Dosing of muscle-targeting complexes to treat myotonic dystrophy

Abstract

Aspects of the disclosure relate to methods of reducing DMPK expression or activity (e.g., reducing the level of mutant or wild-type DMPK RNA, or the activity of a DMPK gene product) in a subject, and / or methods of treating myotonic dystrophy (e.g., DM1). In some embodiments, the methods include administering to the subject a composition comprising a conjugate (e.g., a muscle-targeting conjugate) that includes an oligonucleotide (e.g., a DMPK muscle-targeting oligonucleotide) covalently linked to an antibody (e.g., an anti-TfR1 antibody).

Description

[Technical field]

[0001] Related Applications This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 368,691, filed July 18, 2022, entitled "DOSING OF MUSCLE TARGETING COMPLEXES FOR TREATING MYOTONIC DYSTROPHY," and U.S. Provisional Application No. 63 / 331,733, filed April 15, 2022, entitled "DOSING OF MUSCLE TARGETING COMPLEXES FOR TREATING MYOTONIC DYSTROPHY," the entire contents of each of which are incorporated herein by reference.

[0002] FIELD OF THE PRESENT APPLICATION The present application relates to targeted complexes for delivering effective amounts of oligonucleotide molecular payloads to cells and their uses, particularly for the treatment of disease.

[0003] Electronic Sequence Listing Reference The contents of the electronic sequence listing (D082470077WO00-SEQ-COB.xml; size: 56,306 bytes; and creation date: April 7, 2023) are incorporated herein by reference in their entirety. [Background technology]

[0004] background Myotonic dystrophy (DM) is a dominant genetic disease characterized by muscle tone, muscle loss or degeneration, reduced muscle function, insulin resistance, cardiac arrhythmias, smooth muscle dysfunction, and neurological abnormalities. DM is the most common form of adult-onset muscular dystrophy, with a global incidence of approximately 1 in 8000 people worldwide. Two types of the disease have been described: myotonic dystrophy type 1 (DM1) and myotonic dystrophy type 2 (DM2). DM1, the more common form of the disease, results from a repeat expansion of a CTG trinucleotide repeat in the 3' noncoding region of DMPK on chromosome 19; DM2 results from a repeat expansion of a CCTG tetranucleotide repeat in the first intron of ZNF9 on chromosome 3. Repeat expansions of CTG trinucleotide repeats in DM1 patients, which may contain more than about 50 to about 3,000 or more total repeats, lead to the generation of toxic RNA repeats that can form hairpin structures that bind with high affinity to essential intracellular proteins (e.g., muscleblind-like protein), resulting in protein sequestration and the loss-of-function phenotype characteristic of the disease. Apart from supportive care and treatments to address the symptoms of the disease, no effective therapeutic for DM1 is currently available. Summary of the Invention

[0005] overview According to some aspects, the disclosure provides methods (e.g., methods of delivering an oligonucleotide to a subject, methods of administering a conjugate to a subject, methods of reducing expression or activity of DMPK in a subject, and / or methods of treating myotonic dystrophy (e.g., DM1) in a subject) comprising administering to the subject a composition comprising an effective amount of a conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides.

[0006] According to some aspects, methods of reducing DMPK expression in a subject provided herein include administering to the subject a composition comprising an effective amount of a conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, where the effective amount provides the subject with between 5 mg and 110 mg of anti-TfR1 antibody per kg of the subject, wherein the antibody comprises the following: heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NO: 1, 7, or 12; heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NO: 2, 8, or 13; (CDR-H2), heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14, light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide of the conjugate comprises the nucleobase sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21).

[0007] In some embodiments, the oligonucleotide of the conjugate comprises a 5'-XYZ-3' configuration, where X and Z are flanking regions comprising one or more modified nucleosides, and Y is a gap region comprising one or more 2'-deoxyribonucleosides.

[0008] In some embodiments, each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein the structure is: Each R 1 is represented by formula (Ia): [ka] In the formula R 3comprises an oligonucleotide comprising the nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:21) and comprises a structure represented by +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO:21), where +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents a 5-methyl-2'-MOE-cytidine, +C represents a 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents a 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage: R in the formula 2 comprises an anti-TfR1 antibody; and wherein in each complex, n1 is independently R 1 is an integer greater than or equal to 1 that represents the number of instances of 1 Each instance of is covalently linked to a different lysine of the anti-TfR1 antibody via attachment point A. In some embodiments, the average value of n1 of the conjugates of the composition is in the range of 0.5-5.

[0009] In some embodiments, each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein the structure is: Each R 1 is represented by formula (Ib): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents a 5-methyl-2'-MOE-cytidine, +C represents a 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents a 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage, and R1 The oligonucleotide comprises the nucleobase sequence CAGCGCCCACCAGUCA (SEQ ID NO: 21); R in the formula 2 comprises an anti-TfR1 antibody; and wherein n1 in each complex is independently R 1 is an integer equal to or greater than 1 that represents the number of instances of 1 Each instance of is covalently linked to a different lysine of the anti-TfR1 antibody via attachment point A. In some embodiments, the average value of n1 of the conjugates of the composition is in the range of 0.5-5.

[0010] In some embodiments, each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein the structure is: Each R 1 is represented by the formula (Ic): [ka]

[0043] R in the formula 2 comprises an anti-TfR1 antibody; and wherein n1 in each complex is independently R 1 is an integer equal to or greater than 1 that represents the number of instances of 1 Each instance of is covalently linked to a different lysine of the anti-TfR1 antibody via attachment point A. In some embodiments, the average value of n1 of the conjugates of the composition is in the range of 0.5-5.

[0011] In some embodiments, each conjugate has formula (Id): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents a 5-methyl-2'-MOE-cytidine, +C represents a 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents a 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage, and R 1 The oligonucleotide comprises the nucleobase sequence CAGCGCCCACCAGUCA (SEQ ID NO: 21); R in the formula 2 comprises an anti-TfR1 antibody; and wherein in each complex, n1 is independently R 1 is an integer equal to or greater than 1 that represents the number of instances of 1 Each instance of is covalently linked to a different lysine of the anti-TfR1 antibody via attachment point A. In some embodiments, the average value of n1 of the conjugates of the composition is in the range of 0.5-5.

[0012] In some embodiments, the anti-TfR1 antibody is a Fab fragment.

[0013] In some embodiments, the anti-TfR1 antibody comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 17 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, the anti-TfR1 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO:20.

[0014] In some embodiments, the administration occurs one or more times.

[0015] In some embodiments, an effective amount of each administration provides between 10 mg and 110 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0016] In some embodiments, an effective amount of each administration provides between 5 mg and 90 mg of anti-TfR1 antibody per kg of subject of the conjugate.

[0017] In some embodiments, an effective amount of each administration provides between 10 mg and 20 mg of anti-TfR1 antibody per kg of subject of the conjugate.

[0018] In some embodiments, an effective amount of each administration provides 13 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0019] In some embodiments, an effective amount of each administration provides between 18 mg and 36 mg of anti-TfR1 antibody per kg of subject of the conjugate.

[0020] In some embodiments, an effective amount of each administration provides 25 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0021] In some embodiments, an effective amount of each administration provides between 36 mg and 72 mg of anti-TfR1 antibody per kg of subject of the conjugate.

[0022] In some embodiments, an effective amount of each administration provides 50 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0023] In some embodiments, an effective amount of each administration provides between 55 mg and 110 mg of anti-TfR1 antibody of the conjugate to the subject per kg of subject.

[0024] In some embodiments, an effective amount of each administration provides 75 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0025] In some embodiments, an effective amount of each administration provides between 6 mg and 12 mg of anti-TfR1 antibody per kg of subject of the conjugate.

[0026] In some embodiments, an effective amount of each administration provides 8 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0027] In some embodiments, an effective amount of each administration provides between 11 mg and 22 mg of anti-TfR1 antibody per kg of subject of the conjugate.

[0028] In some embodiments, an effective amount of each administration provides 15 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0029] In some embodiments, an effective amount of each administration provides between 22 mg and 44 mg of anti-TfR1 antibody per kg of subject of the conjugate.

[0030] In some embodiments, an effective amount of each administration provides 30 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0031] In some embodiments, an effective amount of each administration provides between 44 mg and 88 mg of anti-TfR1 antibody per kg of subject of the conjugate.

[0032] In some embodiments, an effective amount of each administration provides 60 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0033] In some embodiments, an effective amount of each administration provides 20 mg to 43 mg of anti-TfR1 antibody per kg of subject of the conjugate to the subject. In some embodiments, an effective amount of each administration provides 29 mg of anti-TfR1 antibody per kg of subject of the conjugate to the subject.

[0034] In some embodiments, an effective amount of each administration provides between 26 mg and 53 mg of anti-TfR1 antibody per kg of subject of the conjugate.

[0035] In some embodiments, an effective amount of each administration provides 37 mg of anti-TfR1 antibody of the conjugate to the subject per kg of the subject.

[0036] In some embodiments, during the administration period, the composition is administered once every 4 weeks, once every 8 weeks, or once every 12 weeks. In some embodiments, the administration period is less than 10 years. In some embodiments, the administration period is the remaining life span of the subject.

[0037] In some embodiments, the composition is administered once every 4 weeks during a first dosing period, followed by once every 8 weeks during a second dosing period, in some embodiments, the first dosing period is from 8 to 16 weeks, and / or the second dosing period is from 16 weeks to the remaining life of the subject.

[0038] In some embodiments, the composition is in the form of an aqueous solution and further comprises tris(hydroxymethyl)aminomethane and sucrose. In some embodiments, the tris(hydroxymethyl)aminomethane is present in the aqueous solution at a concentration of 25 mM, the sucrose is present in the aqueous solution at a concentration of 10 w / v%, and the aqueous solution is at a pH of 7.5. In some embodiments, the complex is present in the composition at a concentration ranging from 10 mg / mL to 50 mg / mL.

[0039] In some embodiments, administration reduces DMPK expression in muscle cells of the subject.In some embodiments, reducing DMPK expression comprises reducing the amount of DMPK RNA in muscle cells.In some embodiments, DMPK RNA amount is reduced in the nucleus of muscle cells.

[0040] In some embodiments, reducing DMPK expression in a muscle cell comprises reducing the amount of DMPK protein in the muscle cell.

[0041] In some embodiments, the subject is a human.

[0042] In some embodiments, the complex is administered systemically. In some embodiments, the complex is administered intravenously. In some embodiments, the complex is administered by infusion.

[0043] In some embodiments, the composition further comprises one or more anti-TfR1 antibodies that are not covalently linked to the oligonucleotide. [Brief description of the drawings]

[0044] BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1] Figures 1A-1D show the amount of DMPK-targeted oligonucleotide (ASO) in the heart (Figure 1A), diaphragm (Figure 1B), gastrocnemius muscle (Figure 1C), or tibialis anterior muscle (Figure 1D), respectively, after administration of a conjugate containing an anti-TfR1 Fab covalently linked to the ASO.

[0045] [Diagram 2] Figures 2A-2D show the ability of a conjugate containing an anti-TfR1 Fab conjugated to a DMPK-targeting oligonucleotide (ASO) to knockdown human DMPK RNA in the heart (Figure 2A), diaphragm (Figure 2B), tibialis anterior (Figure 2C), and gastrocnemius (Figure 2D) muscles of mice expressing both human TfR1 and two copies of a mutant human DMPK transgene carrying an expanded CTG repeat.

[0046] [Diagram 3]Figures 3A-3B show reduced DMPK foci in the nuclei of cardiac muscle fibers in mice expressing both human TfR1 and two copies of a mutant human DMPK transgene carrying an expanded CTG repeat and treated with anti-TfR1 Fab conjugated to a DMPK-targeting oligonucleotide (ASO). Figure 3A shows a representative image of a sample after in situ hybridization staining for DMPK foci and fluorescent staining of myofibrils (insert panel). In the microscopic image shown in Figure 3A, the bright round shapes indicate cell nuclei and the bright puncta within the nucleus indicate DMPK foci. Figure 3B shows the quantification of DMPK foci.

[0047] [Figure 4] 4 shows the splicing correction activity of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) in the hearts of mice expressing both human TfR1 and two copies of a mutant human DMPK transgene carrying an expanded CTG repeat (hTfR1 / DMSXL mice). A composite splicing index based on splicing of Ldb3 exon 11, Mbnl2 exon 6, and Nfix exon 7 is shown for control mice treated with vehicle control ("hTfR1-PBS"), hTfR1 / DMSXL mice treated with vehicle control ("hTfR1 / DMSXL-PBS"), and hTfR1 / DMSXL mice treated with anti-TfR1 Fab-ASO conjugate ("hTfR1 / DMSXL-conjugate").

[0048] [Diagram 5]5 shows the splicing correction activity of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) in the diaphragm of mice expressing both human TfR1 and two copies of a mutant human DMPK transgene carrying an expanded CTG repeat (hTfR1 / DMSXL mice). A composite splicing index based on the splicing of Bin1 exon 11, Insr exon 11, Ldb3 exon 11, and Nfix exon 7 is shown for control mice treated with vehicle control ("hTfR1-PBS"), hTfR1 / DMSXL mice treated with vehicle control ("hTfR1 / DMSXL-PBS"), and hTfR1 / DMSXL mice treated with anti-TfR1 Fab-ASO conjugate ("hTfR1 / DMSXL-conjugate").

[0049] [Figure 6] 6 shows the splicing correction activity of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) in the tibialis anterior muscle of mice expressing both human TfR1 and two copies of a mutant human DMPK transgene carrying an expanded CTG repeat (hTfR1 / DMSXL mice). A composite splicing index based on the splicing of Bin1 exon 11, Ldb3 exon 11, Mbnl2 exon 6, and Nfix exon 7 is shown for control mice treated with vehicle control ("hTfR1-PBS"), hTfR1 / DMSXL mice treated with vehicle control ("hTfR1 / DMSXL-PBS"), and hTfR1 / DMSXL mice treated with anti-TfR1 Fab-ASO conjugate ("hTfR1 / DMSXL-conjugate").

[0050] [Figure 7]7 shows the splicing correction activity of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) in the gastrocnemius muscle of mice expressing both human TfR1 and two copies of a mutant human DMPK transgene carrying an expanded CTG repeat (hTfR1 / DMSXL mice). A composite splicing index based on the splicing of Mbnl2 exon 6, Nfix exon 7, and Ttn exon 313 is shown for control mice treated with vehicle control ("hTfR1-PBS"), hTfR1 / DMSXL mice treated with vehicle control ("hTfR1 / DMSXL-PBS"), and hTfR1 / DMSXL mice treated with anti-TfR1 Fab-ASO conjugate ("hTfR1 / DMSXL-conjugate").

[0051] [Figure 8] Figure 8 shows DMPK knockdown in DM1 patient myotubes and wild-type non-human primate (NHP) myotubes following incubation with a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO). Results are shown normalized to expression in DM1 patient myotubes or NHP myotubes treated with vehicle alone. Data are shown as mean + standard deviation for n=4 replicates per condition. Statistics were calculated by one-way ANOVA (*, P<0.05; **, P<0.01).

[0052] [Figure 9-1]Figures 9A-9D show DMPK expression in the heart (Figure 9A), diaphragm (Figure 9B), tibialis anterior (Figure 9C), or gastrocnemius (Figure 9D) muscles of mice over a 12-week period following administration of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO. DMPK expression is compared to expression in vehicle-treated animals. Data are also presented as mean ± standard deviation for n = 5-12 replicates per tissue. Statistics were calculated by ANOVA followed by uncorrected Fisher's least significant difference test (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001). [Figure 9-2] Figures 9A-9D show DMPK expression in the heart (Figure 9A), diaphragm (Figure 9B), tibialis anterior (Figure 9C), or gastrocnemius (Figure 9D) muscles of mice over a 12-week period following administration of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO. DMPK expression is compared to expression in vehicle-treated animals. Data are also presented as mean ± standard deviation for n = 5-12 replicates per tissue. Statistics were calculated by ANOVA followed by uncorrected Fisher's least significant difference test (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

[0053] [Figure 10-1]Figures 10A-10D show tissue DMPK expression in the heart (Figure 10A), diaphragm (Figure 10B), tibialis anterior (Figure 10C), or gastrocnemius (Figure 10D) of mice following administration of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO. The conjugate was administered as either a single 10 mg / kg ASO-equivalent dose ("10"), two 5 mg / kg ASO-equivalent doses spaced one week apart ("2x5 weekly"), or two 5 mg / kg ASO-equivalent doses spaced two weeks apart ("2x5 biweekly"). Tissue DMPK levels were measured 4 weeks after administration of the final dose. The tissue DMPK levels are presented relative to vehicle-treated controls ("vehicle"). Data are also presented as mean ± standard deviation for n=3-6 replicates per tissue. Statistics were calculated by one-way ANOVA (*, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001). [Figure 10-2] Figures 10A-10D show tissue DMPK expression in the heart (Figure 10A), diaphragm (Figure 10B), tibialis anterior (Figure 10C), or gastrocnemius (Figure 10D) of mice following administration of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO. The conjugate was administered as either a single 10 mg / kg ASO-equivalent dose ("10"), two 5 mg / kg ASO-equivalent doses spaced one week apart ("2x5 weekly"), or two 5 mg / kg ASO-equivalent doses spaced two weeks apart ("2x5 biweekly"). Tissue DMPK levels were measured 4 weeks after administration of the final dose. The tissue DMPK levels are presented relative to vehicle-treated controls ("vehicle"). Data are also presented as mean ± standard deviation for n=3-6 replicates per tissue. Statistics were calculated by one-way ANOVA (*, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0054] [Figure 11]11A-11D show DMPK expression in the heart (FIG. 11A), diaphragm (FIG. 11B), tibialis anterior (FIG. 11C), or gastrocnemius (FIG. 11D) of mice after administration of various dosages of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO. The conjugate was administered as either a single 5 mg / kg ASO equivalent dose ("5"), a single 10 mg / kg ASO equivalent dose ("10"), or a single 20 mg / kg ASO equivalent dose ("20"), 4 weeks after tissue DMPK levels were measured. Data are shown as mean + standard deviation and presented relative to vehicle-treated controls ("Vehicle"). Statistics were calculated by one-way ANOVA with Dunnett's post-hoc analysis (*, P<0.05; **, P<0.01; ***, P<0.001).

[0055] [Figure 12] 12A-12D show DMPK expression in the heart (FIG. 12A), diaphragm (FIG. 12B), tibialis anterior (FIG. 12C), or gastrocnemius (FIG. 12D) of mice after administration of varying doses of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO. The conjugate was administered as either two 5 mg / kg ASO-equivalent doses administered one week apart ("2x5"), or two 10 mg / kg ASO-equivalent doses administered one week apart ("2x10"). Tissue DMPK levels were measured 4 weeks after administration of the first dose. The tissue DMPK levels are presented relative to vehicle-treated controls ("vehicle"). Data are also presented as mean ± standard deviation for n=5-6 replicates per tissue. Statistics were calculated by Brown-Forsythe and Welch ANOVA tests together with Dunnett's T3 multiple comparison test (*, P<0.05; **, P<0.01; ****, P<0.0001).

[0056] [Figure 13]Figures 13A-13D show DMPK expression in the heart (Figure 13A), diaphragm (Figure 13A), tibialis anterior (Figure 13C), or gastrocnemius (Figure 13D) of mice following administration of various dosages of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO. The conjugate was administered as four 5 mg / kg ASO-equivalent doses ("4x5") or four 10 mg / kg ASO-equivalent doses ("4x10"), with each dose administered 4 weeks apart (on days 0, 28, 56, and 84, respectively). Data are presented as mean + standard deviation (n=6 mice per group). Statistics were calculated by one-way ANOVA followed by uncorrected Fisher's least significant difference (LSD) test (*, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001).

[0057] [Figure 14] Figures 14A-14B show DMPK expression in gastrocnemius (Figure 14A) and tibialis anterior (Figure 14B) muscles of non-human primates after administration of 10 mg / kg ASO equivalent of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO. Tissue DMPK levels were measured 4, 8, and 12 weeks after administration of the conjugate. The tissue DMPK levels are presented relative to vehicle-treated controls. Data are presented as mean ± standard deviation. Statistics were calculated by unpaired t-test (*, P<0.05).

[0058] [Figure 15]Figures 15A-15D show DMPK expression in the heart (Figure 15A), diaphragm (Figure 15B), tibialis anterior (Figure 15C), or gastrocnemius (Figure 15D) of non-human primate animals following administration of 5 mg / kg ("5") or 10 mg / kg ("10") ASO-equivalent of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO, respectively. Following administration of either a single 5 mg / kg ASO-equivalent dose or a single 10 mg / kg ASO-equivalent dose to a non-human primate animal model, tissue DMPK levels were measured 4 weeks later. The tissue DMPK levels are presented relative to a vehicle-treated control group ("vehicle"). Data are presented as mean + standard deviation. Statistics were calculated by one-way ANOVA (*, P<0.05; **, P<0.01).

[0059] [Figure 16-1] 16A-16G show DMPK expression in the heart (FIG. 16A), diaphragm (FIG. 16B), tibialis anterior (FIG. 16C), gastrocnemius (FIG. 16D), masseter (FIG. 16E), esophagus (FIG. 16F), or duodenum (FIG. 16G) of non-human primate animals after administration of either two 5 mg / kg ASO-equivalent doses ("2x5") or two 10 mg / kg ASO-equivalent doses ("2x10") of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO, respectively. After administration of either two 5 mg / kg ASO-equivalent doses or two 10 mg / kg ASO-equivalent doses, each 4 weeks apart, to a non-human primate animal model, tissue DMPK levels were measured 4 weeks after the last dose. The tissue DMPK levels are presented relative to a vehicle-treated control group ("vehicle"). Data are presented as mean + standard deviation. Statistics were calculated by one-way ANOVA followed by uncorrected Fisher's least significant difference (LSD) test (*, P<0.05; **, P<0.01; ***, P<0.001). [Figure 16-2]16A-16G show DMPK expression in the heart (FIG. 16A), diaphragm (FIG. 16B), tibialis anterior (FIG. 16C), gastrocnemius (FIG. 16D), masseter (FIG. 16E), esophagus (FIG. 16F), or duodenum (FIG. 16G) of non-human primate animals after administration of either two 5 mg / kg ASO-equivalent doses ("2x5") or two 10 mg / kg ASO-equivalent doses ("2x10") of a conjugate containing an anti-TfR1 Fab covalently linked to a DMPK-targeting ASO, respectively. After administration of either two 5 mg / kg ASO-equivalent doses or two 10 mg / kg ASO-equivalent doses, each 4 weeks apart, to a non-human primate animal model, tissue DMPK levels were measured 4 weeks after the last dose. The tissue DMPK levels are presented relative to a vehicle-treated control group ("vehicle"). Data are presented as mean + standard deviation. Statistics were calculated by one-way ANOVA followed by uncorrected Fisher's least significant difference (LSD) test (*, P<0.05; **, P<0.01; ***, P<0.001). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0060] Detailed Description of the Invention According to some aspects, the disclosure provides a method of reducing expression or activity of DMPK (e.g., reducing levels of mutant or wild-type DMPK RNA) and / or treating myotonic dystrophy (e.g., DM1) in a subject. In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of muscle-targeting complexes, each complex comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides to the subject 0.5 mg to 20 mg (e.g., about 1 mg to about 12 mg, about 1.8 mg, about 3.4 mg, about 6.8 mg, or about 10.2 mg) of oligonucleotide per kg of the subject. In some embodiments, an effective amount provides to the subject about 4 mg or about 5 mg of oligonucleotide per kg of the subject of the complex. In some embodiments, the effective amount provides the subject with 2 mg to 220 mg (e.g., about 5 mg to about 110 mg, about 13 mg, about 25 mg, about 50 mg, or about 75 mg) of anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the effective amount provides the subject with about 29 mg or about 37 mg of anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, administration is once every 2 weeks to once every 12 weeks (e.g., once every 2 weeks, once every 4 weeks, once every 8 weeks, or once every 12 weeks). In some embodiments, the subject has a DMPK allele associated with DM1 (e.g., where the DMPK allele comprises a DM1 disease-associated repeat expansion). Further aspects of the disclosure, including descriptions of defined terms, are provided below.

[0061] definition

[0062] Administering: As used herein, the term "administering" or "administration" means providing a conjugate to a subject in a physiologically and / or (for example and) pharmacologically useful manner (for example, to treat a disease in a subject).

[0063] Approximately: As used herein, the term "approximately" or "about" when applied to one or more values ​​of interest, refers to a value similar to a stated reference value. In certain embodiments, the term "approximately" or "about" refers to a broad range of values ​​that fall within plus or minus (greater or less than) 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the stated reference value, unless otherwise stated or clear from the context (except where such number would exceed 100% of a feasible value).

[0064] Antibody: As used herein, the term "antibody" refers to a polypeptide that includes at least one immunoglobulin variable domain or at least one antigenic determinant, e.g., a paratope, that specifically binds to an antigen. In some embodiments, the antibody is a full-length antibody. In some embodiments, the antibody is a chimeric antibody. In some embodiments, the antibody is a humanized antibody. However, in some embodiments, the antibody is a Fab fragment, a Fab' fragment, a F(ab')2 fragment, an Fv fragment, or an scFv fragment. In some embodiments, the antibody is a nanobody derived from a camelid antibody, or a nanobody derived from a shark antibody. In some embodiments, the antibody is a diabody. In some embodiments, the antibody comprises a framework with human germline sequences. In another embodiment, the antibody comprises a heavy chain constant region selected from the group consisting of the constant regions of IgG, IgG1, IgG2, IgG2A, IgG2B, IgG2C, IgG3, IgG4, IgA1, IgA2, IgD, IgM, and IgE. In some embodiments, the antibody comprises a heavy (H) chain variable region (abbreviated herein as VH) and / or (for example and) a light (L) chain variable region (abbreviated herein as VL). In some embodiments, the antibody comprises a constant region, for example an Fc region. An immunoglobulin constant region refers to the constant region of a heavy or light chain. The constant region amino acid sequences of human IgG heavy and light chains and their functional variations are known. With respect to the heavy chain, in some embodiments, the heavy chain of the antibody described herein can be an alpha (α), delta (Δ), epsilon (ε), gamma (γ), or mu (μ) heavy chain. In some embodiments, the heavy chain of the antibody described herein can comprise a human alpha (α), delta (Δ), epsilon (ε), gamma (γ), or mu (μ) heavy chain. In specific embodiments, the antibody described herein comprises a human gamma 1 CH1 domain, CH2 domain, and / or (for example and) CH3 domain. In some embodiments, the amino acid sequence of the VH domain comprises the amino acid sequence of a human gamma (γ) heavy chain constant region, such as any known in the art.In some embodiments, the amino acid sequence of the VH domain comprises the amino acid sequence of a human gamma (γ) heavy chain constant region, such as any known in the art. Non-limiting examples of human constant region sequences are described in the art, see, for example, U.S. Pat. No. 5,693,780 and Kabat EA et al., (1991), supra. In some embodiments, the VH domain comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or at least 99% identical to any of the variable chain constant regions provided herein. In some embodiments, the antibody is modified, for example, via glycosylation, phosphorylation, sumoylation, and / or (for example, and) methylation. In some embodiments, the antibody is a glycosylated antibody conjugated to one or more sugar or carbohydrate molecules. In some embodiments, one or more sugar or carbohydrate molecules are conjugated to the antibody via N-glycosylation, O-glycosylation, C-glycosylation, glypiation (GPI anchor attachment), and / or (by way of example and) phosphoglycosylation. In some embodiments, the one or more sugar or carbohydrate molecules are monosaccharides, disaccharides, oligosaccharides, or glycans. In some embodiments, the one or more sugar or carbohydrate molecules are branched oligosaccharides or branched glycans. In some embodiments, the one or more sugar or carbohydrate molecules include mannose units, glucose units, N-acetylglucosamine units, N-acetylgalactosamine units, galactose units, fucose units, or phospholipid units. In some embodiments, the antibody is a construct comprising a linker polypeptide or a polypeptide comprising one or more antigen-binding fragments of the present disclosure linked to an immunoglobulin constant region. The linker polypeptide comprises two or more amino acid residues linked together by peptide bonds and is used to link one or more antigen-binding moieties.Examples of linker polypeptides have been reported (see, e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, RJ, et al. (1994) Structure 2:1121-1123). Still further, an antibody may be part of a larger immunoadhesion molecule formed by covalent or noncovalent association of the antibody or antibody portion with one or more other proteins or peptides. Examples of such immunoadhesion molecules include the use of streptavidin core regions to generate tetrameric scFv molecules (Kipriyanov, SM, et al. (1995) Human Antibodies and Hybridomas 6:93-101), and the use of cysteine ​​residues, marker peptides, and C-terminal polyhistidine tags to generate bivalent and biotinylated scFv molecules (Kipriyanov, SM, et al. (1994) Mol. Immunol. 31:1047-1058).

[0065] CDR: As used herein, the term "CDR" refers to a complementarity determining region within an antibody variable sequence. A typical antibody molecule contains a heavy chain variable region (VH) and a light chain variable region (VL), which are mostly involved in antigen binding. The VH and VL regions can be further subdivided into hypervariable regions, also known as "complementarity determining regions" ("CDRs"), interspersed with more conserved regions known as "framework regions" ("FRs"). Each VH and VL is typically composed of three CDRs and four FRs arranged from amino terminus to carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The extent of the framework regions and CDRs can be precisely identified using methodologies known in the art, for example, by the Kabat definition, the IMGT definition, the Chothia definition, the AbM definition, and / or (for example) the contact definition, all of which are well known in the art. See, for example, Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US. The extent of framework regions and CDRs can be precisely identified using methodologies known in the art, for example, by the Kabat definition, the IMGT definition, the Chothia definition, the AbM definition, and / or (for example, and) the contact definition, all of which are well known in the art. The extent of framework regions and CDRs can be precisely identified using methodologies known in the art, for example, by the Kabat definition, the IMGT definition, the Chothia definition, the AbM definition, and / or (for example, and) the contact definition, all of which are well known in the art.(1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US (1987) J. Mol. Biol. 196: 901-917, Al-lazikani et al (1997) J. Molec. 17: 132-143 (2004). See also hgmp.mrc.ac.uk and bioinf.org.uk / abs. As used herein, CDR may refer to a CDR defined by any method known in the art. Two antibodies with the same CDR means that the two antibodies have the same amino acid sequence of the CDR when determined by the same method, for example, the IMGT definition.

[0066] There are three CDRs in each of the variable regions of heavy and light chains, which are designated as CDR1, CDR2, and CDR3 for each of the variable regions. The term "CDR set" as used herein refers to a group of three CDRs that occur in a single variable region that can bind to antigen. The exact boundaries of these CDRs are defined differently according to various systems. The system described by Kabat (Kabat et al., Sequence of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md. (1987) and (1991)) not only provides an unambiguous residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries defining the three CDRs. These CDRs are sometimes referred to as Kabat CDRs. Sub-portions of the CDRs are sometimes designated L1, L2, and L3, or H1, H2, and H3, where "L" and "H" designate the light chain and heavy chain regions, respectively. These regions are sometimes referred to as Chothia CDRs, which have boundaries that overlap with the Kabat CDRs. Other boundaries defining CDRs that overlap with the Kabat CDRs are described by Padlan (FASEB J. 9:133-139 (1995)) and MacCallum (J Mol Biol 262(5):732-45(1996)). Still other CDR boundary definitions may not strictly adhere to one of the above systems, but may still overlap with the Kabat CDRs, and may be shortened or extended in light of predictions or experimental findings that specific residues or groups of residues, or even entire CDRs, do not significantly affect antigen binding. The methods used herein may utilize CDRs defined according to any of these systems. Examples of CDR definition systems are provided in Table 1. [Table 1]

[0067] Complementary: As used herein, the term "complementary" refers to the ability for precise pairing between two nucleotides or two sets of nucleotides. In particular, complementary is a term that characterizes the degree of hydrogen bond pairing that results in binding between two nucleotides or two sets of nucleotides. For example, if a base at a position of an oligonucleotide can hydrogen bond with a base at a corresponding position of a target nucleic acid (e.g., mRNA), then the bases are considered to be complementary to each other at that position. Base pairing may include both canonical Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). For example, in some embodiments, for complementary base pairing, an adenosine-based base (A) is complementary to a thymidine-based base (T) or a uracil-based base (U), a cytosine-based base (C) is complementary to a guanosine-based base (G), and a universal base such as 3-nitropyrrole or 5-nitroindole can hybridize to and is considered complementary to any A, C, U, or T. Inosine (I) is also considered a universal base in the art and is considered complementary to any A, C, U, or T.

[0068] Covalently linked: As used herein, the term "covalently linked" refers to the characteristic of two or more molecules being linked together through at least one covalent bond. In some embodiments, the two molecules may be covalently linked together by a single bond (e.g., a disulfide bond or a disulfide bridge) that acts as an intermolecular linker. However, in some embodiments, the two or more molecules may be covalently linked together through a molecule that acts as a linker that connects the two or more molecules together through multiple covalent bonds. In some embodiments, the linker may be a cleavable linker. However, in some embodiments, the linker may be a non-cleavable linker.

[0069] Disease-associated repeats: As used herein, the term "disease-associated repeats" refers to repeated nucleotide sequences at genomic locations where the number of units of the repeated nucleotide sequence correlates with and / or (by way of example) directly or indirectly contributes to or causes a genetic disease. Each repeat unit of a disease-associated repeat may be 2, 3, 4, 5, or more nucleotides in length. For example, in some embodiments, the disease-associated repeat is a dinucleotide repeat. In some embodiments, the disease-associated repeat is a trinucleotide repeat. In some embodiments, the disease-associated repeat is a tetranucleotide repeat. In some embodiments, the disease-associated repeat is a pentanucleotide repeat. In some embodiments, the disease-associated repeat comprises a CAG repeat, a CTG repeat, a CUG repeat, a CGG repeat, a CCTG repeat, or the nucleotide complement of any thereof. In some embodiments, the disease-associated repeat is in a non-coding portion of a gene. However, in some embodiments, the disease-associated repeat is in a coding region of a gene. In some embodiments, the disease-associated repeat is extended from a normal state to a length that directly or indirectly contributes to or causes a genetic disease. In some embodiments, the disease-associated repeats are in RNA (e.g., RNA transcripts). In some embodiments, the disease-associated repeats are in DNA (e.g., chromosomes, plasmids). In some embodiments, the disease-associated repeats are expanded in a chromosome of a germline cell. In some embodiments, the disease-associated repeats are expanded in a chromosome of a somatic cell. In some embodiments, the disease-associated repeats are expanded to a number of repeat units associated with congenital onset of the disease. In some embodiments, the disease-associated repeats are expanded to a number of repeat units associated with childhood onset of the disease. In some embodiments, the disease-associated repeats are expanded to a number of repeat units associated with adult onset of the disease. In DM1, the DMPK gene comprises a disease-associated repeat of a CTG unit.

[0070] DMPK: As used herein, the term "DMPK" refers to the gene encoding myotonin protein kinase (also known as myotonic dystrophy protein kinase or myotonic dystrophy protein kinase), a serine / threonine protein kinase. Substrates of this enzyme may include myogenin, beta-subunit of L-type calcium channel, and phospholemman. In some embodiments, DMPK may be a human gene (Gene ID:1760), a non-human primate gene (e.g., Gene ID:456139, Gene ID:715328, Gene ID:102125829), or a rodent gene (e.g., Gene ID:13400). In humans, a CTG repeat expansion in the 3' non-coding untranslated region of DMPK is associated with myotonic dystrophy type I (DM1). In addition, multiple human transcript variants (e.g., as annotated under GenBank RefSeq accession numbers: NM_001081563.2, NM_004409.4, NM_001081560.2, NM_001081562.2, NM_001288764.1, NM_001288765.1, and NM_001288766.1) have been characterized that encode various protein isoforms.

[0071] DMPK allele: As used herein, the term "DMPK allele" refers to any one of the alternative forms (e.g., wild-type or mutant forms) of the DMPK gene. In some embodiments, the DMPK allele may encode a wild-type myotonin protein kinase that retains its normal and typical function. In some embodiments, the DMPK allele may contain one or more disease-associated repeat expansions. In some embodiments, a normal subject has two DMPK alleles with repeat units ranging from 5 to 37. In some embodiments, the number of CTG repeat units in subjects with DM1 ranges from about 50 to about 3,000 or more, with higher repeat numbers being associated with increased disease severity. In some embodiments, a mildly affected DM1 subject has at least one DMPK allele with repeat units ranging from 50 to 150. In some embodiments, a subject with classical DM1 has at least one DMPK allele with repeat units ranging from 100 to 1,000 or more. In some embodiments, subjects who have DM1 and are congenitally affected may have at least one DMPK allele that contains more than 2,000 repeat units.

[0072] Framework: As used herein, the term "framework" or "framework sequence" refers to the remaining sequence of the variable region minus the CDRs. Since the exact definition of the CDR sequence can be determined by different systems, the meaning of the framework sequence is subject to correspondingly different interpretations. The six CDRs (CDR-L1, CDR-L2, and CDR-L3 of the light chain, and CDR-H1, CDR-H2, and CDR-H3 of the heavy chain) also divide the framework region on the light chain and the heavy chain into four subregions (FR1, FR2, FR3, and FR4) on each chain, where CDR1 is located between FR1 and FR2, CDR2 is located between FR2 and FR3, and CDR3 is located between FR3 and FR4. The framework region as referred to by others, without specifying the specific subregion as FR1, FR2, FR3, or FR4, represents the FR(s) combined in the variable region of a naturally occurring single immunoglobulin chain. As used herein, FR refers to one of the four subregions, and FR refers to two or more of the four subregions that contain framework regions. Acceptor sequences for human heavy and light chains are known in the art. In one embodiment, acceptor sequences known in the art may be used in the antibodies disclosed herein.

[0073] Human antibody: The term "human antibody" as used herein is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the present disclosure may include amino acid residues (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), e.g., in the CDRs, particularly in CDR3, that are not encoded by human germline immunoglobulin sequences. However, the term "human antibody" as used herein is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, are grafted onto human framework sequences.

[0074] Humanized antibody: The term "humanized antibody" refers to an antibody that contains heavy and light chain variable region sequences from a non-human species (e.g., mouse), but in which at least a portion of the VH and / or (e.g., and) VL sequences have been altered to be more "human-like", i.e., more similar to human germline variable sequences. One type of humanized antibody is a CDR-grafted antibody in which human CDR sequences are introduced onto non-human VH and VL sequences, thereby replacing the corresponding non-human CDR sequences. In one embodiment, humanized anti-transferrin receptor antibodies and antigen-binding portions are provided. Such antibodies may be produced by using existing hybridoma technology followed by humanization using in vitro genetic engineering, such as that disclosed in PCT Publication No. WO 2005 / 123126 A2 to Kasaian et al., to obtain a mouse anti-transferrin receptor monoclonal antibody.

[0075] Kabat numbering: The terms "Kabat numbering", "Kabat definition" and "Kabat labeling" are used interchangeably herein. These terms are recognized in the art and refer to a system of numbering amino acid residues that are more variable (i.e., more variable) than other amino acid residues in the variable regions of the heavy and light chains of an antibody or its antigen-binding portion (Kabat et al. (1971) Ann. NY Acad, Sci. 190: 382-391 and Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, USDepartment of Health and Human Services, NIH Publication No. 91-3242). For the heavy chain variable region, the hypervariable region extends from amino acid position 31 to 35 for CDR1, from amino acid position 50 to 65 for CDR2, and from amino acid position 95 to 102 for CDR3. For the light chain variable region, the hypervariable region ranges from amino acid positions 24 to 34 for CDR1, from amino acid positions 50 to 56 for CDR2, and from amino acid positions 89 to 97 for CDR3.

[0076] Myotonic dystrophy (DM): As used herein, the term "myotonic dystrophy (DM)" refers to a genetic disease caused by mutations in the DMPK gene or the CNBP (ZNF9) gene, characterized by muscle loss, muscle weakness, and muscle function. Two types of the disease have been described: myotonic dystrophy type 1 (DM1) and myotonic dystrophy type 2 (DM2). DM1 is associated with an expansion of a CTG trinucleotide repeat in the 3' non-coding region of DMPK. DM2 is associated with an expansion of a CCTG tetranucleotide repeat in the first intron of ZNF9. In both DM1 and DM2, the nucleotide expansion leads to a toxic RNA repeat that can form a hairpin structure that binds with high affinity to critical intracellular proteins, such as muscleblind-like protein. Myotonic dystrophy, the genetic basis of the disease and associated symptoms are described in the art (see, e.g., Thornton, CA, "Myotonic Dystrophy" Neurol Clin. (2014), 32(3):705-719.; and Konieczny et al. "Myotonic dystrophy: candidate small molecule therapeutics" Drug Discovery Today (2017), 22:11). In some embodiments, the subject is born with a variation of DM1, called congenital myotonic dystrophy. Symptoms of congenital myotonic dystrophy are present from birth and include all muscle weakness, breathing problems, clubfoot, developmental delay, and intellectual disability. DM1 is associated with Online Mendelian Inheritance in Man (OMIM) Entry #160900. DM2 is associated with OMIM Entry #602668.

[0077] Oligonucleotide: As used herein, the term "oligonucleotide" refers to an oligomeric nucleic acid compound up to 200 nucleotides in length. Examples of oligonucleotides include, but are not limited to, RNAi oligonucleotides (e.g., siRNA, shRNA), microRNA, gapmers, mixmers, phosphorodiamidate morpholinos, peptide nucleic acids, aptamers, guide nucleic acids (e.g., Cas9 guide RNA), and the like. Oligonucleotides may be single-stranded or double-stranded. In some embodiments, oligonucleotides may contain one or more modified nucleosides (e.g., 2'-O-methyl sugar modifications, purine modifications, or pyrimidine modifications). In some embodiments, oligonucleotides may contain one or more modified internucleoside linkages. In some embodiments, oligonucleotides may contain one or more phosphorothioate linkages, which may be in the Rp or Sp stereochemical conformation.

[0078] Region of complementarity: As used herein, the term "region of complementarity" refers to a nucleotide sequence (e.g., of an oligonucleotide) that is sufficiently complementary to a cognate nucleotide sequence (e.g., of a target nucleic acid) so that the two nucleotide sequences can anneal to each other under physiological conditions (e.g., in a cell). In some embodiments, the region of complementarity is fully complementary to the cognate nucleotide sequence of the target nucleic acid. However, in some embodiments, the region of complementarity is partially complementary (e.g., at least 80%, 90%, 95%, or 99% complementary) to the cognate nucleotide sequence of the target nucleic acid. In some embodiments, the region of complementarity contains 1, 2, 3, or 4 mismatches compared to the cognate nucleotide sequence of the target nucleic acid.

[0079] Specific Binding: As used herein, the term "specific binding" refers to the ability of a molecule to bind to a binding partner with a degree of affinity or avidity that allows the molecule to be used to distinguish the binding partner from an appropriate control in a binding assay or other binding context. The term "specific binding" with respect to an antibody refers to the ability of an antibody to bind to a specific antigen with a degree of affinity or avidity that allows the antibody to distinguish the specific antigen from other antigens (e.g., to a degree that allows preferential targeting to certain cells (e.g., muscle cells) through binding to the antigen, as described herein) compared to an appropriate reference antigen(s). In some embodiments, an antibody has at least about 10% affinity for binding to a target. -4 M, 10 -5 M, 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M, 10 -12 M, 10 -13 M or less than this K D In some embodiments, the antibody specifically binds to a transferrin receptor, e.g., an epitope in the apical domain of the transferrin receptor.

[0080] Subject: As used herein, the term "subject" refers to a mammal. In some embodiments, the subject is a non-human animal of the primate order or a rodent. In some embodiments, the subject is a human. In some embodiments, the subject is a patient, e.g., a human patient having or suspected of having a disease. In some embodiments, the subject is a human patient having or suspected of having a disease resulting from a disease-associated repeat expansion (e.g., said expansion in a DMPK allele).

[0081] Transferrin receptor: As used herein, the term "transferrin receptor" (also known as TFRC, CD71, p90, TFR, or TFR1) refers to an internalizing cell surface receptor that binds transferrin to facilitate iron uptake by endocytosis. In some embodiments, the transferrin receptor may be of human (NCBI Gene ID 7037) origin, non-human primate (e.g., NCBI Gene ID 711568 or NCBI Gene ID 102136007) origin, or rodent (e.g., NCBI Gene ID 22042) origin. In addition, multiple human transcript variants (e.g., as annotated under GenBank RefSeq accession numbers: NP_001121620.1, NP_003225.2, NP_001300894.1, and NP_001300895.1) that encode different isoforms of the receptor have been characterized.

[0082] 2'-modified nucleoside: As used herein, the terms "2'-modified nucleoside" and "2'-modified ribonucleoside" are used interchangeably to refer to a nucleoside having a sugar moiety modified at the 2' position. In some embodiments, the 2'-modified nucleoside is a 2'-4' bicyclic nucleoside, in which the 2' and 4' positions of the sugar are bridged (e.g., via a methylene, ethylene, or (S)-constrained ethyl bridge). In some embodiments, the 2'-modified nucleoside is a non-bicyclic 2'-modified nucleoside, in which the 2' position of the sugar moiety is substituted (e.g., via a methylene, ethylene, or (S)-constrained ethyl bridge). Non-limiting examples of 2'-modified nucleosides include the following: 2'-deoxy, 2'-fluoro (2'-F), 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamide (2'-O-NMA), locked nucleic acid (LNA, methylene bridged nucleic acid), ethylene bridged nucleic acid (ENA), and (S)-constrained ethyl bridged nucleic acid (cEt). In some embodiments, the 2'-modified nucleosides described herein are high affinity modified nucleotides, and oligonucleotides comprising the 2'-modified nucleosides have increased affinity for target sequences compared to unmodified oligonucleotides. Examples of 2'-modified nucleosides structures are provided below: [ka] The examples are shown with a phosphate group, however, any internucleoside linkage is contemplated between 2'-modified nucleosides.

[0083] Ranges: All ranges provided in this disclosure include the endpoints.

[0084] Complex Provided herein is a conjugate comprising a targeting agent, for example an antibody, covalently linked to an oligonucleotide. In some embodiments, the conjugate comprises a muscle-targeting antibody covalently linked to one or more oligonucleotides. In some embodiments, the oligonucleotide is an antisense oligonucleotide that targets DMPK RNA to reduce DMPK expression or activity (for example, reduce the level of mutant or wild-type DMPK RNA, or the activity of DMPK gene product).

[0085] The conjugates described herein generally include a linker that covalently connects an antibody described herein (e.g., an anti-TfR1 antibody) to an oligonucleotide (e.g., an oligonucleotide comprising a 5'-XYZ-3' configuration). The linker includes at least one covalent bond.

[0086] In some embodiments, the conjugates described herein have the formula (I): [R 1 ] n1 -R 2 In the formula, each R 1 independently includes compounds that include an oligonucleotide (e.g., an oligonucleotide that includes a 5'-XYZ-3' configuration), and R 2 includes an antibody (e.g., an anti-TfR1 antibody), and wherein in each complex, n1 independently represents the number of R 1 In some embodiments, each R 1 In some embodiments, each R 1 In some embodiments, R 2 In some embodiments, each R of the complex comprises an antibody (e.g., an anti-TfR1 antibody) that comprises a heavy chain comprising a heavy chain variable region (VH) and a heavy chain constant region, and a light chain comprising a light chain variable region (VL) and a light chain constant region. 1 are independently 2is covalently linked to a different amino acid residue (e.g., lysine or cysteine) of

[0087] In some embodiments, in each complex, n1 is independently an integer (e.g., 1 or more). In some embodiments, the antibody comprises a sequence as described in Table 2. For example, in some embodiments, the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as described in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as described in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as described in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as described in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as described in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as described in SEQ ID NO: 6 or 16. In some embodiments, the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (eg, at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (eg, at least 95%) identical to SEQ ID NO: 18. In some embodiments, the antibody comprises a VH comprising an amino acid sequence of SEQ ID NO: 17, and / or a VL comprising an amino acid sequence of SEQ ID NO: 18. In some embodiments, the antibody comprises a heavy chain comprising an amino acid sequence at least 85% (eg, at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (eg, at least 95%) identical to SEQ ID NO: 20. In some embodiments, the antibody comprises a heavy chain comprising an amino acid sequence of SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence of SEQ ID NO: 20. In some embodiments, the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. In some embodiments, the antibody is a Fab fragment.

[0088] In some embodiments, the value of n1 for each or any of the conjugates (e.g., any of the conjugates in any of the compositions or formulations disclosed herein) is an integer up to the number of amino acid residues (e.g., the number of lysine residues) of the antibody to which conjugation is desired or targeted. In some embodiments, the value of n1 for each of the conjugates is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27. In some embodiments, the value of n1 for each of the conjugates is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26. In some embodiments, the value of n1 in each conjugate is independently in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3. In some embodiments, the average value of n1 for the conjugates of the composition is in the range of 1 to 5 (e.g., 1 to 5, 1 to 4, 1 to 3, 3 to 5, or 1 to 2). In some embodiments, the compositions described herein comprise a compound represented by formula (I): [R 1 ] n1 -R 2 wherein n1 is 0. In some embodiments, the average value of n1 of the complex of the composition is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2). In some embodiments, n1 in each complex type is independently selected from R 1n1 is an integer equal to or greater than 1 representing the number of instances of each of the conjugate types of the composition, and different conjugate types within each of the conjugate types are characterized by having different n1 values ​​(e.g., n1 values ​​ranging from 1 to 27, 1 to 26, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, or 1 to 3).

[0089] In some embodiments, a composition is provided that includes a plurality of different conjugates (e.g., a formulation that includes tris(hydroxymethyl)aminomethane and / or sucrose as described herein). In some embodiments, the plurality of different conjugates includes a common targeting agent (e.g., an antibody) and a common oligonucleotide (e.g., an oligonucleotide that includes a 5'-XYZ-3' configuration). In such embodiments, the different conjugate types are characterized by having different numbers of oligonucleotides covalently linked to the antibody. For example, in some embodiments, a compound of formula (I): [R 1 ] n1 -R 2 wherein each R 1 independently includes compounds that include an oligonucleotide (e.g., a DMPK-targeting oligonucleotide), and R 2 includes an antibody (e.g., an anti-TfR1 antibody), and wherein n1 is R 1n1 is an integer representing the number of instances of, and in that respect different conjugates of the composition may have different n1 values ​​(e.g., n1 values ​​ranging from 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, n1 in the conjugates of the composition is independently an integer. In some embodiments, the average value of n1 of the complexes of the composition is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2). In some embodiments, the compositions described herein include complexes in which n1 is 0.

[0090] In some embodiments, the compositions described herein include an antibody that is not conjugated to an oligonucleotide (e.g., a trace amount of an antibody) and an antibody that is conjugated to one or more oligonucleotides. In some embodiments, the antibody that is not conjugated to an oligonucleotide has the formula (I): [R 1 ] n1 -R 2 Accordingly, in some embodiments, the composition for administration to a subject in the methods described herein may be a compound having a structure represented by formula (I): [R 1 ] n1 -R 2 In the formula, each R 1 independently comprises a group that comprises an oligonucleotide; R 2 includes an antibody, and n1 independently represents R 1 In some embodiments, the compound of formula (I): [R 1 ] n1 -R 2is less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%, less than 0.05%, or less than 0.01%, compared to all compounds of that structure in which n1 is 1 or more in the composition. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0091] In some embodiments, R in the complex 1 Each instance of R is covalently linked to a different amino acid residue of the antibody. 1 The amino acid to which R is covalently linked contains an ε-amino group (e.g., lysine, arginine). However, in some embodiments, R 1 In some embodiments, the amino acid to which R is covalently linked is a cysteine. 1 is directly covalently linked to an amino acid residue of the antibody. 1 is indirectly covalently linked to an amino acid of the antibody, e.g., covalently linked to a glycosylation site on the amino acid. 1 is not covalently linked to amino acid residues in the CDR regions of the antibody.

[0092] In some embodiments, the conjugates provided herein (e.g., in the compositions or formulations described herein) have the formula (I): [R 1 ] n1 -R 2 In the formula R 1 Each instance of independently represents the formula (Ia): [ka] In the formula R 3 includes oligonucleotides, e.g., oligonucleotides comprising the 5'-XYZ-3' configuration; and R 1 is R 2 At attachment point A, R 2 includes antibodies comprising a sequence as set forth in Table 2. For example, in some embodiments, R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 includes an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 3 comprises an oligonucleotide comprising the nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21). 3 comprises an oligonucleotide comprising the structure represented by +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO:21), where +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage.

[0093] In some embodiments, the conjugates provided herein (e.g., in the compositions or formulations described herein) have the formula (I): [R 1 ] n1 -R 2 In the formula, each R 1 is represented by the formula (Ic): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:21), wherein n1 represents the R 1 is an integer (e.g., 1 or greater) representing the number of instances of, and each R 1 is R 2 At attachment point A, R 2 includes antibodies comprising a sequence as set forth in Table 2. For example, in some embodiments, R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 includes antibodies that are a Fab fragment, a full length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv.

[0094] In some embodiments, the conjugates provided herein (e.g., in the compositions or formulations described herein) have the formula (I): [R 1 ] n1 -R 2 In the formula, each R 1 is represented by the formula (Ic): [ka] In the formula R 1 is R 2 At attachment point A, R 2 includes antibodies comprising a sequence as set forth in Table 2. For example, in some embodiments, R 2comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 includes antibodies that are a Fab fragment, a full length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv.

[0095] In some embodiments, the conjugates provided herein (e.g., in compositions or formulations described herein) have the formula (Id): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:21); 2 includes an antibody comprising a sequence as set forth in Table 2; where n1 is an integer (e.g., 1 or more) representing the number of instances of the group enclosed by the brackets, where each instance of the group enclosed by the brackets is covalently linked to a different amino acid residue of the antibody, optionally where each different amino acid residue is a lysine. 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 includes antibodies that are a Fab fragment, a full length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv.

[0096] In some embodiments, the conjugates described herein have the formula (A): [ka] where y is 0-15 (e.g., 3) and z is 0-15 (e.g., 4). In some embodiments, the amide shown adjacent to an antibody (e.g., an anti-TfR1 antibody) in structure (A) results from reaction with an amine of the antibody, such as a lysine epsilon amine. In some embodiments, the conjugates described herein include an anti-TfR1 antibody (e.g., an anti-TfR1 Fab) covalently linked through a lysine of the antibody to the 5' end of an oligonucleotide (e.g., an oligonucleotide comprising a 5'-XYZ-3' configuration), in some embodiments, the antibody comprises a sequence as set forth in Table 2. For example, in some embodiments, the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. In some embodiments, the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. In some embodiments, the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17, and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, the antibody comprises a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.In some embodiments, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv.

[0097] antibody In some embodiments, the conjugates described herein comprise an antibody that binds to human transferrin receptor 1 (TfR1). An example of an amino acid sequence for human TfR1, which corresponds to the NCBI sequence NP_003225.2 (transferrin receptor protein 1 isoform 1, homo sapiens), is as follows: (Sequence number 23).

[0098] Table 2 provides examples of anti-TfR1 antibody sequences useful in the conjugates provided herein. [Table 2]

[0099] In some embodiments, an anti-TfR1 antibody of the disclosure comprises heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO: 1 (according to the IMGT definition system), heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO: 2 (according to the IMGT definition system), heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO: 3 (according to the IMGT definition system), light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO: 4 (according to the IMGT definition system), light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO: 5 (according to the IMGT definition system), and light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO: 6 (according to the IMGT definition system).

[0100] In some embodiments, an anti-TfR1 antibody of the disclosure comprises heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO: 7 (according to the Kabat definition system), heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO: 8 (according to the Kabat definition system), heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO: 9 (according to the Kabat definition system), light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO: 10 (according to the Kabat definition system), light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO: 11 (according to the Kabat definition system), and light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO: 6 (according to the Kabat definition system).

[0101] In some embodiments, an anti-TfR1 antibody of the disclosure comprises heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO: 12 (according to the Chothia definition system), heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO: 13 (according to the Chothia definition system), heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO: 14 (according to the Chothia definition system), light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO: 15 (according to the Chothia definition system), light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO: 5 (according to the Chothia definition system), and light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO: 16 (according to the Chothia definition system).

[0102] In some embodiments, the anti-TfR1 antibodies of the present disclosure comprise a heavy chain variable region (VH) that contains 25 or fewer amino acid variations (e.g., 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 or fewer amino acid variations) in the framework regions compared to a VH that comprises the amino acid sequence of SEQ ID NO: 17. Alternatively or in addition (e.g., in addition), the anti-TfR1 antibodies of the present disclosure comprise a light chain variable region (VL) that contains 25 or fewer amino acid variations (e.g., 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 or fewer amino acid variations) in the framework regions compared to a VL that comprises the amino acid sequence of SEQ ID NO: 18.

[0103] In some embodiments, an anti-TfR1 antibody of the disclosure comprises a VH comprising an amino acid sequence in a framework region that is at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to a VH comprising the amino acid sequence of SEQ ID NO: 17. Alternatively or additionally (e.g., in addition), in some embodiments, an anti-TfR1 antibody of the disclosure comprises a VL comprising an amino acid sequence in a framework region that is at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to a VL comprising the amino acid sequence of SEQ ID NO: 18.

[0104] In some embodiments, an anti-TfR1 antibody of the present disclosure comprises a VH comprising the amino acid sequence of SEQ ID NO: 17. Alternatively or additionally (for example, in addition), in some embodiments, an anti-TfR1 antibody of the present disclosure comprises a VL comprising the amino acid sequence of SEQ ID NO: 18.

[0105] In some embodiments, an anti-TfR1 antibody of the present disclosure comprises a heavy chain comprising an amino acid sequence at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO: 19. Alternatively or additionally (e.g., in addition), an anti-TfR1 antibody of the present disclosure comprises a light chain comprising an amino acid sequence at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO: 20. In some embodiments, an anti-TfR1 antibody of the present disclosure is a Fab comprising a heavy chain comprising an amino acid sequence at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO: 19. Alternatively or additionally (for example, in addition), an anti-TfR1 antibody of the disclosure is a Fab comprising a light chain comprising an amino acid sequence at least 75% (for example, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO:20.

[0106] In some embodiments, an anti-TfR1 antibody of the present disclosure comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19. Alternatively or additionally (for example, in addition), an anti-TfR1 antibody of the present disclosure comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, an anti-TfR1 antibody of the present disclosure is a Fab comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19. Alternatively or additionally (for example, in addition), an anti-TfR1 antibody of the present disclosure is a Fab comprising a light chain comprising the amino acid sequence of SEQ ID NO: 20.

[0107] In some embodiments, the anti-TfR1 antibodies provided herein may have one or more post-translational modifications. In some embodiments, N-terminal cyclization, also referred to as pyroglutamate formation (pyroGlu), may occur at the N-terminal glutamate (Glu) and / or glutamine (Gln) residues during production in antibodies. Therefore, it should be understood that an antibody identified as having a sequence that includes an N-terminal glutamate or glutamine residue encompasses antibodies that have undergone pyroglutamate formation as a result of post-translational modification. In some embodiments, pyroglutamate formation occurs in the heavy chain sequence. In some embodiments, pyroglutamate formation occurs in the light chain sequence.

[0108] Oligonucleotides In some embodiments, the oligonucleotide of the conjugate described herein is a single stranded oligonucleotide. In some embodiments, the oligonucleotide is useful for targeting DMPK (e.g., for reducing the expression or activity of DMPK RNA, such as the level of mutant or wild type DMPK RNA). In some embodiments, the oligonucleotide is useful for targeting DMPK RNA (e.g., for reducing the expression or activity of DMPK RNA, such as the level of mutant or wild type DMPK RNA). In some embodiments, the oligonucleotide comprises a region of complementarity to DMPK RNA. In some embodiments, the oligonucleotide is useful for reducing the level of toxic DMPK with disease-associated repeat expansion, e.g., in a subject having or suspected of having myotonic dystrophy. In some embodiments, the oligonucleotide is designed to direct RNAse H-mediated degradation of the target DMPK RNA in the nucleus of a cell, e.g., a muscle cell (e.g., a myotube) or a cell of the nervous system (e.g., a central nervous system (CNS) cell). In some embodiments, the oligonucleotide is designed to have desired bioavailability and / or serum stability properties. In some embodiments, the oligonucleotide is designed to have desired binding affinity properties. In some embodiments, the oligonucleotides are designed to have a desired toxicity profile, hi some embodiments, the oligonucleotides are designed to have low complement activation and / or cytokine induction properties.

[0109] In some embodiments, the DMPK-targeting oligonucleotides described herein are designed to trigger RNase H-mediated degradation of DMPK mRNA. It should be understood that in some embodiments, an oligonucleotide in one format (e.g., an antisense oligonucleotide) may be suitably adapted to another format (e.g., an siRNA oligonucleotide) by incorporating a functional sequence (e.g., an antisense strand sequence) from one format into the other.

[0110] Examples of oligonucleotides useful for targeting DMPK include those disclosed in U.S. Patent Application Publication No. 20100016215A1, published on January 1, 2010, entitled Compound And Method For Treating Myotonic Dystrophy; U.S. Patent Application Publication No. 20130237585A1, published on July 19, 2010, entitled Modulation Of Dystrophia Myotonica-Protein Kinase (DMPK) Expression; U.S. Patent Application Publication No. 20150064181A1, published on March 5, 2015, entitled "Antisense Conjugates For Decreasing Expression Of Dmpk"; and U.S. Patent Application Publication No. 20150064181A1, published on August 27, 2015, entitled "Peptide-Linked Morpholino Antisense Oligonucleotides For Treatment Of Myotonic Dystrophy." No. 20150238627A1, entitled "Compounds And Methods For Modulation Of Dystrophia Myotonica-Protein Kinase (Dmpk) Expression," published on October 20, 2016, the contents of each of which are incorporated herein in their entirety.

[0111] In some embodiments, the oligonucleotide may comprise a region of complementarity to the sequence set forth as follows, which is an example of a human DMPK gene sequence (Gene ID 1760; NM_001081560.2):

[0112] In some embodiments, the oligonucleotide may comprise a region of complementarity to the sequence set forth as follows, which is an example of a mouse DMPK gene sequence (Gene ID 13400; NM_001190490.1):

[0113] In some embodiments, the oligonucleotide may contain regions of complementarity to DMPK gene sequences of multiple species, for example selected from human, mouse, and non-human species (eg, cynomolgus monkey).

[0114] In some embodiments, the oligonucleotide may contain a region of complementarity to a mutant form of DMPK, such as those reported in Botta A. et al., "The CTG repeat expansion size correlates with the splicing defects observed in muscles from myotonic dystrophy type 1 patients." J Med Genet. 2008 Oct; 45(10): 639-46.; and Machuca-Tzili L. et al., "Clinical and molecular aspects of the myotonic dystrophies: a review." Muscle Nerve. 2005 Jul; 32(1): 1-18.; the contents of each of which are incorporated herein by reference in their entireties.

[0115] In some embodiments, the oligonucleotide provided herein is an antisense oligonucleotide targeting DMPK. In some embodiments, the oligonucleotide targeting DMPK is any one of the antisense oligonucleotides targeting DMPK as described in US Patent Application Publication 20160304877A1 entitled "Compounds And Methods For Modulation Of Dystrophia Myotonica-Protein Kinase (DMPK) Expression" published on October 20, 2016, which is incorporated herein by reference. In some embodiments, the DMPK targeting oligonucleotide targets the region of the DMPK gene sequence as described in Genbank Accession No. NM_001081560.2 (SEQ ID NO: 24) or as described in Genbank Accession No. NG_009784.1 (SEQ ID NO: 26).

[0116] In some embodiments, the DMPK-targeting oligonucleotides provided herein comprise a nucleotide sequence that includes a region complementary to a target region that is at least 8 contiguous nucleotides (e.g., at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, or more contiguous nucleotides) of SEQ ID NO:24.

[0117] In some embodiments, the DMPK-targeting oligonucleotides provided herein are 10-35 (e.g., 10-35, 10-30, 10-25, 10-20, 10-15, 15-35, 15-30, 15-25, 15-20, 20-35, 20-30, 13-18, 14-17, 15-18, 20-30, 15-17, 27-30, 25-35, or 30-35) nucleotides in length. In some embodiments, the DMPK-targeting oligonucleotides provided herein are 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, optionally 15-30 or 16 nucleotides in length. In some embodiments, the DMPK-targeting oligonucleotides provided herein are 16 nucleotides in length.

[0118] In some embodiments, the DMPK-targeting oligonucleotides provided herein comprise a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) consecutive nucleotides to DMPK RNA.

[0119] In some embodiments, the DMPK-targeting oligonucleotides provided herein comprise a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) consecutive nucleotides to a DMPK sequence as set forth in SEQ ID NO:24 or 25.

[0120] In some embodiments, the DMPK targeting oligonucleotides provided herein comprise a region of complementarity of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, or 16) consecutive nucleotides to a target sequence as set forth in SEQ ID NO: 22 (TGACTGGTGGGCGCTG). In some embodiments, oligonucleotides useful for targeting DMPK comprise at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, or 16) consecutive nucleotides of a sequence as set forth in SEQ ID NO: 21 (CAGCGCCCACCAGUCA). In some embodiments, oligonucleotides useful for targeting DMPK comprise the nucleotide sequence of SEQ ID NO: 21.

[0121] In some embodiments, the DMPK-targeting oligonucleotide comprises a 5'-XYZ-3' configuration. An oligonucleotide comprising a 5'-XYZ-3' configuration may refer to a chimeric antisense compound in which a gap region having multiple nucleosides that support RNase H cleavage is positioned between flanking regions having one or more nucleotides, where the nucleosides comprising the gap region are chemically distinct from the nucleoside(s) comprising the flanking region. In some embodiments, the oligonucleotides described herein (e.g., the DMPK-targeting oligonucleotides described herein) comprise a 5'-XYZ-3' configuration with X and Z as flanking regions around the gap region Y. In some embodiments, the gap region Y comprises one or more 2'-deoxyribonucleosides. In some embodiments, each nucleoside in the gap region Y is a 2'-deoxyribonucleoside, and neither the flanking region X nor the flanking region Z contains any 2'-deoxyribonucleosides.

[0122] In some embodiments, the gap region Y comprises a contiguous stretch of six or more 2'-deoxyribonucleosides capable of recruiting an RNAse, such as RNAse H. In some embodiments, the oligonucleotide binds to a target nucleic acid at which point an RNAse can be recruited and then cleave the target nucleic acid. In some embodiments, the flanking regions X and Z each comprise one or more modified nucleosides. In some embodiments, the flanking regions X and Z each comprise one or more high affinity modified nucleosides, for example, 1-6 high affinity modified nucleosides. Examples of high affinity modified nucleosides include, but are not limited to, 2'-modified nucleosides (for example, 2'-MOE, 2'-O-Me, 2'-F) or 2'-4' bicyclic nucleosides (for example, LNA, cEt, ENA). In some embodiments, the flanking regions X and Z may be 1-20 nucleotides, 1-8 nucleotides, or 1-5 nucleotides in length. Flanking regions X and Z may be of similar or dissimilar lengths. In some embodiments, gap region Y may comprise a nucleotide sequence between 5 and 20 nucleotides, between 5 and 15 nucleotides, between 5 and 12 nucleotides, or between 6 and 10 nucleotides in length.

[0123] In some embodiments, gap region Y comprises one or more unmodified internucleoside linkages. In some embodiments, one or both of flanking regions X and Z each independently comprises a phosphorothioate internucleoside linkage (e.g., a phosphorothioate internucleoside linkage or other linkage) between at least two, at least three, at least four, at least five, or more nucleotides. In some embodiments, gap region Y and the two flanking regions X and Z each independently comprise a modified internucleoside linkage (e.g., a phosphorothioate internucleoside linkage or other linkage) between at least two, at least three, at least four, at least five, or more nucleotides.

[0124] In some embodiments, the gap region Y in the gapmer is 5-20 nucleosides in length. For example, the gap region Y may be 5-20, 5-15, 5-10, 10-20, 10-15, or 15-20 nucleosides in length. In some embodiments, the gap region Y is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length. In some embodiments, each nucleoside in the gap region Y is a 2'-deoxyribonucleoside. In some embodiments, all nucleosides in the gap region Y are 2'-deoxyribonucleosides. In some embodiments, one or more of the nucleosides in the gap region Y are modified nucleosides (e.g., 2'-modified nucleosides, such as those described herein). In some embodiments, one or more cytosines in gap region Y are optionally 5-methylcytosines. In some embodiments, each cytosine in gap region Y is a 5-methyl-cytosine.

[0125] In some embodiments, the flanking region X of the oligonucleotide (X in the 5'-XYZ-3' arrangement) and the flanking region Z of the oligonucleotide (Z in the 5'-XYZ-3' arrangement) are independently 1-20 nucleosides in length. For example, the flanking region X of the oligonucleotide and the flanking region Z of the oligonucleotide may be independently 1-20, 1-15, 1-10, 1-7, 1-5, 1-3, 1-2, 2-5, 2-7, 3-5, 3-7, 5-20, 5-15, 5-10, 10-20, 10-15, or 15-20 nucleosides in length. In some embodiments, the flanking region X of the oligonucleotide and the flanking region Z of the oligonucleotide are independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length. In some embodiments, the flanking region X of the oligonucleotide and the flanking region Z of the oligonucleotide are of the same length. In some embodiments, the flanking region X of the oligonucleotide and the flanking region Z of the oligonucleotide are of different lengths. In some embodiments, the flanking region X of the oligonucleotide is longer than the flanking region Z of the oligonucleotide. In some embodiments, the flanking region X of the oligonucleotide is shorter than the flanking region Z of the oligonucleotide.

[0126] In some embodiments, the oligonucleotides described herein (e.g., DMPK-targeting oligonucleotides) are 5-10-5, 4-12-4, 3-14-3, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 4-6-4, 3-6-3, 2-6-2, 4-7-4, 3-7-3, 2-7-2, 4-8-4, 3-8-3, 2-8-2, 1-8-1, 2-9-2, 1-9-1, 2-10-2, 1-10-1, 1-12-1, 1-16-1, 2-15-1, 1-15-2, 1-14-3, 3-14-1, 2-14-2 , 1-13-4, 4-13-1, 2-13-3, 3-13-2, 1-12-5, 5-12-1, 2-12-4, 4-12-2, 3-12-3, 1-11-6, 6-11-1, 2-11-5, 5-11-2, 3-11-4, 4-11-3, 1-17-1, 2-16-1, 1-16- 2, 1-15-3, 3-15-1, 2-15-2, 1-14-4, 4-14-1, 2-14-3, 3-14-2, 1-13-5, 5-13-1, 2-13-4, 4-13-2, 3-13-3, 1-12-6, 6-12-1, 2-12-5, 5-12-2, 3-12-4, 4-12 -3, 1-11-7, 7-11-1, 2-11-6, 6-11-2, 3-11-5, 5-11-3, 4-11-4, 1-18-1, 1-17-2, 2-17-1, 1-16-3, 1-16-3, 2-16-2, 1-15-4, 4-15-1, 2-15-3, 3-15-2, 1-1 4-5, 5-14-1, 2-14-4, 4-14-2, 3-14-3, 1-13-6, 6-13-1, 2-13-5, 5-13-2, 3-13-4, 4-13-3, 1-12-7, 7-12-1, 2-12-6, 6-12-2, 3-12-5, 5-12-3, 1-11-8, 8- 11-1, 2-11-7, 7-11-2, 3-11-6, 6-11-3, 4-11-5, 5-11-4, 1-18-1, 1-17-2, 2-17-1, 1-16-3, 3-16-1, 2-16-2, 1-15-4, 4-15-1, 2-15-3, 3-15-2, 1-14-5, 2 -14-4, 4-14-2, 3-14-3, 1-13-6, 6-13-1, 2-13-5, 5-13-2, 3-13-4, 4-13-3, 1-12-7, 7-12-1, 2-12-6, 6-12-2, 3-12-5, 5-12-3, 1-11-8, 8-11-1, 2-11-7,7-11-2、3-11-6、6-11-3、4-11-5、5-11-4、1-19-1、1-18-2、2-18-1、1-17-3、3-17-1、2-17-2、1-16-4、4-16-1、2-16-3、3-16-2、1-15-5、2-15-4、4-15-2、3-15-3、1-14-6、6-14-1、2-14-5、5-14-2、3-14-4、4-14-3、1-13-7、7-13-1、2-13-6、6-13-2、3-13-5、5-13-3、4-13-4、1-12-8、8-12-1、2-12-7、7-12-2、3-12-6、6-12-3、4-12-5、5-12-4、2-11-8、8-11-2、3-11-7、7-11-3、4-11-6、6-11-4、5-11-5、1-20-1、1-19-2、2-19-1、1-18-3、3-18-1、2-18-2、1-17-4、4-17-1、2-17-3、3-17-2、1-16-5、2-16-4、4-16-2、3-16-3、1-15-6、6-15-1、2-15-5、5-15-2、3-15-4、4-15-3、1-14-7、7-14-1、2-14-6、6-14-2、3-14-5、5-14-3、4-14-4、1-13-8、8-13-1、2-13-7、7-13-2、3-13-6、6-13-3、4-13-5、5-13-4、2-12-8、8-12-2、3-12-7、7-12-3、4-12-6、6-12-4、5-12-5、3-11-8、8-11-3、4-11-7、7-11-4、5-11-6、6-11-5、1-21-1、1-20-2、2-20-1、1-20-3、3-19-1、2-19-2、1-18-4、4-18-1、2-18-3、3-18-2、1-17-5、2-17-4、4-17-2、3-17-3、1-16-6、6-16-1、2-16-5、5-16-2、3-16-4、4-16-3、1-15-7、7-15-1、2-15-6、6-15-2、3-15-5、5-15-3、4-15-4、1-14-8、8-14-1、2-14-7、7-14-2、3-14-6、6-14-3、4-14-5、5-14-4、2-13-8、8-13-2、3-13-7、7-13-3、4-13-6、6-13-4、5-13-5、1-12-10、10-12-1、2-12-9、9-12-2、3-12-8、8-12-3, 4-12-7, 7-12-4, 5-12-6, 6-12-5, 4-11-8, 8-11-4, 5-11-7, 7-11-5, 6-11-6, 1-22-1, 1-21-2, 2-21-1, 1-21-3, 3-20-1, 2-20-2, 1-19-4, 4-19-1, 2-19-3, 3-19-2, 1-18-5, 2-18-4, 4-18-2, 3-18-3, 1-17-6, 6-17-1, 2-17-5, 5-17-2, 3-17-4, 4-17-3, 1-16-7, 7-16-1, 2-16-6, 6-16-2, 3-16- and 5-15-4, 2-14-8, 8-14-2, 3-14-7, 7-14-3, 4-14-6, 6-14-4, 5-14-5, 3-13-8, 8-13-3, 4-13-7, 7-13-4, 5-13-6, 6-13-5, 4-12-8, 8-12-4, 5-12-7, 7-12-5, 6-12-6, 5-11-8, 8-11-5, 6-11-7, or 7-11-6. The numbers indicate the number of nucleosides in the X, Y, and Z regions, respectively, in an oligonucleotide comprising the 5'-XYZ-3' configuration.

[0127] In some embodiments, one or more nucleosides in the flanking region X of the oligonucleotide (X in a 5'-XYZ-3' arrangement) or the flanking region Z of the oligonucleotide (Z in a 5'-XYZ-3' arrangement) are modified nucleosides (e.g., high affinity modified nucleosides). In some embodiments, the modified nucleoside (e.g., high affinity modified nucleoside) is a 2'-modified nucleoside. In some embodiments, the 2'-modified nucleoside is a 2'-4' bicyclic nucleoside or a non-bicyclic 2' modified nucleoside. In some embodiments, the high affinity modified nucleoside is a 2'-4' bicyclic nucleoside (e.g., LNA, cEt, or ENA) or a non-bicyclic 2'-modified nucleoside (e.g., 2'-fluoro (2'-F), 2'-O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA)).

[0128] In some embodiments, the oligonucleotides described herein (e.g., the DMPK-targeting oligonucleotides described herein) comprise a 5'-XYZ-3' configuration, where X and Z are independently 2-7 (e.g., 2, 3, 4, 5, 6, or 7) nucleosides in length, and Y is 6-10 (e.g., 6, 7, 8, 9, or 10) nucleosides in length, where positions 1, 2, 3, 4, 5, 6, or At least one but not all (e.g., 1, 2, 3, 4, 5, or 6) of 7 (the 5'-most position is position 1) is a non-bicyclic 2'-modified nucleoside (e.g., 2'-MOE or 2'-O-Me), where the remainder of the nucleosides in both X and Z are 2'-4' bicyclic nucleosides (e.g., LNA or cEt), and where each nucleoside in Y is a 2' deoxyribonucleoside. In some embodiments, the oligonucleotides described herein (e.g., the DMPK-targeting oligonucleotides described herein) comprise a 5'-XYZ-3' configuration, where X and Z are independently 2-7 (e.g., 2, 3, 4, 5, 6, or 7) nucleosides in length, and Y is 6-10 (e.g., 6, 7, 8, 9, or 10) nucleosides in length, where positions 1, 2, 3, 4, 5, 6, or 7 in Z are 5'-XYZ-3'. At least one but not all (e.g., 1, 2, 3, 4, 5, or 6) of 7 (the 5'-most position is position 1) is a non-bicyclic 2'-modified nucleoside (e.g., 2'-MOE or 2'-O-Me), where the remainder of the nucleosides in both X and Z are 2'-4' bicyclic nucleosides (e.g., LNA or cEt), and where each nucleoside in Y is a 2' deoxyribonucleoside.In some embodiments, the oligonucleotides described herein (e.g., the DMPK-targeting oligonucleotides described herein) comprise a 5'-XYZ-3' configuration, where X and Z are independently 2-7 (e.g., 2, 3, 4, 5, 6, or 7) nucleosides in length, and Y is 6-10 (e.g., 6, 7, 8, 9, or 10) nucleosides in length, where at least one, but not all (e.g., 1, 2, 3, 4, 5, 6, or 7) of positions 1, 2, 3, 4, 5, 6, or 7 in X is 5'-XYZ-3'. At least one but not all (e.g., 1, 2, 3, 4, 5, or 6) of positions 1, 2, 3, 4, 5, 6, or 7 (the 5'-most position is position 1) in Z is a non-bicyclic 2'-modified nucleoside (e.g., 2'-MOE or 2'-O-Me), where the remainder of the nucleosides in both X and Z are 2'-4' bicyclic nucleosides (e.g., LNA or cEt), and where each nucleoside in Y is a 2' deoxyribonucleoside.

[0129] In some embodiments, the oligonucleotides described herein (e.g., DMPK-targeting oligonucleotides) are 10-20 nucleosides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides), contain a region of complementarity to at least 8 consecutive nucleosides (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleosides) of SEQ ID NO: 22 (TGACTGGTGGGCGCTG), and contain a 5'-XYZ-3' configuration, where X is 3 to 5 (e.g., 3, 4, or 5) linked nucleosides. X comprises 6 to 10 (e.g., 6, 7, 8, 9, or 10) linked 2'-deoxyribonucleosides, where at least one of the nucleosides in X is a 2'-modified nucleoside (e.g., a 2'-MOE modified nucleoside, a 2'-O-Me modified nucleoside, LNA, cEt, or ENA); Y comprises 6 to 10 (e.g., 6, 7, 8, 9, or 10) linked 2'-deoxyribonucleosides, where each cytosine in Y is optionally and independently a 5-methyl-cytosine; and Z comprises 3 to 5 (e.g., 3, 4, or 5) linked nucleosides, where at least one of the nucleosides in Z is a 2'-modified nucleoside (e.g., a 2'-MOE modified nucleoside, a 2'-O-Me modified nucleoside, LNA, cEt, or ENA).

[0130] In some embodiments, the oligonucleotides described herein (e.g., the DMPK-targeting oligonucleotides described herein) comprise at least 8 contiguous nucleosides (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleosides) of the nucleotide sequence of SEQ ID NO:21 (CAGCGCCCACCAGUCA) and comprise a 5'-XYZ-3' configuration, where X comprises 3 to 5 (e.g., 3, 4, or 5) linked nucleosides, and where at least one of the nucleosides in X is a 5'-XYZ-3' arrangement. is a 2'-modified nucleoside (e.g., a 2'-MOE modified nucleoside, a 2'-O-Me modified nucleoside, LNA, cEt, or ENA); Y comprises 6 to 10 (e.g., 6, 7, 8, 9, or 10) linked 2'-deoxyribonucleosides, where each cytosine in Y is optionally and independently a 5-methyl-cytosine; and Z comprises 3 to 5 (e.g., 3, 4, or 5) linked nucleosides, where at least one of the nucleosides in Z is a 2'-modified nucleoside (e.g., a 2'-MOE modified nucleoside, a 2'-O-Me modified nucleoside, LNA, cEt, or ENA). In some embodiments, each thymine base (T) in the nucleotide sequence of the antisense oligonucleotide may be independently and optionally replaced with a uracil base (U), and each U may be independently and optionally replaced with a T.

[0131] In some embodiments, an oligonucleotide described herein (e.g., a DMPK-targeted oligonucleotide described herein) comprises the nucleotide sequence of SEQ ID NO:21 and comprises a 5'-XYZ-3' configuration, where X comprises 3 to 5 (e.g., 3, 4, or 5) linked nucleosides, and where at least one of the nucleosides in X is a 2'-modified nucleoside (e.g., a 2'-MOE modified nucleoside, a 2'-O-Me modified nucleoside, an LNA, a cEt, or an ENA). ); Y comprises 6 to 10 (e.g., 6, 7, 8, 9, or 10) linked 2'-deoxyribonucleosides, where each cytosine in Y is optionally and independently a 5-methyl-cytosine; and Z comprises 3 to 5 (e.g., 3, 4, or 5) linked nucleosides, where at least one of the nucleosides in Z is a 2'-modified nucleoside (e.g., a 2'-MOE modified nucleoside, a 2'-O-Me modified nucleoside, LNA, cEt, or ENA). In some embodiments, each thymine base (T) in the nucleotide sequence of the antisense oligonucleotide may be independently and optionally replaced with a uracil base (U), and each U may be independently and optionally replaced with a T.

[0132] In some embodiments, X comprises at least one 2'-4' bicyclic nucleoside (e.g., LNA, cEt, or ENA) and at least one non-bicyclic 2'-modified nucleoside, e.g., a 2'-MOE modified nucleoside or a 2'-O-Me modified nucleoside, and / or (e.g., and) Z comprises at least one 2'-4' bicyclic nucleoside (e.g., LNA, cEt, or ENA) and at least one non-bicyclic 2'-modified nucleoside (e.g., a 2'-MOE modified nucleoside or a 2'-O-Me modified nucleoside).

[0133] In some embodiments, the 2'-4' bicyclic nucleoside is selected from LNA, cEt, and ENA nucleosides. In some embodiments, the non-bicyclic 2'-modified nucleoside is a 2'-MOE modified nucleoside or a 2'-OMe modified nucleoside.

[0134] In some embodiments, the nucleosides of the oligonucleotide are linked together by phosphorothioate internucleoside linkages, phosphodiester internucleoside linkages, or a combination thereof. In some embodiments, the oligonucleotide contains only phosphorothioate internucleoside linkages linking each nucleoside (i.e., the oligonucleotide contains a complete phosphorothioate backbone). In some embodiments, the oligonucleotide contains at least one phosphorothioate internucleoside linkage. In some embodiments, the oligonucleotide contains a mix of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In some embodiments, the oligonucleotide contains only phosphorothioate internucleoside linkages linking each pair of 2'-deoxyribonucleosides, and a mix of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages linking the remaining nucleosides.

[0135] In some embodiments, the oligonucleotide comprises a 5'-XYZ-3' configuration of LLEE-(D)8-EELL, where "E" is a 2'-MOE modified ribonucleoside; "L" is LNA; "D" is a 2'-deoxyribonucleoside; and "10" or "8" is the number of 2'-deoxyribonucleosides in Y, and where the oligonucleotide comprises phosphorothioate internucleoside linkages, phosphodiester internucleoside linkages, or a combination thereof.

[0136] In some embodiments, each cytidine (e.g., a 2'-modified cytidine) in oligonucleotide X and / or Z is optionally and independently a 5-methyl-cytidine and / or each uridine (e.g., a 2'-modified uridine) in oligonucleotide X and / or Z is optionally and independently a 5-methyl-uridine.

[0137] In some embodiments, the oligonucleotides described herein (eg, the DMPK-targeting oligonucleotides described herein) comprise a 5'-XYZ-3' configuration and comprise the nucleobase sequence CAGCGCCCACCAGUCA (SEQ ID NO: 21). In some embodiments, oligonucleotides described herein (e.g., DMPK-targeted oligonucleotides described herein) comprise a structure represented by +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), where +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents a 5-methyl-2'-MOE-cytidine, +C represents a 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents a 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage.

[0138] In some embodiments, the oligonucleotides described herein (including, for example, the DMPK-targeting oligonucleotides described herein) have the formula (Ie): [ka] The structure includes:

[0139] In some embodiments, the oligonucleotides described herein (e.g., the DMPK-targeting oligonucleotides described herein) may be in the form of a salt, e.g., as a sodium salt, potassium salt, or magnesium salt.

[0140] In some embodiments, the 5' or 3' nucleoside (e.g., the terminal nucleoside) of the oligonucleotide is conjugated to an amine group, optionally via a spacer. In some embodiments, the spacer comprises an aliphatic moiety. In some embodiments, the spacer comprises a polyethylene glycol moiety. In some embodiments, a phosphodiester linkage is present between the spacer and the 5' or 3' nucleoside of the oligonucleotide. In some embodiments, the 5' or 3' nucleoside (e.g., the terminal nucleoside) of the oligonucleotide described herein is covalently linked to a spacer, said spacer being selected from the group consisting of substituted or unsubstituted aliphatic, substituted or unsubstituted heteroaliphatic, substituted or unsubstituted carbocyclylene, substituted or unsubstituted heterocyclylene, substituted or unsubstituted arylene, substituted or unsubstituted heteroarylene, -O-, -N(R A )-, -S-, -C(=O)-, -C(=O)O-, -C(=O)NR A -, -NR A C(=O)-, -NR A C(=O)R A -, -C(=O)R A -, -NR A C(=O)O-, -NR A C(=O)N(R A )-, -OC(=O)-, -OC(=O)O-, -OC(=O)N(R A )-, -S(O)NR A -, -NR A S(O)2-, or a combination thereof; each R A is independently hydrogen or substituted or unsubstituted alkyl. In some embodiments, the spacer is a substituted or unsubstituted alkylene, a substituted or unsubstituted heterocyclylene, a substituted or unsubstituted heteroarylene, -O-, -N(R A )-, or -C(=O)N(R A )2, or a combination of these.

[0141] In some embodiments, the 5' or 3' nucleoside of the oligonucleotide has the formula -NH2-(CH2) n -, where n is an integer from 1 to 12. In some embodiments, n is 6, 7, 8, 9, 10, 11, or 12. In some embodiments, the phosphodiester linkage is conjugated to a compound of the formula NH2-(CH2) n - is present between the compound represented by the formula NH2-(CH2)6- and the 5' or 3' nucleoside of the oligonucleotide. In some embodiments, the compound represented by the formula NH2-(CH2)6- is conjugated to the oligonucleotide via a reaction between 6-amino-1-hexanol (NH2-(CH2)6-OH) and the 5' phosphate of the oligonucleotide.

[0142] In some embodiments, the oligonucleotide is conjugated to a targeting agent, e.g., a muscle targeting agent such as an anti-TfR1 antibody, e.g., via an amine group of a lysine of the targeting agent.

[0143] It should be understood that in some embodiments, methylation of the nucleobase uracil at the C5 position forms thymine. Thus, in some embodiments, a nucleotide or nucleoside having a C5 methylated uracil (or 5-methyl-uracil) may be equivalently identified as a thymine nucleotide or nucleoside.

[0144] In some embodiments, any one or more of the thymine bases (T) in any one of the oligonucleotides provided herein may independently and optionally be uracil bases (U), and / or any one or more of the U's in the oligonucleotides provided herein (e.g., the oligonucleotide as set forth in SEQ ID NO:21) may independently and optionally be T.

[0145] composition In some embodiments, the composition comprising the complex (i.e., the complexes) is prepared in a manner suitable for the methods described herein. In some embodiments, the composition comprising the muscle-targeting complex is delivered to a subject in a manner that minimizes degradation, facilitates delivery and / or (for example and) uptake, or provides another beneficial property to the complex in the composition. Consequently, in some embodiments, the composition comprising the complex (for example, the complexes comprising an oligonucleotide covalently linked to a Fab) comprises tris(hydroxymethyl)aminomethane and / or sucrose. In some embodiments, the composition comprising the muscle-targeting complex (for example, the complexes comprising an oligonucleotide covalently linked to a Fab) comprises tris(hydroxymethyl)aminomethane and / or sucrose in an aqueous solution. In some embodiments, the composition comprising the complexes, tris(hydroxymethyl)aminomethane, and sucrose may be lyophilized (for example, for storage). In some embodiments, the lyophilized composition may be reconstituted (for example, with water) for administration to a subject. In some embodiments, the composition comprising the complexes, tris(hydroxymethyl)aminomethane, and sucrose may be frozen (for example, for storage). In some embodiments, the frozen composition may be thawed prior to administration to a subject, e.g., to produce an aqueous solution. The composition (e.g., in an aqueous solution, frozen composition, or lyophilized composition) may be suitably prepared such that a sufficient amount of the complex enters the target muscle cell when administered to a subject, into the environment surrounding the target cell, or systemically.

[0146] In some embodiments, a composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a complex (i.e., a plurality of complexes), each of which comprises an oligonucleotide (e.g., an oligonucleotide comprising a 5'-XYZ-3' arrangement) covalently linked to an antibody. In some embodiments, a composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a complex, each of which comprises an oligonucleotide (e.g., an oligonucleotide comprising a 5'-XYZ-3' arrangement) covalently linked to an anti-TfR1 antibody, optionally wherein the antibody of such a complex comprises CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 as described in Table 2, and further wherein the composition further comprises tris(hydroxymethyl)aminomethane and sucrose. In some embodiments, the antibody is an anti-TfR1 Fab.

[0147] In some embodiments, a composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein each R 1 independently includes compounds that include oligonucleotides (e.g., oligonucleotides that include a 5'-XYZ-3' configuration), and R 2 wherein R 2 includes an antibody (e.g., an anti-TfR1 antibody), and in those complexes, n1 in each complex is independently R 1 is an integer greater than or equal to 1 that represents the number of instances of

[0148] In some embodiments, the value of n1 for each conjugate in the composition is independently and optionally from 1 to a maximum of 100% of the antibody (R 2In some embodiments, the value of n1 of each conjugate in the composition is independently and optionally selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27. In some embodiments, the value of n1 of each conjugate in the composition is independently and optionally selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26. In some embodiments, the value of n1 for each conjugate in the composition is independently and arbitrarily selected from integers ranging from 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3. In some embodiments, the average value of n1 for the conjugates in the composition is in the range of 1 to 2, 1 to 3, 1 to 5, 1 to 10, 1 to 26, or 1 to 27.

[0149] In some embodiments, a composition for administration to a subject in the methods described herein comprises (e.g., a trace amount of) an unconjugated antibody and an antibody conjugated to one or more oligonucleotides. In some embodiments, the unconjugated antibody has the formula (I): [R 1 ] n1 -R 2 where n1 is zero. Accordingly, in some embodiments, the composition for administration to a subject in the methods described herein may be referred to as a compound comprising a structure represented by formula (I): [R 1 ] n1 -R 2 In the formula, each R 1 independently comprises a group that comprises an oligonucleotide; R 2 includes an antibody, and n1 independently represents R 1 In some embodiments, the compound of formula (I): [R 1 ] n1 -R 2The proportion of compounds containing a structure represented by the formula (I) is less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%, less than 0.05%, or less than 0.01%, compared to all compounds in the composition represented by the formula (I) where n1 is 1 or more. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0150] In some embodiments, R in a conjugate herein (e.g., a conjugate of a composition provided herein) 1 Each instance of R is conjugated to a different amino acid residue of the antibody. In some embodiments, each different amino acid comprises an ε-amino group (e.g., lysine, arginine). However, in some embodiments, R 1 In some embodiments, each different amino acid to which R is covalently linked is a cysteine. 1 is directly covalently linked to an amino acid residue of the antibody. 1 is indirectly covalently linked to an amino acid of the antibody, e.g., covalently linked to a glycosylation site on the amino acid. In some embodiments, a composition is provided, wherein R 1 In some embodiments, a complex in which R is covalently linked to an amino acid residue in the CDR region of the antibody is present in trace amounts, undetectable amounts, or not at all. 1 However, complexes that are covalently linked to amino acid residues in the CDR regions of the antibody are undetectable in the composition using standard detection techniques.

[0151] In some embodiments, the composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein R in the complex of the composition provided herein is 1 Each example has formula (Ia): [ka] In the formula R 3 includes oligonucleotides, e.g., oligonucleotides comprising the 5'-XYZ-3' configuration; and R 1 is R 2 At attachment point A, R 2 includes antibodies comprising a sequence as set forth in Table 2. For example, in some embodiments, R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 includes an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 3 comprises an oligonucleotide comprising the nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21). 3 comprises an oligonucleotide comprising the structure represented by +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO:21), where +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage. In some embodiments, n1 in each conjugate is independently an integer (e.g., an integer in the range of 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, a composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein further comprises a conjugate where n1 is 0.

[0152] In some embodiments, the composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of formula (I): [R1 ] n1 -R 2 wherein R in the complex of the composition provided herein is 1 Each example has formula (Ib): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:21), wherein n1 represents the R 1 is an integer (e.g., 1 or greater) representing the number of instances of, and each R 1 is R 2 At attachment point A, R 2 includes antibodies comprising a sequence as set forth in Table 2. For example, in some embodiments, R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. 2In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 includes an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 2 includes an antibody that is a Fab fragment. In some embodiments, n1 in each conjugate is independently an integer (e.g., an integer ranging from 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, a composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein further includes a conjugate where n1 is 0.

[0153] In some embodiments, the composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of formula (I): [R 1 ] n1 -R 2 wherein R in the complex of the composition provided herein is 1 Each example has formula (Ic): [ka] In the formula R 1 is R 2 At attachment point A, R 2 includes antibodies comprising a sequence as set forth in Table 2. For example, in some embodiments, R 2 comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2includes an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 2 includes an antibody that is a Fab fragment. In some embodiments, n1 in each conjugate is independently an integer (e.g., an integer ranging from 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, a composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein further includes a conjugate where n1 is 0.

[0154] In some embodiments, the composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein comprises a compound of formula (Id): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21); 2 includes an antibody comprising a sequence as set forth in Table 2; where n1 is an integer (e.g., 1 or more) representing the number of instances of the group enclosed by the brackets, where each instance of the group enclosed by the brackets is covalently linked to a different amino acid residue of the antibody, optionally where each different amino acid residue is a lysine. 2comprises an antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. 2 In some embodiments, R comprises an antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20. 2 In some embodiments, R comprises an antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. 2 includes an antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. 2includes an antibody that is a Fab fragment. In some embodiments, n1 in each conjugate is independently an integer (e.g., an integer ranging from 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, a composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein further includes a conjugate where n1 is 0.

[0155] In some embodiments, the composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein has formula (A): [ka] where y is 0-15 (e.g., 3) and z is 0-15 (e.g., 4). In some embodiments, the amide shown adjacent to an antibody (e.g., an anti-TfR1 antibody) in structure (A) results from reaction with an amine of the antibody, such as a lysine epsilon amine. In some embodiments, the conjugates described herein include an anti-TfR1 antibody (e.g., an anti-TfR1 Fab) covalently linked through a lysine of the antibody to the 5' end of an oligonucleotide (e.g., an oligonucleotide comprising a 5'-XYZ-3' configuration), in some embodiments, the antibody comprises a sequence as set forth in Table 2. For example, in some embodiments, the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; and / or a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16. In some embodiments, the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 17, and / or a light chain variable region (VL) comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 18. In some embodiments, the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17, and / or a VL comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, the antibody comprises a heavy chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 19, and / or a light chain comprising an amino acid sequence at least 85% (e.g., at least 95%) identical to SEQ ID NO: 20.In some embodiments, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or a light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, a F(ab')2 fragment, a scFv, or an Fv. In some embodiments, the antibody is a Fab fragment.

[0156] In some embodiments, a composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, and subcutaneous. Typically, the route of administration is intravenous or subcutaneous.

[0157] Method of Use / Treatment / Administration A conjugate comprising an anti-TfR1 antibody (e.g., a Fab) covalently linked to a molecular payload (e.g., a DMPK-targeting oligonucleotide) as described herein is effective in treating a subject with myotonic dystrophy, e.g., DM1. In some embodiments, the conjugate comprises a molecular payload that is an oligonucleotide, e.g., an oligonucleotide that facilitates reduced expression or activity of DMPK (e.g., reduced levels of mutant or wild-type DMPK RNA) in a subject (e.g., a subject with DM1).

[0158] In some embodiments, the subject may be a human subject, a non-human primate animal subject (e.g., a cynomolgus monkey), a rodent animal subject, or any suitable mammalian subject. In some embodiments, the subject is a human. In some embodiments, the subject is a neonatal or young pediatric human subject (e.g., a human subject less than 4 years old, less than 3 years old, less than 2 years old, less than 1 year old, about 11 months old, about 10 months old, about 9 months old, about 8 months old, about 7 months old, about 6 months old, about 5 months old, about 4 months old, about 3 months old, about 2 months old, or about 1 month old). In some embodiments, the subject is a human subject between 2 and 60 years old (e.g., 2-60, 2-50, 2-40, 2-30, 2-20, 2-10 years old). In some embodiments, the subject is a human subject between 5 and 30 years of age (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 years of age). In some embodiments, the subject is a human subject between the ages of 18 and 50 (e.g., 18-50, 18-45, 18-40, 18-35, 18-30, 18-25, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50). In some embodiments, the subject is a human subject 60 years of age or older (e.g., about 60, about 65, about 70, about 75, or about 80). In some embodiments, the subject is a human subject between 5 and 12 years of age (eg, 5, 6, 7, 8, 9, 10, 11, or 12 years of age).In some embodiments, the subject is administered 4-16 (e.g., 4-16, 5-16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16, 15-16, 4-15, 5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, 14-15, 4-14, 5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14, 13-14, 4-13, 5-13, 6-13, 7-13, 8-1 3, 9-13, 10-13, 11-13, 12-13, 4-12, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12, 11-12, 4-11, 5-11, 6-11, 7-11, 8-11, 9-16, 10-11, 4-10, 5-10, 6-10, 7-10, 8-10, 9-10, 4-9, 5-9, 6-9, 7-9, 8-9, 4-9, 5-9, 6-9, 7-9, 8-9, 4-8, 5-8, 6-8, 7-8, 4-7, 5-7, 6-7, 4-6, 5-6, or 4-5) years of age. In some embodiments, the subject is a human subject who is about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 years of age.

[0159] In some embodiments, the subject may have a myotonic dystrophy, such as DM1. In some embodiments, the subject may have a DMPK allele that may optionally contain a disease-associated repeat, e.g., a CTG trinucleotide repeat expansion. In some embodiments, the subject may have a DMPK allele with an expanded disease-associated repeat comprising about 2-10 repeat units, about 2-50 repeat units, about 2-100 repeat units, about 50-1,000 repeat units, about 50-500 repeat units, about 50-250 repeat units, about 50-100 repeat units, about 500-10,000 repeat units, about 500-5,000 repeat units, about 500-2,500 repeat units, about 500-1,000 repeat units, or about 1,000-10,000 repeat units. In some embodiments, the subject suffers from DM1 symptoms, such as muscle atrophy, muscle loss, excessive daytime sleepiness, or retardation. In some embodiments, the subject does not suffer from DM1 symptoms. In some embodiments, the subject has congenital myotonic dystrophy. In some embodiments, the subject is ambulatory. In some embodiments, the subject is non-ambulatory.

[0160] Aspects of the present disclosure include methods involving administering to a subject an effective amount of a composition (e.g., an aqueous solution) comprising a complex as described herein. In some embodiments, an effective amount of a composition (e.g., an aqueous solution) comprising a complex comprising an anti-TfR1 antibody (e.g., a Fab) described herein covalently linked to an oligonucleotide (e.g., a DMPK-targeting oligonucleotide) described herein may be administered to a subject in need of treatment. In some embodiments, the composition (e.g., an aqueous solution) is administered systemically. In some embodiments, a pharmaceutical composition comprising a complex as described herein may be administered by a suitable route, which may include, for example, intravenous administration, e.g., as a bolus or by continuous infusion over a period of time. In some embodiments, administration may be performed by intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraarticular, intrasynovial, or intrathecal routes. In some embodiments, a composition (e.g., an aqueous solution) comprising a complex as described herein is administered by infusion (e.g., intravenous infusion).

[0161] In some embodiments, compositions comprising multiple conjugates described herein may be in solid, aqueous or liquid form. In some embodiments, the aqueous or liquid form may be sprayed or lyophilized. In some embodiments, the lyophilized form may be reconstituted with an aqueous or liquid solution (e.g., prior to administration, such as by intravenous infusion).

[0162] In some embodiments, provided are methods and / or uses for treating a subject with a DMPK allele associated with myotonic dystrophy (e.g., DM1), comprising administering to the subject a composition comprising a complex or complexes described herein in an effective amount of the complex. In some embodiments, provided are methods and / or uses for reducing expression or activity of DMPK in a subject (e.g., reducing the level of mutant or wild-type DMPK RNA, or the activity of a DMPK gene product), comprising contacting a cell with a composition comprising a complex or complexes described herein in an effective amount of the complex(es). In some embodiments, the method comprises administering a lyophilized form of a composition comprising a complex or complexes described herein (e.g., a lyophilized powder), reconstituting the lyophilized form of the composition in an aqueous solution, and administering the aqueous solution to a subject in need thereof. For example, in some embodiments, a lyophilized form of a composition comprising a complex or complexes is shipped and / or stored in lyophilized form, reconstituted in an aqueous solution at the site for administration (e.g., at a health care provider's site), and administered in reconstituted form (e.g., as an aqueous solution) by injection or intravenously (e.g., by infusion). In some embodiments, the subject has a DMPK allele that optionally contains a disease-associated repeat, e.g., a CTG trinucleotide repeat expansion.

[0163] In some embodiments, the composition is administered via site-specific or local delivery techniques, examples of which include an implanted depot source of the complex, a local delivery catheter, a site-specific carrier, direct injection, or direct application.

[0164] In some aspects, provided herein is a method of reducing the expression or activity of DMPK in a subject (e.g., reducing the level of mutant or wild-type DMPK RNA, or the activity of DMPK gene product).In some aspects, provided herein is a method of treating myotonic dystrophy in a subject (e.g., DM1).In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of a conjugate(s), each conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody (e.g., a Fab) covalently linked to one or more oligonucleotides, wherein the antibody comprises the following: heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NO: 1, 7, or 12; heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NO: 2, 8, or 13; and a light chain complementarity determining region 3 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15; a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11; and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide is and optionally wherein the oligonucleotide comprises a structure represented by +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO:21), where +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents a 5-methyl-2'-MOE-cytidine, and +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridge), oU represents 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage; further optionally wherein the antibody (e.g., Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, further optionally wherein the antibody (e.g., Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20.

[0165] In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of a conjugate(s), wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein R in the complex of the composition provided herein comprises a complex comprising a structure represented by 1 Each example has formula (Ia): [ka] In the formula R 3 comprises an oligonucleotide comprising the nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21), optionally 3 includes an oligonucleotide comprising the structure represented by +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO:21), where +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents a 5-methyl-2'-MOE-cytidine, +C represents a 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents a 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage: R in the formula 2comprises a heavy chain complementarity determining region 1 (CDR-H1) having a sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) having a sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) having a sequence as set forth in SEQ ID NO: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) having a sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) having a sequence as set forth in SEQ ID NO: 5, 16, or 17, a light chain complementarity determining region 3 (CDR-L3) having a sequence as set forth in SEQ ID NO: 6, 18, or 19, a light chain complementarity determining region 4 (CDR-L4) having a sequence as set forth in SEQ ID NO: 7, 19, or 20, a light chain complementarity determining region 5 (CDR-L5) having a sequence as set forth in SEQ ID NO: 8, 10, or 21, a light chain complementarity determining region 6 (CDR-L6) having a sequence as set forth in SEQ ID NO: 9, 11, or 22, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; Each R in the formula 1 is R 2 at the attachment point A, and optionally each R 1 At the connection point A, R 2 to different amino acid residues of an antibody (e.g., a Fab), optionally where each different amino acid residue is a lysine; and wherein n1 in each complex is independently R 1 n1 is an integer equal to or greater than 1 representing the number of instances of the compound of formula (I): [R 1 ] n1 -R 2In the formula, n1 is 0. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0166] In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of a conjugate(s), wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein R in the complex of the composition provided herein comprises a complex comprising a structure represented by 1 Each example has formula (Ib): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:21); R in the formula 2comprises a heavy chain complementarity determining region 1 (CDR-H1) having a sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) having a sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) having a sequence as set forth in SEQ ID NO: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) having a sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) having a sequence as set forth in SEQ ID NO: 5, 16, or 17, a light chain complementarity determining region 3 (CDR-L3) having a sequence as set forth in SEQ ID NO: 6, 18, or 19, a light chain complementarity determining region 4 (CDR-L4) having a sequence as set forth in SEQ ID NO: 7, 19, or 20, a light chain complementarity determining region 5 (CDR-L5) having a sequence as set forth in SEQ ID NO: 8, 10, or 21, a light chain complementarity determining region 6 (CDR-L6) having a sequence as set forth in SEQ ID NO: 9, 11, or 22, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; Each R in the formula 1 is R 2 at the attachment point A, and optionally each R 1 At the connection point A, R 2 to different amino acid residues of an antibody (e.g., a Fab), optionally where each different amino acid residue is a lysine; and wherein n1 in each complex is independently R 1 n1 is an integer equal to or greater than 1 representing the number of instances of the compound of formula (I): [R 1 ] n1 -R 2In the formula, n1 is 0. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0167] In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of a conjugate(s), wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein each R of the complex includes a complex having a structure represented by 1 is represented by the formula (Ic): [ka]

[0043] R in the formula 2heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12; heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13; heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15; an anti-TfR1 antibody (e.g., a Fab) comprising a heavy chain complementarity determining region 2 (CDR-L2), and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., a Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., a Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; Each R in the formula 1 is R 2 at the attachment point A, and optionally each R 1 At the connection point A, R 2 to different amino acid residues of an antibody (e.g., a Fab), optionally where each different amino acid residue is a lysine; and wherein n1 in each complex is independently R 1 n1 is an integer equal to or greater than 1 representing the number of instances of the compound of formula (I): [R 1 ] n1 -R 2In the formula, n1 is 0. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0168] In some embodiments, the methods provided herein include administering to a subject a composition comprising an effective amount of a muscle-targeting complex(es), wherein each complex has the formula (Id): [ka]

[0043] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:21); R in the formula 2The CDR-H1 heavy chain complementarity determining region 1 (CDR-H1) comprises the sequence as set forth in SEQ ID NO: 1, 7, or 12; the CDR-H2 heavy chain complementarity determining region 2 (CDR-H2) comprises the sequence as set forth in SEQ ID NO: 2, 8, or 13; the CDR-H3 heavy chain complementarity determining region 3 (CDR-H3) comprises the sequence as set forth in SEQ ID NO: 3, 9, or 14; the CDR-L1 light chain complementarity determining region 1 (CDR-L1) comprises the sequence as set forth in SEQ ID NO: 4, 10, or 15; the CDR-L2 light chain complementarity determining region 2 (CDR-L2) comprises the sequence as set forth in SEQ ID NO: 5, or 11; an anti-TfR1 antibody (e.g., a Fab) comprising a complementarity determining region 2 (CDR-L2) and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., a Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., a Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and wherein n1 in each conjugate is independently an integer equal to or greater than 1, optionally wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5, and optionally wherein the antibodies (e.g., Fabs) are covalently linked via distinct amino acid residues in the anti-TfR1 antibody (e.g., Fabs), and optionally wherein each distinct amino acid residue is a lysine. In some embodiments, the composition (e.g., in an aqueous solution) for administration to a subject in the methods described herein further comprises a conjugate where n1 is 0. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0169] In some embodiments, the composition of any one of the methods described herein is in an aqueous solution and further comprises tris(hydroxymethyl)aminomethane and sucrose, wherein the tris(hydroxymethyl)aminomethane is present in the aqueous solution at a concentration of 5 mM to 50 mM, and the sucrose is present in the aqueous solution at a concentration of 5 w / v% to 15 w / v%. In some embodiments, the composition of any one of the methods described herein is in an aqueous solution and further comprises tris(hydroxymethyl)aminomethane and sucrose, wherein the tris(hydroxymethyl)aminomethane is present in the aqueous solution at a concentration of 25 mM or about 25 mM, and the sucrose is present in the aqueous solution at a concentration of 10 w / v% or about 10 w / v%, and the composition is at a pH of 7.5 or about 7.5. In some embodiments, the complex is present in the composition at a concentration ranging from 10 mg / mL to 50 mg / mL (e.g., 10 mg / mL, 15 mg / mL, 20 mg / mL, 25 mg / mL, 30 mg / mL, 35 mg / mL, 40 mg / mL, 45 mg / mL, 50 mg / mL).

[0170] In some embodiments, the methods described herein include a method comprising administering to a subject a compound of formula (I): [R 1 ] n1 -R 2 (e.g., comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject. In some embodiments, the effective amount of the conjugate in any one of the methods described herein provides the subject with an amount of anti-TfR1 antibody (e.g., Fab) per kg of subject of the conjugate, where the amount of oligonucleotide per kg of subject of the conjugate provided to the subject can be derived using the equation below (Equation A):

number

[0171] In some embodiments, the methods described herein include a method comprising administering to a subject a compound of formula (I): [R 1 ] n1 -R 2 (e.g., comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject. In some embodiments, the effective amount of the conjugate in any one of the methods described herein provides the subject with an amount of oligonucleotide per kg of subject of the conjugate, where the amount of anti-TfR1 antibody (e.g., Fab) per kg of subject of the conjugate provided to the subject can be derived using the equation below (Equation B):

number

[0172] It should be understood that the average value of n1 need not be an integer, but can be a decimal number. In some embodiments, the present disclosure contemplates a variation in the average value of n1 of up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the average value of n1 of the complexes of the composition is 0.5 to 5 (e.g., 0.5 to 5, 0.5 to 4.5, 0.5 to 4, 0.5 to 3.5, 0.5 to 3, 0.5 to 2.5, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 1 to 5, 1 to 4.5, 1 to 4, 1 to 3.5, 1 to 3, 1 to 2.5, 1 to 2, 1 to 1.5, 1.5 to ... 4.5, 1.5~4, 1.5~3.5, 1.5~3, 1.5~2.5, 1.5~2, 2~5, 2~4.5, 2~4, 2~3.5, 2~3, 2~2.5, 2.5~5, 2.5~4.5, 2.5~4, 2.5~3.5, 2.5~3, 3~5, 3~4.5, 3~4, 3~3.5, 3.5~5, 3.5~4.5, 3.5~4, 4~5, 4~4.5 4.5-5, 0.8-1.5, 0.9-1.4, or 1-1.3) with a variability of up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the methods provided herein include a method for determining whether a compound of formula (I): [R 1 ] n1 -R 2The method includes administering to a subject a composition comprising an effective amount of a conjugate having a structure represented by the formula (e.g., a group represented by formula (Ia), (Ib), (Ic), or (Id)), wherein the average value of n1 of the conjugate of the composition is 0.5 to 5 (e.g., 0.5 to 5, 0.5 to 4.5, 0.5 to 4, 0.5 to 3.5, 0.5 to 3, 0.5 to 2.5, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 1 to 5, 1 to 4.5, 1 to 4, 1 to 3.5, 1~3, 1~2.5, 1~2, 1~1.5, 1.5~5, 1.5~4.5, 1.5~4, 1.5~3.5, 1.5~3, 1.5~2.5, 1.5~2, 2~5, 2~4.5, 2~4, 2~3.5, 2~3, 2~2.5, 2.5~5, 2.5~4.5, 2.5~4, 2.5~3.5, 2.5~3, 3~5, 3~4.5, 3~4, 3~3.5, 3.5~5, 3.5~4.5, 3.5~4, 4~5, 4~4.5 4.5-5, 0.8-1.5, 0.9-1.4, or 1-1.3) with a variability of up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the methods provided herein include a method for determining whether a compound of formula (I): [R 1 ] n1 -R 2 (e.g., comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to a subject, wherein the average value of n1 of the conjugates of the composition is about 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 1, 1.05, 1.1, 1.15, 1.2, 1.25, 1.3, 1.35, 1.4, 1.45, or 1.5, varying by up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the methods provided herein comprise the step of preparing a compound of formula (I): [R 1 ] n1 -R 2(e.g., comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to a subject, wherein the average value of n1 of the conjugates in the composition is about 1.1 or 1.15, with a variation of up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%).

[0173] It should be understood that any amount of anti-TfR1 antibody (e.g., Fab) provided herein can be expressed as an amount of oligonucleotide (e.g., DMPK-targeted oligonucleotide) according to Equation A. Therefore, it should be understood that any description herein of providing any amount of anti-TfR1 antibody (e.g., Fab) can be understood as alternatively providing a corresponding amount of oligonucleotide (e.g., DMPK-targeted oligonucleotide) according to Equation A. Conversely, any amount of oligonucleotide (e.g., DMPK-targeted oligonucleotide) provided herein can be understood as an amount of anti-TfR1 antibody (e.g., Fab) according to Equation B. Therefore, it should be understood that any description herein of providing any amount of oligonucleotide (e.g., DMPK-targeted oligonucleotide) can be understood as alternatively providing a corresponding amount of anti-TfR1 antibody (e.g., Fab) according to Equation B.

[0174] In some embodiments, the methods provided herein comprise the step of preparing a compound of formula (I): [R 1 ] n1 -R 2The method includes administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by (e.g., a group represented by formula (Ia), (Ib), (Ic), or (Id)), wherein the effective amount of the conjugate provides the subject with an amount of anti-TfR1 antibody (e.g., Fab) per kg of the subject of the conjugate, and wherein the amount of oligonucleotide per kg of the conjugate provided to the subject is derived using Equation A provided herein based on the average value of n1 of the conjugates of the composition and the amount of anti-TfR1 antibody (e.g., Fab) per kg of the subject of the conjugate provided to the subject. In some embodiments, the amount of oligonucleotide varies by up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%) from the amount derived from Equation A.

[0175] In some embodiments, the methods provided herein comprise the step of preparing a compound of formula (I): [R 1 ] n1 -R 2 The present invention includes administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by: wherein the composition comprises an amount of oligonucleotide of the conjugate per kg of the subject, and wherein the amount of anti-TfR1 antibody (e.g., Fab) provided to the subject per kg of the subject is derived using Equation B provided herein based on the average value of n1 of the conjugate of the composition and the amount of oligonucleotide of the conjugate provided to the subject per kg of the subject. In some embodiments, the amount of anti-TfR1 antibody (e.g., Fab) varies by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%) from the amount derived from Equation B.

[0176] In some embodiments, for purposes of determining the molecular weight of an oligonucleotide, the oligonucleotide has the following structure: [ka] which corresponds to a molecular weight of 5,667 g / mol.

[0177] In some embodiments, the anti-TfR1 Fab of the conjugate used in the methods described herein (eg, an anti-TfR1 Fab comprising a heavy chain and a light chain provided in Table 2) has a molecular weight of 47,986 g / mol.

[0178] Accordingly, in some embodiments, the methods described herein comprise the step of: 1 ] n1 -R 2 (e.g., comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, wherein the effective amount of the conjugate provides the subject with an amount of anti-TfR1 Fab per kg of the subject, and an amount of oligonucleotide per kg of the subject, wherein the amount of oligonucleotide is as follows:

number

[0179] In some embodiments, the methods described herein include a method comprising administering to a subject a compound of formula (I): [R 1 ] n1 -R 2(e.g., comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, wherein the effective amount of the conjugate provides the subject with an amount of anti-TfR1 Fab per kg of the subject, and an amount of oligonucleotide per kg of the subject, wherein the amount of oligonucleotide is as follows:

number

[0180] In some embodiments, the methods described herein include a method comprising administering to a subject a compound of formula (I): [R 1 ] n1 -R 2 wherein the effective amount of the conjugate provides the subject with an amount of oligonucleotide per kg of subject, and an amount of anti-TfR1 Fab per kg of subject, wherein the amount of anti-TfR1 Fab is as follows:

number

[0181] In some embodiments, the methods described herein include a method comprising administering to a subject a compound of formula (I): [R 1 ] n1 -R 2 wherein the effective amount of the conjugate provides the subject with an amount of oligonucleotide per kg of subject, and an amount of anti-TfR1 Fab per kg of subject, wherein the amount of anti-TfR1 Fab is as follows:

[0182]

number

[0183] In some embodiments, in any one of the methods described herein, the composition is administered to the subject during an administration period. In some embodiments, the administration period is 1 to 24 (e.g., 1 to 24, 2 to 24, 3 to 24, 4 to 24, 5 to 24, 6 to 24, 7 to 24, 8 to 24, 9 to 24, 10 to 24, 11 to 24, 12 to 24, 13 to 24, 14 to 24, 15 to 24, 16 to 24, 17 to 24, 18 to 24, 1 to 18, 1 to 12, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, 2 to 18, 2 to 12, 2 to 8, 2 to 6, 2 to 4, 4 to 18, 4 to 12, 4 to 8, 4 to 6, 6 to 18, 6 to 12, 6 to 8, 8 to 18, 8 to 12, or 12 to 18) months. In some embodiments, the administration period is less than 1 month, less than 2 months, less than 3 months, less than 4 months, less than 5 months, less than 6 months, less than 7 months, less than 8 months, less than 9 months, less than 10 months, less than 11 months, less than 12 months, less than 13 months, less than 14 months, less than 15 months, less than 16 months, less than 17 months, or less than 18 months. In some embodiments, the administration period is 1 to 20 (e.g., 1 to 20, 2 to 20, 3 to 20, 4 to 20, 5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, 11 to 20, 12 to 20, 13 to 20, 14 to 20, 15 to 20, 16 to 20, 17 to 20, 18 to 20, 19 to 20, 2 to 18, 2 to 12, 2 to 10, 2 to 5, 4 to 18, 4 to 12, 4 to 8, 6 to 18, 6 to 12, or 6 to 8) years. In some embodiments, the administration period is less than 1 year, less than 2 years, less than 3 years, less than 4 years, less than 5 years, less than 6 years, less than 7 years, less than 8 years, less than 9 years, less than 10 years, less than 11 years, less than 12 years, less than 13 years, less than 14 years, less than 15 years, less than 16 years, less than 17 years, less than 18 years, less than 19 years, or less than 20 years. In some embodiments, the administration period is at least 1 year, at least 2 years, at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years, at least 10 years, at least 11 years, at least 12 years, at least 13 years, at least 14 years, at least 15 years, at least 16 years, at least 17 years, at least 18 years, at least 19 years, or at least 20 years.In some embodiments, the administration period is 1 to 50 years (e.g., 1 to 50 years, 2 to 50 years, 3 to 50 years, 4 to 50 years, 5 to 50 years, 6 to 50 years, 7 to 50 years, 8 to 50 years, 9 to 50 years, 10 to 50 years, 20 to 50 years, 30 to 50 years, 40 to 50 years, 10 to 20 years, 10 to 30 years, 10 to 40 years, 20 to 30 years, 20 to 40 years, or 30 to 40 years). In some embodiments, the administration period is the remaining lifetime of the subject.

[0184] In some embodiments, the methods described herein include administering to a patient a therapeutically effective amount of a conjugate described herein (e.g., a conjugate having formula (I): [R 1 ] n1 -R 2 [R] (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject once per week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, or once every 16 weeks for the remaining life of the subject. In some embodiments, the methods described herein include administering to the subject an effective amount of a conjugate described herein (e.g., a conjugate comprising a group represented by formula (I): 1 ] n1 -R 2 [R] (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject once every four weeks for the remaining life of the subject. In some embodiments, the methods described herein include administering to the subject an effective amount of a conjugate described herein (e.g., a conjugate comprising a group represented by formula (I): [R] (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject once every four weeks for the remaining life of the subject. 1 ] n1 -R 2 [R] (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject once every 8 weeks for the remaining life of the subject. In some embodiments, the methods described herein include administering to the subject an effective amount of a conjugate described herein (e.g., a conjugate comprising a group represented by formula (I): [R 1 ] n1 -R2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject once every 12 weeks for the remaining life of the subject.

[0185] In some embodiments, the methods described herein include administering to a patient a therapeutically effective amount of a conjugate described herein (e.g., a conjugate having formula (I): [R 1 ] n1 -R 2

[0043] A composition comprising a conjugate comprising a structure represented by formula (I): [R 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject once every 4 weeks to once every 16 weeks (e.g., once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, or once every 16 weeks) during the second administration period. In some embodiments, the first administration period is 2 to 24 weeks (e.g., 2 to 24, 2 to 20, 2 to 26, 2 to 12, 2 to 8, 2 to 4, 4 to 24, 4 to 20, 4 to 16, 4 to 12, 4 to 8, 8 to 24, 8 to 20, 8 to 16, 8 to 12, 12 to 24, 12 to 20, 12 to 16, 16 to 24, 16 to 20, or 20 to 24 weeks). In some embodiments, the first administration period is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 weeks. In some embodiments, the second administration period is 4 weeks to the remaining life of the subject (e.g., 4, 8, 12, 16, 18, 20, 22, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, 80, 84, 88, 92, 96 weeks or longer to the remaining life of the subject). In some embodiments, the first administration period is 8 weeks and the second administration period is 16 weeks. In some embodiments, the first administration period is 8 weeks and the second administration period is the remaining life of the subject.

[0186] In some embodiments, each administration during the first administration period comprises a conjugate (e.g., a compound of Formula (I): [R 1 ] n1 -R 2 In some embodiments, each administration during the first administration period provides the subject with a conjugate (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) in the same amount as each administration during the second administration period. In some embodiments, each administration during the first administration period provides the subject with a conjugate (e.g., a conjugate comprising a group represented by formula (I): [R 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) is provided to the subject in a different amount with each administration during the second administration period.

[0187] In some embodiments, the methods described herein include administering to a patient a therapeutically effective amount of a conjugate described herein (e.g., a conjugate having formula (I): [R 1 ] n1 -R 2

[0036] A composition comprising a conjugate comprising a structure represented by formula (I): [R 1 ] n1 -R 2

[0036] The present invention also includes administering a composition comprising a conjugate (e.g., a conjugate comprising a group represented by Formula (Ia), (Ib), (Ic), or (Id)) to the subject once every 8 weeks during a second administration period of 16 weeks, 24 weeks, 32 weeks, 40 weeks, 48 ​​weeks, 56 weeks, 64 weeks, 72 weeks, 80 weeks, 88 weeks, 96 weeks, 104 weeks, 112 weeks, 120 weeks, 128 weeks, 136 weeks, 144 weeks, 152 weeks, 160 weeks, or longer, or the remaining life span of the subject, wherein each administration during the first administration period comprises administering a composition comprising a conjugate (e.g., a conjugate comprising a group represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) is provided to the subject in the same amount as in each administration during the second administration period.

[0188] In some embodiments, the methods described herein include administering to a patient a therapeutically effective amount of a conjugate described herein (e.g., a conjugate having formula (I): [R 1 ] n1 -R 2

[0036] A composition comprising a conjugate comprising a structure represented by formula (I): [R 1 ] n1 -R 2

[0036] The present invention also includes administering a composition comprising a conjugate (e.g., a conjugate comprising a group represented by Formula (Ia), (Ib), (Ic), or (Id)) to the subject once every 8 weeks during a second administration period of 16 weeks, 24 weeks, 32 weeks, 40 weeks, 48 ​​weeks, 56 weeks, 64 weeks, 72 weeks, 80 weeks, 88 weeks, 96 weeks, 104 weeks, 112 weeks, 120 weeks, 128 weeks, 136 weeks, 144 weeks, 152 weeks, 160 weeks, or longer, or the remaining life span of the subject, wherein each administration during the first administration period comprises administering a composition comprising a conjugate (e.g., a conjugate comprising a group represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) is provided to the subject in a different amount with each administration during the second administration period.

[0189] In some embodiments, in any one of the methods described herein, additional administrations may be given to the subject during any administration period.

[0190] In some embodiments, in any one of the methods described herein, an effective amount of a conjugate (e.g., a compound of formula (I): [R 1 ] n1 -R 2(e.g., a complex containing a group represented by formula (Ia), (Ib), (Ic), or (Id)) is administered in an amount of 2 mg to 220 mg (e.g., 2 mg to 220 mg, 5 mg to 220 mg, 5 mg to 210 mg, 5 mg to 200 mg, 5 mg to 190 mg, 5 mg to 180 mg, 5 mg to 170 mg, 5 mg to 160 mg, 5 mg to 150 mg, 5 mg to 140 mg, 5 mg to 130 mg, 5 mg to 120 mg, 5 mg to 110 mg, 5 mg to 100 mg, 5 mg to 90 mg, 5 mg to 80 mg, 5 mg to 75 mg, 5 mg to 80 mg, 5 mg to 90 ... mg, 5mg~70mg, 5mg~60mg, 5mg~50mg, 5mg~40mg, 5mg~30mg, 5mg~20mg, 5mg~10mg, 8mg~220mg, 8mg~210mg, 8mg~200mg, 8mg~190mg, 8mg~180mg, 8mg~170mg , 8mg~160mg, 8mg~150mg, 8mg~140mg, 8mg~130mg, 8mg~120mg, 8mg~110mg, 8mg~100mg, 8mg~90mg, 8mg~80mg, 8mg~75mg, 8mg~70mg, 8mg~60mg, 8mg~50mg, 8mg~40mg, 8mg~35mg, 8mg~30mg, 8mg~25mg, 8mg~20mg, 8mg~15mg, 8mg~13mg, 10mg~150mg, 10mg~140mg, 10mg~130mg, 10mg~120mg, 10mg~110mg, 10mg~10 0mg, 10mg~90mg, 10mg~80mg, 10mg~70mg, 10mg~60mg, 10mg~50mg, 10mg~40mg, 10mg~30mg, 10mg~20mg, 13mg~150mg, 13mg~140mg, 13mg~130mg, 13mg~120 mg, 13mg~110mg, 13mg~100mg, 13mg~90mg, 13mg~80mg, 13mg~75mg, 13mg~70mg, 13mg~60mg, 13mg~50mg, 13mg~40mg, 13mg~35mg, 13mg~30mg, 13mg~25mg, 13mg~20mg, 13mg~15mg, 15mg~150mg, 15mg~140mg, 15mg~130mg, 15mg~120mg, 15mg~110mg, 15mg~100mg, 15mg~90mg, 15mg~80mg, 15mg~75mg, 15mg~70mg,15mg~60mg, 15mg~50mg, 15mg~40mg, 15mg~35mg, 15mg~30mg, 15mg~25mg, 15mg~20mg, 20mg~100mg, 20mg~90mg, 20mg~80mg, 20mg~75mg, 20mg~70mg, 20mg~60mg, 20mg~50 mg, 20mg~40mg, 20mg~30mg, 20mg~25mg, 25mg~90mg, 25mg~80mg, 25mg~75mg, 25mg~70mg, 25mg~60mg, 25mg~50mg, 25mg~40mg, 25mg~35mg, 25mg~30mg, 30mg~100mg, 30mg~ 90 mg, 30 mg to 80 mg, 30 mg to 75 mg, 30 mg to 70 mg, 30 mg to 60 mg, 30 mg to 50 mg, 30 mg to 40 mg, 40 mg to 100 mg, 40 mg to 90 mg, 40 mg to 80 mg, 40 mg to 75 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 100 mg, 50 mg to 90 mg, 50 mg to 80 mg, 50 mg to 75 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 100 mg, 60 mg to 90 mg, 60 mg to 80 mg, 60 mg to 75 mg, or 60 mg to 70 mg) of an anti-TfR1 antibody (e.g., Fab) is provided to a subject. In some embodiments, in any one of the methods described herein, an effective amount of a complex (e.g., a complex of formula (I): [R, 1 ] n1 -R 2(e.g., a complex containing a group represented by formula (Ia), (Ib), (Ic), or (Id)) may be administered in an amount of about 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, 30 mg, 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, 50 mg, 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 61 mg, 62 mg, 63 mg, 64 mg, 65 mg, 66 mg, 67 mg, 68 mg, 69 mg, 70 mg, 71 mg, 72 mg, 73 mg, 74 mg, 75 mg, 76 mg, 77 mg, 78 mg, 79 mg, 80 mg, 81 mg, 82 mg, 83 mg, 84 mg, 85 mg, 86 mg, 87 mg, 88 mg, 89 mg, 90 mg, 91 mg, 92 mg, 93 mg, 94 mg, 95 mg, 96 mg, 97 mg, 98 mg, 99 mg, mg, 33mg, 34mg, 35mg, 36mg, 37mg, 38mg, 39mg, 40mg, 41mg, 42mg, 43mg, 44mg, 45mg, 46mg, 47mg, 48mg, 49mg, 50mg, 51mg, 52mg , 53mg, 54mg, 55mg, 56mg, 57mg, 58mg, 59mg, 60mg, 61mg, 62mg, 63mg, 64mg, 65mg, 66mg, 67mg, 68mg, 69mg, 70mg, 71mg, 72mg, 7 3mg, 74mg, 75mg, 76mg, 77mg, 78mg, 79mg, 80mg, 81mg, 82mg, 83mg, 84mg, 85mg, 86mg, 87mg, 88mg, 89mg, 90mg, 91mg, 92mg, 93m g, 94mg, 95mg, 96mg, 97mg, 98mg, 99mg, 100mg, 101mg, 102mg, 103mg, 104mg, 105mg, 106mg, 107mg, 108mg, 109mg, 110mg, 111m g, 112 mg, 113 mg, 114 mg, 115 mg, 116 mg, 117 mg, 118 mg, 119 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, 150 mg, 155 mg, 160 mg, 165 mg, 170 mg, 175 mg, 180 mg, 185 mg, 190 mg, 195 mg, 200 mg, 205 mg, 210 mg, 215 mg, or 220 mg of an anti-TfR1 antibody (e.g., Fab) is provided to the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), values ​​may vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%).

[0191] In some embodiments, in any one of the methods described herein, an effective amount of a conjugate (e.g., a compound of formula (I): [R 1 ] n1 -R 2(e.g., a complex containing a group represented by formula (Ia), (Ib), (Ic), or (Id)) is administered in an amount of 0.5 mg to 20 mg (e.g., 0.5 mg to 20 mg, 1 mg to 20 mg, 1 mg to 15 mg, 1 mg to 12 mg, 1 mg to 10 mg, 1 mg to 9 mg, 1 mg to 8 mg, 1 mg to 7 mg, 1 mg to 6 mg, 1 mg to 5 mg, 1 mg to 4 mg, 1 mg to 3 mg, 1 mg to 2 mg, 2 mg to 20 mg, 2 mg to 15 mg, 2 mg to 12 mg) of the complex per kg of the subject. , 2mg~10mg, 2mg~9mg, 2mg~8mg, 2mg~7mg, 2mg~6mg, 2mg~5mg, 2mg~4mg, 2mg~3mg, 3mg~20mg, 3mg~15mg, 3mg~12mg, 3mg~10mg, 3mg~9mg, 3m g~8mg, 3mg~7mg, 3mg~6mg, 3mg~5mg, 3mg~4mg, 3.5mg~20mg, 3.5mg~15mg, 3.5mg~12mg, 3.5mg~10mg, 3.5mg~9mg, 3.5mg~8mg, 3.5mg~7mg, 3.5mg~6mg, 3.5mg~5mg, 3.5mg~4mg, 4mg~20mg, 4mg~15mg, 4mg~12mg, 4mg~10mg, 4mg~9mg, 4mg~8mg, 4mg~7mg, 4mg~6mg, 4mg~5mg, 5mg~20 mg, 5mg~15mg, 5mg~12mg, 5mg~10mg, 5mg~9mg, 5mg~8mg, 5mg~7mg, 5mg~6mg, 6mg~20mg, 6mg~15mg, 6mg~12mg, 6mg~10mg, 6mg~9mg, 6mg~8m g, 6 mg to 7 mg, 7 mg to 20 mg, 7 mg to 15 mg, 7 mg to 12 mg, 7 mg to 10 mg, 7 mg to 9 mg, 7 mg to 8 mg, 8 mg to 20 mg, 8 mg to 15 mg, 8 mg to 12 mg, 8 mg to 10 mg, 8 mg to 9 mg, 9 mg to 20 mg, 9 mg to 15 mg, 9 mg to 12 mg, 9 mg to 10 mg, 10 mg to 20 mg, 10 mg to 15 mg, 10 mg to 12 mg, 12 mg to 20 mg, 12 mg to 15 mg, or 15 mg to 20 mg of oligonucleotide. In some embodiments, in any one of the methods described herein, an effective amount of a complex (e.g., a complex of formula (I): [R 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) may be administered in an amount of about 0.5 mg, 1 mg, 1.1 mg, 1.5 mg, 1.8 mg, 2 mg, 2.5 mg, 3 mg, 3.4 mg, 3.5 mg, 4 mg, 4.1 mg, 4.5 mg, 5 mg, 5.5 mg, 6 mg, 6.5 mg, 6.8 mg, 7 mg, 7.5 mg, Provide 8mg, 8.2mg, 8.5mg, 9mg, 9.5mg, 10mg, 10.2mg, 10.5mg, 11mg, 11.5mg, 12mg, 12.5mg, 13mg, 13.5mg, 14mg, 14.5mg, 15mg, 15.5mg, 16mg, 16.5mg, 17mg, 17.5mg, 18mg, 18.5mg, 19mg, 19.5mg or 20mg of oligonucleotide to subject.In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (for example, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%).

[0192] In some embodiments, the methods described herein include administering to a subject a subject an effective amount of a conjugate (e.g., a conjugate having formula (I): [R 1 ] n1 -R 2(e.g., a conjugate having a group represented by formula (Ia), (Ib), (Ic), or (Id)) to a subject, wherein the effective amount (for example, for each administration) is 10 mg to 110 mg (for example, 10 mg to 110 mg, 10 mg to 100 mg, 10 mg to 90 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 10 ... 0mg~60mg, 10mg~50mg, 10mg~40mg, 10mg~30mg, 10mg~20mg, 20mg~110mg, 20mg~100mg, 20mg~90mg, 20mg~80m g, 20mg~70mg, 20mg~60mg, 20mg~50mg, 20mg~40mg, 20mg~30mg, 30mg~110mg, 30mg~100mg, 30mg~90mg, 30mg~ 80mg, 30mg~70mg, 30mg~60mg, 30mg~50mg, 30mg~40mg, 40mg~110mg, 40mg~100mg, 40mg~90mg, 40mg~80mg, 40 mg~70mg, 40mg~60mg, 40mg~50mg, 50mg~110mg, 50mg~100mg, 50mg~90mg, 50mg~80mg, 50mg~70mg, 50mg~60mg , 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 90 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 90 mg, 70 mg to 80 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 110 mg) of an anti-TfR1 antibody to a subject. 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to a subject, where the effective amount (e.g., for each administration) provides the subject with about 13 mg, about 25 mg, about 50 mg, or about 75 mg of anti-TfR1 antibody per kg of the subject of the conjugate. In some embodiments, the effective amount (e.g., for each administration) provides the subject with about 29 mg or about 37 mg of anti-TfR1 antibody per kg of the subject of the conjugate. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value may vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0193] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2

[0036] In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 13 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0194] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ]n1 -R 2

[0036] In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 25 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0195] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1] n1 -R 2

[0036] In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 29 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0196] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R1 ] n1 -R 2

[0036] In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 37 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0197] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2

[0036] In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 50 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0198] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2

[0036] In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 75 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0199] In some embodiments, the methods described herein include administering to a subject a subject an effective amount of a conjugate (e.g., a conjugate having formula (I): [R 1 ] n1 -R 2(e.g., a conjugate having a group represented by formula (Ia), (Ib), (Ic), or (Id)) to a subject, where an effective amount (for example, for each administration) is 5 mg to 90 mg (for example, 5 mg to 90 mg, 5 mg to 80 mg, 5 mg to 70 mg, 5 mg to 60 mg, 5 mg to 50 mg, 5 mg to 40 mg, 5 mg to 30 mg, 5 mg to 20 mg, 5 mg to 10 mg, 10 mg to 90 mg, 10 mg to 80 mg, 10 mg to 70 mg, 10 mg to 60 mg, 10 mg to 50 mg, 10 mg to 40 mg, 10 mg to 30 mg, 10 mg to 20 mg, 20 mg to 90 mg) of the conjugate per kg of the subject. g, 20mg-80mg, 20mg-70mg, 20mg-60mg, 20mg-50mg, 20mg-40mg, 20mg-30mg, 30mg-90mg, 30mg-80mg, 30mg-70mg, 30mg-60mg, 30mg-50mg, 30mg-40mg, 40mg-90mg, 40mg-80mg, 40mg-70mg, 40mg-60mg, 40mg-50mg, 50mg-90mg, 50mg-80mg, 50mg-70mg, 50mg-60mg, 60mg-90mg, 60mg-80mg, 60mg-70mg, 70mg-90mg, 70mg-80mg, or 80mg-90mg) of an anti-TfR1 antibody is provided to the subject. In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) provides the subject with about 8 mg, about 15 mg, about 30 mg, or about 60 mg of anti-TfR1 antibody per kg of the subject of the conjugate. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0200] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2

[0036] In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ]n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 8 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0201] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) is from 11 mg to 22 mg (e.g., from 11 mg to 22 mg, 11.5 mg to 20 mg, 12 mg to 19 mg, 12.5 mg to 18 mg, 13 mg to 17 mg, 14 mg to 16 mg) of conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by formula (I): [R1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 15 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0202] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2

[0036] In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 30 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0203] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R1 ] n1 -R 2

[0036] In some embodiments, the methods described herein include administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 60 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody (e.g., Fab), the value can vary by up to 45% (e.g., up to ±45%, up to ±40%, up to ±35%, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0204] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) is from 36.8 mg to 58.9 mg (e.g., from 36.8 mg to 58.9 mg, 36.8 mg to 51.5 mg, 36.8 mg to 44.2 mg, 44.2 mg to 58.9 mg, 44.2 mg to 51.5 mg, or 51.5 mg to 58.9 mg) of conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) of the conjugate provides the subject with about 36.8 mg of anti-TfR1 antibody per kg of the subject. In some embodiments, for any of the above amounts of anti-TfR1 antibody, the value can vary by up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for the remaining life of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0205] In some embodiments, the methods described herein include administering to a subject a subject an effective amount of a conjugate (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2(e.g., a conjugate having a group represented by formula (Ia), (Ib), (Ic), or (Id)) to a subject, where an effective amount (for example, for each administration) is 1 mg to 14 mg (for example, 1 mg to 14 mg, 1 mg to 13 mg, 1 mg to 12 mg, 1 mg to 11 mg, 1 mg to 10 mg, 1 mg to 9 mg, 1 mg to 8 mg, 1 mg to 7 mg, 1 mg to 6 mg, 1 mg to 5 mg, 1 mg to 4 mg, 1 mg to 3 mg, 1 mg to 2 mg, 2 mg to 3 mg, 3 mg to 4 mg, 4 mg to 5 mg, 5 mg to 6 mg, 5 mg to 7 mg, 6 mg to 8 mg, 7 mg to 8 mg, 8 mg to 9 mg, 9 mg to 10 mg, 1 ... g~14mg, 2mg~13mg, 2mg~12mg, 2mg~11mg, 2mg~10mg, 2mg~9mg, 2mg~8mg, 2mg~7mg, 2mg~6mg, 2mg~5mg, 2mg~4mg, 2mg~3mg, 3mg~14mg, 3mg~13mg, 3mg~12mg, 3mg~11mg, 3mg~10mg, 3mg~9mg, 3mg~8mg, 3mg~7mg, 3mg~6mg, 3mg~5mg, 3mg~4mg, 4mg~14mg, 4mg~13mg, 4mg~12mg, 4mg~11mg, 4mg~10m g, 4mg~9mg, 4mg~8mg, 4mg~7mg, 4mg~6mg, 4mg~5mg, 5mg~14mg, 5mg~13mg, 5mg~12mg, 5mg~11mg, 5mg~10mg, 5mg~9mg, 5mg~8mg, 5mg~7mg, 5mg~6m g, 6mg~14mg, 6mg~13mg, 6mg~12mg, 6mg~11mg, 6mg~10mg, 6mg~9mg, 6mg~8mg, 6mg~7mg, 7mg~14mg, 7mg~13mg, 7mg~12mg, 7mg~11mg, 7mg~10mg, 7 In some embodiments, the methods described herein provide a subject with an oligonucleotide of formula (I): [R 1 ]n1 -R 2 The present invention includes administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by formula (Ia), (Ib), (Ic), or (Id), for example, a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id), wherein the effective amount (for example, for each administration) provides the subject with about 1.8 mg, about 3.4 mg, about 6.8 mg, or about 10.2 mg of oligonucleotide per kg of the subject of the conjugate. In some embodiments, the effective amount (for example, for each administration) provides the subject with about 4 mg or about 5 mg of oligonucleotide per kg of the subject of the conjugate. In some embodiments, for any of the above amounts of oligonucleotide, the value may vary by up to 30% (for example, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (for example, for a period such as the remaining lifespan of the subject). In some embodiments, the composition is administered once every 8 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0206] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2[R] to the subject, where the effective amount (e.g., for each administration) is from 1.2 mg to 2.4 mg (e.g., from 1.2 mg to 2.4 mg, 1.1 mg to 2.3 mg, 1.2 mg to 2.2 mg, 1.3 mg to 2.1 mg, 1.4 mg to 2 mg, 1.5 mg to 1.9 mg, or 1.6 mg to 1.85 mg) of the conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, wherein the effective amount (e.g., for each administration) provides the subject with about 1.8 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 8 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 12 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0207] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) is from 2.2 mg to 4.5 mg (e.g., from 2.2 mg to 4.5 mg, 2.4 mg to 4.4 mg, 2.5 mg to 4.3 mg, 2.6 mg to 4.2 mg, 2.7 mg to 4.1 mg, 2.8 mg to 4 mg, 2.9 mg to 3.9 mg, 3 mg to 3.8 mg, 3.1 mg to 3.7 mg, 3.2 mg to 3.6 mg, or 3.3 mg to 3.5 mg) of conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) is from 2.2 mg to 4.5 mg (e.g., from 2.2 mg to 4.5 mg, 2.4 mg to 4.4 mg, 2.5 mg to 4.3 mg, 2.6 mg to 4.2 mg, 2.7 mg to 4.1 mg, 2.8 mg to 4 mg, 2.9 mg to 3.9 mg, 3 mg to 3.8 mg, 3.1 mg to 3.7 mg, 3.2 mg to 3.6 mg, or 3.3 mg to 3.5 mg) of anti-TfR1 antibody per kg of the subject. 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, wherein the effective amount (for example, for each administration) provides the subject with about 3.4 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (for example, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 8 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0208] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 [R] to the subject, where the effective amount (e.g., for each administration) is from 2.7 mg to 5.3 mg (e.g., from 2.7 mg to 5.3 mg, from 2.8 mg to 5.8 mg, from 3 mg to 5.5 mg, from 3.2 mg to 5 mg, or from 3.8 mg to 4.2 mg) of the conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (for example, for each administration) provides the subject with about 4 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (for example, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 8 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0209] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 [R] to the subject, where the effective amount (e.g., for each administration) is from 3 mg to 7 mg (e.g., from 3 mg to 7 mg, from 3.5 mg to 6.6 mg, from 4 mg to 6 mg, from 4.2 mg to 5.8 mg, or from 4.8 mg to 5.2 mg) of oligonucleotide per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)), where the effective amount (e.g., for each administration) is from 3 mg to 7 mg (e.g., from 3 mg to 7 mg, from 3.5 mg to 6.6 mg, from 4 mg to 6 mg, from 4.2 mg to 5.8 mg, or from 4.8 mg to 5.2 mg) of conjugate. 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) provides the subject with about 5 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 8 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 12 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0210] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 The method includes administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by formula (I): [R 1 , (Ib), (Ic), or (Id) (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)), where the effective amount (e.g., for each administration) is 4.5 mg to 9 mg of conjugate (e.g., 4.5 mg to 9 mg, 4.7 mg to 8.8 mg, 4.9 mg to 8.6 mg, 5.1 mg to 8.4 mg, 5.3 mg to 8.2 mg, 5.5 mg to 8 mg, 5.7 mg to 7.8 mg, 5.9 mg to 7.6 mg, 6.1 mg to 7.4 mg, 6.3 mg to 7.2 mg, 6.5 mg to 7 mg, or 6.6 mg to 6.8 mg) of oligonucleotide per kg of the subject. In some embodiments, the methods described herein provide a conjugate described herein (e.g., a conjugate comprising a group represented by formula (I): [R 1 , (Ib), (Ic), or (Id)) of the conjugate to the subject. 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, wherein the effective amount (for example, for each administration) provides the subject with about 6.8 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (for example, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 8 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0211] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 [R] to the subject, where the effective amount (e.g., for each administration) is from 7 mg to 14 mg (e.g., from 7 mg to 14 mg, from 7.5 mg to 13.5 mg, from 8 mg to 13 mg, from 8.5 mg to 12.5 mg, from 9 mg to 12 mg, from 9.5 mg to 11.5 mg, or from 10 mg to 11 mg) of the conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, wherein the effective amount (for example, for each administration) provides the subject with about 10.2 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (for example, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (for example, for the remaining life of the subject). In some embodiments, the composition is administered once every 8 weeks (for example, for the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (for example, for the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0212] In some embodiments, the methods described herein include administering to a subject a subject an effective amount of a conjugate (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to a subject, wherein an effective amount (for example, for each administration) is from 0.5 mg to 12 mg (for example, from 0.5 mg to 12 mg, from 0.5 mg to 12 mg, from 0.5 mg to 11 mg, from 0.5 mg to 10 mg, from 0.5 mg to 9 mg, from 0.5 mg to 8 mg, from 0.5 mg to 7 mg, from 0.5 mg to 6 mg, from 0.5 mg to 7 ... .5mg~5mg, 0.5mg~4mg, 0.5mg~3mg, 0.5mg~2mg, 0.5mg~1mg, 1mg~12mg, 1mg~11mg, 1mg~10mg, 1mg~9mg, 1mg~8mg, 1mg~7mg, 1mg~6 mg, 1mg~5mg, 1mg~4mg, 1mg~3mg, 1mg~2mg, 2mg~12mg, 2mg~11mg, 2mg~10mg, 2mg~9mg, 2mg~8mg, 2mg~7mg, 2mg~6mg, 2mg~5mg, 2mg~ 4mg, 2mg~3mg, 3mg~12mg, 3mg~11mg, 3mg~10mg, 3mg~9mg, 3mg~8mg, 3mg~7mg, 3mg~6mg, 3mg~5mg, 3mg~4mg, 4mg~12mg, 4mg~11mg, 4mg~10mg, 4mg~9mg, 4mg~8mg, 4mg~7mg, 4mg~6mg, 4mg~5mg, 5mg~12mg, 5mg~11mg, 5mg~10mg, 5mg~9mg, 5mg~8mg, 5mg~7mg, 5mg~6 In some embodiments, the methods described herein provide a subject with an oligonucleotide having a concentration of 1000 to 12000 mg, 6 mg to 12 mg, 6 mg to 11 mg, 6 mg to 10 mg, 6 mg to 9 mg, 6 mg to 8 mg, 6 mg to 7 mg, 7 mg to 12 mg, 7 mg to 11 mg, 7 mg to 10 mg, 7 mg to 9 mg, 7 mg to 8 mg, 8 mg to 12 mg, 8 mg to 11 mg, 8 mg to 10 mg, 8 mg to 9 mg, 9 mg to 12 mg, 9 mg to 11 mg, 9 mg to 10 mg, 10 mg to 12 mg, 10 mg to 11 mg, or 11 mg to 12 mg. 1 ] n1 -R 2The present invention includes administering to a subject a composition comprising an effective amount of a conjugate comprising a structure represented by formula (Ia), (Ib), (Ic), or (Id), for example, a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id), where the effective amount (for example, for each administration) provides the subject with about 1.1 mg, about 2 mg, about 4.1 mg, or about 8.2 mg of oligonucleotide per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (for example, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (for example, for the remaining life of the subject). In some embodiments, the composition is administered once every 8 weeks (for example, for the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (e.g., for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject).

[0213] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 [R 2 ], (Ib), (Ic), or (Id) (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) provides 0.7 mg to 1.5 mg (e.g., 0.7 mg to 1.5 mg, 0.8 mg to 1.4 mg, 0.9 mg to 1.3 mg, or 1 mg to 1.2 mg) of conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by formula (I): [R 2 ], (Ib), (Ic), or (Id) (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)), where the effective amount (e.g., for each administration) provides 0.7 mg to 1.5 mg (e.g., 0.7 mg to 1.5 mg, 0.8 mg to 1.4 mg, 0.9 mg to 1.3 mg, or 1 mg to 1.2 mg) of conjugate per kg of the subject. 1 ] n1 -R 2(e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, wherein the effective amount (for example, for each administration) provides the subject with about 1.1 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (for example, up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 8 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 12 weeks (for example, for a period such as the remaining life of the subject). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0214] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 [R] to the subject, where the effective amount (e.g., for each administration) is from 1.4 mg to 2.7 mg (e.g., from 1.4 mg to 2.7 mg, from 1.5 mg to 2.6 mg, from 1.6 mg to 2.5 mg, from 1.7 mg to 2.4 mg, from 1.8 mg to 2.3 mg, from 1.9 mg to 2.2 mg, or from 1.95 mg to 2.1 mg) of the conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ] n1 -R2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) provides the subject with about 2 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 8 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 12 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0215] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 [R], (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) is from 2.7 mg to 5.4 mg (e.g., from 2.7 mg to 5.4 mg, 2.9 mg to 5.2 mg, 3.1 mg to 5 mg, 3.3 mg to 4.8 mg, 3.5 mg to 4.6 mg, 3.7 mg to 4.3 mg, 3.9 mg to 4.2 mg, or 4 mg to 4.15 mg) of conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by formula (I): [R], (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id) 1 ]n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) provides the subject with about 4.1 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 8 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 12 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0216] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 [R] to the subject, where the effective amount (e.g., for each administration) is from 5 mg to 11 mg (e.g., 5 mg to 11 mg, 5.5 mg to 10.5 mg, 6 mg to 10 mg, 6.5 mg to 9.5 mg, 7 mg to 9 mg, 7.5 mg to 8.5 mg, or 8 mg to 8.3 mg) of the conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by Formula (I): [R 1 ]n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (for example, for each administration) provides the subject with about 8.2 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 8 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 12 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0217] It should be understood that once every 4 weeks is substantially similar to once every month, once every 8 weeks is substantially similar to once every 2 months, once every 12 weeks is substantially similar to once every 3 months, and once every 16 weeks is substantially similar to once every 4 months.Therefore, in some embodiments, once every 4 weeks can mean once every month; once every 8 weeks can mean once every 2 months; once every 12 weeks can mean once every 3 months; and once every 16 weeks can mean once every 4 months.Similarly, in some embodiments, once every 4 weeks can mean 12 times per year; once every 8 weeks can mean 6 times per year; and once every 12 weeks can mean 4 times per year.

[0218] In some embodiments, the methods described herein include a method for producing a conjugate described herein (e.g., a conjugate of formula (I): [R 1 ] n1 -R 2 [R 2 ], (Ib), (Ic), or (Id) (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)), where the effective amount (e.g., for each administration) provides 5 mg to 8 mg (e.g., 5 mg to 8 mg, 5 mg to 7 mg, 5 mg to 6 mg, 6 mg to 8 mg, 6 mg to 7 mg, or 7 mg to 8 mg) of conjugate per kg of the subject. In some embodiments, the methods described herein include administering to the subject a composition comprising an effective amount of a conjugate comprising a structure represented by formula (I): [R 2 ], (Ib), (Ic), or (Id) (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)), where the effective amount (e.g., for each administration) provides 5 mg to 8 mg of conjugate per kg of the subject (e.g., 5 mg to 8 mg, 5 mg to 7 mg, 5 mg to 6 mg, 6 mg to 8 mg, 6 mg to 7 mg, or 7 mg to 8 mg) of oligonucleotide per kg of the subject. 1 ] n1 -R 2 (e.g., a conjugate comprising a group represented by formula (Ia), (Ib), (Ic), or (Id)) to the subject, where the effective amount (e.g., for each administration) provides the subject with about 5 mg of oligonucleotide of the conjugate per kg of the subject. In some embodiments, for any of the above amounts of oligonucleotide, the value can vary by up to 30% (e.g., up to ±30%, up to ±25%, up to ±20%, up to ±15%, up to ±10%, up to ±5%, up to ±3%, or up to ±1%). In some embodiments, the composition is administered once every 4 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 8 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 12 weeks (e.g., for the remainder of the subject's life). In some embodiments, the composition is administered once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by once every 8 weeks during a second administration period (e.g., 16 weeks through the remaining life of the subject).

[0219] In some embodiments, the methods described herein include administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising conjugates (e.g., in an aqueous solution), where each conjugate has the formula (I): [R 1 ] n1 -R 2 In the formula, each R 1 is represented by formula (Ia): [ka]

[0043] In the formula, R 3 comprises an oligonucleotide comprising the nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO: 21), optionally 3 includes an oligonucleotide comprising the structure represented by +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO:21), where +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents a 5-methyl-2'-MOE-cytidine, +C represents a 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents a 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage: R in the formula 2comprises a heavy chain complementarity determining region 1 (CDR-H1) having a sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) having a sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) having a sequence as set forth in SEQ ID NO: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) having a sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) having a sequence as set forth in SEQ ID NO: 5, 16, or 17, a light chain complementarity determining region 3 (CDR-L3) having a sequence as set forth in SEQ ID NO: 6, 18, or 19, a light chain complementarity determining region 4 (CDR-L4) having a sequence as set forth in SEQ ID NO: 7, 19, or 20, a light chain complementarity determining region 5 (CDR-L5) having a sequence as set forth in SEQ ID NO: 8, 10, or 21, a light chain complementarity determining region 6 (CDR-L6) having a sequence as set forth in SEQ ID NO: 9, 11, or 22, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; Each R in the formula 1 is R 2 at the attachment point A, and optionally each R 1 is R at the connection point A. 2 to different amino acid residues of an antibody (e.g., a Fab), optionally where each different amino acid residue is a lysine; and wherein n1 in each complex is independently R 1 is an integer equal to or greater than 1 representing the number of instances of, optionally wherein the average value of n1 for the complexes of the composition is in the range of 1 to 5; and Here, the effective amount of each administration provides the subject with 5 mg to 110 mg (e.g., 8 mg to 60 mg or 13 mg to 75 mg) of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the effective amount of each administration provides the subject with about 13 mg, about 25 mg, about 50 mg, or about 75 mg of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the effective amount of each administration provides the subject with about 5 mg, about 15 mg, about 30 mg, or about 60 mg of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the subject is administered the composition once every 4 weeks or once every 8 weeks. In some embodiments, the subject is administered the composition once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by administration of the composition once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject). In some embodiments, the composition comprising a conjugate for administration to a subject in the methods described herein further comprises a compound represented by formula (I): [R 1 ] n1 -R 2 In the formula, n1 is 0. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0220] In some embodiments, the methods described herein include administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising conjugates (e.g., in an aqueous solution), where each conjugate has the formula (I): [R 1 ] n1 -R 2In the formula, each R 1 is represented by formula (Ib): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:21); R in the formula 2 comprises a heavy chain complementarity determining region 1 (CDR-H1) having a sequence as set forth in SEQ ID NO: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) having a sequence as set forth in SEQ ID NO: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) having a sequence as set forth in SEQ ID NO: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) having a sequence as set forth in SEQ ID NO: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) having a sequence as set forth in SEQ ID NO: 5, 16, or 17, a light chain complementarity determining region 3 (CDR-L3) having a sequence as set forth in SEQ ID NO: 6, 18, or 19, a light chain complementarity determining region 4 (CDR-L4) having a sequence as set forth in SEQ ID NO: 7, 19, or 20, a light chain complementarity determining region 5 (CDR-L5) having a sequence as set forth in SEQ ID NO: 8, 10, or 21, a light chain complementarity determining region 6 (CDR-L6) having a sequence as set forth in SEQ ID NO: 9, 11, or 22, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; Each R in the formula 1 is R 2 at the attachment point A, and optionally each R 1 is R at the connection point A. 2to different amino acid residues of an antibody (e.g., a Fab), optionally where each different amino acid residue is a lysine; and wherein n1 in each complex is independently R 1 is an integer equal to or greater than 1 representing the number of instances of, optionally wherein the average value of n1 for the complexes of the composition is in the range of 1 to 5. Here, the effective amount of each administration provides the subject with 5 mg to 110 mg (e.g., 8 mg to 60 mg or 13 mg to 75 mg) of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the effective amount of each administration provides the subject with about 13 mg, about 25 mg, about 50 mg, or about 75 mg of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the effective amount of each administration provides the subject with about 5 mg, about 15 mg, about 30 mg, or about 60 mg of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the subject is administered the composition once every 4 weeks or once every 8 weeks. In some embodiments, the subject is administered the composition once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by administration of the composition once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject). In some embodiments, the composition comprising a conjugate for administration to a subject in the methods described herein further comprises a compound represented by formula (I): [R 1 ] n1 -R 2 In the formula, n1 is 0. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0221] In some embodiments, the methods described herein include administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising conjugates (e.g., in an aqueous solution), where each conjugate has the formula (I): [R 1 ] n1 -R 2 In the formula, each R of the complex 1 is represented by the formula (Ic): [ka]

[0043] R in the formula 2 heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence as set forth in SEQ ID NO: 1, 7, or 12; heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence as set forth in SEQ ID NO: 2, 8, or 13; heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14; light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15; an anti-TfR1 antibody (e.g., a Fab) comprising a heavy chain complementarity determining region 2 (CDR-L2), and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., a Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., a Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; Each R in the formula 1 is R 2 at the attachment point A, and optionally each R 1 At the connection point A, R 2 to different amino acid residues of an antibody (e.g., a Fab), optionally where each different amino acid residue is a lysine; and wherein n1 in each complex is independently R 1is an integer equal to or greater than 1 representing the number of instances of, optionally wherein the average value of n1 for the complexes of the composition is in the range of 1 to 5; Here, the effective amount of each administration provides the subject with 5 mg to 110 mg (e.g., 8 mg to 60 mg or 13 mg to 75 mg) of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the effective amount of each administration provides the subject with about 13 mg, about 25 mg, about 50 mg, or about 75 mg of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the effective amount of each administration provides the subject with about 5 mg, about 15 mg, about 30 mg, or about 60 mg of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the subject is administered the composition once every 4 weeks or once every 8 weeks. In some embodiments, the subject is administered the composition once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by administration of the composition once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject). In some embodiments, the composition comprising a conjugate for administration to a subject in the methods described herein further comprises a compound represented by formula (I): [R 1 ] n1 -R 2 In the formula, n1 is 0. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0222] In some embodiments, the methods described herein include administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising conjugates (e.g., in an aqueous solution), where each conjugate has the formula (Id): [ka]

[0043] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:21); R in the formula 2 The CDR-H1 heavy chain complementarity determining region 1 (CDR-H1) comprises the sequence as set forth in SEQ ID NO: 1, 7, or 12; the CDR-H2 heavy chain complementarity determining region 2 (CDR-H2) comprises the sequence as set forth in SEQ ID NO: 2, 8, or 13; the CDR-H3 heavy chain complementarity determining region 3 (CDR-H3) comprises the sequence as set forth in SEQ ID NO: 3, 9, or 14; the CDR-L1 light chain complementarity determining region 1 (CDR-L1) comprises the sequence as set forth in SEQ ID NO: 4, 10, or 15; the CDR-L2 light chain complementarity determining region 2 (CDR-L2) comprises the sequence as set forth in SEQ ID NO: 5, or 11; an anti-TfR1 antibody (e.g., a Fab) comprising a complementarity determining region 2 (CDR-L2) and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NO: 6 or 16, optionally wherein the antibody (e.g., a Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and a VL comprising the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., a Fab) comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20; and wherein n1 in each conjugate is independently an integer greater than or equal to 1, and optionally wherein the average value of n1 for the conjugates of the composition is in the range of 1 to 5; Here, the effective amount of each administration provides the subject with 5 mg to 110 mg (e.g., 8 mg to 60 mg or 13 mg to 75 mg) of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the effective amount of each administration provides the subject with about 13 mg, about 25 mg, about 50 mg, or about 75 mg of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the effective amount of each administration provides the subject with about 5 mg, about 15 mg, about 30 mg, or about 60 mg of the anti-TfR1 antibody (e.g., Fab) of the conjugate per kg of the subject. In some embodiments, the subject is administered the composition once every 4 weeks or once every 8 weeks. In some embodiments, the subject is administered the composition once every 4 weeks during a first administration period (e.g., 8 weeks, 12 weeks, or 16 weeks), followed by administration of the composition once every 8 weeks during a second administration period (e.g., 16 weeks to the remaining life of the subject). In some embodiments, the composition comprising a conjugate for administration to a subject in the methods described herein further comprises a compound represented by formula (I): [R 1 ] n1 -R 2 In the formula, n1 is 0. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0223] In some embodiments, the methods described herein include administering intravenously (e.g., via intravenous infusion) an effective amount of a composition comprising conjugates (e.g., in an aqueous solution), where each conjugate comprises a group represented by formula (Ia), (Ib), (Ic), or (Id), and where each effective amount of administration provides the subject with 0.5 mg to 20 mg (e.g., 1 mg to 14 mg or 0.5 mg to 12 mg) of conjugate oligonucleotide per kg of the subject. In some embodiments, each effective amount of administration provides the subject with about 1.8 mg, about 3.4 mg, about 6.8 mg, or about 10.2 mg of conjugate oligonucleotide per kg of the subject. In some embodiments, each effective amount of administration provides the subject with about 1.1 mg, about 2 mg, about 4.1 mg, or about 8.2 mg of conjugate oligonucleotide per kg of the subject. In some embodiments, the subject is administered the composition once every 4 weeks or once every 8 weeks. In some embodiments, the composition comprising the complex (e.g., in an aqueous solution) for administration to a subject in the methods described herein further comprises a complex, wherein n1 is 0. Thus, in some embodiments, the average value of n1 of the complexes in the compositions disclosed herein is in the range of 0.5 to 5 (e.g., 0.5 to 5, 1 to 5, 1 to 4, 1 to 3, 3 to 5, 0.5 to 4, 0.5 to 3, 0.5 to 2, 0.5 to 1.5, 0.5 to 1, 0.7 to 1.5, 1 to 1.6, 1 to 1.5, 1 to 1.4, 1 to 1.3, 1 to 1.2, 1.1 to 1.5, 0.8 to 2, 0.8 to 1.5, 0.8 to 1.3, 0.8 to 1.2, 0.8 to 1.1, 0.9 to 3, 0.9 to 2, 0.9 to 1.8, 0.9 to 1.6, 0.9 to 1.5, 0.9 to 1.4, 0.9 to 1.3, or 0.9 to 1.2).

[0224] In some embodiments, administration of an effective amount of a composition comprising the complex according to any one of the methods described herein reduces the expression or activity of DMPK (e.g., reduces the level of mutant or wild-type DMPK RNA or reduces the activity of the DMPK gene product) in a subject (e.g., a subject with DM1). In some embodiments, administration of a composition comprising an effective amount of the complex according to any one of the methods described herein results in a reduction in DMPK expression or activity (e.g., the level of mutant or wild-type DMPK RNA or the activity of a DMPK gene product) in a subject by at least 1% (e.g., at least 1%, at least 2%, at least 3%, at least 4%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%) compared to a control. In some embodiments, the control is the level of DMPK expression or activity in a healthy subject (e.g., a subject not having myotonic dystrophy). In some embodiments, the control is the level of DMPK expression or activity in a subject not having mutated DMPK RNA. In some embodiments, the control is the level of DMPK expression or activity in the subject prior to administration to the subject of a composition comprising an effective amount of the conjugate.

[0225] In some embodiments, any one of the methods described herein may further comprise the additional step of administering to the subject a composition comprising a complex described herein.

[0226] example Example 1. In vivo tissue distribution of conjugates containing anti-TfR1 Fab conjugated to DMPK-targeted oligonucleotides in a DM1 mouse model A conjugate comprising an anti-TfR1 Fab conjugated to a DMPK-targeting oligonucleotide (ASO) was tested in a mouse model expressing both human TfR1 and a human DMPK mutant carrying an expanded CUG repeat. The anti-TfR1 Fab used has the VH / VL sequence provided in Table 2. The Fab was covalently linked (through lysine conjugation) via a linker comprising a valine-citrulline sequence to a DMPK-targeting oligonucleotide comprising the nucleobase sequence of SEQ ID NO:21. The conjugate has the formula (Id): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-O-methoxyethyl (MOE) modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, * represents a phosphorothioate internucleoside linkage, and wherein the oligonucleotide comprises a nucleobase sequence of CAGCGCCCACCAGUCA (SEQ ID NO:21), and wherein R 2 is an anti-TfR1 Fab provided in Table 2, and where in each conjugate, n1 is independently an integer from 1 to 3.

[0227] The conjugate was intravenously administered to mice on days 0 and 7 at a dose equivalent to 9.7 mg / kg ASO each time. Tissue exposure of ASO was tested by hybridization ELISA (Burki et al., Nucleic Acid Ther. 2015 Oct;25(5):275-84, incorporated herein by reference), and the levels of ASO in tissues were graphed. Figure 1A, Figure 1B, Figure 1C, and Figure 1D show the amount of ASO in the heart, diaphragm, gastrocnemius, or tibialis anterior muscle, respectively, two weeks after the first injection. These results demonstrate that conjugates containing anti-TfR1 antibodies (for example, anti-TfR1 Fab with the VH and VL sequences provided in Table 2) can deliver oligonucleotides (for example, DMPK-targeted ASO) to various muscle tissues after intravenous administration.

[0228] Example 2. Sustained knockdown of toxic human DMPK in hTfR1 / DMSXL homozygous mice 4 weeks after repeated dosing of anti-TfR1 Fab-ASO conjugate Conjugates containing anti-TfR1 Fab covalently linked to DMPK-targeting oligonucleotides (ASOs) as described in Example 1 (labeled as "anti-TfR1 Fab-ASO conjugates" in this example) were tested in a mouse model (hTfR1 / DMSXL mice) expressing both human TfR1 and two copies of a mutant human DMPK transgene carrying an expanded CUG repeat. Mice were administered either vehicle control (PBS) or a 10 mg / kg ASO-equivalent dose of anti-TfR1 Fab-ASO conjugate on days 0 and 7. Mice were sacrificed on day 28 (4 weeks after administration of the first dose of anti-TfR1 Fab-ASO conjugate) and tissues were collected. RNA was extracted and selected tissue samples were fixed, paraffin-embedded, sectioned, and then subjected to in situ hybridization. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) of RNA samples was performed to measure human DMPK and mouse Ppib (peptidyl prolyl isomerase) as an internal control. DMPK expression is shown in Figures 2A-2D as geometric mean + / - standard deviation (n=6-9). Significance was assessed by Student's t-test (****P<0.0001).

[0229] Figure 2A shows that anti-TfR1 Fab-ASO conjugates knocked down DMPK expression in the heart by 49% compared to PBS-treated mice. Figure 2B shows that anti-TfR1 Fab-ASO conjugates knocked down DMPK expression in the diaphragm by 40% compared to PBS-treated mice. Figure 2C shows that anti-TfR1 Fab-ASO conjugates knocked down DMPK expression in the tibialis anterior muscle by 49% compared to PBS-treated mice. Figure 2D shows that anti-TfR1 Fab-ASO conjugates knocked down DMPK expression in the gastrocnemius muscle by 44% compared to PBS-treated mice.

[0230] Figures 3A and 3B show that anti-TfR1 Fab-ASO conjugates reduced DMPK-ForS in the nuclei of myofibers. Figure 3A shows reduced DMPK-ForS by in situ hybridization, and Figure 3B shows quantification of DMPK-ForS in fluorescent microscopy images, demonstrating that the conjugates reduced ForS area by 49%. Data are presented as mean + / - standard deviation (n=7). Significance was assessed by t-test (*P<0.05).

[0231] These results demonstrate that administration of the anti-TfR1 Fab-ASO conjugate leads to robust and sustained knockdown of human toxic DMPK in cardiac and skeletal muscle.

[0232] Example 3. Correction of splicing defects in hTfR1 / DMSXL homozygous mice by anti-TfR1 Fab-ASO conjugates A conjugate as described in Example 2 (labeled in this example as "anti-TfR1 Fab-ASO conjugate") containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) was tested in a mouse model expressing both human TfR1 and two copies of a mutant human DMPK transgene carrying an expanded CUG repeat ("hTfR1 / DMSXL"). These mice are known to display splicing defects consistent with those observed in patients suffering from DM1 (Huguet, et al. (2012) PLOS Genetics 8(11):e1003043). Mice were administered either a vehicle control ("hTfR1 / DMSXL-PBS") or a 10 mg / kg ASO-equivalent dose of the anti-TfR1 Fab-ASO conjugate ("hTfR1 / DMSXL-conjugate") on days 0 and 7. Mice expressing only human TfR1 but not mutant human DMPK transgene (hTfR1 mice) and mice treated with PBS ("hTfR1-PBS") were used as additional controls to define the extent of the splicing phenotype in hTfR1 / DMSXL mice and to assess the magnitude of the effect of the conjugate on splicing. Mice were sacrificed on day 28 (4 weeks after administration of the first dose of anti-TfR1 Fab-ASO conjugate), tissues were collected, and RNA was extracted. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to measure exon inclusion in a set of RNAs known to be misspliced ​​during DM1 progression in humans and mice (Nakamori, et al. (2013) Ann. Neurol. 74(6):862-872; Huguet, et al. (2012) PLOS Genetics 8(11):e1003043).Exon inclusion was calculated as the normalized percent spliced ​​in (PSI) for each splicing RNA marker, and composite splicing indices were calculated using the normalized PSI values ​​from splicing markers in the heart (Figure 4), diaphragm (Figure 5), tibialis anterior (Figure 6), and gastrocnemius (Figure 7). Composite splicing indices were calculated as previously described (Tanner MK, et al. (2021) Nucleic Acids Res. 49: 2240-2254) and are shown as the mean + / - standard deviation.

[0233] 4 shows that anti-TfR1 Fab-ASO conjugates corrected splicing in cardiac tissue from hTfR1 / DMSXL mice, as demonstrated by composite splicing index data. The normalized PSI values ​​used to generate composite splicing index data showed correction of Mbnl2 exon 6 (E6) and Nfix E7 splicing, but not Ldb3 E11 splicing, in cardiac tissue from hTfR1 / DMSXL mice upon treatment with anti-TfR1 Fab-ASO conjugates. The composite splicing index data shown in Figure 4 was based on splicing data for Ldb3 E11, Mbnl2 E6, and Nfix E7; Bin1 E11, Dtna E12, Insr E11, and Mbnl2 E5 were not included because their normalized PSI values ​​in cardiac tissue were not altered in hTfR1 / DMSXL mice compared to hTfR1 mice under the experimental conditions tested.

[0234] 5 shows that anti-TfR1 Fab-ASO conjugates corrected splicing in diaphragm tissue of hTfR1 / DMSXL mice, as demonstrated by composite splicing index data. The normalized PSI values ​​used to generate composite splicing index data showed correction of splicing of Bin1 E11, Insr E11, Ldb3 E11, and Nfix E7 in diaphragm tissue of hTfR1 / DMSXL mice by treatment with anti-TfR1 Fab-ASO conjugates. The composite splicing index data shown in Figure 7 was based on splicing data for Bin1 E11, Insr E11, Ldb3 E11, and Nfix E7; Dtna E12, Mbnl2 E5, Mbnl2 E6, and Ttn E313 were not included because their normalized PSI values ​​in diaphragm tissue were unchanged in hTfR1 / DMSXL mice compared to hTfR1 mice under the experimental conditions tested.

[0235] 6 shows that anti-TfR1 Fab-ASO conjugates corrected splicing in tibialis anterior muscle tissue of hTfR1 / DMSXL mice, as demonstrated by composite splicing index data. The normalized PSI values ​​used to generate composite splicing index data showed correction of Bin1 E11, Ldb3 E11, and Nfix E7 splicing, but not Mbnl2 E6 splicing, in tibialis anterior muscle tissue of hTfR1 / DMSXL mice by treatment with anti-TfR1 Fab-ASO conjugates. The composite splicing index data shown in Figure 6 was based on splicing data for Bin1 E11, Ldb3 E11, Mbnl2 E6, and Nfix E7; Dtna E12, Insr E11, Mbnl2 E5, and Ttn E313 were not included because their normalized PSI values ​​in tibialis anterior muscle tissue were not altered in hTfR1 / DMSXL mice compared to hTfR1 mice under the experimental conditions tested.

[0236] 7 shows that anti-TfR1 Fab-ASO conjugates did not correct splicing in gastrocnemius tissue from hTfR1 / DMSXL mice, as demonstrated by composite splicing index data. The normalized PSI values ​​used to generate composite splicing index data showed correction of splicing of Mbnl2 E6, Nfix E7, and Ttn E313 in gastrocnemius tissue from hTfR1 / DMSXL mice by treatment with anti-TfR1 Fab-ASO conjugates. The composite splicing index data shown in Figure 7 was based on splicing data for Mbnl2 E6, Nfix E7, and Ttn E313; Bin1 E11, Dtna E12, Insr E11, Ldb3 E11, and Mbnl2 E5 were not included because their normalized PSI values ​​in gastrocnemius muscle tissue were not altered in hTfR1 / DMSXL mice compared to hTfR1 mice under the experimental conditions tested.

[0237] These results demonstrate that administration of the anti-TfR1 Fab-ASO conjugate facilitates the correction of the DM1 splicing defect in cardiac and skeletal muscles.

[0238] Example 4. DMPK knockdown in non-human primates and DM1 patient myotubes A conjugate as described in Example 1 (labeled in this example as "anti-TfR1 Fab-ASO conjugate") containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) was tested in human DM1 patient myotubes (32F cells) and in non-human primate (NHP) myotubes. The DM1 patient myotubes used express both mutant DMPK mRNA containing 380 CUG repeats and wild-type DMPK mRNA. The NHP myotubes used express only wild-type DMPK.

[0239] DM1 patient cells or NHP cells were seeded in 96-well plates in growth medium at a density of 50,000 cells per well and allowed to recover overnight. The next day, growth medium was replaced with low serum differentiation medium and cells were treated with conjugates at concentrations equivalent to 125 nM, 250 nM, or 500 nM ASO. Cells were incubated for 10 days and then cDNA was synthesized using the Cells-to-Ct kit with crude cell lysate as the source of total RNA.

[0240] cDNA was used to assess total DMPK knockdown using Taqman PCR. Data were normalized to PPIB expression and -ΔΔCt The method was used to determine DMPK knockdown relative to PBS-treated controls ("vehicle"). Data shown in Figure 8 are presented as mean DMPK expression + standard deviation (n=4 replicates per condition) relative to species-matched vehicle controls.

[0241] The results show that the anti-TfR1 Fab-ASO conjugate, when administered at physiologically relevant concentrations (FIG. 8), achieved knockdown of DMPK expression in both normal NHP myotubes and DM1 patient myotubes, with greater knockdown of DMPK expression in DM1 patient cells (expressing both DMPK mRNA containing 380 CUG repeats and wild-type DMPK mRNA) compared to NHP cells (expressing only wild-type DMPK mRNA). At an ASO equivalent concentration of 125 nM, the conjugate achieved approximately 40% DMPK knockdown compared to vehicle-only controls in NHP myotubes and approximately 65% ​​DMPK knockdown in DM1 patient myotubes. At an ASO equivalent concentration of 250 nM, the conjugate achieved approximately 45% DMPK knockdown compared to vehicle-only controls in NHP myotubes and approximately 80% DMPK knockdown in DM1 patient myotubes. The conjugate achieved approximately 60% DMPK knockdown compared to vehicle only controls in NHP myotubes and approximately 90% DMPK knockdown in DM1 patient myotubes at an ASO equivalent concentration of 500 nM.

[0242] These results indicate that conjugates containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide can achieve greater knockdown of DMPK in human myotubes expressing both wild-type and mutant DMPK mRNA (with an expanded CUG repeat) compared to cynomolgus monkey myotubes expressing wild-type DMPK.

[0243] Example 5. DMPK knockdown in hTfR1 / DMSXL hemizygous mice 12 weeks after administration of anti-TfR1 Fab-ASO conjugate Conjugates containing anti-TfR1 Fab covalently linked to DMPK-targeting oligonucleotides (ASOs) as described in Example 1 were tested in hTfR1 / DMSXL hemizygous mouse models. Mutant human DMPK expression was monitored in various tissues for 12 weeks after intravenous administration to mice via the tail vein. Mice were administered the conjugates at a 20 mg / kg ASO equivalent dose. Heart, diaphragm, gastrocnemius, and tibialis anterior tissues were harvested. Mutant human DMPK knockdown was measured by quantitative PCR (qPCR) for the expression of DMPK mRNA. DMPK knockdown in treated mice was assayed 1 week (7 days), 2 weeks (14 days), 4 weeks (28 days), 8 weeks (56 days), and 12 weeks (84 days) after administration of anti-TfR1 Fab-ASO conjugates.

[0244] Figures 9A, 9B, 9C, and 9D show mutant human DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius tissues of treated mice, respectively, compared to control (PBS-treated) mice. Maximal knockdown of DMPK was generally achieved 2-4 weeks after treatment, after which DMPK knockdown declined. Expression of mutant human DMPK in the heart remained suppressed for up to 3 months after administration of the conjugate. Data are presented as mean + / - standard deviation (n=5-12 replicates per tissue).

[0245] These data indicate efficacy of the administered anti-TfR1 Fab-ASO conjugates for at least 2 weeks after treatment.

[0246] Example 6. DMPK knockdown in hTfR1 / DMSXL hemizygous mice following administration of anti-TfR1 Fab-ASO conjugates Conjugates containing anti-TfR1 Fab covalently linked to DMPK-targeting oligonucleotides (ASOs) as described in Example 1 were further tested in hTfR1 / DMSXL hemizygous mouse models. DMPK expression in various tissues was assessed 4 weeks after treatment with the same dosage of anti-TfR1 Fab-ASO conjugates administered either in a single dose or in two separate doses. Mice received either a single dose of conjugate equivalent to 10 mg / kg ASO, or two doses of conjugate (each dose equivalent to 5 mg / kg ASO). Mice receiving two 5 mg / kg doses received the doses either 1 week or 2 weeks apart. Mice receiving two 5 mg / kg doses received the doses either 1 week or 2 weeks apart.

[0247] Four weeks (28 days) after administration of the final dose (either a 10 mg / kg dose or a second dose of two 5 mg / kg doses), DMPK knockdown and ASO levels were assessed in various muscle tissues. Figures 10A, 10B, 10C, and 10D show DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius muscle tissues of treated mice, respectively, compared to control (vehicle-treated) mice. Mice treated with all dosing regimens sustained knockdown of toxic human DMPK for up to 4 weeks. Mice treated with all dosing regimens sustained knockdown of toxic human DMPK for up to 4 weeks. Data are presented as mean + standard deviation (n=6 replicates per tissue). Significance was determined by one-way ANOVA.

[0248] These results indicate that administering anti-TfR1 Fab-ASO conjugates to a subject in temporally spaced doses can enhance the efficacy of DMPK knockdown without increasing the total dose of ASO administered to the subject.

[0249] Example 7. DMPK knockdown in hTfR1 / DMSXL hemizygous mice following administration of anti-TfR1 Fab-ASO conjugates Conjugates as described in Example 1 containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) were further tested in an hTfR1 / DMSXL hemizygous mouse model administered either in a single dose or in two doses spaced one week apart. Conjugates as described in Example 1 containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) were further tested in an hTfR1 / DMSXL hemizygous mouse model administered either in a single dose or in two doses spaced one week apart.

[0250] Figures 11A, 11B, 11C, and 11D show mutant human DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius tissues of mice treated with either a single 5 mg / kg ASO equivalent dose, a single 10 mg / kg ASO equivalent dose, or a 20 mg / kg ASO equivalent dose of the conjugate, respectively. DMPK knockdown was assessed 28 days after administration of the conjugate. A dose-dependent trend in toxic human DMPK knockdown was observed, with approximately similar effects at the 10 mg / kg and 20 mg / kg doses tested at the 28 day time point. When measured 28 days after administration of the complex, a 5 mg / kg dose resulted in 30% knockdown in the heart, 26% knockdown in the diaphragm, 39% knockdown in the tibialis anterior muscle, and 19% knockdown in the gastrocnemius muscle; a 10 mg / kg dose resulted in 46% knockdown in the heart, 51% knockdown in the diaphragm, 46% knockdown in the tibialis anterior muscle, and 42% knockdown in the gastrocnemius muscle; and a 20 mg / kg dose resulted in 41% knockdown in the heart, 47% knockdown in the diaphragm, 53% knockdown in the tibialis anterior muscle, and 40% knockdown in the gastrocnemius muscle. Data are presented as mean value + / - standard deviation. Significance was determined by one-way ANOVA.

[0251] Figures 12A, 12B, 12C, and 12D show human mutant DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius tissues of mice treated with two 5 mg / kg ASO equivalent doses (total 10 mg / kg) or two 10 mg / kg ASO equivalent doses (total 20 mg / kg) of the conjugate, respectively. The two 5 mg / kg ASO equivalent doses and the two 10 mg / kg ASO equivalent doses were administered one week apart. DMPK knockdown was assessed 28 days after administration of the first dose to the mice (i.e., 21 days after the second dose was administered). A dose-dependent effect on DMPK knockdown was observed in all tissues assayed. When measured 28 days after administration of the first dose of the complex, two 5 mg / kg doses of the complex resulted in 36% knockdown in the heart, 34% knockdown in the diaphragm, 36% knockdown in the gastrocnemius, and 38% knockdown in the tibialis anterior; two 10 mg / kg doses of the complex resulted in 51% knockdown in the heart, 78% knockdown in the diaphragm, 64% knockdown in the gastrocnemius, and 57% knockdown in the tibialis anterior. Data are presented as mean ± standard deviation (n=5-6 replicates per tissue). Significance was determined by Brown-Forsythe and Welch ANOVA tests with Dunnett's T3 multiple comparison test.

[0252] The anti-TfR1 Fab-ASO conjugate was also tested in hTfR1 / DMSXL hemizygous mice after four monthly doses of the conjugate were administered to the mice. The conjugate was administered as four 5 mg / kg ASO equivalent doses or four 10 mg / kg ASO equivalent doses of the conjugate, each administered four weeks apart (days 0, 28, 56, and 84, respectively). DMPK knockdown was assessed in various tissues 112 days (16 weeks) after administration of the first dose to the mice. Figures 13A, 13B, 13C, and 13D show human mutant DMPK expression in the heart, diaphragm, tibialis anterior, and gastrocnemius tissues, respectively, of mice treated with the conjugate. DMPK knockdown was observed in all tissues tested, with both tibialis anterior and gastrocnemius muscles showing a statistically significant increase in knockdown in mice receiving four 10 mg / kg ASO equivalent doses compared to mice receiving four 5 mg / kg doses. Four monthly 5 mg / kg doses of the complex resulted in 50% knockdown in the heart, 43% knockdown in the diaphragm, 45% knockdown in the gastrocnemius, and 47% knockdown in the tibialis anterior muscle, as measured 112 days after administration of the first dose of the complex; and four monthly 10 mg / kg doses of the complex resulted in 48% knockdown in the heart, 51% knockdown in the diaphragm, 64% knockdown in the gastrocnemius, and 59% knockdown in the tibialis anterior muscle. Data are presented as mean ± standard deviation (n=5-6 replicates per tissue). Significance was determined by ANOVA test followed by uncorrected Fisher's least significant difference test.

[0253] These results show the effect of various doses of the anti-TfR1 Fab-ASO conjugate on the expression of toxic human DMPK and suggest that the efficacy of the conjugate can be enhanced by dividing the dosage of the conjugate.

[0254] Example 8. DMPK knockdown in non-human primates following administration of anti-TfR1 Fab-ASO conjugates Conjugates as described in Example 1 containing an anti-TfR1 Fab covalently linked to a DMPK-targeting oligonucleotide (ASO) were tested in a non-human primate (NHP) model (cynomolgus monkey, Macaca fascicularis) at dosages informed by the mouse studies described in Examples 5 to 7. DMPK expression was assessed in various tissues after treatment with the conjugates, as measured using a quantitative PCR assay (qPCR) for expression of DMPK mRNA.

[0255] 14A and 14B show DMPK expression in gastrocnemius and tibialis anterior tissues of NHPs treated with approximately 10 mg / kg ASO-equivalent dose of the conjugate, measured 4, 8, and 12 weeks after intravenous infusion of the conjugate, respectively. Expression is shown relative to expression in vehicle-only control animals. Expression in animals administered the conjugate was decreased relative to the control group at each time point tested (gastrocnemius relative expression at 4, 8, and 12 weeks post-dosing was 0.54, 0.47, and 0.61, respectively; tibialis anterior relative expression at 4, 8, and 12 weeks post-dosing was 0.75, 0.48, and 0.72, respectively). Data are presented as mean + / - standard deviation. Significance was determined by unpaired t-test.

[0256] Figures 15A, 15B, 15C, and 15D show DMPK expression in heart, diaphragm, tibialis anterior, and gastrocnemius tissues of NHPs treated with either 5 mg / kg or 10 mg / kg ASO-equivalent doses of the conjugate, respectively, compared to control (vehicle-treated) animals. DMPK knockdown was assessed 4 weeks after administration of the conjugate. A dose-dependent effect of the conjugate on DMPK knockdown was observed in cardiac and skeletal muscles. At the time points assayed, a 5 mg / kg dose resulted in 21% knockdown in heart, 43% knockdown in diaphragm, 22% knockdown in gastrocnemius, and 25% knockdown in tibialis anterior; and a 10 mg / kg dose resulted in 38% knockdown in heart, 60% knockdown in diaphragm, 30% knockdown in gastrocnemius, and 35% knockdown in tibialis anterior. These results were consistent with the dosage effect previously observed in the hTfR1 / DMSXL mouse model. Data are presented as mean + / - standard deviation. Significance was determined by one-way ANOVA with Dunnett's post-hoc analysis.

[0257] Figures 16A, 16B, 16C, 16D, 16E, 16F, and 16G show DMPK expression in heart, diaphragm, tibialis anterior, gastrocnemius, masseter, esophagus, and duodenum tissues of NHPs treated with either two 5 mg / kg or two 10 mg / kg ASO-equivalent doses of the conjugate, the two doses administered 4 weeks (28 days) apart. DMPK knockdown was assessed 8 weeks after administration of the first dose of the conjugate. Monthly administration of the anti-TfR1 Fab-ASO conjugate led to sustained DMPK knockdown across all tissues assayed. Monthly administration of the 10 mg / kg ASO-equivalent dose led to the greatest and most significant knockdown of WT DMPK in tissues relevant to DM1 pathology. When measured 8 weeks after administration of the first dose, two 5 mg / kg ASO equivalent doses of the complex resulted in 24% knockdown in the heart, 41% knockdown in the diaphragm, 56% knockdown in the gastrocnemius, 45% knockdown in the tibialis anterior, 39% knockdown in the masseter, 21% knockdown in the esophagus, and 28% knockdown in the duodenum; two 10 mg / kg ASO equivalent doses of the complex resulted in 34% knockdown in the heart, 64% knockdown in the diaphragm, 70% knockdown in the gastrocnemius, 65% knockdown in the tibialis anterior, 60% knockdown in the masseter, 49% knockdown in the esophagus, and 67% knockdown in the duodenum. Data are presented as mean + / - standard deviation. Significance was determined by one-way ANOVA followed by uncorrected Fisher's least significant difference (LSD) test.

[0258] These results show that the anti-TfR1 Fab-ASO conjugate is efficacious in the NHP model, and further indicate long-term efficacy of the conjugate when administered monthly, consistent with previous results obtained in a mouse model recapitulating the pathogenesis of DM1. Additional Aspects 1. A method of reducing DMPK expression in a subject, comprising administering to the subject a composition comprising an effective amount of a conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with between 5 mg and 110 mg of the anti-TfR1 antibody of the conjugate per kg of the subject, wherein the antibody has the following: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NO: 1, 7, or 12; a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NO: 2, 8, or 13; a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in sequence number 3, 9, or 14; a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15; a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11; and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide of the conjugate comprises the nucleobase sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21). 2. A method of treating myotonic dystrophy in a subject, comprising administering to the subject a composition comprising an effective amount of a conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein the effective amount provides the subject with between 5 mg and 110 mg of anti-TfR1 antibody per kg of the subject of the conjugate, wherein the antibody comprises the following: heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NO: 1, 7, or 12; heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NO: 2, 8, or 13; , heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14, light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide of the complex comprises the nucleobase sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21). 3. A method of reducing DMPK expression in a subject, comprising administering to the subject a composition comprising an effective amount of a conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 1 mg to 12 mg of oligonucleotide of the conjugate per kg of the subject, wherein the antibody has the following: heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NO: 1, 7, or 12; heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NO: 2, 8, or 13; a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in sequence number 3, 9, or 14; a light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15; a light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11; and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide of the conjugate comprises the nucleobase sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21). 4. A method of treating myotonic dystrophy in a subject, comprising administering to the subject a composition comprising an effective amount of a conjugate comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein an effective amount provides the subject with 1 mg to 12 mg of oligonucleotide of the conjugate per kg of the subject, wherein the antibody comprises the following: heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NO: 1, 7, or 12; heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NO: 2, 8, or 13; , heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence as set forth in SEQ ID NO: 3, 9, or 14, light chain complementarity determining region 1 (CDR-L1) comprising the sequence as set forth in SEQ ID NO: 4, 10, or 15, light chain complementarity determining region 2 (CDR-L2) comprising the sequence as set forth in SEQ ID NO: 5 or 11, and light chain complementarity determining region 3 (CDR-L3) comprising the sequence as set forth in SEQ ID NO: 6 or 16, wherein the oligonucleotide of the complex comprises the nucleobase sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21). 5. The method of any one of aspects 1-4, wherein the oligonucleotide of the conjugate comprises a 5'-XYZ-3' configuration, where X and Z are flanking regions comprising one or more modified nucleosides, and Y is a gap region comprising one or more 2'-deoxyribonucleosides. 6. The method of any one of aspects 1-5, wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein the structure is: Each R 1 is represented by formula (Ib): [ka] wherein +N represents an LNA (2'-4' methylene bridged) ribonucleoside, dN represents a 2'-deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents a 5-methyl-2'-MOE-cytidine, +C represents a 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents a 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate internucleoside linkage, and R 1 The oligonucleotide comprises the nucleobase sequence CAGCGCCCACCAGUCA (SEQ ID NO: 21); R 2 comprises an anti-TfR1 antibody; and In each complex, n1 is independently selected from the group consisting of R 1 In the formula, R is an integer of 1 or more that represents the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody via attachment point A, optionally wherein the average value of n1 for the conjugates of the composition is in the range of 0.5 to 5. 7. The method of any one of aspects 1-5, wherein each conjugate has the formula (I): [R 1 ] n1 -R 2 wherein the structure is: Each R 1 is represented by the formula (Ic): [ka]

[0043] R in the formula 2 comprises an anti-TfR1 antibody; and In each complex, n1 is independently selected from the group consisting of R 1 In the formula, R is an integer of 1 or more that represents the number of instances of 1 is covalently linked to a different lysine of the anti-TfR1 antibody via attachment point A, optionally wherein the average value of n1 for the conjugates of the composition is in the range of 0.5 to 5. 8. The method of any one of aspects 1-7, wherein the anti-TfR1 antibody is a Fab fragment. 9. The method of any one of aspects 1 to 8, wherein the anti-TfR1 antibody comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 17 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 18. 10. The method of any one of aspects 1 to 9, wherein the anti-TfR1 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20. 11. The method of any one of aspects 1-10, wherein the administration occurs one or more times. 12. The method of embodiment 11, wherein each administration is effective to provide the subject with between 10 mg and 110 mg of the anti-TfR1 antibody of the conjugate per kg of the subject. 13. The method of embodiment 11, wherein each administration is effective to provide the subject with between 5 mg and 90 mg of the anti-TfR1 antibody of the conjugate per kg of the subject. 14. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 10 mg and 20 mg of anti-TfR1 antibody of the conjugate per kg of subject, optionally wherein each effective amount of administration provides the subject with 13 mg of anti-TfR1 antibody of the conjugate per kg of subject. 15. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 18 mg and 36 mg of anti-TfR1 antibody of the conjugate per kg of subject, optionally wherein each effective amount of administration provides the subject with 25 mg of anti-TfR1 antibody of the conjugate per kg of subject. 16. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 36 mg and 72 mg of anti-TfR1 antibody of the conjugate per kg of the subject, optionally wherein each effective amount of administration provides the subject with 50 mg of anti-TfR1 antibody of the conjugate per kg of the subject. 17. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 55 mg and 110 mg of anti-TfR1 antibody of the conjugate per kg of subject, optionally wherein each effective amount of administration provides the subject with 75 mg of anti-TfR1 antibody of the conjugate per kg of subject. 18. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 6 mg and 12 mg of the anti-TfR1 antibody of the conjugate per kg of the subject, optionally wherein each effective amount of administration provides the subject with 8 mg of the anti-TfR1 antibody of the conjugate per kg of the subject. 19. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 11 mg and 22 mg of anti-TfR1 antibody of the conjugate per kg of subject, optionally wherein each effective amount of administration provides the subject with 15 mg of anti-TfR1 antibody of the conjugate per kg of subject. 20. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 22 mg and 44 mg of the anti-TfR1 antibody of the conjugate per kg of the subject, optionally wherein each effective amount of administration provides the subject with 30 mg of the anti-TfR1 antibody of the conjugate per kg of the subject. 21. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 44 mg and 88 mg of the anti-TfR1 antibody of the conjugate per kg of the subject, optionally wherein each effective amount of administration provides the subject with 60 mg of the anti-TfR1 antibody of the conjugate per kg of the subject. 22. The method of embodiment 11, wherein each administration effective amount provides the subject with between 1 mg and 14 mg of oligonucleotide of the conjugate per kg of the subject. 23. The method of embodiment 11, wherein each administration is effective to provide the subject with between 0.5 mg and 12 mg of oligonucleotide of the conjugate per kg of subject. 24. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 1.2 mg and 2.4 mg of oligonucleotide of the conjugate per kg of subject, optionally wherein each effective amount of administration provides the subject with 1.8 mg of oligonucleotide of the conjugate per kg of subject. 25. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 2.2 mg and 4.5 mg of oligonucleotide of the conjugate per kg of subject, optionally wherein each effective amount of administration provides the subject with 3.4 mg of oligonucleotide of the conjugate per kg of subject. 26. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 4.5 mg and 9 mg of oligonucleotide of the conjugate per kg of subject, optionally wherein each effective amount of administration provides the subject with 6.8 mg of oligonucleotide of the conjugate per kg of subject. 27. The method of embodiment 11, wherein each effective amount of administration provides the subject with between 7 mg and 14 mg of oligonucleotide of t...

Claims

1. A composition for use in a method for reducing DMPK expression in a subject and / or treating myotonic dystrophy, wherein the method comprises administering the composition to the subject, wherein the composition comprises an effective amount of a complex comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, Here, the effective dose is 5 mg to 110 mg of the conjugated anti-TfR1 antibody per kg of the target. Here, the antibody comprises: heavy chain complementarity determination region 1 (CDR-H1) containing the sequence as described in SEQ ID NO: 1, 7, or 12; heavy chain complementarity determination region 2 (CDR-H2) containing the sequence as described in SEQ ID NO: 2, 8, or 13; heavy chain complementarity determination region 3 (CDR-H3) containing the sequence as described in SEQ ID NO: 3, 9, or 14; light chain complementarity determination region 1 (CDR-L1) containing the sequence as described in SEQ ID NO: 4, 10, or 15; light chain complementarity determination region 2 (CDR-L2) containing the sequence as described in SEQ ID NO: 5 or 11; and light chain complementarity determination region 3 (CDR-L3) containing the sequence as described in SEQ ID NO: 6 or 16. The composition wherein the oligonucleotide of the complex contains the nucleic acid base sequence CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21).

2. The composition for use according to claim 1, wherein the oligonucleotide of the complex comprises a 5'-X-Y-Z-3' configuration, where X and Z are flanking regions comprising one or more modified nucleosides, and Y is a gap region comprising one or more 2'-deoxyribonucleosides.

3. Each complex is given by formula (I): [R １ ] ｎ１ -R ２ The structure includes the form represented by the formula: Each R １ Equation (Ia): 【Chemistry 1】 It contains a group represented by the formula R ３ It contains an oligonucleotide containing the nucleic acid base sequence CAGCGCCCACCAGUCA (SEQ ID NO: 21), and also contains a structure represented by +C*+A*oG*oC*dG*dC*dC*dC*dA*dC*dC*dA*oG*oU*+C*+A (SEQ ID NO: 21), where +N represents LNA (2'-4' methylene bridged) ribonucleoside, and dN represents 2' - represents a deoxyribonucleoside, oN represents a 2'-MOE modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-uridine, and * represents a phosphorothioate nucleoside linkage: R ２ This includes an anti-TfR1 antibody; and In each complex, n1 independently, R １ An integer of 1 or more that represents the number of actual examples of R in the formula. １ The composition for use according to claim 1, wherein each example is covalently linked to a different lysine of the anti-TfR1 antibody via attachment site A.

4. Each complex has a structure represented by the formula (I): [R １ ｎ１ -R ２ wherein the formula:​ Each R １ Equation (Ib): 【Chemistry 2】 The formula contains the group represented by , where +N represents LNA (2'-4' methylene bridged) ribonucleoside, dN represents 2'-deoxyribonucleoside, oN represents 2'-MOE modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-urisine, and * represents a phosphorothioate nucleoside linkage, and R １ The oligonucleotide contains the nucleic acid sequence CAGCGCCCACCAGUCA (SEQ ID NO: 21); R ２ This includes an anti-TfR1 antibody; and In each complex, n1 independently, R １ An integer of 1 or more that represents the number of actual examples of R in the formula. １ The composition for use according to claim 1, wherein each example is covalently linked to a different lysine of the anti-TfR1 antibody via attachment site A.

5. Each complex is given by formula (I): [R １ ] ｎ１ -R ２ The structure includes the form represented by the formula: Each R １ Equation (Ic): 【Transformation 3】 It includes a group represented by, In the formula R ２ This includes an anti-TfR1 antibody; and In each complex, n1 independently, R １ An integer of 1 or more that represents the number of actual examples of R in the formula. １ Each example is covalently linked to a different lysine of the anti-TfR1 antibody via attachment point A, and optionally the average value of n1 of the complex of the composition is in the range of 0.5 to 5, the composition for use according to claim 1.

6. Each complex is given by formula (Id): 【Chemistry 4】 The structure includes the formula, where +N represents LNA (2'-4' methylene bridged) ribonucleoside, dN represents 2'-deoxyribonucleoside, oN represents 2'-MOE modified ribonucleoside, oC represents 5-methyl-2'-MOE-cytidine, +C represents 5-methyl-2'-4'-bicyclic-cytidine (2'-4' methylene bridged), oU represents 5-methyl-2'-MOE-urisine, and * represents a phosphorothioate nucleoside linkage, and R １ The oligonucleotide contains the nucleic acid sequence CAGCGCCCACCAGUCA (SEQ ID NO: 21); R ２ This includes an anti-TfR1 antibody; and In each complex, n1 independently, R １ An integer of 1 or more that represents the number of actual examples of R in the formula. １ The composition for use according to claim 1, wherein each example is covalently linked to a different lysine of the anti-TfR1 antibody via attachment site A.

7. The composition for use according to any one of claims 3 to 6, wherein the average value of n1 of the composite composition is in the range of 0.5 to 5.

8. A composition for use according to any one of claims 1 to 6, wherein the anti-TfR1 antibody comprises a heavy chain containing an N-terminal glutamate.

9. A composition for use according to any one of claims 1 to 6, wherein one or more oligonucleotides are independently covalently linked to the antibody via lysine residues of the anti-TfR1 antibody.

10. A composition for use according to any one of claims 1 to 6, wherein the anti-TfR1 antibody is a Fab fragment.

11. A composition for use according to any one of claims 1 to 6, wherein the anti-TfR1 antibody comprises a heavy chain variable region (VH) containing the amino acid sequence of SEQ ID NO: 17 and a light chain variable region (VL) containing the amino acid sequence of SEQ ID NO:

18.

12. The composition for use according to claim 11, comprising an anti-TfR1 antibody, a heavy chain containing the amino acid sequence of SEQ ID NO: 19, and a light chain containing the amino acid sequence of SEQ ID NO:

20.

13. A composition for use according to any one of claims 1 to 6, wherein administration occurs once or more times.

14. Effective dose for each administration: (a) A conjugate containing 10 mg to 110 mg of anti-TfR1 antibody per kg of the target; (b) The conjugate contains 5 mg to 90 mg of anti-TfR1 antibody per kg of the target; (c) The conjugate contains 10 mg to 20 mg of anti-TfR1 antibody per kg of the target; (d) The conjugate contains 18 mg to 36 mg of anti-TfR1 antibody per kg of the target; (e) A conjugate containing 36 mg to 72 mg of anti-TfR1 antibody per kg of the target; (f) A conjugate containing 55 mg to 110 mg of anti-TfR1 antibody per kg of the target; (g) A conjugate containing 6 mg to 12 mg of anti-TfR1 antibody per kg of the target; (h) A conjugate containing 11 mg to 22 mg of anti-TfR1 antibody per kg of the target; (i) a complex containing 22 mg to 44 mg of anti-TfR1 antibody per kg of the target; (j) a complex containing 44 mg to 88 mg of anti-TfR1 antibody per kg of the target; or The composition for use according to claim 13, which provides the target with 30 mg to 60 mg of anti-TfR1 antibody per kg of the (k) complex.

15. Effective dose for each administration: (a) Oligonucleotides of the complex in an amount of 1 mg to 14 mg per kg of the target; (b) Oligonucleotides of the complex in an amount of 0.5 mg to 12 mg per kg of the target; (c) Oligonucleotides of the complex in an amount of 1.2 mg to 2.4 mg per kg of the target; (d) Oligonucleotides of the complex in an amount of 2.2 mg to 4.5 mg per kg of the target; (e) Oligonucleotides of the complex in an amount of 4.5 mg to 9 mg per kg of the target; (f) Oligonucleotides of the complex, 7 mg to 14 mg per kg of the target; (g) Oligonucleotides of the complex, 0.7 mg to 1.5 mg per kg of the target; (h) Oligonucleotides of the complex in an amount of 1.4 mg to 2.7 mg per kg of the target; (i) Oligonucleotides of the complex in an amount of 2.7 mg to 5.4 mg per kg of the target; (j) 5 mg to 11 mg of oligonucleotides per kg of the subject in the complex; or The composition for use according to claim 13, wherein (k) complex provides the target with an oligonucleotide of 3 mg to 7 mg per kg of the target.

16. The composition for use according to any one of claims 1 to 6, wherein each effective dose provides the target with 36 mg to 72 mg of the anti-TfR1 antibody of the complex per kg of the target.

17. The composition for use according to any one of claims 1 to 6, wherein each effective dose provides the target with 30 mg to 60 mg of the anti-TfR1 antibody of the complex per kg of the target.

18. The composition for use according to any one of claims 1 to 6, wherein each effective dose provides the target with 50 mg of the anti-TfR1 antibody of the complex per kg of the target.

19. The composition for use according to any one of claims 1 to 6, wherein each effective dose provides the target with 4.5 mg to 9 mg of the anti-oligonucleotide of the complex per kg of the target.

20. The composition for use according to any one of claims 1 to 6, wherein each effective dose provides the target with 3 mg to 7 mg of oligonucleotides of the complex per kg of the target.

21. The composition for use according to any one of claims 1 to 6, wherein each effective dose provides the subject with 6.8 mg of oligonucleotides of the complex per 1 kg of the subject.

22. The composition for use according to any one of claims 1 to 6, wherein the composition is administered once every four weeks, once every eight weeks, or once every twelve weeks during the administration period.

23. The composition for use according to claim 16, wherein the composition is administered once every four weeks, once every eight weeks, or once every twelve weeks during the administration period.

24. The composition for use according to claim 17, wherein during the administration period, the composition is administered once every four weeks, once every eight weeks, or once every twelve weeks.

25. The composition for use according to claim 18, wherein during the administration period, the composition is administered once every four weeks, once every eight weeks, or once every twelve weeks.

26. The composition for use according to claim 19, wherein during the administration period, the composition is administered once every four weeks, once every eight weeks, or once every twelve weeks.

27. The composition for use according to claim 20, wherein during the administration period, the composition is administered once every four weeks, once every eight weeks, or once every twelve weeks.

28. The composition for use according to claim 20, wherein during the administration period, the composition is administered once every four weeks, once every eight weeks, or once every twelve weeks.

29. The composition for use according to claim 22, wherein the administration period is less than 10 years.

30. The composition for use according to claim 22, wherein the administration period is the remaining lifespan of the subject.

31. The composition for use according to any one of claims 1 to 6, wherein the composition is administered once every four weeks during a first administration period, and subsequently once every eight weeks during a second administration period.

32. The composition for use according to claim 16, wherein the composition is administered once every four weeks during a first administration period, and subsequently once every eight weeks during a second administration period.

33. The composition for use according to claim 17, wherein the composition is administered once every four weeks during a first administration period, and subsequently once every eight weeks during a second administration period.

34. The composition for use according to claim 18, wherein the composition is administered once every four weeks during a first administration period, and subsequently once every eight weeks during a second administration period.

35. The composition for use according to claim 19, wherein the composition is administered once every four weeks during a first administration period, and subsequently once every eight weeks during a second administration period.

36. The composition for use according to claim 20, wherein the composition is administered once every four weeks during a first administration period, and subsequently once every eight weeks during a second administration period.

37. The composition for use according to claim 21, wherein the composition is administered once every four weeks during a first administration period, and subsequently once every eight weeks during a second administration period.

38. The composition for use according to claim 31, wherein the first administration period is 8 to 16 weeks, and / or the second administration period is 16 weeks to the remainder of the subject's lifespan.

39. The composition for use according to claim 32, wherein the first administration period is 8 to 16 weeks, and / or the second administration period is 16 weeks to the remainder of the subject's lifespan.

40. The composition for use according to claim 33, wherein the first administration period is 8 to 16 weeks, and / or the second administration period is 16 weeks to the remainder of the subject's lifespan.

41. The composition for use according to claim 34, wherein the first administration period is 8 to 16 weeks, and / or the second administration period is 16 weeks to the remainder of the subject's lifespan.

42. The composition for use according to claim 35, wherein the first administration period is 8 to 16 weeks, and / or the second administration period is 16 weeks to the remainder of the subject's lifespan.

43. The composition for use according to claim 36, wherein the first administration period is 8 to 16 weeks, and / or the second administration period is 16 weeks to the remainder of the subject's lifespan.

44. The composition for use according to claim 37, wherein the first administration period is 8 to 16 weeks, and / or the second administration period is 16 weeks to the remainder of the subject's lifespan.

45. The composition for use according to any one of claims 1 to 6, wherein the effective dose of each administration provides the subject with 50 mg of anti-TfR1 antibody of the conjugate per kg of the subject, wherein the composition is administered once every 4 weeks during a first administration period, and once every 8 weeks during a second administration period following the first administration period, wherein the first administration period is 8 weeks, and the second administration period is 16 weeks to the remainder of the subject's lifespan.

46. The composition for use according to any one of claims 1 to 6, wherein the composition is in the form of an aqueous solution and further comprises tris(hydroxymethyl)aminomethane and sucrose.

47. The composition for use according to claim 46, wherein tris(hydroxymethyl)aminomethane is present in an aqueous solution at a concentration of 25 mM, sucrose is present in an aqueous solution at a concentration of 10 w / v%, and the aqueous solution is at a pH of 7.

5.

48. The composition for use according to claim 47, wherein the complex is present in the composition at a concentration in the range of 10 mg / mL to 50 mg / mL.

49. A composition for use according to any one of claims 1 to 6, wherein administration reduces DMPK expression in target muscle cells.

50. The composition for use according to claim 49, wherein the reduction of DMPK expression comprises a reduction in the amount of DMPK RNA in muscle cells.

51. The composition for use according to claim 50, wherein the amount of DMPK RNA is reduced in the nucleus of muscle cells.

52. The composition for use according to claim 50, wherein reducing DMPK expression in muscle cells reduces the amount of DMPK protein in muscle cells.

53. A composition for use according to any one of claims 1 to 6, wherein the subject is a human.

54. A composition for use according to any one of claims 1 to 6, wherein the complex is administered systemically.

55. The composition for use according to claim 54, wherein the complex is administered intravenously.

56. The composition for use according to claim 55, wherein the complex is administered by injection.

57. The composition for use according to any one of claims 1 to 6, further comprising one or more anti-TfR1 antibodies not covalently linked to an oligonucleotide.

Images