Non-viral vectors for gene therapy

Abstract

The present invention relates to fluorinated amphiphilic dendrimer structures (FJDs) that are capable of self-assembly into supramolecular systems of different sizes and shapes. A further object is a supramolecular complex comprising at least one dendrimer structure according to the invention and its use in gene therapy.

Description

[Background technology]

[0001] Currently, gene therapy has limited clinical application due to the difficulty of safely and efficiently delivering genetic material to cells.

[0002] The approaches used are based on viral and non-viral vectors. Viral vectors are very efficient but generally induce immune responses and require very complicated preparation techniques. Non-viral vectors, generally consisting of lipids or cationic / ionic polymers, are less efficient than viral vectors but are less immunogenic, easier to prepare and more versatile. The presence of cationic polar heads in non-viral vectors also results in cytotoxicity.

[0003] Along with efficient and safe delivery systems, another strong need is the ability to noninvasively monitor the biodistribution of vectors and demonstrate their effective reach to the target site.

[0004] Lipid nanoparticles for use as non-viral vectors are summarized in Kulkarni JA et al. in Nucleic Acid Therapeutics 2018; 28, 3.

[0005] Gaucheron J et al. in Bioconjugate Chem. 2001; 12, 6, 949-963 describe cationic lipid vectors functionalized with fluorinated glycerophosphoethanolamines.

[0006] Wang M et al, in Nat Commun 2014; 5, 3053, describe polymer vectors with long perfluorinated linear chains.

[0007] Functionalization has been shown to be advantageous at the intracellular level for the internalization of genetic material and its release from endosomes to exert the desired biological function. However, to achieve the above results, linear perfluorinated chains are used, and a high density of conjugated fluorinated chains on one polymer is required, which leads to a "crowding" of the polymer surface and makes it impossible to mediate further modifications with other functional ligands. Moreover, it is difficult to monitor such vectors with clinical level imaging techniques unless radioactive tracers with complex and expensive preparations are used. In fact, 19 F magnetic resonance technology ( 19 The use of perfluoroalkyl chains (F-MRI) is complicated by the fact that currently used perfluoroalkyl chains generate multiple magnetic resonance signals due to the presence of magnetically non-equivalent fluorine atoms. This greatly impairs the sensitivity of the analysis. Finally, the use of perfluoroalkyl chains poses major problems for environmental sustainability, since compounds containing long fluorinated chains (more than six carbon atoms) show high persistence in the environment and high bioaccumulation potential.

[0008] Dendrimers are a type of highly branched synthetic polymer compound that has a repeating structure.

[0009] The defining features of dendrimers are their structure, which include: - A central core that defines the internal dimensions, number and direction of branches; - Starting from a central core, layers of repeating units (called generations) control the flexibility and size of the molecule; - active end groups and surface charges which define its chemical nature and interaction possibilities.

[0010] Dendrimers have been proposed as polymeric non-viral vectors (Dufes C et al. Dendrimers in gene delivery. Advance drug delivery reviews 2015; 57:2177-2202). For example, cationic dendrimers belonging to the classes of polyamidoamine (PAMAM), polypropyleneimine (PPI), poly-L-lysine carbosilane (CBS) (PLL9), and phosphorus-containing dendrimers have been proposed for the delivery of siRNA and microRNA. Each of these classes has its advantages and limitations, making it highly necessary to obtain non-viral vectors that can overcome the limitations found with the ligands available to date. DETAILED DESCRIPTION OF THE PRESENT EMBODIMENT

[0011] [Brief description of the drawings]

[0012] [Figure 1] A) 1H-NMR spectrum and peak positions of FDG2N. B) 19F-NMR spectrum of FDG2N. As shown by the integrals, each cationic amphiphile molecule carries 27 fluorine atoms and 4 TFA anions as counterions. Solvent: CD3OD. [Diagram 2] Cryo-EM images. A, B) Fresh sample of 2.5 mM FDG2N in 10 mM HEPES buffer (pH 7.4), showing the presence of small micelles with diameters of approximately 5-10 nm. C, D) Fresh sample of 2.5 mM FDG2N in 150 mM NaCl, showing the coexistence of small micelles (diameters 10-20 nm) and large globular aggregates (diameters approximately 50-70 nm). [Diagram 3] Cryo-EM images. A) 0.56 mM FDG2N in 150 mM NaCl alone, fresh sample. The image shows the coexistence of aggregates of various sizes (10-70 nm in diameter). B) Dendriplexes obtained by dissolving FDG2N at a concentration of 0.56 mM in 150 mM NaCl with N / P=30. [Figure 4]Effect of the dendriplex mimic miR124a on the survival of epSPCs. A) Light microscopy images of epSPCs treated with negative control (NC) N / P5; NC N / P10; NC N / P20; NC N / P30; NC N / P40 or miR-124a N / P5 dendriplex; miR-124a N / P10 dendriplex; miR-124a N / P20 dendriplex; miR-124a N / P30 dendriplex; miR-124a N / P40 dendriplex. B) Light microscopy images of epSPCs treated under baseline conditions, C) with empty N / P40; D) with Lipofectamine and NC (top) or Lipofectamine and miR-124a (bottom). Black arrows indicate areas of cell depletion likely due to cell death. Bar scale: 50 μm. E) Confocal microscopy images of epSPC cells under baseline conditions (left), treated with miR-124a N / P30 dendriplexes (middle), and treated with Lipofectamine and miR-124a (right). They were labeled with the neural stem cell marker nestin (grey) and stained with DAPI (white) to highlight the nuclei. Bar scale = 50 μm. The graph shows the quantification of nestin-positive epSPC cells under baseline conditions, treated with miR-124a N / P30 dendriplexes, and treated with Lipofectamine and miR-124a; data are expressed as the mean ± SD of nestin-positive cells from analysis of 6 randomly selected fields per slide. F) Real-time RT-PCR measurement of CASP6 gene expression levels in epSPCs under baseline conditions, treated with miR-124a N / P30 dendriplexes, and treated with lipofectamine and miR-124a (N=6 cultures per group). CASP6 expression levels are shown as mean ± SE of relative values ​​(2-ΔCt) normalized to the 18S housekeeping gene. *p<0.05 by Mann Whitney test. [Diagram 5]Regulation of DLX2 gene expression via miR-124a. A) Real time RT-PCR analysis to evaluate miR-124a expression in epSPC cultures under baseline conditions and after treatment with NC N / P5-N / P40; Lipofectamine (Lipo) and NC; miR-124a N / P5-N / P40 dendriplex; Lipofectamine (Lipo) and miR-124a. miR-124a levels are shown as mean ± SEM relative values ​​(2-ΔCt) normalized to endogenous U6 control. Mann Whitney test *p<0.05, **p<0.01 for miR-124a N / P5-N / P40 dendriplex and Lipo and miR-124a versus baseline conditions; ###p<0.001 for miR-124a N / P5-N / P40 dendriplex and Lipo and miR-124a versus negative controls N / P5-N / P40 and Lipo and NC. B) Real-time RT-PCR analysis to assess DLX2 expression in epSPC cultures under baseline conditions and after treatment with NC N / P5-N / P40; Lipo and NC; miR-124a N / P5-N / P40 dendriplex; Lipo and miR-124a. DLX2 mRNA abundance is shown as mean ± SEM of relative values ​​(2-ΔCt) normalized to the 18S housekeeping gene. Mann Whitney test. **p<0.01, miR-124a N / P30 dendriplex vs. baseline condition; ##p<0.01, miR-124a N / P30 dendriplex vs. NC N / P30; $$$p<0.001, miR-124a N / P30 dendriplex vs. Lipo and miR-124a.

[0013] As used herein, the term "dendriplex" refers to a carrier comprising at least one dendrimer structure and at least one nucleic acid.

[0014] By "lipoplex" is meant a structure comprising lipofectamine and at least one nucleic acid.

[0015] In the dendriplex, in the preferred form of miRNA, "N / P" indicates the ratio of nitrogen atoms of the dendrimer structure to phosphorus atoms of the nucleic acid charged to the dendrimer structure.

[0016] The present invention first relates to fluorinated amphiphilic dendrimer structures (FJDs) that can self-assemble into supramolecular systems of various sizes and shapes. The structures of the present invention have the general formula (I) and comprise a fluorinated hydrophobic portion and a polyester-based hydrophilic portion.

[0017] [ka]

[0018] In formula (I) n is an integer from 1 to 5; R is [ka] [ka] Selected from R 1 teeth, CH (4) [ka] Selected from X is independently: OH; (6) COOH (7) NH 2 (8) NH 3 + Y - (9) NR 2 2 (10) NR 2 3+ Y - (11) Selected from Where: R 2 are independently -CH 3 , -CH 2 CH 3 , -CH 2 CH 2 CH 3 , -CH(CH 3 ) 2 , -CH 2 OH, -CH 2 CH 2 Selected from OH; Y - teeth: [ka] is selected from.

[0019] In one embodiment, n is 2 or 3, preferably 3.

[0020] In one embodiment, R is [ka] It is.

[0021] In one embodiment, R 1 teeth, [ka] It is.

[0022] In one embodiment, X is NH 3 + Y - and Y is [ka] is selected from Preferably, Y is [ka] It is.

[0023] In one embodiment, n is 3 and R is [ka] and R 1 teeth [ka] and X is NH 3 + Y - and Y - teeth [ka] is

[0024] In this embodiment, the compound is FDG. 2 It is called N.

[0025] In one embodiment, n is 3 and R is [ka] and R 1 is CH; X is OH

[0026] The present invention further relates to a supramolecular complex comprising at least one of said dendrimer structures and one or more nucleic acids.

[0027] The present invention further relates to a composition comprising at least one of the above dendrimer structures, an effective amount of a nucleic acid, and a pharma- ceutically acceptable vector.

[0028] The nucleic acid is selected from deoxyribonucleic acid (DNA), both single-stranded and double-stranded, ribonucleic acid (RNA), ribosomal RNA (rRNA), catalytic RNA (cRNA), snRNA, messenger RNA (mRNA), transfer RNA (tRNA), siRNA, shRNA, protein nucleic acid (PNA) and substituted nucleic acid oligonucleotides.

[0029] In a preferred embodiment, the nucleic acid is a nucleic acid capable of mediating RNA interference (RNAi), wherein the nucleic acid is an RNA molecule selected from the group consisting of siRNA and shRNA.

[0030] In a preferred embodiment, the nucleic acid is a mimic miR-124a, ie, a chemically modified double-stranded RNA molecule designed to mimic an endogenous microRNA.

[0031] In a preferred embodiment, the dendrimer structure is 2 It's N.

[0032] In one embodiment, a pharmaceutical formulation is claimed that includes the compositions described herein.

[0033] The present invention further relates to a method for obtaining said supramolecular complex, said method comprising providing a dendrimer structure of formula (I) and dispersing it together with a nucleic acid in a saline solution, said dendrimer structure of formula (I) and said nucleic acid being dispersed in a molar ratio of 50-600, in a preferred embodiment 344, i.e. said ratio expressed as N / P is 5-40, in one embodiment 30.

[0034] The present invention further relates to one or more supramolecular complexes described for use in gene therapy.

[0035] In one embodiment, the use is in the treatment of a neurological / neurodegenerative disease.

[0036] In one embodiment, the supramolecular complex comprises miR-128 and miR-15, and the complex is for use in the treatment of Alzheimer's disease.

[0037] In one embodiment, the supramolecular complex comprises miR-30 and miR-26a, and the complex is for use in the treatment of Parkinson's disease (Chakraborty et al., J. Adv. Res.2021; 28: 127-138).

[0038] In one embodiment, the supramolecular complex comprises miR-206 and miR-146a, and the complex is for use in the treatment of amyotrophic lateral sclerosis (Rinchetti et al., Mol. Neurobiol. 2018; 2617-2630).

[0039] In one embodiment, the supramolecular complex comprises miR-19a and miR-19b, and the complex is for use in the treatment of multiple sclerosis (Gao et al., Clin. Chim. Acta. 2021; 92-99).

[0040] The present invention further relates to a supramolecular complex according to the invention for use in tracking a dendriplex after its administration.

[0041] MiR-124a positively targets the Distal-Less Homeobox 2 gene (DLX2) to regulate and induce neuronal differentiation in the adult brain and spinal cord (Marcuzzo et al., Exp Neurol. 2014; 91-101; Marcuzzo et al., Mol. Brain 2015; 8, 5). In ependymal stem / progenitor cells (epSPCs) present in the adult spinal cord (Haidet-Phillips et al., Nat. Biotechnol. 2011; 824-828; Marcuzzo et al., 2014 cit.), miR-124a is involved in signaling pathways underlying the neurogenesis process in the spinal cord. Thus, the inventors have surprisingly observed that mimic miR-124a administered by the supramolecular complex according to the present invention can increase the expression level of miR-124a in ependymal stem / progenitor cells without prematurely activating apoptosis, as observed instead when administered by lipofectamine.The results obtained show that the use of the supramolecular complex according to the present invention is an effective method for obtaining mi-RNA-mediated gene regulation.

[0042] advantage The dendrimer structures according to the invention, due to the inherent tendency of the branched fluorinated chains to crystallize, provide stable and dense packaging as well as, for example, 19 This makes available many equivalent fluorine atoms (27F), useful for F-MRI.

[0043] Furthermore, the presence of four ether bonds in the nucleus facilitates the degradation of the molecule in the environment, overcoming the problem of bioaccumulation of PFAs.

[0044] Such molecules exhibit finely controllable assembly in aqueous media as a function of the equilibrium that occurs between fluorinated and hydrophilic domains.

[0045] The supramolecular complexes according to the invention surprisingly show a higher transfection capacity than observed with lipid non-viral vectors, accompanied by a significantly reduced cytotoxicity. The in vitro and in vivo results confirm the validity of the approach for the delivery of nucleic acids for gene therapy purposes, even when the target is cells of the nervous system.

[0046] In the complex according to the invention 19 The presence of F advantageously makes it possible to track its location when administered to an organism. EXAMPLES

[0047] Example 1: Synthesis of first, second and third generation fluorinated amphiphilic dendrimers For the synthesis, chemicals used as reagents and solvents were purchased with a purity of >97% from TCI Deutschland GmbH; Sigma Aldrich, DE; Fluorochem, UK and were used as received without further purification.

[0048] TLC thin-layer chromatography was performed on plates precoated with Si 60-F254 silica gel (Merck, Darmstadt, Germany). Flash chromatography was performed on JT Baker silica gel mesh size 230-400 using ninhydrin or potassium permanganate solutions as chemical stains.

[0049] Based on small-generation polyester dendrons (first, second, and third) with 2,2-bis(hydroxymethyl)propionic acid (BIS-MPA) as a monomer, the synthesis was carried out following a convergent procedure that required separate synthesis of the fluorinated derivative and the hydrophilic moiety.

[0050] The synthesis of branched fluorinated structures was optimized to obtain azide derivatives suitable for conjugation with polyester moieties.

[0051] As shown in Diagram 1, the synthesis of the azide derivative (F27-N3) starts from pentaerythritol (1 eq., 100 g) reacted with tert-butyl acrylate (1.2 eq.) in the presence of NaOH (0.2 eq.) as base in dimethylsulfoxide (DMSO, total volume: 128 ml). Compound a (1 eq., 1.36 g) is then reacted with triphenylphosphine (PPh 3 The fluorinated ester compound b (1 equiv., 0.4 g) was then reacted with LiAlH in anhydrous THF (total volume: 50 ml) to give a fluorinated ester compound b (1 equiv., 0.4 g) in anhydrous THF (total volume: 50 ml) with 100% ethanol. 4 (4 equiv.) to give the alcohol derivative.

[0052] [ka]

[0053] Compound c (1 equiv., 0.85 g) was dissolved in anhydrous dichloromethane (CH 2 Cl 2 , total volume 26 ml) with methanesulfonyl chloride (MsCl, 3 eq.) and triethylamine (Et 3 Finally, derivative d (1 equiv., 2.90 g) was converted to the mesylated derivative by a second substitution reaction in the presence of sodium azide (2.2 equiv.) in anhydrous dimethylformamide (DMF, total volume: 19 ml) to give F 27 -N 3 Compound a was purified by flash chromatography on silica gel using diethyl ether and acetone (1:1) as eluents (Rf=0.3) and permanganate solution as TLC chemical dye. All other intermediates could be purified by extraction from water with organic solvents (mainly dichloromethane or hexane) without further purification. Compound b was recrystallized from ethanol to remove all by-products.

[0054] The synthesis of polyester dendrimers was carried out separately starting from the protection of the OH groups of Bis-MPA as shown in Diagram 2.

[0055] [ka]

[0056] The reaction is carried out in acetone (total volume 25 ml) in the presence of Bis-MPA (1 equivalent, 5 g), 2,2-dimethoxypropane (2 equivalents) and catalytic amount of paratoluenesulfonic acid (pTsOH, 0.1 equivalents). The propargyl ester is then obtained using a Steglich esterification reaction. 2 Cl 2 Compound 1 (1 eq., 252 mg) is reacted with propargyl alcohol (2 eq.) in the presence of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, 1.1 eq.) and 4-dimethylaminopyridine (DMAP, 0.1 eq.) in methanol (total volume: 10 ml). Compound 2 (1 eq., 151 mg) and sulfuric acid (H 2 SO 4 , 0.85 equiv.) to give the first generation polyester dendron (DG1). Generation progression is achieved by alternating Steglich esterification and acetonide deprotection. Thus, to give the second generation polyester dendron (DG2), the reaction is carried out in the presence of anhydrous CH 2 Cl 2 DG1 (1 eq., 172 mg) was reacted with compound 1 (5 eq.) in the presence of EDC and DMAP (5 eq. and 0.5 eq., respectively) in methanol (total volume: 10 mL); 2 SO 4 Compound 3 (1 equiv., 170 mg) was deprotected in the presence of anhydrous CH 2 Cl 2DG2 (1 equiv., 150 mg) was reacted with compound 1 (8 equiv.) in the presence of EDC and DMAP (8 equiv. and 0.5 equiv., respectively) in methanol (total volume: 13 mL) to give intermediate 4. Compound 4 (1 equiv., 200 mg) was then deprotected as an acetonide in the presence of sulfuric acid (3.4 equiv.) in methanol (total volume: 7 mL) to give the third generation dendron (DG3). Intermediates 2, 3, and 4 were purified by silica flash column chromatography using hexane and ethyl acetate (8:2) for 2 and hexane and ethyl acetate (7:3) for 3 and 4. To connect the branched fluorinated moieties and the hydrophilic polyester moieties via a rigid linker, a copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction was performed as shown in Diagram 3.

[0057] [ka]

[0058] This strategy allowed the orthogonal linkage of the two moieties in good yields without side products. Compound DG 1 The first generation fluorinated amphiphilic dendrimer (FDG1) was synthesized by dissolving F (1 equivalent, 313 mg) and copper(I) acetate (0.1 equivalent) in DMF. 27 -N 3 (1 equiv.) was dissolved in additional DMF (total volume: 3 mL) and added to the reaction mixture. 2 The second generation fluorinated dendrimer (FDG) was prepared by dissolving FDG (1 equivalent, 110 mg) and copper(I) acetate (0.15 equivalent) in DMF. 2 Next, we synthesized F 27 -N 3 (1 eq.) was dissolved in DMF (total volume: 3 mL) and added to the reaction mixture. 3 (1 equiv., 53 mg) and copper(I) acetate (0.5 equiv.) were mixed in DMF (total volume: 2.5 mL) and F 27 -N 3 (1 equivalent) to obtain the third generation fluorinated dendrimer FDG. 3All CuAAC reactions were carried out overnight at 55 °C under an inert atmosphere. The reactions were then stopped, added to ice water, and cooled to 5 °C. 2 Cl 2 The organic phase was washed twice with 0.1% disodium EDTA solution in deionized water to remove copper and once with saturated NaCl solution. The organic phase was collected and extracted with Na 2 SO 4 The mixture was dried at 40° C. and rotary evaporated to give the desired compound. 1 H, 13 C, and 19 F-NMR combined with ATR-FTIR and HRESI-MS analyses confirmed the formation of the final dendritic structure.

[0059] Example 2: Synthesis of second generation fluorinated amphiphilic dendrimers for gene delivery To construct a gene delivery vector that can bind to the positive charge of the phosphate group present in nucleic acids, four primary ammonium salts were inserted to bind FDG. 2 The surface groups present in were chemically modified. The synthetic steps are highlighted in Diagram 4.

[0060] [ka]

[0061] Under inert atmosphere, anhydrous CH 2 Cl 2 (Total volume: 7 ml) 2 (1 equiv., 176 mg) was reacted with Boc-β-alanine (12 equiv.), EDC (12 equiv.) and DMAP (0.5 equiv.) overnight to give intermediate 5. To purify the product, flash silica column chromatography was performed using a mixture of hexane and ethyl acetate (1:1) as eluent and ninhydrin solution as TLC chemical dye (rf: 0.3). To remove excess Boc-β-alanine, the purified mixture was washed with CH 2 Cl 2 Dissolved in 10% NaHCO 3 The organic phase was washed twice with Na 2 SO4 After drying over 1000 rpm and removing the solvent by rotary evaporation, a pale yellow oil was recovered. To obtain the tetraammonium salt, compound 5 (1 equiv., 195 mg) was dissolved in CH 2 Cl 2 (total volume: 2 mL) and reacted with trifluoroacetic acid (TFA, 2 mL).

[0062] The reaction was carried out until the total conversion of the precursor, which was confirmed by TLC (eluent: 1:1 mixture of hexane and ethyl acetate). After rotary evaporation of the reaction solvent, the compound was dissolved in hexafluoro-2-propanol and dried again three times to remove excess TFA. Finally, the product was dissolved in water and lyophilized to obtain FDG. 2 I got N. 1 H, 13 C and 19 F-NMR combined with ATR-FTIR and HRESI-MS analyses confirmed the formation of the final dendritic structure.

[0063] Example 3: Characterization of second generation fluorinated amphiphilic dendrimers in solution FDG 2 N solutions were obtained by dispersing the necessary amount of solid to obtain the desired concentration (2.5 mM and 0.5 mM) directly into the final solvent (MilliQ water, 150 mM NaCl and 10 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid); pH was adjusted to pH = 7.4 with 1 M NaOH solution. The solutions were aged at constant temperature (25 °C) and analyzed after 1 h, 24 h and 48 h of aging as described above. Analysis of the dispersions was performed by dynamic light scattering (DLS), Z potential, 19F-NMR was performed. Multi-angle DLS was measured using an ALV compact goniometer system equipped with an ALV-5000 / EPP correlator, using a He-Ne laser (λ = 633 nm, power 22 mW) as the light source. The temperature was controlled by a thermostatic bath and set at 25 °C. Volumes from 800 μL to 1 ml were used for the analysis. DLS was measured at different time points (0, 24, 48 h) and diffusion angles θ = 70 to 130 ° in 20 ° increments. Each measurement was the result of the average of three consecutive tests of 10 s each, with a threshold sensitivity of 10%. Data analysis was performed with the ALV-Correlator software. The apparent hydrodynamic rays at different angles were obtained by intensity-weighted and number-weighted adaptation of the autocorrelation function. The hydrodynamic lines (RH) and polydispersity index (PdI) were calculated using cumulative coupling. For a more accurate analysis, CONTIN analysis was performed, excluding the cumulative adaptation due to the high polydispersity of the sample. 48 hours after preparation of the colloidal dispersion, the Z potential was measured at 25 °C in a folded capillary cell (a U-shaped cell with two gold-plated beryllium / copper electrodes on top) using a Zetasizer Nano ZS (Malvern Instrument, Malvern, Worcestershire, UK) equipped with a 633 nm laser. Before each measurement, the cell was washed with MilliQ water and filled with approximately 1 ml of sample solution. 2.5 and 0.5 mM FDG 2 500 μL of N dispersion was mixed with 50 μL of deuterium oxide and analyzed. 19 F-NMR spectra were performed. Spectra were collected with 256 scans set as input parameters. The TFA anion peak was set at -76.55 ppm. T1 and T2 measurements were performed with 2.5 mM FDG in MilliQ water. 2 N solution. Data adaptation was performed by single exponential adaptation, and the raw data were analyzed by Bruker TopSpin and MestReNova software. The morphology of the aggregates was further confirmed by Cryo-TEM.

[0064] Critical micelle concentration (CMC) measurements were performed in both water and 150 mM NaCl by measuring pyrene fluorescence. Essentially, small aliquots (17 μl) of pyrene solution (6.25 μM in methanol) were diluted with increasing concentrations of FDG to a final volume of 1 mL (final pyrene concentration: 100 nM). 2 Transfer to N solution. Fluorescence emission and excitation spectra were obtained using a commercial spectrofluorometer (Jasco, FP-6500).

[0065] Nucleic acid binding FDG 2 To better understand the effect of N on the self-assembly of dendriplexes (FDG 2 We obtained cryo-electron microscopy images of FDG-N complexes in 150 mM NaCl. 2 N solution (0.56 mM) was mixed with siRNA (double-stranded, SEQ ID NO:1 CUUACGCUGAGUACUUCGA, encoding luciferase) at different nitrogen-phosphorus (N / P) ratios, specifically 20, 30, and 40, to mimic the in vitro conditions described below. The characteristics of the aggregates were also confirmed by DLS, potential Z, and NMR experiments.

[0066] Example 4: FDG 2 Synthesis and characterization of N in solution The synthetic procedure employed allows 1 H and 19 As confirmed by F-NMR experiments and highlighted in Figures 1A and 1B, respectively, the cationic fluorinated dendrimer FDG 2 N could be isolated in good yield and purity.

[0067] The compound is directly dispersible in aqueous media and tends to self-assemble with a CMC of 50 μM or less in pure water and 20 μM or less in NaCl. In pure water and at physiological pH (10 mM HEPES buffer, pH = 7.4), it self-assembles mainly by forming small micelles with an average hydrodynamic radius of about 2.5 nm, as confirmed by Cryo-TEM analysis, which is consistent with the DLS results. When dissolved in 150 mM NaCl, FDG 2N tends to form larger spherical aggregates. Indeed, larger spherical aggregates (50-100 nm in diameter) are observed in the vicinity of small micelles (15-20 nm in diameter). Such large aggregates are considered to be the cause of the higher hydrodynamic lines obtained by DLS in NaCl compared to the aggregates observed in HEPES buffer and water. Figure 2 shows the Cryo-TEM results observed in HEPES buffer (2A, 2B) and in 150 mM NaCl (2C, 2D).

[0068] Even 48 hours after the Z-potential measurements, the aggregates remained positively charged, showing values ​​of +40 mV or higher, suggesting the possibility of binding to nucleic acids.

[0069] The relaxation times T1 and T2 were measured using 2.5 mM FDG. 2 The N concentration was measured in pure water. 2 N's T1 was 465 ms and T2 was 85.4 ms. 19 It was ideal for F-MRI application.

[0070] The complex with siRNA was confirmed by cryo-electron microscopy, and the presence of siRNA was confirmed by FDG 2 It was observed that N influenced the aggregation behavior, leading to the formation of spherical aggregates of larger dimensions (Figure 3B) with respect to those observed with the same concentration of fluorinated dendrimer alone (Figure 3A).

[0071] Example 5: FDG mimic 2 Preparation of N-miR124a dendriplexes Dilute 2 μl of the miRNA of interest in 125 μl Opti-MEM Medium and add to each well to be treated. This 0.5 μM miRNA solution was mixed with 125 μl of Lipofectamine RNAiMAX Reagent (Cat. no. 13778-075 Thermo Fisher Scientific) as a control or 125 μl of FDG. 2N is added at the concentration shown in Table 1. The miRNA used is hsa-miR-124-3p Accession No. MI0000443 (Mature miRNA Sequence SEQ ID NO: 2 UAAGGCACGCGGUGAAUGCC).

[0072] In this way, dendriplexes are obtained with the N / P and molar ratios shown in Table 1, namely miR-124a N / P5 dendriplex, miR-124a N / P10 dendriplex, miR-124a N / P20 dendriplex, miR-124a N / P30 dendriplex, miR-124a N / P40 dendriplex used in the following examples.

[0073] [Table 1]

[0074] Example 6: FDG mimics 2 N-miR124a dendriplexes do not alter epSPC survival We isolated epSPCs (adult spinal cord-derived stem progenitor ependymal cells) from the spinal cords of 18-week-old mice.

[0075] All animal experiments were performed in accordance with EU Directive 2010 / 63 and the Italian legislation on the protection of animals used for scientific purposes (Decree 26 / 2014). Control male B6.SJL mice were purchased from Charles River Laboratories, Inc. (Wilmington MA, USA) and were maintained and bred in accordance with the institutional guidelines. At 18 weeks of age, mice were cultured under CO 2Mice were sacrificed following exposure and tissue harvesting was performed. After removing meninges and blood vessels, spinal cords were cut into small pieces, dissociated with 0.05% collagenase I for 15 min at 37°C, and processed to generate epSPC neurospheres as described in Marcuzzo et al., 2014. On day 7, epSPC neurospheres were dissociated into individual cells (cell passage 1, P1) and cultured for an additional week. This was repeated until day 21 of in vitro culture (P3) to obtain sufficient cells for further analysis. Neurospheres were periodically observed under a light microscope (Eclipse TE 2000-S, Nikon, Tokyo, Japan). At P3, 8 × 10 4 epSPCs were cultured under various growth conditions at a density of: 1) baseline condition; 2) Opti-MEM condition, which corresponds to the baseline condition but in the presence of Opti-MEM transfection medium; 3) negative control (NC) N / P5: FDG charged with molecules carrying random miRNA mimic sequences. 2 Negative control (NC) consisting of N dendriplexes N / P5 (Thermo Fisher Scientific Inc., Foster City, MA, USA; at a nitrogen-phosphorus ratio of 5; 4) NC N / P10; 5) NC N / P20; 6) NC N / P30; 7) NC; 8) Lipofectamine and NC; 9) FDG charged with SEQ ID NO:2 at a nitrogen-phosphorus ratio of 5 2 1) MiR-124a N / P5 dendriplex consisting of N; 2) MiR124a N / P10 dendriplex; 3) MiR-124a N / P20 dendriplex; 4) MiR-124a N / P30 dendriplex; 5) MiR-124a N / P40 dendriplex; 6) MiR-124a N / P50 dendriplex; 7) MiR-124a N / P60 dendriplex; 8) MiR-124a N / P70 dendriplex; 9) MiR-124a N / P80 dendriplex; 10) MiR-124a N / P10 dendriplex; 11) MiR-124a N / P20 dendriplex; 12) MiR-124a N / P30 dendriplex; 13) MiR-124a N / P40 dendriplex; 14) Empty N / P40. Cells were cultured for 72 h. Afterwards, epSPCs were harvested for molecular and immunofluorescence analysis. Figure 4A-D shows example images observed by fluorescence microscopy under the indicated conditions.

[0076] After dendriplex treatment, the density of epSPCs was comparable across culture conditions. In contrast, cells cultured in the presence of lipofectamine, negative control (NC), or miR-124a mimics showed a decrease in cell density relative to that observed in the absence of lipofectamine. To better evaluate the effect of dendriplexes and lipofectamine on epSPC cultures, immunofluorescence staining was performed for nestin, a marker of neural stem / progenitor cells, under baseline conditions and after treatment with miR-124a N / P30 dendriplexes or miR-124a lipofectamine mimics.

[0077] For this purpose, epSPC neurospheres were dissociated into individual cells and plated at 8 × 10 on Matrigel-treated coverslips. 4Cells were plated at a density of 100x and maintained in growth medium for 72 h under the following conditions: 1) baseline; 2) miR-124a N / P30 dendriplex; and 3) miR-124a mimic Lipofectamine. They were then fixed with 4% paraformaldehyde for 20 min at room temperature, permeabilized with 0.1% Triton X-100, and treated with 10% anti-goat in PBS to block nonspecific binding sites. Samples were then incubated with anti-mouse nestin (Mouse-antimouse Nestin IgG, 1:200, Millipore, Billerica, MA). Immunopositivity was revealed with anti-mouse IgG conjugated with Alexa Fluor 488 (Thermo Fischer Scientific). Cells were stained with 4,6-diamino-2-phenylindole (DAPI) and coverslips were mounted with FluorSave. Point fluorescence images were obtained with a confocal laser scanning microscope (Eclipse TE 2000-E, Nikon) and analyzed with EZ-C1 3.70 imaging software (Nikon). Quantitative assessment of individual nestin-positive cells was performed with ImageJ software (version 1.52 p) in 6 randomly selected fields per slide at X60 magnification for each condition. Examples of confocal images obtained under the three different conditions tested are shown in Figure 4E. Quantification of the obtained results is shown in the graph in Figure 4E. Similar to the above observations, no differences were found in the number of nestin-positive epSPCs between baseline cultures (gray columns) and cultures treated with miR-124a N / P30 dendriplexes (striped columns); in contrast, there was a significant reduction in nestin-positive cells in cultures treated with lipofectamine and miR-124a (black columns) with respect to baseline cultures and cultures treated with miR-124a N / P30 dendriplexes. To evaluate the impact of dendriplexes charged with mimic miR-124a on epSPCs survival at the molecular level and to exclude excitotoxic effects, we analyzed the expression levels of the apoptosis-associated caspase-6 gene (CASP6) in the same cultures.CASP6, which cleaves and activates caspase-3, has been described as a caspase initiator in the apoptotic cascade leading to neuronal death after excitotoxic events (Girling et al., 2018, J. Neurosci.Res.).

[0078] 2-2.5×10 using TRIzol 5 Total RNA was extracted from epSPCs. RNA quality was checked using a 2100Nano bioanalyzer (Agilent Technologies, Waldbron, Germany). Total RNA was retranscribed with TaqMan MicroRNA using miR-124a and U6 specific primers (Thermo Fisher Scientific). cDNA (corresponding to 15 ng of total RNA) was amplified in duplicate by Real Time PCR on a Viia7 Real Time PCR System (Applied Biosystem) using Universal PCR Master Mix and TaqMan MicroRNA assays specific for miR-124a and U6 (Thermo Fisher Scientific). All results were normalized with respect to U6, and relative miRNA expression levels were calculated using the formula 2-ΔCt.

[0079] For gene expression analysis, total RNA extracted from epSPCs previously screened for miRNA expression was retranscribed using the SuperScript Vilo cDNA synthesis kit (Thermo Fisher Scientific). This cDNA (corresponding to 10 ng of total RNA) was amplified in duplicate by quantitative real-time PCR for caspase-6 (CASP6), cyclin D2 (Dlx2), and 18s housekeeping genes in Viia7 Real-Time PCR (Applied Biosystems) using TaqMan Fast Advanced Master Mix and Taqman Gene Expression Assays (Thermo Fischer Scientific). The results are shown in Figure 4F. Notably, CASP6 mRNA levels were comparable in cells under baseline conditions (gray columns) and in cells treated with miR-124a N / P30 dendriplexes (striped columns), but were significantly increased in epSPC cultures treated with miR-124a and Lipofectamine (black columns). Taken together, these results indicate that the apoptotic process is activated early in cells treated with Lipofectamine, but not in cells mimicking miR-124a with the dendriplexes according to the invention. This data confirms the safety of using the dendriplexes according to the invention to mimic miRNAs in epSPCs.

Claims

1. Fluorinated dendrimer structures of formula (I): 【Chemistry 1】 During the ceremony, n is an integer from 1 to 5; R is 【Chemistry 2】 【Transformation 3】 is selected from R 1 teeth, CH (4) 【Chemistry 4】 is selected from X is independently: OH; (6) COOH (7) NH 2 (8) NH 3 + Y - (9) No. 2 2 (10) NR 2 3 + Y - (11) is selected from where: R 2 are independently -CH 3 , -CH 2 CH 3 , -CH 2 CH 2 CH 3 , -CH(CH 3 ) 2 , -CH 2 OH, -CH 2 CH 2 OH; Y - teeth: 【Transformation 5】 A structure selected from:

2. 2. The structure of claim 1, wherein n is 2 or 3.

3. R is (2) 【Transformation 6】 2. The structure of claim 1 , wherein:

4. R 1 However, (5) 【Transformation 7】 2. The structure of claim 1 , wherein:

5. X is NH 3 + Y - and Y is 【Transformation 8】 The structure of claim 1 , wherein the structure is selected from:

6. n is 3, R is (2), and R 1 is (5), and X is NH 3 + Y - and Y is (12) and the structure is FDG 2 N.

7. A supramolecular complex comprising at least one dendrimer structure according to any one of claims 1 to 6 and one or more nucleic acids.

8. The complex according to claim 7, wherein the ratio (N / P) of nitrogen atoms of the dendrimer structure to phosphorus atoms of the one or more nucleic acids is 5 to 40.

9. 9. The complex of claim 8, wherein N / P is 30.

10. The supramolecular complex of claim 7 for use in gene therapy.

Images