Improved Producer Cells

JP2025513335A5Pending Publication Date: 2026-04-24F HOFFMANN LA ROCHE & CO AG +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
F HOFFMANN LA ROCHE & CO AG
Filing Date
2023-04-17
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

The prior art has limitations in improving protein expression efficiency and cell survival in mammalian cells, especially in reducing or eliminating the expression of specific endogenous genes, which makes it difficult to significantly improve protein productivity.

Method used

Through gene editing techniques such as CRISPR/Cas9, the expression of BAK, BAX, ICAM-1, SIRT-1 and MYC genes is reduced or eliminated, thereby improving the protein production efficiency and cell survival of mammalian cells.

Benefits of technology

The protein productivity of mammalian cells has been significantly improved and the cell survival and growth efficiency has been improved, which is specifically manifested as an increase in protein productivity by 10% to 35%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

This paper reports modified mammalian cells in which the expression of one or more of MYC gene and BAK, BAX, SIRT-1 and ICAM-1 genes is reduced or eliminated, and a method for recombinant production of heterologous polypeptides using modified mammalian cells according to the present invention.Furthermore, the use of reduced expression of genes is reported to increase volumetric productivity, increase cell volume, increase viability, and increase the possible culture time without cell division.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention is in the field of recombinant therapeutic protein production. More specifically, improved mammalian (e.g., Chinese Hamster Ovary (CHO)) production cells and their use for recombinant production of therapeutic proteins are reported herein, the improvement being achieved by reducing or eliminating the expression of a limited number of endogenous genes in mammalian cells. [Background technology]

[0002] 2. Background of the Invention Mammalian host cell lines, particularly CHO and HEK cell lines, are often used for the recombinant production of secreted proteins, such as feeding proteins (e.g., antigens, receptors, etc.) and therapeutic molecules (e.g., antibodies, cytokines, etc.). These host cell lines are transfected with vectors containing expression cassettes encoding the corresponding therapeutic molecules. Stable transfectants are then selected by applying selective pressure. This results in a cell "pool" of individual "clones". In a single cell cloning step, these clones are isolated and subsequently screened in various assays to identify high producing cells.

[0003] Genetic engineering approaches have been used to improve their properties, such as (i) overexpression of endogenous proteins involved in the unfolded protein response pathway to improve protein folding and secretion (Gulis, G., et al., BMC biotechnology, 14 (2014) 26 (Non-Patent Document 1)), (ii) overexpression of anti-apoptotic proteins to improve cell viability and extend the fermentation process (Lee, JS, et al., Biotechnol. Bioeng. 110 (2013) 2195-2207 (Non-Patent Document 2)), (iii) overexpression of miRNA and / or shRNA molecules to improve cell growth and productivity (Fischer, S., et al., J. Biotechnol. 212 (2015) 32-43 (Non-Patent Document 3)), (iv) overexpression of therapeutic molecules (Ferrara, C., et al., J. Biotechnol. 212 (2015) 32-43 (Non-Patent Document 4)), and (v) overexpression of therapeutic molecules (Ferrara, C., et al., J. Biotechnol. 212 (2015) 32-43 (Non-Patent Document 5)). al., Biotechnol. Bioeng. 93 (2006) 851-861 (Non-Patent Document 4)) and many others (Fischer, S., et al., Biotechnol. Adv. 33 (2015) 1878-1896 (Non-Patent Document 5)) have been applied to improve host cell lines, such as overexpression of glycoenzymes to modulate glycosylation patterns.

[0004] Furthermore, the reduction or elimination of expression of certain endogenous proteins has been shown to improve cellular properties. Examples include (i) reducing or eliminating the expression of BAX / BAK proteins, leading to increased resistance to apoptosis (Cost, GJ, et al., Biotechnol. Bioeng. 105 (2010) 330-340 (Non-Patent Document 6)), (ii) reducing or eliminating the expression of PUTS to generate non-fucosylated proteins (Yamane-Ohnuki, N., et al., Biotechnol. Bioeng. 87 (2004) 614-622 (Non-Patent Document 7)), (iii) reducing or eliminating the expression of GS to increase the selection efficiency using the GS selection system (Fan, L., et al., Biotechnol. Bioeng. 109 (2012) 1007-1015 (Non-Patent Document 8)) and many others (Fischer, S., et al., Biotechnol. Adv. 33 (2015) 1878-1896 (Non-Patent Document 5)). Zinc finger or TALEN proteins have been used in the past, but recently CRISPR / Cas9 has been established for versatile and simple targeting of genomic sequences to reduce or eliminate target expression. For example, miRNA-744 was targeted in CHO cells using CRISPR / Cas9 by using multiple gRNAs that allow sequence excision (Raab, N., et al., Biotechnol. J. (2019) 1800477 (Non-Patent Document 9)).

[0005] Inactivation of the SIRT-1 gene using CRISPR / Cas has been reported in WO 2020 / 260327 (Patent Document 1).

[0006] Bernier, M. et al. reported the negative regulation of STAT3 respiration by SIRT1 protein (J. Biol. Chem. 286 (2011) 19270-19279 (Non-Patent Document 10)).

[0007] Inactivation of the BAX and BAK genes using zinc finger nucleases has been reported in WO 2009 / 151591 (Patent Document 2).

[0008] Inactivation of the MYC gene using CRISPR / Cas has been reported in WO 2022 / 063877 (Patent Document 3). [Prior art documents] [Patent documents]

[0009] [Patent Document 1] International Publication No. 2020 / 260327 [Patent Document 2] International Publication No. 2009 / 151591 [Patent Document 3] International Publication No. 2022 / 063877 [Non-patent literature]

[0010] [Non-Patent Document 1] Gulis, G., et al., BMC biotechnology, 14 (2014) 26 [Non-Patent Document 2] Lee, JS, et al.,Biotechnol.Bioeng.110(2013)2195-2207 [Non-Patent Document 3] Fischer, S., et al., J.Biotechnol.212(2015)32-43 [Non-Patent Document 4] Ferrara, C., et al.,Biotechnol.Bioeng.93(2006)851-861 [Non-Patent Document 5] Fischer,S.,et al.,Biotechnol.Adv.33(2015)1878-1896 [Non-Patent Document 6] Cost, GJ, et al.,Biotechnol.Bioeng.105(2010)330-340 [Non-Patent Document 7] Yamane-Ohnuki, N., et al.,Biotechnol.Bioeng.87(2004)614-622 [Non-Patent Document 8] Fan, L., et al.,Biotechnol.Bioeng.109(2012)1007-1015 [Non-Patent Document 9] Raab, N., et al.,Biotechnol.J.(2019)1800477 [Non-Patent Document 10] Bernier,M.,et al.,J.Biol.Chem.286(2011)19270-19279 Summary of the Invention

[0011] This document reports modified mammalian cells with improved properties and their uses.One of the improved properties of mammalian cells according to the present invention is, among others, increased volumetric productivity compared to mammalian cells that are not modified according to the present invention.Modification according to the present invention includes, but is not limited to, reducing or eliminating the expression of one or more or all of BAK, BAX, ICAM-1, SIRT-1 and MYC genes.

[0012] The following independent aspects and dependent embodiments illustrate the subject matter of the present invention.

[0013] 1. A modified mammalian cell in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes is reduced or eliminated.

[0014] 2. MYC, SIRT-1 and ICAM-1 genes, or MYC, BAX, BAK and SIRT-1 genes, or MYC, BAX, BAK, ICAM-1 and SIRT-1 genes 2. The modified mammalian cell of embodiment 1, wherein expression of

[0015] 3. The modified mammalian cell according to any one of aspect 1 or embodiment 2, wherein expression of the MYC, SIRT-1 and ICAM-1 genes is reduced or eliminated.

[0016] 4. The modified mammalian cell according to any one of aspect 1 or embodiment 2, wherein expression of MYC, BAX, BAK and SIRT-1 genes is reduced or eliminated.

[0017] 5. The modified mammalian cell according to any one of aspect 1 or embodiment 2, wherein expression of MYC, BAX, BAK, ICAM-1 and SIRT-1 genes is reduced or eliminated.

[0018] 6. The modified mammalian cell according to aspect 1 or any one of embodiments 2-5, wherein the reduction or elimination of expression is elimination by gene knockout.

[0019] 7. The modified mammalian cell according to aspect 1 or any one of embodiments 2-5, wherein the reduction or elimination of expression is elimination by gene ablation.

[0020] 8. The modified mammalian cell according to aspect 1 or any one of embodiments 2-5, wherein the reduction or elimination of expression is by CRISPR / Cas-mediated gene knockout.

[0021] 9. The modified mammalian cell according to aspect 1 or any one of embodiments 2-5, wherein the reduction or elimination of expression is by CRISPR / Cas-mediated gene inactivation.

[0022] 10. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 9, which is a modified CHO cell.

[0023] 11. The modified mammalian cell according to aspect 1 or any one of embodiments 2-9, which is a modified HEK cell.

[0024] 12. The modified mammalian cell according to aspect 1 or any one of embodiments 2-11, comprising one or more targeted integration landing sites.

[0025] 13. The modified mammalian cell according to aspect 1 or any one of embodiments 2-12, wherein the modified mammalian cell comprises one or more targeted integration landing sites each comprising two or three recombinase recognition sequences, whereby, in the case of two or more landing sites, the recombinase recognition sequences of each landing site are not compatible with each other.

[0026] 14. The modified mammalian cell according to aspect 1 or any one of embodiments 2-13, wherein the modified mammalian cell comprises one or more targeted integration landing sites, whereby one of the targeted integration landing sites comprises the recombinase recognition sequences L3, LoxFas and 2L.

[0027] 15. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 14, wherein the modified mammalian cell comprises one or more targeted integration landing sites, whereby one or more nucleic acids encoding heterologous proteins are integrated at one of the targeted integration landing sites.

[0028] 16. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 15, wherein the modified mammalian cell comprises one or more targeted integration landing sites, whereby at one targeted integration landing site, one or more nucleic acids encoding monospecific or multispecific antibodies are integrated.

[0029] 17. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 15, wherein the expression of the MYC, BAK, BAX, ICAM-1 or / and SIRT-1 genes has been reduced or eliminated following stable introduction of one or more nucleic acids encoding heterologous proteins.

[0030] 18. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 17, wherein the expression of the MYC, BAK, BAX, ICAM-1 or / and SIRT-1 genes has been reduced or eliminated following stable introduction of one or more nucleic acids encoding a monospecific or multispecific antibody.

[0031] 19. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 18, having increased productivity compared to a mammalian cell having the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0032] 20. A modified mammalian cell according to aspect 1 or any one of embodiments 2 to 19, having a productivity increased by 10% or more compared to a mammalian cell having the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0033] 21. A modified mammalian cell according to aspect 1 or any one of embodiments 2 to 20, having a productivity increased by 25% or more compared to a mammalian cell having the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0034] 22. A modified mammalian cell according to aspect 1 or any one of embodiments 2 to 21, having a productivity increased by 35% or more compared to a mammalian cell having the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0035] 23. The modified mammalian cell according to any one of embodiments 19 to 22, wherein the productivity is recombinant expression of a heterologous protein.

[0036] 24. The modified mammalian cell according to any one of embodiments 19 to 22, wherein the productivity is recombinant expression of a monospecific or multispecific antibody.

[0037] 25. A modified mammalian cell according to any one of embodiments 19 to 24, wherein expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has increased productivity compared to a mammalian cell having the same genotype, in which the expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes is wild-type.

[0038] 26. The modified mammalian cell according to any one of embodiments 6, 8 and 10 to 25, wherein the knockout is at least a heterozygous knockout.

[0039] 27. The modified mammalian cell according to any one of embodiments 6, 8 and 10 to 25, wherein the knockout is a homozygous knockout.

[0040] 28. A modified mammalian cell according to aspect 1 and any one of embodiments 2 to 27, having an increased cell diameter compared to a mammalian cell of the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0041] 29. The modified mammalian cell according to aspect 1 and any one of embodiments 2 to 28, having a cell diameter increased by at least 0.5 μm compared to a mammalian cell having the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0042] 30. A modified mammalian cell according to aspect 1 and any one of embodiments 2 to 29, having a cell diameter increased by at least 1 μm compared to a mammalian cell having the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0043] 31. A modified mammalian cell according to aspect 1 and any one of embodiments 2 to 27, having an increased cell volume compared to a mammalian cell of the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0044] 32. A modified mammalian cell according to aspect 1 and any one of embodiments 2 to 27 and 31, having a cell volume that is increased by at least 10% compared to a mammalian cell having the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0045] 33. A modified mammalian cell according to aspect 1 and any one of embodiments 2-27 and 31-32, having a cell volume that is increased by at least 15% compared to a mammalian cell having the same genotype in which expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0046] 34. A method for the recombinant production of a protein, comprising: a) culturing a modified mammalian cell according to aspect 1 or any one of embodiments 2 to 33, comprising one or more nucleic acids encoding a protein, in a culture medium under suitable conditions for expression of the protein; b) recovering the protein from the modified mammalian cells or the culture medium; c) optionally purifying the protein using one or more chromatography steps; thereby recombinantly producing a protein.

[0047] 35. The method according to aspect 34, wherein the culturing step is for 6 to 16 days.

[0048] 36. The method according to any one of aspects 34 or embodiment 35, wherein the culturing step is for 12 to 15 days.

[0049] 37. The method according to any one of aspects 34 or embodiments 35-36, wherein the culturing step is for about 14 days.

[0050] 38. The culture process is 5 x 10 6 The method according to aspect 34 or any one of embodiments 35 to 37, starting with a cell density of ≧ 10 cells / ml.

[0051] 39. The culture process is 10 x 10 6 The method according to aspect 34 or any one of embodiments 35 to 38, starting with a cell density of ≧ 10 cells / ml.

[0052] 40. The method according to aspect 34 or any one of embodiments 35 to 39, wherein the culturing step is a fed-batch culture.

[0053] 41. The method according to aspect 34 or any one of embodiments 35 to 40, wherein the culturing is a fed-batch culture with feeding at least on days 1, 4, 7 and 10.

[0054] 42. The method according to aspect 34 or any one of embodiments 35 to 41, wherein the culturing step is a fed-batch culture with daily feeding.

[0055] 43. Use of reducing or eliminating expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in mammalian cells expressing a recombinant polypeptide to increase the volumetric productivity of the mammalian cells.

[0056] 44. Use of reducing or eliminating expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in mammalian cells to increase cell volume.

[0057] 45. Use of reducing or eliminating expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in mammalian cells expressing a recombinant polypeptide to enhance bioprocess viability.

[0058] 46. ​​Use of reducing or eliminating expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in mammalian cells expressing a recombinant polypeptide to increase / extend the culture time of the mammalian cells without cell division.

[0059] 47. MYC, SIRT-1 and ICAM-1 genes, or MYC, BAX, BAK and SIRT-1 genes, or MYC, BAX, BAK, ICAM-1 and SIRT-1 genes 47. The use according to any one of aspects 43 to 46, wherein expression of is reduced or eliminated.

[0060] 48. Use according to any one of aspects 43 to 46, wherein expression of the MYC, SIRT-1 and ICAM-1 genes is reduced or eliminated.

[0061] 49. Use according to any one of aspects 43 to 46, wherein expression of the MYC, BAX, BAK and SIRT-1 genes is reduced or eliminated.

[0062] 50. Use according to any one of aspects 43 to 46, wherein expression of the MYC, BAX, BAK, ICAM-1 and SIRT-1 genes is reduced or eliminated.

[0063] 51. The use according to any one of aspects 43 to 46 or embodiments 47 to 50, wherein expression is permanently reduced or eliminated.

[0064] 52. The cell, method or use according to any one of aspect 1, or aspect 34, or aspect 43 to 46, or any one of embodiments 2 to 33, or embodiments 35 to 42, or embodiments 47 to 51, wherein the reduction or elimination of expression is permanent.

[0065] 53. The cell, method or use according to any one of aspect 1 or aspect 34 or aspects 43-46 or any one of embodiments 2-33 or embodiments 35-42 or embodiments 47-52, wherein the reduction or elimination of expression is at least about 40% compared to a mammalian cell having the same genotype in which the expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes is not reduced or eliminated.

[0066] 54. The cell, method or use according to any one of aspect 1 or aspect 34 or aspects 43-46 or any one of embodiments 2-33 or embodiments 35-42 or embodiments 47-52, wherein the reduction or elimination of expression is at least about 50% compared to a mammalian cell having the same genotype in which the expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes is not reduced or eliminated.

[0067] 55. The cell, method or use according to any one of aspect 1 or aspect 34 or aspects 43-46 or any one of embodiments 2-33 or embodiments 35-42 or embodiments 47-52, wherein the reduction or elimination of expression is at least about 60% compared to a mammalian cell having the same genotype in which the expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes is not reduced or eliminated.

[0068] 56. The cell, method or use according to any one of aspect 1 or aspect 34 or aspects 43-46 or any one of embodiments 2-33 or embodiments 35-42 or embodiments 47-52, wherein the reduction or elimination of expression is at least about 80% compared to a mammalian cell having the same genotype in which the expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes is not reduced or eliminated.

[0069] 57. The cell, method or use according to any one of aspect 1 or aspect 34 or aspects 43-46 or any one of embodiments 2-33 or embodiments 35-42 or embodiments 47-52, wherein the reduction or elimination of expression is at least about 90% compared to a mammalian cell having the same genotype in which the expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes is not reduced or eliminated.

[0070] 58. The cell, method or use according to any one of aspect 1 or aspect 34 or aspects 43-46 or any one of embodiments 2-33 or embodiments 35-42 or embodiments 47-52, wherein the reduction or elimination of expression is at least about 95% compared to a mammalian cell having the same genotype in which the expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes is not reduced or eliminated.

[0071] In addition to the various embodiments explicitly depicted and claimed, the subject matter encompassed by the present disclosure also covers other embodiments having other combinations of the features disclosed and claimed herein. Thus, the specific features presented herein, particularly as aspects or embodiments, can be combined with each other in other ways within the scope of the subject matter of the present disclosure, so that the subject matter of the present disclosure includes any suitable combination of the features disclosed herein. The foregoing description of specific embodiments of the subject matter of the present disclosure is presented for illustrative and explanatory purposes. It is not intended to be exhaustive or to limit the subject matter of the present disclosure to the disclosed embodiments.

[0072] An aspect as used herein relates to an independent subject of the invention, and an embodiment as used herein provides a more detailed realization of one or more or all of the independent aspects. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0073] DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS OF THEINVENTION The present invention is based, at least in part, on the discovery that volumetric productivity of recombinant polypeptides in mammalian cells can be increased by reducing or eliminating expression of one or more or all of the BAK, BAX, ICAM-1, SIRT-1 and MYC genes.

[0074] I. General Definitions Useful methods and techniques for carrying out the subject matter of the present invention are described, for example, in Ausubel, FM (ed.), Current Protocols in Molecular Biology, Volumes I to III (1997); Glover, ND, and Hames, BD, ed., DNA Cloning: A Practical Approach, Volumes I and II (1985), Oxford University Press; Freshney, RI (ed.), Animal Cell Culture-a practical approach, IRL Press Limited (1986); Watson, JD, et al., Recombinant DNA, Second Edition, CHSL Press (1992); Winnacker, EL, From Genes to Clones; NY, VCH Publishers (1987); Celis, J., ed., Cell Biology, Second Edition, Academic Press (1998); Freshney, RI, Culture of Animal Cells: A Manual of Basic Technique, second edition, Alan R. Liss, Inc., NY (1987). The use of recombinant DNA technology allows the production of derivatives of nucleic acids. Such derivatives can be modified, for example, by substitution, alteration, replacement, deletion or insertion, at individual or several nucleotide positions. Modification or derivatization can be carried out, for example, by site-directed mutagenesis.Such modifications can be readily performed by those skilled in the art (see, e.g., Sambrook, J., et al., Molecular Cloning: A laboratory manual (1999) Cold Spring Harbor Laboratory Press, New York, USA; Hames, BD, and Higgins, SG, Nucleic acid hybridization-a practical approach (1985) IRL Press, Oxford, England).

[0075] It should be noted that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, a reference to "a cell" includes a plurality of such cells, and equivalents thereof known to those of skill in the art, and so forth. Similarly, the terms "a" (or "an"), "one or more," and "at least one" may be used interchangeably herein. It should also be noted that the terms "comprising," "including," and "having" may be used interchangeably.

[0076] The term "about" refers to a range of ±20% of the numerical value that follows it. In certain embodiments, the term about refers to a range of ±10% of the numerical value that follows it. In certain embodiments, the term about refers to a range of ±5% of the numerical value that follows it.

[0077] "Comprise(s)", "include(s)", "having", "has", "can", "contain(s)" and variations thereof, as used herein, are intended to be open-ended transitional phrases, terms or words that do not exclude the possibility of additional acts or structures. The term "comprising" also encompasses the term "consisting of". The present disclosure also contemplates other embodiments that "comprising", "consisting of" and "consisting essentially of" the embodiments or elements presented herein, whether or not explicitly stated.

[0078] The term "recombinant mammalian cell" as used herein refers to a mammalian cell comprising an exogenous nucleotide sequence capable of expressing a polypeptide. Such a recombinant mammalian cell is a cell into which one or more exogenous nucleic acids have been introduced, including the progeny of such a cell. Thus, the term "mammalian cell comprising a nucleic acid encoding a heterologous polypeptide" refers to a cell comprising an exogenous nucleotide sequence integrated into the genome of the mammalian cell and capable of expressing a heterologous polypeptide. In certain embodiments, a mammalian cell comprising an exogenous nucleotide sequence is a cell comprising an exogenous nucleotide sequence integrated into a single site within a locus of the genome of the host cell, the exogenous nucleotide sequence comprising a first and a second recombination recognition sequence adjacent to at least one first selection marker, and a third recombination recognition sequence located between the first and second recombination recognition sequences, and the recombination recognition sequences are all different.

[0079] The term "recombinant cell" as used herein refers to a cell after genetic modification, such as a cell that expresses a heterologous polypeptide of interest and can be used for the production of the heterologous polypeptide of interest on any scale. For example, a "recombinant mammalian cell comprising an exogenous nucleotide sequence" refers to a cell in which a coding sequence of a heterologous polypeptide of interest is introduced into the genome of a host cell. For example, a "recombinant mammalian cell comprising an exogenous nucleotide sequence" that has been subjected to recombinase-mediated cassette exchange (RMCE), thereby introducing a coding sequence of a polypeptide of interest into the genome of a host cell, is a "recombinant cell".

[0080] Both "mammalian cells containing an exogenous nucleotide sequence" and "recombinant cells" are "transformed cells." The term includes the primary transformed cell and the progeny derived therefrom, regardless of the number of transfers. The progeny may not be completely identical to the parent cell, for example in nucleic acid content, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are encompassed.

[0081] An "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. Isolated nucleic acid includes a nucleic acid molecule that is contained within a cell that ordinarily contains the nucleic acid molecule, but where the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0082] An "isolated" polypeptide or antibody refers to a polypeptide or antibody molecule that has been separated from a component of its natural environment.

[0083] The term "integration site" refers to a nucleic acid sequence in a cell genome into which an exogenous nucleotide sequence is inserted. In certain embodiments, the integration site is between two adjacent nucleotides in the cell genome. In certain embodiments, the integration site comprises a stretch of nucleotide sequence. In certain embodiments, the integration site is located in a specific locus of the genome of a mammalian cell. In certain embodiments, the integration site is in an endogenous gene of a mammalian cell.

[0084] The terms "vector" or "plasmid" can be used interchangeably and, as used herein, refer to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. This term includes vectors as autonomously replicating nucleic acid structures as well as vectors integrated into the genome of a host cell into which the vector is introduced. Certain vectors are capable of directing the expression of a nucleic acid to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[0085] As used herein, the term "selection marker" refers to a gene that allows cells carrying the gene to be positively or negatively specifically selected in the presence of a corresponding selection agent. For example, but not limited to, a selection marker can allow host cells transformed with the selection marker gene to be positively selected in the presence of the respective selection agent (under selective culture conditions), and untransformed host cells cannot grow or survive under the selective culture conditions. A selection marker can be positive, negative, or bifunctional. A positive selection marker can allow the selection of cells carrying the marker, whereas a negative selection marker can allow the selective elimination of cells carrying the marker. A selection marker can confer resistance to a drug in a host cell or compensate for a metabolic or catabolic defect. In prokaryotic cells, genes that confer resistance to ampicillin, tetracycline, kanamycin, or chloramphenicol, among others, can be used. Resistance genes useful as selectable markers in eukaryotic cells include, but are not limited to, genes for aminoglycoside phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthase (indole), histidinol dehydrogenase (histidinol D)), as well as genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, zeocin, and mycophenolic acid. Additional marker genes are described in WO 92 / 08796 and WO 94 / 28143.

[0086] Beyond facilitating selection in the presence of the corresponding selection agent, the selection marker can alternatively be a molecule that is not normally present in cells, such as green fluorescent protein (GFP), enhanced GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), enhanced YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean, and T-Sapphire.For example, cells expressing such molecules can be distinguished from cells that do not carry this gene based on the detection or absence, respectively, of the fluorescence emitted by the encoded polypeptide.

[0087] As used herein, the term "operably linked" refers to the juxtaposition of two or more components in a relationship that allows them to function in a desired manner. For example, a promoter and / or enhancer is operably linked to a coding sequence if the promoter and / or enhancer act to modulate the transcription of the coding sequence. In certain embodiments, "operably linked" DNA sequences are contiguous and adjacent on a single chromosome. In certain embodiments, for example, when it is necessary to join the coding regions of two proteins, such as a secretory leader and a polypeptide, the sequences are contiguous, adjacent, and in the same reading frame. In certain embodiments, an operably linked promoter may be located upstream of and adjacent to the coding sequence. In certain embodiments, for example, with respect to an enhancer sequence that modulates the expression of a coding sequence, the two components may be operably linked, but not adjacent. An enhancer is operably linked to a coding sequence if the enhancer increases the transcription of the coding sequence. An operably linked enhancer may be located upstream, inside or downstream of a coding sequence, and may be located far away from the promoter of the coding sequence. Operable linkage can be achieved by recombinant methods known in the art, for example, by using PCR methods and / or by ligation at a convenient restriction site. If a convenient restriction site does not exist, synthetic oligonucleotide adaptors or linkers can be used according to conventional procedures. An internal ribosome entry site (IRES) is operably linked to an open reading frame (ORF) if it can initiate the translation of the ORF at an internal position, independent of the 5' end.

[0088] As used herein, the term "exogenous" indicates that a nucleotide sequence does not originate from a particular cell, but is introduced into the cell by a DNA delivery method, such as transfection, electroporation, or transformation. Thus, an exogenous nucleotide sequence is an artificial sequence, which may result, for example, from a combination of partial sequences of different origins (e.g., the combination of a recombinase recognition sequence with an SV40 promoter and a coding sequence for green fluorescent protein is an artificial nucleic acid), or from partial deletion or nucleic acid base mutation of a sequence (e.g., a sequence or cDNA coding only for the extracellular domain of a membrane-bound receptor). The term "endogenous" refers to a nucleotide sequence originating from a cell. An "exogenous" nucleotide sequence may have an "endogenous" counterpart with the same base composition, but an "exogenous" sequence is introduced into a cell, for example, by recombinant DNA technology.

[0089] As used herein, the term "heterologous" refers to a polypeptide that does not originate from a particular cell, and the respective encoding nucleic acid is introduced into the cell by a DNA delivery method, such as transfection, electroporation, or transformation. Thus, a heterologous polypeptide is an artificial polypeptide relative to the cell that expresses it, and therefore does not depend on whether the polypeptide is a naturally occurring polypeptide originating from a different cell / organism, or a synthetic polypeptide.

[0090] The term "sirtuin-1" refers to an enzyme that is part of signal transduction in mammals, namely, NAD-dependent deacetylase sirtuin-1. Sirtuin-1 is encoded by the SIRT-1 gene. Chinese hamster sirtuin-1 has UniProtKB entry A0A3L7IF96. The effect of SIRT-1 gene inactivation is described in WO2020 / 260327, which is expressly incorporated herein by reference.

[0091] The term "myc proto-oncogene protein" refers to a family of regulatory genes that code for transcription factors. This family includes the proteins c-myc (encoded by the MYC gene), l-myc (encoded by the MYCL gene) and n-myc (encoded by the MYCN gene). The Chinese hamster myc proto-oncogene protein has a genomic location in the CHO genome (PICR genome) of RAZU01000002.1 (8,114,040-8,118,048) (see https: / / www.ncbi.nlm.nih.gov / assembly / GCF_003668045.3 / ). The effects of MYC inactivation are described in International Publication No. WO 2022 / 063877, which is expressly incorporated herein by reference.

[0092] The term "bcl-2 associated X protein" refers to the pro-apoptotic Bcl-2 family member encoded by the BAX gene (also known as Bcl2l4).

[0093] The term "bcl-2 homologous antagonist / killer" refers to a pro-apoptotic Bcl-2 family member encoded by the BAK gene (also known as BCL2 antagonist / killer 1, Bak1, Cdn1, Bcl2l7, and Bak-like).

[0094] The effects of BAX and BAK gene inactivation are described in WO 2009 / 151591, expressly incorporated herein by reference.

[0095] The term "intercellular adhesion molecule 1" refers to a cell surface glycoprotein. Its binding partners are integrins of the CD11a / CD18 or CD11b / CD18 type. It is also known as CD54 (cluster of differentiation 54). In humans, it is encoded by the ICAM-1 gene.

[0096] The term "activity" as used herein with respect to the activity of a protein refers to any activity of the protein, including, but not limited to, enzymatic activity, ligand binding, drug transport, ion transport, protein localization, receptor binding, and / or structural activity. Such activity can be modulated, e.g., reduced or eliminated, by reducing or eliminating the expression of the protein, thereby reducing or eliminating the presence of the protein. Such activity can also be modulated, e.g., reduced or eliminated, by altering the nucleic acid sequence encoding the protein, such that the resulting modified protein exhibits reduced or eliminated activity compared to the wild-type protein.

[0097] The terms "expression" and "expressing" are used herein to refer to the transcription and translation occurring in a host cell. The expression level of a production gene in a host cell can be determined based on either the amount of corresponding mRNA present in the cell or the amount of protein encoded by the production gene produced by the cell. For example, the mRNA transcribed from the production gene is preferably quantified by Northern hybridization. Sambrook et al., Molecular Cloning: A Laboratory Manual, pp.7.3-7.57 (Cold Spring Harbor Laboratory Press, 1989). The protein encoded by the production gene can be quantified either by assaying the biological activity of the protein or by using an assay that is independent of such activity, such as Western blot or radioimmunoassay, which uses an antibody capable of reacting with the protein. Sambrook et al., Molecular Cloning: A Laboratory Manual, pp.18.1-18.88 (Cold Spring Harbor Laboratory Press, 1989). When referring to the reduction and / or elimination of expression of one or more endogenous genes relative to the expression of those endogenous genes in an unmodified cell, such reduction and / or elimination of expression encompasses the reduction and / or elimination of active endogenous genes, regardless of the presence of mRNA encoding all or a portion of the endogenous gene or the presence of an endogenous protein translated from such mRNA.

[0098] II. Antibodies General information regarding the nucleotide sequences of human immunoglobulin light and heavy chains is given in Kabat, EA, et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991).

[0099] The term "antibody" as used herein is used in the broadest sense and encompasses a variety of antibody structures including, but not limited to, full length antibodies, monoclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody-antibody fragment-fusions and combinations thereof.

[0100] The term "natural antibody" refers to naturally occurring immunoglobulin molecules with various structures. For example, natural IgG antibodies are heterotetrameric glycoproteins of about 150,000 daltons composed of two identical light chains and two identical heavy chains that are disulfide-bonded. From the N-terminus to the C-terminus, each heavy chain has a heavy chain variable region (VH) followed by three heavy chain constant domains (CH1, CH2, and CH3), which position the hinge region between the first heavy chain constant domain and the second heavy chain constant domain. Similarly, from the N-terminus to the C-terminus, each light chain has a light chain variable region (VL) followed by a light chain constant domain (CL). The light chain of an antibody may be assigned to one of two types, called kappa (κ) and lambda (λ), based on the amino acid sequence of its constant domain.

[0101] The term "full-length antibody" refers to an antibody that has a structure substantially similar to that of a natural antibody. A full-length antibody comprises two full-length antibody light chains, each comprising a light-chain variable region and a light-chain constant domain from N-terminus to C-terminus, and two full-length antibody heavy chains, each comprising a heavy-chain variable region, a first heavy-chain constant domain, a hinge region, a second heavy-chain constant domain, and a third heavy-chain constant domain from N-terminus to C-terminus. In contrast to a natural antibody, a full-length antibody may comprise additional immunoglobulin domains, such as one or more additional scFvs, or Fab fragments of heavy or light chains, or scFabs that are conjugated to one or more ends of different chains of a full-length antibody, but only one fragment at each end. These conjugates are also encompassed by the term full-length antibody.

[0102] The "class" of an antibody refers to the type of constant domain or region, preferably the Fc region, possessed by the heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, some of which may be further divided into "subclasses" (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively.

[0103] The term "heavy chain constant region" refers to the region of an immunoglobulin heavy chain that contains the constant domains, i.e., the CH1 domain, the hinge region, the CH2 domain, and the CH3 domain. In certain embodiments, the human IgG constant region extends from Ala118 to the carboxyl terminus of the heavy chain (numbering according to Kabat EU index). However, the C-terminal lysine (Lys447) of the constant region may or may not be present (numbering according to Kabat EU index). The term "constant region" refers to a dimer that includes two heavy chain constant regions that can be covalently linked to each other via hinge region cysteine ​​residues that form interchain disulfide bonds.

[0104] The term "heavy chain Fc region" refers to the C-terminal region of an immunoglobulin heavy chain that contains at least a portion of the hinge region (middle and lower hinge regions), the CH2 domain and the CH3 domain. In certain embodiments, the human IgG heavy chain Fc region extends from Asp221 or Cys226 or Pro230 to the carboxyl terminus of the heavy chain (numbering according to Kabat EU index). Thus, the Fc region is smaller than the constant region but is essentially identical to the C-terminal portion. However, the C-terminal lysine (Lys447) of the heavy chain Fc region may or may not be present (numbering according to Kabat EU index). The term "Fc region" refers to a dimer comprising two heavy chain Fc regions that can be covalently linked to each other via cysteine ​​residues in the hinge regions that form interchain disulfide bonds.

[0105] The constant region of an antibody, more precisely the Fc region (and also the constant region), is directly involved in complement activation, C1q binding, C3 activation and Fc receptor binding. The effect of an antibody on the complement system depends on certain conditions, but the binding to C1q is caused by a defined binding site in the Fc region. Such binding sites are known in the state of the art and are described, for example, in Lukas, TJ, et al., J. Immunol. 127 (1981) 2555-2560; Brunhouse, R., and Cebra, JJ, Mol. Immunol. 16 (1979) 907-917; Burton, DR, et al., Nature 288 (1980) 338-344; Thommesen, JE, et al., Mol. Immunol. 37 (2000) 995-1004; Idusogie, EE, et al., J. Immunol. 164 (2000) 4178-4184; Hezareh, M., et al., J. Virol. 75 (2001) 12161-12168; Morgan, A., et al., Immunology 86 (1995) 319-324; and European Patent No. 0307434. Such binding sites are, for example, L234, L235, D270, N297, E318, K320, K322, P331 and P329 (numbering according to the Kabat EU index). Antibodies of the subclasses IgG1, IgG2 and IgG3 usually exhibit complement activation, C1q binding and C3 activation, whereas IgG4 does not activate the complement system, does not bind C1q and does not activate C3.

[0106] The "Fc region of an antibody" is a term well known to those skilled in the art and is defined based on papain cleavage of an antibody.

[0107] The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies constituting the population are identical and / or bind to the same epitope, with the exception of possible variant antibodies that contain, for example, naturally occurring mutations or arise during the production of the monoclonal antibody preparation, and such variants are generally present in minor amounts. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on the antigen. Thus, the modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and should not be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies may be produced by a variety of techniques, including, but not limited to, hybridoma methods, recombinant DNA methods, phage display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci.

[0108] The term "valency" as used within this application refers to the presence of a particular number of binding sites on an antibody. Thus, the terms "bivalent," "tetravalent," and "hexavalent" refer to the presence of two, four, and six binding sites, respectively, on an antibody.

[0109] "Monospecific antibody" refers to an antibody that has a single binding specificity, i.e., that specifically binds to one antigen. Monospecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2) or combinations thereof (e.g., full-length antibodies with additional scFv or Fab fragments). Monospecific antibodies need not be monovalent, i.e., they may contain more than one binding site that specifically binds to one antigen. For example, natural antibodies are monospecific but bivalent.

[0110] "Multispecific antibodies" refers to antibodies that have binding specificities for at least two different epitopes on the same antigen or two different antigens. Multispecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2 bispecific antibodies) or combinations thereof (e.g., full-length antibodies with additional scFv or Fab fragments). Multispecific antibodies are at least bivalent, i.e., contain two antigen-binding sites. Furthermore, multispecific antibodies are at least bispecific. Thus, bivalent bispecific antibodies are the simplest form of multispecific antibodies. Engineered antibodies with two, three or more (e.g., four) functional antigen-binding sites have been reported (see, e.g., U.S. Patent Application Publication No. 2002 / 0004587).

[0111] In certain embodiments of all aspects and embodiments of the subject matter of the present invention, the cell according to the present invention expresses an antibody.In certain embodiments, the antibody is a multispecific antibody, for example, at least a bispecific antibody.In certain embodiments, one of the binding specificities is for a first antigen, and the other is for a different second antigen.In certain embodiments, the multispecific antibody can bind to two different epitopes of the same antigen.The multispecific antibody may be used to localize a cytotoxic agent to a cell that expresses one or more antigens.

[0112] Multispecific antibodies can be prepared as full-length antibodies or antibody-antibody fragment-fusions.

[0113] Techniques for making multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy-light chain pairs with different specificities (see Milstein, C. and Cuello, A.C., Nature 305 (1983) 537-540, WO 93 / 08829, and Traunecker, A., et al., EMBO J. 10 (1991) 3655-3659) and "knobs-in-holes" engineering (see, e.g., U.S. Pat. No. 5,731,168). Multispecific antibodies can also be produced by manipulating electrostatic steering effects to create antibody Fc heterodimeric molecules (WO 2009 / 089004), cross-linking two or more antibodies or fragments (see, e.g., U.S. Pat. No. 4,676,980, and Brennan, M., et al., Science 229 (1985) 81-83), producing bispecific antibodies using leucine zippers (see, e.g., Kostelny, SA, et al., J. Immunol. 148 (1992) 1547-1553), using general light chain techniques to avoid light chain mispairing problems (see, e.g., WO 98 / 50431), using specific techniques to create bispecific antibody fragments (see, e.g., Holliger, P., et al., Proc. Natl. Acad. Sci. USA 90 (1993) 6444-6448), and for example, by the preparation of trispecific antibodies in Tutt, A., et al., J. Immunol. 147 (1991) 60-69.

[0114] Engineered antibodies with three or more antigen binding sites, including, for example, "Octopus antibodies," or DVD-Igs, are also included herein (see, for example, WO 2001 / 77342 and WO 2008 / 024715). Other examples of multispecific antibodies with three or more antigen binding sites can be found in WO 2010 / 115589, WO 2010 / 112193, WO 2010 / 136172, WO 2010 / 145792, and WO 2013 / 026831. Bispecific antibodies or antigen-binding fragments thereof also include "dual-acting Fabs" or "DAFs" (see, for example, U.S. Patent Application Publication Nos. 2008 / 0069820 and WO 2015 / 095539).

[0115] Multispecific antibodies can also be provided in an asymmetric manner with domain crossover, i.e. by exchanging VH / VL domains (see, e.g., WO 2009 / 080252 and WO 2015 / 150447), CH1 / CL domains (see, e.g., WO 2009 / 080253) or complete Fab arms (see, e.g., WO 2009 / 080251, WO 2016 / 016299, see also Schaefer et al., Proc. Natl. Acad. Sci. USA 108 (2011) 1187-1191, and Klein at al., MAbs 8 (2016) 1010-1020) in one or more binding arms of the same antigen specificity. In certain embodiments of all aspects and embodiments of the invention, the cells according to the invention express multispecific antibodies comprising Cross-Fab fragments. The term "Cross-Fab fragment" refers to a Fab fragment in which either the variable or constant regions of the heavy and light chains have been exchanged. A cross-Fab fragment comprises a polypeptide chain composed of a light chain variable region (VL) and a heavy chain constant region 1 (CH1), and a polypeptide chain composed of a heavy chain variable region (VH) and a light chain constant region (CL). Asymmetric Fab arms can also be engineered by introducing charged or uncharged amino acid mutations at the domain interface to direct the pairing of the correct Fab heavy chain fragment with the cognate light chain. See, for example, WO 2016 / 172485.

[0116] The antibody or fragment may also be a multispecific antibody as described in WO 2009 / 080254, WO 2010 / 112193, WO 2010 / 115589, WO 2010 / 136172, WO 2010 / 145792 or WO 2010 / 145793.

[0117] The antibody or fragment thereof may also be a multispecific antibody as disclosed in WO 2012 / 163520.

[0118] Various additional molecular formats of multispecific antibodies are known in the art and can be produced using the cells according to the invention (see, e.g., Spiess et al., Mol. Immunol. 67 (2015) 95-106).

[0119] Bispecific antibodies are generally antibody molecules that specifically bind to two different, non-overlapping epitopes on the same antigen or to two epitopes on different antigens.

[0120] In a preferred embodiment of all aspects and embodiments, the cell according to the invention expresses a composite (multispecific) antibody selected from the group of (composite) (multispecific) antibodies consisting of: Full-length antibodies with domain swapping (i.e., a multispecific IgG antibody comprising a first Fab fragment and a second Fab fragment, In the first Fab fragment, a) only the CH1 and CL domains are replaced by each other (i.e. the light chain of the first Fab fragment comprises the VL and CH1 domains and the heavy chain of the first Fab fragment comprises the VH and CL domains), b) only the VH and VL domains are replaced by each other (i.e. the light chain of the first Fab fragment comprises the VH and CL domains and the heavy chain of the first Fab fragment comprises the VL and CH1 domains), or c) the CH1 and CL domains are replaced by one another and the VH and VL domains are replaced by one another (i.e. the light chain of the first Fab fragment comprises the VH and CH1 domains and the heavy chain of the first Fab fragment comprises the VL and CL domains), and the second Fab fragment comprises a light chain comprising a VL domain and a CL domain, and a heavy chain comprising a VH domain and a CH1 domain; A full-length antibody having domain exchange can comprise a first heavy chain comprising a CH3 domain and a second heavy chain comprising a CH3 domain, both CH3 domains being engineered in a complementary manner by respective amino acid substitutions, e.g., as described in WO 96 / 27011, WO 98 / 050431, EP 1 870459, WO 2007 / 110205, WO 2007 / 147901, WO 2007 / 12022, WO 2007 / 110205, WO 2007 / 1202 ... (supporting heterodimerization of the first heavy chain and the modified second heavy chain as disclosed in WO 2009 / 089004, WO 2010 / 129304, WO 2011 / 90754, WO 2011 / 143545, WO 2012 / 058768, WO 2013 / 157954 or WO 2013 / 096291 (herein incorporated by reference); Full-length antibody with domain swapping and additional heavy chain C-terminal binding site (BS) (i.e., a multispecific IgG antibody comprising: a) a full-length antibody comprising two pairs each of a full-length antibody light chain and a full-length antibody heavy chain, wherein a binding site formed by each pair of full-length heavy chains specifically binds to a first antigen; and b) one additional Fab fragment fused to the C-terminus of one heavy chain of the full-length antibody, the binding site of the additional Fab fragment specifically binding to a second antigen; Additional Fab fragments that specifically bind to a second antigen i) contain a) a) a domain crossover such that the light chain variable domain (VL) and the heavy chain variable domain (VH) are replaced by each other, or b) a domain crossover such that the light chain constant domain (CL) and the heavy chain constant domain (CH1) are replaced by each other, or ii) are single chain Fab fragments), 1-Arm Single Chain Antibody (i.e., an antibody that comprises a first binding site that specifically binds to a first epitope or antigen, and a second binding site that specifically binds to a second epitope or antigen, whereby the individual chains are as follows: -Light chain (variable light domain + constant light kappa domain) -Light / heavy chain combination (variable light domain + light constant domain + peptide linker + variable heavy domain + CH1 + hinge + CH2 + CH3 with knob mutation) - heavy chain (variable heavy domain + CH1 + hinge + CH2 + CH3 with hole mutation), Two-arm single chain antibody (i.e., an antibody that comprises a first binding site that specifically binds to a first epitope or antigen, and a second binding site that specifically binds to a second epitope or antigen, whereby the individual chains are as follows: -Light / Heavy Chain 1 Combination (Variable Light Domain + Light Chain Constant Domain + Peptide Linker + Variable Heavy Domain + CH1 + Hinge + CH2 + CH3 with Hole Mutation) - light chain / heavy chain 2 combination (variable light domain + light chain constant domain + peptide linker + variable heavy domain + CH1 + hinge + CH2 + CH3 with knob mutation), Common light chain bispecific antibodies (i.e., an antibody that comprises a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, whereby the individual chains are -Light chain (variable light domain + constant light domain) -Heavy Chain 1 (VH domain + CH1 + hinge + CH2 + CH3 with hole mutation) - heavy chain 2 (variable heavy domain + CH1 + hinge + CH2 + CH3 with knob mutation), T cell bispecific antibody (TCB) (i.e., a full-length antibody with an additional heavy chain N-terminal binding site with domain swapping, a first Fab fragment and a second Fab fragment, the respective binding sites of which specifically bind to a first antigen, - a third Fab fragment, the binding site of which specifically binds to a second antigen, the third Fab fragment comprising a domain crossover such that the variable light domain (VL) and the variable heavy domain (VH) are interchangeable, and a full-length antibody comprising an Fc region, the Fc region comprising a first Fc region polypeptide and a second Fc region polypeptide; wherein the first Fab fragment and the second Fab fragment each comprise a heavy chain fragment and a full-length light chain; the C-terminus of the heavy chain fragment of the first Fab fragment is fused to the N-terminus of the first Fc region polypeptide; the C-terminus of the heavy chain fragment of the second Fab fragment is fused to the N-terminus of the variable light chain domain of a third Fab fragment, and the C-terminus of the CH1 domain of the third Fab fragment is fused to the N-terminus of a second Fc region polypeptide; Antibody-multimer fusion (i.e., a multimeric fusion protein comprising: (a) an antibody heavy chain and an antibody light chain, (b) a first fusion polypeptide comprising, from N-terminus to C-terminus, a first portion of a non-antibody multimeric polypeptide, an antibody heavy chain CH1 domain or an antibody light chain constant domain, an antibody hinge region, an antibody heavy chain CH2 domain, and an antibody heavy chain CH3 domain, and a second fusion polypeptide comprising, from N-terminus to C-terminus, a second portion of a non-antibody multimeric polypeptide, and an antibody light chain constant domain if the first polypeptide comprises an antibody heavy chain CH1 domain, or an antibody heavy chain CH1 domain if the first polypeptide comprises an antibody light chain constant domain; Where: (i) the antibody heavy chain of (a) and the first fusion polypeptide of (b), (ii) the antibody heavy chain of (a) and the antibody light chain of (a), and (iii) the first fusion polypeptide of (b) and the second fusion polypeptide of (b), are each independently covalently linked to each other by at least one disulfide bond; The variable domains of an antibody heavy chain and an antibody light chain form a binding site that specifically binds an antigen).

[0121] "Knobs-into-holes" dimerization modules and their use in antibody engineering are described in Carter P.; Ridgway JBB; Presta LG: Immunotechnology, Volume 2, Number 1, February 1996, pp. 73-73(1).

[0122] The CH3 domains of the heavy chains of the antibodies can be modified by the "knob-into-hole" technique, which is described in detail with some examples, for example, in WO 96 / 027011, Ridgway, JB, et al., Protein Eng. 9 (1996) 617-621, and Merchant, AM, et al., Nat. Biotechnol. 16 (1998) 677-681. In this method, the interaction surfaces of the two CH3 domains are modified to increase the heterodimerization of these two CH3 domains and thereby the heterodimerization of the polypeptides containing them. Each of the two CH3 domains (of the two heavy chains) can be a "knob", while the other is a "hole". Introduction of disulfide bridges further stabilizes the heterodimers (Merchant, AM, et al., Nature Biotech. 16 (1998) 677-681; Atwell, S., et al., J. Mol. Biol. 270 (1997) 26-35) and increases the yield.

[0123] The mutation T366W in the CH3 domain (of the antibody heavy chain) is designated as a "knob mutation" or "mutated knob", and the mutations T366S, L368A, Y407V in the CH3 domain (of the antibody heavy chain) are designated as "hole mutations" or "mutated hole" (numbering according to the EU index of Kabat). Additional interchain disulfide bridges between CH3 domains (Merchant, AM, et al., Nature Biotech. 16 (1998) 677-681) can also be used, for example, by introducing an S354C mutation in the CH3 domain of a heavy chain with a "knob mutation" (designated as "knob-cys-mutation" or "mutated knob-cys") and by introducing a Y349C mutation in the CH3 domain of a heavy chain with a "hole mutation" (designated as "hole-cys-mutation" or "mutated hole-cys") (numbering according to the EU index of Kabat).

[0124] The term "domain crossing" as used herein means that in a pair of an antibody heavy chain VH-CH1 fragment and its corresponding cognate antibody light chain, i.e., in the antibody Fab (fragment antigen binding), the domain sequence deviates from that of the native antibody in that at least one heavy chain domain is replaced by its corresponding light chain domain and vice versa. There are three general types of domain crossing: (i) crossing of a CH1 domain with a CL domain, where the domain crossing in the light chain results in a VL-CH1 domain sequence and in the heavy chain fragment results in a VH-CL domain sequence (or a full-length antibody heavy chain with a VH-CL-hinge-CH2-CH3 domain sequence); (ii) crossing of a VH domain with a VL domain, where the domain crossing in the light chain results in a VH-CL domain sequence and in the heavy chain fragment results in a VH-CL domain sequence (or a full-length antibody heavy chain with a VH-CL-hinge-CH2-CH3 domain sequence); and (iii) domain crossing between a complete light chain (VL-CL) and a complete VH-CH1 heavy chain fragment ("Fab crossing"), where the domain crossing results in a light chain with a VH-CH1 domain sequence and the domain crossing results in a heavy chain fragment with a VL-CL domain sequence (all domain sequences above are shown in the N-terminal to C-terminal direction).

[0125] As used herein, the term "replaced with each other" refers to the domain crossing described above with respect to corresponding heavy and light chain domains.Therefore, when CH1 domain and CL domain are "replaced with each other", this term refers to the domain crossing described under item (i) and the resulting heavy and light chain domain sequences.Therefore, when VH and VL are "replaced with each other", this term refers to the domain crossing described under item (ii), and when CH1 domain and CL domain are "replaced with each other", and when VH domain and VL domain are "replaced with each other", this term refers to the domain crossing described under item (iii). Bispecific antibodies that include cross-domains have been reported, for example, in WO 2009 / 080251, WO 2009 / 080252, WO 2009 / 080253, WO 2009 / 080254, and Schaefer, W., et al, Proc. Natl. Acad. Sci. USA 108 (2011) 11187-11192. Such antibodies are generally referred to as CrossMab.

[0126] In a preferred embodiment of all aspects and embodiments of the present invention, the cell according to the present invention expresses a multispecific antibody comprising at least one Fab fragment comprising either a domain crossover between CH1 and CL domains, or a domain crossover between VH and VL domains, or a domain crossover between VH-CH1 and VL-VL domains. In a multispecific antibody with domain crossover, the Fabs that specifically bind to the same antigen are constructed to have the same domain sequence. Therefore, when two or more Fabs with domain crossover are contained in a multispecific antibody, the Fabs specifically bind to the same antigen.

[0127] A "humanized" antibody refers to an antibody that comprises amino acid residues from non-human HVRs and amino acid residues from human FRs. In certain embodiments, a humanized antibody comprises substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non-human antibody and all or substantially all of the FRs correspond to those of a human antibody. A humanized antibody may optionally comprise at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of an antibody, e.g., a non-human antibody, refers to an antibody that has undergone humanization.

[0128] The term "recombinant antibody" as used herein means all antibodies (chimeric, humanized and human) prepared, expressed, generated or isolated by recombinant means, such as using cells according to the invention. This includes antibodies isolated from recombinant cells, such as NS0, HEK, BHK, amniotic cells, or CHO cells modified according to the invention.

[0129] As used herein, the term "antibody fragment" refers to a molecule other than an intact antibody that contains a portion of an intact antibody that binds to the same epitope of the same antigen that the intact antibody binds, i.e., it is a functional fragment. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2, bispecific Fab, diabody, linear antibody, single chain antibody molecule (e.g., scFv or scFab).

[0130] III. Recombinant Methods and Compositions In one aspect of the invention there is provided a method for producing a polypeptide or protein using a cell according to the invention, the method comprising culturing a cell according to the invention comprising one or more nucleic acids encoding the polypeptide or protein under conditions suitable for expression of the polypeptide or protein, recovering the polypeptide or protein from the cells (or cell culture medium) and, optionally, purifying the polypeptide or protein in one or more chromatography steps.

[0131] Antibodies can be produced using recombinant methods and compositions, for example, as described in U.S. Patent No. 4,816,567. These methods provide one or more isolated nucleic acids encoding the antibody.

[0132] In one aspect of the invention, there is provided a method of making an antibody, the method comprising culturing a cell according to the invention comprising one or more nucleic acids encoding the antibody under conditions suitable for expression of the antibody and, optionally, recovering the antibody from the cell (or cell culture medium).

[0133] For example, in recombinant production of a polypeptide or protein, such as an antibody, the nucleic acid encoding the polypeptide or protein is isolated and inserted into one or more vectors for further cloning and / or expression in a cell according to the invention. Such nucleic acids can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chains of the antibody), or can be produced by recombinant methods, or can be obtained by chemical synthesis.

[0134] Generally, for recombinant large-scale production of a polypeptide or protein of interest, such as a therapeutic antibody, cells that stably express and secrete the polypeptide or protein are required. These cells are called "recombinant cells" or "recombinant production cells" and the process used to generate such cells is called "cell line development".

[0135] In the first step of the cell line development process, suitable host cells, e.g., CHO cells, modified according to the present invention, are transfected with a suitable nucleic acid sequence for expression of the polypeptide or protein of interest. In the second step, cells stably expressing the polypeptide or protein of interest are selected based on co-expression of a selectable marker that has been co-transfected with the nucleic acid encoding the polypeptide or protein of interest.

[0136] The nucleic acid that codes for a polypeptide, i.e., the coding sequence, is called a structural gene. Such a structural gene is pure coding information. Therefore, additional regulatory elements are required for its expression. Therefore, the structural gene is usually incorporated into a so-called expression cassette. The minimum regulatory elements required for an expression cassette to be functional in a mammalian cell are a promoter that is functional in said mammalian cell, located upstream, i.e., on the 5' side, of the structural gene, and a polyadenylation signal sequence that is functional in said mammalian cell, located downstream, i.e., on the 3' side, of the structural gene. The promoter sequence, the structural gene sequence, and the polyadenylation signal sequence are arranged in an operably linked form.

[0137] If the polypeptide of interest is a heteromultimeric protein composed of different (monomeric) polypeptides, such as, for example, an antibody or a complex antibody format, not only a single expression cassette is required, but multiple expression cassettes differing from one another in the structural genes they contain, i.e. at least one expression cassette for each of the different (monomeric) polypeptides of the heteromultimeric protein.

[0138] For example, a full-length antibody is a heteromultimeric polypeptide that contains two copies of a light chain and two copies of a heavy chain. Thus, a full-length antibody is composed of two different polypeptides. Therefore, two expression cassettes are required for the expression of a full-length antibody, one for the light chain and one for the heavy chain. For example, if a full-length antibody is a bispecific antibody, i.e., if the antibody contains two different binding sites that specifically bind to two different antigens, the two light chains and the two heavy chains are also different from each other. Thus, such a bispecific full-length antibody is composed of four different polypeptides, and therefore four expression cassettes are required.

[0139] The expression cassette for the polypeptide or protein of interest is then incorporated into one or more so-called "expression vectors". An "expression vector" is a nucleic acid that provides all the elements required to amplify the vector in prokaryotic cells and to express the contained structural gene in mammalian cells. Typically, an expression vector contains a prokaryotic plasmid propagation unit, which contains, for example in the case of E. coli, an origin of replication and a prokaryotic selection marker, as well as a eukaryotic selection marker, and an expression cassette required for the expression of the structural gene of interest. An "expression vector" is a delivery vehicle for introducing an expression cassette into a modified mammalian cell according to the present invention.

[0140] As outlined in the previous paragraph, the more complex the polypeptide or protein of interest, the greater the number of different expression cassettes required. Essentially, the total size of the nucleic acid integrated into the genome of the host cell, i.e., the number of base pairs, increases with the number of expression cassettes. At the same time, the size of the expression vector also increases. However, the practical upper limit of the vector size is in the range of about 15 kbp, above which the efficiency of manipulation and processing decreases significantly. This problem can be addressed by using two or more expression vectors. Thereby, the expression cassette is divided between different expression vectors, each of which contains only a part of the expression cassette, resulting in a reduction in the size (number of bp) of each individual vector.

[0141] For example, cell line development (CLD) for generating recombinant cells expressing heterologous polypeptides or proteins, such as multispecific antibodies, employs either random integration (RI) or targeted integration (TI) of nucleic acids containing the respective expression cassettes required for the expression and production of the heterologous polypeptide or protein of interest.

[0142] Using RI, typically several vectors or fragments thereof are integrated into the genome of a cell at the same or different loci.

[0143] Using TI, typically a single copy of a transgene containing different expression cassettes is integrated into a defined "hot spot" in the host cell's genome.

[0144] Suitable host cells for the expression of (glycosylated) polypeptides or proteins are generally derived from multicellular organisms, such as, for example, vertebrates.

[0145] IV.Host cells Any mammalian cell can be modified according to the present invention. This application of the modification according to the present invention is independent of the cell, which is an adherent growing cell or a cell growing in suspension, and the integration method, i.e., RI and TI. Any mammalian cell can be used in the present invention.

[0146] Examples of mammalian cells that can be modified according to the present invention are human amniotic cells (e.g., CAP-T cells described in Woelfel, J. et al., BMC Proc. 5 (2011) p. 133), monkey kidney cells (CV1; monkey kidney CV1 cells transformed with SV40 (COS-7), human embryonic kidney cells (e.g., HEK293 cells or HEK293T cells described in Graham, F. et al., J. Gen Virol. 36 (1977) 59-74), baby hamster kidney cells (BHK), mouse Sertoli cells (e.g., TM4 cells described in Mather, JP, Biol. Reprod. 23 (1980) 243-252), African green monkey kidney cells (VERO-76), human cervical carcinoma cells (HELA), canine kidney cells (MDCK, Buffalo rat liver cells (BRL 3A), human lung cells (W138), human liver cells (HepG2), mouse mammary tumor cells (MMT060562), TRI cells (described, for example, in Mather, JP et al., Annals NYAcad. Sci. 383 (1982) 44-68), MRC5 cells, and FS4 cells.

[0147] Particularly useful mammals that can be modified according to the present invention include Chinese hamster ovary (CHO) cells, including DHFR-CHO cells ((Urlaub, G. et al., Proc. Natl. Acad. Sci. USA 77 (1980) 4216-4220), and myeloma cells, e.g., Y0, NS0 and Sp2 / 0. For a review of certain mammalian host cell lines suitable for antibody production, see, e.g., Yazaki, P. and Wu, A.M., Methods in Molecular Biology, Vol. 248, Lo, BKC (ed.), Humana Press, Totowa, NJ (2004), pp. 255-268.

[0148] In certain embodiments of all aspects and embodiments of the invention, the mammalian cell modified according to the invention or used in a method or use according to the invention is a Chinese Hamster Ovary (CHO) cell (e.g., CHO K1, CHO DG44, etc.), a human embryonic kidney (HEK) cell, a lymphoid cell (e.g., Y0, NS0, Sp2 / 0 cell) or a human amniotic cell (e.g., CAP-T, etc.). In one embodiment, the mammalian cell modified according to the invention or used in a method according to the invention is a CHO cell or a HEK cell.

[0149] In certain embodiments, the present invention relates to modified mammalian cells in which the expression of one or more endogenous products (e.g., host cell proteins) of unmodified mammalian cells (e.g., CHO cells) is reduced or eliminated. For example, but not limited to, methods for reducing or eliminating the expression of endogenous products in mammalian cells include: (1) modifying the gene encoding the endogenous product or its components, for example by introducing deletions, insertions, substitutions, or combinations thereof into the gene; (2) reducing or eliminating the transcription and / or stability of the mRNA encoding the endogenous product or its components; and (3) reducing or eliminating the translation of the mRNA encoding the endogenous product or its components. In a preferred embodiment, the reduction or elimination of protein expression is obtained by targeted genome editing. For example, CRISPR / Cas9-based genome editing can be used to modify one or more target genes, resulting in the reduction or elimination of the expression of the gene(s) targeted for editing.

[0150] In certain embodiments, one or more of the endogenous products of mammalian cells targeted for reduction or elimination of expression are selected based on their role in promoting apoptosis. Because apoptosis can reduce the viability and productivity of cultures, reducing or eliminating the expression of such proteins can have a positive effect on the viability and productivity of cultures. For example, but not limited to, mammalian cell proteins selected based on their role in promoting apoptosis are BCL2 Binding X, Apoptosis Regulator (BAX) or BCL2 Antagonist / Killer 1 (BAK). In certain embodiments, the mammalian cells of the present invention show reduced or eliminated expression of BAX. In certain embodiments, the mammalian cells of the present invention show reduced or eliminated expression of BAK. In certain embodiments, the mammalian cells of the present invention show reduced or eliminated expression of BAX and BAK.

[0151] In certain embodiments, the mammalian cell endogenous product targeted for reduction or elimination of expression is selected based on its role in promoting clumping and / or aggregation during cell culture. When mammalian cells are used for the production of a recombinant product of interest, such clumping and / or aggregation during cell culture may result in a reduction in product titer due to the adverse effect of clumping and / or aggregation on the viability of mammalian cells. For example, but not limited to, the mammalian cell endogenous product selected based on its role in promoting clumping and / or aggregation during cell culture is intercellular adhesion molecule 1 (ICAM-1). In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of ICAM-1.

[0152] In certain embodiments, one or more of the mammalian cell endogenous products targeted for reduction or elimination of expression are selected based on their role in promoting inefficient cell growth. Mammalian cells express many endogenous products that are not essential for cell growth, survival and / or productivity. Since the expression of these endogenous products consumes significant cellular energy and DNA / protein building blocks, reducing or eliminating the expression of such endogenous products can make cell growth more efficient and, in the case of cells used to produce a recombinant product of interest, can free up those cellular resources to achieve higher productivity of the recombinant product of interest. For example, but not limited to, the mammalian cell endogenous products selected based on their role in promoting efficient cell growth and higher productivity of the recombinant product of interest are BAX, BAK, ICAM-1, Sirtuin 1 (SIRT-1) or MYC proto-oncogene, BHLH transcription factor (MYC). In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of SIRT-1. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of SIRT-1 and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAK and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of ICAM-1 and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX and SIRT-1. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAK and SIRT-1. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of ICAM-1 and SIRT-1. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX, SIRT-1 and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAK, SIRT-1 and MYC.In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of ICAM-1, SIRT-1 and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX, BAK, SIRT-1 and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX, ICAM-1, SIRT-1 and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAK, ICAM-1, SIRT-1 and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX, BAK, MYC, SIRT-1 and ICAM.

[0153] In certain embodiments, the host cell of the present invention is modified to reduce or eliminate the expression of one or more host cell endogenous products, compared to the expression of the host cell endogenous products in unmodified or "reference" host cells. Such "reference" host cells have the same genotype as modified cells, except for the genes expressing the endogenous products. In certain embodiments, the reference host cell is a host cell in which the expression of one or more specific endogenous products, such as BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides, is not reduced or eliminated. In certain embodiments, the reference host cell is a cell that contains at least one or both wild-type alleles of the genes encoding BAX, BAK, ICAM-1, SIRT-1 and / or MYC. For example, but not limited to, the reference host cell is a host cell that has both wild-type alleles of the genes encoding BAX, BAK, ICAM-1, SIRT-1 and / or MYC. In certain embodiments, the reference host cell is a wild-type (WT) host cell. In certain embodiments, the modification that reduces or eliminates expression of one or more endogenous products of the host cell is performed prior to introduction of an exogenous nucleic acid encoding a recombinant product of interest. In certain embodiments, the modification that reduces or eliminates expression of one or more endogenous products of the host cell is performed after introduction of an exogenous nucleic acid encoding a recombinant product of interest.

[0154] In certain embodiments, expression of one or more endogenous products, e.g., a BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptide, in a cell that has been modified to reduce or eliminate expression of the endogenous product is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell. In certain embodiments, expression of one or more endogenous products in a cell that has been modified to reduce or eliminate expression of the endogenous product is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell.

[0155] In certain embodiments, expression of one or more endogenous products, e.g., a BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptide, in a host cell modified to reduce or eliminate expression of the endogenous product is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2% or at least about 1% of the expression of the corresponding endogenous product in a reference host cell, e.g., a WT host cell. In certain embodiments, expression of one or more endogenous products in a host cell that has been engineered to reduce or eliminate expression of the endogenous product is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2%, or at least about 1% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT mammalian cell.

[0156] In certain embodiments, the expression of one or more particular endogenous products, such as BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides, in cells modified to reduce or eliminate expression of the endogenous products is about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, about 10% or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, or about 1% or less of the expression of the corresponding endogenous products in a reference host cell, such as a WT host cell. In certain embodiments, the expression of one or more endogenous products, such as BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides, in cells modified to reduce or eliminate expression of the endogenous products is about 40% or less of the expression of the corresponding endogenous products in a reference cell, such as a WT mammalian cell. In certain embodiments, expression of one or more endogenous products in a cell that has been modified to reduce or eliminate expression of the endogenous product is about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, about 10% or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, or about 1% or less of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell.

[0157] In certain embodiments, expression of one or more endogenous products, e.g., BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides, in a cell modified to reduce or eliminate expression of the endogenous product is between about 1% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 35% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell. 0%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 80% to about 90%, about 85% to about 90%, about 1% to about 80%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 60% to about 80%, about 70% to about 80%, about 75% to about 80%, about 1% to about 70%, about 10% to about 70%, about 20% ~ about 70%, about 30% to about 70%, about 40% to about 70%, about 50 to about 70%, about 60 to about 70%, about 65 to about 70%, about 1 to about 60%, about 10 to about 60%, about 20 to about 60%, about 30 to about 60%, about 40 to about 60%, about 50% to about 60%, about 55% to about 60%, about 1% to about 50%, about 10% to about 50%, about 20% to about 50%, about 30% to about 50%, about 40% to about 50%, about 45% to about 50% , about 1% to about 40%, about 10% to about 40%, about 20% to about 40%, about 30% to about 40%, about 35% to about 40%, about 1% to about 30%, about 10% to about 30%, about 20% to about 30%, about 25% to about 30%, about 1% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 1% to about 10%, about 5% to about 10%, about 5% to about 20%, about 5% to about 30%, and about 5% to about 40%.In certain embodiments, expression of one or more endogenous products, e.g., BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides, in a cell modified to reduce or eliminate expression of the endogenous product is between about 1% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 35% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell. 0%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 80% to about 90%, about 85% to about 90%, about 1% to about 80%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 60% to about 80%, about 70% to about 80%, about 75% to about 80%, about 1% to about 70%, about 10% to about 70%, about 20% ~ about 70%, about 30% to about 70%, about 40% to about 70%, about 50 to about 70%, about 60 to about 70%, about 65 to about 70%, about 1 to about 60%, about 10 to about 60%, about 20 to about 60%, about 30 to about 60%, about 40 to about 60%, about 50% to about 60%, about 55% to about 60%, about 1% to about 50%, about 10% to about 50%, about 20% to about 50%, about 30% to about 50%, about 40% to about 50%, about 45% to about 50% , about 1% to about 40%, about 10% to about 40%, about 20% to about 40%, about 30% to about 40%, about 35% to about 40%, about 1% to about 30%, about 10% to about 30%, about 20% to about 30%, about 25% to about 30%, about 1% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 1% to about 10%, about 5% to about 10%, about 5% to about 20%, about 5% to about 30%, and about 5% to about 40%.

[0158] In certain embodiments, expression of one or more endogenous products, e.g., a BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptide, in a cell modified to reduce or eliminate expression of the endogenous product is about 5% to about 40% of the expression of the corresponding endogenous product in a reference cell, e.g., a WT host cell.

[0159] In certain embodiments, the expression levels of one or more endogenous products, e.g., BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides, in various reference cells (e.g., cells that contain at least one or both wild-type alleles of the corresponding genes) may vary.

[0160] In certain embodiments, a genetic engineering system is used to reduce or eliminate the expression of one or more specific endogenous products (e.g., the expression of BAX, BAK, ICAM-1, SIRT-1 and / or MYC). A variety of genetic engineering systems known in the art can be used for the methods disclosed herein. Non-limiting examples of such systems include the use of CRISPR / Cas systems, zinc finger nuclease (ZFN) systems, transcription activator-like effector nuclease (TALEN) systems, and other tools for reducing or eliminating protein expression by gene silencing, such as small interfering RNA (siRNA), short hairpin RNA (shRNA) and microRNA (miRNA). Any CRISPR / Cas system known in the art, including conventional, enhanced or modified Cas systems, and other bacterial-based genome excision tools, such as Cpf-1, can be used with the methods disclosed herein.

[0161] In certain embodiments, a portion of one or more genes, such as genes encoding endogenous products such as BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides, is deleted to reduce or eliminate the expression of the corresponding endogenous products in the host cell. In certain embodiments, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% or at least about 90% of the genes are deleted. In certain embodiments, about 2% or less, about 5% or less, about 10% or less, about 15% or less, about 20% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, about 45% or less, about 50% or less, about 55% or less, about 60% or less, about 65% or less, about 70% or less, about 75% or less, about 80% or less, about 85% or less, or about 90% or less of the genes are deleted.In certain embodiments, about 2% to about 90%, about 10% to about 90%, about 20% to about 90%, about 25% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 80% to about 90%, about 85% to about 90%, about 2% to about 80%, about 10% to about 80%, about 20% to 80%, 30% to 80%, 40% to 80%, 50% to 80%, 60% to 80%, 70% to 80%, 75% to 80%, 2% to 70%, 10% to 70%, 20% to 70%, 30% to 70%, 40% to 70%, 50% to 70%, 60% to 70%, 65% to 70%, 0%, approx. 2% to approx. 60%, approx. 10% to approx. 60%, approx. 20% to approx. 60%, approx. 30% to approx. 60%, approx. 40% to approx. 60%, approx. 50% to approx. 60%, approx. 55% to approx. 60%, approx. 2% to approx. 50%, approx. 10% to approx. 50%, approx. 20% to approx. 50%, approx. 30% to approx. 50%, approx. 40% to approx. 50%, approx. 45% to approx. 50%, approx. 2% to approx. 40%, approx. 10% to About 40%, about 20% to about 40%, about 30% to about 40%, about 35% to about 40%, about 2% to about 30%, about 10% to about 30%, about 20% to about 30%, about 25% to about 30%, about 2% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 2% to about 10%, about 5% to about 10%, or about 2% to about 5% is deleted.

[0162] In certain embodiments, at least one exon of the genes encoding BAX, BAK, ICAM-1, SIRT-1, and / or MYC polypeptides is at least partially deleted in the host cell."Partially deleted" as used herein refers to, for example, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, Approx. 2% or less, approx. 5% or less, approx. 10% or less, approx. 15% or less, approx. 20% or less, approx. 25% or less, approx. 30% or less, approx. 35% or less, approx. 40% or less, approx. 85% or less, approximately 90% or less, approximately 95% or less, approximately 2% to approximately 90%, approximately 10% to approximately 90%, approximately 20% to approximately 90%, approximately 25% to approximately 90%, approximately 30% to approximately 90%, approximately 40% to approximately 90%, approximately 50% to approximately 90%, approximately 60% to approximately 90%, approximately 70% to approximately 90%, approximately 80% to approximately 90% , about 85% to about 90%, about 2% to about 80%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, about 60% to about 80%, about 70% to about 80%, about 75% to about 80%, about 2% to about 70%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, about 50% to about 70%, about 60% to about 70%, about 65% to about 70%, about 2% to about 60%, about 10% to about 60%, about 20% to about 60%, about 30% to about 60%, about 40% to about 60%, about 50% to about 60 %, about 55% to about 60%, about 2% to about 50%, about 10% to about 50%, about 20% to about 50%, about 30% to about 50%, about 40% to about 50%, about 45% to about 50%, about 2% to about 40%, about 10% to about 40%, about 20% to about 40%, about 30% to about 40%, about 35% to about 40%, about 2% to about 30%, about 10% to about 30%, about 20% to about 30%, about 25% to about 30%, about 2% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, about 2% to about 10%, about 5% to about 10%, or about 2% to about 5% is deleted.

[0163] In a preferred, non-limiting embodiment, the CRISPR / Cas9 system is used to reduce or eliminate the expression of one or more endogenous products in a host cell, such as BAX, BAK, ICAM-1, SIRT-1, and / or MYC polypeptides. The clustered regularly interspaced short palindromic repeats (CRISPR) system is a genome editing tool found in prokaryotic cells. When used for genome editing, the system includes Cas9 (a protein that can modify DNA using crRNA as a guide), CRISPR RNA (crRNA, which contains RNA to guide crRNA to the correct part of host DNA, along with a region that is used by Cas9 and binds to tracrRNA (which is generally in the form of a hairpin loop) that forms an active complex with Cas9), and transactivation crRNA (tracrRNA, which binds to crRNA and forms an active complex with Cas9). The terms "guide RNA" and "gRNA" refer to any nucleic acid that facilitates the specific association (or "targeting") of an RNA-guided nuclease, such as Cas9, to a target sequence, such as a genomic or episomal sequence in a cell. gRNAs can be unimolecular (comprising a single RNA molecule, alternatively called a chimera) or modular (comprising two or more, typically two, separate RNA molecules, such as crRNA and tracrRNA, that are usually associated with each other, e.g., by duplexing).

[0164] In the CRISPR / Cas9 strategy, vectors can be used to transfect mammalian cells. Guide RNA (gRNA) can be designed for each application, as it is the sequence that uses Cas9 to identify and directly bind to target DNA in mammalian cells. Multiple crRNAs and tracrRNAs can be packaged together to form single-stranded guide RNA (sgRNA). The sgRNA can be spliced ​​with the Cas9 gene and incorporated into a vector for transfection into mammalian cells.

[0165] In certain embodiments, the CRISPR / Cas9 system for use in reducing or eliminating the expression of one or more endogenous products, such as BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides, comprises a Cas9 molecule and one or more gRNAs that comprise a targeting domain that is complementary to the target sequence of the gene that codes for the endogenous product or its components.In certain embodiments, the target gene is the region of the gene that codes for the endogenous product, such as BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptide.The target sequence can be any exon or intron region within the gene.

[0166] In certain embodiments, the gRNA is administered to the mammalian cell in a single vector, and the Cas9 molecule is administered to the host cell in a second vector. In certain embodiments, the gRNA and the Cas9 molecule are administered to the host cell in a single vector. Alternatively, each of the gRNA and the Cas9 molecule can be administered by a separate vector. In certain embodiments, the CRISPR / Cas9 system can be delivered to the host cell as a ribonucleoprotein complex (RNP) that includes the Cas9 protein complexed with one or more gRNAs, for example, by electroporation (see, for example, DeWitt et al., Methods 121-122:9-15 (2017) for additional methods of delivering RNPs to cells). In certain embodiments, administration of the CRISPR / Cas9 system to the host cell reduces or eliminates the expression of endogenous products, for example, BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides.

[0167] In certain embodiments, the genetic engineering system is a ZFN system for reducing or eliminating the expression of one or more specific endogenous products in mammalian cells, such as BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides. ZFNs can act as restriction enzymes, which are generated by combining zinc finger DNA binding domains with DNA cleavage domains. Zinc finger domains can be engineered to target specific DNA sequences, allowing zinc finger nucleases to target desired sequences within the genome. The DNA binding domain of each ZFN typically contains multiple individual zinc finger repeats, each capable of recognizing multiple base pairs. The most common method for creating new zinc finger domains is to combine small zinc finger "modules" with known specificity. The most common cleavage domain in ZFNs is the non-specific cleavage domain derived from the type II restriction endonuclease FokI. ZFNs modulate protein expression by creating double-stranded breaks (DSBs) within target DNA sequences, which are repaired by non-homologous end joining (NHEJ) in the absence of a homologous template. Such repair can result in base pair deletions or insertions, resulting in a frameshift and preventing the production of harmful proteins (Durai et al., Nucleic Acids Res.; 33(18):5978-90(2005)). Multiple pairs of ZFNs can also be used to completely remove entire large segments of genomic sequences (Lee et al., Genome Res.; 20(1):81-9(2010)).

[0168] In certain embodiments, the genetic engineering system is a TALEN system to reduce or eliminate the expression of one or more specific endogenous products in mammalian cells, such as BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides. TALENs are restriction enzymes that can be engineered to cleave specific sequences in DNA. TALEN systems operate on a principle similar to ZFNs. TALENs are generated by combining a transcription activator-like effector DNA binding domain with a DNA cleavage domain. Transcription activator-like effectors (TALEs) are composed of a repeating motif of 33-34 amino acids with two variable positions that strongly recognize specific nucleotides. By assembling an array of these TALEs, the TALE DNA binding domain can be engineered to bind to a desired DNA sequence, thereby guiding a nuclease to cleave at a specific location in the genome (Boch et al., Nature Biotechnology; 29(2):135-6 (2011)). In certain embodiments, the target genes encode BAX, BAK, ICAM-1, SIRT-1 and / or MYC.

[0169] In certain embodiments, the expression of one or more specific endogenous products, such as BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptides, can be reduced or eliminated using oligonucleotides having complementary sequences to corresponding nucleic acids (e.g., mRNA).Non-limiting examples of such oligonucleotides include small interfering RNA (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA).In certain embodiments, such oligonucleotides can be homologous to at least a portion of BAX, BAK, ICAM-1, SIRT-1 and / or MYC polypeptide nucleic acid sequences, and the homology of the portion to the corresponding nucleic acid sequence is at least about 75, or at least about 80, or at least about 85, or at least about 90, or at least about 95, or at least about 98 percent. In certain non-limiting embodiments, the complementary portion can comprise at least 10 nucleotides, or at least 15 nucleotides, or at least 20 nucleotides, or at least 25 nucleotides, or at least 30 nucleotides, and the antisense nucleic acid, shRNA, mRNA, or siRNA molecule can be up to 15, or up to 20, or up to 25, or up to 30, or up to 35, or up to 40, or up to 45, or up to 50, or up to 75, or up to 100 nucleotides in length. The antisense nucleic acid, shRNA, mRNA, or siRNA molecule can comprise DNA or atypical or non-naturally occurring residues, such as, but not limited to, phosphorothioate residues.

[0170] The genetic engineering system disclosed herein can be delivered to mammalian cells using viral vectors, such as retroviral vectors, such as gamma retroviral vectors, and lentiviral vectors. If the capsid protein is functional to infect human cells, a combination of a retroviral vector and a suitable packaging line is suitable. A variety of amphotropic virus-producing cell lines are known, including, but not limited to, PA12 (Miller, et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller, et al. (1986) Mol. Cell. Biol. 6:2895-2902); and CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464). Non-amphotropic particles, such as those pseudotyped with VSVG, RD114 or GALV envelopes and any other known in the art, are also suitable. Possible methods of transduction include direct co-culture of the cells with producer cells, e.g., by the method of Bregni, et al. (1992) Blood 80:1418-1422, or culture with viral supernatant alone or concentrated vector stocks, with or without appropriate growth factors and polycations, e.g., by the method of Xu, et al. (1994) Exp. Hemat. 22:223-230; and Hughes, et al. (1992) J. Clin. Invest. 89:1817.

[0171] Other transducing viral vectors can be used to modify the mammalian cells disclosed herein. In certain embodiments, the selected vector shows high infection efficiency and stable integration and expression (see, for example, Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). Other viral vectors that can be used include, for example, adenovirus, lentivirus, and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus, or herpes viruses, such as Epstein-Barr virus (see, e.g., Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; LeGal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995).Retroviral vectors in particular have been developed and used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Patent No. 5,399,346).

[0172] Non-viral approaches can also be used for the genetic engineering of mammalian cells as disclosed herein. For example, administration of nucleic acids in the presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), asialoorosomucoid-polylysine conjugation (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989) or microinjection under surgical conditions (Wolff et al., Science Nucleic acid molecules can be introduced into mammalian cells by ELISA (247:1465,1990). Other non-viral means for gene transfer include in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Polyethylenimine (PEI)-based non-viral gene delivery systems (Ferri et al., Polymers (Basel). 2021 Oct;13(19):3307) can also find use in connection with the compositions and methods of the present invention. Liposomes can also be potentially beneficial for delivering nucleic acid molecules into mammalian cells. Transplantation of normal genes into diseased tissues of a subject can also be accomplished by transferring normal nucleic acids into a culturable cell type ex vivo (e.g., autologous or heterologous primary cells or their progeny) and then injecting the cells (or their progeny) into the target tissue or systemically.

[0173] V. Targeted Integration Targeted integration (TI) allows the integration of an exogenous nucleotide sequence into a defined site in the genome of a mammalian cell.

[0174] In certain embodiments, the use of TI host cells for the introduction of exogenous nucleic acids encoding a recombinant product of interest results in robust and stable cell culture performance and reduces the risk of sequence variants in the resulting recombinant product of interest. TI host cells, and strategies for their use, are described in detail in U.S. Patent Application Publication No. 2021 / 0002669, the entire contents of which are incorporated by reference.

[0175] In certain embodiments using targeted integration, exogenous nucleotide sequence is integrated into the genome of TI host cell at a site in a specific locus.In certain embodiments, the locus into which exogenous nucleotide sequence is integrated is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to the sequence selected from Contigs NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1.

[0176] In certain embodiments, the nucleotide sequence immediately 5' of the integrated exogenous sequence is selected from the group consisting of nucleotides 41190-45269 of NW_006874047.1, nucleotides 63590-207911 of NW_006884592.1, nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1, or nucleotides 82214-97705 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments, the nucleotide sequence immediately 5' to the integrated exogenous sequence is selected from the group consisting of nucleotides 41190-45269 of NW_006874047.1, nucleotides 63590-207911 of NW_006884592.1, nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_00361506 3.1, nucleotides 2650443-2662054 of NW_006882936.1, or nucleotides 82214-97705 of NW_003615411.1.

[0177] In certain embodiments, the nucleotide sequence immediately 3' to the integrated exogenous sequence is selected from the group consisting of nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, nucleotides 491910-667813 of NW_006881296.1, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, or nucleotides 97706-105117 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments, the nucleotide sequence immediately 3' to the integrated exogenous sequence is selected from the group consisting of nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, nucleotides 491910-667813 of NW_006881296.1, nucleotides 79769-100059 of NW_003616412.1, nucleotides 79769-100059 of NW_00361506 nucleotides 315266-362442 of NW_006882936.1, nucleotides 2662055-2701768 of NW_006882936.1, or nucleotides 97706-105117 of NW_003615411.1.

[0178] In certain embodiments, the integrated exogenous sequence is flanked 5' by a nucleotide sequence selected from the group consisting of nucleotides 41190-45269 of NW_006874047.1, nucleotides 63590-207911 of NW_006884592.1, nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1, and nucleotides 82214-97705 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments, the integrated exogenous sequence is flanked 3' by a nucleotide sequence selected from the group consisting of nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, nucleotides 491910-667813 of NW_006881296.1, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, and nucleotides 97706-105117 of NW_003615411.1, and sequences at least 50% homologous thereto.In certain embodiments, the nucleotide sequence flanking the 5' side of the integrated exogenous nucleotide sequence is selected from the group consisting of nucleotides 41190-45269 of NW_006874047.1, nucleotides 63590-207911 of NW_006884592.1, nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_003616412.1, and nucleotides 70111-70112 of NW_003616412.1. NW_006882936.1; and nucleotides 82214-97705 of NW_003615411.1. In certain embodiments, the nucleotide sequence adjacent to the 3' side of the integrated exogenous nucleotide sequence is selected from the group consisting of nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, nucleotides 491910-667813 of NW_006881296.1, nucleotides 79769-100059 of NW_003616412.1, and nucleotides 80111-80157 of NW_003616412.1. NW_003615411.1.

[0179] In certain embodiments, the integrated exogenous nucleotide sequence is operably linked to a nucleotide sequence selected from the group consisting of Contigs NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1, and sequences that are at least 50% homologous thereto. In certain embodiments, the nucleotide sequence operably linked to the exogenous nucleotide sequence is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to a sequence selected from Contigs NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1.

[0180] In targeted integration, site-specific recombination is used to introduce exogenous nucleic acid at a specific locus in the genome of a mammalian TI host cell. It is an enzymatic process in which the sequence of the integration site in the genome is exchanged with the exogenous nucleic acid. One system used to perform such a nucleic acid exchange is the Cre-lox system. The enzyme that catalyzes the exchange is Cre recombinase. The sequence to be exchanged is defined by the location of two lox(P) sites in the genome as well as in the exogenous nucleic acid. These lox(P) sites are recognized by Cre recombinase. Nothing more is required, i.e. no ATP etc. The Cre-lox system was originally discovered in bacteriophage P1.

[0181] In certain embodiments of all aspects and embodiments of the invention, the cells modified according to the invention have been subjected to targeted integration of a nucleic acid encoding a polypeptide or protein of interest prior to modification according to the invention.

[0182] In certain embodiments of all aspects and embodiments of the invention, the cells modified according to the invention have been subjected to targeted integration of a nucleic acid encoding a polypeptide or protein of interest after modification according to the invention.

[0183] In certain embodiments of all aspects and embodiments of the invention, targeted integration is mediated by a recombinase that recognizes one or more recombination recognition sequences (RRS) present within the genome of the mammalian cell and within the exogenous nucleotide sequence to be integrated into the genome of the mammalian cell.

[0184] In certain embodiments of all aspects and embodiments of the invention, targeted integration is mediated by homologous recombination.

[0185] A "recombination recognition sequence" (RRS) is a nucleotide sequence that is recognized by a recombinase and is necessary and sufficient for a recombinase-mediated recombination event. An RRS can be used to define the location at which a recombination event occurs within a nucleotide sequence.

[0186] In certain embodiments of all aspects and embodiments of the invention, the RRS is recognized by Cre recombinase.

[0187] In certain embodiments of all aspects and embodiments of the invention, the RRS is a LoxP site and Cre recombinase mediates targeted integration by recombination.

[0188] In certain embodiments of all aspects and embodiments of the invention, the RRS is recognized by an FLP recombinase.

[0189] In certain embodiments of all aspects and embodiments of the invention, the RRS is an FRT site and the FLP recombinase mediates targeted integration by recombination.

[0190] In certain embodiments of all aspects and embodiments of the invention, the RRS is recognized by Bxb1 integrase.

[0191] In certain embodiments of all aspects and embodiments of the invention, the RRS is a Bxb1 attP or Bxb1 attB site, and Bxb1 integrase mediates targeted integration by recombination.

[0192] In certain embodiments of all aspects and embodiments of the invention, the RRS is recognized by φC31 integrase.

[0193] In certain embodiments of all aspects and embodiments of the invention, the RRS is a φC31 attP or φC31 attB site, and φC31 integrase mediates targeted integration by recombination.

[0194] The recombinase can be introduced into the cell using an expression vector containing the coding sequence for the enzyme, or as a protein or mRNA.

[0195] For TI, any known or future mammalian cell, including those modified according to the present invention, that contains a landing site described herein integrated at a single site within a genomic locus may be used in the present invention. Such cells are referred to as mammalian TI host cells.

[0196] In certain embodiments of all aspects and embodiments of the invention, the mammalian TI host cell is a hamster cell, a human cell, a rat cell, or a mouse cell that comprises a landing site described herein. In a preferred embodiment, the mammalian TI host cell is a CHO cell. In certain embodiments, the mammalian TI host cell is a CHO K1 cell, a CHO K1SV cell, a CHO DG44 cell, a CHO DUKXB-11 cell, a CHO K1S cell, or a CHO K1M cell that comprises a landing site described herein integrated at a single site within a genomic locus.

[0197] In certain embodiments of all aspects and embodiments of the present invention, the mammalian TI host cell comprises an integrated landing site, the landing site comprising one or more recombination recognition sequences (RRS). The RRS can be recognized by a recombinase, for example, Cre recombinase, FLP recombinase, Bxb1 integrase, or φC31 integrase. The one or more RRS can be selected, independently of each other, from the group consisting of LoxP sequence, LoxP L3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, φC31 attP sequence, and φC31 attB sequence. If multiple RRSs must be present, the selection of each sequence is dependent on the other, to the extent that non-identical RRSs are selected.

[0198] In certain embodiments of all aspects and embodiments of the present invention, the landing site comprises one or more recombination recognition sequences (RRS), and the RRS can be recognized by a recombinase. In certain embodiments, the integrated landing site comprises at least two RRSs. In certain embodiments, the integrated landing site comprises three RRSs, and the third RRS is located between the first RRS and the second RRS. In certain preferred embodiments, all three RSSs are different. In certain embodiments, the landing site comprises a first RRS, a second RRS, and a third RRS, and at least one selection marker located between the first RRS and the second RRS, and the third RRS is different from the first RRS and / or the second RRS. In certain embodiments, the landing site further comprises a second selection marker, and the first and second selection markers are different. In certain embodiments, the landing site further comprises a third selection marker and an internal ribosome entry site (IRES), the IRES being operably linked to the third selection marker. The third selection marker can be different from the first or second selection marker.

[0199] An exemplary mammalian TI host cell suitable for modification according to the invention and for use in the methods according to the invention is a CHO cell carrying a landing site integrated at a single site within a locus in its genome, the landing site containing three heterospecific loxP sites for Cre recombinase-mediated DNA recombination.

[0200] In this example, the heterospecific loxP sites are L3 (SEQ ID NO: 01), LoxFas (SEQ ID NO: 03), and 2L (SEQ ID NO: 02) (see, e.g., Lanza et al., Biotechnol. J. 7 (2012) 898-908; Wong et al., Nucleic Acids Res. 33 (2005) e147), whereby L3 and 2L are adjacent to the 5' and 3' ends of the landing site, respectively, and LoxFas is located between the L3 and 2L sites. The landing site further contains a bicistronic unit that couples the expression of an IRES-mediated selection marker to the expression of a fluorescent GFP protein, allowing for stabilization of the landing site by positive selection, as well as selection for the absence of the site after transfection and Cre recombination (negative selection). The green fluorescent protein (GFP) serves to monitor the RMCE reaction.

[0201] This construction of the landing site as outlined in the previous paragraph allows the simultaneous integration of two vectors, for example the so-called front vector carrying L3 and LoxFas sites and back vector carrying LoxFas and 2L sites.The functional elements of the selection marker gene that are different from those present in the landing site can be distributed between both vectors, and the promoter and start codon can be located on the front vector, whereas the coding region and polyA signal are located on the back vector.Only the correct recombinase-mediated integration of the nucleic acid from both vectors induces resistance to the respective selection agents.

[0202] Generally, a mammalian TI host cell is a mammalian cell that comprises a landing site that integrates at a single site within a locus of the genome of the mammalian cell, the landing site comprising a first recombination recognition sequence and a second recombination recognition sequence adjacent to at least a first selectable marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and wherein the recombination recognition sequences are all different.

[0203] The selection marker may be selected from the group consisting of aminoglycoside phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, zeocin, and mycophenolic acid. Alternatively, the selection marker may be a fluorescent protein selected from the group consisting of green fluorescent protein (GFP), enhanced GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), enhanced YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald6, CyPet, mCFPm, Cerulean, and T-Sapphire.

[0204] An exogenous nucleotide sequence is a nucleotide sequence that does not originate from a particular cell, but can be introduced into the cell by a DNA delivery method, such as transfection, electroporation, or transformation. In certain embodiments, the mammalian TI host cell comprises at least one landing site that is integrated into one or more integration sites in the genome of the mammalian cell. In certain embodiments, the landing site is integrated into one or more integration sites in a specific locus of the genome of the mammalian cell.

[0205] In certain embodiments of all aspects and embodiments according to the present invention, the integrated landing site comprises at least one selection marker. In certain embodiments, the integrated landing site comprises a first RRS, a second RRS and a third RRS, and at least one selection marker. In certain embodiments, the selection marker is located between the first RRS and the second RRS. In certain embodiments, the two RRSs are adjacent to at least one selection marker, i.e., the first RRS is located 5' (upstream) of the selection marker, and the second RRS is located 3' (downstream) of the selection marker. In certain embodiments, the first RRS is adjacent to the 5' end of the selection marker, and the second RRS is adjacent to the 3' end of the selection marker. In certain embodiments, the landing site comprises a first RRS, a second RRS and a third RRS, and at least one selection marker is located between the first RRS and the third RRS.

[0206] In certain embodiments of all aspects and embodiments of the present invention, the selection marker is located between the first RRS and the second RRS, and the two adjacent RRSs are different. In certain preferred embodiments, the first adjacent RRS is a LoxP L3 sequence, and the second adjacent RRS is a LoxP 2L sequence. In certain embodiments, the LoxP L3 sequence is located 5' to the selection marker, and the LoxP 2L sequence is located 3' to the selection marker. In certain embodiments, the first adjacent RRS is a wild-type FRT sequence, and the second adjacent RRS is a mutant FRT sequence. In certain embodiments, the first adjacent RRS is a Bxb1 attP sequence, and the second adjacent RRS is a Bxb1 attB sequence.

[0207] In certain embodiments, the first adjacent RRS is a φC31 attP sequence, and the second adjacent RRS is a φC31 attB sequence. In certain embodiments, the two RRSs are arranged in the same direction. In certain embodiments, the two RRSs are both oriented in the forward or reverse direction. In certain embodiments, the two RRSs are arranged in opposite directions.

[0208] In certain embodiments of all aspects and embodiments according to the invention, the integrated landing site comprises a first and a second selection marker flanked by two RRSs, the first selection marker being different from the second selection marker. In certain embodiments, both of the two selection markers, independently of each other, are selected from the group consisting of a glutamine synthetase selection marker, a thymidine kinase selection marker, a HYG selection marker, and a puromycin resistance selection marker. In certain embodiments, the integrated landing site comprises a thymidine kinase selection marker and a HYG selection marker. In certain embodiments, the first selection marker is an aminoglycosyl phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin, and G418). APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, zeocin, and mycophenolic acid, and the second selection marker is selected from the group consisting of GFP, eGFP, synthetic GFP, YFP, eYFP, CFP, mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean, and T-Sapphire fluorescent protein. In certain embodiments, the first selection marker is a glutamine synthetase selection marker and the second selection marker is a GFP fluorescent protein, hi certain embodiments, the two RRSs flanking both selection markers are different.

[0209] In certain embodiments, the selection marker is operably linked to a promoter sequence. In certain embodiments, the selection marker is operably linked to an SV40 promoter. In certain embodiments, the selection marker is operably linked to a human cytomegalovirus (CMV) promoter.

[0210] The Cre-lox system operates in a variety of cell types, including mammalian, plant, bacterial, and yeast.

[0211] In certain embodiments of all aspects and embodiments according to the invention, exogenous nucleic acids encoding heterologous polypeptides or proteins are integrated into mammalian TI host cells by single or double recombinase-mediated cassette exchange (RMCE), resulting in recombinant mammalian cells, such as recombinant CHO cells, in which a defined specific expression cassette sequence is integrated into the genome at a single locus, which in turn results in efficient expression and production of the heterologous polypeptide.

[0212] The Cre-LoxP site-specific recombination system is widely used in many biological experimental systems. Cre recombinase is a 38 kDa site-specific DNA recombinase that recognizes 34 bp LoxP sequences. Cre recombinase is derived from bacteriophage P1 and belongs to the tyrosine family of site-specific recombinases. Cre recombinase can mediate both intra- and intermolecular recombination between LoxP sequences. The LoxP sequence consists of an 8 bp non-palindromic core region flanked by two 13 bp inverted repeats. Cre recombinase binds to the 13 bp repeats, thereby mediating recombination within the 8 bp core region. Cre-LoxP-mediated recombination occurs with high efficiency and does not require any other host factors. When two LoxP sequences are arranged in the same orientation on the same nucleotide sequence, Cre recombinase-mediated recombination results in the DNA sequence located between the two LoxP sequences being excised as a covalently closed circle. If two LoxP sequences are located in opposite orientations on the same nucleotide sequence, Cre recombinase-mediated recombination will invert the orientation of the DNA sequence located between the two sequences. If two LoxP sequences are on two different DNA molecules and one DNA molecule is circular, Cre recombinase-mediated recombination will result in the integration of the circular DNA sequence.

[0213] The term "matched RRS" indicates that recombination occurs between two RRSs. In certain embodiments, the two matched RRSs are the same. In certain embodiments, both RRSs are wild-type LoxP sequences. In certain embodiments, both RRSs are mutant LoxP sequences. In certain embodiments, both RRSs are wild-type FRT sequences. In certain embodiments, both RRSs are mutant FRT sequences. In certain embodiments, the two matched RRSs are different sequences but can be recognized by the same recombinase. In certain embodiments, the first matched RRS is a Bxb1 attP sequence and the second matched RRS is a Bxb1 attB sequence. In certain embodiments, the first matched RRS is a φC31 attB sequence and the second matched RRS is a φC31 attB sequence.

[0214] A "two-plasmid RMCE" strategy or "double RMCE" is used in the method according to the present invention when using a combination of two vectors. For example, but not limited to, the integrated landing site may comprise three RRSs, such as an arrangement in which a third RRS ("RRS3") is present between a first RRS ("RRS1") and a second RRS ("RRS2"), while the first vector comprises two RRSs that match the first and third RRSs on the integrated exogenous nucleotide sequence, and the second vector comprises two RRSs that match the third and second RRSs on the integrated exogenous nucleotide sequence.

[0215] The two-plasmid RMCE strategy involves performing two independent RMCE simultaneously using three RRS sites. Thus, the landing site of a mammalian TI host cell using the two-plasmid RMCE strategy contains a third RRS site (RRS3) that has no cross activity towards either the first RRS site (RRS1) or the second RRS site (RRS2). The two plasmids to be targeted require the same flanking RRS sites for efficient targeting, with one plasmid (front) flanked by RRS1 and RRS3 and the other (back) flanked by RRS3 and RRS2. Furthermore, in two-plasmid RMCE, two selectable markers are also required. One selectable marker expression cassette was split into two parts. The front plasmid contains a promoter followed by a start codon and an RRS3 sequence. The back plasmid lacks a start codon (ATG) and has the RRS3 sequence fused to the N-terminus of the selectable marker coding region. To ensure in-frame translation of the fusion protein, i.e., operative linkage, it may be necessary to insert additional nucleotides between the RRS3 site and the selection marker sequence. Only when both plasmids are correctly inserted will the complete expression cassette of the selection marker be assembled, thus conferring resistance to the respective selection agent to the cells.

[0216] Two-plasmid RMCE involves a recombinase-catalyzed double recombination crossover event between two heterospecific RRSs in a target genomic locus and a donor DNA molecule. Two-plasmid RMCE is designed to introduce copies of the combined DNA sequences from the front and back vectors into a predetermined locus of the mammalian TI host cell genome. RMCE can be performed such that no sequences of the prokaryotic vector are introduced into the mammalian TI host cell genome, thus reducing and / or preventing unwanted triggering of the host's immune or defense mechanisms. The RMCE procedure can be repeated with multiple DNA sequences.

[0217] In certain embodiments of all aspects and embodiments according to the present invention, the targeted integration is achieved by two rounds of RMCE, where two different DNA sequences each contain at least one expression cassette encoding a portion of a heteromultimeric polypeptide and / or at least one selection marker or part thereof flanked by two heterospecific RRSs, and both are integrated into a predetermined site in the genome of the corresponding RRS of the mammalian TI host cell. In certain embodiments, the targeted integration is achieved by multiple rounds of RMCE, where DNA sequences from multiple vectors each contain at least one expression cassette encoding a portion of a heteromultimeric polypeptide and / or at least one selection marker or part thereof flanked by two heterospecific RRSs, and all are integrated into a predetermined site in the genome of the mammalian TI host cell. In certain embodiments, the selection marker may be partially encoded in a first vector and partially encoded in a second vector, such that expression of the selection marker is possible only if both are correctly integrated by double RMCE.

[0218] It should be pointed out that in certain embodiments, reduction or elimination of expression, e.g. by knockout, can be performed in a stably transfected clone or a pool of stably transfected clones before, as well as after, the introduction of an exogenous nucleic acid encoding a heterologous polypeptide or protein.

[0219] VI. Compositions and Methods According to the Invention The present invention is based, at least in part, on the discovery that by reducing or eliminating the expression of one or more of the BAK, BAX, ICAM-1, SIRT-1 and MYC genes, the properties of mammalian cells for the recombinant production of heterologous polypeptides and proteins can be improved. One of the improved properties is, inter alia, increased volumetric productivity compared to mammalian cells that have not been modified according to the present invention.

[0220] Without being bound by this theory, it is believed that by reducing or eliminating expression of the BAX and BAK genes, apoptosis resistance can be improved, by reducing or eliminating expression of the ICAM-1 gene, cell clumping in culture can be reduced, by reducing or eliminating expression of the SIRT-1 gene, productivity can be improved, and by reducing or eliminating expression of the MYC-1 gene, cell volume can be increased, thereby increasing cell-based volumetric productivity. These effects are maintained by combining the reduction or elimination of expression of one or more or all of these genes.

[0221] The reduction or elimination of expression according to the present invention is not limited to a particular mammalian cell, it can be applied to any cell, such as CHO cells, HEK cells, CAP cells or BHK cells.

[0222] The present subject matter is exemplified below with CHO cells and CRISPR / Cas genetic modification, which is presented only to illustrate the present subject matter and should not be construed as limiting in any way.

[0223] In a preferred embodiment, CRISPR / Cas9 technology is used to reduce or eliminate the expression of BAK, BAX, ICAM-1, SIRT-1 and MYC genes.Similarly, any other technology such as zinc finger nuclease or TALENS can be used, and RNA silencing such as siRNA / shRNA / miRNA can be used to reduce or eliminate the mRNA level of BAK, BAX, ICAM-1, SIRT-1 and MYC genes, resulting in the reduction or elimination of the transcriptional activity / expression of BAK, BAX, ICAM-1, SIRT-1 and MYC genes.

[0224] CRISPR / Cas9 can be used to target each gene at one, two, three or more different sites. For example, but not limited to, multiplexed ribonucleoprotein delivery can be used to simultaneously use three different gRNAs to target three different sites in the coding sequence. In certain embodiments, multiplexed ribonucleoprotein delivery shows higher gene editing efficiency and specificity compared to common plasmid-based CRISPR-Cas9 editing. In certain embodiments, double-stranded breaks at gene target sites induce indel formation. In certain embodiments, when multiple sites are targeted, for example due to multiplexed gRNA use, deletion of sequences between target sites, such as intervening exons, results in frameshift of the coding sequence (CDS) of the target protein. Sequencing of PCR-amplified loci in modified cell pools obtained according to the present invention revealed interruption of the sequencing reaction at the first gRNA site, indicating successful targeting to each gene.

[0225] In certain embodiments, sequencing of the PCR amplified loci in the modified cell pool reveals an interruption of the sequencing reaction at the first gRNA site, indicating successful gene targeting. In certain embodiments, the cell pool comprises modifications in all target genes of at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool. In certain embodiments, the cell pool contains modifications in four of the five target genes in at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool. In certain embodiments, the cell pool contains modifications in three of the five target genes in at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool.In certain embodiments, the cell pool contains modifications in two of the five target genes in at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool. In certain embodiments, the cell pool contains modifications in one of the five target genes in at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool.

[0226] In a fed-batch process, productivity increases of over 40% were observed for engineered cells in which expression of the BAK, BAX, SIRT-1 and MYC genes was reduced or eliminated.

[0227] In a fed-batch process, productivity increases of over 40% were observed for engineered cells in which expression of the BAK, BAX, SIRT-1, ICAM-1 and MYC genes was reduced or eliminated.

[0228] This effect has been observed at the cell pool or clone level for expression of antibodies of different binding specificities and different formats compared to unmodified cell pools or clones (data shown in the tables below for 10 and 14 days of fed-batch culture, respectively). Control and modified cells have the same genotype except for the further reduction or elimination of expression of the identified genes, i.e., the modifications have been introduced into cells stably expressing the respective antibodies.

[0229] TIFF2025513335000002.tif175147

[0230] Without being bound by this theory, it is hypothesized that a homozygous knockout has a beneficial effect on increasing productivity over a heterozygous knockout.

[0231] The present invention is based, at least in part, on the finding that the effect of the combination of modifications according to the invention is more pronounced at culture times greater than 10 days, as shown in Figure 1 for cells expressing mAb-A and in Figure 2 for cells expressing mAb-B.

[0232] Thus, engineered cells in which expression of the BAK, BAX, SIRT-1, MYC and ICAM-1 genes is reduced or eliminated exhibit no growth defect and have increased bioprocess viability and increased volumetric productivity.

[0233] The increase in volumetric productivity is based on the fact that an increase in average cell diameter of 1-2 μm results in a 15%-45% increase in volume, which is exemplarily shown in Figure 3 for cells expressing mAb-B.

[0234] Summary of culture results mAb-A=antibody-multimer-fusion mAb-B = antibody with heavy chain C-terminal cytokine fusion mAb-C=T cell bispecific antibody mAb-D = T cell bispecific antibody with different binding specificity than mAb-C mAb-E = full length antibody with domain exchange mAb-F = full length antibody with domain swapping and additional heavy chain C-terminal binding site mAb-G = full-length antibody with domain swapping and an additional heavy chain C-terminal binding site; different binding specificity than mAb-F

[0235] TIFF2025513335000003.tif132154TIFF2025513335000004.tif214154TIFF2025513335000005.tif216154 TIFF2025513335000006.tif226154TIFF2025513335000007.tif217154TIFF2025513335000008.tif216154 TIFF2025513335000009.tif228154TIFF2025513335000010.tif218154TIFF2025513335000011.tif228154 TIFF2025513335000012.tif224154TIFF2025513335000013.tif213154TIFF2025513335000014.tif209154

[0236] The following figures, sequences and examples are provided to aid the understanding of the present invention, the true scope of which is set forth in the appended claims. It is understood that modifications can be made in the procedures set forth without departing from the spirit of the invention. [Brief description of the drawings]

[0237] [Figure 1] Time-dependent titer of expression of mAb-A in different cell lines: (1)=BAX / BAK knockout; (2)=ICAM-1 knockout; (3)=control, no knockout; (4)=MYC knockout; (5)=BAX / BAK / ICAM-1 / MYC / SIRT-1 knockout; (6)=SIRT-1 knockout. [Diagram 2] Time-dependent titer of expression of mAb-B in different cell lines: (1)=BAX / BAK knockout; (2)=ICAM-1 knockout; (3)=control, no knockout; (4)=MYC knockout; (5)=BAX / BAK / ICAM-1 / MYC / SIRT-1 knockout; (6)=SIRT-1 knockout. [Diagram 3]Increase in mean cell diameter versus culture time for cells expressing mAb-B: (1)=control, no knockout; (2)=MYC knockout; (3)=BAX / BAK / ICAM-1 / MYC / SIRT-1 knockout.

[0238] Array Description All gRNA sequences contain only the genome targeting sequence of the gRNA.

[0239] SEQ ID NO: 01: Exemplary sequence of an L3 recombinase recognition sequence: AAGTCTCC

[0240] SEQ ID NO: 02: Exemplary sequence of 2L recombinase recognition sequence: GCATACAT

[0241] SEQ ID NO: 03: Exemplary sequence of a LoxFas recombinase recognition sequence: TACCTTTC

[0242] SEQ ID NOs: 04-06: Exemplary variants of the human CMV promoter SEQ ID NO:04: TIFF2025513335000015.tif105128 SEQ ID NO:05: TIFF2025513335000016.tif118128 SEQ ID NO:06: TIFF2025513335000017.tif35128TIFF2025513335000018.tif232107TIFF2025513335000019.tif92128

[0243] SEQ ID NO: 07: An exemplary SV40 polyadenylation signal sequence: TIFF2025513335000020.tif23128

[0244] SEQ ID NO: 08: An exemplary bGH polyadenylation signal sequence: TIFF2025513335000021.tif35128

[0245] SEQ ID NO: 09: Exemplary hGT terminator sequence: TIFF2025513335000022.tif10128

[0246] SEQ ID NO: 10: Exemplary SV40 promoter sequence: TIFF2025513335000023.tif48128

[0247] SEQ ID NO:11: An exemplary GFP nucleic acid sequence: TIFF2025513335000024.tif137128

[0248] SEQ ID NOs: 12 to 14: SIRT-1 guide RNA SEQ ID NO: 12: gRNA_SIRT1_1: TATCATCCAACTCAGGTGGA SEQ ID NO: 13: gRNA_SIRT1_2: GCAGCATCTCATGATTGGCA SEQ ID NO: 14: gRNA_SIRT1_3: GCATTCTTGAAGTAACTTCA

[0249] SEQ ID NOs: 15-16: SIRT-1 PCR primers SEQ ID NO: 15: SIRT1_for:ATGGCAGTTTTAGACACC SEQ ID NO: 16: SIRT1_rev: CTTGGAACTCAGACAAGG

[0250] SEQ ID NOs: 17 to 19: MYC guide RNA SEQ ID NO: 17: gRNA_MYC_1: CTATGACCTCGACTACGACT SEQ ID NO: 18: gRNA_MYC_2: GGACGCAGCGACCGTCACAT SEQ ID NO: 19: gRNA_MYC_3: CACCATCTCCAGCTGATCCG

[0251] SEQ ID NOs: 20-21: MYC PCR primers SEQ ID NO: 20: MYC_for: CACACACACACTTGGAAG SEQ ID NO: 21: MYC_rev: CTTGATGAAGGTCTCGTC

[0252] SEQ ID NOs: 22-23 and 36-37: ICAM-1 guide RNA SEQ ID NO: 22: gRNA_ICAM1_1: ACCTGCATGGATGCACCCCG SEQ ID NO: 23: gRNA_ICAM1_2: GCACCGTGCCCACCTCCAGG SEQ ID NO: 36: gRNA_ICAM1_3: TAACCGCCAGAGAAAGATC SEQ ID NO: 37: gRNA_ICAM1_4: ACCTGCATGGATGCACCCCG

[0253] SEQ ID NOs: 24-25: ICAM-1 PCR primers SEQ ID NO: 24: ICAM1_for:CCAAGCTAGATGATGTGAG SEQ ID NO: 25: ICAM1_rev: GCCCTACCCTTTTAATAC

[0254] SEQ ID NOs: 26 to 28 and 38 to 39: BAK guide RNA SEQ ID NO: 26: gRNA_BAK_1: TACAGCATCTTGGGTCAGGT SEQ ID NO: 27: gRNA_BAK_2: GTCCATCTCGGGGTTGGCAG SEQ ID NO: 28: gRNA_BAK_3: AATCTGGTGAAGAGTTCGT SEQ ID NO: 38: gRNA_BAK_4: TCATCACAGTCCTGCCTAGG SEQ ID NO: 39: gRNA_BAK_5: ATGGCGTCTGGACAAGGACC

[0255] SEQ ID NOs: 29-30: BAK PCR primers SEQ ID NO: 29: BAK_for: CGTATCTGAGTTCACGAAC SEQ ID NO: 30: BAK_rev: CCATCAGGAACAAGAGAC

[0256] SEQ ID NOs: 31 to 33 and 40 to 41: BAX guide RNA SEQ ID NO: 31: gRNA_BAX_1: ACAGGGGCCTTTTTGCTACA SEQ ID NO: 32: gRNA_BAX_2: GCTCATCTCCAATTCGCCTG SEQ ID NO: 33: gRNA_BAX_3: ACGAGAGGTCTTCTTCCGTG SEQ ID NO: 40: gRNA_BAX_4: GGGTCGGGGGAGCAGCTCGG SEQ ID NO: 41: gRNA_BAX_5: GGGTCCCGAAGTATGAGAGG

[0257] SEQ ID NOs: 34-35: BAX PCR primers SEQ ID NO: 34: BAX_for:ATCTTGTCTCCCTCGTAG SEQ ID NO: 35: BAX_rev:TCCTGGACTTCTCTAACC EXAMPLES

[0258] Example 1 general technique 1) Recombinant DNA techniques DNA was manipulated using standard methods as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1989). Molecular biological reagents were used according to the manufacturer's instructions.

[0259] 2) Determination of DNA sequence DNA sequencing was performed at SequiServe GmbH (Vaterstetten, Germany) or Eurofins Genomics GmbH (Ebersberg, Germany) or Microsynth AG (Balgach, Switzerland).

[0260] 3) DNA and protein sequence analysis and sequence data management The EMBOSS (European Molecular Biology Open Software Suite) software package and Geneious prime 2021 (Auckland, New Zealand) were used for sequence creation, mapping, analysis, annotation, and illustration.

[0261] 4) Synthesis of genes and oligonucleotides The desired gene segments were prepared by chemical synthesis at Geneart GmbH (Regensburg, Germany) or Twist Bioscience (San Francisco, USA). The synthesized gene fragments were cloned into E. coli plasmids for propagation / amplification. The DNA sequences of the subcloned gene fragments were confirmed by DNA sequencing. Alternatively, short synthetic DNA fragments were assembled by annealing chemically synthesized oligonucleotides or by PCR. The respective oligonucleotides were prepared by metabion GmbH (Planegg-Martinsried, Germany).

[0262] 5) Reagents Unless otherwise stated, all commercially available chemicals, antibodies, and kits were used as provided according to the manufacturer's protocols.

[0263] 6) Cultivation of TI host cell lines TI CHO host cells were cultured at 37 °C in a humidified incubator with 85% humidity and 5% CO2. They were cultured in a proprietary DMEM / F12-based medium containing 300 μg / ml hygromycin B and 4 μg / ml of a second selection marker. Cells were cultured every 3 or 4 days at 0.3 × 10 6The cells were divided into a total volume of 30 ml at a concentration of 10 cells / ml. For the culture, 125 ml non-baffled Erlenmeyer flasks were used. The cells were shaken at 150 rpm with a shaking amplitude of 5 cm. The cell number was determined using a Cedex HiRes Cell Counter (Roche). The culture was continued until the cells reached 60 days of age.

[0264] 7) Cloning a) General: Cloning at the R site depends on the DNA sequence next to the gene of interest (GOI), which is equal to the sequence in the next fragment. Thus, assembly of the fragments is possible by overlapping of equal sequences followed by sealing of the nicks in the assembled DNA with DNA ligase. Therefore, cloning of a single gene, specifically a spare vector containing an appropriate R site, is necessary. After successful cloning of these spare vectors, the gene of interest flanked by the R sites is excised via restriction digestion with an enzyme that cuts immediately next to the R site. The final step is to assemble all DNA fragments in one step. More specifically, a 5'-exonuclease removes the 5' end of the overlapping region (R site). Annealing of the R site can then be performed and DNA polymerase extends the 3' end to fill the gap in the sequence. Finally, DNA ligase seals the nicks between the nucleotides. The single fragments are assembled into one plasmid by adding an assembly master mix containing different enzymes such as exonuclease, DNA polymerase and ligase, and then incubating the reaction mix at 50° C. Competent E. coli cells are then transformed with the plasmid.

[0265] For some vectors, a restriction enzyme-mediated cloning strategy was used. By choosing a suitable restriction enzyme, the desired gene of interest can be excised and then inserted into a different vector by ligation. Therefore, it is preferable to use an enzyme that cuts at a multiple cloning site (MCS) and selected in a smart way to ensure that ligation of the fragments in the correct array can be performed. If the vector and the fragment have been previously cut with the same restriction enzyme, the sticky ends of the fragment and the vector will be perfectly compatible and can then be ligated with DNA ligase. After ligation, competent E. coli cells are transformed with the newly generated plasmid.

[0266] b) Cloning by restriction digestion: For digestion of the plasmid with restriction enzymes, the following components were pipetted together on ice:

[0267] Table: Restriction digestion reaction mix TIFF2025513335000025.tif30128

[0268] When more enzyme was used per digest, 1 μl of each enzyme was used, adjusting the volume by adding more or less PCR-grade water. All enzymes were selected with the prerequisite that they were qualified for use in CutSmart buffer from New England Biolabs (100% activity) and at the same incubation temperature (all at 37°C).

[0269] Incubation was performed using a thermomixer or thermal cycler, allowing the samples to incubate at a constant temperature (37°C). Samples were not stirred during incubation. The incubation time was set to 60 min. Samples were then mixed directly with loading dye and loaded onto agarose electrophoresis gels or stored at 4°C / on ice for further use.

[0270] A 1% agarose gel was prepared for gel electrophoresis. For that, 1.5 g of all-purpose agarose was weighed into a 125 Erlenmeyer flask and filled with 150 ml of TAE buffer. The mixture was heated in a microwave oven until the agarose was completely dissolved. 0.5 μg / ml of ethidium bromide was added to the agarose solution. The gel was then poured into a mold. After the agarose had solidified, the mold was placed into the electrophoresis chamber and the chamber was filled with TAE buffer. The sample was then loaded. In the first pocket (from the left), the appropriate DNA molecular weight marker was loaded, followed by the sample. The gel was run at <130 V for approximately 60 min. After electrophoresis, the gel was removed from the chamber and analyzed on a UV-Imager.

[0271] The target band was excised and transferred to a 1.5 ml Eppendorf tube. Gel purification was performed using Qiagen's QIAquick Gel Extraction Kit according to the manufacturer's instructions. DNA fragments were stored at -20°C for further use.

[0272] The fragments for ligation were pipetted together in a vector to insert molar ratio of 1:2, 1:3, or 1:5 depending on the length of the insert and vector fragments and their relationship to each other. If the fragment that needed to be inserted into the vector was short, a ratio of 1:5 was used. The longer the insert, the lesser the amount of insert used in relationship to the vector. A vector amount of 50 ng was used for each ligation, and the specific insert amount was calculated with the NEBioCalculator. For the ligations, the T4 DNA Ligation Kit from NEB was used. An example of a ligation mixture is shown in the table below.

[0273] Table: Ligation reaction mix TIFF2025513335000026.tif40131

[0274] All components were pipetted together on ice, starting with mixing the DNA and water, adding the buffer, and finally the enzyme. The reaction was gently mixed by pipetting up and down, microcentrifuged briefly, and then incubated at room temperature for 10 minutes. After incubation, the T4 ligase was heat inactivated at 65°C for 10 minutes. The samples were cooled on ice. In the final step, 10 beta-competent E. coli cells were transformed with 2 μl of the ligated plasmid (see below).

[0275] c) Cloning by R site assembly: For assembly, all DNA fragments with R sites at both ends were pipetted together on ice. When more than four fragments were assembled, equimolar ratios of all fragments (0.05ng) ​​were used as recommended by the manufacturer. One half of the reaction mix was performed with NEBuilder HiFi DNA Assembly Master Mix. The total reaction volume was 40μl, which was reached by filling with PCR-grade clean water. An exemplary pipetting scheme is shown in the table below.

[0276] Table: Assembly reaction mix TIFF2025513335000027.tif61133

[0277] After setting up the reaction mixture, the tubes were incubated in a thermocycler for 60 minutes at 50° C. After successful assembly, 10 beta-competent E. coli was transformed with 2 μl of the assembled plasmid DNA (see below).

[0278] d) Transform 10 beta-competent E. coli cells: For transformation, 10 beta-competent E. coli cells were thawed on ice. Then, 2 μl of plasmid DNA was pipetted directly into the cell suspension. The tube was flicked and placed on ice for 30 min. The cells were then placed in a 42 °C warm thermal block and heat shocked for exactly 30 s. Immediately afterwards, the cells were cooled on ice for 2 min. 950 μl of NEB10-beta growth medium was added to the cell suspension. The cells were incubated at 37 °C for 1 h with shaking. Then, 50–100 μl was pipetted onto pre-warmed (37 °C) LB-Amp agar plates and spread with a disposable spatula. The plates were incubated overnight at 37 °C. Only bacteria that have successfully integrated the plasmid and carry a resistance gene to ampicillin are able to grow on these plates. The next day, single colonies were picked and cultured in LB-Amp medium for subsequent plasmid preparation.

[0279] e) Bacterial culture: The E. coli culture was performed in LB medium, short for Luria Bertani, and 1 ml / L of 100 mg / ml ampicillin was added to give an ampicillin concentration of 0.1 mg / ml. For the different plasmid preparations, the following volumes were inoculated with a single bacterial colony:

[0280] Table: E. coli culture volumes TIFF2025513335000028.tif26131

[0281] For Mini-Prep, 96-well 2 ml deep-well plates were filled with 1.5 ml of LB-Amp medium per well. Colonies were picked by pressing a toothpick into the medium. Once all colonies were picked, the plate was closed with an adhesive air-porous membrane. The plate was incubated in a 37 °C incubator with a shaking speed of 200 rpm for 23 hours.

[0282] For Mini-Prep, 15 ml tubes (with ventilated lids) were filled with 3.6 ml of LB-Amp medium and inoculated evenly with bacterial colonies. The toothpicks were not removed but left in the tubes during incubation. Similar to the 96-well plates, the tubes were incubated at 37°C and 200 rpm for 23 hours.

[0283] For Maxi-Prep, 200 ml of LB-Amp medium was filled into an autoclaved glass 1 L Erlenmeyer flask and inoculated with 1 ml of a 1-day culture of bacteria that was approximately 5 hours old. The Erlenmeyer flask was closed with a paper stopper and incubated at 37 °C and 200 rpm for 16 hours.

[0284] f) Plasmid preparation: For Mini-Prep, 50 μl of bacterial suspension was transferred to a 1 ml deep-well plate. The bacterial cells were then centrifuged in the plate at 3000 rpm for 5 min at 4° C. The supernatant was removed and the plate with the bacterial pellet was placed in an EpMotion. After approximately 90 min, the procedure was performed and the eluted plasmid DNA could be removed from the EpMotion for further use.

[0285] For Mini-Prep, the 15 ml tube was removed from the incubator and 3.6 ml of bacterial culture was divided into two 2 ml Eppendorf tubes. The tubes were centrifuged at 6,800 × g in a tabletop microcentrifuge for 3 min at room temperature. Mini-Prep was then performed using the Qiagen QIAprep Spin Miniprep Kit according to the manufacturer's instructions. Plasmid DNA concentration was measured by Nanodrop.

[0286] Maxi-Prep was performed using the Macherey-Nagel NucleoBond® Xtra Maxi EF Kit according to the manufacturer's instructions. DNA concentration was measured with a Nanodrop.

[0287] g) Ethanol Precipitation: The volume of DNA solution was mixed with 2.5 volumes of ethanol 100%. This mixture was incubated at -20°C for 10 minutes. The DNA was then centrifuged at 14,000 rpm for 30 minutes at 4°C. The supernatant was carefully removed and the pellet was washed with 70% ethanol. The tube was centrifuged again at 14,000 rpm for 5 minutes at 4°C. The supernatant was carefully removed by pipetting and the pellet was dried. Once the ethanol had evaporated, an appropriate amount of endotoxin-free water was added. The DNA was allowed to redissolve in water overnight at 4°C. A small aliquot was taken and the DNA concentration was measured with a Nanodrop device.

[0288] Example 2 Generation of plasmids Composition of the expression cassette For expression of the antibody chains, transcription units containing the following functional elements were used: the immediate early enhancer and promoter from human cytomegalovirus, including intron A; - human heavy chain immunoglobulin 5' untranslated region (5'UTR), - mouse immunoglobulin heavy chain signal sequence, - nucleic acids encoding each antibody chain, - the bovine growth hormone polyadenylation sequence (BGH pA), and - Optionally, the human gastrin terminator (hGT).

[0289] In addition to the expression unit / cassette containing the desired gene to be expressed, a basic / standard mammalian expression plasmid contains the following: - the origin of replication from the vector pUC18 allowing replication of this plasmid in E. coli, and -The beta-lactamase gene that confers ampicillin resistance to E. coli.

[0290] Front and back vector cloning To construct the two plasmid antibody constructs, the antibody HC and LC fragments were cloned into a front vector backbone containing L3 and LoxFas sequences, and a back vector containing LoxFas and 2L sequences and a Pac selection marker. The Cre recombinase plasmid pOG231 (Wong, ET, et al., Nucl. Acids Res. 33 (2005) e147; O'Gorman, S., et al., Proc. Natl. Acad. Sci. USA 94 (1997) 14602-14607) was used for all RMCE processes.

[0291] cDNAs encoding each antibody chain were generated by gene synthesis (Geneart, Life Technologies Inc.). Gene synthesis and backbone vectors were digested with HindIII-HF and EcoRI-HF (NEB) for 1 h at 37°C and separated by agarose gel electrophoresis. Insert and backbone DNA fragments were excised from the agarose gel and extracted by QIAquick Gel Extraction Kit (Qiagen). The purified insert and backbone fragments were ligated at a 3:1 insert / backbone ratio by Rapid Ligation Kit (Roche) according to the manufacturer's protocol. The ligation approach was then transformed into competent E. coli DH5α by heat shock at 42°C for 30 s and incubated at 37°C for 1 h before plating on agar plates containing ampicillin for selection. Plates were incubated at 37°C overnight.

[0292] The next day, clones were picked and incubated overnight at 37°C with shaking for mini- or maxiprep, performed using an EpMotion® 5075 (Eppendorf) or using a QIAprep Spin Mini-Prep Kit (Qiagen) / NucleoBond Xtra Maxi EF Kit (Macherey & Nagel), respectively. All constructs were sequenced to ensure the absence of any unwanted mutations (SequiServe GmbH).

[0293] In the second cloning step, the precloned vector was digested with KpnI-HF / SalI-HF and SalI-HF / MfeI-HF using the same conditions as for the first cloning. The TI backbone vector was digested with KpnI-HF and MfeI-HF. Isolation and extraction were performed as described above. Ligation of the purified insert and backbone was performed at 4° C. overnight with a 1:1:1 insert / insert / backbone ratio using T4 DNA ligase (NEB) according to the manufacturer's protocol and inactivated at 65° C. for 10 min. Subsequent cloning steps were performed as described above.

[0294] The cloned plasmids were used for TI transfection and pool generation.

[0295] Example 3 Culture, transfection, selection and single cell cloning TI host cells were grown in a proprietary DMEM / F12-based medium in disposable 125 ml vented shake flasks under standard humidified conditions (95% rH, 37°C, and 5% CO2) with a constant agitation speed of 150 rpm. Every 3-4 days, cells were transferred to synthetic medium containing effective concentrations of selection marker 1 and selection marker 2 at 3 × 10 5 Cells were seeded at a concentration of 1000 cells / ml. Culture density and viability were measured with a Cedex HiRes cell counter (F. Hoffmann-La Roche Ltd, Basel, Switzerland).

[0296] For stable transfection, equimolar amounts of front and back vectors were mixed. The total DNA used per transfection was 30 μg with a plasmid ratio of 2.5:2.5:1 (front-, back-, Cre plasmid).

[0297] Two days before transfection, TI host cells were cultured at 4 × 10 5 The cells were seeded in fresh medium at a density of 3 × 10 cells / ml. Transfection was performed using a MaxCyte STX electroporation device (MaxCyte Inc., Gaithersburg) with an OC-400 electroporation cassette according to the manufacturer's protocol. 7 Cells were transfected with a total of 30 μg of nucleic acid, either 30 μg of plasmid (2.5:2.5:1 molar ratio of front:back:Cre plasmid) or 5 μg of Cre mRNA and 25 μg of front and back vector mix. After transfection, cells were seeded in 30 ml of medium without selection agent.

[0298] Five days after seeding, the cells were centrifuged and diluted to 6 x 10 for selection of recombinant cells. 5 The cells were transferred to 80 mL of synthetic medium containing puromycin (selection agent 1) and 1-(2'-deoxy-2'-fluoro-1-beta-D-arabinofuranosyl-5-iodo)uracil (FIAU; selection agent 2) at an effective concentration of 100 cells / ml. The cells were incubated at 37°C, 150 rpm, 5% CO2, and 85% humidity from this day on, and were not split. The cell density and viability of the cultures were monitored regularly. If the viability of the cultures began to increase again, the concentrations of selection agents 1 and 2 were reduced to approximately half of the amounts used previously.

[0299] More specifically, to facilitate cell recovery, the viability must be greater than 40% and the viable cell density (VCD) must be less than 0.5×10 6 The selection pressure was reduced when the concentration was higher than 4 × 10 cells / mL.5 The cells / ml were centrifuged and resuspended in 40 ml of Selection Medium II (synthetic medium, 1 / 2 selection markers 1 and 2). The cells were incubated in the same conditions as before and were also not split.

[0300] Successful Cre-mediated cassette exchange was confirmed by flow cytometry measuring the expression of intracellular GFP and extracellular heterologous polypeptides bound to the cell surface 10 days after the start of selection. APC antibodies (allophycocyanin-labeled F(ab')2 fragment goat anti-human IgG) against the light and heavy chains of human antibodies were used for FACS staining. Flow cytometry was performed using a BD FACS Canto II flow cytometer (BD, Heidelberg, Germany). Ten thousand events were measured per sample. Live cells were gated on a plot of forward scatter (FSC) against side scatter (SSC). A live cell gate was defined by untransfected TI host cells and was applied to all samples using FlowJo 10.8.1 EN software (TreeStar, Olten, Switzerland). GFP fluorescence was quantified in the FITC channel (excitation at 488 nm, detection at 530 nm). The heterologous polypeptide was measured in the APC channel (excitation at 645 nm, detection at 660 nm). Parental CHO cells, i.e. the cells used to generate the TI host cells, were used as negative controls for GFP and heterologous polypeptide expression. After 14-21 days from the start of selection, viability was above 90% and selection was considered complete.

[0301] After selection, the pool of stably transfected cells can be subjected to single cell cloning by limiting dilution. For this purpose, cells are stained with Cell Tracker Green™ (Thermo Fisher Scientific, Waltham, MA) and plated at 0.6 cells / well in 384-well plates. For single cell cloning and all further culture steps, selection agent 2 is omitted from the medium. Wells containing only one cell are identified by bright field and fluorescence-based plate imaging. Only wells containing one cell are further considered. Approximately 3 weeks after plating, colonies are picked from confluent wells and further cultured in 96-well plates.

[0302] Example 4 FACS screening FACS analysis was performed to determine the transfection efficiency and RMCE efficiency of the transfection. 5 The cells were centrifuged (1200 rpm, 4 min) and washed twice with 1 mL of PBS. After a washing step with PBS, the pellet was resuspended in 400 μL of PBS and transferred to a FACS tube (Falcon® round-bottom tube with cell strainer cap, Corning). Measurements were performed using a FACS CantoII and data were analyzed by the software FlowJo.

[0303] Example 5 Fed-batch culture Fed-batch production cultures were performed in shake flasks or Ambr15 vessels (Sartorius Stedim) containing proprietary synthetic medium. Cells were cultured at 2 × 10 6Cells were seeded at 1000 cells / ml. Cultures were fed with proprietary feed medium on days 3, 7, and 10. Viable cell count (VCC) and percent viability of cells in cultures were measured on days 0, 3, 7, 10, and 14 using a Cedex HiRes instrument (Roche Diagnostics GmbH, Mannheim, Germany). Concentrations of glucose, lactate, and product titer were measured on days 3, 5, 7, 10, 12, and 14 using a Cobas Analyzer (Roche Diagnostics GmbH, Mannheim, Germany). 14 days after the start of fed-batch culture, supernatants were harvested by centrifugation (10 min, 1000 rpm and 10 min, 4000 rpm) and clarified by filtration (0.22 μm). Protein A affinity chromatography with UV detection was used to determine titers on day 14. Product quality was determined by Caliper's LabChip (Caliper Life Sciences).

[0304] Example 6 RNP-based CRISPR-Cas9 gene knockout in CHO cells Material / Source: Geneious 2021.2.2 software for guide and primer design ●CHO TI host cell line; culture status: 30-60 days ●Gibco TrueCut Cas9 Protein, A45220P, Thermo Fisher ●sgRNA (custom designed for the target gene, 3 nm chemically modified sgRNA, Synthego) Culture medium (200 μg / ml hygromycin B, 4 μg / ml selection agent 2) DPBS - Dulbecco's Phosphate Buffered Saline (Ca and Mg free) (Thermo Fisher) ●Microplate 24 deep well plate (Agilent Technologies, Porvoir science), with cover (homemade) ●A long, thin filter tip that is free of RNase, DNase, and pyrogens and can be used with OC-100 cassettes. (Biozyme) ●Hera Safe Hood (Thermo Fisher) ●Cedex HiRes Analyzer(Innovatis) ●Liconic Incubator Storex IC ●HyClone electroporation buffer ●MaxCyte OC-100 Cassette • DNA was manipulated using standard methods described in the MaxCyte STX electroporation system.

[0305] CRISPR-Cas9 RNP delivery RNPs were pre-assembled by mixing 30 pmol of Cas9 with 30 pmol of gRNA mix (equal ratios of each gRNA - see table below for exemplary genes and specific gRNA sequences) and incubated for 20 min at RT. 6 Cells at a concentration between 1x10 cells / mL were centrifuged (3 min, 300g). Afterwards, cells were resuspended in 90 μL of HyClone electroporation buffer. Pre-incubated RNP mix was added to the cells and incubated for 5 min. The cell / RNP solution was then transferred to an OC-100 cuvette and electroporated using the MaxCyte electroporation system with the program "CHO2". Immediately after electroporation, the cell suspension was transferred to a 24-dwell and incubated at 37°C for 30 min. Fresh and pre-warmed medium was added to bring the final cell concentration to 1x10 6The cells were then split into individual pieces and incubated at 37°C with shaking at 350 rpm for cell expansion. For genomic DNA preparation (day 6 or 8), a QuickExtract kit (Lucigen) was added to the cells and served as a PCR template. Specific gene amplicons were PCR amplified using a standard Q5 Hot Start Polymerase protocol (NEB) and gene-specific primers spanning the gRNA target site (see table below for an example). Each amplicon was purified using a QIAquick PCR purification kit (Qiagen) and analyzed by Sanger sequencing by Eurofins Genomics GmbH to verify gene inactivation by knockout.

[0306] Example 7 Fed-batch culture Fed-batch production cultures were performed in Ambr 15 or Ambr 250 vessels (Sartorius Stedim) containing proprietary synthetic medium. Cells were cultured at 2 × 10 6 Cells were seeded at 1000 cells / ml. Cultures were fed with proprietary feed medium on days 3, 7, and 10. Viable cell count (VCC) and percent viability of cells in cultures were measured on days 0, 3, 7, 10, 12, and 14 using a Cedex HiRes (Roche Diagnostics GmbH, Mannheim, Germany). Glucose concentration, lactate concentration, and product titer were measured on days 3, 5, 7, 10, 12, and 14 using a Cobas analyzer (Roche Diagnostics GmbH, Mannheim, Germany). Supernatants were harvested 10, 12, or 14 days after the start of fed-batch by centrifugation (10 min, 1000 rpm, followed by 10 min, 4000 rpm) and clarified by filtration (0.22 μm). Recovery titers were further determined using Protein A affinity chromatography with UV detection. Product quality was determined by Caliper's LabChip (Caliper Life Sciences).

[0307] Example 8 High cell density fed-batch culture Fed-batch production cultures were performed in Ambr 15 or Ambr 250 vessels (Sartorius Stedim) containing proprietary synthetic medium. Cells were cultured at 15 × 10 6 Cells were seeded at 1000 cells / ml. Cultures were fed with proprietary feed medium on days 1, 3, and 6. Viable cell count (VCC) and percent viability of cells in cultures were measured on days 0, 3, 7, 10, 12, and 14 using a Cedex HiRes instrument (Roche Diagnostics GmbH, Mannheim, Germany). Glucose concentration, lactate concentration, and product titer were measured on days 3, 5, 7, 10, 12, and 14 using a Cobas Analyzer (Roche Diagnostics GmbH, Mannheim, Germany). After 10 or 12 or 14 days of culture initiation, supernatants were harvested by centrifugation (10 min, 1000 rpm, followed by 10 min, 4000 rpm) and clarified by filtration (0.22 μm). Recovery titers were further determined using Protein A affinity chromatography with UV detection. Product quality was determined by Caliper's LabChip (Caliper Life Sciences).

Claims

1. Modified mammalian cells in which the expression of the MYC gene and one or more of the BAK, BAX, SIRT-1, and ICAM-1 genes is reduced or eliminated.

2. The aforementioned MYC, SIRT-1, and ICAM-1 genes, or The aforementioned MYC, BAX, BAK, and SIRT-1 genes, or The aforementioned MYC, BAX, BAK, ICAM-1, and SIRT-1 genes The modified mammalian cell according to claim 1, wherein the expression of is reduced or eliminated.

3. The modified mammalian cell according to claim 1, wherein the reduction or elimination is achieved by gene knockout.

4. A modified mammalian cell according to claim 1, comprising one or more target integration landing sites.

5. A modified mammalian cell according to claim 1, comprising one or more target integration landing sites, wherein one or more nucleic acids encoding monospecific or multispecific antibodies are incorporated at one of the target integration landing sites.

6. The modified mammalian cell according to claim 1, wherein the reduction or elimination of the expression of the MYC, BAK, BAX, ICAM-1, and / or SIRT-1 genes is performed after the stable introduction of one or more nucleic acids encoding heterologous proteins.

7. The modified mammalian cell according to claim 1, which is a modified CHO or CHO-K1 cell.

8. The modified mammalian cell according to claim 1, which is a modified HEK293, HEK293T, BHK, A549, or HeLa cell.

9. A method for recombinant protein production, a) A step of culturing a modified mammalian cell according to any one of claims 1 to 8, which comprises one or more nucleic acids encoding the protein, in a culture medium under conditions suitable for the expression of the protein, b) A step of recovering the protein from the modified mammalian cells or the culture medium, c) Optionally, a step of purifying the protein using one or more chromatography steps, A method comprising, thereby recombinantly producing the protein.

10. The method according to claim 9, wherein the culturing step is performed for 6 to 16 days.

11. The aforementioned culturing step is 5 × 10 6 The method according to claim 9, which is started with a cell density of 100 cells / ml or more.

12. The method according to claim 9, wherein the culturing step is a fed-batch culture in which the culture is supplied on at least the 1st, 4th, 7th, and 10th days.

13. The method according to claim 9, wherein the modified mammalian cells are modified CHO or CHO-K1 cells.

14. The method according to claim 9, wherein the modified mammalian cell is a modified HEK293, HEK293T, BHK, A549, or HeLa cell.

15. The use of reducing or eliminating the expression of one or more of the MYC gene and BAK, BAX, SIRT-1, and ICAM-1 genes in modified mammalian cells expressing recombinant polypeptides in order to increase the volume productivity of the modified mammalian cells.

16. The use of reducing or eliminating the expression of one or more of the MYC gene and the BAK, BAX, SIRT-1, and ICAM-1 genes in modified mammalian cells to increase cell volume.

17. The use of reducing or eliminating the expression of one or more of the MYC gene and BAK, BAX, SIRT-1, and ICAM-1 genes in modified mammalian cells expressing recombinant polypeptides to enhance bioprocess viability.

18. The use of reducing or eliminating the expression of one or more of the MYC gene and BAK, BAX, SIRT-1, and ICAM-1 genes in modified mammalian cells expressing a recombinant polypeptide, in order to increase / extend the culture time of the modified mammalian cells without cell division.

19. The aforementioned MYC, SIRT-1, and ICAM-1 genes, or The aforementioned MYC, BAX, BAK, and SIRT-1 genes, or The aforementioned MYC, BAX, BAK, ICAM-1, and SIRT-1 genes The use according to any one of claims 15 to 17, wherein the expression of is permanently reduced or eliminated.

20. The use according to any one of claims 15 to 18, wherein the modified mammalian cells are modified CHO or CHO-K1 cells.

21. The use according to any one of claims 15 to 18, wherein the modified mammalian cell is a modified HEK293, HEK293T, BHK, A549, or HeLa cell.