad. Sci. USA, 86, 9268-9272 (1989); Martin et al., Methods Enzymol., 203, 121-153, (1991); Pedersen et al. al., Immunomethods, 1, 126, (1992); and Rees et al., In Sternberg MJE (ed.), Protein Structure Prediction. Oxford University Press, Oxford, 141-172 1996). References to CDRs as determined by Kabat numbering are based on, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institute of Health, Bethesda, MD (1991)). Chothia CDRs are determined as defined by Chothia (see, e.g., Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)).

[0030] The CDRs as shown in Tables 1 and 2 are defined by IMGT and Kabat. HThe CDRs are defined as follows: HCDR1 is defined by a combination of Kabat and IMGT, HCDR2 is defined by Kabat, and HCDR3 is defined by IMGT. L CDRs are defined by Kabat. Figures 11A-11D show specific glycan-binding agents V with CDRs designated by Kabat and IMGT. H and V L The alignment of sequences is shown. The CDRs of other glycan binding agents provided herein can be similarly designated. As known in the art, the numbering and arrangement of CDRs can vary depending on the numbering system adopted. It should be understood that the disclosure of variable heavy chain sequence and / or variable light chain sequence includes the disclosure of related CDRs, regardless of the numbering system adopted.

[0031] "Fc region" refers to the constant region of an antibody excluding the first constant region immunoglobulin domain. Thus, for example, for human immunoglobulins, "Fc" refers to the last two constant region immunoglobulin domains of IgA, IgD, and IgG, the last three constant region immunoglobulin domains of IgE and IgM, and the flexible hinge at the N-terminus of these domains. For IgA and IgM, Fc may include the J chain. For IgG, Fc includes immunoglobulin domains Cγ2 and Cγ3 and the hinge between Cγ1 and Cγ2. Although it is understood in the art that the boundaries of the Fc region may vary, the human IgG heavy chain Fc region is usually defined to include residues C226 or P230 at the carboxyl terminus, using numbering according to the EU index by Kabat et al. (1991, NIH Publication 91-3242, National Technical Information Service, Springfield, Va.). The term "Fc region" can refer to this region alone or in the context of an antibody or antibody fragment. "Fc region" includes naturally occurring allelic variants of the Fc region, as well as modified Fc regions that have been modified to modulate, for example, effector functions or other properties, such as the pharmacokinetics, stability, or production characteristics of the antibody. The Fc region also includes variants that do not exhibit a change in biological function. For example, one or more amino acids can be deleted from the N-terminus or C-terminus of the Fc region of an immunoglobulin without significant loss of biological function. Such variants can be selected according to general rules known in the art to have minimal effect on activity (see, for example, Bowie et al., Science 247:306-1310, 1990). For example, in the case of IgG4 antibodies, a single amino acid substitution (S228P according to the Kabat numbering, designated IgG4Pro) can be introduced to eliminate the heterogeneity observed in recombinant IgG4 antibodies (see, e.g., Angal et al., Mol Immunol 30:105-108, 1993).

[0032] As used herein, "EC 50" refers to the half maximal effective concentration, which is the concentration of an antibody that elicits a response (signal generated in an engagement assay) halfway between the baseline and maximum after a specified exposure time. In some embodiments, "multiple of EC50" refers to the ratio of the EC50 of a reference antibody to the EC50 of a test antibody. 50 It is determined by dividing by.

[0033] The term "equilibrium dissociation constant" means (K D ), and the dissociation rate constant (k d ,time -1 ) to the binding rate constant (k a ,time -1 M -1 ) The equilibrium dissociation constant can be measured by any method. Thus, in some embodiments, the antibodies of the disclosure have a K of less than about 50 nM, typically less than about 25 nM, or less than 10 nM, e.g., less than about 5 nM or less than about 1 nM, and often less than about 10 nM, as determined by surface plasmon resonance analysis using a biosensor system, such as a Biacore® system, performed at 37° C. D In some embodiments, the antibodies of the disclosure have a binding affinity of 5×10 when measured as a bivalent antibody. -5 Less than M, 10 -5 Less than M, 5×10 -6 Less than M, 10 -6 Less than M, 5×10 -7 Less than M, 10 -7 Less than M, 5×10 -8 Less than M, 10 -8 Less than M, 5×10 -9 Less than M, 10 -9 Less than M, 5×10 -10 Less than M, 10 -10 Less than M, 5×10 -11 Less than M, 10 -11 Less than M, 5×10 -12 Less than M, 10 -12 Less than M, 5×10 -13 Less than M, 10 -13 Less than M, 5×10 -14 Less than M, 10 -14 Less than M, 5×10 -15 Less than M or 10 -15K less than M D In the context of the present invention, "improved" K D That is, lower K D In some embodiments, the antibodies of the present disclosure have a molecular weight of 5×10 when measured as a monovalent antibody, such as a monovalent Fab. -5 Less than M, 10 -5 Less than M, 5×10 -6 Less than M, 10 -6 Less than M, 5×10 -7 Less than M, 10 -7 Less than M, 5×10 -8 Less than M, 10 -8 Less than M, 5×10 -9 Less than M, 10 -9 Less than M, 5×10 -10 Less than M, 10 -10 Less than M, 5×10 -11 Less than M, 10 -11 Less than M, 5×10 -12 Less than M, 10 -12 Less than M, 5×10 -13 Less than M, 10 -13 Less than M, 5×10 -14 Less than M, 10 -14 Less than M, 5×10 -15 Less than M or 10 -15 K less than M D In some embodiments, the glycan-binding agents of the present disclosure have a K of less than 100 pM, or, for example, less than 75 pM, e.g., in the range of 1 to 100 pM, as measured by surface plasmon resonance analysis using a biosensor system, such as a Biacore® system, performed at 37° C. D In some embodiments, the glycan-binding agents of the present disclosure have a K of greater than 100 pM as measured by surface plasmon resonance analysis using a biosensor system, such as a Biacore® system, performed at 37° C. D For example, a K in the range of 100 to 1000 pM or 500 to 1000 pM. D has.

[0034] The term "monovalent molecule" refers to a molecule that has one antigen-binding site, e.g., a Fab or scFv.

[0035] As used herein, the term "bivalent molecule" refers to a molecule having two antigen-binding sites. In some embodiments, the bivalent molecule of the invention is a bivalent antibody or a bivalent fragment thereof. In some embodiments, the bivalent molecule of the invention is a bivalent antibody. In some embodiments, the bivalent molecule of the invention is an IgG. Generally, monoclonal antibodies have a bivalent basic structure. IgG and IgE have only one bivalent unit, whereas IgA and IgM have multiple bivalent units (2 and 5, respectively) and therefore have a higher valency. This bivalency increases the affinity of the antibody for the antigen.

[0036] As used herein, the terms "monovalent binding" or "monovalently binds" refer to one antigen-binding site binding to the antigen.

[0037] The terms "bivalent binding" or "bivalently bind" refer to both antigen-binding sites of a bivalent molecule binding to its antigen. In some embodiments, both antigen-binding sites of a bivalent molecule share the same antigen specificity.

[0038] The term "valency" refers to the number of different sites at which an antibody binds to an antigen. A monovalent antibody contains one binding site for an antigen. A bivalent antibody contains two binding sites for the same antigen.

[0039] The term "affinity" in the context of antibody binding to an antigen refers to the combined binding strength of the antibody's multiple binding sites. Thus, "bivalent affinity" refers to the combined strength of two binding sites.

[0040] The term "identical" or percent "identity" in the context of two or more polynucleotide or polypeptide sequences refers to two or more sequences or subsequences that, when compared and aligned for maximum correspondence over a comparison window or designated region, are the same (e.g., 100% identity) or have a specified percentage of nucleotides or amino acid residues that are identical (e.g., at least 70%, at least 75%, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity, or 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) over a designated region, e.g., the length of the two sequences. Alignment for determining percent amino acid sequence identity can be performed in various ways, including using publicly available computer software such as BLAST, BLAST-2, ALIGN, Megalign (DNASTAR) software. Examples of algorithms suitable for determining percent sequence identity and sequence similarity include the BLAST 2.0 algorithm described in Altschul et al., Nuc.Acids Res.25:3389-3402 (1977) and Altschul et al., J.Mol.Biol.215:403-410 (1990). Thus, for the purposes of this disclosure, BLAST 2.0 can be used with default parameters to determine percent sequence identity.

[0041] When used in the context of identifying a given amino acid residue in a polypeptide sequence, the terms "corresponding to," "determined with reference to," or "numbered with reference to" refer to the position of the residue in a particular reference sequence when a given amino acid sequence is maximally aligned and compared to the reference sequence. A polypeptide that is aligned to a reference sequence need not be the same length as the reference sequence.

[0042] "Conservative" substitutions refer to substitutions of amino acids such that charge, polarity, hydropathy (hydrophobic, neutral, or hydrophilic), and / or size of the side group chain are maintained. Exemplary sets of amino acids that can be substituted for one another include (i) the positively charged amino acids Lys and Arg, and His at pH about 6, (ii) the negatively charged amino acids Glu and Asp, (iii) the aromatic amino acids Phe, Tyr, and Trp, (iv) the nitrogen ring amino acids His and Trp, (v) the aliphatic hydrophobic amino acids Ala, Val, Leu, and Ile, (vi) the hydrophobic sulfur-containing amino acids Met and Cys, which are less hydrophobic than Val, Leu, and Ile, (vii) the small polar uncharged amino acids Ser, Thr, Asp, and Asn, (viii) the small hydrophobic or neutral amino acids Gly, Ala, and Pro, (ix) the amide-containing amino acids Asn and Gln, and (xi) the beta-branched amino acids Thr, Val, and Ile. The charges of the amino acids referred to in this paragraph refer to the charge at pH 6-7.

[0043] The terms "nucleic acid" and "polynucleotide" are used interchangeably and refer to both sense and antisense strands of RNA, cDNA, genomic DNA, as well as synthetic forms and mixed polymers of the above. In certain embodiments, nucleotides refer to ribonucleotides, deoxynucleotides, or modified forms of either type of nucleotide, or combinations thereof. The term also includes, but is not limited to, single-stranded and double-stranded forms of DNA. Furthermore, polynucleotides, such as cDNA or mRNA, may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotide linkages. Nucleic acid molecules may be chemically or biochemically modified or may include non-natural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labels, methylation, replacement of one or more analogs of naturally occurring nucleotides, uncharged bonds (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds (e.g., phosphorothioates, phosphorodithioates, etc.), pendant moieties (e.g., polypeptides), intercalators (e.g., acridines, psoralens, etc.), chelators, alkylators, and internucleotide modifications such as modified bonds (e.g., alpha-anomeric nucleic acids, etc.). The above terms are also intended to include any topological structure, including single-stranded, double-stranded, partially duplexed, triplexed, hairpin, circular, and padlock structures. Reference to a nucleic acid sequence includes its complementary sequence, unless otherwise specified. Thus, reference to a nucleic acid molecule having a particular sequence should be understood to include its complementary strand with its complementary sequence. The term also includes codon-optimized nucleic acids that encode the same polypeptide sequence.

[0044] As used herein, the term "vector" refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. This term includes vectors as self-replicating nucleic acid structures as well as vectors integrated into the genome of a host cell into which it is introduced. As used herein, "vector" refers to a recombinant construct in which a nucleic acid sequence of interest is inserted into the vector. Certain vectors are capable of inducing the expression of a nucleic acid to which it is operably linked. Such vectors are referred to herein as "expression vectors."

[0045] A "substitution" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides, respectively.

[0046] An "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. Isolated nucleic acid includes a nucleic acid molecule contained within a cell that ordinarily contains the nucleic acid molecule, but where the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its native chromosomal location.

[0047] An "isolated nucleic acid encoding an antibody or fragment thereof" refers to one or more nucleic acid molecules encoding the heavy or light chain (or fragment thereof) of an antibody, and includes such nucleic acid molecule(s) in a single vector or in separate vectors, and such nucleic acid molecule(s) present in one or more locations within a host cell.

[0048] The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, and the progeny of such cells. Thus, a host cell is a recombinant host cell, and includes the primary transformed cell and its progeny, regardless of the number of passages.

[0049] A polypeptide "variant" is typically a polypeptide that differs from one or more of the polypeptide sequences specifically disclosed herein by one or more substitutions, deletions, additions, and / or insertions.

[0050] As used herein, the term "cancer cell" or "tumor cell" refers to a neoplastic cell. This term includes cells derived from benign as well as malignant tumors. Neoplastic transformation refers to the change in the phenotype of the tumor cell relative to the cell type from which it was derived. Changes can include loss of contact inhibition, morphological changes, and unregulated cell proliferation.

[0051] The terms "inhibiting tumor growth" and "inhibiting cancer growth" are used interchangeably and refer to slowing the growth and / or reducing the cancer cell burden in a cancer patient. Thus, "inhibiting cancer growth" includes killing cancer cells, as well as reducing tumor growth rate, tumor size, invasion, and / or metastasis by direct or indirect effects on tumor cells.

[0052] A "therapeutic agent" refers to an agent that, when administered in a therapeutically effective amount to a patient suffering from a disease, cures or at least partially arrests the symptoms of the disease and complications associated with the disease.

[0053] "Expression of a glycan by a cell" or "glycan expressed by a cell" means that the glycan is present within or on the cell.

[0054] "Glycan-overexpressing tumor" or "glycan-overexpressing tumor" or "glycan-overexpressing cancer" or "glycan-overexpressing cancer" refers to a tumor or cancer that expresses a particular glycan at a level higher than the level of the glycan expressed in normal tissue (e.g., tumor-adjacent tissue or TAT), or that has an increased amount of the glycan compared to normal tissue. In certain embodiments, a glycan-overexpressing tumor or cancer expresses the glycan at a level at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 80%, at least 100%, at least 200%, at least 300% or more higher than normal tissue (e.g., tumor-adjacent tissue or TAT).

[0055] The term "tumor-associated glycan" refers to a glycan expressed by tumor cells. In some embodiments, tumor-associated glycans are not expressed by normal tissue cells. In some embodiments, tumor-associated glycans are expressed by tumors at levels at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 80%, at least 100%, at least 200%, at least 300% or more higher than normal tissue (e.g., tumor-adjacent tissue or TAT). In some embodiments, tumor-associated glycans are expressed on the cell surface, i.e., are extracellular glycans. The glycans or tumor-associated glycans disclosed herein may be bound to proteins or lipids, known as glycoproteins and glycolipids.

[0056] In some aspects, the present disclosure further provides a method for identifying a subject who is a candidate for treatment with a glycan-binding agent having a tumor-targeting effect. Thus, in one embodiment, the present invention provides a method for identifying a patient who can benefit from treatment with the glycan-binding agent of the present disclosure. In one embodiment, the patient has a tumor that expresses glycans. In one embodiment, the patient has a tumor that expresses tumor-associated glycans. In some embodiments, the tumor sample is from a primary tumor. In alternative embodiments, the tumor sample is a metastatic lesion. Binding of an antibody to tumor cells via binding interactions with glycans can be measured using any assay, such as immunohistochemistry or flow cytometry. In some embodiments, binding of an antibody to at least 0.2%, 0.5%, or 1%, or at least 5%, 10%, or at least 20%, 30%, or 50% of tumor cells in a sample can be used as a selection criterion for determining which patients will be treated with the glycan-binding agents described herein. In other embodiments, analysis of blood components is used to identify patients whose tumor cells express tumor-associated glycans.

[0057] The glycan-binding agents disclosed herein can be used to treat a number of different cancers. In some embodiments, cancer patients who can benefit from the treatment of glycan-binding agents suffer from cancers that express glycans. In some embodiments, cancer patients who can benefit from the treatment of glycan-binding agents have tumors that express tumor-associated glycans. In some embodiments, the cancer is carcinoma, melanoma, or sarcoma.

[0058] As used herein, the term "glycan binding agent," "antibody that binds to glycan," or "anti-glycan antibody" refers to a molecule, e.g., an antibody or antibody binding domain, that binds to a tumor and whose binding depends on the activity of one or more glycosyltransferases. In some embodiments, the glycan binding agent binds to tumor-associated glycans under permissive conditions (e.g., in a suitable buffer), and the detection signal resulting from the binding is at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 100-fold, at least 150-fold, or at least 200-fold higher than the reference level. In some embodiments, the reference level is the detection signal generated by contacting a control antibody with a glycan or contacting an antibody with a control protein.

[0059] A "variant" of a reference antibody refers to an antibody that differs from the reference antibody in one or more substitutions, deletions, additions, and / or insertions in the amino acid sequence of the heavy and / or light chains.

[0060] As used herein, the term "internalize" or "internalization" refers to the phenomenon in which an antibody molecule crosses the cell membrane and reaches the cytoplasm and / or nucleus.

[0061] The present application relates to tumor-targeting antibodies that bind to tumors, and the binding is dependent on the activity of one or more glycosyltransferases. In some embodiments, the glycan-binding agent binds to tumor-associated glycans. These antibodies are referred to as glycan-binding agents in this disclosure. The antibodies preferentially bind to tumor tissue over normal tissue, and exhibit cytotoxicity against tumor cells in various antibody toxins or antibody immunomodulatory agent constructs. Thus, these antibodies exhibit therapeutic efficacy in the treatment of cancer.

[0062] The glycan-binding agents are also useful in diagnostic applications to detect tumors suitable for treatment with the glycan-binding agents.

[0063] Glycan Glycans are a complex group of monosaccharide or polysaccharide compounds composed of various monosaccharide residues linked together by glycosidic bonds. A glycosidic bond is a covalent bond between a carbohydrate moiety, which may or may not be another carbohydrate (e.g., C-, O-, N-), and another group. Through these glycosidic bonds, glycolipids, glycoproteins, and polysaccharides are formed. For the purposes of this disclosure, the term "glycan" refers to the carbohydrate moiety of a polysaccharide or oligosaccharide, or a glycoprotein, glycolipid, or any glycol complex, such as a glycopeptide, peptidoglycan, lipopolysaccharide, or proteoglycan. Glycans can be homopolymers or heteropolymers of monosaccharide residues.

[0064] Glycosidic bond formation usually requires glycosyltransferases. Glycosyltransferases modify glycans in the ER and Golgi apparatus during biosynthesis. Glycosyltransferases catalyze the transfer of a sugar moiety from an activated nucleotide sugar (also called a "glycosyl donor") to a nucleophilic glycosyl acceptor molecule, where the nucleophile can be oxygen, carbon, nitrogen, or sulfur based. Williams, GJ; Thorson, JS(2009).Natural product glycosyltransferases: properties and applications.Advances in Enzymology and Related Areas of Molecular Biology.Vol.76.pp.55-119.At least 200 glycosyltransferases have been identified to date. Cummings RD,Pierce JM.2014.The challenge and promise of glycomics.Chem.Biol.21:1-15.

[0065] Glycosyltransferases Glycosyltransferase B4GALNT3 (β-1,4-N-acetyl-galactosaminyltransferase 3) is responsible for transferring N-acetylgalactosamine (GalNAc) to N-acetylglucosamine-β (GlcNAc) to form N,N'-diacetyllactosediamine with a β1,4 linkage. The product of this reaction is GalNAcbeta1,4GlcNAc (LacdiNAc). Figure 16. 10.3390 / biom12020195 Ikehara Y et al "Apical Golgi localization of N,N'-diacetyllactosediamine synthase,beta4GalNAc-T3,is responsible for LacdiNAc expression on gastric mucosa.Glycobiology". See 2006 Sep;16(9):777-85.doi:10.1093 / glycob / cwl005. In humans, B4GALNT4 has been reported to have activity similar to B4GALNT3. Examples of human B4GALNT3 and B4GALNT4 and their mouse homologous genes include human B4GALNT3 (GenBank Accession No. AB089940, UniProt ID: Q6L9W6; SEQ ID NO: 919); mouse b4galnt3 (GenBank Accession No. AB114826; UniProt ID: Q6L8S8); human B4GALNT4 (GenBank Accession No. AB089939.1; UniProt ID: Q76KP1.1); and mouse b4galnt4 (GenBank Accession No. AB114827; UniProt ID: Q766D5.1).

[0066] Fucosyltransferases (FUTs) are glycosyltransferases involved in the synthesis of cell surface antigens by catalyzing the transfer of fucose from GDP-fucose to acceptor sugars on biomolecules. The FUT family includes enzymes that catalyze α1,2-, α1,3 / 4-, α1,6-, and protein O-FUT conjugation. The α1,3 / 4-FUT group includes at least eight members: FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11. FUT4 is known to catalyze the α(1->3) conjugation of β-L-fucose to the GlcNAc of type 2 lactosmaine Gal-β(1->4)GlcNAc. See Figure 16 for the structure of fucosylated LacdiNAc. See Lowe JB et al. “Molecular cloning of a human fucosyltransferase gene that determines expression of the Lewis x and VIM-2 epitopes but not ELAM-1-dependent cell adhesion”. J Biol Chem. 1991 Sep 15;266(26):17467-77.Examples of human FUTs include FUT3 (GenBank Accession No. NM_000149, UniProt ID: P21217); FUT4 (SEQ ID NO: 920) (GenBank Accession No. NM_002033; UniProt ID: P22083); FUT5 (GenBank Accession No. NM_002034.2; UniProt ID: Q11128); FUT6 (GenBank Accession No. NM_000150.2; NM_001040701.1; UniProt ID: P51993.1); FUT7 (GenBank Accession No. NM_004479; UniProt ID: Q11130); FUT9 (GenBank Accession No. NM_006581; UniProt ID: Q9Y231); FUT10 (GenBank Accession No. AJ582015; UniProt ID: ... ID:Q6P4F1); and FUT11 (GenBank Accession No. BC036037 UniProt ID:Q495W5). Examples of mouse FUTs include FUT4 (GenBank Accession No. NM_010242; UniProt ID:B2RPT3); FUT7 (GenBank Accession No. NM_013524; UniProt ID:Q11131); FUT9 (GenBank Accession No. NM_010243; UniProt ID:O88819); FUT10 (GenBank Accession No. AJ880009; UniProt ID:Q5F2L2); and FUT11 (GenBank Accession No. NM_028428.2; UniProt ID:Q8BHC9).

[0067] Glycan-binding agents AB-006410 is an example of a glycan binder. AB-006410 was discovered in an antibody repertoire generated by Immune Repertoire Capture® (IRC®) technology from plasmablast B cells isolated from a melanoma patient treated with pembrolizumab. The patient showed a vigorous antitumor immune response as evidenced by tumor-selective antibodies derived from plasmablast B cells. IRC® technology and its use in antibody discovery are well known and are disclosed, for example, in International Publication No. WO2012148497A2, the entire contents of which are incorporated herein by reference.

[0068] Glycan-binding agent AB-006410 and other glycan-binding agents provided herein bind to tumors, and the binding is dependent on the expression of one or more specific glycosyltransferases in the tumor. That is, if one or more glycosyltransferases are not expressed, the glycan-binding agent will not exhibit detectable binding to the tumor. In one embodiment, one of the one or more glycosyltransferases has N-acetyl-galactosaminyltransferase activity, such as the activity of B4GALNT3 or B4GALNT4. In one embodiment, one of the one or more glycosyltransferases has fucosyltransferase activity, such as the activity of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11. In one embodiment, one of the one or more glycosyltransferases has N-acetyl-galactosaminyltransferase activity, such as the activity of B4GALNT3, or fucosyltransferase activity, such as the activity of FUT4. In one embodiment, one of the one or more glycosyltransferases has N-acetyl-galactosaminyltransferase activity, such as the activity of B4GALNT3, and one of the one or more glycosyltransferases has fucosyltransferase activity, such as the activity of FUT4.

[0069] In one embodiment, binding of the glycan-binding agent to the tumor is dependent on the expression of one or more specific glycosyltransferases in the tumor, i.e., in the absence of expression of one or more glycosyltransferases, the glycan-binding agent does not exhibit detectable binding to the tumor.

[0070] In one embodiment, each of the one or more glycosyltransferases is selected from the group consisting of B4GALNT3, B4GALNT4, FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11. In one embodiment, the binding is dependent on the expression of glycosyltransferase B4GALNT3 or glycosyltransferase FUT4. In one embodiment, the binding is dependent on the expression of B4GALNT3 and FUT4. In one embodiment, the glycan binding agent binds to tumor cells expressing glycans comprising GalNAcbeta1,4GlcNAc (LacdiNAc). In one embodiment, the glycan binding agent binds to tumor cells expressing GalNAcbeta1,4GlcNAc (LacdiNAc). In one embodiment, the LacdiNAc is fucosylated.

[0071] In some embodiments, the glycan-binding agent disclosed herein binds to extracellular tumor-associated glycans. The presence of glycans (or the presentation of glycans on the surface of tumor cells) depends on the expression of one or more specific glycosyltransferases in the tumor. That is, if one or more glycosyltransferases are not expressed, glycans will not be generated within tumor cells or presented on the surface of tumor cells. In one embodiment, each of the one or more glycosyltransferases is selected from the group consisting of B4GALNT3, B4GALNT4, FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11. In one embodiment, the glycan depends on the expression of glycosyltransferase B4GALNT3 or glycosyltransferase FUT4. In one embodiment, the glycan depends on the expression of B4GALNT3 and FUT4. In one embodiment, the glycan-binding agent binds to glycans containing GalNAcbeta1,4GlcNAc (LacdiNAc). In one embodiment, the glycan binder binds to GalNAcbeta1,4GlcNAc (LacdiNAc). In one embodiment, the glycan binder binds to tumor cells expressing glycans comprising GalNAcbeta1,4GlcNAc (LacdiNAc). In one embodiment, the glycan binder binds to tumor cells expressing GalNAcbeta1,4GlcNAc (LacdiNAc). In one embodiment, the LacdiNAc is fucosylated.

[0072] Glycan-binding agent structures In some embodiments, the glycan binding agent comprises an HCDR1 of any one of SEQ ID NOs: 1-14 and 113-212, or a variant HCDR1 with 1, 2, 3, 4, or 5 amino acid substitutions relative to the sequence, an HCDR2 of any one of SEQ ID NOs: 15-28 and 213-312, or a variant HCDR2 with 1, 2, 3, 4, or 5 amino acid substitutions relative to the sequence, and an HCDR3 of any one of SEQ ID NOs: 29-42 and 313-412, or a variant HCDR3 with 1, 2, 3, 4, or 5 amino acid substitutions relative to the sequence. In some embodiments, the glycan binding agent comprises a light chain variable region comprising an LCDR1 of any one of SEQ ID NOs: 43-56 and 413-512, or a variant LCDR1 with 1, 2, 3, 4, or 5 amino acid substitutions relative to the sequence, an LCDR2 of any one of SEQ ID NOs: 57-70 and 513-612, or a variant LCDR2 with 1, 2, or 3 amino acid substitutions relative to the sequence, and an LCDR3 of any one of SEQ ID NOs: 71-84 and 613-712, or a variant LCDR3 with 1, 2, 3, 4, or 5 amino acid substitutions relative to the sequence.

[0073] In some embodiments, the glycan binding agent comprises a heavy chain variable region comprising an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 85-98 and 713-812. In some embodiments, the glycan binding agent comprises a light chain variable region comprising an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of SEQ ID NOs: 99-112 and 813-912.

[0074] In some embodiments, the glycan binding agent is a heavy chain variable (V H ) region and the light chain variable (V L ) area. V HThe region has an amino acid sequence at least 70% identical to SEQ ID NO:85 and includes CDR1 of SEQ ID NO:1, or CDR1 of SEQ ID NO:1 with 1, 2, 3, 4, or 5 amino acid substitutions, CDR2 of SEQ ID NO:15, or CDR2 of SEQ ID NO:15 with 1, 2, 3, 4, or 5 amino acid substitutions, CDR3 of SEQ ID NO:29, or CDR3 of SEQ ID NO:29 with 1, 2, 3, 4, or 5 substitutions. L The region has an amino acid sequence at least 70% identical to SEQ ID NO:99 and includes CDR1 of SEQ ID NO:43, or the CDR1 of SEQ ID NO:43 with 1, 2, 3, 4 or 5 amino acid substitutions, CDR2 of SEQ ID NO:57, or the CDR2 of SEQ ID NO:57 with 1, 2, 3, 4 or 5 amino acid substitutions, CDR3 of SEQ ID NO:71, or the CDR3 of SEQ ID NO:71 with 1, 2, 3, 4 or 5 substitutions.

[0075] In some embodiments, the glycan-binding agent comprises the amino acid sequence SEQ ID NO:85. H V containing the region and amino acid sequence SEQ ID NO:99 L Includes the area.

[0076] In some embodiments, the glycan binding agent of the present invention has one, two, or three CDRs (LCDRs) of the VL sequence of Table 2. In some embodiments, the glycan binding agent has at least one mutation in the VL amino acid sequence and has no more than 10, 20, 30, 40, or 50 mutations compared to the VL sequence listed in Table 3. In some embodiments, the VL amino acid sequence can include an insertion or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids compared to the VL sequence listed in Table 3. In some embodiments, the VL amino acid sequence can include a deletion or insertion, such as a deletion or insertion of 1, 2, 3, 4, 5, 6, or 7 amino acids, relative to the CDR sequence shown in Table 2. In some embodiments, the VL region includes a CDR1 with one or two substitutions relative to the CDR1 sequence shown in Table 2. In some embodiments, the CDR1 has three, four, or five substitutions relative to the CDR1 sequence shown in Table 2. In some embodiments, the VL region comprises a CDR2 having one or two, or one, two, or three substitutions relative to the CDR2 sequence shown in Table 2. In some embodiments, the VL region comprises a CDR3 having one, two, or three, or one, two, three, or four substitutions relative to the CDR3 sequence shown in Table 2. In some embodiments, the glycan binding agent of the present disclosure comprises a CDR1, CDR2, and CDR3 having at least 70% identity with CDR1, CDR2, and CDR3, respectively, as shown in Table 2. In some embodiments, the glycan binding agent of the present disclosure comprises a CDR1, CDR2, and CDR3 having at least 80% identity with LCDR1, LCDR2, and LCDR3, respectively, as shown in Table 2. In some embodiments, the glycan binding agent of the present disclosure comprises an LCDR1, an LCDR2, and an LCDR3, respectively, as shown in Table 2. In some embodiments, the glycan binding agents of the invention are selected from the group consisting of AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-011376, AB-011622, AB-011623,CDR1, CDR2 of the antibody designated as AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-011855, AB-011856, AB-011857, AB-011858, AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, or AB-011873and CDR3.

[0077] In some embodiments, the glycan binding agent of the present invention has one, two, or three CDRs (HCDRs) of the VH sequence of Table 1. In some embodiments, the glycan binding agent has at least one mutation in the VH amino acid sequence and has no more than 10, 20, 30, 40, or 50 mutations compared to the VH sequence listed in Table 3. In some embodiments, the VH amino acid sequence can include an insertion or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids compared to the VH sequence listed in Table 3. In some embodiments, the VH amino acid sequence can include a deletion or insertion, such as a deletion or insertion of 1, 2, 3, 4, 5, 6, or 7 amino acids, relative to the CDR sequence shown in Table 1. In some embodiments, the VH region includes an HCDR1 with one or two substitutions relative to the HCDR1 sequence shown in Table 1. In some embodiments, the HCDR1 has three, four, or five substitutions relative to the CDR1 sequence shown in Table 1. In some embodiments, the VH region comprises an HCDR2 having one or two, or one, two, or three substitutions with respect to the HCDR2 sequence shown in Table 1. In some embodiments, the VH region comprises an HCDR3 having one, two, or three, or one, two, three, or four substitutions with respect to the CDR3 sequence shown in Table 1. In some embodiments, the glycan binding agent of the present disclosure comprises HCDR1, HCDR2, and HCDR3, each having at least 70% identity with HCDR1, HCDR2, and HCDR3, respectively, as shown in Table 1. In some embodiments, the glycan binding agent of the present disclosure comprises CDR1, CDR2, and CDR3, each having at least 80% identity with HCDR1, HCDR2, and HCDR3, respectively, as shown in Table 1. In some embodiments, the glycan binding agent of the present disclosure comprises HCDR1, HCDR2, and HCDR3, each having at least 80% identity with HCDR1, HCDR2, and HCDR3, respectively, as shown in Table 1. In some embodiments, the glycan binding agents of the invention are selected from the group consisting of AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-011376,AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB- 011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-0117 98, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, A B-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-01 1823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-01183 5, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB -011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-011855, AB-011856, AB-011857, AB-011858, AB-011859, AB-011 860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872or HCDR1, HCDR2, and HCDR3 of the antibody designated AB-011873.

[0078] In some embodiments, the glycan-binding agents disclosed herein are selected from the group consisting of V H Region array and V LIn some embodiments, the glycan binding agent disclosed herein comprises a heavy chain variable region and a light chain variable region of an antibody designated as AB-006410 or other glycan binding agent disclosed in Table 3. The variant comprises a heavy chain variable region having a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% identical to the sequence of the corresponding heavy chain variable region, and a light chain variable region having a sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% identical to the sequence of the corresponding light chain variable region. For example, variants include AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-011376, AB-011622, AB-011623, AB-011624, AB- 011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-0 11786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-01 1795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011 804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-0118 13, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-01182 2, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831,AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-011 842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB -011853, AB-011854, AB-011855, AB-011856, AB-011857, AB-011858, AB-011859, AB-011860, AB-011861, AB-011862, AB-01186 3, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, or AB-011873 V, H V that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to H、ならびに / あるいはAB-006410、AB-011110、AB-011111、AB-011366、AB-011367、AB -011368、AB-011369、AB-011370、AB-011371、AB-011372、AB-011373、AB-01 1374、AB-011375、AB-011376、AB-011622、AB-011623、AB-011624、AB-0116 25、AB-011626、AB-011627、AB-011628、AB-011781、AB-011782、AB-011783、 AB-011784、AB-011785、AB-011786、AB-011787、AB-011788、AB-011789、AB -011790、AB-011791、AB-011792、AB-011793、AB-011794、AB-011795、AB-01 1796、AB-011797、AB-011798、AB-011799、AB-011800、AB-011801、AB-0118 02、AB-011803、AB-011804、AB-011805、AB-011806、AB-011807、AB-011808、 AB-011809、AB-011810、AB-011811、AB-011812、AB-011813、AB-011814、AB -011815、AB-011816、AB-011817、AB-011818、AB-011819、AB-011820、AB-01 1821、AB-011822、AB-011823、AB-011824、AB-011825、AB-011826、AB-0118 27、AB-011828、AB-011829、AB-011830、AB-011831、AB-011832、AB-011833、 AB-011834、AB-011835、AB-011836、AB-011837、AB-011838、AB-011839、AB -011840、AB-011841、AB-011842、AB-011843、AB-011844、AB-011845、AB-01 1846、AB-011847、AB-011848、AB-011849、AB-011850、AB-011851、AB-0118 52、AB-011853、AB-011854、AB-011855、AB-011856、AB-011857、AB-011858、V that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, or AB-011873, L may include.

[0079] In some embodiments, the glycan binding agents disclosed herein include HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 of AB-006410. Exemplary glycan binding agents include AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-011376, AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB- 011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-0117 92, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB -011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011 815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, A B-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-01 1838, AB-011839, AB-011840, AB-011841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849,AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-011855, AB-011856, AB-011857, AB-011858, AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, or AB-011873. The structural information of these glycan binders is shown in Tables 1 to 3.

[0080] [Table 1-1]

[0081] [Table 1-2]

[0082] [Table 1-3]

[0083] [Table 1-4]

[0084] [Table 1-5]

[0085] [Table 1-6]

[0086] [Table 1-7]

[0087]

Table 1-8

[0088]

Table 2-1

[0089]

Table 2-2

[0090]

Table 2-3

[0091]

Table 2-4

[0092]

Table 2-5

[0093]

Table 2-6

[0094]

Table 2-7

[0095]

Table 2-8

[0096]

Table 3-1

[0097]

Table 3-2

[0098]

Table 3-3

[0099]

Table 3-4

[0100]

Table 3-5

[0101]

Table 3-6

[0102]

Table 3-7

[0103]

Table 3-8

[0104]

Table 3-9

[0105]

Table 3-10

[0106]

Table 3-11

[0107]

Table 3-12

[0108]

Table 3-13

[0109]

Table 3-14

[0110]

Table 3-15

[0111]

Table 3-16

[0112]

Table 3-17

[0113]

Table 3-18

[0114]

Table 3-19

[0115]

Table 3-20

[0116]

Table 3-21

[0117]

Table 3-22

[0118] Variables In some embodiments, variants of any of the glycan binders disclosed herein can be generated by introducing mutations into the heavy and / or light chain sequences. In some embodiments, the mutation(s) are introduced into one or more of the CDRs of the glycan binders disclosed herein, such as AB-006410 or other glycan binders disclosed in Table 1 or Table 2. In some embodiments, the mutation(s) are introduced in the framework regions. In some embodiments, the variants are engineered to be as similar to themselves as possible to minimize immunogenicity. One approach to this is to identify a close germline sequence and mutate one of the glycan binders to the germline residue type at as many mismatch positions as possible (also called "germline deviations").

[0119] For any of the mutations disclosed in this application, the name indicates whether the mutation is heavy or light chain, the position of the mutation in the heavy or light chain (numbering is based on the sequences provided in Table 3 and not on Kabat or other amino acid sequence numbering conventions), the amino acid residue at the position before the mutation, and the amino acid at the position after the mutation. For example, L26NS refers to an asparagine (N) at position 26 of the light chain being mutated to a serine (S). In some embodiments, one or more of the CDRs of AB-006410 or other glycan binders disclosed in Table 1 or Table 2 are mutated to generate variants with improved properties. In some embodiments, LCDR1 of AB-006410 is mutated to remove an N-linked glycosylation site. In some embodiments, LCDR1 comprises the mutation L26NS. Exemplary variants of AB-006410 include AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-011376, A B-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-0117 81, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-0 11789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-0118 04, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB- 011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819,AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, A B-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB- 011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-0 11841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011 848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-0118 55, AB-011856, AB-011857, AB-011858, AB-011859, AB-011860, AB-011861, AB-011862 , AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, or AB-011873, and various sequences of the antibodies are shown in Tables 1 to 3.

[0120] Methods for generating variants are described in further detail in the section "Manipulation of Variants" and in Example 2 below.

[0121] Additional Fc variants In addition to the variants described above, there are several useful Fc amino acid modifications that can be made for a variety of reasons, including but not limited to altering binding to one or more FcγR receptors, altering binding to the FcRn receptor, etc., as described below. Thus, the antibodies (heterodimers as well as homodimers) provided herein can include such amino acid modifications with or without the heterodimerization variants (e.g., pI variants and conformational variants) outlined herein. Each set of variants can be independently optionally included or excluded in any heterodimeric protein.

[0122] FcγR variants Thus, there are several useful Fc substitutions that can be made to alter binding to one or more FcγR receptors. In certain embodiments, the antibodies of the present invention include modifications that alter binding to one or more FcγR receptors (i.e., "FcγR variants"). Substitutions that result in increased binding as well as decreased binding can be useful. For example, it is known that increased binding to FcγRIIIa generally increases ADCC (antibody dependent cell-mediated cytotoxicity, a cell-mediated reaction in which non-specific cytotoxic cells expressing FcγR recognize bound antibodies on target cells and subsequently cause lysis of the target cells). Similarly, decreased binding to FcγRIIb (an inhibitory receptor) can also be beneficial in some circumstances. Amino acid substitutions that find use in the antibodies described herein include those described in U.S. Patent Nos. 8,188,321 (particularly FIG. 41) and 8,084,582, and U.S. Patent Application Publication Nos. 20060235208 and 20070148170, all of which are expressly incorporated by reference in their entireties, particularly for the variants disclosed herein. Particular variants that find use include, but are not limited to, 236A, 239D, 239E, 332E, 332D, 239D / 332E, 267D, 267E, 328F, 267E / 328F, 236A / 332E, 239D / 332E / 330Y, 239D / 332E / 330L, 243A, 243L, 264A, 264V, and 299T.

[0123] Furthermore, there are additional Fc substitutions that find use in increasing binding to the FcRn receptor and extending serum half-life, which are specifically disclosed in U.S. Patent Application Serial No. 12 / 341,769, including, but not limited to, 434S, 434 A, 428L, 308F, 2591, 428L / 434S, 259I / 308F, 436I / 428L, 4361 or V / 434S, 436V / 428L, and 259I / 308F / 428L. Such modifications may be included in one or both Fc domains of the subject antibody.

[0124] In some embodiments, the glycan-binding agents (including antibody fragments) disclosed herein comprise an Fc region that has an effector function, e.g., antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), and / or complement-dependent cytotoxicity (CDC). In some embodiments, the Fc region can be an engineered Fc region to alter one or more functional properties of an antibody, such as serum half-life, complement fixation, Fc receptor binding, and / or ADCC. Thus, the Fc region can include additional mutations to increase or decrease effector function, i.e., the ability to induce a particular biological function upon binding to an Fc receptor expressed on an immune cell. Immune cells include, but are not limited to, monocytes, macrophages, neutrophils, dendritic cells, eosinophils, mast cells, platelets, B cells, large granular lymphocytes, Langerhans cells, natural killer (NK) cells, and cytotoxic T cells.

[0125] In some embodiments, the Fc region described herein may include additional modifications that modulate effector function. Examples of amino acid mutations in the Fc region that modulate effector function include, but are not limited to, one or more substitutions at positions 228, 233, 234, 235, 236, 237, 238, 239, 243, 265, 269, 270, 297, 298, 318, 326, 327, 329, 330, 331, 332, 333, and 334 (EU numbering scheme) in the Fc region.

[0126] Exemplary substitutions that reduce effector function include a mutation in which the proline at position 329 is replaced with glycine or arginine, or with an amino acid residue large enough to disrupt the Fc / Fcγ receptor interface formed between proline 329 of Fc and tryptophan residues Trp87 and Trp110 of FcγRIII. Additional exemplary substitutions that reduce effector function include S228P, E233P, L235E, N297A, N297D, and P331S. To reduce effector functions, multiple substitutions may be present, such as, for example, L234A and L235A in the human IgG1 Fc region, L234A, L235A, and P329G in the human IgG1 Fc region, S228P and L235E in the human IgG4 Fc region, L234A and G237A in the human IgG1 Fc region, L234A, L235A, and G237A in the human IgG1 Fc region, V234A and G237A in the human IgG2 Fc region, L235A, G237A, and E318A in the human IgG4 Fc region, and S228P and L236E in the human IgG4 Fc region. Examples of substitutions that enhance effector function include, for example, E333A, K326W / E333S, S239D / I332E / G236A, S239D / A330L / I332E, G236A / S239D / A330L / I332E, F243L, G236A, and S298A / E333A / K334A, etc. In some embodiments, the Fc variant comprises P329G, L234A, L235A, or a combination thereof. Descriptions of amino acid mutations in the Fc region that can increase or decrease effector function can be found, for example, in Wang et al., Protein Cell. 9(1):63-73, 2018; Saunders, Front Immunol. Jun 7, eCollection, 2019; Kellner et al., Transfus Med Hemother. 44(5):327-336, 2017; and Lo et al., J Biol Chem. 292(9):3900-3908, 2017.

[0127] In some embodiments, the Fc region may have one or more amino acid substitutions that modulate ADCC, e.g., substitutions at positions 298, 333, and / or 334 of the Fc region according to the EU numbering scheme. Specifically, introduction of S298A, E333A, and K334A into the Fc region can increase the affinity of the Fc region for FcγRIIIa and decrease the affinity of the Fc region for FcγRIIa and FcγRIIb.

[0128] The Fc region may also include additional mutations to extend serum half-life. Such mutations in the Fc region may improve the pharmacokinetics of the antibody by enhancing binding to the neonatal Fc receptor (FcRn). Examples of substitutions in the Fc region that extend the serum half-life of the antibody include, for example, M252Y / S254T / T256E, T250Q / M428L, N434A, N434H, T307A / E380A / N434A, M428L / N434S, M252Y / M428L, D259I / V308F, N434S, V308W, V308Y, V308F, etc. Amino acid mutations in the Fc region that can extend the serum half-life of antibodies are described, for example, in Dumet et al., MAbs. 26:1-10, 2019; Booth et al., MAbs. 10(7):1098-1110, 2018; and Dall'Acqua et al., J Biol Chem. 281(33):23514-24, 2006.

[0129] In some embodiments, the glycan-binding agents described herein comprise an Fc region with modified glycosylation that enhances the ability of the antibody to recruit NK cells and / or increase ADCC. In some embodiments, the Fc region comprises glycans that do not contain fucose (i.e., the Fc region is defucosylated). Defucosylated antibodies can be produced using cell lines expressing heterologous enzymes that deplete intracellular fucose pools (e.g., GlymaxX® from ProBioGen AG, Berlin, Germany). Nonfucosylated antibodies can also be produced using host cell lines in which the endogenous α-1,6-fucosyltransferase (FUT8) gene has been deleted. See Satoh, M. et al., "Non-fucosylated therapeutic antibodies as next-generation therapeutic antibodies," Expert Opinion on Biological Therapy, 6:11, 1161-1173, DOI:10.1517 / 14712598.6.11.1161.

[0130] Additionally, in some embodiments, an antibody of the disclosure may be chemically modified (e.g., one or more chemical moieties may be attached to the antibody) or may be modified (e.g., produced in a cell line and / or cell culture conditions to alter its glycosylation (e.g., hypofucosylation, defucosylation, or increased sialylation) to alter one or more functional properties of the antibody. For example, an antibody may be conjugated to one of a variety of polymers, such as, for example, polyethylene glycol. In some embodiments, an antibody may include mutations to facilitate conjugation to chemical moieties and / or to alter residues that are subject to post-translational modifications, e.g., glycosylation.

[0131] Activity Tumor binding activity The activity of the glycan binder as described herein can be evaluated for binding in a binding assay.Non-limiting examples of suitable assays include surface plasmon resonance analysis or flow cytometry assays using biosensor systems such as the Biacore® system, which are described in more detail in the Examples section.

[0132] In some embodiments, binding to glycan proteins is assessed in a competitive assay format using reference antibody AB-006410 or a reference antibody having the variable region of AB-006410. In some embodiments, a variant glycan binding agent according to the present disclosure can block binding of the reference antibody by about 50% or more in a competitive assay.

[0133] In some embodiments, binding assays to assess activity of variants are performed on ex vivo tumor tissue or tumor cells, e.g., on tumor cells grown in vivo as tumor explants in syngeneic (immunocompatible) mice and then harvested and processed within 24-48 hours. Binding can be assessed by any number of means, including flow cytometry, immunohistochemistry, or immunofluorescence-based assays.

[0134] In some embodiments, the antibody is added to a cancer cell line and the binding is analyzed by flow cytometry. In one example, AB-006410 was shown to bind to A549 cells, and the binding of AB-006410 was reduced in A549 cells in which one or more selected glycosyltransferases were knocked out. In one embodiment, the glycosyltransferase is B4GALNT3 or FUT4. In one embodiment, the glycosyltransferase is B4GALNT3 and FUT4. Figure 2.

[0135] In some embodiments, the binding of the antibody to bind to tumor cells is evaluated by immunofluorescence, as described in the Examples. Glycan-binding agents preferentially bind to various tumors, but not to normal human tissues (Figure 6A). In one example, AB-006410 showed preferential binding to ovarian, lung, pancreatic, and esophageal cancer tissues compared to their respective tumor adjacent tissues (TAT).

[0136] In some embodiments, the binding activity of the antibody is determined by EC 50 In some embodiments, the activity is assessed by determining the EC value, and in some embodiments, further determining the delta activity, i.e., the difference in specific activity between the lower and upper plateaus of the activation curve, expressed as a percentage of the activity of a selected antibody with known in vitro activity. In typical embodiments, the EC 50 The values ​​are compared to a reference antibody. For the purposes of this disclosure, an antibody comprising the VH and VL regions of the glycan-binding agents disclosed herein and the mouse IgG2a Fc region when testing ex vivo binding using a mouse tumor model is used as the reference antibody and included in the assay to evaluate the activity of the variants relative to the reference antibody. EC 50 is the EC of the reference antibody 50 EC of the test antibody 50 Based on the values ​​obtained, antibodies were assigned to groups and ranked from 0 to 4 as follows: 0=(>500nM); 1=<0.5; 2=0.5-2; 3=2-4; 4=>4.

[0137] Fc effector function In some embodiments, the glycan-binding agent of the present disclosure comprises an Fc region with effector functions. Examples of effector functions include, but are not limited to, C1q binding and complement-dependent cytotoxicity (CDC), Fc receptor binding (e.g., FcγR binding), ADCC, antibody-dependent cell-mediated phagocytosis (ADCP), downregulation of cell surface receptors (e.g., B cell receptors), and B cell activation. Effector functions may vary depending on the class of antibody. For example, natural human IgG1 and IgG3 antibodies can induce ADCC and CDC activity when bound to the appropriate Fc receptor present on immune system cells, and natural human IgG1, IgG2, IgG3, and IgG4 can induce ADCP function when bound to the appropriate Fc receptor present on immune cells.

[0138] In some embodiments, the Fc region of the glycan-binding agent disclosed herein can be an engineered Fc region to alter one or more functional properties of the antibody, such as serum half-life, complement fixation, Fc receptor binding, and / or ADCC. Thus, the Fc region can include additional mutations to increase or decrease effector function, i.e., the ability to induce a specific biological function upon binding to an Fc receptor expressed on an immune cell. Immune cells include, but are not limited to, monocytes, macrophages, neutrophils, dendritic cells, eosinophils, mast cells, platelets, B cells, large granular lymphocytes, Langerhans cells, natural killer (NK) cells, and cytotoxic T cells. In some embodiments, the antibodies of the present disclosure have improved ADCC and / or serum stability compared to antibody AB-006410 when the antibodies are assayed in a human IgG1 isotype format.

[0139] The glycan binding agents of the present disclosure can be evaluated in various assays for their ability to mediate FcR-dependent activity. In one assay, the binding activity of the glycan binding agent is evaluated in an Fc receptor ligation assay. For the purposes of testing variants, Fc receptor "ligation" occurs when a variant antibody binds and signals both to a target tumor cell via its Fv region and to FcγR present on an immune cell via the antibody's Fc region. If the Fc region is kept constant between variants with different Fv regions, this assay can evaluate the tumor binding activity between such variants in terms of potential signaling through a particular Fc region that binds to a particular Fc receptor. In some embodiments, the binding of the antibody's Fc region can result in clustering and / or internalization of the FcR, which can generate a luminescent signal in cells carrying the NFAT-RE-luciferase reporter construct.

[0140] ADCC activity In some embodiments, the glycan-binding agents of the present disclosure have ADCC when the antibody is assayed in a mouse IgG2a isotype format.

[0141] ADCP activity In some embodiments, the ADCP activity of glycan-binding agents is evaluated using fluorescently labeled in vitro cultured tumor cells and Raw264.7 mouse macrophages. In certain embodiments, opsonization of tumor cells with antibodies results in phagocytosis detected by flow cytometry. Variations of this assay have been described, and may include co-labeling of tumor cells and effector cells, or evaluation of phagocytosis by involvement of FcyRIIa ligation (e.g., Promega's FcγRIIa-H ADCP reporter bioassay).

[0142] ADC activity A glycan-binding antibody is considered to have ADC activity if the antibody is conjugated with a drug molecule (toxin) to form an antibody drug conjugate (ADC), and the ADC is capable of killing a target cell. In some embodiments, the EC 50 is less than 1E-08, the antibody is considered to have ADC activity. In one exemplary assay, the ADC activity of the glycan binder is assessed using a drug-conjugated secondary antibody. The antibody-drug conjugate assay involves tumor target cells, a primary antibody of interest (the glycan binder being tested), and a secondary antibody conjugated to a drug molecule, where the secondary antibody recognizes the primary antibody. Briefly, a primary antibody dilution is incubated with the target cells at room temperature for a first period of time (e.g., 10-30 minutes). The drug-conjugated secondary antibody is then added to the incubation mixture containing the target cells and the primary antibody. The mixture is then incubated for a second period of time before measuring the extent of lysis of the target cells. In some embodiments, the assay generates a 100% cell lysis value by adding cell lysis buffer directly to target cell samples that have not been treated with the primary antibody or drug-conjugated secondary antibody, and cell killing data from samples treated with the antibody mixture as disclosed above can be normalized to the 100% cell lysis value. The results of this assay can be used to predict whether an ADC generated by conjugating a particular antibody with a drug molecule can kill target cells.

[0143] in vivo activity In some embodiments, the activity of the glycan-binding agent is evaluated in vivo in a suitable animal tumor model. The tumor burden of the subject treated with the test substance is reduced compared to the tumor burden of the subject treated with the control substance, reflecting the anti-tumor function of the antibody. The glycan-binding agent or glycan-antibody immunoconjugate disclosed herein can reduce the tumor burden of the subject by at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, or at least 60%, or 70%, or more, compared to the tumor burden of the control subject.

[0144] In some embodiments, variants of antibodies as described herein have an anti-tumor activity that is at least 20%, at least 30%, at least 40%, at least 50%, or at least 60%, or 70% or more of the anti-tumor activity of a reference antibody shown in Tables 1-3 when assessed under the same assay conditions for measuring anti-tumor activity in vivo. In some embodiments, the anti-tumor antibody exhibits improved activity, i.e., greater than 100% activity, compared to the reference antibody.

[0145] Antibody Format In some embodiments, the glycan-binding agent according to the present disclosure is in a monovalent format. In some embodiments, the tumor-targeting antibody is in a fragment format, e.g., Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In a further aspect of the present disclosure, the glycan-binding agent according to the present disclosure can be an antibody fragment, e.g., Fv, Fab, Fab', scFv, diabody, or F(ab')2 fragment. In another embodiment, the antibody is a substantially full-length antibody, e.g., an IgG antibody or other antibody class or isotype as defined herein. For a review of certain antibody fragments, see Hudson et al. Nat. Med. 9:129-134 (2003). Antibody fragments can be generated by a variety of techniques, including, but not limited to, proteolytic digestion of intact antibodies as well as production by recombinant host cells.

[0146] In some embodiments, the glycan-binding agent according to the present disclosure administered to the patient is an IgG1 subclass IgG. In some embodiments, such an antibody is an IgG2, IgG3, or IgG4 subclass IgG. In some embodiments, such an antibody is an IgM. In some embodiments, such an antibody has a lambda light chain constant region. In some embodiments, such an antibody has a kappa light chain constant region.

[0147] In some embodiments, the glycan binding agents of the present disclosure are used in a bispecific or multispecific format, for example, a trispecific format. For example, in some embodiments, antibodies can be incorporated into bispecific or multispecific antibodies that contain additional binding domains that bind to the same or different antigens.

[0148] The formats that can be used for bispecific or multispecific antibodies are diverse. The formats can vary in factors such as the number of binding arms, the format of each binding arm (e.g., Fab, scFv, scFab, or VH only), the number of antigen binding domains present in the binding arms, the mutual connectivity and shape of each arm, the presence or absence of Fc domain, Ig class (e.g., IgG or IgM), Fc subclass (e.g., hIgG1, hIgG2, or hIgG4), and any mutations of Fc (e.g., mutations for reduced or increased effector function or extended serum half-life). Also see Speiss, et al., Alternative Molecular Formats and Therapeutic Applications for Bispecific Antibodies, Mol Immunol, 67, 95-106 (2015), especially Figure 1 for examples of bispecific and multispecific formats.

[0149] In one embodiment of any of the above bispecific or multispecific antibody constructs, the tumor target binding domain comprises all six CDR (HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3) sequences from the individual antibodies disclosed in Tables 1 and 2.

[0150] In one embodiment of any of the above bispecific or multispecific antibody constructs, the tumor target binding domain comprises the VH and VL sequences of an individual antibody disclosed in Table 3.

[0151] In one embodiment of any of the above bispecific or multispecific antibody constructs, the tumor target binding domain is selected from the group consisting of antibodies AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-011376, AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011 627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-0 11804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-01181 6, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB -011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011 841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853,Contains all six CDR (HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3) sequences from any one of AB-011854, AB-011855, AB-011856, AB-011857, AB-011858, AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, and AB-011873.

[0152] In one embodiment of any of the above bispecific or multispecific antibody constructs, the tumor targeting binding domain is selected from the group consisting of AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-011376, AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-01 1792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-01 1817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-01 1842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854,The VH and VL sequences of AB-011855, AB-011856, AB-011857, AB-011858, AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, and AB-011873 are included.

[0153] In some embodiments, the glycan binding agent disclosed herein is constructed as a multivalent antibody.In some embodiments, the glycan binding agent is constructed as a tetravalent molecule that comprises four glycan binding arms per molecule.Such constructs show increased ADCC activity as well as increased binding to tumor cells as measured by flow cytometry.

[0154] In some embodiments, the glycan binding agents of the present disclosure are used in a bispecific or multispecific format, for example, a trispecific format. For example, in some embodiments, antibodies can be incorporated into bispecific or multispecific antibodies that contain additional binding domains that bind to the same or different antigens.

[0155] There are many different formats that can be used for bispecific or multispecific antibodies. The formats can vary in factors such as the number of binding arms, the format of each binding arm (e.g., Fab, scFv, scFab, or VH only), the number of antigen binding domains present in the binding arms, the mutual connectivity and shape of each arm, the presence or absence of Fc domain, Ig class (e.g., IgG or IgM), Fc subclass (e.g., hIgG1, hIgG2, or hIgG4), and any mutations of Fc (e.g., mutations for reduced or increased effector function or extended serum half-life). Also see Speiss, et al., Alternative Molecular Formats and Therapeutic Applications for Bispecific Antibodies, Mol Immunol, 67, 95-106 (2015), Figure 1 for examples of bispecific and multispecific formats.

[0156] Exemplary antigens that can be targeted by additional binding domains in bispecific or multispecific antibodies comprising the antigen-binding domains of the glycan-binding agents described herein include, but are not limited to, antigens on T cells to enhance T cell ligation and / or activate T cells. Illustrative examples of such antigens include, but are not limited to, CD3, CD2, CD4, CD5, CD6, CD8, CD28, CD40L, CD44, IL-15Rα, CD122, CD132, or CD25. In some embodiments, the antigen is CD3. In some embodiments, the antigen is in a T cell activation pathway, such as 4-1BB / CD137, 4-1BBL / CD137L, OX40, OX40L, GITRL, GITR, CD27, CD70, CD28, ICOS, HVEM, or LIGHT antigens.

[0157] Multispecific format that binds to CD3 In some embodiments, the glycan-binding agent is incorporated into a bispecific or multispecific antibody that contains a binding domain that binds to a T cell antigen. These bispecific or multispecific antibodies can induce T cells to attach to and lyse target tumor cells, i.e., tumor cells that express glycans. In some embodiments, the bispecific or multispecific antibody contains a binding domain that binds to CD3. In some embodiments, the bispecific or multispecific antibody contains a binding domain that binds to human CD3, including the anti-tumor antibodies described herein.

[0158] As will be appreciated by those skilled in the art, any collection of anti-CD3 CDRs, anti-CD3 variable light and heavy domains, Fabs and scFvs shown in any of the figures can be used. Similarly, any of the anti-glycan antigen binding domains can be used, i.e., any of the CDRs, variable light and heavy domains, Fabs and scFvs can be used, optionally independently combined in any combination.

[0159] Multispecific format that binds 4-1BB In some embodiments, the glycan-binding agent is incorporated into a multispecific antibody that includes a binding domain derived from an agonist antibody that binds 4-1BB. In one embodiment, the 4-1BB agonist antibody is a bispecific antibody that can bind both glycans and 4-1BB. For purposes of this application, the term "4-1BB engager" refers to a portion of a molecule that binds 4-1BB (e.g., a bispecific antibody that can bind both 4-1BB and glycans). In some embodiments, the 4-1BB engager is an antibody or antibody fragment (e.g., scFv) that binds 4-1BB. In some embodiments, the 4-1BB engager is a multimeric 4-1BB ligand ("4-1BBL"), e.g., a 4-1BBL trimer. In some embodiments, as further described below, the bispecific antibody includes one or more scFv fragments of an anti-4-1BB antibody and a glycan-binding agent disclosed herein. In one embodiment, the 4-1BB agonist antibody is a trispecific antibody. Examples of bispecific and trispecific antibody constructs are shown in Figure 1 of US Patent Publication No. 20190010248, Figure 1 of WO 2020025659, and in Berezhnoy A et al. Converting PD-L1-induced T-lymphocyte Inhibition into CD137-mediated Costimulation via PD-L1 x CD137 Bispecific DART® Molecules. Poster presented at 30 th EORTC / AACR / NCI Symposium, November 13-16, 2018, Dublin, Ireland, Compte, M. et al. Tumor-targeted trimeric 4-1BB-agonist antibodies induce potent tumor-targeted immunity without systemic toxicity. Nat Com 9, 4809 (2018), Figure 1; U.S. Pat. No. 10,239,949, Figure 10; and WO 2019 / 092452, Example 2.

[0160] In one embodiment, the fusion molecule comprises a silencing human IgG1 with three human 4-1BB ligand extracellular domains linked via a flexible linker. See WO2019086499, Figures 1-3. Other 4-1BBL fusion molecules can also be utilized with the tumor-targeting antibodies described herein. See Zhang et al., Targeted and Untargeted CD137L Fusion Proteins for the Immunotherapy of Experimental Solid Tumors, Clin Cancer Res., 2758-2767 (2007), Figure 1; (See Kermer et al., Combining Antibody-Directed Presentation of IL-15 and 4-1BBL in a Trifunctional Fusion Protein for Cancer Immunotherapy, Mol Cancer Ther, 112-121 (2014), Figure 1.

[0161] In some embodiments, the glycan-binding agent is incorporated into a fusion molecule that includes one or more 4-1BB ligands (4-1BBL). In one embodiment, a trimer of 4-1BBL is fused to the C-terminus of either the light or heavy chain of the glycan-binding agent. In one embodiment, one or more individual 4-1BBL domains are connected via a linker, and one of the domains is further fused to the glycan-binding agent via a linker. The 4-1BBL domain includes the entire ECD portion of the molecule, or a truncated form that can bind and activate 4-1BB. See WO2019086499, Figures 1-3.

[0162] Generation of antibodies Glycan-binding agents can be produced using vectors and recombinant methods well known in the art (see, e.g., Sambrook & Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; Ausubel, Current Protocols in Molecular Biology). Reagents, cloning vectors, and kits for genetic manipulation are available from commercial vendors. Thus, in a further aspect of the present disclosure, the V of any of the tumor-targeting antibodies as described herein can be used. H Region and / or V L Provided herein are isolated nucleic acids encoding the V region, or fragments thereof, vectors containing such nucleic acids, and host cells into which nucleic acids have been introduced that are used to replicate the nucleic acid encoding the antibody and / or to express the antibody. Such nucleic acids include those encoding the V region of a tumor-targeting antibody. L and / or V H In some embodiments, the host cell may encode an amino acid sequence (e.g., an antibody light chain and / or a heavy chain) comprising: (1) V L Polynucleotides encoding amino acid sequences and V H (2) a vector comprising a polynucleotide encoding an amino acid sequence; or L A first vector comprising a polynucleotide encoding an amino acid sequence and a V H A second vector comprising a polynucleotide encoding the amino acid sequence.

[0163] In a further aspect, the present invention provides a method for producing a glycan-binding agent as described herein. In some embodiments, the method comprises culturing a host cell as described in the previous paragraph under conditions suitable for the expression of the antibody. In some embodiments, the antibody is then recovered from the host cell (or the host cell culture medium).

[0164] Suitable vectors containing a polynucleotide encoding an antibody of the present disclosure or a fragment thereof include cloning vectors and expression vectors. The cloning vector selected may vary depending on the host cell to be used, and useful cloning vectors are generally capable of self-replicating, have a single target for a specific restriction endonuclease, and / or may carry a marker gene that can be used in selecting clones containing the vector. Examples include plasmids and bacterial viruses, such as pUC18, pUC19, Bluescript (e.g., pBS SK+) and its derivatives, mpl8, mpl9, pBR322, pMB9, ColE1 plasmid, pCR1, RP4, phage DNA, and shuttle vectors. These cloning vectors and many other cloning vectors are available from commercial vendors.

[0165] Expression vector is generally a replicable polynucleotide construct that contains the nucleic acid of the present disclosure.Expression vector can replicate in host cell as episome or as integral part of chromosomal DNA.Suitable expression vector includes but is not limited to plasmid and virus vector (including adenovirus, adeno-associated virus, retrovirus and other vectors).

[0166] Suitable host cells for expressing the glycan binders as described herein include both prokaryotic and eukaryotic cells. For example, if glycosylation and Fc effector function are not required, the glycan binders may be produced in bacteria. After expression, the antibody may be isolated as a soluble fraction from the bacterial cell paste and further purified. Alternatively, the host cell may be a eukaryotic host cell, including eukaryotic microorganisms such as filamentous fungi or yeast, including fungal and yeast strains in which the glycosylation pathway has been "humanized" to produce antibodies with partially or fully human glycosylation patterns, vertebrate, invertebrate, and plant cells. Examples of invertebrate cells include insect cells. A number of baculovirus strains have been identified that may be used in combination with insect cells. Plant cell cultures may also be utilized as host cells.

[0167] In some embodiments, vertebrate host cells are used to produce the glycan-binding agents of the present disclosure. For example, monkey kidney CV1 line transformed by SV40 (COS-7), human embryonic kidney line (e.g., 293 or 293 cells as described in Graham et al., J. Gen Virol. 36:59, 1977, baby hamster kidney cells (BHK), mouse Sertoli cells (e.g., TM4 cells as described in Mather, Biol. Reprod. 23:243-251, 1980), monkey kidney cells (CV1), African green monkey kidney cells (VERO-76), human cervical carcinoma cells (HELA), canine kidney cells (MDCK; buffalo rat liver, BRL3A), human lung cells (W138), human hepatocytes (HepG2), mouse mammary tumor (MMT060562), Mather et al. Mammalian cell lines such as TRI cells, MRC5 cells, and FS4 cells as described in (Urlaub et al., Annals N.Y. Acad. Sci. 383:44-68, 1982) can be used to express tumor-targeting antibodies. Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, including DHFR-CHO (Chinese hamster ovary) cells (Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216, 1980), and myeloma cell lines such as Y0, NS0, and Sp2 / 0. Host cells of the present disclosure also include, but are not limited to, isolated cells, in vitro cultured cells, and ex vivo cultured cells. For a review of certain mammalian host cell lines suitable for antibody production, see, for example, Yazaki and Wu, Methods in Molecular Biology, Vol. 248 (BKC Lo, ed., Humana Press, Totowa, NJ), pp. 255-268, 2003.

[0168] In some embodiments, the glycan binders of the present invention are produced by a CHO cell line, for example, a CHO-K1 cell line. One or more expression plasmids encoding heavy and light chain sequences can be introduced. For example, in one embodiment, an expression plasmid encoding a heavy chain as disclosed herein and an expression plasmid encoding a light chain as disclosed herein are transfected into the host cell. The expression plasmids can be introduced as linearized plasmids in a 1:1 ratio into the CHO-K1 host cell line using a reagent such as Freestyle Max reagent. Fluorescence-activated cell sorting (FACS) combined with single cell imaging can be used as a cloning method to obtain a production cell line.

[0169] Host cells transfected with an expression vector encoding the glycan-binding agent or fragment thereof of the present disclosure can be cultured under appropriate conditions to allow expression of the polypeptide to occur. The polypeptide can be secreted and isolated from a mixture of cells and medium containing the polypeptide. Alternatively, the polypeptide can be retained in the cytoplasm or membrane fraction, the cells can be harvested, lysed, and the polypeptide can be isolated using a desired method.

[0170] In some embodiments, the glycan binding agents of the present disclosure can be produced by in vitro synthesis (see, for example, the Sutro Biopharma biochemical protein synthesis platform).

[0171] In some embodiments, methods are provided herein for producing variants of glycan-binding agents as disclosed herein. Thus, for example, the V H The constructs encoding the CDR3 variants can be modified, and the V encoded by the modified constructs can be H The region may be a V L A V domain or a V domain as described herein paired with a variant domain HIn the context of the region, binding activity to LoVo cells and / or in vivo tumor targeting activity can be tested. L The constructs encoding the CDR3 variants can be modified, and the V encoded by the modified constructs can be L The regions can be tested for efficacy in binding to CT26 cells or other tumor cells, and / or in vivo tumor targeting activity. Such analyses can also be performed with other CDR or framework regions, after which antibodies with the desired activity can be selected.

[0172] Tumor-targeted antibody conjugates / costimulatory agents In further embodiments, the glycan binding agent disclosed herein can be conjugated or bound to a therapeutic, imaging / detectable moiety, or enzyme.For example, the glycan binding agent can be conjugated to a detectable marker, a cytotoxic agent, an immunomodulatory agent, an imaging agent, a therapeutic agent, an oligonucleotide, or an enzyme.Methods for conjugating or binding an antibody to a desired molecule are well known in the art.The moiety can be bound to the antibody by covalent or non-covalent binding.

[0173] In some embodiments, antibodies are conjugated directly, or through a cleavable or non-cleavable linker, to a cytotoxic moiety or other moiety that affects important cellular processes necessary for survival (a "payload") to form an antibody-drug conjugate ("ADC").

[0174] In some embodiments, the glycan binder is conjugated to an auristatin to form an ADC. In some embodiments, the ADC comprises a glycan binder conjugated to a ZymeLink™ auristatin (ZLA) payload. Such an ADC construct is referred to as a ZymeLink™ ADC construct, as disclosed in U.S. Patent No. 9,879,086 (herein incorporated by reference) and further disclosed below.

[0175] In some embodiments, a ZymeLink™ ADC of the disclosure comprises a glycan-binding agent conjugated to an auristatin analog ZLA having structure 1 (also referred to herein as “compound 1”) via a linker L.

[0176] [ka]

[0177] In certain embodiments, a ZymeLink™ ADC has formula (I):

[0178] [ka] (In the formula, L is a cleavable linker, n is the drug-antibody ratio (DAR) and is an integer from 1 to 12; Ab is an antibody.

[0179] In some embodiments, each of the n agents in formula (I) is independently conjugated to the antibody Ab via one of the n linkers L.

[0180] In some embodiments, in a ZymeLink™ ADC of general formula (I), the linker, L, is a protease-cleavable linker.

[0181] In some embodiments, in a ZymeLink™ ADC of Formula (I), the linker L is a peptide-containing linker. In some embodiments, in an ADC of Formula (I), the linker L comprises a dipeptide selected from Val-Lys, Ala-Lys, Phe-Lys, Val-Cit, Phe-Cit, Leu-Cit, Ile-Cit, and Trp-Cit.

[0182] In some embodiments, in a ZymeLink™ ADC of Formula (I), the linker, L, comprises a dipeptide and a stretcher.

[0183] In certain embodiments, the linker L in a ZymeLink™ ADC of Formula (I) is conjugated to the antibody via a cysteine ​​or lysine residue on the antibody. In some embodiments, the linker L in an ADC of Formula (I) is conjugated to the antibody via a lysine residue on the antibody.

[0184] In some embodiments, in the ZymeLink™ ADC of Formula (I), n is an integer from 1 to 8. In some embodiments, in the ADC of Formula (I), n has a value from 2 to 8, e.g., from 2 to 6, from 3 to 7, or from 4 to 8. In terms of the upper limit, n may be less than 12, e.g., less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, or less than 3. In terms of the lower limit, n may be greater than 2, e.g., greater than 3, greater than 4, greater than 5, greater than 6, greater than 7, greater than 8, greater than 9, greater than 10, or greater than 11. Larger values ​​of n, e.g., greater than 12, are also contemplated.

[0185] Any combination of the foregoing embodiments of ZymeLink™ ADCs of Formula (I) is contemplated, with each combination forming a separate embodiment for purposes of this disclosure.

[0186] In certain embodiments, a ZymeLink™ ADC of the disclosure has formula (II):

[0187] [ka] (wherein n is the drug-antibody ratio (DAR) and is an integer from 1 to 12; Ab is an antibody.

[0188] In some embodiments, each of the n agents in formula (II) is independently conjugated to the antibody Ab via one of the n linkers L.

[0189] In certain embodiments, the carbonyl group of formula (II) marked with an asterisk forms a peptide bond with the side chain amine group of a lysine residue on an antibody (Ab).

[0190] In some embodiments, in the ZymeLink™ ADC of general formula (II), n is an integer from 1 to 8. In some embodiments, in the ADC of general formula (II), n has a value from 2 to 8, e.g., from 2 to 6, from 3 to 7, or from 4 to 8. In terms of the upper limit, n may be less than 12, e.g., less than 11, less than 10, less than 9, less than 8, less than 7, less than 6, less than 5, less than 4, or less than 3. In terms of the lower limit, n may be greater than 2, e.g., greater than 3, greater than 4, greater than 5, greater than 6, greater than 7, greater than 8, greater than 9, greater than 10, or greater than 11. Larger values ​​of n, e.g., greater than 12, are also contemplated.

[0191] Linker L

[0192] In the ZymeLink™ ADCs of the present disclosure, the antibody is linked to the auristatin analog ZLA disclosed herein by a linker L. The linker is a bifunctional or multifunctional moiety that can attach one or more drug molecules to the antibody. The linker can be bifunctional (or monovalent) to attach a single drug to a single site on the antibody, or multifunctional (or multivalent) to attach multiple drug molecules to a single site on the antibody. Linkers that can attach one drug molecule to multiple sites on the antibody can also be multifunctional.

[0193] Certain linkers useful in the present invention may be up to 30 carbon atoms in length. For example, the linkers can each independently be 5 to 20 carbon atoms in length. The types of bonds used to connect the linkers to the cytotoxic agents and antibodies of the present disclosure include, but are not limited to, amides, amines, esters, carbamates, ureas, thioethers, thiocarbamates, thiocarbonates, and thioureas. One of skill in the art will appreciate that other types of bonds are also useful in the provided ZymeLink™ ADCs.

[0194] Attachment of the linker to the antibody can be achieved in a variety of ways, such as through surface lysines on the antibody, through reductive linkage to oxidized carbohydrates on the antibody, or through cysteine ​​residues on the antibody that have been liberated by reducing interchain disulfide bonds. Alternatively, attachment of a linker to the antibody can be achieved by modifying the antibody to contain additional cysteine ​​residues (see, e.g., U.S. Pat. Nos. 7,521,541, 8,455,622, and 9,000,130) or unnatural amino acids that provide reactive handles such as selenomethionine, p-acetylphenylalanine, formylglycine, or p-azidomethyl-L-phenylalanine (e.g., Hofer et al., Biochemistry, 48:12047-12057 (2009); Axup et al., PNAS, 109:16101-16106 (2012); Wu et al., PNAS, 106:3000-3005 (2009); Zimmerman et al., Bioconj. Chem., 25:351-361 (2014)), allowing site-specific conjugation.

[0195] The linker comprises at least one functional group that can react with the targeting group(s) on the antibody, and one or more functional groups that can react with the targeting group on the drug.Suitable functional groups are known in the art, and include, for example, the functional groups described in Bioconjugate Techniques (GTHermanson, 2013, Academic Press).

[0196] Examples of targeting groups on antibodies that can be conjugated with linkers include the thiol group of cysteine ​​residues and the amine group of lysine residues.Non-limiting examples of functional groups that react with free cysteine ​​or thiol include maleimide, haloacetamide, haloacetyl, succinimide ester, active ester such as 4-nitrophenyl ester, pentafluorophenyl ester, tetrafluorophenyl ester, anhydride, acid chloride, sulfonyl chloride, isocyanate and isothiocyanate.In this context, "self-stabilizing" maleimides are also useful, as described in Lyon et al., Nat.Biotechnol.,32:1059-1062(2014). Non-limiting examples of functional groups that react with free amines include active esters (such as N-hydroxysuccinamide (NHS) esters, sulfo-NHS esters, imidoesters such as Traut's reagent, tetrafluorophenyl (TFP) esters, and sulfodichlorophenyl esters), isothiocyanates, aldehydes, and anhydrides (such as diethylenetriaminepentaacetic anhydride (DTPA)). Other examples include succinimide-1,1,3,3-tetra-methyluronium tetrafluoroborate (TSTU) and benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate (PyBOP).

[0197] Other linkers include those with functional groups that allow for cross-linking of two interchain cysteines on an antibody, such as the ThioBridge® linker (Badescu et al., Bioconjug. Chem., 25:1124-1136 (2014)), dithiomaleimide (DTM) linker (Behrens et al., Mol. Pharm., 12:3986-3998 (2015)), dithioarylpyridazinedione-based linkers (Lee et al., Chem. Sci., 7:799-802 (2016)), dibromopyridazinedione-based linkers (Maruani et al., Nat. Commun., 6:6645 (2015)), and others known in the art.

[0198] A linker may contain one or more linker components. Typically, a linker contains two or more linker components. Exemplary linker components include functional groups for reaction with an antibody, functional groups for reaction with a drug, stretchers, peptide components, self-immolative groups, self-leaving groups, hydrophilic moieties, and the like. A variety of linker components are known in the art, some of which are described below.

[0199] Certain useful linker moieties can be obtained from a variety of commercial suppliers, such as Pierce Biotechnology, Inc. (now Thermo Fisher Scientific Corporation, Waltham, Mass.) and Molecular Biosciences Inc. (Boulder, Colo.), or can be synthesized according to procedures described in the art (see, e.g., Toki et al., J. Org. Chem., 67:1866-1872 (2002); Dubowchik et al., Tetrahedron Letters, 38:5257-60 (1997); Walker, MA, J. Org. Chem., 60:5352-5355 (1995); Frisch et al., Bioconjugate Chem., 7:180-186 (1996); U.S. Pat. Nos. 6,214,345 and 7,553,816, and International Patent Application Publication No. 02 / 088172).

[0200] Examples of linker moieties include N-(β-maleimidopropyloxy)-N-hydroxysuccinimide ester (BMPS), N-(ε-maleimidocaproyloxy)succinimide ester (EMCS), N-[γ-maleimidobutyryloxy]succinimide ester (GMBS), 1,6-hexane-bis-vinylsulfone (HBVS), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate) (LC-SMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH), succinimidyl 3-(bromoacetamido)propionate (SBAP), succinimidyl iodoacetate (SIA), succinimidyl (4 -iodoacetyl)aminobenzoate (STAB), N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), N-succinimidyl-4-(2-pyridylthio)pentanoate (SPP), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB), succinimidyl 6-[(β-maleimidopropionamido)hexanoate] (SMPH), iminothiolane (IT), sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC, sulfo-SMPB, and succinimidyl-(4-vinylsulfone)benzoate (SVSB).

[0201] Additional examples include bis-maleimide reagents such as dithiobismaleimide ethane (DTME), bis-maleimide-trioxyethylene glycol (BMPEO), 1,4-bismaleimide butane (BMB), 1,4-bismaleimidyl-2,3-dihydroxybutane (BMDB), bismaleimide hexane (BMH), bismaleimide ethane (BMOE), BM(PEG)2 and BM(PEG)3, bifunctional derivatives of imido esters (dimethyl adipamide), HCl), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azide compounds (such as bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)ethylenediamine), diisocyanates (such as toluene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene).

[0202] Suitable linkers are generally chemically more stable to extracellular conditions than intracellular conditions, although less stable linkers may be considered in certain circumstances, such as when the drug is selective or targeted and less toxic to normal cells. Linkers may be "cleavable linkers" or "non-cleavable linkers." Cleavable linkers are generally susceptible to cleavage under intracellular conditions, such as lysosomal processes. Examples include protease-sensitive, acid-sensitive, reduction-sensitive, or photolabile linkers. In contrast, non-cleavable linkers rely on the degradation of the antibody within the cell, usually resulting in the release of the amino acid-linker-toxin moiety.

[0203] According to the present invention, the linker L included in the ADC of formula (I) is a cleavable linker. Suitable cleavable linkers include, for example, linkers that contain two or more amino acids and contain a peptide moiety that can be cleaved by intracellular proteases, such as lysosomal or endosomal proteases. The peptide moiety can contain naturally occurring amino acid residues and / or minor amino acids and / or non-naturally occurring amino acid analogs, such as citrulline. The peptide moiety can be designed and optimized for enzymatic cleavage by enzymes, such as tumor-associated proteases, cathepsin B, C, or D, or plasmin proteases.

[0204] In certain embodiments, the linker L included in the ADC of formula (I) may be a peptide-containing linker. In some embodiments, the linker L included in the ADC may be a dipeptide-containing linker, such as a linker containing valine-citrulline (Val-Cit) or phenylalanine-lysine (Phe-Lys). Other examples of dipeptides suitable for inclusion in the linker L include Val-Lys, Ala-Lys, Me-Val-Cit, Phe-homoLys, Phe-Cit, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Arg, Ala-Phe, Val-Ala, Met-Lys, Asn-Lys, Ile-Pro, Ile-Val, Asp-Val, His-Val, Met-(D)Lys, Asn-(D)Lys, Val-(D)Asp, NorVal-(D)Asp, Ala-(D)Asp, Me3Lys-Pro, PhenylGly-(D)Lys, Met-(D)Lys, Asn-(D)Lys, Pro-(D)Lys, and Met-(D)Lys. Cleavable linkers may include longer peptide moieties such as tripeptides, tetrapeptides, or pentapeptides. Examples include, but are not limited to, the tripeptides Met-Cit-Val, Gly-Cit-Val, (D)Phe-Phe-Lys, (D)Ala-Phe-Lys, and the tetrapeptides Gly-Phe-Leu-Gly, Gly-Gly-Phe-Gly, and Ala-Leu-Ala-Leu. In some embodiments, the linker L included in the ADC is a peptide-containing linker, and the peptide may be 2 to 5 amino acids in length, e.g., 2 to 4 amino acids in length.

[0205] Further examples of cleavable linkers include disulfide-containing linkers, such as N-succinimidyl-4-(2-pyridyldithio)butanoate (SPBD) and N-succinimidyl-4-(2-pyridyldithio)-2-sulfobutanoate (sulfo-SPBD). Disulfide-containing linkers can optionally include additional groups (e.g., inclusion of geminal dimethyl groups) to provide steric hindrance adjacent to the disulfide bond and improve the extracellular stability of the linker. Other suitable linkers include linkers that are hydrolyzable at a particular pH or within a pH range, such as hydrazone linkers. Linkers that contain a combination of these functional groups can also be useful, for example, linkers that contain both hydrazones and disulfides are known in the art.

[0206] A further example of a cleavable linker is a linker that contains a β-glucuronide that is cleavable by β-glucuronidase, an enzyme present in lysosomes and tumor stroma (see, e.g., De Graaf et al., Curr. Pharm. Des., 8:1391-1403 (2002)).

[0207] The cleavable linker may optionally further comprise one or more additional components, such as a self-immolative and self-leaving group, a stretcher, or a hydrophilic moiety.

[0208] Self-immolative and self-leaving groups that find use in linkers include, for example, p-aminobenzyloxycarbonyl (PABC) and p-aminobenzyl ether (PABE) groups, and methylated ethylenediamine (MED). Other examples of self-immolative groups include, but are not limited to, aromatic compounds that are electronically similar to PABC or PABE groups, such as heterocyclic derivatives, such as 2-aminoimidazole-5-methanol derivatives, as described in U.S. Pat. No. 7,375,078. Other examples include groups that cyclize after amide bond hydrolysis, such as substituted and unsubstituted 4-aminobutyric acid amides (Rodrigues et al., Chemistry Biology, 2:223-227 (1995)) and 2-aminophenylpropionic acid amides (Amsberry et al., J. Org. Chem., 55:5867-5877 (1990)).

[0209] Stretcher that finds use in the linker of ADC includes, for example, alkylene groups, and fatty acid, diacid, amine or diamine-based stretchers, such as diglycolate, malonate, caproate, and caproamide.Other stretchers include, for example, glycine-based stretchers, polyethylene glycol (PEG) stretchers, and monomethoxypolyethylene glycol (mPEG) stretchers.PEG and mPEG stretchers also function as hydrophilic moieties.

[0210] Examples of moieties commonly found in cleavable linkers include, but are not limited to, SPBD, sulfo-SPBD, hydrazone, Val-Cit, maleidocaproyl (MC), MC-Val-Cit, MC-Val-Cit-PABC, Phe-Lys, MC-Phe-Lys, MC-Phe-Lys-PABC, maleimidotriethyleneglycolate (MT), MT-Val-Cit, MT-Phe-Lys, TFP, and adipate (AD).

[0211] Selection of an appropriate linker for a given ZymeLink™ ADC can be readily made by one skilled in the art taking into account relevant factors such as the attachment site to the antibody, any structural constraints of the payload drug, and the hydrophobicity of the payload drug (see, e.g., Nolting, Chapter 5, Antibody-Drug Conjugates: Methods in Molecular Biology, 2013, Ducry (Ed.), Springer).

[0212] In certain embodiments, the linker, L, included in a ZymeLink™ ADC of the disclosure has formula (V):

[0213] [ka] (In the formula, Z is a linking group that joins the linker to a targeting group on the antibody; Str is the stretcher, AA1 and AA2 are each independently an amino acid, and AA1-[AA2] m forms a protease cleavage site, X is a self-immolative group, s is 0 or 1; m is 1, 2, 3 or 4; o is 0, 1, or 2; # is the point of attachment to the antibody, % is the point of attachment to the auristatin analog).

[0214] In some embodiments, in formula (V), m is 1, 2, or 3.

[0215] In some embodiments, in formula (V), s is 1.

[0216] In some embodiments, in formula (V), o is 0 (ie, X is absent).

[0217] In some embodiments, in formula (V), Z is

[0218] [ka] where # is the point of attachment to the antibody and * is the point of attachment to the remainder of the linker.

[0219] In some embodiments, in formula (V), Z is a carbonyl group (-C(O)-).

[0220] In some embodiments, in formula (V), Str is

[0221] [ka] (In the formula, each R is independently H or C1-C6 alkyl; each p is independently an integer from 2 to 10; each q is independently an integer from 1 to 10; $ is the point of attachment to Z, * is the point of attachment to the remainder of the linker).

[0222] In some embodiments, in formula (V), Str is

[0223] [ka] (In the formula, p, q, $ , and * are as defined above).

[0224] In some embodiments, in formula (V), Str is

[0225] [ka] (In the formula,$ and * is as defined above, p is an integer from 2 to 6, and q is an integer from 2 to 8).

[0226] In some embodiments, in formula (V), AA1-[AA2]m is Val-Lys, Ala-Lys, Phe-Lys, Val-Cit, Phe-Cit, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Arg, Ala-Phe, Val-Ala, Met-Lys, Asn-Lys, Ile-Pro, Ile-Val, Asp-Val, His-Val, Met-(D)Lys, Asn-(D)Lys, Val-(D )Asp, NorVal-(D)Asp, Ala-(D)Asp, Me3Lys-Pro, PhenylGly-(D)Lys, Met-(D)Lys, Asn-(D)Lys, Pro-(D)Lys, Met-(D)L ys, Met-Cit-Val, Gly-Cit-Val, (D)Phe-Phe-Lys, (D)Ala-Phe-Lys, Gly-Phe-Leu-Gly, and Ala-Leu-Ala-Leu.

[0227] In some embodiments, in formula (V), m is 1 (ie, AA1-[AA2]m is a dipeptide).

[0228] In some embodiments, in formula (V), AA1-[AA2]m is a dipeptide selected from Val-Lys, Ala-Lys, Phe-Lys, Val-Cit, Phe-Cit, Leu-Cit, Ile-Cit, and Trp-Cit.

[0229] In some embodiments, in formula (V), Z is a carbonyl group (-C(O)-) and Str is

[0230] [ka] and $is the point of attachment to Z, * is the point of attachment to the remainder of the linker, p is an integer from 2 to 6, and q is an integer from 2 to 8; m is 1, and AA1-[AA2] m is a dipeptide selected from Val-Lys, Ala-Lys, Phe-Lys, Val-Cit, Phe-Cit, Leu-Cit, Ile-Cit and Trp-Cit, s is 1, o is 0.

[0231] In some embodiments, in formula (V), Z is

[0232] [ka] where # is the point of attachment to the antibody, * is the point of attachment to the remainder of the linker, and Str is

[0233] [ka] and $ is the point of attachment to Z, * is the point of attachment to the remainder of the linker, p is an integer from 2 to 6, and q is an integer from 2 to 8; m is 1, and AA1-[AA2] m is a dipeptide selected from Val-Lys, Ala-Lys, Phe-Lys, Val-Cit, Phe-Cit, Leu-Cit, Ile-Cit and Trp-Cit, s is 1, o is 0.

[0234] In certain embodiments, a linker included in a ZymeLink™ ADC of the disclosure has formula (VI):

[0235] [ka] (In the formula, * is the point of attachment to the antibody Y is one or more additional linker moieties or is absent; D is the point of attachment to the auristatin analog.

[0236] In some embodiments, in the linker of formula (VI), Y is absent.

[0237] In certain embodiments, the linker included in the ADCs of the disclosure has formula (VII):

[0238] [ka] (In the formula, * is the point of attachment to the antibody Y is one or more additional linker moieties or is absent; D is the point of attachment to the auristatin analog.

[0239] In some embodiments, in the linker of formula (VII), Y is absent.

[0240] In certain embodiments, a linker included in a ZymeLink™ ADC of the disclosure has formula (VIII):

[0241] [ka] (In the formula, * is the point of attachment to the antibody Y is one or more additional linker moieties or is absent; D is the point of attachment to the auristatin analog.

[0242] In some embodiments, in the linker of formula (VIII), Y is absent.

[0243] In some embodiments, the ADCs of the present disclosure are conjugated to microtubule inhibitors that induce apoptosis in cells undergoing mitosis, for example, by causing cell cycle arrest at G2 / M. Non-limiting examples of microtubule inhibitors that can be used include maytansine derivatives (DM1 / DM4), or auristatins (MMAE / MMAF) and variants thereof (monomethyl auristatin D, PF-06380101, duostatin 5, AS269, Tap18Hr1, AGD-0182, HPA-auristatin F, etc.). In some embodiments, the payload is a tubulin targeting agent (e.g., hemiasterin, tubulysin, or eribulin). In some embodiments, the payload is a DNA damaging payload, including enediynes (calicheamicins), duocarmycin derivatives, pyrrolobenzodiazepine dimers (PBD dimers), and indolinobenzodiazepine pseudodimers.

[0244] In some embodiments, the antibody is an antibody that is capable of binding to, for example, ricin A chain, doxorubicin, daunorubicin, maytansinoids, taxol, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxyanthracin dione, methotrexate, actinomycin, diphtheria toxin, exotoxin A from Pseudomonas, Pseudomonas exotoxin 40, abrin, abrin A chain, modeccin A chain, alpha-sarcin, gefitinib ... The antibody is conjugated to a cytotoxic agent, including but not limited to ronin, mitogenin, restrictocin, combrane venom factor, ribonuclease, modified shiga toxin, phenomycin, enomycin, chrysin, crotin, calicheamicin, Saponaria officinalis inhibitor, glucocorticoid, auristatin, auromycin, yttrium, bismuth, combrestatin, duocarmycin, dolastatin, cc1065, or cisplatin. In some embodiments, the antibody may be linked to an agent such as an enzyme inhibitor, a proliferation inhibitor, a lytic agent, a DNA or RNA synthesis inhibitor, a membrane permeability modifier, a DNA metabolite, a dichloroethyl sulfide derivative, a protein production inhibitor, a ribosome inhibitor, or an apoptosis inducer. In some embodiments, the antibody is conjugated to an agent such as a topoisomerase inhibitor, e.g., a topoisomerase I inhibitor. Topoisomerase I inhibitors include, but are not limited to, quinoline alkaloids (e.g., SN-38, DXd).

[0245] In some embodiments, the antibody is conjugated to one or more cytotoxic and / or anti-mitotic compounds as disclosed in WO2014144871A1 and WO2016041082A1, the entire contents of both applications being incorporated herein by reference.

[0246] In some embodiments, the glycan-binding agent as described herein is conjugated to a molecule that facilitates transport of the antibody across a biological membrane, for example, by facilitating membrane penetration and facilitating translocation of the protein across the membrane. Thus, for example, the antibody may be linked to a cell-penetrating agent, such as a cell-penetrating peptide. Examples of cell-penetrating peptides include TAT, permeabilizing, polyarginine molecules, Kunitz domain-derived peptides (e.g., angiopep-2, SynB, buforin, transportan, amphipathic peptides, etc.). In some embodiments, the antibody may be conjugated to a cationic molecule, such as a polyamine. In some embodiments, the antibody may be conjugated to an agent that facilitates transport, e.g., transcytosis, across the blood-brain barrier. Thus, for example, the antibody may be conjugated to an agent that binds to an endothelial cell receptor that is internalized, such as the transferrin receptor, insulin receptor, insulin-like growth factor receptor, or low-density lipoprotein receptor. In some embodiments, the antibody may be conjugated to a toxin, e.g., Shiga toxin, that facilitates entry of the antibody into the cytoplasm. In some embodiments, the glycan-binding agents described herein may be conjugated to an engineered toxin body (ETB) to facilitate internalization of the antibody into the cell.

[0247] In some embodiments, the glycan-binding agents described herein are conjugated to or administered together with a polypeptide immunomodulator, such as an adjuvant. Examples of immunomodulatory agents include, but are not limited to, cytokines (e.g., transforming growth factor-β (TGFβ)), growth factors, lymphotoxins, tumor necrosis factor (TNF), hematopoietic factors, interleukins (e.g., interleukin-1 (IL-1), IL-2, IL-3, IL-6, IL-10, IL-12, IL-15, IL-15 / IL-15Rα, e.g., sushi domain, complex, IL-18, and IL-21), colony stimulating factors (e.g., granulocyte colony stimulating factor (G-CSF) and granulocyte macrophage colony stimulating factor (GM-CSF), interferons (e.g., interferon-α, -β, or -γ, erythropoietin and thrombopoietin, or combinations thereof). In some embodiments, the antibody is administered in combination with an adjuvant, a Toll-like receptor (TLR) inhibitor, a stimulatory inhibitor, or a combination thereof. The therapeutic agent may be linked to or administered with a compound that stimulates the innate immune system, such as a TLR agonist, a C-type lectin receptor (CLR) agonist, a retinoic acid-inducible gene I-like receptor (RLR) agonist, a polysaccharide such as saponin, chitin, chitosan, beta-glucan, ISCOM, QS-21, a stimulator of interferon gene (STING) agonist, or another immune enhancer.

[0248] In some embodiments, the glycan-binding agent described herein is conjugated to or administered with an IL-15 receptor agonist, such as an IL-15 fusion construct, an IL-15:IL-15Rα fusion construct, or a single-chain IL-15:IL-15Rα (sushi) fusion construct. In one embodiment, the tumor-targeting antibody conjugated to the IL-15 receptor agonist is a bispecific or multispecific antibody. In some embodiments, the antibody is a bispecific or multispecific antibody that comprises an antigen-binding domain described herein and further comprises an IL-15 receptor agonist.

[0249] In one embodiment, the glycan-binding agent described herein is administered with a single-chain IL-15:IL-15Rα(sushi) fusion construct. In some embodiments, the glycan-binding agent is administered with a polymer-conjugated IL-15 construct, such as NKTR-255.

[0250] The IL-15:IL-15Rα single chain construct can be administered to a subject at a therapeutically effective dose, e.g., in the range of less than 0.01 mg / kg body weight to about 25 mg / kg body weight, e.g., in the range of 0.1 to 10 mg / kg body weight. In some embodiments, the construct can be administered at a dose of 1 mg to 2 g per patient, or about 50 mg to 1000 mg per patient.

[0251] In one embodiment, the single chain IL-15 fusion construct comprises IL-15 joined to IL-15Rα(sushi) by a polypeptide linker. In one embodiment, the single chain IL-15 fusion construct is joined to another protein, such as Fc, via a polypeptide linker for long half-life. See, for example, FIG. 9B in WO2018071919A1 (corresponding to US10550185). In one embodiment, IL-15 is joined or fused to the N-terminus of the heavy chain of Fc, and IL-15R(sushi) is joined or fused to the N-terminus of the other Fc heavy chain using heavy chain heterodimerization technology to form the desired hybrid Fc. See, for example, FIG. 9A in WO2018071919A1.

[0252] In one embodiment, the IL-15:IL-15Rα(sushi) single chain construct is fused to the C-terminus of an antibody light chain or to the C-terminus of an antibody heavy chain, in either case generating a molecule with two tumor target binding sites (Fab arms) and two IL15:IL15Rα units. In another embodiment, one copy of the IL15:IL15Rα fusion construct is fused to a glycan-binding agent, thereby generating an antibody molecule that contains two tumor target binding sites (Fab arms) and only one IL15:IL15Rα unit, for example using heavy chain heterodimerization by the knobs-in-holes approach or other heterodimerization techniques.

[0253] In some embodiments, the IL-15:IL-15Rα(sushi) fusion construct or antibody comprising the fusion construct comprises a low affinity IL-15 variant with improved pharmacokinetics (PK). In some embodiments, the IL-15:IL-15Rα(sushi) fusion construct comprises a high affinity IL-15 variant with increased agonistic activity. In some embodiments, the high affinity IL-15 variant has an N72D mutation. In some embodiments, the high affinity variant is fused to a dimeric IL-15Rαsushi domain-IgG1Fc fusion protein. In some embodiments, the IL-15:IL-15Rα(sushi) fusion construct is ALT-803. See Liu B et al. (November 2016). "A Novel Fusion of ALT-803 (Interleukin (IL)-15 Superagonist) with an Antibody Demonstrates Antigen-specific Antitumor Responses". The Journal of Biological Chemistry. 291(46): 23869-23881. Doi:10.1074 / jbc.M116.733600. The sequences of the IL-15:IL-15Rα fusion constructs and linkers are shown in the Examples.

[0254] In some embodiments, antibodies comprising an IL15:IL15Rα fusion construct comprise one or more mutations in the Fc region described herein, e.g., E333A, K326W / E333S, S239D / I332E / G236A, S239D / A330L / I332E, G236A / S239D / A330L / I332E, F243L, G236A, and S298A / E333A / K334A. In some embodiments, antibodies comprising an IL15:IL15Rα fusion comprise one or more mutations in the Fc region that increase binding of the antibody to tumor cells, e.g., mutations P329G, L234A, L235A, or combinations thereof.

[0255] In some embodiments, the glycan binding agent described herein is conjugated to an IL-2 receptor agonist or administered together with an IL-2 receptor agonist. In one embodiment, the tumor targeting antibody conjugated to the IL-2 receptor agonist is a bispecific or multispecific antibody. In some embodiments, the antibody is a bispecific or multispecific antibody that comprises the antigen binding domain of the antibody described herein (e.g., AB-006410) and further comprises an IL-2 receptor agonist. In some embodiments, the IL-2 receptor agonist is pegylated IL-2.

[0256] In some embodiments, the glycan-binding agents described herein are conjugated to or administered together with a construct that can act as a trap for transforming growth factor-β (TGFβ). In one embodiment, the TGFβ trap comprises the extracellular domain (ECD) of TGFβ. In one embodiment, the TGFβ trap comprises the extracellular domain (ECD) of TGFβRII. In one embodiment, the TGFβ trap is in the form of a bispecific antibody (see Figure 1 of US Patent Application Publication No. 2018 / 0118832A1). Preferably, the TGFβRII ECD can capture TGFβ1 and has a low affinity for TGFβ2, thereby reducing potential cardiac toxicity.

[0257] Thus, in another aspect, the glycan binding agent described herein comprises the extracellular domain (ECD) of the TGFβ receptor fused to the C-terminus of the heavy chain or the C-terminus of the light chain. In some embodiments, the TGFβ trap is a single trap construct. In some embodiments, the single TGFβ trap is a bispecific tumor-targeting TGFβ trap comprising a TGFβRII ECD fused to any one of the antibodies disclosed herein via a flexible linker to the C-terminus of the heavy chain or the C-terminus of the light chain.

[0258] In some embodiments, the TGFβ trap is a tandem trap construct. In some embodiments, the tandem TGFβ trap comprises an IgG fused to two TGFβRII ECDs. In some embodiments, the tandem TGFβ trap comprises two TGFβ2RII ECDs. In some embodiments, the two TGFβ2RII ECDs are fused in tandem and linked by a short linker (e.g., L10 or L25). In some embodiments, the two TGFβ2RII ECDs are fused directly in tandem without a linker (L0). In some embodiments, the tandem TGFβRII ECDs are fused to the C-terminus (HC-Cter) of the heavy chain, and the heavy chains are designed as an asymmetric pair, such that the tandem trap is present in only one heavy chain. In some embodiments, the asymmetric pair of heavy chains comprises a knob-in-hole mutation that promotes pairing of the heavy chains. For example, in some embodiments, one heavy chain comprises the amino acid substitutions T366S+L368A+Y407V (and optionally Y349C) and the other heavy chain comprises the amino acid substitutions T336W (and optionally S354C). In some embodiments, an asymmetric single heavy chain C-ter fusion improves steric access of the Fc region to Fc gamma receptors, thereby improving function.

[0259] In some embodiments, the tandem TGFβ trap is fused to the C-terminus of the light chain (LC-Cter), and both light chains contain two TGFβRII ECDs. In these embodiments, the net molecule exhibits twice the TGFβ trapping capacity per molecule and may therefore have improved function.

[0260] In some embodiments, the bispecific TGFβ trap construct comprises a human variable region. In some embodiments, the bispecific TGFβ trap construct comprises an IgG1 or IgG2 constant region. In some embodiments, the bispecific TGFβ trap construct comprises a human IgG1 constant region. In some embodiments, the bispecific TGFβ trap construct comprises a mouse IgG2a constant region. In some embodiments, the variable region of the TGFβ trap construct is fused in frame to the IgG constant region.

[0261] The binding of the TGFβ trap construct can be determined using an ELISA assay, as described in the Examples. The ability of the TGFβ trap construct to bind to target tumor cells can be determined using flow cytometry, for example, as described in the Examples. The ability of the TGFβ trap construct to ligate and stimulate Fc-γ receptors in the presence of target tumor cells can be determined using a reporter bioassay, as described in the Examples. The ability of the TGFβ trap construct to inhibit tumor growth can be determined in a syngeneic mouse model, for example, as described in the Examples.

[0262] In some embodiments, the antibody may be linked to a radionuclide, an iron-related compound, a dye, a fluorescent agent, or an imaging agent. In some embodiments, the antibody may be linked to an agent such as, but not limited to, a metal, a metal chelator, a lanthanide, a lanthanide chelator, a radioactive metal, a radioactive metal chelator, a positron emitting nucleus, a microbubble (for ultrasound), a liposome, a molecule microencapsulated in a liposome or nanosphere, a single crystalline iron oxide nano compound, a magnetic resonance imaging contrast agent, a light absorbing, reflecting and / or scattering agent, a colloidal particle, a fluorophore such as a near infrared fluorophore.

[0263] How to induce an immune response In a further aspect, provided herein is a method of eliciting an immune response by administering a glycan-binding agent as described herein to a subject having a tumor. In some embodiments, the glycan-binding agent is an antibody described in Tables 1-4, or a variant thereof. In some embodiments, the antibody or variant thereof comprises an altered Fc region comprising a mutation as described herein. For example, in some embodiments, the antibody comprises an Fc mutation that increases effector function selected from E333A, K326W / E333S, S239D / I332E / G236A, S239D / A330L / I332E, G236A / S239D / A330L / I332E, F243L, G236A, S298A / E333A / K334A, and P329G / L234A / L235A, or a combination thereof. In some embodiments, the antibody comprises a modified Fc region that is defucosylated. In some embodiments, the antibody is conjugated to or administered with an IL-15 receptor agonist, a TGFβ trap, a TLR agonist, or an agonist anti-4-1BB antibody. In some embodiments, the antibody is a bispecific or multispecific antibody described herein.

[0264] The immune response elicited by administration of an antibody as described herein can be either an innate or adaptive immune response. In some embodiments, the antibody directly activates the immune response, for example, by the antibody binding to a target tumor cell and ligating with an Fc receptor on an effector cell, which activates the effector cell. In some embodiments, the antibody indirectly activates the immune response, for example, by eliciting an immune response initiated by the antibody binding to a target cell and an effector cell, which then elicits a downstream immune response. In some embodiments, the antibody activates monocytes, myeloid cells, and / or NK cells, for example, macrophages, neutrophils, dendritic cells, mast cells, basophils, eosinophils, and / or NK cells. In some embodiments, the antibody activates T lymphocytes and / or B cells.

[0265] Cancer Treatment In further aspects, the glycan binding agent or variants thereof as provided herein can be used as a therapeutic agent for treating cancer. In some embodiments, the glycan binding agent comprises a modified Fc region comprising a mutation as described herein. For example, in some embodiments, the antibody comprises an Fc mutation that increases effector function selected from E333A, K326W / E333S, S239D / I332E / G236A, S239D / A330L / I332E, G236A / S239D / A330L / I332E, F243L, G236A, S298A / E333A / K334A, and P329G / L234A / L235A, or a combination thereof. In some embodiments, the antibody comprises a modified Fc region that is defucosylated. In some embodiments, the antibody is conjugated to or administered with an IL-15 receptor agonist, a TGFβ trap, a TLR agonist, or an agonist anti-4-1BB antibody. In some embodiments, the antibody is a bispecific or multispecific antibody described herein.

[0266] In some aspects, the present disclosure further provides a method for identifying a subject who is a candidate for treatment with a glycan-binding agent having a tumor-targeting effect. Thus, in one embodiment, the present disclosure provides a method for identifying a patient who can benefit from treatment with a glycan-binding agent disclosed herein. In one embodiment, the patient has a tumor that expresses tumor-associated glycans. In some embodiments, the tumor sample is from a primary tumor. In an alternative embodiment, the tumor sample is a metastatic lesion. Binding of an antibody to tumor cells via binding interactions with glycans can be measured using any assay, such as immunohistochemistry or flow cytometry. In some embodiments, binding of an antibody to at least 0.2%, 0.5%, or 1%, or at least 5%, 10%, or at least 20%, 30%, or 50% of tumor cells in a sample can be used as a selection criterion for determining which patients will be treated with a glycan-binding agent as described herein.

[0267] The glycan-binding agents or glycan antibody immunoconjugates (e.g., glycan antibody drug conjugates) disclosed herein can be used to treat a number of different cancers. In some embodiments, cancer patients who may benefit from treatment with glycan-binding agents or glycan antibody immunoconjugates (e.g., glycan antibody drug conjugates) suffer from cancers that express tumor-associated glycans. In some embodiments, the cancer is a carcinoma, melanoma, or sarcoma. In some embodiments, the cancer is colorectal cancer, pancreatic cancer, gastric cancer, or uterine cancer. In some embodiments, the cancer is a blood cancer. In some embodiments, the cancer is breast cancer, prostate cancer, testicular cancer, renal cell cancer, bladder cancer, ovarian cancer, cervical cancer, endometrial cancer, lung cancer, colorectal cancer, anal cancer, pancreatic cancer, gastric cancer, esophageal cancer, hepatocellular carcinoma, head and neck cancer, brain cancer, such as glioblastoma, melanoma, or bone or soft tissue sarcoma. In one embodiment, the cancer is acral melanoma.In some embodiments, the cancer is acute lymphocytic leukemia, acute myeloid leukemia, adrenocortical carcinoma, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bone tumor, brain stem glioma, cerebellar astrocytoma, cerebral astrocytoma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, visual pathway and hypothalamic glioma, bronchial adenoma, Burkitt's lymphoma, central nervous system lymphoma, cerebellar astrocytoma, chondrosarcoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, epithelioid hemangioendothelioma (EHE), esophageal cancer, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, omentum. Membranoblastoma, gallbladder cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor, gestational trophoblastic tumor, gastric cancer, hairy cell leukemia, hepatocellular carcinoma, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, childhood, intraocular melanoma, pancreatic islet cell carcinoma, Kaposi's sarcoma, kidney cancer, laryngeal cancer, leukemia, lip and oral cavity cancer, liposarcoma, liver cancer, non-small cell lung cancer, small cell lung cancer, lymphoma, macroglobulinemia, male breast cancer, malignant fibrous histiocytoma of bone, medulloblastoma, Merkel cell carcinoma, mesothelioma, metastatic squamous cell neck cancer, oral cancer, multiple endocrine neoplasia syndrome, multiple myeloma, mycosis fungoides, myelodysplastic syndrome, myeloid leukemia leukemia, myeloid leukemia, adult acute, myeloproliferative disorders, chronic, myxoma, nasal and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin's lymphoma, oligodendroglioma, oral cavity cancer, oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, paranasal sinus and nasal cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pineoblastoma, supratentorial primitive neuroectodermal tumor, and pituitary adenoma.Plasma cell neoplasms, pleuropulmonary blastoma, primary central nervous system lymphoma, rectal cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Ewing sarcoma, Kaposi's sarcoma, soft tissue sarcoma, uterine sarcoma, Sézary syndrome, nonmelanoma skin cancer, melanoma, small intestine cancer, squamous cell carcinoma, squamous cell cervical cancer, gastric cancer, cutaneous T-cell lymphoma, pharyngeal cancer, thymoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, trophoblastic tumor, gestational, urethral cancer, uterine cancer, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia, or Wilms' tumor.

[0268] In some embodiments, the cancer is lung cancer, e.g., non-small cell lung adenocarcinoma or squamous cell carcinoma, breast cancer, e.g., Triple cell carcinoma, - , ER / PR + Her2 - , ER / PR - Her2 + , or Triple - , colorectal cancer, e.g., adenocarcinoma, mucinous adenocarcinoma, or papillary adenocarcinoma, esophageal cancer, gastric cancer, renal cancer, e.g., renal clear cell carcinoma, ovarian cancer, e.g., ovarian endometrioid carcinoma, ovarian mucinous cystadenocarcinoma, or ovarian serous cystadenocarcinoma, melanoma, e.g., acral melanoma, cutaneous melanoma, or mucosal melanoma, uterine or cervical cancer, liver cancer (such as hepatocellular carcinoma or cholangiocarcinoma), bladder cancer (such as transitional bladder cancer or urothelial bladder cancer), or testicular cancer.

[0269] In some embodiments, the cancer is pancreatic adenocarcinoma, esophageal adenocarcinoma, NSCLC adenocarcinoma, or ovarian mucinous adenocarcinoma.

[0270] In one aspect, the method of the present disclosure comprises administering to a cancer patient a glycan-binding agent or variant thereof as disclosed herein in a pharmaceutical composition in a therapeutically effective amount using a suitable dosing regimen for treating cancer. The composition can be formulated for use in a variety of drug delivery systems. For proper formulation, one or more physiologically acceptable excipients or carriers can also be included in the composition. Suitable formulations for use in the present invention can be found, for example, in Remington: The Science and Practice of Pharmacy, 21 st Edition, Philadelphia, PA. Lippincott Williams & Wilkins, 2005.

[0271] The glycan antibody is provided in a solution suitable for administration to a patient, such as a sterile isotonic aqueous solution for injection. The antibody is dissolved or suspended in an acceptable carrier at a suitable concentration. In some embodiments, the carrier is aqueous, such as water, saline, phosphate buffered saline, etc. The composition may contain auxiliary pharmaceutical substances such as pH adjusters, buffers, tonicity adjusters, etc., as necessary to approximate physiological conditions.

[0272] Administration The pharmaceutical composition is administered to the patient in an amount sufficient to cure or at least partially suppress the disease or its symptoms and complications. An amount sufficient to accomplish this is defined as a "therapeutically effective dose". A therapeutically effective dose is determined by monitoring the patient's response to treatment. Typical criteria for indicating a therapeutically effective dose include improvement of the patient's symptoms of the disease. Amounts effective for this use will vary depending on the severity of the disease and the patient's general health, including other factors such as age, weight, sex, and route of administration. The antibody can be administered once or multiple times, depending on the dosage and frequency as needed and tolerated by the patient. In any case, these methods provide a sufficient amount of tumor-targeting antibody to effectively treat the patient.

[0273] The glycan-binding agent can be administered by any suitable means, including, for example, parenteral, intrapulmonary, intranasal, and local administration, such as intratumoral administration. Parenteral administration includes intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In some embodiments, the antibody may be administered by inhalation. In an exemplary embodiment, the antibody may be stored at 10 mg / mL in a sterile isotonic saline solution for injection at 4° C. and diluted in 100 mL or 200 mL of 0.9% sodium chloride for injection prior to administration to the patient. In some embodiments, the antibody is administered by intravenous infusion over 1 hour at a dose of 0.01 to 25 mg / kg. In other embodiments, the antibody is administered by intravenous infusion over a time period of 15 minutes to 2 hours. In still other embodiments, the administration procedure is by subcutaneous bolus injection.

[0274] The dosage of the antibody is selected to provide an effective treatment to the patient and ranges from less than 0.01 mg / kg to about 25 mg / kg body weight, or from 1 mg to 2 g / patient. Preferably, the dosage is 0.1 to 10 mg / kg, or from about 50 mg to 1000 mg / patient. Administration can be repeated at a suitable frequency, which can range from once a day to once every 3 months, or up to once every 6 months, depending on the pharmacokinetics (e.g., half-life of the antibody in the circulation) and pharmacodynamic response (e.g., duration of therapeutic effect of the antibody). In some embodiments, the in vivo half-life is from about 7 days to about 25 days, and administration of the antibody is repeated from once a week to once every 3 months, or once every 6 months. In other embodiments, the antibody is administered about once a month.

[0275] In exemplary embodiments, the antibody may be stored at 10 mg / mL or 20 mg / mL in a sterile, isotonic aqueous solution. The solution may include agents such as buffers and stabilizers. For example, in some embodiments, a buffer such as histidine is included to maintain the pH of the formulation at about 5.5. Reagents or substitutes such as sucrose may be added to prevent aggregation and fragmentation in the solution during freezing and thawing. Inclusion of agents or substitutes such as polysorbate 80 may reduce surface tension and stabilize the antibody against denaturation due to agitation and air-liquid and ice-liquid surface denaturation. In some embodiments, the injectable solution is stored at 4° C. and diluted in 100 mL or 200 mL of 0.9% sodium chloride for injection before administration to the patient.

[0276] Combination therapy The glycan-binding agent may be administered with one or more additional therapeutic agents, such as radiation therapy, chemotherapy, and / or immunotherapy.

[0277] In some embodiments, the glycan-binding agent can be administered in combination with an agent that targets an immune checkpoint antigen. In one aspect, the agent is a biological therapeutic agent or a small molecule. In another aspect, the agent is a monoclonal antibody, a humanized antibody, a human antibody, a fusion protein, or a combination thereof. In certain embodiments, the agent inhibits a checkpoint antigen (PD1, PDL1, CTLA-4, ICOS, PDL2, IDO1, IDO2, B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, GITR, HAVCR2, LAG3, KIR, LAIR1, LIGHT, MARCO, OX-40, SLAM, , 2B4, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137 (4-1BB), CD160, CD39, VISTA, TIGIT, aSIGLEC, CGEN-15049, 2B4, CHK1, CHK2, A2aR, B-7 family of ligands or their receptors, or combinations thereof), e.g., by blocking binding of the ligand to the receptor. In some embodiments, the agent targets PD-1, e.g., an antibody that inhibits binding of PD-L1 to PD-1 or inhibits PD-1. In some embodiments, the agent targets CTLA-4. In some embodiments, the agent targets LAG3. In some embodiments, the agent targets TIM3. In some embodiments, the agent targets ICOS.

[0278] In some embodiments, the glycan-binding agent can be administered in combination with a therapeutic antibody, such as an antibody that targets a tumor cell antigen. Examples of therapeutic antibodies include rituximab, trastuzumab, tositumomab, ibritumab, alemtuzumab, atezolizumab, avelumab, durvalumab, pidilizumab, AMP-224, AMP-514, PDR001, cemiplimab, BMS-936559, CK-301, epratuzumab, bevacizumab, elotuzumab, These include necitumumab, blinatumomab, brentuximab, cetuximab, daratumumab, denosumab, dinutuximab, gemtuzumab, ibritumumab, ipilimumab, nivolumab, obinutuzumab, ofatumumab, adotrastuzumab, panitumumab, pembrolizumab, pertuzumab, ramucirumab, and ranibizumab. In some embodiments, the glycan-binding agent can be administered in combination with a therapeutic antibody that binds to an extracellular RNA-protein complex containing polyadenylated RNA (e.g., an antibody designated ATRC-101) (see International Publication No. WO2020168231, which is incorporated herein in its entirety).

[0279] In some embodiments, the glycan-binding agent is administered with a chemotherapeutic agent. Examples of cancer chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide, alkylsulfonates such as busulfan, improsulfan, and piposulfan, aziridines such as benzodopa, carboquone, meturedopa, and uredopa, ethylenimines and methylmelamines such as altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphatamide, and trimethylolmelamine, chlorambucil, chlornaphazine, chlorophosphamide, estramustine, isoflavone, cyclophosphamide ... Phosphamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, nobembitine, phenesterine, prednimustine, trofosfamide, nitrogen mustards such as uracil mustard, nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimustine, aclacinomycin, actinomycin, autramycin, azaserine, bleomycin, cactinomycin, calicheamicin, carabicin, caminomycin, carzinophilin, chromomycin, dacalcinomycin, Antibiotics such as cutinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin, epirubicin, esorubicin, idarubicin, marcelomycin, mitomycin, mycophenolic acid, nogalamycin, olivomycin, peplomycin, potfilomycin, puromycin, keramycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; metabolic antagonists such as methotrexate and 5-fluorouracil. , folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate, purine analogues such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine, pyrimidine analogues such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, androgens such as calsterone, dromostanolone propionate, epithiostanol, mepitiostane, testolactone, aminoglutethimide, mitotane,Anti-adrenal drugs such as trilostane, folic acid supplements such as floric acid, aceglatone, aldophosphamide glycosides, aminolevulinic acid, amsacrine, bestravcil, bisantrene, edatraxate, defofamine, demecolcine, diazicon, elformitine, elliptinium acetate, etoglucide, gallium nitrate, hydroxyurea, lentinan, lonidamine, mitoguazone, mitoxantrone, mopidamol, nitracrine, pentostatin, phenameth, pirarubicin, podophyllic acid, 2-ethylhydrazide, procarbazine, razoxane, cytomegalovirus ... Zofiran, spirogermanium, tenuazonic acid, triazicon, 2,2',2"-trichlorotriethylamine, urethane, vindesine, dacarbazine, mannomustine, mitobronitol, mitolactol, pipobroman, gacytosine, arabinoside, cyclophosphamide, thiotepa, taxoids such as paclitaxel and doxetaxel, chlorambucil, gemcitabine, 6-thioguanine, mercaptopurine, methotrexate, platinum analogs such as cisplatin and carboplatin, vinblastine, docetaxel, platinum, etoposide (VP- 16), ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, navelbine, novantrone, teniposide, daunomycin, aminopterin, xeloda, ibandronate, CPT-11, the topoisomerase inhibitor RFS2000, difluoromethylornithine (DMFO), bexarotene, retinoic acid derivatives such as alitretinoin, denileukin diftitox, esperamicin, capecitabine, and pharmacologic acceptable salts, acids, or derivatives of any of the above. This definition includes hormone therapy against tumors. Also included are antihormonal agents that modulate or inhibit the action of hormones, for example, antiestrogens such as tamoxifen, raloxifene, mifepristone, aromatase-inhibiting 4(5)-imidazole, 4-hydroxytamoxifen, trioxifene, ketoxifene, LY117018, onapristone, and toremifene (Fareston), antiandrogens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin, as well as pharmaceutical acceptable salts, acids, or derivatives of any of the above. Other cancer treatments include sorafenib,and other protein kinase inhibitors such as afatinib, axitinib, crizotinib, dasatinib, erlotinib, fostamatinib, gefitinib, imatinib, lapatinib, lenvatinib, mubritinib, nilotinib, pazopanib, pegaptanib, ruxolitinib, vandetanib, vemurafenib, and sunitinib, as well as sirolimus (rapamycin), everolimus, and other mTOR inhibitors. Examples of additional chemotherapeutic agents include topoisomerase I inhibitors (e.g., irinotecan, topotecan, camptothecin and its analogs or metabolites, doxorubicin), topoisomerase II inhibitors (e.g., etoposide, teniposide, and daunorubicin), alkylating agents (e.g., melphalan, chlorambucil, busulfan, thiotepa, ifosfamide, carmustine, lomustine, semustine, streptozocin, decarbazine, methotrexate, These include cyclophosphamide, mitomycin C, and cyclophosphamide), DNA intercalators (e.g., cisplatin, oxaliplatin, and carboplatin), DNA intercalators and free radical generators such as bleomycin, and nucleoside mimetics (e.g., 5-fluorouracil, capecitibin, gemcitabine, fludarabine, cytarabine, mercaptopurine, thioguanine, pentostatin, and hydroxyurea). Exemplary chemotherapeutic agents further include paclitaxel, docetaxel, and related analogs, vincristine, vinblastine, and related analogs, thalidomide, lenalidomide, and related analogs (e.g., CC-5013 and CC-4047), protein tyrosine kinase inhibitors (e.g., imatinib mesylate and gefitinib), proteasome inhibitors (e.g., bortezomib), IκB kinase inhibitors, and NF-κB inhibitors, including other inhibitors of proteins or enzymes known to be upregulated, overexpressed, or activated in cancer, the inhibition of which downregulates cell replication. Additional agents include asparaginase and Bacillus Calmete-Gurein preparations.

[0280] In some embodiments, the glycan-binding agent as described herein is administered after or simultaneously with a therapeutic agent, such as a chemotherapeutic agent ("SG inducer") such as doxorubicin that induces stress granules. Increasing the amount of stress granules in cancer cells facilitates targeting of tumor cells by tumor-targeting antibodies. Other exemplary therapeutic agents that can induce stress granules include pyrimidine analogs (e.g., 5-FU, trade names: Adrucil®, Carac®, Efudex®, Efudix®), protease inhibitors (e.g., bortezomib, trade name: Velcade®), kinase inhibitors (e.g., sorafenib and imatinib, trade names: Nexavar® and Gleevec®, respectively), arsenic compounds (e.g., arsenic trioxide, trade name: Trisenox®), platinum-based compounds that induce DNA damage (e.g., cisplatin and oxaliplatin, trade names: Platino®, respectively), and erythrocyte-derived chemotherapeutic agents (e.g., erythrocyte-derived chemotherapeutic agents) that induce DNA damage. l® and Eloxatin®), drugs that disrupt microtubules (e.g., Vinblastin, sold under the trade names Velban® or alkabban-AQ®, vincristin, sold under the trade names Vincasar®, Marqibo®, or Oncovin®, Vinorelbin, sold under the trade name Navelbin®), topoisomerase II inhibitors (e.g., Etoposide, sold under the trade names Etopophos, Toposar®, VePesid®), and drugs that induce DNA damage, such as radiation. Some exemplary therapeutic agents that can induce stress granule formation are disclosed in Mahboubi et al., Biochimica et Biophysica Acta 1863 (2017) 884-895.

[0281] Various combinations of glycan-binding agents and SG-inducing agents (or combinations of such agents) described herein can be used to treat cancer patients. "Combination therapy" or "in combination with" does not mean that the therapeutic agents must be administered simultaneously and / or formulated to be delivered together, although these delivery methods are within the scope described herein. The tumor-targeting antibody and the SG-inducing agent can be administered according to the same or different dosing schedules. In some embodiments, the tumor-targeting antibody and the SG-inducing agent are administered sequentially in any order over the entire treatment period or a portion of the treatment period. In some embodiments, the tumor-targeting antibody and the SG-inducing agent are administered simultaneously or nearly simultaneously (e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other). In still other embodiments, the SG-inducing agent may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 days or more prior to administration of the tumor-targeting antibody. In some embodiments, the SG-inducing agent is administered 1 to 4 weeks or more prior to administration of the tumor-targeting antibody.

[0282] The glycan-binding agent can be administered to a cancer patient in combination with a cell-based therapy, such as a natural killer (NK) cell therapy or a cancer vaccine. In some cases, the cancer vaccine is a peptide-based vaccine, a nucleic acid-based vaccine, a cell-based vaccine, a virus-based or virus fragment-based vaccine, or an antigen presenting cell (APC)-based vaccine (e.g., a dendritic cell-based vaccine).Cancer vaccines include Gardasil®, Cervarix®, sipuleucel-T (Provenge®), NeuVax™, HER-2 ICD peptide-based vaccine, HER-2 / neu peptide vaccine, AdHER2 / neu dendritic cell vaccine, HER-2 pulsed DC1 vaccine, Ad-sig-hMUC-l / ecdCD40L fusion protein vaccine, MVX-ONCO-1, hTERT / survivin / CMV multi-peptide vaccine, E39, J65, P10s-PADRE, rV-CEA-Tricom, GVAX®, Lucanix®, HER2 VRP, AVX901, ONT-10, ISAlOl, ADXSl 1-001, VGX-3100, INO-9012, GSK1437173A, BPX-501, AGS-003, IDC-G305, HyperAcute®-HAR Immunotherapy, Prevenarl3, MAGER-3.A1, NA17.A2, DCVax-Direct, Latent Membrane Protein-2 (LMP2)-Loaded Dendritic Cell Vaccine (NCT02115126), HS410-101 (NCT02010203, Heat Biologies), EAURF2010-01 (NCT01435356, GSK), 140036 (NCT02015104, Rutgers Cancer Institute of New Jersey), 130016 (NCTO1730118, National Cancer Institute of New Jersey), Institute), MVX-201101 (NCT02193503, Maxivax SA), ITL-007-ATCR-MBC (NCT01741038, Immunovative Therapies, Limited), CDR0000644921 (NCT00923143, Abramson cancer center of the University of Pennsylvania), SuMo-Sec-01 (NCT00108875, Julius Maximilians Universitaet Hospital), or MCC-15651 (NCT01176474, Medarex, Inc, BMS).

[0283] In some embodiments, the glycan-binding agent can be administered with an agent that reduces side effects resulting from stimulation of the immune system, such as a corticosteroid.

[0284] In the context of the present invention, the therapeutic agent administered in combination with the glycan-binding agent of the present invention can be administered before administration of the tumor-targeting antibody or after administration of the tumor-targeting antibody. In some embodiments, the glycan-binding agent can be administered simultaneously with the additional therapeutic agent. In some embodiments, the glycan-binding agent and the additional therapeutic agent can be administered according to the same or different dosing schedules. In some embodiments, the tumor-targeting antibody and the therapeutic agent are administered sequentially in any order throughout or part of the treatment period. In some embodiments, the tumor-targeting antibody and the therapeutic agent are administered simultaneously or approximately simultaneously (e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other). In still other embodiments, the therapeutic agent can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 days or more before administration of the tumor-targeting antibody. In still other embodiments, the therapeutic agent can be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 days or more after administration of the tumor-targeting antibody.

[0285] Functional assays Also described herein are functional assays that can be used to determine the ability of the antibodies described herein to mediate FcR-dependent activities, in some embodiments, the assays measure antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), or complement-dependent cytotoxicity (CDC).

[0286] In some embodiments, the binding and activation of FcγRIII by the antibodies described herein is determined. In some embodiments, the binding and activation of FcγRIIa by the antibodies described herein is determined. In some embodiments, the binding and activation of FcR is determined using an ex vivo bioluminescent cell-based assay. In the bioluminescent cell-based assay, the primary effector cells are replaced with a Jurkat cell line that stably expresses human FcγR and NFAT-induced luciferase. After the antibodies described herein bound to the target tumor cells are linked to the Fc region, the effector cells expressing FcγRIIa or FcγRIII transmit an intracellular signal, resulting in NFAT-mediated luciferase activity that can be easily quantified. See Promega's website at promega.com / Products / Reporter-Bioassays / fc-effector-activity-bioassays / ADCP-Bioassays / catNum=G9991. IN VIVO ASSAYS

[0287] In some embodiments, the activity of the antibodies is evaluated in vivo in known animal models for certain human tumors. One exemplary model is the CT26 mouse model. The in vivo tumor targeting activity of these antibodies can be evaluated using several assays, including but not limited to, analyzing blood and tumor immune profiling using flow cytometry to monitor tumor growth and performing immunofluorescence to semi-quantitatively estimate tumor invasion. In some embodiments, the efficacy of the antibodies can be evaluated using viability, normalized area above the curve (NAAC), and normalized growth rate metric (NGRM), both of which were developed at Atreca. The determination of "in vivo activity" can be based on in vivo activity being evaluated with a p-value ≦0.05 in at least one of the viability, NAAC, and NGRM analyses. That is, an antibody is considered to be "in vivo active" if it exhibits a p-value of 0.05 or less for viability, NAAC, and / or NGRM (any one is sufficient).

[0288] In one aspect, provided herein are antibodies that exhibit an inhibitory effect on tumors, including reducing the rate of tumor growth, size, tumor invasion and / or metastasis. Such antibodies exert a tumor targeting effect in vivo, for example, when administered to a subject having a tumor that expresses a tumor-associated glycan.

[0289] Manipulation of variables In some embodiments, the antibodies or variants thereof described herein are modified to have improved developability (i.e., reduced development liability), including but not limited to, reduced heterogeneity, increased yield, improved stability, improved net charge to improve pharmacokinetics, and / or reduced immunogenicity. In some embodiments, antibodies with improved developability can be obtained by introducing mutations that reduce or eliminate potential development liability. In some embodiments, antibodies with improved developability have modifications in the amino acid sequence compared to a reference or control antibody.

[0290] In some embodiments, the antibodies or variants thereof disclosed herein have improved developability while maintaining similar or improved binding affinity to the target antigen compared to a reference antibody or a control (unmodified) antibody. In some embodiments, the antibodies or variants thereof disclosed herein have improved developability while maintaining similar activity as the reference antibody or a control (unmodified) antibody.

[0291] In some embodiments, the antibody or variant thereof has improved developability, as confirmed through various in vitro assays, such as, for example, aggregation assessment by HPLC or UPLC, hydrophobic interaction chromatography (HIC), polyspecific assays (e.g., baculovirus particle binding), self-interaction nanoparticle spectroscopy (SINS), or mass spectrometry following incubation at accelerated degradation conditions such as high temperature, low pH, high pH, ​​or oxidized H2O2. A mutation is successful if activity is maintained (or enhanced) while eliminating or reducing the severity of the liability.

[0292] Improved properties of antibodies or variants thereof as described herein include: (1) compatibility with standard platforms (expression, purification, formulation), (2) high yield, (3) low heterogeneity (glycosylation, chemical modifications, etc.), (4) consistent manufacturability (batch-to-batch and small to large scale), (5) high stability (years in liquid formulations), e.g., minimal chemical degradation, fragmentation, and aggregation, and (6) long PK (in vivo half-life), e.g., no off-target binding, no impairment of FcRn recycling, and stable. Antibody liability is further detailed in Table 8.

[0293] [Table 4]

[0294] Another goal of engineering variables is to reduce the risk of clinical immunogenicity, i.e., the generation of anti-drug antibodies against the therapeutic antibody. To mitigate this risk, the antibody sequence is evaluated to identify residues that can be engineered to increase similarity to native immunoglobulin variable region sequences in the target population.

[0295] The factors that promote clinical immunogenicity can be divided into two groups: first, factors inherent to the drug, such as sequence, post-translational modifications, aggregates, degradation products, and contaminants; second, factors related to the way the drug is used, such as dosage, frequency of administration, route of administration, immune status of the patient, and HLA type of the patient.

[0296] One way to engineer a variant to be as self-like as possible is to identify a close germline sequence and mutate as many mismatched positions (also called "germline deviations") as possible to the germline residue type. This approach is applied to the germline genes IGHV, IGHJ, IGKV, IGKJ, IGLV, and IGLJ, and considers all variable heavy (VH) and variable light (VL) regions except for part of the H-CDR3. The germline gene IGHD, which encodes part of the H-CDR3 region, typically has too much diversity in the way it recombines with IGHV and IGHJ (e.g., forward or reverse, any of the three translation frames, 5' and 3' modifications, and non-templated additions) to represent a "self" sequence template from a population perspective.

[0297] Each germline gene can appear as different alleles in a population. With a view to minimizing the proportion of patients with an immunogenic response, the least immunogenic drug candidates would likely be those that match the alleles commonly found in the patient population. Single nucleotide polymorphism (SNP) data from the human genome can be used to estimate the frequency of alleles in a population.

[0298] Another approach to engineer leads to reduce immunogenicity risk is to use in silico prediction of immunogenicity, such as prediction of T cell epitopes, or in vitro assays of immunogenicity, such as ex vivo human T cell activation. For example, services such as those offered by Lonza in the UK use platforms for HLA binding prediction and in vitro evaluation to further identify potential epitopes.

[0299] Antibody variants can be designed to enhance the efficacy of the antibody. In some embodiments, design parameters can focus on CDRs, for example, CDR3. The positions to be mutated can be identified based on the structural analysis of antibody-antigen cocrystals (Oyen et al., Proc. Natl. Acad Sci. USA 114: E10438-E10445, 2017; Epub Nov 14, 2017) and based on sequence information of other antibodies of the same lineage.

[0300] Approaches to Mutation Design Development liabilities can be eliminated or reduced by one or more mutations. Mutations are designed to eliminate or reduce development liabilities and improve function while maintaining the structure and function of the antibody. In some embodiments, mutations to chemically similar residues that maintain size, shape, charge, and / or polarity can be identified. Exemplary mutations are listed in Table 9.

[0301] [Table 5]

[0302] Methods for Altering the Glycosylation of Antibodies In another aspect, the antibodies described herein comprise an Fc region with altered glycosylation that enhances the ability of the antibody to recruit NK cells and / or increase ADCC. In some embodiments, the Fc region comprises glycans that do not contain fucose (i.e., the Fc region is defucosylated). Fucosylated antibodies can be produced using cell lines expressing heterologous enzymes that deplete the intracellular fucose pool (e.g., GlymaxX® from ProBioGen AG, Berlin, Germany). Nonfucosylated antibodies can also be produced using host cell lines in which the endogenous α-1,6-fucosyltransferase (FUT8) gene has been deleted. See Satoh, M. et al., "Non-fucosylated therapeutic antibodies as next-generation therapeutic antibodies," Expert Opinion on Biological Therapy, 6:11, 1161-1173, DOI: 10.1517 / 14712598.6.11.1161.

[0303] Embodiment Embodiment 1 is an antibody that binds to a tumor, wherein the binding of the antibody to the tumor is dependent on the expression of one or more glycosyltransferases in the tumor, one of the one or more glycosyltransferases having N-acetyl-galactosaminyltransferase activity.

[0304] Embodiment 2 is the antibody of embodiment 1, wherein one of the one or more glycosyltransferases has fucosyltransferase activity.

[0305] Embodiment 3 is the antibody of embodiment 1 or 2, wherein the glycosyltransferase having N-acetyl-galactosaminyltransferase activity is selected from the group consisting of B4GALNT3 and B4GALNT4.

[0306] Embodiment 4 is an antibody according to embodiment 2 or 3, wherein one of the one or more glycosyltransferases having fucosyltransferase activity is selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0307] Embodiment 5 is an antibody according to any one of embodiments 1 to 4, wherein the tumor expresses a tumor-associated glycan.

[0308] Embodiment 6 is the antibody of embodiment 5, wherein the tumor-associated glycan is an extracellular glycan.

[0309] Embodiment 7 is the antibody of embodiment 1, wherein the one or more glycosyltransferases are selected from the group consisting of B4GALNT3 and B4GALNT4.

[0310] Embodiment 8 is the antibody of any one of embodiments 1 to 3, wherein the one or more glycosyltransferases are selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0311] Embodiment 9 is the antibody of embodiment 8, wherein the glycosyltransferase is FUT4.

[0312] Embodiment 10 is the antibody according to any one of embodiments 1 to 9, wherein the glycosyltransferase is B4GALNT3.

[0313] Embodiment 11 is the antibody of embodiment 5, wherein the presence of tumor-associated glycans depends on the expression of B4GALNT3 and FUT4 in the tumor.

[0314] Embodiment 12 is the antibody according to any one of embodiments 1 to 11, wherein the antibody preferentially binds to tumor tissue over normal tissue.

[0315] Embodiment 13 is the antibody according to any one of embodiments 1 to 12, wherein the antibody is internalized by tumor cells upon contact with the tumor.

[0316] Embodiment 14 is an antibody that binds to a tumor, the antibody comprising a heavy chain variable region comprising an HCDR1, HCDR2, and / or HCDR3 amino acid sequence listed in Table 1, or a variant of the HCDR1, HCDR2, and / or HCDR3 amino acid sequence with one, two, three, four, five or more amino acid substitutions, and / or a light chain variable region comprising an LCDR1, LCDR2, and / or LCDR3 amino acid sequence listed in Table 2, or a variant of the LCDR1, LCDR2, and / or LCDR3 amino acid sequence with one, two, three, four, five or more amino acid substitutions.

[0317] An antibody described in any one of embodiments 1 to 13, which binds to a tumor and which comprises a heavy chain variable region comprising the HCDR1, HCDR2, and / or HCDR3 amino acid sequences listed in Table 1, or variants of the HCDR1, HCDR2, and / or HCDR3 amino acid sequences with one, two, three, four, five or more amino acid substitutions, and / or a light chain variable region comprising the LCDR1, LCDR2, and / or LCDR3 amino acid sequences listed in Table 2, or variants of the LCDR1, LCDR2, and / or LCDR3 amino acid sequences with one, two, three, four, five or more amino acid substitutions.

[0318] Embodiment 15 is the antibody of embodiment 14, wherein the tumor expresses a tumor-associated glycan.

[0319] Embodiment 16 is such that the antibody is AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-011376, AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-011855, AB-011856, AB-011857,16. The antibody of embodiment 14 or 15, comprising all six CDRs of an antibody selected from the group consisting of AB-011858, AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, and AB-011873.

[0320] Embodiment 17 is an antibody described in any one of embodiments 14 to 16, wherein the antibody comprises a VH region comprising a VH amino acid sequence of Table 3 or an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the VH amino acid sequence of Table 3, and / or the antibody comprises a VL region comprising a VL amino acid sequence of Table 3 and an amino acid sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the VL amino acid sequence of Table 3.

[0321] Embodiment 18 is such that the antibody is AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-01137, AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-011855, AB-011856, AB-011857, AB-011858,The antibody according to any one of embodiments 14 to 17, comprising a VH of an antibody selected from the group consisting of AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, AB-011873 and variants thereof.

[0322] Embodiment 19 is such that the antibodies are AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-01137, AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-011855, AB-011856, AB-011857, AB-011858,The antibody according to any one of embodiments 14 to 18, comprising a VL of an antibody selected from the group consisting of AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, AB-011873 and variants thereof.

[0323] Embodiment 20 is such that the antibody is AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-01137, AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-011855, AB-011856, AB-011857, AB-011858,The antibody according to any one of embodiments 14 to 19, comprising both the VH and VL of an antibody selected from the group consisting of AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, AB-011873 and variants thereof.

[0324] Embodiment 21 is an antibody according to any one of embodiments 14 to 19, wherein the antibody comprises both the VH and VL of an antibody selected from the group consisting of AB-011110, AB-011788, AB-011789, AB-011794, AB-011367, and AB-011861.

[0325] Embodiment 22 is an antibody according to any one of embodiments 14 to 20, wherein binding of the antibody to the tumor depends on the expression of one or more glycosyltransferases in the tumor, one of the one or more glycosyltransferases having N-acetyl-galactosaminyltransferase activity.

[0326] Embodiment 23 is the antibody of embodiment 22, wherein the one or more glycosyltransferases have fucosyltransferase activity.

[0327] Embodiment 24 is the antibody of embodiment 22 or 23, wherein the glycosyltransferase having N-acetyl-galactosaminyltransferase activity is selected from the group consisting of B4GALNT3 and B4GALNT4.

[0328] Embodiment 25 is an antibody according to any one of embodiments 23 to 25, wherein one of the one or more glycosyltransferases having fucosyltransferase activity is selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0329] Embodiment 26 is an antibody according to any one of embodiments 22 to 25, wherein the tumor expresses a tumor-associated glycan.

[0330] Embodiment 27 is the antibody of embodiment 26, wherein the tumor-associated glycan is an extracellular glycan.

[0331] Embodiment 28 is the antibody of embodiment 22, wherein the one or more glycosyltransferases are selected from the group consisting of B4GALNT3 and B4GALNT4.

[0332] Embodiment 29 is an antibody according to any one of embodiments 22 to 28, wherein the one or more glycosyltransferases are selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0333] Embodiment 30 is the antibody of embodiment 29, wherein the glycosyltransferase is FUT4.

[0334] Embodiment 31 is an antibody according to any one of embodiments 22 to 30, wherein the glycosyltransferase is B4GALNT3.

[0335] Embodiment 32 is the antibody of embodiment 26, wherein the presence of tumor-associated glycans depends on the expression of B4GALNT3 and FUT4 in the tumor.

[0336] Embodiment 33 is the antibody according to any one of embodiments 14 to 32, wherein the antibody preferentially binds to tumor tissue over normal tissue.

[0337] Embodiment 34 is the antibody according to any of embodiments 14 to 33, wherein the antibody is internalized by cells in the tumor upon contact with the tumor.

[0338] Embodiment 35 is an antibody according to any one of embodiments 14 to 34, wherein at least one or two of the substitutions are conservative substitutions, at least 50% of the substitutions are conservative substitutions, or all of the substitutions are conservative substitutions.

[0339] Embodiment 36 is the antibody according to any one of embodiments 14 to 35, wherein the antibody is a non-naturally occurring antibody.

[0340] Embodiment 37 is an antibody that competes for binding with the antibody of any one of embodiments 14 to 36.

[0341] Embodiment 38 is the antibody according to any one of embodiments 1 to 37, wherein the antibody is a chimeric antibody, a multispecific antibody, a bispecific antibody, an scFv, or a Fab.

[0342] Embodiment 39 is the antibody of any one of embodiments 1 to 38, wherein the antibody is a bispecific antibody comprising a first and a second antigen-binding domain, wherein the first binding domain binds to an antigen on the tumor and the second binding domain binds to a second antigen.

[0343] Embodiment 40 is the antibody of embodiment 39, wherein the second antigen is 4-1BB or CD3.

[0344] Embodiment 41 is an immunoconjugate comprising an antibody according to any one of embodiments 1 to 39 and a cytotoxic agent.

[0345] Embodiment 42 is the immunoconjugate of embodiment 41, wherein the cytotoxic agent is an auristatin.

[0346] Embodiment 43 is an immunoconjugate of embodiment 41, wherein the cytotoxic agent is ZymeLink™ auristatin (ZLA).

[0347] Embodiment 44 relates to an immunoconjugate having formula (I) or (II):

[0348] [ka] wherein L is a cleavable linker, n is the drug-antibody ratio (DAR) and is an integer from 1 to 12, and Ab is an antibody according to any one of embodiments 1 to 40; or

[0349] [ka] (wherein n is the drug-antibody ratio (DAR) and is an integer of 1 to 12, and Ab is the antibody according to any one of claims 1 to 40).

[0350] Embodiment 45 is an immunoconjugate comprising the antibody according to any one of embodiments 1 to 40 and an IL-15 receptor agonist, a TGFβ trap, a TLR agonist, or a 4-1BB ligand (4-1BBL).

[0351] Embodiment 46 is a polypeptide comprising: (1) a VH sequence having at least 70% amino acid sequence identity to a VH amino acid sequence in Table 3, and / or a VL sequence having at least 70% amino acid sequence identity to a VL amino acid sequence in Table 3.

[0352] Embodiment 47 is a polypeptide described in embodiment 46, in which the VH amino acid sequence is selected from the group consisting of SEQ ID NOs: 85 to 98 and 713 to 812, and the VL amino acid sequence is selected from the group consisting of SEQ ID NOs: 99 to 113 and 813 to 912.

[0353] Embodiment 48 is a polypeptide described in embodiment 46, wherein the VH amino acid sequence is selected from the group consisting of SEQ ID NOs: 86, 727, 728, 733, 89, and 800, and the VL amino acid sequence is selected from the group consisting of SEQ ID NOs: 100, 827, 828, 833, 103, and 900.

[0354] Embodiment 49 is a polynucleotide encoding the polypeptide according to any one of embodiments 46 to 48.

[0355] Embodiment 50 is an expression vector comprising a polynucleotide encoding the VH region and / or VL region of the antibody according to any one of embodiments 1 to 40.

[0356] Embodiment 51 is a host cell comprising the expression vector of embodiment 50.

[0357] Embodiment 52 is a host cell comprising a polynucleotide encoding the VH region and / or the VL region of the antibody according to any one of embodiments 1 to 40.

[0358] Embodiment 53 is a pharmaceutical composition comprising the antibody of any one of embodiments 1 to 40 and a pharma- ceutically acceptable carrier.

[0359] Embodiment 54 is a method of treating a cancer patient, the method comprising administering to the patient an antibody described in any one of embodiments 1 to 39, or an immunoconjugate described in any one of embodiments 41 to 45.

[0360] Embodiment 55 is the method of embodiment 54, wherein the cancer is colorectal cancer or gastric cancer.

[0361] Embodiment 56 is the method of embodiment 54 or 55, wherein the method further comprises administering chemotherapy and / or radiation therapy.

[0362] Embodiment 57 is a method for identifying a patient having a tumor suitable for treatment with an antibody, wherein binding of the antibody to the tumor is dependent on expression of one or more glycosyltransferases in the tumor, one of the one or more glycosyltransferases having N-acetyl-galactosaminyltransferase activity, the method comprising contacting a tumor sample from the patient with an antibody of any one of embodiments 1 to 40 and detecting binding of the antibody to the tumor sample, wherein detection of binding identifies a patient having a tumor suitable for treatment with the antibody.

[0363] Embodiment 58 is the method of embodiment 57, wherein one of the one or more glycosyltransferases has fucosyltransferase activity.

[0364] Embodiment 59 is the method of embodiment 57 or 58, wherein the glycosyltransferase having N-acetyl-galactosaminyltransferase activity is selected from the group consisting of B4GALNT3 and B4GALNT4.

[0365] Embodiment 60 is the method of embodiment 58 or 59, wherein one of the one or more glycosyltransferases having fucosyltransferase activity is selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0366] Embodiment 61 is a method according to any one of embodiments 57 to 60, wherein the tumor expresses a tumor-associated glycan.

[0367] Embodiment 62 is the method of embodiment 61, wherein the tumor-associated glycan is an extracellular glycan.

[0368] Embodiment 63 is the method of embodiment 57, wherein the glycosyltransferase is selected from the group consisting of B4GALNT3 and B4GALNT4.

[0369] Embodiment 64 is the method of any one of embodiments 57 to 63, wherein the one or more glycosyltransferases are selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0370] Embodiment 65 is the method of embodiment 64, wherein the glycosyltransferase is FUT4.

[0371] Embodiment 66 is a method according to any one of embodiments 57 to 65, wherein the glycosyltransferase is B4GALNT3.

[0372] Embodiment 67 is the method of embodiment 62, wherein the presence of tumor-associated glycans depends on the expression of B4GALNT3 and FUT4 in the tumor.

[0373] Embodiment 68 is a method for producing an antibody, the method comprising culturing a host cell described in embodiment 49 under conditions in which a polynucleotide encoding a VH amino acid sequence and a polynucleotide encoding a VL amino acid sequence are expressed.

[0374] Embodiment 69 is a method for selecting an anti-tumor antibody, the method comprising: (1) contacting a candidate antibody with a tumor cell (or a lysate thereof) or a control cell (or a lysate thereof), the tumor cell (or a lysate thereof) (i) containing one or more glycosyltransferases in the tumor, one of the one or more glycosyltransferases having N-acetyl-galactosaminyltransferase activity; (2) detecting binding of the candidate antibody to the tumor cell (or a lysate thereof) or the control cell (or a lysate thereof); and (3) selecting the candidate antibody as an anti-tumor antibody if the binding of the candidate antibody to the tumor cell (or a lysate thereof) is greater than the binding of the candidate antibody to the control cell (or a lysate thereof).

[0375] Embodiment 70 is the method of embodiment 69, wherein the control cell is deficient in one or more glycosyltransferases.

[0376] Embodiment 71 is the method of embodiment 69, wherein the control cell is a tumor cell that is deficient in one or more glycosyltransferases.

[0377] Embodiment 72 is the method of embodiment 69, wherein one of the one or more glycosyltransferases has fucosyltransferase activity.

[0378] Embodiment 73 is the method of embodiment 69 of embodiment 70, wherein the glycosyltransferase having N-acetyl-galactosaminyltransferase activity is selected from the group consisting of B4GALNT3 and B4GALNT4.

[0379] Embodiment 74 is the method of embodiment 70 or 71, wherein one of the one or more glycosyltransferases having fucosyltransferase activity is selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0380] Embodiment 75 is a method according to any one of embodiments 69 to 74, wherein the tumor expresses a tumor-associated glycan.

[0381] Embodiment 76 is the method of embodiment 75, wherein the tumor-associated glycan is an extracellular glycan.

[0382] Embodiment 77 is the method of embodiment 1, wherein the one or more glycosyltransferases are selected from the group consisting of B4GALNT3 and B4GALNT4.

[0383] Embodiment 78 is a method according to any one of embodiments 69 to 77, wherein the one or more glycosyltransferases are selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0384] Embodiment 79 is the method of embodiment 78, wherein the glycosyltransferase is FUT4.

[0385] Embodiment 80 is the method of any of embodiments 69-79, wherein the glycosyltransferase is B4GALNT3.

[0386] Embodiment 81 is the method of embodiment 75, wherein the presence of tumor-associated glycans depends on the expression of B4GALNT3 and FUT4 in the tumor.

[0387] Embodiment 82 is the method of any one of embodiments 69 to 81, wherein the candidate antibody is an antibody isolated from a cancer patient.

[0388] Embodiment 83 is the method of any one of embodiments 69 to 82, wherein the candidate antibody is a variant of an antibody isolated from a cancer patient.

[0389] Embodiment 84 is the method described in embodiment 83, in which a variant is generated by mutating a polynucleotide encoding the VH or VL CDR3 of an antibody described in any one of embodiments 1 to 39 and expressing the variant comprising the mutated VH or VL CDR3.

[0390] Embodiment 85 is the method according to any one of embodiments 69 to 84, wherein the candidate antibody is a variant of an antibody according to any one of embodiments 1 to 40.

[0391] Embodiment 86 is a method for selecting an antibody having tumor targeting activity, the method comprising: mutating a polynucleotide encoding the VH or VL CDR3 of an antibody described in any one of embodiments 1 to 40; expressing an antibody comprising the mutated VH or VL CDR3; and selecting the antibody as an antibody having tumor targeting activity if the antibody inhibits tumor growth or reduces tumor size, tumor invasion, and / or metastasis in vivo.

[0392] Embodiment 87. Use of an antibody according to any one of embodiments 1 to 40 or an immunoconjugate according to any one of embodiments 41 to 45 for a method for treating cancer.

[0393] Embodiment 88 is the use of the antibody described in embodiment 87, wherein the cancer expresses tumor-associated glycans, and the presence of tumor-associated glycans depends on the expression of one or more glycosyltransferases in the tumor, one of which has N-acetyl-galactosaminyltransferase activity.

[0394] Embodiment 89 is the use according to embodiment 88, wherein one of the one or more glycosyltransferases has fucosyltransferase activity.

[0395] Embodiment 90 is the use according to embodiment 88 of embodiment 89, wherein the glycosyltransferase having N-acetyl-galactosaminyltransferase activity is selected from the group consisting of B4GALNT3 and B4GALNT4.

[0396] Embodiment 91 is the use according to embodiment 89 or 90, wherein one of the one or more glycosyltransferases having fucosyltransferase activity is selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0397] Embodiment 92 is the use according to any one of embodiments 88 to 91, wherein the tumor expresses tumor-associated glycans.

[0398] Embodiment 93 is the use according to embodiment 92, wherein the tumor-associated glycan is an extracellular glycan.

[0399] Embodiment 94 is the use according to embodiment 88, wherein the one or more glycosyltransferases are selected from the group consisting of B4GALNT3 and B4GALNT4.

[0400] Embodiment 95 is the use according to any one of embodiments 88 to 94, wherein the one or more glycosyltransferases are selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0401] Embodiment 96 is the use according to embodiment 95, wherein the glycosyltransferase is FUT4.

[0402] Embodiment 97 is the use according to any of embodiments 88 to 96, wherein the glycosyltransferase is B4GALNT3.

[0403] Embodiment 98 is the use according to embodiment 92, wherein the presence of tumor-associated glycans depends on the expression of B4GALNT3 and FUT4 in the tumor.

[0404] Embodiment 99 is the use described in embodiment 87, wherein the cancer is colorectal cancer or gastric cancer.

[0405] Embodiment 100. A means for binding a tumor expressing a tumor-associated glycan, wherein the presence of the tumor-associated glycan is dependent on the expression of one or more glycosyltransferases in the tumor, each of the one or more glycosyltransferases being selected from the group consisting of B4GALNT3, B4GALNT4, FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

[0406] Embodiment 101 is an antibody according to any of the preceding embodiments, wherein the tumor expresses a tumor-associated glycan, and the tumor-associated glycan comprises GalNAcbeta1,4GlcNAc (LacdiNAc).

[0407] Embodiment 102 is the antibody of embodiment 101, wherein the LacdiNAc is fucosylated.

[0408] Embodiment 103 is an antibody that binds to tumor cells expressing GalNAcbeta1,4GlcNAc (LacdiNAc).

[0409] Working Example Example 1. Target Identification We performed a functional genomic screen in the AB-006410 flow-positive CRC cell line LoVo, which expresses Cas9 nuclease. Cells were transfected with a genome-wide CRISPR sgRNA library and inhibition of AB-006410 binding was assessed by flow cytometry. The top hits in the screen included two glycosyltransferases, B4GALNT3 and FUT4, and the fucose transporter, SLC35C1.

[0410] The binding of AB-006410 to tumor cells in the presence of one of the glycosyltransferase inhibitors A-D and DMSO (control) was analyzed by flow cytometry. A, tunicamycin inhibits N-linked glycosylation, B, BADGP inhibits O-linked glycosylation (O-GlcNac), C, luteolin inhibits O-linked glycosylation (O-GalNac), and D, PPMP inhibits glycolipid synthesis. The results show that compared to DMSO, the glycosyltransferase inhibitors weaken the binding between AB-006410 and tumor cells, indicating that the binding of AB-006410 to tumor cells is dependent on glycosyltransferases. Figure 1.

[0411] We investigated the binding of AB-006410 to LoVo cells in which glycosyltransferases were knocked out by CRISPR / Cas9. Briefly, Cas9 RNPs were delivered into the LoVo cell line using electroporation with the Neon system (Invitrogen, Carlsbad, USA) according to the manufacturer's instructions. For RNP delivery experiments, purified Cas9 protein and synthetic single guide RNA (sgRNA) were assembled at a 1:9 molar ratio (Cas9 protein:synthetic sgRNA) using Buffer R (supplied with the Neon™ Transfection System) for 10 min at room temperature. After complexation, the RNPs were electroporated into the cell line. 72 h after RNP electroporation, the effect of knockout of each gene on antibody staining phenotype was analyzed by flow cytometry. Results show that AB-006410 binding was reduced in LoVo cells treated with sgRNAs targeting B4GALNT3 and FUT4 compared to control sgRNA-treated cells. Knockout of B4GLANT3 reduced AB-006410 binding to nearly isotype control levels (Figure 2A), while deletion of FUT4 reduced AB-006410 binding to a lower but significant extent (Figure 2B).

[0412] To determine which glycosyltransferases are important in presenting the glycans involved in AB-006410 binding to cells, the glycan profile of A549 cells that do not exhibit AB-006410 binding was altered by overexpression of glycosyltransferases. A549 cells were engineered to express the CRISPRa dCas9-VRP protein and electroporated with sgRNAs targeting the promoters of specific glycosyltransferases, B4GALNT3 or FUT4, or a non-human sequence (negative sgRNA) as a control. Duplication assays were performed using the following sets of sgRNAs: Fut4_guide RNA1: GGCGCCGCAGGAGGCTCCCG (sequence number: 913); Fut4_guide RNA2: GAGGCTCCCGGGGCCTGGTC (sequence number: 914); B4GALNT3_guide RNA1: GGCCTGCGACGGGAGAGGCG (sequence number: 915); B4GALNT3_guide RNA2: GAGGCCATTCGGCTTCCCTA (sequence number: 916); Non-targeting (negative control 1): GTGTCGTGATGCGTAGACGG (sequence number: 917); Non-targeting (negative control 2) GTCATCAAGGAGCATTCCGT (sequence number: 918).

[0413] The assay results showed that overexpression of either B4GALNT3 or FUT4 induces low to moderate binding of AB-006410 and AB-011110. Overexpression of both B4GALNT3 and FUT4 strongly increases the binding of both AB-006410 and AB-011110 compared to overexpression of either glycosyltransferase alone. Figures 3A-3D show the results of overexpression of both B4GALNT3 and FUT4 using B4GALNT3_guide RNA2 (SEQ ID NO: 916), Fut4_guide RNA2:GAGGCTCCCGGGGCCTGGTC (SEQ ID NO: 914), and non-targeting (negative control 2) GTCATCAAGGAGCATTCCGT (SEQ ID NO: 918).

[0414] The expression of B4GALNT3 or FUT4 and the binding of AB-006410 were examined using immunofluorescence staining. Staining was performed on formalin-fixed paraffin-embedded tissue sections of human cancers with high, low, and moderate prevalence of AB-006410 (colorectal, ovarian, and head and neck cancers, respectively). After dewaxing and antigen retrieval techniques, standard immunostaining protocols were performed. Briefly, fixed tissues were washed with 3% donkey serum to block nonspecific binding. Serial tissue sections were incubated with primary antibodies against AB-006410, B4GALNT3, or FUT4 in 3% donkey serum dilution. Sections were incubated with Alexa-647-conjugated secondary antibodies, counterstained with Hoechst, and mounted with antifade mounting reagent. Serial slides were stained using H&E. Primary antibodies were used with species-specific secondary antibodies and detected using standard methods.

[0415] Concordance was based on the observed signal concordance between AB-006410 and B4GALNT3 and / or FUT4 (i.e., all antibodies show positive or negative signals). Greater than 50 percent concordance was observed between AB-006410 and B4GALNT3 and / or FUT4 in all three human cancer indications, suggesting that B4GALNT3 and / or FUT4 are likely required for expression of AB-006410 targets and binding of AB-006410 to its targets. AB-006410 binding was seen in less than 10% of tumors where B4GALNT3 and FUT4 signals were not observed, further suggesting that B4GALNT3 and FUT4 are involved in expression of AB-006410 targets. FIG. 13 shows representative images of the binding of AB-006410, B4GALNT3, and FUT4 antibodies to colorectal cancer tissues, and the results indicate that the binding profiles were similar.

[0416] Example 2. AB-006410 variants The sequence of AB-006410 was analyzed for potential liabilities. AB-006410 was mutated to remove the N-linked glycosylation site in the light chain CDR1 to generate AB-011110 and AB-011111. AB-011110 was then used as the basis to generate additional variants designed to address other potential liabilities. One of these variants, AB-011622, contained an R30Q mutation in the light chain CDR1 and a D97N mutation in the light chain CDR3 designed to remove the two liabilities. Based on AB-011622, additional variants were generated, including AB-011788, which contained a D54K mutation in the heavy chain CDR2. AB-011367 was generated using a consensus of three sibling species antibodies in which the N-glycosylation site in the light chain CDR1 and the free cysteine ​​in the light chain CDR3 were removed. Based on AB-011367, additional variants were generated, including AB-011628, which contains the R57N mutation in the light chain CDR2, and AB-011861, which contains the D54N mutation in the heavy chain HCDR2. The variants tested retained the thermal stability of the parent antibody.

[0417] Example 3. In Vitro Studies of Glycan-Binding Agents Surface binding in tumor cells Surface binding to cultured cell lines in vitro was assessed by flow cytometry. Tumor cells were detached from culture plates using Versene and counted. Cells were stained with primary antibodies in BSA-containing buffer for 30 min at 4 °C with shaking. Cells were then washed and stained with secondary PE-labeled antibodies for 30 min at 4 °C with shaking. Cells were counterstained with DAPI before analysis on an Intellicyt iQue3 scanner. MedFI values ​​from live single cells were expressed as fold of isotype control. Assay results showed that AB-006410 has a very unique binding profile, binding primarily to colorectal cancer cell lines. Binding was also observed in the gastric cancer cell line NUGC4. Table 10.

[0418] [Table 6]

[0419] AB-006410 showed no binding to normal cell lines tested, including colon (CCD841CoN), skin (Detroit551), and intestine (Hs738.St / Int and HIEC-6). AB-011110 also showed no binding to normal cell lines tested, including colon (CCD841CoN) and intestine (Hs738.St / Int and HIEC-6).

[0420] The flow cytometry assay was repeated to test the binding of the mutant glycan binders to the colorectal cancer cell lines LoVo, HT29, and LS174T. The results of the assay showed that all tested variants AB-011110, AB-011622, AB-011623, AB-011367, and AB-011628 retained binding to the cell lines. Figure 14.

[0421] Next, surface binding of AB-006410 to isolated human colorectal cancer samples was evaluated. AB-006410 was conjugated using Thermo's SiteClick™ R-PE Antibody Labeling Kit for testing on isolated colorectal cancer cells obtained from commercial sources. These cells included cells from tumors of the colon, rectum, and splenic flexure. Dissociated cells were thawed, blocked with Human TruStain FcX™ (Fc receptor blocking solution) antibody, and stained with PE-conjugated antibodies EpCAM-BV421 and CD45-BV605 for 30 minutes at 4°C. Cells were washed three times with 200 μL of 1% FBS / 1 mM EDTA / PBS and resuspended in assay buffer containing DAPI. Cells were analyzed using Cytoflex and FlowJo_v10.7.1. Results showed that AB-006410 bound to the surface of six of nine dissociated cancer samples and did not bind to CD45+ tumor-infiltrating leukocytes (see Figure 4). AB-011111 showed an immunofluorescence profile consistent with AB-006410; Figure 5. No binding was detected in eight dissociated ovarian cancer samples.

[0422] Binding in tumor tissue Immunohistochemical staining was performed on formalin-fixed paraffin-embedded tissue sections of several human tumors. Standard dewaxing and antigen retrieval techniques were performed, followed by standard immunostaining protocols. Briefly, fixed tissues were incubated with Dako serum-free protein to inhibit nonspecific binding. Sections were incubated with primary antibodies in Dako background reducing diluent. Sections were incubated with polymer-HRP-conjugated secondary antibodies and stained using hematoxylin. Primary antibodies were used with species-specific secondary antibodies and detected using standard methods. AB-006410 showed a strong and tumor-selective signal in more than 50% of tumor cells. The top five tumor types most reactive with AB-006410 included colorectal adenocarcinoma, pancreatic adenocarcinoma, gastric adenocarcinoma, uterine endometrioid adenocarcinoma, and NSCLC (squamous cell carcinoma and adenocarcinoma), indicating the presence of glycan targets for this antibody in these tumor types. Table 4.

[0423] [Table 7]

[0424] AB-006410 showed strong signals in binding to colorectal, pancreatic, gastric, and uterine cancers (Figure 6A). No binding of AB-006410 was detected to frozen tissue samples from 26 types of normal human tissues, and only slight to moderate cytoplasmic immune reactivity was observed in normal human stomach.

[0425] Immunohistochemical staining was performed on formalin-fixed paraffin-embedded tissue sections of various human tumors. After performing dewaxing and antigen retrieval techniques, standard immunostaining protocols were performed. Briefly, fixed tissues were incubated with Dako serum-free protein block to inhibit nonspecific binding. Sections were incubated with primary antibodies in Dako background reducing diluent. Sections were incubated with polymer-HRP-conjugated secondary antibodies and stained using hematoxylin. Primary antibodies were used with species-specific secondary antibodies and detected using standard methods. AB-006410, AB-011110, and AB-011628 showed strong and tumor-selective signals in more than 50% of tumor cells. Representative images of colorectal and pancreatic adenocarcinomas are shown in Figure 6B, demonstrating the presence of glycan targets of these antibodies in these tumor types. Staining intensity was highest for AB-011110, followed by AB-006410 and AB-011628. All three antibodies were shown to bind to the same tumor core, suggesting conserved paratope / epitope recognition between these variants.

[0426] internalization Internalization into in vitro cultured cell lines was assessed by flow cytometry. Antibodies were conjugated to pH-sensitive dyes using Thermo's pHrodo™ iFL Green Microscale Protein Labeling Kit. Cells were detached with Versene, plated in 96-well plates, and incubated with 250 nM conjugated antibodies at 37 °C. After incubation, cells were washed and stained with A647-conjugated anti-mouse IgG secondary antibody for 20 min at 4 °C, washed, and assessed for antibody remaining on the cell surface. Cells were stained with DAPI and both internalization and surface signal were measured using Intellicyt's iQue3 scanner. Results showed that AB-006410 and variants of AB-006410 were internalized at 37 °C over time, as indicated by the pH-sensitive pHrodo Green dye, which fluoresces when the conjugated antibody reaches early endosomes. Concomitantly, a decrease in surface-bound antibody was observed in the three different colorectal cancer cell lines, supporting the above findings regarding the internalization of antibody-bound targets in these three different colorectal cancer cell lines. FIG. 15.

[0427] ADC Antibody-drug conjugate (ADC) activity of glycan binders was evaluated in LoVo cells. Briefly, a secondary toxin-conjugated antibody was used to test the ADC activity of the antibody. Target cells were detached from the culture plate and the cell concentration was adjusted to 31,250 cells / mL in assay medium. 2,500 cells were added to each well of a 96-well plate and incubated with various concentrations of primary antibody for 15 min at room temperature. Subsequently, a secondary Fab anti-mouse IgGFc conjugated to duocarmycin with a cleavable linker (Moradec, #AM-202-DD) was added at a final concentration of 250 ng / mL. Cells were incubated for 72 h at 37 °C, 5% CO2. At the end of the incubation period, 100 μL of CellTiter-Glo® was added to each well and incubated at room temperature for 5–10 min before luminescence was read on a BMG ClarioSTAR plate reader. Data were then normalized to maximum lysis control and plotted using GraphPad Prism. Cetuximab was included as a positive control.

[0428] The results of this assay showed that AB-006410 exhibited dose-responsive ADC activity in this model. Figure 7. The ADC activity of variants mutated to remove the N-linked glycosylation motif (NES) in the CDR-L1 of AB-006410 was evaluated compared to the ADC activity of AB-006410. The results of the assay showed that the variants exhibited similar levels of cytotoxicity as AB-006410. Figure 8.

[0429] ADC activity for additional glycan binder variants was evaluated and the results are shown in Table 5. All glycan binders demonstrated dose-responsive ADC activity, with several variants exhibiting cytotoxicity similar to AB-011110.

[0430] [Table 8]

[0431] To assess the effect of glycosyltransferases on AB-006410 activity, A549 cells, which do not exhibit AB-006410 binding, were modified in glycan profile by overexpressing both B4GALNT3 and FUT4 as described in Example 1. Results showed that overexpression of these glycosyltransferases restored AB-006410 responsiveness and sensitized these cells to ADC killing. Introduction of control sgRNA into these cells did not affect responsiveness to ADC. Figure 12. Overexpression of either B4GALNT3 or FUT4 also sensitized cells to ADC killing, but not to the same extent as dual overexpression as found in this assay.

[0432] Direct conjugation of ADCs The activity of antibody drug conjugates was tested with antibodies directly conjugated with ZymeLink™ auristatin payload. LoVo target cells were detached from culture plates and cell concentration was adjusted to 31,250 cells / mL in assay medium. 2,500 cells were added to each well of a 96-well plate and incubated with various concentrations of directly conjugated primary antibodies for 15 min at room temperature. Cells were then incubated at 37°C and 5% CO2 for 72 h. At the end of the incubation period, 100 μL of CellTiter-Glo® was added to each well and incubated at room temperature for 5–10 min before luminescence was read on a BMG ClarioSTAR plate reader. Data were then normalized to maximum lysis control and plotted using GraphPad Prism.

[0433] The results of this assay showed that the Zymelink™ auristatin format of AB-006410 exhibited cytotoxicity against the LoVo cell line. Cetuximab-auristatin ZymeLink™ ADC (cetuximab-ZLA) was included as a positive control and isotype-auristatin ZymeLink™ ADC (isotype-ZLA) was included as a negative control. Figure 9A.

[0434] Additional variants of AB-006410 were expressed and conjugated with ZymeLink™ auristatin payload. The same protocol was used to evaluate ADC cytotoxicity on LoVo target cells. The results are shown in Table 6. Many of the variants maintained the ability to lyse LoVo cells at 100 nM. For a subset of the conjugated variants, cytotoxicity against LoVo cells was evaluated over a broader concentration range starting at 1000 nM (Figure 9B and Figure 9C, Table 7). Some variant conjugates had more potent cytotoxicity than the AB-006410 conjugate.

[0435] [Table 9]

[0436] [Table 10]

[0437] Many of the antibodies in the variants showed improved ADC activity as conjugates, including AB-011110, AB-011788, AB-011789, AB-011794, AB-011367, and AB-011861, with AB-011861 showing a 10-fold improvement in ADC activity compared to AB-006410.

[0438] Example 4. IN VIVO STUDIES OF AB-006410 AB-006410 in ZymeLink™ ADC construct format was also tested in mice bearing tumors derived from LoVo tumor cells. Briefly, 1E7 LoVo tumor cells were injected subcutaneously into female BALB / c nude mice. Tumors formed and reached approximately 150 mm 3The mice were randomized at 0.05 mg / kg / day for 12 h. Administration was performed on the day of randomization. Compared to the group treated with isotype-Zymelink™ conjugate, the groups of mice treated with AB-006410-Zymelink™ conjugate (Zyme) (6 mpk) or AB-006410-Zyme (12 mpk) showed reduced tumor growth during the treatment period. Figure 10. The results showed that injection of a single dose of the antibody could induce a strong tumor shrinkage response in a dose-dependent manner.

[0439] Incorporation by Reference All publications and patent documents referenced in this disclosure are herein incorporated by reference in their entirety for all purposes to the same extent as if each such publication or document was specifically and individually indicated to be incorporated by reference herein.

[0440] While the present invention has been described with reference to specific examples and figures, within the scope of ordinary development and optimization, and within the knowledge of those skilled in the art, modifications can be made and equivalents substituted to adapt to a particular situation or intended use, thereby achieving the advantages of the present invention without departing from the scope of the appended claims and their equivalents.

Claims

1. An antibody that binds to a tumor, wherein binding of the antibody to the tumor is dependent on expression of one or more glycosyltransferases in the tumor, one of the one or more glycosyltransferases having N-acetyl-galactosaminyltransferase activity.

2. The antibody of claim 1 , wherein one of the one or more glycosyltransferases has fucosyltransferase activity.

3. The antibody of claim 1, wherein the glycosyltransferase having N-acetyl-galactosaminyltransferase activity is selected from the group consisting of B4GALNT3 and B4GALNT4.

4. The antibody of claim 2 or 3, wherein one of the one or more glycosyltransferases having fucosyltransferase activity is selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

5. The antibody of any one of claims 1 to 4, wherein the tumor expresses a tumor-associated glycan.

6. The antibody of claim 5, wherein the tumor-associated glycan is an extracellular glycan.

7. The antibody of claim 1 , wherein the one or more glycosyltransferases are selected from the group consisting of B4GALNT3 and B4GALNT4.

8. The antibody of any one of claims 1 to 7, wherein the one or more glycosyltransferases are selected from the group consisting of FUT3, FUT4, FUT5, FUT6, FUT7, FUT9, FUT10, and FUT11.

9. The antibody of claim 8 , wherein the glycosyltransferase is FUT4.

10. The antibody of any one of claims 1 to 9, wherein the glycosyltransferase is B4GALNT3.

11. The antibody of claim 5, wherein the presence of the tumor-associated glycan is dependent on the expression of B4GALNT3 and FUT4 in the tumor.

12. The antibody of any one of claims 1 to 11, wherein the antibody preferentially binds to tumor tissue over normal tissue.

13. The antibody of any one of claims 1 to 12, wherein the antibody is internalized by tumor cells upon contact with the tumor.

14. The antibody binds to a tumor. a heavy chain variable region comprising an HCDR1, HCDR2, and / or HCDR3 amino acid sequence listed in Table 1, or a variant of said HCDR1, HCDR2, and / or HCDR3 amino acid sequence in which one, one, two, three, four, five, or more amino acids are substituted; and a light chain variable region comprising an LCDR1, LCDR2, and / or LCDR3 amino acid sequence listed in Table 2, or a variant of said LCDR1, LCDR2, and / or LCDR3 amino acid sequence in which one, two, three, four, five, or more amino acids have been substituted.

15. The antibodies are AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-011376, AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-011855, AB-011856, AB-011857, AB-011858,The antibody of claim 14, comprising all six CDRs of an antibody selected from the group consisting of AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, and AB-011873.

16. The antibody is V of Table 3 Ｈ an amino acid sequence, or the V Ｈ V comprising an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the amino acid sequence Ｈ and / or The antibody is V of Table 3 Ｌ The amino acid sequence and the V Ｌ and an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity with the amino acid sequence of Ｌ The antibody of any one of claims 14 to 15, comprising a region.

17. The antibodies are AB-006410, AB-011110, AB-011111, AB-011366, AB-011367, AB-011368, AB-011369, AB-011370, AB-011371, AB-011372, AB-011373, AB-011374, AB-011375, AB-01137, AB-011622, AB-011623, AB-011624, AB-011625, AB-011626, AB-011627, AB-011628, AB-011781, AB-011782, AB-011783, AB-011784, AB-011785, AB-011786, AB-011787, AB-011788, AB-011789, AB-011790, AB-011791, AB-011792, AB-011793, AB-011794, AB-011795, AB-011796, AB-011797, AB-011798, AB-011799, AB-011800, AB-011801, AB-011802, AB-011803, AB-011804, AB-011805, AB-011806, AB-011807, AB-011808, AB-011809, AB-011810, AB-011811, AB-011812, AB-011813, AB-011814, AB-011815, AB-011816, AB-011817, AB-011818, AB-011819, AB-011820, AB-011821, AB-011822, AB-011823, AB-011824, AB-011825, AB-011826, AB-011827, AB-011828, AB-011829, AB-011830, AB-011831, AB-011832, AB-011833, AB-011834, AB-011835, AB-011836, AB-011837, AB-011838, AB-011839, AB-011840, AB-011841, AB-011842, AB-011843, AB-011844, AB-011845, AB-011846, AB-011847, AB-011848, AB-011849, AB-011850, AB-011851, AB-011852, AB-011853, AB-011854, AB-011855, AB-011856, AB-011857, AB-011858V of an antibody selected from the group consisting of AB-011859, AB-011860, AB-011861, AB-011862, AB-011863, AB-011864, AB-011865, AB-011866, AB-011867, AB-011868, AB-011869, AB-011870, AB-011871, AB-011872, AB-011873 and variants thereof, Ｈ and V Ｌ The antibody according to any one of claims 14 to 16, comprising both of the following:

18. The antibody is an antibody selected from the group consisting of AB-011110, AB-011788, AB-011789, AB-011794, AB-011367, and AB-011861. Ｈ and V Ｌ The antibody according to any one of claims 14 to 17, comprising both of the following:

19. An antibody that competes for binding with the antibody of any one of claims 14 to 18.

20. An immunoconjugate comprising an antibody according to any one of claims 1 to 19 and a cytotoxic agent.

21. 21. The immunoconjugate of claim 20, wherein the cytotoxic agent is an auristatin.

22. 21. The immunoconjugate of claim 20, wherein the cytotoxic agent is ZymeLink™ Auristatin (ZLA).

23. The immunoconjugate has formula (I) or formula (II): 【Chemistry 1】 (In the formula, L is a cleavable linker, n is the drug-to-antibody ratio (DAR), an integer from 1 to 12; Ab is an antibody according to any one of claims 1 to 19; or 【Chemistry 2】 (In the formula, n is the drug-to-antibody ratio (DAR), an integer from 1 to 12; The immune complex according to claims 20 to 22, comprising an antibody (Ab) according to any one of claims 1 to 23.

24. V of the antibody according to any one of claims 1 to 19 Ｈ Sequence and / or V of the antibody according to any one of claims 1 to 19 Ｌ A polynucleotide encoding a polypeptide comprising the sequence.

25. V of the antibody according to any one of claims 1 to 19 Ｈ Region and / or V Ｌ An expression vector comprising a polynucleotide encoding the region.

26. A host cell comprising the expression vector of claim 25.

27. A pharmaceutical composition comprising an antibody according to any one of claims 1 to 19, or an immunoconjugate according to any one of claims 20 to 23, and a pharma- ceutically acceptable carrier.

28. A method of treating a cancer patient, said method comprising administering to said patient an antibody according to any one of claims 1 to 19.

29. 1. A method for identifying a patient having a tumor suitable for treatment with an antibody, wherein binding of the antibody to the tumor is dependent on expression of one or more glycosyltransferases in the tumor, one of the one or more glycosyltransferases having N-acetyl-galactosaminyltransferase activity, the method comprising: contacting a tumor sample from said patient with an antibody according to any one of claims 1 to 23; detecting binding of the antibody to the tumor sample, wherein detection of said binding identifies said patient having a tumor suitable for treatment with the antibody.

30. 1. A method for selecting an anti-tumor antibody, the method comprising: (1) contacting a candidate antibody with a tumor cell (or a lysate thereof) or a control cell (or a lysate thereof), the tumor cell (or a lysate thereof) being (i) one or more glycosyltransferases in the tumor, wherein one of the one or more glycosyltransferases comprises a glycosyltransferase having N-acetyl-galactosaminyltransferase activity; (2) detecting binding of the candidate antibody to the tumor cells (or a lysate thereof) or the control cells (or a lysate thereof); and (3) selecting the candidate antibody as the anti-tumor antibody if binding of the candidate antibody to the tumor cells (or their lysates) is greater than binding of the candidate antibody to the control cells (or their lysates).

31. Use of an antibody according to any one of claims 1 to 19 or an immunoconjugate according to any one of claims 20 to 23 for a method for treating cancer.

Images