Aptamer dynamic range compression and detection techniques

Abstract

Aptamer detection techniques with dynamic range compression are described, which allow for the removal of a portion of the more abundant aptamers in aptamer-based assays. In embodiments, a mixture of tagged probes and dummy probes can be used, so that the dummy probes bind to the more abundant aptamers and are not captured or amplified for downstream detection. Other techniques are also contemplated, including targeted removal or cleavage of probes that bind to excess aptamers.

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims priority to and the benefit of U.S. Provisional Application No. 63 / 329,101, filed April 8, 2022. This application also claims priority to and the benefit of U.S. Provisional Application No. 63 / 343,760, filed May 19, 2022. This application also claims priority to and the benefit of U.S. Provisional Application No. 63 / 347,375, filed May 31, 2022. This application also claims priority to and the benefit of U.S. Provisional Application No. 63 / 385,544, filed November 30, 2022, the disclosures of all of which are incorporated herein by reference in their entireties.

[0002] (Reference to Electronic Sequence Listing) This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated herein by reference in its entirety. The .XML copy, created on April 5, 2023, is designated "IP-2487-PCT.xml" and is 19,152 bytes in size. The Sequence Listing contained in this .XML file is a part of the present specification and is incorporated herein by reference in its entirety. [Background technology]

[0003] The disclosed technology relates generally to aptamer detection and / or identification techniques for dynamic range compression in conjunction with aptamer-based assays. In particular, the disclosed technology relates to nucleic acid sequencing for direct or indirect aptamer detection in conjunction with aptamer-based assays.

[0004] The subject matter discussed in this section should not be assumed to be prior art merely as a result of its mention in this section. Similarly, it should not be assumed that the problems mentioned in this section, or associated with the subject matter provided as background, have been previously recognized in the prior art. The subject matter in this section merely represents different approaches, which as such may also correspond to embodiments of the claimed technology.

[0005] Protein expression patterns help define the identity and state of a cell. RNA transcripts are often used as a surrogate for protein expression, but the relationship between protein and mRNA abundance is not one-to-one. There are differences caused by post-transcriptional, translational, and protein degradation regulation. Therefore, direct nucleic acid sequencing of RNA transcripts cannot provide an accurate estimate of protein expression.

[0006] Aptamers are nucleic acids that bind with high affinity and specificity to molecular targets such as proteins. Advances in aptamer selection and design include Systematic Evolution of Ligands by EXponential enrichment (SELEX). In SELEX, high affinity nucleic acids for different analytes of interest can be isolated from combinatorial libraries, allowing high-throughput characterization of aptamer-target binding and multiplexed assays for analytes in complex biological samples. Once an aptamer binds to an analyte target, the binding event can be detected to characterize the presence and concentration of various analytes in the biological sample. However, protein or other analyte concentrations can be highly variable within and / or between different biological samples, making it difficult to identify a useful detection range in a multiplexed aptamer-based assay. Summary of the Invention

[0007] In one embodiment, the present disclosure provides a method of aptamer detection, comprising contacting an analyte of a sample with a plurality of aptamers under conditions that allow the formation of an analyte-aptamer complex, wherein different aptamers of the plurality of aptamers have specific affinities for respective different analytes of the analyte. The method also comprises detecting the analyte by detecting the aptamers of the analyte-aptamer complex. Detecting each aptamer of the plurality of aptamers comprises contacting each aptamer with a mixture of first probes, wherein a first complementary region of each first probe of the mixture hybridizes to a first region of each aptamer, and only a subset of the first probes in the mixture bind to the affinity tag. The detecting also includes contacting each aptamer with a second probe, and hybridizing the second complementary region of the second probe to the second region of each aptamer, the second probe includes a non-hybridized region extending from the complementary region, the non-hybridized region includes an identification sequence that uniquely identifies each aptamer, and the first complementary region and the second complementary region uniquely hybridize to each aptamer. The detecting also includes capturing the first probe of the mixture through binding of the affinity tag with an affinity tag binder to capture each aptamer and the second probe hybridized to the second region of each aptamer, the first probe being in the subset that is bound to the affinity tag. The detecting also includes detecting the identification sequence of the captured second probe.

[0008] In one embodiment, the present disclosure provides an aptamer detection probe set. The aptamer detection probe set comprises a plurality of different first probe mixtures that are complementary to each different aptamer of the aptamer panel. Each of the plurality of different first probe mixtures comprises a binding subset of the first probes that are bound to affinity tags, and a dummy subset of the first probes, and each probe in the binding subset and the dummy subset of each of the first probe mixtures comprises the same binding region that is complementary to the first sequence of each aptamer of the aptamer panel. The aptamer detection probe set also comprises a plurality of different second probes that are complementary to each different aptamer of the aptamer panel, and each of the plurality of different second probes comprises a second binding region that is complementary to the second sequence of each aptamer, and each of the second probes comprises a non-hybridized region, and the non-hybridized region comprises an identification sequence that uniquely identifies each aptamer. In certain embodiments, aptamer detection probe sets can be used to generate oligonucleotides suitable for next generation sequencing techniques.Therefore, aptamer detection using aptamer detection probe sets can include sequencing the identification sequence in the generated oligonucleotides using next generation sequencing (NGS) techniques.Furthermore, the generated oligonucleotides can include one or more adapter sequences and / or sample-specific index sequences to allow multiplexing in a single sequencing run.

[0009] In one embodiment, the present disclosure provides an aptamer detection probe set. The aptamer detection probe set comprises a plurality of different first probe mixtures that are complementary to each different aptamer of the aptamer panel. Each first probe mixture of the plurality of different first probe mixtures comprises a binding subset of the first probes and a dummy subset of the first probes that are not bound to the affinity tag, and each first probe mixture comprises a binding region that is complementary to an aptamer of the aptamer panel, and the binding region is unique to each first probe mixture, so that each first probe mixture binds to a different aptamer of the aptamer panel, and therefore each first probe mixture has a different ratio of binding subset to dummy subset compared to other first probe mixtures of the plurality. The aptamer detection probe set also comprises a plurality of different second probes that are complementary to each different aptamer of the aptamer panel.

[0010] In one embodiment, the disclosure provides an aptamer detection probe set that includes a mixture of multiple different reporter probes complementary to each different aptamer in an aptamer panel. Each reporter probe mixture of the plurality of different reporter probe mixtures comprises a first subset of reporter probes comprising an amplifiable non-hybridized region, the first subset comprising an identification sequence uniquely identifying an individual aptamer that is adjacent to and can be amplified using primers complementary to or corresponding to (e.g., having the same sequence as) the first primer region and the second primer region, and a second subset of reporter probes, each probe in the first subset and the second subset of each reporter probe mixture comprises the same binding region that is complementary to a first sequence of an individual aptamer in the aptamer panel, and each second probe comprises a non-amplifiable non-hybridized region that cannot be amplified using primers. The aptamer detection probe set also includes a plurality of different capture probes complementary to each different aptamer of the aptamer panel, each capture probe of the plurality of different capture probes includes a second binding region complementary to a second sequence of the respective aptamer, and each capture probe of the plurality is bound to an affinity tag.

[0011] In one embodiment, the disclosure provides a method of aptamer detection, the method comprising contacting individual aptamers with reporter probes that hybridize to a first region of each aptamer, a first subset of the reporter probes comprising an amplifiable non-hybridizing region, the amplifiable non-hybridizing region comprising an identifying sequence uniquely identifying the individual aptamer adjacent to a first primer region and a second primer region, and a second subset of the reporter probes comprising a non-amplifiable non-hybridizing region; The method includes contacting each aptamer with a capture probe, where the capture probe hybridizes to a second region of each aptamer and the capture probe is associated with an affinity tag; capturing the capture probe via binding of the affinity tag to an affinity tag binder to capture each aptamer and a reporter probe comprising an amplifiable non-hybridized region hybridized to the first region of each aptamer; and detecting the discriminator sequence of the captured reporter probe via amplification of the discriminator sequence.

[0012] In one embodiment, the present disclosure provides a method of aptamer detection, the method comprising contacting an aptamer with probes that hybridize to respective different aptamers, wherein a complementary region of each probe hybridizes to an individual one of the aptamers and each probe includes a non-hybridized region extending from the complementary region, the non-hybridized region including an identification sequence that uniquely identifies the individual aptamer, removing excess probes that are not hybridized to the aptamers using an exonuclease, and detecting the identification sequence in the capture probe after removing the excess probes.

[0013] In one embodiment, the disclosure provides a method of aptamer detection, the method comprising contacting a first aptamer and a second aptamer with a reporter probe, the reporter probe comprising a first subset that hybridizes to the first aptamer and a second subset that hybridizes to the second aptamer, the first subset of reporter probes comprising a first non-hybridizing region comprising a first discriminator sequence uniquely identifying the first aptamer and a first group capture sequence, and the second subset of reporter probes comprising a second non-hybridizing region comprising a second discriminator sequence uniquely identifying the second aptamer and the first group capture sequence. The method also includes contacting the first and second aptamers with a capture probe, where the capture probe hybridizes to the first aptamer or the second aptamer and where the capture probe is associated with an affinity tag; capturing the capture probe via binding of the affinity tag to an affinity tag binder to capture the first and second aptamers and the reporter probe; generating a first oligonucleotide comprising a first discrimination sequence and a first group capture sequence from a first subset and a second oligonucleotide comprising a second discrimination sequence and a first group capture sequence from a second subset; capturing the first and second oligonucleotides using a first group of beads having a sequence complementary to the first group capture sequence; and detecting the first discrimination sequence in the captured first oligonucleotide and the second discrimination sequence in the second oligonucleotide to detect the first and second aptamers.

[0014] In one embodiment, the disclosure provides a method of aptamer detection, the method comprising contacting each aptamer with a first reporter probe that hybridizes to a first region of each aptamer, the first reporter probe comprising a first non-hybridizing region, the non-hybridizing region comprising a first identification sequence that uniquely identifies the individual aptamer, and a second reporter probe that hybridizes to a second region of each aptamer, the second reporter probe comprising a second non-hybridizing region, the second non-hybridizing region comprising a first identification sequence that uniquely identifies the individual aptamer. the hybridization region comprises a second discrimination sequence that uniquely identifies an individual aptamer; ligating the ends of the first discrimination sequence and the second discrimination sequence to each other to generate a ligated reporter probe; capturing the ligated reporter probe using an affinity tag bound to the first reporter probe or the second reporter probe; and detecting the first discrimination sequence and the second discrimination sequence via amplification of the captured ligated reporter probe to detect the individual aptamers.

[0015] In one embodiment, the disclosure provides a method of aptamer detection, the method comprising: contacting an analyte of a sample with a plurality of aptamers under conditions allowing for the formation of analyte-aptamer complexes, where different aptamers of the plurality of aptamers have specific affinities for respective different analytes of the analyte; detecting the analyte by detecting the aptamers of the analyte-aptamer complex, where detecting individual aptamers of the plurality of aptamers comprises contacting the individual aptamers with a mixture of first probes, where a first complementary region of each of the first probes of the mixture can hybridize to a first region of an individual aptamer, where only a subset of the first probes in the mixture are bound to affinity tags such that the first probes of the mixture hybridize to the first region of the individual aptamers; and contacting the individual aptamers with a second probe to hybridize the second complementary region of the second probes. to a second region of each aptamer, wherein the second probe includes a non-hybridizing region extending from the complementary region, the non-hybridizing region including an identification sequence uniquely identifying the individual aptamer, and the first complementary region and the second complementary region uniquely hybridize to the individual aptamer; and hybridizing the first probe hybridized to the first region of each aptamer to a second region of each aptamer. capturing the first probe via binding of the affinity tag to an affinity tag binder to capture each aptamer and a second probe hybridized to a second region of each aptamer and ligated to the first probe, wherein the first probe is in the subset bound to the affinity tag; and detecting the identifying sequence of the captured second probe.

[0016] In one embodiment, the present disclosure provides a method of aptamer detection, the method comprising contacting an analyte of a sample with a plurality of aptamers under conditions allowing for the formation of analyte-aptamer complexes, different aptamers of the plurality of aptamers having specific affinity for respective different analytes of the analytes, the method also comprising detecting the analyte by detecting the aptamer of the analyte-aptamer complex. The detecting includes contacting each aptamer with a mixture of first probes, where a first complementary region of each first probe of the mixture hybridizes to a first region of the individual aptamer, and where only a subset of the first probes in the mixture bind to the affinity tag; and contacting each aptamer with a second probe, where a second complementary region of the second probe hybridizes to a second region of the individual aptamer, the second probe including a non-hybridizing region extending from the complementary region, the non-hybridizing region including an identification sequence uniquely identifying the individual aptamer, and the first complementary region and the second complementary region the affinity tag is in a subset bound to the affinity tag; capturing a first probe of the mixture via binding of the affinity tag with an affinity tag binder to capture each aptamer and a second probe hybridized to a second region of each aptamer, the first probe being in a subset bound to the affinity tag; generating an amplification product from the captured second probe using a primer pair, the primer pair including a first primer that does not include the second complementary region and that is complementary to a region of the second probe that does not include the discriminatory sequence; and sequencing the amplification product.

[0017] In one embodiment, the disclosure provides a method of sequencing that includes generating sequence data from a sequence library that includes contacting an analyte of a sample with a plurality of aptamers under conditions that allow for the formation of analyte-aptamer complexes, where different aptamers of the plurality of aptamers have specific affinities for respective different analytes of the analyte, and forming a first plurality of aptamer complexes of a first type by hybridizing a reporter probe and a dummy probe to each aptamer of the plurality of aptamers, where the dummy probe includes a first complementary region that hybridizes to a first region of each aptamer, and the reporter probe includes a second complementary region that hybridizes to a second region of each aptamer and a non-complementary region extending from the complementary region. The method includes: forming a second plurality of aptamer complexes of a second type by hybridizing a reporter probe and a capture probe to each aptamer, the capture probe comprising a first complementary region that hybridizes to the first region of each aptamer and an affinity tag; generating a second plurality of aptamer complexes separated from the first plurality via the affinity tag; and amplifying a portion of the reporter probe of the separated second plurality of aptamer complexes to generate a sequence library. The method also includes identifying the identifying sequences in the sequence data and generating a notification that each aptamer is present in the sample based on the identifying. In an embodiment, the method also includes quantifying the identified identifying sequences in the sequence data to measure the relative amount of aptamers present in the sample. The number of discriminating sequences identified allows the relative amount of the aptamer to be quantified. [Brief description of the drawings]

[0018] These and other features, aspects, and advantages of the disclosed embodiments will become better understood when the following detailed description is read in conjunction with the accompanying drawings, in which like features represent like parts throughout the drawings. [Figure 1] 1 is a schematic diagram of an exemplary dynamic range within a sample, according to an embodiment. [Diagram 2] 1 illustrates an exemplary workflow for dynamic range compression, according to an embodiment. [Diagram 3] 1 illustrates an exemplary workflow for dynamic range compression using differential probe mixes based on aptamer abundance, according to an embodiment. [Figure 4] FIG. 1 is a schematic diagram of capture probe and reporter probe separation, according to an embodiment. [Diagram 5] FIG. 1 is a schematic diagram of a trimolecular complex for use in conjunction with dynamic range compression techniques, according to an embodiment. [Figure 6] 1 shows an exemplary arrangement of non-hybridizing regions, according to an embodiment. [Figure 7] 1 illustrates an exemplary reporter probe direct amplification technique, according to an embodiment. [Figure 8A] 1 shows an exemplary sequencing from a direct amplification technique, according to an embodiment. [Figure 8B] FIG. 8A shows the results of sequencing using the technique of option 1. [Figure 8C] FIG. 8B shows sequencing quality metrics for the sequencing reaction of FIG. [Figure 9A] 1 illustrates an exemplary reporter probe step-out amplification technique, according to an embodiment. [Figure 9B] FIG. 9B shows the results of amplification using the technique of option 1 of FIG. 9A. [Figure 9C] FIG. 9A shows the amplification product tape station for option 2. [Figure 10] 1 shows an exemplary sequencing from a step-out amplification technique, according to an embodiment. [Figure 11] 1 illustrates an exemplary reporter probe ligation amplification technique, according to an embodiment. [Figure 12] 1 shows an exemplary sequencing from a ligation amplification technique, according to an embodiment. [Figure 13] 1 illustrates an exemplary splint ligation technique, according to an embodiment. [Figure 14A] 1 illustrates an exemplary extension ligation technique, according to an embodiment. [Figure 14B] 1 shows the PCR-free library conversion of the extension ligation technique. [Figure 14C] 1 shows the conversion efficiency of the extension-ligation technique. [Figure 15] 1 illustrates an exemplary extension ligation technique, according to an embodiment. [Figure 16] 1 illustrates an exemplary split reporter probe technique, according to an embodiment. [Figure 17A] 1 illustrates an exemplary split reporter probe technique using a splint, according to an embodiment. [Figure 17B] 1 illustrates an exemplary split reporter probe technique using a splint, according to an embodiment. [Figure 17C] 1 shows the ligation products of split reporter probe technology. [Figure 17D] 1 shows the efficiency of the split reporter probe technique to generate ligation products over time. [Figure 18A] 1 shows an exemplary exonuclease digest for use in conjunction with split reporter probe technology, according to an embodiment. [Figure 18B] 1 shows ligation product protection in the presence of exonuclease digestion. [Figure 19] 1 shows an exemplary exonuclease digestion for use in conjunction with circularization split reporter probe technology, according to an embodiment. [Figure 20A] 1 illustrates an exemplary dummy reporter technique that uses a mixture of amplifiable and non-amplifiable regions, according to an embodiment. [Figure 20B] 1 illustrates an exemplary dummy reporter technique that uses a mixture of amplifiable and non-amplifiable regions, according to an embodiment. [Figure 20C] Sequencing read counts in the presence of a dummy reporter are shown. [Figure 21] 1 illustrates an exemplary dummy reporter technique using endogenous restriction enzyme sites, according to an embodiment. [Figure 22A] 1 illustrates an exemplary exonuclease digestion technique, according to an embodiment. [Figure 22B] Reporter probe exonuclease digestion is shown. [Diagram 23] 1 illustrates an exemplary bead-based selection technique, according to an embodiment. [Figure 24] 1 illustrates an exemplary streamlined workflow using index amplification, according to an embodiment. [Diagram 25] FIG. 25 is a plot comparing sequencing read counts from the streamlined workflow of FIG. 24 with the ligation prep workflow. [Figure 26] 1 illustrates an exemplary workflow with reduced cleaning steps, according to an embodiment. [Figure 27] Sequencing read counts under different wash conditions are shown. [Figure 28A] 1 shows compression of sequencing read counts using dummy-biotin for different aptamers. [Figure 28B] 1 shows sequencing of reporter probes captured using different dummy biotin concentrations. [Figure 29] 1 shows exemplary undesired non-specific binding between aptamer binding regions. [Diagram 30] 1 shows the contribution of different aptamer binding regions to non-specific binding. [Diagram 31] FIG. 2 is a block diagram of a sequencing device configured to obtain sequencing data, according to an embodiment. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] The following discussion is presented to enable those skilled in the art to make and use the disclosed technology and is provided in the context of a particular application and its requirements. Various modifications to the disclosed embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the disclosed technology. Thus, the disclosed technology is not intended to be limited to the embodiments shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.

[0020] Aptamers are short, single-stranded nucleic acid molecules (ssDNA or ssRNA) that can bind with high affinity to their specific target molecules. Thus, aptamers can be used for multi-omics applications such as proteomic characterization of samples in a high-throughput manner. For the evaluation of proteins in complex samples in a high-throughput approach, the challenge is to combine aptamers with low abundance proteins together with high abundance proteins in a single panel. For example, human serum / plasma contains proteins that may differ in concentration by many orders of magnitude, e.g., in the 10-log range. Certain aptamer detection platforms can compress the dynamic range of the proteins detected. However, even after compression, the dynamic range can still be relatively large. Figure 1 shows an exemplary 5-log dynamic range within aptamer detection results for a sample, showing three different aptamers with positive binding results along a wide dynamic range. To address the complexity of the dynamic range, samples can undergo pre-treatment or targeted panels are used to measure proteins over a specific range. These approaches add additional complexity and opportunities for loss of low abundance proteins.

[0021] Disclosed herein is a technique for compressing the dynamic range of aptamers with positive binding results (e.g., binds to a target molecule in a sample), which may occur prior to or in conjunction with the aptamer detection step. This technique preserves aptamer binding to low abundance proteins that are evaluated together with high abundance proteins. Furthermore, since low abundance proteins may correspond to biomarkers that can be used for diagnostic purposes, the disclosed technique prevents noise or false negative results in aptamer-based assays caused by high abundance proteins obscuring the results. In addition, reducing the dynamic range can also reduce the amount of total sequencing data required to detect aptamers in a detection assay by reducing the amount of reads wasted on high abundance aptamer sequences. In certain embodiments, the disclosed technique may provide a streamlined workflow with reduced equipment load through a reduction in the number of steps (e.g., a single hybridization reaction or a reduced number of washing steps). The disclosed technique may include a sample preparation step and / or sample preparation that allows for improved aptamer abundance measurements.

[0022] FIG. 2 shows an exemplary workflow for dynamic range compression, where the dynamic range of individual aptamers 14a can be compressed by removal of some of the aptamers 14a before the detection step. In the illustrated workflow, dynamic range compression is shown for individual aptamers 14a of a single aptamer type. It should be understood that the illustrated workflow can be extended in parallel to all aptamers in a multiplexed aptamer-based assay. Furthermore, the assay eluent can contain multiple aptamers 14a, depending on the concentration of the target molecules of the aptamers 14a in the sample being evaluated. The aptamers 14a are single-stranded nucleic acids with fixed or substantially fixed nucleic acid sequences. Thus, all copies or multiples of an individual aptamer 14a can share a conserved sequence. Different aptamers, commonly referred to as aptamers 14 (see FIG. 3), can have different nucleic acid sequences relative to each other, facilitating different target specificities for each different aptamer 14.

[0023] The conserved sequence of the aptamer 14a can be used to design a probe set 20 that includes a first probe 22 that hybridizes (e.g., via a complementary sequence) to a first region 23 of the aptamer 14a and a second probe 24 that hybridizes to a second region 25 of the aptamer 14a. The first probe 22 is a mixture of at least two different types of probes, both of which share the ability to hybridize to the first region 23. As shown, the mixture includes an affinity-tagged probe 28 that includes an affinity tag 30 and a dummy probe 32 that lacks the affinity tag 30. In an embodiment, the affinity-tagged probe 28 and the dummy probe 32 are identical except for the presence or absence of the affinity tag 30. The ratio of affinity-tagged probe 28 to dummy probe 32 can be adjusted based on the abundance of the target of the aptamer 14a, as generally discussed herein.

[0024] The workflow includes contacting the aptamer 14a with a probe set 20, for example, a first probe 22 and a second probe 24. Both the affinity-tagged probe 28 to the dummy probe 32 of the first probe 22 have the same binding ability and specificity for the first region 23 of the aptamer 14a, and contacting the first probe with the aptamer 14a results in binding of both the affinity-tagged probe 28 and the dummy probe 32. If the affinity-tagged probe 28 is rare (for example, less than 10%) in the mixture of the first probe 22, the majority of the aptamer 14a will be bound to the dummy probe 32. Furthermore, all of the second probes 24 can be identical to each other. Therefore, two different types of trimolecular complexes are formed for the aptamer 14a. The first type 33 includes the second probe 24 and the dummy probe 32. The second type 34 includes the second probe 24 and the affinity-tagged probe 28. Again, because the first probe 22 is provided as a mixture, the relative ratios of first type 33 and second type 34 trimolecular complexes depend on the ratio of affinity-tagged probes 28 to dummy probes 32 in the first probe 22. The ratio of affinity-tagged probes 28 to dummy probes 32 can be selected for each aptamer in the assay based on its relative abundance with respect to other aptamers, e.g., to compress the dynamic range for downstream detection via NGS.

[0025] The workflow also includes a step of separating the first type 33 trimolecular complexes from the second type 34 trimolecular complexes via a capture entity. For example, only the second type 34 trimolecular complexes may be captured using a capture entity shown here as a capture bead 36 bound to an affinity tag binder 38. However, other configurations are contemplated, including column-based, flow cell-based, or substrate-based separations using a capture entity that binds to an affinity tag 30. The unbound first type 33 may be washed or separated, leaving only the second type 34 trimolecular complexes and their component molecules, the aptamer 14a, the affinity tagged probe 28, and the second probe 24. In addition, unbound or uncaptured probes of the probe set 20 are also removed. The workflow also includes detection, such as via sequencing, of the second probe 24, or oligonucleotides amplified or otherwise derived from the second probe 24, as a surrogate measure of the aptamer 14a as generally discussed herein.

[0026] FIG. 3 shows an exemplary workflow for dynamic range compression comparing high abundance aptamer 14a to low abundance aptamer 14b. For example, high abundance aptamer 14a may have specific binding affinity to a protein known to be of high abundance, such as albumin, alpha-2-macroglobulin, apolipoprotein A1, complement C4, IgG, IgM, apolipoprotein A2, alpha-1-antitrypsin, plasminogen, or collagen. Low abundance aptamer 14b may have specific binding affinity to a biomarker, a transiently expressed protein, a protein expressed only in a certain type of cell, or the like. These are examples, and it should be understood that the identity of the protein target depends on the composition of the aptamer in the aptamer-based assay. Furthermore, it should be understood that in certain embodiments, the high abundance aptamer and the low abundance aptamer may be based on abundance relative to each other or other aptamers in the aptamer-based assay, rather than absolute abundance or concentration.

[0027] In the illustrated example, the high abundance aptamer 14a may be expected to be present in a higher concentration in the aptamer-based assay eluate compared to the low abundance aptamer 14b, for example, based on empirical testing or retrospective analysis. Therefore, to compress the dynamic range in the downstream detection step, different mixtures of the first probes in the probe sets 20a, 20b may be used based on the predicted abundance. For the high abundance aptamer 14a, relatively more aptamer-bound dummy complexes may be removed via binding with the dummy probe 32a. Therefore, the dummy probe 32a may be present in a higher proportion in the first probe 22a. To convert less aptamer 14b via dummy binding before the detection step, the dummy probe 32b may be present in a relatively lower proportion in the first probe 22b. In one embodiment, the proportion of the dummy probe 32b may be 0%. That is, for a particular aptamer, probe 22 can include only tagged probes 28 and no dummy probes 32. Thus, the ratio of dummy probes 32 to affinity tagged probes 28 can be adjusted and can be different for different aptamers 14. In a high throughput assay, each individual aptamer 14 can, in embodiments, be associated with a different ratio of dummy probes 32 to affinity tagged probes 28.

[0028] In an embodiment, the ratio of dummy probes 32 to affinity-tagged probes 28 in the mixture of first probes 22 can be greater than 100,000:1, greater than 10,000:1, greater than 1000:1, greater than 100:1, greater than 20:1, greater than 10:1, greater than 5:1, greater than 2:1, about 1:1, less than 1:2, or less than 1:5. In an embodiment, the mixture of first probes 22 includes only dummy probes 32 or affinity-tagged probes 28 and does not include other probe types. In an embodiment, the dummy probes 32 are at least 25%, at least 50%, at least 75%, or at least 90% of the mixture of first probes 22. In an embodiment, the mixture of first probes 22 includes only dummy probes 32 or affinity-tagged probes 28 and does not include other probe types. In an embodiment, the first probes 22 include only affinity-tagged probes 28 and does not include any dummy probes 32. For example, for very low abundance proteins, it may be undesirable to lose any aptamers 14 via depletion.

[0029] In a high throughput assay, each individual aptamer 14 may, in embodiments, be associated with a different ratio of dummy probe 32 to affinity tagged probe 28 such that each individual aptamer 14 has a unique ratio compared to other aptamers 14 used together in a panel or assay. In embodiments, a particular group of aptamers 14 all associated in an approximate abundance range may have the same ratio of dummy probe 32 to affinity tagged probe 28 compared to each other. In embodiments, for a high throughput assay, at least three different ratios of dummy probe 32 to affinity tagged probe 28 are present for a group of at least 1000 different aptamers 14. In embodiments, at least 5, 10, 50, 100, or more different ratios of dummy probe 32 to affinity tagged probe 28 are present for the aptamers 14 in the assay.

[0030] The workflow includes contacting the aptamers 14a, 14b with the probe sets 20a, 20b, e.g., first probes 22a, 22b and second probes 24a, 24b. It should be understood that the first probes 22a, 22b have binding capacities and specificities for different first regions 23a, 23b, and therefore have different nucleic acid sequences. Similarly, the second probes 24a, 24b have binding capacities and specificities for different second regions 25a, 25b, and therefore have different nucleic acid sequences. Contact with the probe sets 20a, 20b causes the formation of a first type 33a, 33b and a second type 34a, 34b of trimolecular complexes. Thus, in the illustrated example, due to the different ratios of dummy probes 32 to affinity-tagged probes 28 in the first probes 22a, 22b compared to each other, different ratios of trimolecular complexes of the first type 33a, 33b and trimolecular complexes of the second type 34a, 34b are formed between the different aptamers 14a, 14b. Due to the higher abundance of aptamer 14a, a larger proportion of the first type 33a is formed and can be subsequently removed in a capture step using affinity tag 30 and a capture entity, e.g. capture bead 36 and affinity tag binder 38. The affinity tag 30 can be the same tag for all affinity-tagged probes 28, allowing the capture of all trimolecular complexes of the second type 34 by the same means.

[0031] In embodiments, it should be understood that even if most complex formation is of the first type 33a, such that at least 50%, at least 75%, or at least 90% is removed for the high abundance aptamer 14a, the high abundance aptamer 14a may nevertheless be present in greater amounts upon detection simply due to a higher overall starting concentration compared to the low abundance aptamer 14b. That is, 1% of the high abundance aptamer 14a may be more than 100% of the low abundance aptamer 14b. However, the disclosed techniques can compress the dynamic range by 1 log, 2 logs, or more based on ratio adjustment or other techniques discussed herein.

[0032] The disclosed technique includes a workflow in which a trimolecular complex is formed and the affinity-tagged probe 28 used to capture the aptamer 14 is separated from the second probe 24 to be detected. FIG. 4 illustrates the advantage of separating the reporter or detection probe, e.g., second probe 24b, from the capture probe, e.g., affinity-tagged probe 28b. In one example, the aptamer 14b is not detected in a particular sample based on the sample composition. Thus, the aptamer 14b is not present in the workflow. In such an example, during the capture of another trimolecular complex, e.g., from the aptamer 14a, via the affinity-tagged probe 28. The capture bead 36 can pull down the affinity-tagged probe 28b. However, the absence of the aptamer 14b to bridge the gap and bind to the second probe 24b means that there is no second probe 24b to be detected. If the detectable moiety was on the affinity-tagged probe 28b, the illustrated example would produce a false positive.

[0033] FIG. 5 is a schematic diagram of a trimolecular complex, which may be of a first type 33 or a second type 34, depending on the type of attached first probe 22 (e.g., affinity tagged probe 28 or dummy probe 32), as generally discussed herein. The first probe 22 hybridizes to the first region 23 of the aptamer 14 via a first complementary region 60, e.g., a first aptamer binding region. The second probe 24 hybridizes to the second region 25 of the aptamer 14 via a second complementary region 62, e.g., a second aptamer binding region. The first complementary region 60 and the second complementary region 62 are unique to each individual aptamer 14. It should be understood that the relative positions of the first probe 22 and the second probe 24 on the aptamer 14 may be interchangeable, such that the first probe 22 may be 5' or 3' of the second probe 24. The first region 23 and the second region 25 can be spaced apart, for example, at least 1-2 nucleotides apart in the aptamer 14. In an embodiment, the first region 23 and the second region 25 are spaced apart, for example, 1-30 nucleotides apart in the aptamer 14. Providing spacing can provide benefits such as normalizing melting temperatures between probe sets of different aptamers 14 or reducing non-specific complementarity.

[0034] The first region 23 and the second region 25 may be contiguous or adjacent to each other, for example, 0 nucleotides apart. The contiguous arrangement of the first probe 22 and the second probe 24 may facilitate a workflow in which the first probe 22 and the second probe 24 are ligated to each other, for example, directly ligated at their respective ends, following aptamer binding. In embodiments, the first probe 22 and / or the second probe 24 may include matched overhangs or may be blunt-ended, depending on the desired ligation protocol. Ligation of the first probe 22 with the second probe 24 may provide the advantage of reducing melting temperature variation between sets of different probes used in the workflow, and may also avoid the need for Tm-enhancing probes. Furthermore, ligation may facilitate higher stringency washes for greater background removal and / or reduced wash times for a streamlined workflow. In embodiments, the ligation-based approach may also contribute to dynamic range compression. For example, the first probe 22 and / or the second probe 24 may be provided as a mixture with a dummy probe. In an embodiment, the second probe 24 can be provided as a mixture containing both a ligatable version with a 5' phosphate for ligation and a non-ligatable version with the same sequence and aptamer binding ability as the ligatable version, but without an available 5' phosphate. The ratio of non-ligatable to ligatable versions can be adjusted based on aptamer abundance. High abundance aptamers can be provided with a probe mixture with fewer ligatable versions in the mixture compared to lower abundance aptamers. After ligation with the available ligatable versions, the melting temperature and binding of the ligated product will be higher. Thus, higher stringency washing results in retention of the ligated product and loss of the unphosphorylated but bound non-ligatable version.In one embodiment, the ligated probes can be protected and separated from the unligated reporter probes 24 using a 5' affinity reagent such as biotin bound to streptavidin on the beads, and the ligated probes are protected from exonuclease digestion, while the free probes can be digested using an exonuclease, as discussed in Figure 19.

[0035] The second probe also includes a non-hybridizing region 64 that extends away from the second complementary region 62 and does not hybridize to the aptamer 14. Thus, the sequence of the non-hybridizing region 64 can be selected to avoid substantial complementarity with the sequence of the aptamer 14. The non-hybridizing region 64 can be used as a surrogate for the aptamer 14 for detection. Thus, the non-hybridizing region 64 can include a barcode or identification sequence 68 that is unique to each individual aptamer 14. Thus, different aptamers 14 are associated with different identification sequences 68 that are all different from each other and uniquely identify each aptamer 14. In an embodiment, the uniquely identifying sequence is uniquely identifying while taking into account barcode errors (e.g., 1-2 nucleotide sequence errors) during sequencing. Furthermore, the identification sequence 68 can be designed such that the identification sequence 68 is different from the aptamer sequence.

[0036] To facilitate detection, the non-hybridizing region 64 may include a first primer region 70 and a second primer region 72 that flank the discriminating sequence 68, such that amplification of the non-hybridizing region 64 using primers 74, 76 to generate an amplification product 80 as generally discussed herein amplifies the discriminating sequence 68 to allow detection of the aptamer 14. In an embodiment, the amplification is part of preparation of a sequencing library for sequencing.

[0037] Because the non-hybridizing region 64 is single stranded, the first primer region 70 can represent a primer binding site that is the reverse complement of a first primer 74, while the second primer region 72 can correspond to the sequence of a second primer 76 that binds to the amplified strand generated from the first primer 74.

[0038] 6-15 show different embodiments of amplification, ligation, and / or sequencing techniques and corresponding arrangements of non-hybridizing regions 64 that may be used to adapt the generated amplification products 80 to input for sequencing library preparation or, in embodiments, to a sequencing library that may be sequenced to generate sequence data for the amplification products. Thus, the disclosed embodiments may, in embodiments, provide the advantage of incorporating one or more sequencing library preparation steps into the detection of aptamers 14. Furthermore, the disclosed embodiments may allow certain steps of sequencing library preparation to be omitted or combined, thus increasing detection efficiency. In embodiments, the disclosed embodiments also relate to sequencing techniques that allow for the generation of sequence data from sequence reads of the amplification products 80.

[0039] FIG. 6 is a schematic diagram of different arrangements of non-hybridizing regions 64 containing universal or conserved sequences that can be used in conjunction with Illumina® sequencing reactions. It is understood that these are examples and any of the disclosed arrangements can be used in conjunction with the disclosed techniques. Non-hybridizing regions 64 can include a minimal sequence of only primer regions 70, 72 flanking the identification sequence to introduce adapter sequences such as the example sequences or their complements for primer 1 and primer 2 used in Illumina® sequencing preparations A14, B15 during amplification. In other embodiments, the universal capture primer sequence and / or sample index sequence can be incorporated into the oligonucleotides generated from the reporter probe 24, such as through amplification and / or ligation and extension. Certain arrangements that include indexes can incorporate custom or bridge primers during sequencing to accommodate different indexes. Other embodiments can include custom options, for example, to sequence libraries using a single read from surface P5 or to add dark sequencing by synthesis cycles where a common sequence is present in the adapter region.

[0040] The adaptor sequences A14-ME, ME, B15-ME, ME', A14, B15, and ME are provided below: A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1) B15-ME: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 2) ME': 5'-phos-CTGTCTCTTATACACATCT-3' (SEQ ID NO: 3) A14: 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 4) B15: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 5) ME: AGATGTGTATAAGAGACAG (SEQ ID NO: 6)

[0041] The primer region or primer binding region may include a region having the sequence of a universal Illumina® capture primer or a region that specifically hybridizes to a universal Illumina® capture primer. A universal Illumina® capture primer may include, for example, P5 5'-AATGATACGGCGACCACCGA-3' ((SEQ ID NO: 7)) or P7 (5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 8)), or a fragment thereof. A region that specifically hybridizes to a universal Illumina® capture primer may include, for example, the reverse complementary sequence of Illumina® capture primer P5 ("anti-P5": 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 9) or P7 ("anti-P7": 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO: 10)), or a fragment thereof.

[0042] The conserved primer region may additionally or alternatively comprise a region having the sequence of, or that specifically hybridizes to, an Illumina® sequencing primer or a fragment thereof. Illumina® sequencing primers include, for example, SBS3 (5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO: 11)) or SBS8 (5'-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3' (SEQ ID NO: 12)). A region that specifically hybridizes to an Illumina® sequencing primer, or a fragment thereof, may include, for example, the reverse complementary sequence of Illumina® sequencing primer SBS3 ("anti-SBS3": 5'-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3' (SEQ ID NO: 13)) or SBS8 ("anti-SBS8": 5'-AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG-3' (SEQ ID NO: 14)), or a fragment thereof. Incorporation of the sequencing primer sequence into the reporter probe may be either direct or via a subsequent amplification, ligation, or other sequencing library preparation step.

[0043] In embodiments, the disclosed amplification products 80 may include amplification products that differ from one another based on different identification sequences 68, but have conserved or universal primer regions 70, 72. In this manner, a single primer set can be used to amplify reporter probes 24 with variable identification sequences 68. Provided herein is a library preparation kit that includes primers 74, 76 that can generate amplification products 80 from reporter probes 24 to generate a sequencing library. The sequences of the primers 74, 76 are based on the sequencing of the first primer binding region 70 and the second primer binding region 72. However, it should be understood that these arrangements are exemplary and that the primer regions 70, 72 for primer binding can be selected to be compatible with other library preparations.

[0044] In embodiments, sequencing may use Illumina® NGS primers. The following primers are provided as examples: Read 1 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3' (SEQ ID NO: 15) Read 2 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG' (SEQ ID NO: 16) Paired end read 1 5'ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 17) Paired end read 2 5'CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT (SEQ ID NO: 18) Index 1 read 5'CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (SEQ ID NO: 19) Index 2 read 5'AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (SEQ ID NO: 20) It should be understood that index read primers can be designed to contain a specific index sequence that is associated with a particular sample in an aptamer-based assay. Thus, index primers can have nucleotide regions designated as i5 or i7 that vary in sequence between different samples of the multiplexed samples. Other samples in the run can be prepared with primers that contain their respective indexes. Thus, a particular sequence read can be obtained using a universal primer, while other sequence reads are obtained using a primer or mixture of primers that are specific to the index of one or more samples in the multiplexed reaction.

[0045] In embodiments, a unique molecular identifier (UMI) may be incorporated into reporter probe 24, for example via ligation. A UMI is a short sequence used to uniquely tag each molecule in a sample library to provide error correction and reduce sequencing bias.

[0046] FIG. 7 shows an exemplary arrangement of reporter probe 24 for direct amplification via primers 74, 76 (see FIG. 5). In option 1, reporter probe 24 includes both a second complementary region 62 that binds to the aptamer and a non-hybridizing region 64. The non-hybridizing region 64 includes a first primer region 70 with ME and A14 sequences and a second primer region 72 with the complement of the B15 sequence, generating an amplification product that can be used with Illumina® sequencing primers. Their inclusion therefore allows standard Illumina® sequencing or NGS techniques to be performed. The first primer region 70 and the second primer region 72 flank the identification sequence 68. In option 2, the second primer region 72 includes the ME' sequence. In option 3, the ME and ME' sequences are excluded. Options 1, 2, and 3 provide different length options for reporter probe 24 as well as different length options for the amplification product. In certain embodiments, smaller reporter probes 24 may be less costly to manufacture and purify, as in option 3. However, elimination of the ME and ME' sequences may involve non-standard sequencing techniques, as discussed with respect to FIG.

[0047] An example of a sequencing technique based on the amplification product 80 of the reporter probe of FIG. 7 is shown in FIG. 8A. The reporter probe 24 is directly amplified using appropriate primers 75, 76 such that the amplification product 80 contains the desired adapter sequences including P5, P7, i5, and i7 compatible with Illumina® NGS technology. Therefore, the prepared sequencing library, e.g., the amplification product 80 in the illustrated example, is longer than the reporter probe 24. Furthermore, the amplification product 80 may remove or eliminate the second complementary region 62. In certain embodiments, the amplification product 80 provided herein may be single or double indexed. Each individual sample subjected to an aptamer-based assay may be uniquely associated with a specific index(es) that is not used for other samples in the multiplex reaction. A sequence reaction based on the amplification product 80 from option 1 may use standard sequencing primers and may generate sequence data using a read 1 primer to generate the identification sequence 68 as well as sequence reads that include index information. In certain cases, additional index information can be obtained from the complementary strand index read using i5 or other index primers. Similarly, sequence data from option 2 amplification product 80 can generate a discriminatory sequence read as well as a first index read. In option 2, a second index read can also be performed. The index read can generally be a shorter cycle read. In the illustrated embodiment (e.g., Figures 8, 10, 12), the i5 and R1 primers are A14-ME and A14'-ME', respectively. The i7 read primer is ME-B15.

[0048] The lack of ME sequences, as in option 3, may involve non-standard sequencing. In the illustrated example, index information as well as identification sequences may be obtained from single sequence reads using, for example, p5 primers. However, certain cycles are run as dark cycles, e.g., chemistry only, where images are not taken and / or analyzed. Thus, certain sequencing embodiments may be used in conjunction with specific operating instructions for a sequencing device, as discussed with respect to FIG.

[0049] FIG. 8B shows sequencing data from a sequencing library created by PCR amplifying an oligonucleotide mixture containing different reporter probes using option 1 in FIG. 8A. 384 separate dual i5 and i7 index PCR primers were used for amplification. The libraries were purified by SPRI, quantified, and sequenced as either 24-plex (24 different i5 and i7) or 192-plex (192 different i5 and i7) on NovaSeqX at a load concentration of either 90 pM or 100 pM. Exemplary %-based plots are shown, showing expected reads for read 1 (SOMA-iD), read 2 (i7 reads), and read 3 (i5 reads). Sequencing metrics including PF% and Q30% data are shown in the table in FIG. 8C.

[0050] FIG. 9A shows an example of step-out PCR where multiple amplifications and primers can be used to add adapters or other sequences. Option 1 shows a first round of amplification to add the 3' adapter, while the 5' adapter is completed via a second PCR round. Option 2 shows the reverse orientation. Option 3 shows a two-step PCR on both the 5' and 3' adapter sequences. The reporter probe 24 contains a specific sequence within the primer regions 70, 72 that are included with the adapter sequence. Step-out PCR can be performed in an index PCR or in a separate reaction. FIG. 9B shows data from the amplification of the reporter probe according to option 1 of FIG. 9A. A long oligo containing identifier sequence with a non-amplified aptamer binding region (P1B) was used as a template in a PCR reaction with three primers. The B15-containing primer serves as the "fwd" primer and the two A14-containing primers serve as the "rev" primers. The amplified products were loaded into the tape station for analysis. Reducing the concentration of A14-ME primers results in more amplification of the full-length product (0.1x A14ME 153bp - blue) as shown in the tape station trace. Figure 9C shows the tape station results for the amplification of the reporter probe by option 2 in Figure 9B. The long P1B-containing oligo was used as a template in a PCR reaction with four primers. Two M13F-containing primers serve as "fwd" primers and two M13R-containing primers serve as "rev" primers. The amplified product was loaded onto the tape station for analysis. The expected product was observed at 130bp and decreases with less DNA input. Primer dimers occur at 98bp in the absence of DNA template.

[0051] FIG. 10 shows a sequencing workflow for sequencing libraries prepared from the amplification products 80 from step-out PCR. Sequence reactions based on the amplification products 80 from option 1 and option 2 can use standard sequencing primers and generate sequence data using a read 1 primer to generate a sequence read that includes the identification sequence 68. Additional index information can be obtained from a complementary strand index read using an i5 or other index primer. A second index read can also be performed to obtain second index information. In option 3, an index can be obtained from the first and second index reads and a custom primer is used to generate a sequence read that includes the identification sequence 68. The custom primer sequence read can include a dark cycle to skip non-standard regions of the amplification products 80.

[0052] FIG. 11 shows an example of ligation to PCR where a double-stranded terminal adaptor is ligated to a complementary template at the 3′ end of the probe 24. In the disclosed example, the length of the reporter probe 24 can be adjusted based on the desired downstream detection modality as well as the reporter synthesis efficiency. For example, a shorter reporter probe 24 may generally be less expensive and more pure. However, a shorter reporter probe 24 may also contain fewer endogenous adaptors for sequencing requiring a non-standard sequencing approach (e.g., single read using dark cycle). Option 1 shows a relatively short reporter probe 24 that includes a first primer region 70 but does not include a second primer region 72. Instead, the reporter probe 24 has a short three-nucleotide tail 84 to which a partially double-stranded adaptor 86 can be ligated. Option 2 shows a similar arrangement but with a longer first primer region 70. The resulting amplification product can then incorporate additional sequences (e.g., indexes p5, p7) via direct or step-out amplification techniques as discussed in Figures 7 and 9. However, as shown in Figure 12, sequencing from the relatively short amplification product 80 of option 1 may include custom sequencing primers or standard primers (i5, i7), but with the incorporation of three dark cycles to accommodate the tail 84. Option 2 shows an alternative arrangement in which standard sequencing primers can be used to generate sequence data using the Read 1 primer to generate a sequence read that includes the identification sequence 68. Additional index information can be obtained from one or both of the i5 or i7 primers, or other combinations of index primers.

[0053] Adapters for sequencing or other assays can be added in subsequent ligation and / or PCR steps. Longer reporters can include endogenous adapters, but may be more expensive, less pure, and / or less viable to synthesize due to lower yield if too long. Thus, in certain embodiments, adapter incorporation via a direct or indirect ligation step can be used to modify shorter reporter probes 24 that are involved in aptamer binding but do not include adapter sequences (e.g., index sequences, primer binding sequences, functional sequences). The disclosed adapter ligation techniques can be used in conjunction with the dynamic range compression workflows provided herein, for example, using dummy probes or reporters. Furthermore, in certain embodiments, the disclosed adapter ligation techniques as discussed herein can be PCR-free workflows that avoid thermocycling. In embodiments, the PCR-free workflow offers the advantages of reducing potential amplicon contamination and eliminating the need for separate regions for pre- and post-PCR runs.

[0054] FIG. 13 shows an exemplary PCR-free workflow using the splint ligation technique to add one or more adapters via ligation and extension. The captured reporter probe 24 has a free 3′ end, but the 5′ end includes a binding region 62. In other examples, this region 62 is not retained in an amplification product using a primer that does not cover the region 62. However, in the illustrated example, the reporter probe 24 has an endogenous cleavage site 90, e.g., a uracil cleavage site. Here, the reporter probe 24 is captured as part of a trimolecular complex. The trimolecular complex can be generated as generally discussed herein, and the uncaptured reporter probe 24 can be associated with a different type of trimolecular complex that was not captured based on the absence of an affinity tag to facilitate binding to the capture bead 36.

[0055] Upon capture, uncaptured components can be removed and the non-hybridized region 64 can be cleaved to expose the 5' end. Cleavage can be mediated by cleavage of U bases by uracil-DNA glycosylase. After cleavage, 5' adaptor 94 ligation can be facilitated by 5' splint 97, which forms a partially double-stranded ligation region when hybridized, and 3' adaptor 96 ligation can be facilitated by 3' splint 98, which forms a partially double-stranded ligation region at the 3' end. The dotted arrow shown is a polymerase extension from B15' using template i7 to copy the index to add the index complement to the reporter via extension. The extension can include an extension to completely copy p7' without ligation entirely by extending from the B15' end, or can add p7' to allow extension-ligation. The polymerase can be non-strand displacing and does not have 5-3' exonuclease activity. In an embodiment, an Illumina extension ligation mix is ​​used. After ligation and splint denaturation 97, 98, the remaining oligonucleotides can be amplified for detection as generally discussed herein.

[0056] 14A shows an exemplary ligation extension workflow that adds one or more adaptors via ligation and extension. The workflow includes the formation of a trimolecular complex as generally discussed herein, including binding of both the capture probe 28 via a first complementary region 60 and the reporter probe 24 via a second complementary region 62 to corresponding regions of the aptamer 14. The reporter probe 24 includes a non-hybridizing region 64 that does not hybridize to the aptamer 14, which has an identification sequence 68 that is uniquely specific for the aptamer 14. The workflow also includes a step of separating the trimolecular complex from the dummy-containing trimolecular complex (see FIG. 1) and / or the free aptamer 14 or free reporter probe 24 using a capture entity, such as an affinity tag binder that binds to an affinity tag 30 present on the capture probe 28.

[0057] Once captured, the reporter probe 24 and aptamer 14 can be eluted from the capture entity and capture probe 28. In this workflow, the reporter probe 24 has a first region 100 that corresponds to a portion of the 5' adapter sequence and a second region 102 that corresponds to a portion of the 3' adapter sequence. The complete 5' and 3' adapter sequences, if present, can represent terminal adapter sequences, respectively, that allow the oligonucleotide to be used as part of a sequencing library for NGS sequencing that, in embodiments, can be used to sequence the discrimination sequence 68 as part of the aptamer detection. In the illustrated workflow, rather than having the reporter probe 24 have the complete 5' and 3' adapter sequences, the reporter probe has only a portion of these sequences and is relatively short. For example, the total length of the reporter probe can be about 70 nucleotides in one example. In embodiments, the reporter probe 24 can be 50-80 nucleotides. The complete 5' and 3' sequences are incorporated at the ends via extension ligation as shown.

[0058] As shown, oligonucleotide 110 having first region complement 111 and oligonucleotide 120 having second region complement 122 hybridize to reporter probe 24. Oligonucleotide 110 includes adapter region 124 that does not hybridize to reporter probe 24, e.g., is not complementary to complementary region 62. Oligonucleotide 112 includes adapter region 130 and affinity tag 30 that does not hybridize to reporter probe 24. This hybridization can occur after elution of the aptamer from the aptamer bead. Oligonucleotide 112 can be extended in the 3' direction using identification sequence 68 as a template and ligated to oligonucleotide 110. In addition, reporter probe 24 can be extended in the 3' direction using adapter region 130 as a template. Thus, the extended reporter probe 24 and the extended ligated oligonucleotides 110, 112 form a partially double-stranded structure that does not hybridize to the complementary region 62. In this way, the complementary region 62 can be removed from the downstream product without a cleavage step, in contrast to the workflow in Figure 10.

[0059] The retained extended ligated oligonucleotide 132 can undergo further extension after a washing step (e.g., heat wash, NaOH, or other denaturing agent) using the hybridized oligonucleotide 136 as a template. The oligonucleotide 136 hybridizes to the adapter region 124 via a complementary region 140. The oligonucleotide 136 also includes a 5' adapter region 142. In an embodiment, the extended hybridized oligonucleotide 136 can be extended and ligated to a hybridized p7' oligo (not shown) that can hybridize to the retained extended ligated oligonucleotide 132. The workflow can include 3' extension of the retained extended ligated oligonucleotide 132 using the 5' adapter region 142 as a template and 3' extension of the hybridized oligonucleotide 136 using the extended ligated oligonucleotide 132 as a template.

[0060] The oligonucleotides 110, 112 used for extension or extension ligation can be universal oligonucleotides that hybridize to any captured (e.g., aptamer-bound) reporter probe 24 via a universal region carried by the reporter probe 24. Oligonucleotide 136 hybridizes to the universal adapter region 124. Thus, extension ligation oligonucleotide reagents can be used across the entire panel for aptamer detection.

[0061] An optional second capture step can separate the extension oligonucleotide 136 from the extension oligonucleotide 132. Both oligonucleotides 132, 136 contain complete 5' and 3' adapters or their complements for NGS sequencing. The initiating reporter probe 24 is shorter (e.g., about 70 nucleotides in one example), but the generated product of the extension ligation workflow is longer. In embodiments, the oligonucleotides 132, 136 can be at least 25%, at least 50%, or at least 100% longer than the initiating reporter probe 24. The illustrated workflow can be performed, in embodiments, with or without a subsequent amplification step.

[0062] Figure 14B and Figure 14C show PCR-free NGS conversion results. A model system was designed to test the PCR-free NGS conversion assay for aptamers. After hybridization with the aptamer, the reporter molecule containing the discrimination sequence requires the addition of index and P5 / P7 sequences to cluster and sequence without the use of PCR. In this model system, the reporter molecule was annealed with three additional oligos, for example, as in Figure 14A. The B15-containing oligo allows the reporter oligo to extend from B15' to add i7' and P7' to the 3' end. To add an adaptor to the 5' end of the reporter molecule, a "sprint" oligo was annealed to the ME portion of the reporter and the second index oligo containing A14, i5, and P5. Upon incubation of the annealed oligos with ELM (extension ligation mix, ligase + polymerase, Illumina), the reporter molecule obtains both 5' and 3' adapters containing the index, as well as the P5 and P7' adapters, respectively. In addition to converting the reporter strand, the method can also create a complete second strand, doubling the yield of the reaction through extension-ligation of the A14' "sprint" oligo and extension of the B15 adapter across the discriminator sequence. The addition of the adapters is quantified by qPCR as shown in Figure 14B, using a range of fmol input of reporter oligo. The output fmol can be used to calculate the conversion efficiency (LCE%) as shown in Figure 14C, measured at approximately 30% for a wide range of concentrations. In addition to using ELM to perform the conversion, an additional method adds BST polymerase extension as a second step after ELM. This can potentially increase the yield by compensating for any failed extension ligations, resulting in higher yields.

[0063] Figure 15 shows another example of the cleavage-free extension ligation technique. As in Figure 14, the workflow includes the formation of a trimolecular complex having both the capture probe 28 via a first complementary region 60 and the reporter probe 24 via a second complementary region 62 binding to corresponding regions of the aptamer 14. The reporter probe 24 includes a non-hybridizing region 64 that does not hybridize to the aptamer 14 having an identification sequence 68 that uniquely identifies the aptamer 14. The workflow also includes a step of separating the trimolecular complex from the dummy-containing trimolecular complex (see Figure 1) and / or the free aptamer 14 or free reporter probe 24 using a capture entity such as an affinity tag binder that binds to the affinity tag 30 present on the capture probe 28.

[0064] Once captured, reporter probe 24 and aptamer 14 can be eluted from the capture entity and capture probe 28. Multiple oligonucleotide hybridization forms a complex to allow for extension ligation of the complete adapter sequence. Reporter probe 24 includes a first region 100 that corresponds to a portion of the 5' adapter sequence and a second region 102 that corresponds to a portion of the 3' adapter sequence. As shown, oligonucleotide 150 having first region complement 112 and oligonucleotide 152 having second region complement 153 both hybridize to reporter probe 24. In addition, oligonucleotide 150 includes adapter region 155 that does not hybridize to reporter probe 24, e.g., is not complementary to complementary region 62, and includes internal affinity tag 30. Oligonucleotide 152 includes adapter region 156 that does not hybridize to reporter probe 24 and serves as an extension template. Oligonucleotide 158 hybridizes to adapter region 155, and oligonucleotide 160 hybridizes to oligonucleotide 150 via region 162. Oligonucleotide 158 acts as a split for the ligation of oligonucleotides 150 and 160. In the complex, oligonucleotides 152, 150, 160 can be ligated via extension to form oligonucleotide 166.

[0065] Oligonucleotide 166 can be captured via affinity tag 30 and used as a template for extension of hybridized oligonucleotide 158. For example, multiple extension using T4 polynucleotide kinase allows addition of complete 5' and 3' adapters. As discussed with respect to FIG. 11, extension ligation allows for the use of shorter reporter probes 24 to generate products that are longer, e.g., at least 25%, at least 50%, or at least 100% longer than the starting reporter probe 24. In addition, the oligonucleotides used for extension can be universal oligonucleotides that hybridize to any captured (e.g., aptamer-bound) reporter probes 24 via universal regions carried by reporter probes 24 and can be used across panels for aptamer detection at different aptamers and their associated different discriminating sequences 68. The illustrated workflow can be performed in embodiments with or without a subsequent amplification step and with or without an additional capture step. In embodiments, extension can be performed from A14 without initial phosphate blocking.

[0066] FIG. 16 shows an example of a workflow using a split reporter probe that forms a trimolecular complex with an aptamer 14. In contrast to workflows in which the entire discrimination sequence 68 is provided on a single probe 24, the illustrated example includes a first reporter probe 170 and a second reporter probe 172, with the discrimination sequence 68 being split between these probes. Using a shorter reporter probe is more economical and subsequent ligation produces a longer product, which has library clean-up benefits. Having a split discrimination sequence distributed between the two probes allows for the assessment of successful hybridization of both probes. This is an advantage, since in other techniques the second probe is not part of the readout and mishybridization is not evident in the resulting readout.

[0067] The first reporter probe 170 has a first discrimination sequence 176 and the second reporter probe 172 has a second discrimination sequence 178. Similarly, the aptamer binding regions are also split between the probes. The first reporter probe 170 has a first aptamer binding region 182 and a first primer site 183 located between the first aptamer binding region 182 and the first discrimination sequence 176. The second reporter probe 172 has a second aptamer binding region 184 and a second primer site 185 located between the second aptamer binding region 185 and the second discrimination sequence 178. The primer sites are shown as truncated or partial adapter sequences (A14' and B15). It should be understood that additional adapter sequences may also be included in the split probe or may be introduced by amplification and / or ligation as generally discussed herein.

[0068] Binding of the first reporter probe 170 and the second reporter probe 172 to the aptamer 14 results in a trimolecular complex, where one of the first reporter probe 170 or the second reporter probe 172 can have an affinity tag 30, as shown in the first reporter probe 170 as an example. The identification sequence and primer site are carried in the non-hybridized portions of the reporter probes 170, 172. Dynamic range compression can be achieved for split probes by using a mixture that includes a dummy probe (e.g., a dummy first probe 170 or a dummy second probe 172) that does not have an affinity tag 30 for a particular aptamer 14. As discussed herein, the selected ratio of dummy to affinity tag-bearing probes can be adjusted based on aptamer abundance.

[0069] The discrimination sequence 68 can be assembled, for example, by ligating the ends of the first reporter probe 170 and the second reporter probe 172 using single stranded ligation, e.g., CircLigase. The 5' phosphate and adjacent 3' OH of the probes 170, 172 are ligated together such that the first discrimination sequence 176 and the second discrimination sequence 178 are contiguous. The ligated strands can be separated using the affinity tag 30. Any dummy reporter probe 170 and unligated second reporter probe 172 are not retained. Unligated reporter probes 170 are also captured, but the amplification step using the first primer site 183 and the second primer site 185 ensures that only the ligated pair produces an amplification product. To eliminate false positives from non-specific or undesired binding, the technique may require matched pairs for the discrimination sequences 176, 178. That is, both the identification sequence 176 and the identification sequence 178 may be specific to the aptamer 14, and the technique may require a positive sequence match for both identification sequences 176, 178 when evaluated using sequencing data obtained from a sequencing device before verifying detection of the aptamer 14.

[0070] Figure 17A is an embodiment of the technique of Figure 16 in which a single-stranded splint oligonucleotide 190 is provided to improve the ligation efficiency of ligation of reporter probes 170, 172. The splint oligonucleotide 190 hybridizes to at least a portion of the first discrimination sequence 176 and the second discrimination sequence 178 to create a double-stranded region. If it also binds to an aptamer 14, the reporter probes 170, 172 are also partially double-stranded along the aptamer binding regions 182, 184. In an embodiment, the splint oligonucleotide 190 can be 15-30 nucleotides in length. As shown in FIG. 17B, reporter probes 170, 172 may contain respective terminal conserved or universal sequences 192, 194 that are the same even for reporter probes with different identification sequences 176, 178, such that a common splint oligonucleotide sequence can be used to enhance ligation for reaction mixtures containing a panel of different reporter probes 170, 172 that form the identification sequence for the complete panel of assayed aptamers 14. That is, reporter probe 170 may contain a first terminal sequence 192 and reporter probe 172 may contain a second terminal sequence 194 that is different from the first terminal sequence. However, each of the different reporter probes 170 may have different identification sequences 176 relative to each other, but share the same terminal sequence 192. Similarly, each of the different reporter probes 172 may have different identification sequences 178 relative to each other, but share the same terminal sequence 194.

[0071] FIG. 17C shows a model system designed to test splint ligation of reporter probes (e.g., reporter probes 170, 172) in the presence of "mimic mers," which are DNA-based oligos of similar size to the exemplary aptamers. Two different mimic mers were used, with 40% and 50% GC content. The mimic mer oligos and probes were labeled with Cy3 (green) and the reporters were labeled with Cy5 (red). As shown in FIG. 17C, the probes were incubated with T4 DNA ligase for 5, 10, 30, and 60 minutes and analyzed by PAGE. Upon successful ligation, the largest product is formed at 123 nt. With increasing ligation time, the intensity of the largest band increases (as shown by the band intensity plot in FIG. 17D), and the intensity is also highest in the presence of the mimic mer.

[0072] FIG. 18A is an embodiment of the technique of FIG. 16 and / or FIG. 17. In particular, the use of splint oligonucleotides 190 can facilitate ligation of reporter probes 170, 172 even in the absence of aptamer binding. Exonuclease digestion of free reporter probes 170, 172 can improve background generated from ligation of reporter probes 170, 172 in the absence of aptamer binding. As examples, exonucleases RecJF and Exo I are shown. Providing a mixture of 5' to 3' and 3' to 5' exonucleases can facilitate sufficient digestion to eliminate or significantly reduce amplification products generated from aptamer-free ligation. FIG. 18B shows a model system designed to test exonuclease protection of splinted ligation of probes in the presence of "mimic-mers," which are DNA-based oligos of similar size to the exemplary aptamers. Two different mimicmers were used that either matched (complementary, binds) or did not match (e.g., non-complementary, does not bind) the probe sequence. The mimicmer oligo and probe were labeled with Cy3 (green) and the H2 oligo was labeled with Cy5 (red). The oligos were incubated with T4 DNA ligase for 30 min and then subjected to various exonuclease treatments before analysis by PAGE. When treated with ExoI, RecJF, or a mixture, the full-length product was only protected when ligated in the presence of the correct matching mimicmer (lanes 6, 9, 12). The products of exonuclease digestion are shown to the side of the gel when the exonuclease is stopped at the indicated fluorophore.

[0073] Figure 19 illustrates a workflow in which aptamer-bound reporter probes 170, 172 can be fully circularized to protect from exonuclease digestion as shown in Figure 15. In particular, exonuclease digestion targets reporter probes 170, 172 that are not bound to aptamer 14 but are ligated to each other in the presence of, for example, splint oligonucleotide 190.

[0074] In certain embodiments, reporter probes and the resulting ligation products, extension products, or amplification products as discussed herein, for example in Figures 16-19, may be used without a capture step.

[0075] FIG. 20A illustrates an exemplary dummy reporter probe technique. In FIG. 20A, a trimolecular complex 200 is captured using a capture probe 28 via the interaction of the bead 36 with the affinity tag 30. The trimolecular structure includes an associated reporter probe 24 that includes an aptamer binding region 62 and an active or amplifiable non-hybridized region 64 with a discriminating sequence 68 flanking the primer regions 70, 72. Here, instead of (or in addition to) using a capture probe 28 mixed with a dummy probe 32, the reporter probe 24 can also include a mixture of an active probe 202 and a dummy probe 210. Thus, other trimolecular structures can be formed that are associated with an inactive dummy reporter 210. These inactive dummy reporters 210 include an aptamer binding region 62 to facilitate binding to the aptamer 14. However, the non-amplifiable non-hybridized region 64 of these inactive dummy reporters 210 is not amplifiable. Examples of placement of inactive dummy reporter 210 may include one or both of primer regions 70, 72, or the absence of discriminating sequence 68. In another example, non-amplifying non-hybridizing region 64 may include an abasic extension blocker, a spacer, or an extension blocker such as uracil. In another variation, non-phosphorylated probes may be added to adjust the dynamic range by providing them as a mixture that includes both a version with a 5' phosphate and a version with the same sequence and aptamer binding capacity but without an available 5' phosphate. The ratio of versions may be adjusted based on aptamer abundance.

[0076] The mixture ratio or relative ratio of active reporters 202 to inactive dummy reporters 210 can be as generally discussed for capture probe mixtures.

[0077] FIG. 20B shows a system designed to confirm dynamic range compression in the presence of dummy biotin or dummy reporter in a trimolecular assay as provided herein. The dummy biotin approach titrated biotin H1 into the trimolecular assay at 100%, 50%, 20%, 10% and 1%. The dummy reporter used 100%, 50%, 20%, 10% and 1% of the reporter with a non-amplifiable amplification primer (M13). Three different mimicmers with three different GC contents (50, 60 and 80) were used, with three different corresponding probe sets for every condition. Following hybridization, capture and washing, the libraries were PCR amplified and sequenced on an Illumina sequencer, then analyzed and normalized for counts. The results show that both the dummy biotin "Dbio" and the dummy reporter "Drep" acted to reduce read counts for all three mimicmers tested.

[0078] 21 shows reporter probes (e.g., probes 24) with a mix of endogenous restriction endonuclease (RE) sites arranged with non-hybridized regions 64. For example, in low abundance aptamers 14, groups 222 of probes 24 may all be the same, e.g., may not have a RE site within the non-hybridized regions 64, but instead have a "null" region of nucleotides that do not correspond to the RE site. In medium abundance aptamers 14, groups 224 of probes 24 may have a mix of 50% probes that have a RE site within the non-hybridized regions 64, and 50% probes that do not have a RE site, but instead have a null region of nucleotides that do not correspond to the RE site. For high abundance aptamers 14, group 226 of probes 24 may have a mix of 75% probes that have a RE site within the non-hybridizing region 64 and 25% probes that do not have a RE site, but instead have a null region of nucleotides that do not correspond to a RE site. It should be understood that these percentages are by way of example.

[0079] The presence of the RE site facilitates cleavage using an appropriate RE. The RE site may be conserved across all aptamers 14 such that only a single RE treatment is required to cleave the non-hybridized region 64. The cleavage site may be specific for ss DNA cleavage. In such an embodiment, cleavage may occur after capture by the capture probe 28 and before amplification. In other embodiments, cleavage may occur after amplification using a double-stranded RE. In such a case, the RE site is retained during amplification. As such, the cleaved probe 24 is not available for downstream sequencing, thus achieving dynamic range compression by not being sequenced after amplification. In an embodiment, the null region may differ from the RE site by only a single base substitution to minimize amplification bias between dummy (with RE site) and active (null site, no RE site) probes.

[0080] FIG. 22 shows an alternative example that can be used in conjunction with a single probe workflow and / or a dual probe workflow to eliminate capture and / or wash steps. That is, rather than a trimolecular complex in which both capture probe 28 and reporter probe 24 are used, the illustrated embodiment can be performed using only reporter probe 24, as generally discussed. Free reporter probe 24 can be removed or digested with an exonuclease. Bound reporter probes that are part of a double-stranded complex with aptamer 14 are protected. However, in certain embodiments, the disclosed exonuclease digestion can be performed in conjunction with other disclosed embodiments, such as with a dual probe workflow using dummy capture probe 32 and / or dummy reporter probe 24, as generally discussed herein. The illustrated embodiment shows a 3' to 5' exonuclease digestion of the free reporter, with the 3' end of reporter probe 24 participating in aptamer binding and therefore protected from 3' to 5' exonuclease digestion. The disclosed embodiments may additionally or alternatively be used in conjunction with an exonuclease having 5' to 3' exonuclease activity. In such embodiments, reporter probe 24 may be designed such that the 5' end is the end that hybridizes to aptamer 14 to protect the 5' end from digestion relative to unhybridized reporter probe 24. In certain embodiments, exonuclease digestion may enable a workflow with reduced wash times and / or improved sensitivity.

[0081] 23 illustrates an embodiment of bead-based capture using group-specific capture sequences and corresponding different capture bead sets to compress the dynamic range for an input library 250 in captured reporter probes 24 or in the amplified or ligation extension oligonucleotide products generated from the captured reporter probes 24. In one embodiment, the input library 250 represents a population of oligonucleotides 252 having certain universal or common sequences (e.g., adapter sequences 254, 256) shared among the input libraries 250, certain identification sequences 68 that are unique to only some members of the input library 250 that bind to certain aptamers 14, and also group-specific capture sequences (e.g., group capture sequences 260, 262, 264) that differ among the different groups. The different groups are shown as an example of a high abundance group 270, a medium abundance group 272, and a low abundance group 274, although more or fewer groups are contemplated. The estimated abundance of aptamers 14 in a particular aptamer-based assay can be used to separate aptamers 14 into groups based on the relative abundance of the aptamers 14. Once separated, reporter probes 24 designed to bind to aptamers 14 in each group (e.g., groups 270, 272, 274) can each include a common group capture sequence that is related to the abundance of the group. Any products generated using reporter probes 24 will include the appropriate group capture sequence. Additionally, in certain embodiments, when oligonucleotides 252 are products generated using reporter probes 24, oligonucleotides 252 can exclude aptamer binding regions (e.g., second complementary region 62, see FIG. 5) that may be present in reporter probes 24 but are not amplified or included in input library 250.

[0082] The oligonucleotides 252 in the relatively high abundance group 270 may all include the same group capture sequence 260 associated with the high abundance group 270. It should be understood that if the oligonucleotides 252 are double-stranded, the oligonucleotides 252 in the relatively high abundance group 270 may all include either the same group capture sequence 260 or the reverse complement of the group capture sequence 260. Similarly, if the oligonucleotides 252 are double-stranded, the oligonucleotides 252 in all three groups may all include either the universal adapter sequences 256, 258, or their reverse complements. As shown, a mix of different discrimination sequences 68 may be present within each group, such that group 270 includes different discrimination sequences 68a, 68b, 68c corresponding to different aptamers 14a, 14b, 14c designated as high abundance. Similarly, group 272 includes different discrimination sequences 68d, 68e, 68f corresponding to different aptamers 14d, 14e, 14f designated as medium abundance. The low abundance group 274 may also contain a mixture of different discriminating sequences 68. In an embodiment, a particular discriminating sequence 68 is assigned to only one group, such that discriminating sequence 68a is only present in the high abundance group 270 and only associates with group capture sequences 260.

[0083] After performing an aptamer-based assay to generate an input library 250 from reporter probes 24 bound to aptamers 14 that have positive binding events for components of a sample as generally discussed herein, the input library 250 is contacted with different beads 280 of a bead pool 290. The bead pool 290 can include different bead groups 300, 302, 304 having different respective complementary regions 310, 312, 314 that are complementary to the bead capture sequences 260, 262, 264. Thus, oligonucleotides 252 of the high abundance group 270 that include the bead capture sequence 260 are captured by hybridization with the single-stranded complementary region 310 that is only present in the first bead group 300. The oligonucleotides 252 of the medium abundance group 272, which includes the bead capture sequence 262, are captured by the complementary region 312 present only in the second bead group 302, and the oligonucleotides 252 of the low abundance group 274, which includes the bead capture sequence 264, are captured by the complementary region 314 present only in the second bead group 304. As mentioned, if the oligonucleotides are double-stranded, only one strand may include the associated bead capture sequence. Thus, capture may occur after denaturing the oligonucleotides 252 to allow binding to the single-stranded complementary region. Upon binding, the beads 280, which include the captured oligonucleotides 252, may be detected as discussed herein. In embodiments, the beads 280 may be designed to generally capture the same amount of oligonucleotides per bead 280, such that each bead group captures approximately the same amount. However, in certain embodiments, the amount of capture per bead 280 in a particular bead group or the number of beads per group may be adjusted to further adjust the concentration of captured oligonucleotides 252 associated with a particular aptamer 14.

[0084] A different group capture sequence can be incorporated into each reporter probe 24 to allow bead-based capture via hybridization with a complementary region immobilized on a bead 280. In contrast, if a single common bead capture sequence is used for the entire input library 250, the high abundance group 270 will tend to be captured at a greater rate by the available beads 280 based on the relatively greater proportion of oligonucleotides 252 of the high abundance group 270 in the library 250. By using separate sets of beads 280, dynamic range compression between low and high abundance can be achieved. Although three separate abundance groups with corresponding bead groups are illustrated, it should be understood that more or fewer groups are contemplated. In addition, the number of different aptamers 14 and associated discriminator sequences 68 assigned to each individual group capture sequence can be selected to be 1, 2, 3, 10, 100, 500, or more. In embodiments, the number of discriminator sequences 68 assigned to each group can vary. For example, high abundance group 270 may contain fewer distinct discriminating sequences compared to medium abundance group 272 or low abundance group 274. Additionally, the illustrated embodiment may be used alone or in combination with other dynamic range compression techniques as discussed herein (e.g., dummy probes) that may be used to adjust the relative abundance of oligonucleotides 252 in input library 250. Furthermore, the workflow is discussed in the context of beads, and capture techniques may be used with surfaces such as flow cells or other substrates.

[0085] FIG. 24 shows an exemplary streamlined workflow using direct index amplification, according to an embodiment. In the exemplary workflow, an amplification reaction, e.g., step-out amplification or direct amplification, can be used to eliminate a separate ligation preparation workflow step. On the left side of the workflow, the captured reporter probe 24 can undergo an amplification reaction and then be fed to a sequence library preparation where a branched adapter is ligated to the end of the amplified reporter probe. However, amplification to incorporate a sequencing adapter sequence can be used to produce the same end product, but without the intervening ligation step. Thus, a direct amplification workflow without a ligation step or without adapter ligation can save library preparation time. FIG. 25 is a plot comparing the sequencing read counts from the streamlined workflow of FIG. 24 with the ligation preparation workflow, showing similar sequence read counts and similar efficiency in library preparation.

[0086] FIG. 26 shows an exemplary workflow with a washing step according to an embodiment. In the first step of the workflow, the aptamer 14 is contacted with the capture probe 28 and the reporter probe 24. The reaction may include a mixture of dummy and non-dummy capture probes 28 as disclosed herein. For example, the hybridization reaction that allows the aptamer to hybridize with the reporter probe may be, by way of example, an overnight hybridization. However, other time ranges are also contemplated (e.g., 30 minutes, 1 hour, 2 hours, 5 hours). If an aptamer 14 that is part of an aptamer-based assay is present in the sample, an aptamer complex is formed that includes the aptamer 14, the capture probe 28, and the reporter probe 24. The probe and aptamer complex is separated from unbound elements in the reaction mixture via affinity tag capture, denoted as bead capture. The capture bead includes an affinity tag binder such that the capture bead can capture at least one capture probe 28 that has an affinity tag. As discussed herein, the beads may also capture empty or uncomplexed probes that are not hybridized to any aptamer. However, uncomplexed capture probes 28 that are not complexed to reporter probes 24 via an aptamer will not give rise to any amplification products in downstream processes.

[0087] Once captured on the beads, a wash step is performed to separate the beads from unbound elements, including reporter probes 24 that are not complexed with any aptamer, as well as dummy complexes that may include reporter probes 24 complexed with dummy probes that do not have affinity tags. After separation, the samples proceed to a sequence library preparation step, shown as a ligation to PCR reaction. However, other preparation workflows are also contemplated, such as direct amplification, step-out PCR, or other amplification and / or ligation preparations as discussed herein. The end product of the workflow includes oligonucleotide fragments, which can then be sequenced as part of a sequencing reaction to generate sequence data.

[0088] In embodiments, the workflow may include only a single wash step after bead capture and before the amplification and / or ligation step. In other embodiments, two, three or more wash steps are contemplated. Figure 27 shows different wash conditions at the bead capture step, as well as sequencing read counts for comparing 3, 6, and 12 washes. Reducing the number of wash steps from 12 to 6 improves reproducibility and reduces assay time and consumable use. Further reducing the washes from 6 to 3 further increases the signal, but the background also increases without any input (0 input fM).

[0089] FIG. 28A shows compression of sequencing read counts using dummy-biotin for different aptamers. The left panel shows the experimental setup with aptamer and probe complex formation. Two different types of complexes can be formed for each aptamer: a first complex containing an affinity tag and a second complex without an affinity tag. The ratio of these types of complexes for a given aptamer depends on the ratio of dummy probe to capture probe. FIG. 28A shows that sequence read counts are reduced through the use of dummy probes in the workflow of FIG. 26, removing a portion of the aptamer population that would have generated sequence reads otherwise. FIG. 28A shows a reduced read count of two orders of magnitude (100×), i.e., compression to 1% across a panel of 96 aptamers. FIG. 28B shows results from a trimolecular NGS conversion assay performed using probes targeting the aptamer panel. 20 uL of assay eluent from pooled human plasma samples (10 donors) was added to the trimolecular conversion assay. For the "POS" control, all probes had 100% biotin. For the "DRC (Dynamic Range Compression)" samples, the probes were divided into four virtual groups with different % of biotin. The amount of biotin in the four virtual groups was 0.065%, 0.63%, 5.42% and 100%. Samples were sequenced on a NovaSeq 6000 and data was normalized for count analysis (y-axis) for each of the aptamers (SeqID-x-axis).

[0090] FIG. 29 shows an example of undesired non-specific binding between aptamer binding regions. The top diagram of FIG. 29 shows the desired complex structure after the hybridization reaction, where the complex includes aptamer 14, reporter probe 24, and capture probe 28. The bottom diagram of FIG. 29 shows the undesired structure formation, where reporter probe 24 directly complexes with capture probe 28 via the aptamer binding region of reporter probe 24 and / or the aptamer binding region of capture probe 28. In this case, the complex is formed without aptamer cross-linking. The background due to undesired non-specific binding occurs when reporter probe 24 is pulled down during bead capture and subsequent amplification and sequencing. FIG. 30 shows the contribution of different aptamer binding regions to non-specific binding. Non-specific aptamer binding region interactions were shown to be the major contributor to the background. Non-specific binding can be a low level of base pairing between adapter sequences.

[0091] 31 is a schematic diagram of a sequencing device 500 that may be used in conjunction with the disclosed embodiments to obtain sequencing data of identification sequences and / or index sequences as generally discussed herein. The sequencing device 500 may be implemented according to any sequencing technique, such as those incorporating the sequencing-by-synthesis methods described in U.S. Patent Publication Nos. 2007 / 0166705, 2006 / 0188901, 2006 / 0240439, 2006 / 0281109, 2005 / 0100900, U.S. Patent No. 7,057,026, WO 05 / 065814, WO 06 / 064199, WO 07 / 010251, the disclosures of which are incorporated herein by reference in their entirety. Alternatively, sequencing by ligation techniques may be used in the sequencing device 500. Such techniques use DNA ligase to incorporate and identify oligonucleotides and are described in U.S. Patent Nos. 6,969,488, 6,172,218, and 6,306,597, the disclosures of which are incorporated herein by reference in their entireties. Some embodiments may utilize nanopore sequencing, whereby a target nucleic acid strand or nucleotides are removed from the target nucleic acid by an exonuclease and passed through a nanopore. As the target nucleic acid or nucleotide passes through the nanopore, each base type can be identified by measuring the fluctuation in the electrical conductance of the pore (U.S. Pat. No. 7,001,792; Soni & Meller, Clin. Chem. 53, 1996-2001 (2007); Healy, Nanomed. 2, 459-481 (2007); and Cockroft, et al. J. Am. Chem. Soc. 130, 818-820 (2008), the disclosures of which are incorporated herein by reference in their entireties). Yet other embodiments include detection of protons released upon incorporation of a nucleotide into an extension product.For example, sequencing based on detection of released protons may use electrical detectors and related techniques commercially available from Ion Torrent (Guilford, CT, a subsidiary of Life Technologies), or may use the sequencing methods and systems described in U.S. Patent Application Publication Nos. 2009 / 0026082(A1), 2009 / 0127589(A1), 2010 / 0137143(A1), and 2010 / 0282617(A1), each of which is incorporated herein by reference in its entirety. Certain embodiments may utilize methods that include real-time monitoring of DNA polymerase activity. Nucleotide incorporation can be detected via Fluorescence Resonance Energy Transfer (FRET) interactions between fluorophore-bearing polymerases and γ-phosphate-labeled nucleotides, or using zero-mode waveguides, for example, as described in Levene et al. Science 299, 682-686 (2003); Lundquist et al. Opt. Lett. 33, 1026-1028 (2008); Korlach et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), the disclosures of which are incorporated herein by reference in their entirety. Other suitable alternative techniques include, for example, Fluorescent In Situ SEQuencing (FISSEQ) and Massively Parallel Signature Sequencing (MPSS). In certain embodiments, the sequencing device 500 may be a HiSeq, MiSeq, or HiScanSQ from Illumina (La Jolla, Calif.). In other embodiments, the sequencing device 500 may be configured to operate using a CMOS sensor with nanowells fabricated over photodiodes such that DNA deposits are aligned one-to-one with the respective photodiodes.

[0092] The sequencing device 500 may be a "one channel" detection device in which only two of the four nucleotides are labeled and detectable for any given image. For example, thymine may have a permanent fluorescent label, while adenine uses the same fluorescent label in a separable form. Guanine may be permanently dark, and cytosine may be initially dark but add labels during the cycle. Thus, each cycle may include a first image and a second image, where a dye is cleaved from any adenine and added to any cytosine such that only thymine and adenine are detectable in the first image, but only thymine and cytosine are detectable in the second image. Any base that is dark throughout both images is a guanine, and any base that is detectable throughout both images is a thymine. A base that is detectable in the first image but not in the second image is an adenine, and a base that is not detectable in the first image but is detectable in the second image is a cytosine. By combining information from the first image and the second image, all four bases can be identified using one channel.

[0093] In the embodiment shown, the sequencing device 500 includes a separate sample processing device 502 and associated computer 504. However, as noted above, these may be implemented as a single device. Additionally, the associated computer 504 may be local to, or networked with, or otherwise in communication with, the sample processing device 502. In the embodiment shown, a biological sample may be added to a sample substrate 510, e.g., a flow cell or slide, in the sample processing device 502, which is imaged to generate sequence data. For example, reagents that interact with the biological sample may fluoresce at specific wavelengths in response to an excitation beam generated by the imager 512, thereby returning emitted light for imaging. For example, fluorescent moieties may be generated by fluorescently tagged nucleic acids that hybridize to the moiety's complementary molecule or to fluorescently tagged nucleotides that have been incorporated into oligonucleotides using a polymerase. As will be appreciated by those skilled in the art, the wavelengths at which the sample dyes are excited and at which they fluoresce will depend on the absorption and emission spectra of the particular dyes. Such returned radiation may propagate through a directing optical system. This retrobeam may generally be directed towards the detection optics of the imager 512.

[0094] The imager detection optics may be based on any suitable technology, for example a charged coupled device (CCD) sensor that generates pixelated image data based on photons impacting locations within the device. However, it will be understood that any of a variety of other detectors may also be used, including, but not limited to, detector arrays configured for time delay integration (TDI) operation, complementary metal oxide semiconductor (CMOS) detectors, avalanche photodiode (APD) detectors, Geiger-mode photon counters, or any other suitable detector. TDI mode detection may be coupled with line scanning, as described in U.S. Pat. No. 7,329,860, which is incorporated herein by reference. Other useful detectors are described, for example, in the references provided previously herein in the context of various nucleic acid sequencing methodologies.

[0095] The imager 512 may be under processor control, for example by a processor 514, and the sample receiving device 502 may also include an I / O control 516, an internal bus 518, a non-volatile memory 520, a RAM 522, and any other memory structures such that the memory can store executable instructions, as well as other suitable hardware components that may be similar to those described with respect to FIG. 31. Additionally, the associated computer 504 may also include a processor 524, an I / O control 526, a communication circuit 527, and a memory architecture including a RAM 528 and a non-volatile memory 530 such that the executable instructions 532 can be stored. The hardware components may be coupled by an internal bus that may also be coupled to a display 534. In embodiments in which the sequencing device 500 is implemented as an all-in-one device, certain redundant hardware elements may be eliminated.

[0096] The processor 514, 524 may be programmed to assign individual sequencing reads to samples based on the associated index sequence or sequences according to the techniques provided herein. In certain embodiments, based on image data acquired by the imager 512, the sequencing device 500 may be configured to generate sequencing data including base calls for each base of the sequencing read. Furthermore, based on the image data, for sequential sequencing reads, individual reads may be linked to the same location, and thus the same template strand, via the image data. In this manner, the index sequencing reads may be associated with the sequencing reads of the insert sequence before being assigned to the original sample. The processor 514, 524 may also be programmed to perform downstream analysis on the sequences corresponding to the insert of a particular sample following the assignment of the sequencing reads to samples.

[0097] In certain embodiments, the I / O controls 516, 526 may be configured to accept user input to automatically select sequencing parameters based on the reporter probe 24 and the associated sequence library preparation technique. For example, if custom primers or a dark cycle are incorporated into the sequencing run, the sequencing device may select from pre-programmed operating instructions and / or receive user input to operate the sequencing device according to the desired sequence parameters. In embodiments, the user input may be the selection of a sequence library preparation kit or reading a barcode or identifier of a sequence library preparation kit.

[0098] In embodiments of the disclosed techniques, aptamer detection may be based on the presence of identifying sequences 68 that uniquely identify individual aptamers in the sequencing data generated by the sequencing device 500. Thus, in embodiments, the sequencing device 500 may perform analysis of sequence reads to identify one or more identifying sequences 68 for a panel of aptamers. Based on the identified aptamers, a notification or report of positive aptamer identification may be generated. In embodiments, the notification is provided on the display 534 or communicated to a remote device or cloud server via the communications circuitry 527.

[0099] As used herein, an aptamer may refer to a non-naturally occurring nucleic acid that has a specific binding affinity to a target molecule. The binding of an aptamer to a target molecule may result in catalytically altering the target molecule, reacting with the target molecule in a manner that modifies or alters the target molecule or the functional activity of the target molecule, covalently binding to the target molecule (as in suicide inhibitors), and facilitating a reaction between the target molecule and another molecule. In one embodiment, the target molecule is a three-dimensional chemical structure other than a polynucleotide that binds to the aptamer through a mechanism that is largely independent of Watson / Crick base pairing or triple helix binding. In an embodiment, the aptamer is not a nucleic acid that has a known physiological function that is bound by the target molecule.

[0100] Aptamers include nucleic acids that are identified from a candidate mixture of nucleic acids. The specific binding affinity of an aptamer to its target may generally refer to the aptamer binding to its target with a much higher degree of affinity than it binds to other non-target components in the mixture or sample. Different aptamers may have either the same or different numbers of nucleotides. Aptamers may be DNA or RNA, may be single-stranded, double-stranded, or may include double-stranded regions. The aptamers discussed herein may be used in any diagnostic, imaging, high-throughput screening, or target validation technique or procedure, or assay that may use, but is not limited to, aptamers, oligonucleotides, antibodies, and ligands.

[0101] The aptamers disclosed herein can be used in aptamer-based assays, such as those disclosed in U.S. Patent Nos. 7,855,054 and 7,964,356, and U.S. Patent Application Publication Nos. US / 2011 / 0136099 and US / 2012 / 0115752. In one example, a panel of aptamers against different target molecules is provided attached to a solid support. The attachment of the aptamer to the solid support is achieved by contacting a first solid support with the aptamer and allowing the releasable first tag contained in the aptamer to directly or indirectly associate with a suitable first capture agent attached to the first solid support or a portion thereof. Then, a test sample is prepared and contacted with the immobilized aptamers that have specific affinity for their respective target molecules that may or may not be present in the sample. If the test sample contains a target molecule, an aptamer-target affinity complex is formed in the mixture with the test sample. In addition to the aptamer-target affinity complex, uncomplexed aptamer is also attached to the first solid support. The aptamer-target affinity complex and uncomplexed aptamer associated with the probe on the solid support are then partitioned from the remainder of the mixture, thereby removing the free target and all other uncomplexed substances in the test sample (sample matrix), i.e., the components of the mixture that are not associated with the first solid support. This partitioning step is referred to herein as catch 1 partitioning (see definition below). Following partitioning, the aptamer-target affinity complex, together with any uncomplexed aptamer, is released from the first solid support using a method appropriate for the particular releasable first tag used.

[0102] In one embodiment, the aptamer-target affinity complex bound to the solid support is treated with an agent that introduces a second tag to the target molecule component of the aptamer-target affinity complex. In one embodiment, the target is a protein or peptide, and the target is biotinylated by treating it with NHS-PEO4-biotin. The second tag introduced to the target molecule can be the same as or different from the aptamer capture tag. If the second tag is the same as the first tag, or the aptamer capture tag, free capture sites on the first solid support can be blocked before the start of this tagging step. In this exemplary embodiment, the first solid support is washed with free biotin before the start of target tagging. Tagging methods, particularly tagging of targets such as peptides and proteins, are described in U.S. Pat. No. 7,855,054.

[0103] The partitioning is completed by releasing the uncomplexed aptamer and the aptamer-target affinity complex from the first solid support. In one embodiment, the first releasable tag is a photocleavable moiety that is cleaved by irradiation with a UV lamp under conditions that cleave >90% of the first releasable tag. In other embodiments, the release is achieved by a method appropriate for the selected releasable moiety in the first releasable tag. The aptamer-target affinity complex can be eluted and collected for further use in the assay, or can be contacted with another solid support to perform the remaining steps of the assay.

[0104] In one embodiment, a second partition is performed to remove free aptamers (herein referred to as Catch 2 partition, see definition below). As mentioned above, in one embodiment, the second tag used for Catch 2 partition can be added to the target while the aptamer-target affinity complex is still in contact with the solid support used for Catch 0 capture. In other embodiments, the second tag can be added to the target at another time in the assay before the start of Catch 2 partition. The mixture is contacted with a solid support, which has a capture element (second) attached to its surface that can bind to the target capture tag (second tag) preferably with high affinity and specificity. In one embodiment, the solid support is a magnetic bead (e.g., DynaBeads MyOne Streptavidin C1) contained within the well of a microtiter plate, and the capture element (second capture element) is streptavidin. The magnetic beads provide a convenient method for the separation of the partitioned components of the mixture. Thereby, the aptamer-target affinity complex contained in the mixture is bound to the solid support through the binding interaction between the target (second) capture tag and the second capture element on the second solid support. The aptamer-target affinity complex is then partitioned from the remainder of the mixture by washing the support with a buffered solution, for example, a buffer containing an organic solvent, including but not limited to glycerol.

[0105] The aptamers are then selectively eluted from the aptamer-target complexes using a buffer containing a chaotropic salt from the group including, but not limited to, sodium perchlorate, lithium chloride, sodium chloride, and magnesium chloride. Aptamers retained on the Catch 2 beads by aptamer / aptamer interactions are not eluted by this treatment.

[0106] In another embodiment, the aptamers released from the Catch 2 partition are detected and optionally quantified by detection methods as discussed herein, such as through next generation sequencing techniques. For example, through amplification and / or sequencing of probes that bind to the eluted aptamers. In certain embodiments, the detection includes a detection result that provides a relative concentration and / or an estimated absolute concentration of the detected aptamer. The detection result may include a notification or output of a positive or negative detection result or a relative or estimated concentration for a particular aptamer ID or a particular target of the aptamer.

[0107] In certain embodiments of the present disclosure, the disclosed probes of the probe set 20 can include one or more conserved regions, such as a conserved primer region, for example, a first conserved primer region and a second conserved primer region. The conserved regions are conserved among at least some other probes of the probe set 20, such that the conserved regions have the same or similar nucleotide sequences when compared among the probes. For example, for a given second probe 24, all probes 24 can have the same first conserved primer region and second conserved primer region. In this manner, primers based on the first conserved primer region and the second conserved primer region can be used to amplify any captured probe 24.

[0108] One or more of the probes discussed herein may include a discrimination sequence that can include one or more nucleotide sequences that can be used to identify one or more specific aptamers. The discrimination sequence can be an artificial sequence. The discrimination sequence can include at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides. In some embodiments, the discrimination sequence includes at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more consecutive nucleotides. In some embodiments, at least a portion of the discrimination sequence in the probe is different.

[0109] One or more of the probes discussed herein may include an affinity tag. The affinity tag may be useful for various applications, such as bulk separation of target nucleic acids hybridized to the hybridization tag. As used herein, the term "affinity tag" and grammatical equivalents may refer to a component of a multi-component complex that specifically interacts with or binds to each other. For example, the affinity tag may include biotin or poly-His, which may bind to streptavidin or nickel, respectively. Other examples of multi-component affinity tag complexes are listed, for example, in U.S. Patent Application Publication No. 2012 / 0208705, U.S. Patent Application Publication No. 2012 / 0208724, and International Patent Application Publication No. 2012 / 061832, each of which is incorporated herein by reference in its entirety.

[0110] The disclosed embodiments provide different primers and probes. The probes and / or primers of the disclosed embodiments are designed to be complementary to the target sequence (either the target sequence of the sample or other probe sequence) so that hybridization between the target sequence and the probe of the present invention occurs. As outlined below, this complementarity does not need to be perfect, and there can be any number of base pair mismatches that interfere with hybridization between the target sequence and the single-stranded nucleic acid of the present invention. However, if the number of mutations is so great that hybridization cannot occur even under the least stringent hybridization conditions, the sequence is not a complementary target sequence. Thus, "substantially complementary" in this specification means that the probe is sufficiently complementary to the target sequence to hybridize under normal reaction conditions.

[0111] A variety of hybridization conditions can be used in the present invention, including high, medium and low stringency conditions. Longer sequences hybridize specifically at higher temperatures. In general, stringent conditions are selected to be about 5-10°C lower than the thermal melting point (Tm) for a particular sequence at a defined ionic strength and pH. Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (if the target sequence is present in excess, at Tm 50% of the probes are occupied at equilibrium). Stringent conditions include salt concentrations of less than about 1.0 M sodium ion at pH 7.0-8.3, typically about 0.01-1.0 M sodium ion concentration (or other salt), and temperatures of at least about 30°C for short probes (e.g., 10-50 nucleotides) and at least about 60°C for long probes (e.g., more than 50 nucleotides).

[0112] In certain embodiments, the probe contacting step may be performed under stringency conditions that allow the formation of a hybridization complex only in the presence of target. Stringency may be controlled by varying process parameters that are thermodynamic variables, including but not limited to temperature, formamide concentration, salt concentration, chaotropic salt concentration, pH, organic solvent concentration, etc. The size of the primer nucleic acid may vary, generally from 5 to 500 nucleotides in length, as will be understood by those skilled in the art. Primers may be 10 to 100, 15 to 50, and 10 to 35, depending on the use and amplification technique.

[0113] The disclosed techniques relate to dynamic range compression in one or more applications, such as the analysis of aptamer-based assay eluates. Dynamic range compression may include one or more amplification steps that may be part of a sequencing library preparation that may oligonucleotideize an adapter to a reporter probe for downstream sequencing. The adapter may be attached to the target polynucleotide in any other suitable manner. In some embodiments, the adapter is introduced in a multi-step process, such as a two-step process, involving ligation of a portion of the adapter to the target polynucleotide with a universal primer sequence. The second step includes extension, for example, by PCR amplification, using a primer that includes a 3' end with a sequence complementary to the attached universal primer sequence and a 5' end that contains the other sequence of the adapter. By way of example, such extension may be performed as described in U.S. Pat. No. 8,053,192, which is incorporated herein by reference in its entirety. An additional extension may be performed to provide additional sequence at the 5' end of the resulting previously extended polynucleotide.

[0114] In some embodiments, the adapter may be ligated to a reporter probe. Any suitable adapter may be attached to a target polynucleotide, such as a reporter probe, via any suitable process, such as those discussed herein. The adapter may include a library-specific index tag sequence (e.g., i5, i7). The index tag sequence may be attached to the target polynucleotide from each library before the sample is immobilized for sequencing. The index tag is not itself formed by a portion of the target polynucleotide, but becomes part of the template for amplification. The index tag may be a synthetic sequence of nucleotides that is added to the target as part of the template preparation process. Thus, a library-specific index tag is a nucleic acid sequence tag attached to each of the target molecules of a particular library, the presence of which is used to indicate or identify the library from which the target molecule was isolated. Preferably, the index tag sequence is 20 nucleotides or less in length. For example, the index tag sequence may be 1-10 nucleotides or 4-6 nucleotides in length. A four nucleotide index tag provides the possibility of multiplexing 256 samples on the same array, and a six base index tag allows the processing of 4,096 samples on the same array. Adapters may contain more than one index tag to increase the multiplexing potential.

[0115] The adaptor may include any other suitable sequence in addition to the index tag sequence. For example, the adaptor may include a universal extension primer sequence, typically located at the 5' or 3' end of the adaptor, and a polynucleotide obtained for sequencing. The universal extension primer sequence may hybridize to a complementary primer bound to the surface of a solid substrate. The complementary primer includes a free 3' end to which a polymerase or other suitable enzyme may add nucleotides to extend the sequence using the hybridized library polynucleotide as a template to provide the reverse strand of the library polynucleotide bound to the solid surface. Such extension may be part of a sequencing run or cluster amplification.

[0116] In some embodiments, the adapter comprises one or more universal sequencing primer sequences. The universal sequencing primer sequences may bind to a sequencing primer to allow sequencing of the index tag sequence, the target sequence, or the index tag sequence and the target sequence. In some embodiments, the disclosed reporter probes, such as reporter probe 24, may comprise a "sequencing adapter" or "sequencing adapter site", i.e., a region that comprises one or more sites that can hybridize to a primer. In some embodiments, the sequence may comprise at least a first primer site useful for amplification, sequencing, etc.

[0117] After adapter incorporation, the disclosed reporter probes can be sequenced. In one example, sequencing can be via Illumina's sequencing-by-synthesis and reversible terminator-based sequencing chemistry. Illumina's sequencing technology relies on attachment of fragmented genomic DNA to a planar, optionally optically transparent surface to which oligonucleotide anchors are attached. The template DNA is end-repaired to generate 5' phosphorylated blunt ends, and a single A base is added to the 3' ends of the blunt phosphorylated DNA fragments using the polymerase activity of the Klenow fragment. This addition prepares the DNA fragments for ligation to oligonucleotide adapters, which have a single T base overhang at their 3' ends to enhance ligation efficiency. The adapter oligonucleotide is complementary to a flow cell anchor. Under limiting dilution conditions, the adapter-modified single-stranded template DNA is added to the flow cell and immobilized by hybridization to the anchor. The attached DNA fragments are extended and the bridges are amplified to create an ultra-high density sequencing flow cell with hundreds of millions of clusters, each containing approximately 1,000 copies of the same template. In one embodiment, the randomly fragmented genomic DNA is amplified using PCR before undergoing cluster amplification. Alternatively, an amplification-free genomic library preparation is used, in which the randomly fragmented genomic DNA is enriched using cluster amplification only. The templates are sequenced using a robust four-color DNA sequencing-by-synthesis technique that employs reversible terminators with removable fluorescent dyes. Highly sensitive fluorescence detection is achieved using laser excitation and total internal reflection optics. The sequences are aligned against a truth table or conserved correlation between aptamer identity and discriminating sequence using specially developed data analysis pipeline software.

[0118] This written description enables any person skilled in the art to practice the disclosed embodiments, including using the examples to make and use any device or system, and to perform any incorporated methods. The patentable scope is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they include structural elements that do not differ from the literal words of the claims, or if they include equivalent structural elements that have only minor differences from the literal words of the claims.

Claims

1. 1. A method for aptamer detection comprising: contacting an analyte of a sample with a plurality of aptamers under conditions allowing for the formation of an analyte-aptamer complex, wherein different aptamers of the plurality of aptamers have specific affinity for respective different analytes of the analytes; detecting the analyte by detecting an aptamer of the analyte-aptamer complex, wherein detecting an individual aptamer of the plurality of aptamers; contacting the individual aptamers with a mixture of first probes, wherein a first complementary region of each first probe of the mixture hybridizes to a first region of the individual aptamer, and wherein only a subset of the first probes in the mixture bind to an affinity tag; contacting the individual aptamers with a second probe to hybridize a second complementary region of the second probe to a second region of the individual aptamer, the second probe comprising a non-hybridizing region extending from the complementary region, the non-hybridizing region comprising an identification sequence uniquely identifying the individual aptamer, and the first complementary region and the second complementary region uniquely hybridize to the individual aptamer; capturing a first probe of the mixture via binding of the affinity tag with an affinity tag binder to capture the individual aptamers and the second probe hybridized to the second region of the individual aptamers, wherein the first probe is in the subset bound to the affinity tag; detecting the identification sequence of the captured second probe.

2. 2. The method of claim 1, wherein the first region and the second region are spaced apart by at least one nucleotide.

3. The method of claim 1 , wherein the affinity tag is biotin and the affinity tag capture molecule is avidin or streptavidin.

4. 2. The method of claim 1, wherein detecting the discrimination sequence of the captured second probe comprises contacting the captured second probe with a primer to generate an amplification product.

5. 5. The method of claim 4, wherein the primers comprise a first primer that binds to a first primer binding region of the non-hybridized region and a second primer that binds to a second primer binding region of the non-hybridized region, the first primer binding region and the second primer binding region flanking the identification sequence.

6. 6. The method of claim 5, wherein the first primer comprises the first sequencing primer and the second primer comprises the second sequencing primer, such that the amplification product comprises a first sequencing primer and a second sequencing primer.

7. The method of claim 4 , wherein detecting the discrimination sequence of the captured second probe comprises sequencing the amplification product.

8. The method of claim 1 , further comprising generating a notification regarding the individual aptamers based on detecting the discriminating sequence.

9. The method of claim 1 , further comprising separating the captured second probe from the captured first probe and the captured individual aptamers prior to detecting the discriminating sequence.

10. 2. The method of claim 1, further comprising ligating an oligonucleotide to the end of the captured second probe and extending the ligated oligonucleotide prior to detecting the discrimination sequence.

11. 2. The method of claim 1, further comprising hybridizing a first oligonucleotide and a second oligonucleotide to the captured second probe, and extending the first oligonucleotide using the captured second probe as a template to ligate the first oligonucleotide to the second oligonucleotide via extension ligation.

12. 12. The method of claim 11, further comprising separating the ligated first and second oligonucleotides from the captured second probe using a second affinity tag attached to the second oligonucleotide.

13. 13. The method of claim 12, further comprising hybridizing a third oligonucleotide to the ligated first and second oligonucleotides, and extending the ligated first and second oligonucleotides and the hybridized third oligonucleotide to generate first and second complementary strands comprising 5' and 3' adapters for sequencing.

14. 2. The method of claim 1, further comprising cleaving at least a portion of the non-hybridized region that includes the discriminating sequence from the captured second probe prior to detecting the discriminating sequence.

15. 15. The method of claim 14, further comprising, after said cleaving, ligating the cleaved portion of the captured second probe to an end of an adaptor.

16. The method of claim 1 , further comprising removing uncaptured probes prior to detecting the discrimination sequence.

17. 17. The method of claim 16, wherein the uncaptured probes comprise probes in the mixture that are not in the subset, and the probes that are not in the subset are not bound to the affinity tag.

18. An aptamer detection probe set, comprising: a plurality of different first probe mixtures complementary to respective different aptamers of an aptamer panel, each first probe mixture of the plurality of different first probe mixtures comprising: a binding subset of first probes bound to affinity tags; a plurality of different first probe mixtures comprising a dummy subset of first probes not bound to said affinity tag, wherein each probe in said binding subset and said dummy subset of said individual first probe mixtures comprises the same binding region that is complementary to a first sequence of an individual aptamer of said aptamer panel; an aptamer detection probe set comprising: a plurality of different second probes complementary to each different aptamer of the aptamer panel, wherein each second probe of the plurality of different second probes comprises a second binding region complementary to a second sequence of each aptamer, and each second probe comprises a non-hybridizing region, the non-hybridizing region comprising an identification sequence uniquely identifying each aptamer; and

19. The probe set of claim 18, wherein the discriminating sequences do not overlap with the sequences of the individual aptamers.

20. 20. The probe set of claim 18, wherein the discrimination sequence is 20 nucleotides or less in length.

21. 20. The probe set of claim 18, wherein each second probe comprises a cleavage site disposed between the non-hybridizing region and the second binding region.

22. 20. The probe set of claim 18, wherein the non-hybridizing regions comprise primer regions adjacent to the discriminatory sequence.

23. 20. The set of probes of claim 18, wherein the binding subset comprises less than 20% of the individual first probe mixtures.

24. 20. The set of probes of claim 18, wherein the ratio of the binding subset to the dummy subset is less than 1:1 in each of the first probe mixtures.

25. a plurality of different second first probe mixtures, a second binding subset of the first probes bound to the affinity tag; 20. The probe set of claim 18, comprising a plurality of different second first probe mixtures, the second first probe mixture comprising a second dummy subset of first probes that are not bound to an affinity tag, the second binding subset of the second first probe mixture and each probe in the second dummy subset comprising the same second binding region that is complementary to a second aptamer of the aptamer panel, the second aptamer being different from the individual aptamers, and the second binding region being different from the binding region.

26. 26. The probe set of claim 25, wherein a first ratio of the binding subset to the dummy subset in the individual first probe mixture is different from a second ratio of the second binding subset to the second dummy subset in the second first probe mixture.

27. An aptamer detection probe set, comprising: a plurality of different first probe mixtures complementary to respective different aptamers of an aptamer panel, each first probe mixture of said plurality of different first probe mixtures comprising: a binding subset of the first probe; a plurality of different first probe mixtures comprising a dummy subset of first probes not bound to affinity tags, each first probe mixture comprising a binding region complementary to an aptamer of said aptamer panel, said binding regions being unique to each first probe mixture such that each first probe mixture binds to a different aptamer of said aptamer panel, each first probe mixture having a different ratio of said binding subset to said dummy subset as compared to other first probe mixtures of said plurality; and a plurality of different second probes complementary to each different aptamer of the aptamer panel.

28. 30. The probe set of claim 27, wherein the plurality of different first probe mixtures comprises at least 100 different first probe mixtures.

29. An aptamer detection probe set, comprising: a plurality of different reporter probe mixtures complementary to respective different aptamers of an aptamer panel, each of the plurality of different reporter probe mixtures comprising: a first subset of reporter probes comprising an amplifiable non-hybridizing region, the non-hybridizing region being adjacent to a first primer region and a second primer region and comprising an identification sequence uniquely identifying an individual aptamer that can be amplified using primers complementary to or corresponding to the first primer region and the second primer region; a second subset of reporter probes, wherein each probe in the first and second subsets of the individual reporter probe mixtures comprises the same binding region that is complementary to a first sequence of an individual aptamer of the aptamer panel, and each second probe comprises a non-amplifiable, non-hybridizing region that cannot be amplified using the primers; and a plurality of different capture probes complementary to each different aptamer of the aptamer panel, each capture probe of the plurality of different capture probes comprising a second binding region complementary to a second sequence of each aptamer, and each capture probe of the plurality is bound to an affinity tag.

30. 30. The probe set of claim 29, wherein the non-amplifiable, non-hybridizing region does not include one or both of the first primer region and the second primer region.

31. 30. The probe set of claim 29, wherein the non-amplified, non-hybridizing region does not include the identifier sequence.

32. 30. The set of probes of claim 29, wherein the non-amplified, non-hybridizing region comprises at least one extension blocker.

33. 30. The set of probes of claim 29, wherein the non-amplifiable, non-hybridizing region comprises a restriction enzyme site.

34. 1. A method for aptamer detection comprising: contacting each aptamer with a reporter probe that hybridizes to a first region of the individual aptamer, a first subset of the reporter probes comprising an amplifiable non-hybridizing region, the amplifiable non-hybridizing region comprising an identifier sequence uniquely identifying the individual aptamer adjacent to a first primer region and a second primer region, and a second subset comprising a non-amplifiable non-hybridizing region; contacting the individual aptamers with a capture probe, the capture probe hybridizing to a second region of the individual aptamer, the capture probe being associated with an affinity tag; capturing the capture probe via binding of the affinity tag with an affinity tag binder to capture the individual aptamers and the reporter probe comprising the amplifiable non-hybridized region hybridized to the first region of the individual aptamer; detecting the discrimination sequence of the captured reporter probe via amplification of the discrimination sequence.

35. 35. The method of claim 34, wherein detecting the discrimination sequence of the captured reporter probe comprises contacting the captured reporter probe with a primer to generate an amplification product.

36. 36. The method of claim 35, wherein the primers comprise a first primer that binds to a first primer binding region of the non-hybridized region and a second primer that corresponds to a second primer binding region of the non-hybridized region, the first primer binding region and the second primer binding region being adjacent to the non-hybridized region.

37. 36. The method of claim 35, wherein detecting the discrimination sequence of the captured reporter probe comprises sequencing the amplification product.

38. 35. The method of claim 34, wherein reporter probes comprising the non-amplified, non-hybridizing region hybridized to the first region of the individual aptamers are not detected.

39. 1. A method for aptamer detection comprising: contacting the aptamers with probes that hybridize to respective different ones of the aptamers, wherein a complementary region of each probe hybridizes to an individual one of the aptamers, and each probe includes a non-hybridizing region extending from the complementary region, the non-hybridizing region including an identification sequence that uniquely identifies each individual aptamer; removing excess probes that are not hybridized to said aptamers using an exonuclease; detecting the discrimination sequence in the probe after removing the excess probe.

40. 1. A method for aptamer detection comprising: contacting the first aptamer and the second aptamer with a reporter probe, the reporter probes comprising a first subset that hybridizes to the first aptamer and a second subset that hybridizes to the second aptamer, the reporter probes of the first subset comprising a first non-hybridizing region that comprises a first discriminator sequence uniquely identifying the first aptamer and a first group capture sequence, and the reporter probes of the second subset comprising a second discriminator sequence uniquely identifying the second aptamer and a second non-hybridizing region that comprises the first group capture sequence; contacting the first aptamer and the second aptamer with a capture probe, wherein the capture probe hybridizes to the first aptamer or the second aptamer, and the capture probe is associated with an affinity tag; capturing the capture probe via binding of the affinity tag with an affinity tag binder to capture the first aptamer and the second aptamer and the reporter probe; generating a first oligonucleotide comprising the first discrimination sequence and the first group capture sequence from the first subset, and a second oligonucleotide comprising the second discrimination sequence and the first group capture sequence from the second subset; capturing the first oligonucleotide and the second oligonucleotide using a first group of beads having a sequence complementary to the first group capture sequence; detecting the first discrimination sequence in the captured first oligonucleotide and the second discrimination sequence in the captured second oligonucleotide to detect the first aptamer and the second aptamer.

41. The method of claim 40, comprising contacting a third aptamer with the reporter probe, the reporter probe comprising a third subset comprising a third identification sequence uniquely identifying the third aptamer and a third non-hybridizing region comprising a second group capture sequence different from the first group capture sequence.

42. generating a third oligonucleotide comprising the third discriminator sequence from the third subset and the second group capture sequence; capturing the third oligonucleotide using a second group of beads having sequences complementary to the second group capture sequences; 42. The method of claim 41 , comprising detecting the third discrimination sequence in the captured third oligonucleotide to detect the third aptamer.

43. 43. The method of claim 42, wherein the first group of beads and the second group of beads include approximately the same number of beads.

44. 1. A method for aptamer detection comprising: contacting each aptamer with a first reporter probe that hybridizes to a first region of the individual aptamer, the first reporter probe comprising a first non-hybridizing region, the non-hybridizing region comprising a first identification sequence that uniquely identifies the individual aptamer, and a second reporter probe that hybridizes to a second region of the individual aptamer, the second reporter probe comprising a second non-hybridizing region, the second non-hybridizing region comprising a second identification sequence that uniquely identifies the individual aptamer; ligating the ends of the first and second identifier sequences together to generate a ligated reporter probe; capturing the ligated reporter probe using an affinity tag attached to the first reporter probe or the second reporter probe; detecting the first and second discrimination sequences via amplification of the captured ligated reporter probes to detect the individual aptamers.

45. 45. The method of claim 44, comprising hybridizing a single-stranded oligonucleotide splint to the first reporter probe and the second reporter probe.

46. 45. The method of claim 44, comprising using one or more exonucleases to digest other reporter probes that are not bound to the individual aptamers or other aptamers.

47. 45. The method of claim 44, comprising circularizing the captured ligated reporter probe using a ligase.

48. 45. The method of claim 44, wherein the first reporter probe comprises a first primer region, the second reporter probe comprises a second primer region, and the amplification uses primers complementary to or corresponding to the first primer region and the second primer region.

49. 49. The method of claim 48, wherein the first primer region is located between the first identification sequence and a sequence that binds to the aptamer in the first reporter probe.

50. 50. The method of claim 49, wherein the second primer region is located between the second identification sequence and a sequence that binds to the aptamer in the second reporter probe.

51. 1. A method for aptamer detection comprising: contacting an analyte of a sample with a plurality of aptamers under conditions allowing for the formation of an analyte-aptamer complex, wherein different aptamers of the plurality of aptamers have specific affinity for respective different analytes of the analytes; detecting the analyte by detecting an aptamer of the analyte-aptamer complex, wherein detecting an individual aptamer of the plurality of aptamers; contacting the individual aptamers with a mixture of first probes, wherein a first complementary region of each first probe of the mixture is capable of hybridizing to a first region of the individual aptamer, and wherein only a subset of the first probes in the mixture are bound to affinity tags such that the first probes of the mixture hybridize to the first region of the individual aptamers; contacting the individual aptamers with a second probe to hybridize a second complementary region of the second probe to a second region of the individual aptamer, the second probe comprising a non-hybridizing region extending from the complementary region, the non-hybridizing region comprising an identification sequence uniquely identifying the individual aptamer, and the first complementary region and the second complementary region uniquely hybridize to the individual aptamer; ligating the first probe hybridized to the first region of the individual aptamer to the second probe hybridized to the second region of the individual aptamer; capturing the first probe via binding of the affinity tag to an affinity tag binder to capture the individual aptamers and the second probe hybridized to the second region of the individual aptamer and ligated to the first probe, wherein the first probe is in the subset bound to the affinity tag; detecting the identification sequence of the captured second probe.

52. 1. A method for aptamer detection comprising: contacting an analyte of a sample with a plurality of aptamers under conditions allowing for the formation of an analyte-aptamer complex, wherein different aptamers of the plurality of aptamers have specific affinity for respective different analytes of the analytes; detecting the analyte by detecting an aptamer of the analyte-aptamer complex, wherein detecting an individual aptamer of the plurality of aptamers; contacting the individual aptamers with a mixture of first probes, wherein a first complementary region of each first probe of the mixture hybridizes to a first region of the individual aptamer, and wherein only a subset of the first probes in the mixture bind to an affinity tag; contacting the individual aptamers with a second probe to hybridize a second complementary region of the second probe to a second region of the individual aptamer, the second probe comprising a non-hybridizing region extending from the complementary region, the non-hybridizing region comprising an identification sequence uniquely identifying the individual aptamer, and the first complementary region and the second complementary region uniquely hybridize to the individual aptamer; capturing a first probe of the mixture via binding of the affinity tag with an affinity tag binder to capture the individual aptamers and the second probe hybridized to the second region of the individual aptamers, wherein the first probe is in the subset bound to the affinity tag; generating an amplification product from the captured second probe using a primer pair, the primer pair comprising a first primer that does not include the second complementary region and that is complementary to a region of the second probe that does not include the discriminator sequence; and detecting comprising sequencing said amplification products.

53. 53. The method of claim 52, wherein the non-hybridizing region of the second probe comprises a first adaptor sequence and a second adaptor sequence adjacent to the identification sequence.

54. 54. The method of claim 53, wherein the primer pair comprises a sequence that is complementary to or comprises a portion of the first adapter sequence or the second adapter sequence.

55. 54. The method of claim 53, wherein sequencing the amplification product comprises using a sequencing primer that is complementary to or comprises a portion of the first adapter sequence or the second adapter sequence.

56. 54. The method of claim 53, wherein the first adaptor sequence comprises a first index sequence and the second adaptor sequence comprises a second index sequence.

57. 53. The method of claim 52, comprising separating the captured first probe from the first probe in the mixture that is not bound to the affinity tag via a wash step.

58. 58. The method of claim 57, wherein the washing step comprises no more than six washes.

59. 1. A method for sequencing comprising: generating sequence data from a sequence library, the sequence library comprising: contacting an analyte of a sample with a plurality of aptamers under conditions allowing for the formation of an analyte-aptamer complex, wherein different aptamers of the plurality of aptamers have specific affinity for respective different analytes of the analytes; forming a first plurality of aptamer complexes of a first type by hybridizing a reporter probe and a dummy probe to each aptamer of the plurality of aptamers, wherein the dummy probe comprises a first complementary region that hybridizes to a first region of the each aptamer, and the reporter probe comprises a second complementary region that hybridizes to a second region of the each aptamer and a non-hybridizing region extending from the complementary region, the non-hybridizing region comprising an identification sequence uniquely identifying the each aptamer; forming a second plurality of aptamer complexes of a second type by hybridizing the reporter probe and a capture probe to the individual aptamers, the capture probe comprising the first complementary region that hybridizes to a first region of the individual aptamer and an affinity tag; separating the second plurality of aptamer complexes from the first plurality of aptamer complexes via the affinity tag to generate a separated second plurality of aptamer complexes; amplifying a portion of the reporter probes of the separated second plurality of aptamer complexes to generate the sequence library; identifying the identification sequence in the sequence data; generating a notification that the individual aptamer is present in the sample based on said identifying.

60. 60. The method of claim 59, wherein the notification is displayed on a display of the sequencing device or a computer in communication with the sequencing device.

61. 60. The method of claim 59, wherein sequence data is generated from a sequence library using a sequencing primer that is complementary to or includes an amplified portion of the reporter probe.

62. 60. The method of claim 59, wherein the sequence library is formed by forming additional multiple aptamer complexes of the first type and the second type for the different aptamers of the plurality of aptamers.

63. 63. The method of claim 62, comprising identifying a discriminating sequence for each of the distinct aptamers in the sequence data; and generating a notification that the distinct aptamers are present in the sample based on said identifying.

64. 60. The method of Claim 59, wherein generating the sequence data comprises: using a first sequencing primer to generate sequence reads that comprise the discriminating sequence; and using a second sequencing primer to generate sequence reads that comprise an index associated with the sample.

65. 60. The method of claim 59, wherein generating the sequence data comprises operating a sequencing device to incorporate a dark cycle.

Images