3D molecular surface feature mapping of AAV capsids

Abstract

Provided are compositions and methods for obtaining and mapping 3D molecular surface features of viral capsids (e.g., AAV capsids).

Description

[Technical field]

[0001] [Priority claim] This application claims priority to U.S. Provisional Application Nos. 63 / 334,590, filed April 25, 2022, 63 / 334,595, filed April 25, 2022, and 63 / 334,596, filed April 25, 2022, the entire contents of which are incorporated herein by reference.

[0002] The present disclosure relates to compositions and methods for acquiring and mapping 3D features of viral capsids (e.g., AAV capsids). [Background technology]

[0003] Gene therapy using adeno-associated virus (AAV) as a vector has become a novel therapeutic approach that has the potential to lead to significant disease improvement in many monogenic diseases and treatments.

[0004] AAV therapy offers the promise of delivering truly groundbreaking innovation to patients with a wide range of applications, including restoring blood clotting to patients with hemophilia, restoring vision to patients with Leber congenital amaurosis (a rare genetic form of blindness) and halting the progression of infantile spinal muscular atrophy.

[0005] However, the treatment of many diseases with AAV therapy is limited by the tissue or cell type selectivity of AAV capsid mutants, among which gene therapy drugs show very low affinity, especially for CNS-related diseases.

[0006] The treatment of rare diseases, cancer and other organ-, tissue- or cell-type restricted disease conditions would be greatly facilitated by the development of AAV capsid variants for targeted delivery of therapeutic agents to the organ, tissue or cell type of interest.

[0007] Thus, there is a need in the art for methods to map the 3D molecular features of the AAV capsid for the development of AAV capsid mutants. Summary of the Invention

[0008] The present disclosure relates to methods for obtaining and analyzing 3D molecular surface features of AAV (adeno-associated virus) capsid mutants using binding profiles of DNA-encoded libraries (DELs), such as DNA-encoded chemical libraries (DECLs) and DNA-encoded antibody libraries (DEALs), phage display libraries, DNA aptamer libraries (single-stranded and circular aptamers), RNA aptamer libraries (single-stranded and circular aptamers), or combinations thereof.

[0009] According to the present invention, a method for characterizing the 3D molecular surface features of an AAV capsid comprises: a) contacting the AAV capsid with one or more AAV capsid-targeting aptamer libraries; b) removing unbound aptamers; c) eluting the bound aptamers; d) identifying the aptamer that is bound to the AAV capsid; e) determining the presence and / or levels of said identified aptamers; f) characterizing the 3D molecular surface features of the AAV capsid based on the presence and / or levels of the identified aptamers.

[0010] In some embodiments, steps a) through c) are repeated one, two, three or more times.

[0011] In some embodiments, the eluted aptamers are amplified by a PCR reaction.

[0012] In some embodiments, the aptamers in the aptamer library are linear aptamers or cyclic aptamers.

[0013] In some embodiments, each aptamer in the aptamer library comprises at least one primer binding region and one random sequence.

[0014] In some embodiments, the primer binding region of the aptamers in the aptamer library is about 20 bp in length.

[0015] In some embodiments, the random sequences of the aptamers in the aptamer library are about 36 to about 40 bp.

[0016] In some embodiments, each aptamer in the aptamer library comprises a double-stranded oligonucleotide sequence.

[0017] In some embodiments, each aptamer in the aptamer library comprises a single-stranded oligonucleotide sequence.

[0018] In some embodiments, at least one aptamer in the aptamer library is capable of binding to a target on the AAV capsid via a random sequence.

[0019] In some embodiments, each aptamer in the aptamer library comprises a single stranded DNA (Guard-DNA or G-DNA) that is complementary to a region of the DNA aptamer that contains a 5' extension region.

[0020] In some embodiments, contacting the AAV capsid with the aptamer library releases the single-stranded G-DNA molecule.

[0021] In some embodiments, identifying the aptamer bound to the AAV capsid comprises contacting the mixture obtained in step a) with RNase H and single-stranded RNA complementary to G-DNA and measuring the fluorescence intensity of the mixture, wherein the single-stranded RNA is labeled with a fluorophore and a quencher at its 5' end and 3' end, respectively.

[0022] In some embodiments, the fluorophore is selected from the group consisting of fluorescein, tetramethylrhodamine, Cy5, Cy3, and Texas Red.

[0023] In some embodiments, the quencher is selected from the group consisting of dabsyl, dabcyl, and a black quencher.

[0024] In some embodiments, identifying the aptamer that is bound to the AAV capsid is performed by sequencing.

[0025] In some embodiments, the sequencing comprises performing high-throughput sequencing or droplet sequencing.

[0026] In some embodiments, the targets of the aptamers in the aptamer library are known.

[0027] In some embodiments, the exact targets of the aptamers in the aptamer library need not be known.

[0028] In some embodiments, the AAV capsid is in solution prior to contacting with the aptamer library.

[0029] In some embodiments, the AAV capsid is immobilized on a support prior to contacting with the aptamer library.

[0030] In some embodiments, the method further comprises characterizing additional AAV capsid 3D molecular surface features.

[0031] Further in accordance with the present invention, a method for characterizing 3D molecular surface features of an AAV capsid includes: a) contacting the AAV capsid with a DNA-encoded chemical library (DECL) comprising a pool of DNA-encoded chemical binding agents that target one or more AAV capsids; b) removing unbound DNA-encoded chemical binding agents; c) eluting the bound DNA-encoded chemical binding agent; d) identifying the DNA-encoded chemical binding agent that is bound to the AAV capsid; and e) determining the presence and / or level of said identified DNA encoded chemical binding agents; f) characterizing the 3D molecular surface features of the AAV capsid based on the presence and / or level of the identified DNA-encoded chemical binding agents.

[0032] In some embodiments, steps a) through c) are repeated one, two, three or more times.

[0033] In some embodiments, each DNA encoded chemical linker in the DECL comprises: a) a compound capable of binding to one or more targets on the AAV capsid; and b) a DNA barcode; c) a linker.

[0034] In some embodiments, the DNA barcode of the eluted DNA-encoded chemical binding agent is amplified by a PCR reaction.

[0035] In some embodiments, the sequence of the DNA barcode of the DNA-encoded chemical binding agent is between about 5 bp and about 15 bp in length.

[0036] In some embodiments, the sequence of the DNA barcode of each DNA-encoded chemical binding agent is associated with the identity of the chemical binding agent.

[0037] In some embodiments, identifying the DNA encoded chemical binding agent is performed by sequencing the sequence of the DNA barcode.

[0038] In some embodiments, the sequencing comprises performing high-throughput sequencing, droplet sequencing, or single-cell sequencing.

[0039] In some embodiments, the target of the DNA encoded chemical binding agent in the DECL is known.

[0040] In some embodiments, the exact targets of the DNA-encoded chemical binding agents in the aptamer library need not be known.

[0041] In some embodiments, the AAV capsid is in solution prior to contact with the DECL.

[0042] In some embodiments, the AAV capsid is immobilized on a support prior to contacting with the DECL.

[0043] In some embodiments, the linker is a cleavable linker.

[0044] In some embodiments, the method further comprises characterizing additional AAV capsid 3D molecular surface features.

[0045] Further in accordance with the present invention, a method for characterizing 3D molecular surface features of an AAV capsid includes: a) contacting the AAV capsid with a DNA-encoded antibody library (DEAL) comprising a pool of DNA-encoded antibody binders targeting one or more AAV capsids; b) removing unbound DNA-encoded antibody binding agents; c) eluting the bound DNA-encoded antibody binding agent; d) identifying the DNA-encoded antibody binding agent that is bound to the AAV capsid; and e) determining the presence and / or level of said identified DNA encoded antibody binding agents; f) characterizing the 3D molecular surface features of the AAV capsid based on the presence and / or level of the identified DNA-encoded antibody binding agents.

[0046] In some embodiments, steps a) through c) are repeated one, two, three or more times.

[0047] In some embodiments, each DNA encoded antibody binding agent in said DECL comprises: a) an antibody or antigen-binding fragment thereof capable of binding to one or more targets on the AAV capsid; and b) a DNA barcode; c) a linker.

[0048] In some embodiments, the DNA barcodes of the eluted DNA-encoded antibody binding agents are amplified by a PCR reaction.

[0049] In some embodiments, the sequence of the DNA barcode of the DNA-encoded antibody binding agent is between about 5 bp and about 15 bp in length.

[0050] In some embodiments, identifying the DNA encoded antibody binding agent is performed by sequencing.

[0051] In some embodiments, the sequencing comprises performing high-throughput sequencing or droplet sequencing.

[0052] In some embodiments, the target of the DNA-encoded antibody binding agent in the DEAL is known.

[0053] In some embodiments, the exact targets of the DNA-encoded antibody binding agents in the DEAL library need not be known.

[0054] In some embodiments, the AAV capsid is in solution prior to contact with the DEAL.

[0055] In some embodiments, the AAV capsid is immobilized on a support prior to contacting with the DEAL.

[0056] In some embodiments, the linker is a cleavable linker.

[0057] In some embodiments, the linker comprises at least one nucleic acid molecule having an enzyme-cleavable sequence (CL).

[0058] In some embodiments, the method further comprises characterizing additional AAV capsid 3D molecular surface features.

[0059] Further in accordance with the present invention, a method for enriching a combinatorial library for characterizing 3D molecular surface features of an AAV capsid comprises: (a) contacting a pool of binding agents with a first population of AAV capsids; (b) enriching the binding library for characterizing 3D molecular surface features of the AAV capsids by enriching a subpool of binding agents that bind to the first population of AAV capsids.

[0060] In some embodiments, the method further comprises: (c) contacting the subpool of binding agents that bind to the first population of AAV capsids with a second population of AAV capsids; (d) selecting a group of binding agents that have preferential affinity for the first population of AAV capsids by depleting a second subpool of binding agents that exhibit affinity for the second population of AAV capsids.

[0061] In some embodiments, the library of binding agents is an aptamer library, a DNA-encoded chemical library (DECL) or a DNA-encoded antibody library (DEAL).

[0062] In some embodiments, the AAV capsid or first population of AAV capsids comprises one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVhu.37, AAVrh.8, AAVrh.10, AAVrh.39, AAV11, AAV12 and AAV13, as well as other variants derived from mutation, peptide insertion or shuffling.

[0063] In some embodiments, said 3D molecular surface features are said binding profiles of said library.

[0064] In some embodiments, the binding profile is the number, sequence, and copy number of bound binding agents.

[0065] In some embodiments, the 3D molecular surface characteristics of the AAV capsid are indicative of an affinity profile and / or a neutralization profile (e.g., the ability to evade neutralizing antibodies).

[0066] Further, in accordance with the present invention, there is provided a kit for carrying out the above-described method for enriching a combinatorial library.

[0067] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials applicable to the present invention are described herein, but other suitable methods and materials known in the art can also be used. The materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In the event of any discrepancy, the present specification, including definitions, will control.

[0068] Other features and advantages of the invention will be apparent from the following detailed description, drawings and claims. [Brief description of the drawings]

[0069] [Figure 1A] FIG. 1 is a schematic diagram of aptamers within a linear aptamer library. [Figure 1B] FIG. 1 is a schematic diagram of aptamers within a cyclic aptamer library. [Figure 2A] FIG. 1 is a schematic diagram of the enrichment of the aptamer library for an AAV sample (AAV Mix 01). [Figure 2B] FIG. 1 is a schematic diagram of the enrichment of the aptamer library for an AAV sample (AAV Mix 02). [Figure 2C] 1 shows an example of raw data obtained from the aptamer enrichment described herein. [Diagram 3] The counts of the top 100 enriched aptamers from each enrichment round described herein are shown. [Figure 4] The sequence composition signatures of the top 100 enriched aptamers obtained from each enrichment round are shown. [Diagram 5] The counts for the top 500 enriched aptamers described herein are shown. [Figure 6] The number of enriched aptamers obtained from any enrichment round of the linear aptamer library is shown. [Figure 7A] The difference in counts of enriched circular aptamers for two AAV samples (AAV Mix 01 and AAV Mix 02) is shown. The Y-axis shows the difference in counts (calculated as C2*C0 / C1^2, where C0=1 / number of enriched aptamer sequences). C1 is the number of enriched aptamers in the first enrichment round. C2 is the number of enriched aptamers in the second enrichment round. The X-axis shows the DNA sequence IDs of aptamers shared between enriched aptamer libraries for two different AAV samples, where the aptamer counts are greater than 50. [Figure 7B]The difference in counts of enriched circular aptamers for two AAV samples (AAV Mix 01 and AAV Mix 02) is shown. The Y-axis shows the difference in counts (calculated as C2*C0 / C1^2, where C0=1 / number of enriched aptamer sequences). C1 is the number of enriched aptamers in the first enrichment round. C2 is the number of enriched aptamers in the second enrichment round. The X-axis shows the DNA sequence IDs of aptamers shared between enriched aptamer libraries for two different AAV samples, where the aptamer counts are greater than 50. [Figure 7C] The difference in counts of enriched linear aptamers for two AAV samples (AAV Mix 01 and AAV Mix 02) is shown. The Y-axis shows the difference in counts (calculated as C2*C0 / C1^2, where C0=1 / number of enriched aptamer sequences). C1 is the number of enriched aptamers in the first enrichment round. C2 is the number of enriched aptamers in the second enrichment round. The X-axis shows the DNA sequence IDs of aptamers shared between enriched aptamer libraries for two different AAV samples, where the aptamer counts are greater than 50. [Figure 7D] The difference in counts of enriched linear aptamers for two AAV samples (AAV Mix 01 and AAV Mix 02) is shown. The Y-axis shows the difference in counts (calculated as C2*C0 / C1^2, where C0=1 / number of enriched aptamer sequences). C1 is the number of enriched aptamers in the first enrichment round. C2 is the number of enriched aptamers in the second enrichment round. The X-axis shows the DNA sequence IDs of aptamers shared between enriched aptamer libraries for two different AAV samples, where the aptamer counts are greater than 50. [Figure 8A] 1 shows the distribution of enriched aptamer counts within a linear aptamer library. [Figure 8B] 1 shows the distribution of enriched aptamer counts within a linear aptamer library. [Figure 9A] 1 shows the distribution of enriched aptamer counts within a circular aptamer library. [Figure 9B]1 shows the distribution of enriched aptamer counts within a circular aptamer library. [Figure 10] FIG. 1 is a schematic diagram of a DNA-encoded chemical library (DECL). [Figure 11] FIG. 1 is a schematic diagram of using DECL to characterize the 3D molecular surface features of the AAV capsid. [Figure 12] FIG. 1 is a schematic diagram of converting the 3D molecular surface features of the AAV capsid into DECL space. [Figure 13] FIG. 1 is a schematic diagram of using DECL and DEAL in combination with droplet-based sequencing to characterize the 3D molecular surface features of the AAV capsid. [Figure 14] Illustrative examples of commercially available DNA-encoded libraries are provided. [Figure 15] A Venn diagram of enriched DECL chemical binders for four AAV samples is shown. [Figure 16A] 1 shows a clustering analysis of enriched DECL chemical binders performed using principal component analysis (PCA). [Figure 16B] 1 shows a clustering analysis of enriched DECL chemical binders performed using principal component analysis (PCA). [Figure 16C] 1 shows a clustering analysis of enriched DECL chemical binders performed using principal component analysis (PCA). [Figure 16D] 1 shows a clustering analysis of enriched DECL chemical binders performed using principal component analysis (PCA). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0070] The present disclosure relates to methods for analyzing 3D molecular surface features of AAV (adeno-associated virus) capsid variants in solution or on a solid support using DNA-encoded libraries (DELs), such as DNA-encoded chemical libraries (DECLs) and DNA-encoded antibody libraries (DEALs), phage display libraries, DNA aptamer libraries (single-stranded and circular aptamers), RNA aptamer libraries (single-stranded and circular aptamers), or combinations thereof, etc. More specifically, the present disclosure relates to compositions and methods for delineating and mapping 3D molecular surface features of AAV capsid variants by converting them into binding profiles using binding libraries that selectively bind, individually or in combination, to the surface of the AAV capsid variants.

[0071] The methods described herein provide a method for converting the AAV capsid 3D molecular surface feature space into specific protein-to-DNA encoded molecule or protein-to-aptamer affinity interaction features defined by the binding of a detection library to an AAV sample. The methods described herein may further include droplet and / or single cell-like sequencing of the DNA sequence information encoded by the protein-to-DNA encoded molecule or protein-to-aptamer complex. The present disclosure also provides a means to functionally annotate the AAV capsid, as well as a visual platform to aid in recombinant DNA vector engineering to improve gene delivery applications.

[0072] [Adeno-associated virus] Adeno-associated viruses (AAV) are single-stranded DNA packaging viruses in the Parvoviridae family and classified in the Dependoparvovirus genus. AAV-based vectors have been developed and used as biologics for gene delivery to treat a variety of monogenic diseases. Thirteen human and primate AAV serotypes and numerous genomic isolates have been described and assigned to six clades A-F or individual clonal isolates. AAV viral particles consist of a non-enveloped capsid with T=1 icosahedral symmetry and a diameter of approximately 260 angstroms. These are assembled from 60 viral proteins (VPs): VP1 (≒82 kDa), VP2 (≒73 kDa), and VP3 (≒61 kDa) in an approximate ratio of 1:1:10. The VPs share a common C-terminus that includes the entire VP3. Compared to VP3, VP1 and VP2 share an extended N-terminus of approximately 65 amino acids (aa) and, in the case of VP1 (VP1u), an additional 137 aa at the N-terminus of VP2. The N-terminal regions of VP1 and VP2 contain conserved elements required for AAV infectivity, such as the phospholipase A2 (PLA2) domain, calcium binding domain, nuclear localization signal, etc. Overall, the VP1 amino acid sequence identity of AAV serotypes varies from 57% to 99%.

[0073] The capsid structures of several naturally occurring human and primate AAV serotypes (AAV1-AAV6, AAV8, AAV9, AAVhu.37, AAVrh.8, AAVrh.10 and AAVrh.39) have been determined by X-ray crystallography and / or cryo-electron microscopy (cryo-EM). Regardless of the method of structure determination, only the VP3 of AAV, except for the first approximately 15 aa, has been structurally aligned. The VP3 structure consists of an antiparallel eight-stranded (βB to βI) β-barrel motif with a BIDG sheet forming the inner surface of the capsid. An additional strand, βA, runs antiparallel to the βB strand. In addition, all AAVs conserve an α-helix (αA), located between βC and βD. Between the individual β-strands, large loops are inserted that are characterized by high sequence and structural diversity among AAVs. These loops form the outer surface of the capsid and are named after the adjacent β-strands. For example, the HI loop is sandwiched between the βH and βI strands. Sequence diversity in different AAVs results in alternative conformations of these loops, resulting in AAV serotype-specific capsid molecular surface features. Nine regions of significant diversity at the apex of these loops are defined as variable regions (VRs) by structural alignment. Despite the structural differences in the VRs, the overall capsid morphology is conserved. These include a cylindrical channel at the icosahedral 5-fold axis surrounded by a depression formed by the DE loop (VR-II) and mostly outlined by the HI loop. The 5-fold channel is thought to be the route through which genomic DNA packaging and VP1u externalization occur during endosomal / lysosomal transport after cell entry. At the 2-fold axis, protrusions surrounding the 3-fold axis are located on either side of the depression, and the capsid region that rises between the 2-fold and 5-fold axes is called the 2 / 5-fold wall. The three-fold symmetry region and the 2 / 5 fold wall have been identified as receptor binding sites for many AAV serotypes and function as determinants of cell and tissue tropism. Cellular receptors include sialic acid, heparan sulfate proteoglycan (HSPG), terminal galactose, sulfated N-acetyllactosamine, AAVR, laminin, αvβ1 integrin, αvβ5 integrin, hepatocyte growth factor receptor, fibroblast growth factor receptor, and platelet-derived growth factor receptor.In addition to receptor binding, the surface of the capsid, which contains the five-fold symmetry region, displays antigenic sites for antibodies generated by the host immune response.

[0074] In a recent study, the structures of AAV7, AAV11, AAV12 and AAV13 capsids are determined by cryo-electron microscopy to complete the panel of available structures of defined AAV serotypes. For these four AAV serotypes, empty and genome-containing capsid structures are reconstructed at a resolution of 2.54–3.15 Å. All density maps show well-defined amino acid side chain density and display AAV capsid features including channels at the 5-fold axis, depressions around the 2-fold and 5-fold axes and protrusions around the 3-fold axis. Comparing empty (no DNA) and complete (genome-packaged) capsid structures, no structural differences in the VP monomers are found except for aligned nucleotides in the aforementioned nucleotide (nt)-binding pocket in the case of complete capsids and alternative side chain orientations. Compared to AAV2, major structural differences are found in the 3-fold protrusions and 2 / 5-fold walls, mainly due to amino acid insertions or deletions and sequence differences. Structural characterization of AAV7, AAV11, AAV12, and AAV13 has resulted in a library of defined serotypes.

[0075] Details regarding AAV capsids and their structure are known in the art, see, for example, Mietzsch et al., Viruses. 2021 Jan;13(1):101; Cotmore SF et al., J. Gen. Virol. 2019;100:367-368. doi:10.1099 / jgv.0.001212; Wang D. et al., Adeno-associated virus vector as a platform for gene therapy delivery, Nat. Rev. Drug Discov. 2019;18:358-378; Gao G et al., J. Virol. 2004;78:6381-6388. doi:10.1128 / JVI.78.12.6381-6388.2004; Mietzsch M, Twenty-five years of structural parvovirology, Viruses.2019;11:362, Snijder J. et al., the stoichiometry and cargo load of viral and bacterial nanoparticles by orbitrap mass spectrometry, J.Am.Chem.Soc.2014;136:7295-7299, Girod A. et al., The VP1 capsid protein of adeno-associated virus type 2 is carrying a phospholipase A2 Gene therapy using adeno-virusassociated vectors, Clin. This is described in review articles such as Microbiol. Rev. 2008;21:583-593.Each review article is incorporated herein by reference in its entirety.

[0076] [3D molecular surface characteristics of AAV capsid] Adeno-associated virus (AAV) has become the vector of choice for many current gene therapy approaches. AAV is highly infectious but unable to replicate naturally in the absence of a helper virus, and its genome is easy to manipulate. To generate recombinant AAV (rAAV) vectors, viral genes are replaced with transgene expression cassettes, but leave behind the flanking inverted terminal repeats (ITRs) required for encapsidation. Viral particle capsid proteins for encapsidating the vector DNA are provided in trans, and the resulting rAAV is subsequently purified. The safety profile of rAAV vectors has been well established through decades of research and over 200 clinical trials to date. There are also numerous investigational drug applications in various stages of review. AAV-mediated gene transfer could benefit many patients with genetic diseases by mediating long-term expression of the transgene. However, several hurdles remain, such as pre-existing immunity to the rAAV capsid and undesirable immune responses to the transgene product.

[0077] Various subtypes of AAV capsids can deliver DNA to various cells and tissues, although the specific cells and tissues vary depending on the subtype. This is due to the configuration of the icosahedral-shaped capsid that forms an envelope around the DNA payload and interacts with specific molecules on the target cell via the protruding spike structure on the capsid surface. A challenge in many gene therapies is that the AAV virus is absorbed into cells that are not originally targeted. This can reduce the efficiency of the virus at the intended target site and can generate undesirable reactions in other cell and tissue types. These include cells of the immune system that can trigger immune responses and immune memory that would prevent the therapeutic virus from being administered again if needed.

[0078] Thus, the present invention provides a method for characterizing the 3D molecular surface features of AAV capsids. The 3D molecular surface features described herein refer to any structural, chemical and functional features of AAV capsids. For example, the 3D molecular surface features of AAV capsids may include the components of AAV capsids (e.g., the VP protein composition of AAV capsids), the secondary or tertiary protein structure of AAV capsids, the biophysical properties of AAV capsids (e.g., the ability to bind to receptors, small molecules, or other proteins both in vitro and in vivo), the viral tropism of AAV, and the antibody neutralization or immunogenicity profile of AAV. These 3D molecular surface features can be used to predict immune responses and delivery efficiency to various tissues and cells.

[0079] Pre-existing neutralizing antibodies against AAV capsids are found in a significant proportion of the human population due to exposure to circulating wild-type AAV. These antibodies can significantly reduce the transduction efficiency of rAAV and inhibit successful delivery of the transgene to those individuals. Thus, antibody binding profiles are important for engineering AAV capsids.

[0080] In some embodiments, the 3D molecular surface characteristics of the AAV capsid are antibody binding profiles of the AAV. In some embodiments, the 3D molecular surface characteristics of the AAV capsid indicate antibody binding preferences of the AAV.

[0081] Although rAAV vectors have traditionally been considered non-immunogenic, immune responses can occur against the AAV itself or the transgene product.Recently, post-translational modifications have been discovered in the rAAV capsid that may contribute to the undesired immunogenicity observed in some patients receiving gene therapy.

[0082] Viral tropism, i.e., the ability to infect a particular tissue or cell type, is an important factor to consider when selecting the most suitable rAAV serotype for gene delivery. Viral tropism is determined primarily by the rAAV capsid, and a variety of different capsid serotypes have been identified. When rAAV vectors are generated in the laboratory, the AAV2 ITR genome is engineered to contain the transgene of interest, and the resulting recombinant genome is encapsidated within a preferred capsid. Depending on the intended target cell or tissue, different serotypes may be preferred. An additional potential source of immunogenicity for rAAV-expressed transgene products is related to off-target delivery. If antigen-presenting cells (APCs) are inadvertently transduced, they may be presented to the immune system and trigger an immune response.

[0083] In some embodiments, the 3D molecular surface characteristics of the AAV capsid refer to the viral tropism of the AAV. In some embodiments, the 3D molecular surface characteristics of the AAV capsid refer to the tropism of the AAV (e.g., rAAV).

[0084] Although rAAV-mediated gene transfer is primarily used to treat monogenic diseases, it can also be used to deliver immunotherapeutic drugs such as monoclonal antibodies, which can deliver coding sequences for well-characterized protective / neutralizing antibodies against a pathogen of interest, with the aim of preventing or treating infectious diseases and conferring long-term immunity.

[0085] There is an ongoing immunological and molecular competition between AAV and its human host, and the art is in need of safer and more broadly applicable therapeutics.

[0086] In some embodiments, the methods described herein characterize the 3D molecular surface features of a population of AAV capsids. In some embodiments, the population of AAV capsids has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 types of AAV capsids. In some embodiments, the types of AAV capsids in the population are selected from serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVhu.37, AAVrh.8, AAVrh.10, AAVrh.39, AAV11, AAV12, and AAV13. In some embodiments, the AAV capsids in the population are wild-type AAV capsids. In some embodiments, one or more AAV capsids in the population include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 mutations in the capsid protein. In some embodiments, the mutations are single point mutations. In some embodiments, the mutations are on multiple amino acid residues in the AAV capsid protein.

[0087] In some embodiments, the population of AAV capsids comprises about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 In some embodiments, the population of AAV capsids includes about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10 2 , 10 3 , 10 4 , 10 5 , 106 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , or 10 20 In some embodiments, the population of AAV capsids includes about 1 to about 10 20 In some embodiments, the population of AAV capsids includes about 10 to about 10 20 In some embodiments, the population of AAV capsids includes about 10 2 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 3 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 4 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 5 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 6 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 7 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 8 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 9 ~about 10 20In some embodiments, the population of AAV capsids includes about 10 10 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 11 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 12 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 13 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 14 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 15 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 16 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 17 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 18 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 19 ~about 10 20 In some embodiments, the population of AAV capsids includes about 10 to about 10 10 In some embodiments, the population of AAV capsids includes about 10 2 ~about 10 10 In some embodiments, the population of AAV capsids includes about 10 3 ~about 10 10In some embodiments, the population of AAV capsids includes about 10 4 ~about 10 10 In some embodiments, the population of AAV capsids includes about 10 5 ~about 10 10 In some embodiments, the population of AAV capsids includes about 10 6 ~about 10 10 In some embodiments, the population of AAV capsids includes about 10 7 ~about 10 10 In some embodiments, the population of AAV capsids includes about 10 8 ~about 10 10 In some embodiments, the population of AAV capsids includes about 10 9 ~about 10 10 It contains one or more AAV capsids.

[0088] The methods described herein (e.g., methods for characterizing the 3D molecular surface features of viral capsids using aptamer libraries, DECL, DEAL, and / or phage display libraries) can be applied to characterize the 3D molecular surface features of any suitable virus particle, virus-like particle, self-assembling protein used for gene delivery purposes.

[0089] [Characterization of the 3D molecular surface features of AAV capsids using aptamer libraries] Aptamers are nucleic acid species that are routinely selected in vitro by SELEX (Systematic Evolution of Ligands by Exponential Enrichment). Since their introduction by the group of Gold and Szostak (Tuerk and Gold, Science, vol. 249, pp. 505-510, (1990)), aptamers have been utilized as molecular recognition elements to detect virtually any target, from small molecules to proteins, and even cells and tissues. Aptamers can be easily reproduced at low cost by chemical synthesis. Furthermore, aptamers have desirable storage properties and cause little or no immunogenicity in biological contexts. The utility of aptamers in therapy and diagnostics is greatly expanded. Recently, the lack of inherent signaling properties of aptamers has prompted the development of various strategies to convert target-binding events into easily measurable signals for biotechnological and biomedical applications (see, e.g., Navani and Li, Curr. Opin. Chem. Biol., vol. 10, pp. 272-281 (2006)).

[0090] Methods that use fluorescent reporters have proven particularly useful in the generation of aptamer-based biosensors. For example, monomorphic approaches (see, e.g., Jhaveri et al., J. Am. Chem. Soc., vol. 122, pp. 2469-2473 (2000)), aptamer beacon engineering (see, e.g., Hamaguchi et al., Anal. Biochem., vol. 294, pp. 126-131 (2001)), conformation-switching signaling (see, e.g., Nutiu and Li, J. Am. Chem. Soc., vol. 125, pp. 4771-4778 (2003)), in situ labeling (see, e.g., Merino and Weeks, J. Am. Chem. Soc., vol. 125, pp. 12370-12371 (2003)), allosteric chimeras (see, e.g., Wu and Curran, Nucleic Acids Res., vol. 27, pp. 1512-1516 (1999)), dye staining approaches (see, e.g., Li et al., Chem. Commun., pp. 73-75 (2007)), and polymer complex-based fluorescent chemosensors (see, e.g., Ho and Leclerc, J. Am. Chem. Soc., vol. 126, pp. 1384-1387 (2004)). While these systems generally generate signals stoichiometrically, attempts have been made to amplify the signal by incorporating proximity ligation assays (see, e.g., Fredriksson et al., Nature Biotechnol., vol. 20, pp. 473-477 (2002)) or exonuclease protection assays (see, e.g., Wang et al., Nature. Chem., vol. 76, pp. 5605-5610 (2004)) into aptamer-based sensing. Furthermore, DNA polymerase assays integrated with molecular beacons have been used for the amplified detection of recognition between aptamers and target small molecules (see, e.g., Shlyahovsky et al., J. Am. Chem. Soc., vol. 129, pp. 3814-3815 (2007)). Such technologies continually require the development of aptamer-based methods that facilitate accurate and specific bioanalysis, yet are simple and easily applied.

[0091] In one aspect, a method for characterizing 3D molecular surface features of an AAV capsid includes the steps of: a) contacting the AAV capsid with one or more aptamer libraries targeting the AAV capsid; b) removing unbound aptamers; c) eluting bound aptamers; d) identifying aptamers bound to the AAV capsid; e) determining the presence and / or level of the identified aptamers; and f) characterizing the 3D molecular surface features of the AAV capsid based on the presence and / or level of the identified aptamers.

[0092] In some embodiments, the enrichment (i.e., contacting, washing, and elution steps (steps a-c) of the aptamer library against the AAV sample are repeated 1, 2, 3, 4, 5 or more times.

[0093] The methods described herein can be carried out in any suitable solution or buffer. In some embodiments, enrichment of aptamer library for AAV sample is carried out in DPBS buffer (e.g., 1.47 mM KH2PO4, 8 mM Na2HPO4, 138 mM NaCl, 2.67 mM KCl, 0.5 mM MgCl2, 0.9 mM CaCl2, pH 7.4). Those skilled in the art can easily understand that any other suitable buffer and range of reagents in the buffer can be used in the methods described herein.

[0094] In some embodiments, enrichment of the aptamer library for the AAV sample is performed at room temperature, although one of skill in the art can readily appreciate that other suitable temperatures can be used to carry out the methods described herein.

[0095] In some embodiments, the eluted aptamers are amplified by a polymerase chain reaction (PCR) reaction, which in some embodiments includes PCR-based methods such as real-time polymerase chain reaction (RT-PCR), quantitative real-time polymerase chain reaction (Q-PCR / qPCR), and electric field-driven polymerase chain reaction (ePCR).

[0096] The aptamers in the library of the methods described herein can be any suitable aptamers known in the art. In some embodiments, the aptamers in the aptamer library are linear aptamers. In some embodiments, the aptamers in the aptamer library are cyclic aptamers.

[0097] In some embodiments, each aptamer in the aptamer library comprises at least one primer binding region and one random sequence. In some embodiments, the random sequence of the aptamer may bind to one or more targets on the AAV capsid. In some embodiments, the length of the random sequence of the aptamer in the aptamer library is about 30 bp to about 50 bp. In some embodiments, the length of the random sequence of the aptamer in the aptamer library is about 30 bp to about 40 bp. In some embodiments, the length of the random sequence of the aptamer in the aptamer library is about 36 to about 40 bp. In some embodiments, the method described herein further comprises filtering out the aptamer sequence (e.g., before or after sequencing the eluted bound aptamers).

[0098] In some embodiments, the length of the primer binding region of the aptamer in the aptamer library is about or at least 10 bp or more, about or at least 15 bp or more, about or at least 20 bp or more, about or at least 25 bp or more, about or at least 30 bp or more, about or at least 35 bp or more, about or at least 40 bp or more. In some embodiments, the length of the primer binding region of the aptamer in the aptamer library is about 20 bp.

[0099] Aptamers in an aptamer library may be double-stranded or single-stranded. In some embodiments, each aptamer in an aptamer library comprises a double-stranded oligonucleotide sequence. In some embodiments, each aptamer in an aptamer library comprises a single-stranded oligonucleotide sequence.

[0100] The aptamer or DEL chemical binding agents used in the methods described herein may be directly or indirectly bound to a solid surface or substrate, such as, for example, the surfaces of microarrays and wells; beads, columns, optical fibers, wipes, glass and modified or functionalized glass, quartz, mica, diazotized membranes (paper or nylon), particles such as polyformaldehyde, cellulose, cellulose acetate, paper, ceramics, metals, metalloids, semiconductor materials, quantum dots, coated beads or particles, other chromatographic materials, magnetic particles; plastics (e.g., acrylic, polystyrene, copolymers of styrene or other materials, polypropylene, polyethylene, polybutylene, polyurethane, Teflon materials, etc.), polysaccharides, The substrate may be any physically separable solid to which the binder can be attached directly or indirectly, including nylon or nitrocellulose, resins, silica or silica-based materials (including silicon and modified silicon), carbon, metals, inorganic glasses, plastics, ceramics, conductive polymers (including polymers such as polypyrrole and polyindole); micro- or nano-structured surfaces such as nucleic acid tile arrays, nanotubes, nanowires, nanoparticle decorated surfaces; or porous surfaces or gels such as methacrylates, acrylamides, sugar polymers, cellulose, silicates, or other fibrous or chain-like polymers. Additionally, as known in the art, the substrate may be coated with any number of materials, including polymers such as dextran, acrylamide, gelatin, agarose, etc., using passive or chemically derivatized coatings. Such coatings facilitate the use of the array with biological samples.

[0101] Aptamers or other useful binding agents may be conjugated to a detectable entity or label.

[0102] Suitable labels include, but are not limited to, magnetic labels, fluorescent moieties, enzymes, chemiluminescent probes, metal particles, non-metallic colloidal particles, polymeric dye particles, pigment molecules, pigment particles, electrochemically active species, semiconductor nanocrystals, or other nanoparticles such as quantum dots, gold particles, fluorophores, quantum dots, and radioactive labels. Protein labels include luminescent proteins such as green fluorescent protein (GFP) and its variants (such as cyan fluorescent protein and yellow fluorescent protein) and luciferase, as described below. Radioactive labels include: 3 H, 11 C. 14 C. 18 F, 32 P, 35 S, 64 Cu, 68 Ga, 86 Y, 99 Tc, 111 In, 123 I, 124 I, 125 I, 131 I, 133 Xe, 177 Lu, 211 At, or 213Fluorescent labels include, but are not limited to, radioisotopes (radionuclides) such as Bi. Fluorescent labels include rare earth chelates (e.g., europium chelates), rhodamine; fluorescein types (including, but not limited to, FITC, 5-carboxyfluorescein, 6-carboxyfluorescein); rhodamine types (including, but not limited to, TAMRA); dansyl; Lissamine; cyanine; phycoerythrin; Texas Red; Cy3, Cy5, dapoxyl, NBD, Cascade Yellow, dansyl, PyMPO, pyrene, 7-diethylaminocoumarin-3-carboxylic acid and other coumarin derivatives, Marina Blue™, Pacific Blue™, Cascade Blue™, 2-anthracenesulfonyl, PyMPO, 3,4,9,10-perylenetetracarboxylic acid, 2,7-difluorofluorescein (Oregon Green™ 488-X), 5-carboxyfluorescein, Texas Red™-X, Alexa Examples of suitable fluorescent probes include, but are not limited to, Fluor 430, 5-carboxytetramethylrhodamine (5-TAMRA), 6-carboxytetramethylrhodamine (6-TAMRA), BODIPY FL, bimane, Alexa Fluor 350, 405, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 647, 660, 680, 700, 750, and derivatives thereof. See, for example, "The Handbook--A Guide to Fluorescent Probes and Labeling Technologies," 10th Edition, available on the Internet at probes(dot)invitrogen(dot)com / handbook. The fluorescent label may be one or more of FAM, dRHO, 5-FAM, 6FAM, dR6G, JOE, HEX, VIC, TET, dTAMRA, TAMRA, NED, dROX, PET, BHQ, Gold540, and LIZ.

[0103] Aptamers may be directly or indirectly labeled using conventional techniques. For example, the label is attached to the aptamer via biotin-streptavidin (e.g., a biotinylated aptamer is synthesized and then allowed to bind to a streptavidin molecule that is itself attached to a detectable label. Non-limiting examples include streptavidin, phycoerythrin conjugation (SAPE)). Chemical conjugation methods using multiple steps include biotinylation, trinitrophenol (TNP) or digoxigenin conjugation (e.g., conjugation using succinimide esters of these compounds). Biotinylation can be achieved, for example, by using D-biotinyl-N-hydroxysuccinimide. Succinimide groups react effectively with amino groups at pH values ​​above 7, preferably between about pH 8.0 and about pH 8.5. Alternatively, the aptamer is unlabeled and contacted with a labeled second antibody after the first antibody has bound to the antigen of interest.

[0104] Various enzyme substrate labels can also be used in combination with the compositions or methods described herein. Enzymes generally catalyze a chemical change in a chromogenic substrate that can be measured using various techniques. For example, the enzyme can catalyze a color change in the substrate, which can be measured spectrophotometrically. Alternatively, the enzyme can change the fluorescence or chemiluminescence of the substrate. Examples of enzyme labels include luciferase (e.g., firefly luciferase and bacterial luciferase), luciferin, 2,3-dihydrophthalazinediones, malate dehydrogenase, urease, peroxidases such as horseradish peroxidase (HRP), alkaline phosphatase (AP), β-galactosidase, glucoamylase, lysozyme, sugar oxidases (e.g., glucose oxidase, galactose oxidase, and glucose-6-phosphate dehydrogenase), heterocyclic oxidases (e.g., uricase and xanthine oxidase), lactoperoxidase, microperoxidase, and the like. Examples of enzyme-substrate combinations include, but are not limited to, horseradish peroxidase (HRP) with hydrogen peroxidase as a substrate, where the hydrogen peroxidase oxidizes a dye precursor (e.g., orthophenylenediamine (OPD) or 3,3',5,5'-tetramethylbenzidine hydrochloride (TMB)), alkaline phosphatase (AP) with paranitrophenyl phosphate as a chromogenic substrate, and β-D-galactosidase (β-D-Gal) with a chromogenic substrate (e.g., p-nitrophenyl-β-D-galactosidase) or fluorogenic substrate 4-methylumbelliferyl-β-D-galactosidase.

[0105] The aptamers may be linked to a substrate, such as a planar substrate. Planar arrays typically contain addressable locations (such as pads, addresses, or microlocations) of biomolecules in an array format. The size of the array depends on the configuration and end use of the array. Arrays containing from two different molecules to several thousand molecules can be made. Typically, arrays consist of from two to over 100,000 molecules, depending on the end use and manufacturing method of the array.

[0106] In some embodiments, each aptamer in the aptamer library comprises a single stranded DNA (Guard-DNA or G-DNA) that is complementary to a region of the DNA aptamer that contains the 5' extension region.

[0107] In some embodiments, the single-stranded G-DNA molecules are released when the AAV capsid is contacted with the aptamer library, and identifying the binder comprises contacting the mixture obtained in step a with RNase H and single-stranded RNA complementary to the G-DNA, where a fluorophore and a quencher are labeled at the 5' and 3' ends of the single-stranded RNA, respectively, and measuring the fluorescence intensity of the mixture.

[0108] In some embodiments, the fluorophore is selected from the group consisting of fluorescein, tetramethylrhodamine, Cy5, Cy3, and Texas Red.

[0109] Any suitable quencher can be used in the methods described herein, hi some embodiments, the quencher is selected from the group consisting of dabsyl, dabcyl, and black quenchers.

[0110] In some embodiments, identification of binding agents is by sequencing.

[0111] In some embodiments, the methods described herein include identifying a target-specific aptamer profile. In one embodiment, a pool of aptamers is selected for an AAV sample and compared to a reference sample (e.g., a non-AAV sample or a different AAV sample), and aptamers in the subset that bind to components in the AAV sample but not to components in the reference sample are sequenced using conventional sequencing techniques to identify the subset that bind, thereby identifying the aptamer profile of the specific AAV sample. In this way, the aptamer profile provides an individual platform for characterizing the 3D molecular surface features of AAV capsids in an AAV sample. Furthermore, by selecting an appropriate reference or control sample, the aptamer profile can provide a predictive model of the AAV sample (e.g., including a population of AAV capsids) for characterizing additional test AAV samples.

[0112] In some embodiments, the pool of aptamers may contain any number of desired sequences, for example, at least 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , or at least 10 20 may be present in the starting pool of aptamers. Steps (a)-(c) may be repeated to further refine the pool of aptamers. In one embodiment, these steps are repeated at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times.

[0113] A variety of sequencing, amplification, and hybridization techniques may be used to identify the eluted aptamers. For example, when using a large pool of oligonucleotides, the identification of the oligonucleotides may be performed by high-throughput methods such as next-generation sequencing and hybridization. In some embodiments, the sequencing includes performing high-throughput sequencing, droplet sequencing, or single-cell sequencing.

[0114] In some embodiments, the targets of the aptamers in the aptamer library are known. In some embodiments, the exact targets of the aptamers in the aptamer library do not need to be known.

[0115] The AAV capsid according to the methods described herein may be in any suitable form. In some embodiments, the AAV capsid is in solution before contacting with the aptamer library. In some embodiments, the AAV capsid is fixed to a support before contacting with the aptamer library.

[0116] In some embodiments, the method further comprises characterizing additional AAV capsid 3D features. The aptamer binding profile of an AAV sample may be used as a unique signature to identify and distinguish an AAV sample from other AAV samples. In some embodiments, the aptamer binding profile includes the sequence of aptamers bound to a particular AAV sample. In some embodiments, the aptamer binding profile includes copies of each aptamer bound to a particular AAV sample. In some embodiments, one or more parameters in the aptamer binding profile can be used to identify an AAV sample (e.g., a population of AAV capsids).

[0117] In some embodiments, one or more 3D molecular surface features of the AAV capsid are measured using the methods described herein. 2 , 10 3 , 10 4, 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , or at least 10 20 In some embodiments, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 eluted aptamers in the manner described herein. 20 In some embodiments, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 eluted aptamers in the manner described herein. 15 In some embodiments, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 eluted aptamers in the manner described herein. 10 In some embodiments, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 eluted aptamers in the manner described herein. 5 In some embodiments, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 eluted aptamers in the manner described herein. 4 In some embodiments, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 eluted aptamers in the manner described herein. 3 In some embodiments, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 eluted aptamers in the manner described herein. 2 Each aptamer is characterized by a single eluted aptamer.

[0118] In one aspect, a DNA aptamer library is provided for detecting and characterizing 3D molecular surface features of AAV capsid mutants in a sample, suitable for use in the method of claim 1. The DNA aptamer library includes 1) a DNA duplex consisting of (a) a DNA aptamer library containing a sequence required for binding of an AAV capsid mutant and a sequence extended from the 5' end of the target binding sequence, and (b) a single-stranded DNA (G-DNA) complementary to a region of the DNA aptamer containing the 5' extended region, 2) a single-stranded RNA complementary to the G-DNA and labeled with a fluorophore and a quencher, and 3) RNase H, wherein the length of the single-stranded RNA is equal to or less than the length of the single-stranded DNA.

[0119] In some embodiments, the fluorophore is selected from the group consisting of fluorescein, tetramethylrhodamine, Cy5, Cy3, and Texas Red.

[0120] In some embodiments, the quencher is selected from the group consisting of dabsyl, dabsyl, and black quencher. In some embodiments, the quencher is a fluorophore that acts as a fluorescent acceptor in a fluorescence resonance energy transfer (FRET) mechanism. In some embodiments, the AAV capsid mutant particle is a protein complex comprising a capsid protein and a DNA genome sequence.

[0121] In one aspect, the present disclosure provides a method for detecting 3D molecular surface features of AAV capsid mutants using DNA aptamers that contain 5' extensions.One oligonucleotide covalently linked to a fluorophore is homologous to the 5' extension, while another oligonucleotide covalently linked to a quencher is homologous to the target binding domain.When reacting with the target, the aptamer dissociates and a signal is generated.

[0122] In some embodiments, the probe hybridizes to a specific sequence on the surface of the AAV capsid mutant. The probe is then nicked or cleaved and dissociated from the target. Dissociation of the probe fragments allows their detection. In some embodiments, a single-stranded RNA probe is used to delete the target DNA sequence. RNaseH specifically degrades the RNA probe that forms a heteroduplex with the target DNA. The DNA binds to another RNA probe, causing signal amplification.

[0123] In one aspect, a method is provided for detecting 3D molecular surface features of AAV capsid mutants by amplifying a fluorescent signal generated when a DNA aptamer binds to the 3D molecular surface features of the AAV capsid mutants in the presence of other molecules in a sample. The method includes the steps of: 1) forming a DNA duplex consisting of (a) a DNA aptamer (5'-Ex_aptamer) containing a sequence required for target binding and a sequence extended from the 5' end of the target binding sequence, and (b) a single-stranded DNA (Guard-DNA or G-DNA) complementary to the region of the DNA aptamer containing the 5' extension region; 2) mixing a sample containing AAV capsid mutant particles with the DNA duplex in step 1) to release single-stranded G-DNA molecules; 3) mixing the mixture obtained in step 2) with RNase H and single-stranded RNA (F-RNA-Q) complementary to the G-DNA, so that the 5' and 3' ends of the single-stranded RNA are labeled with a fluorophore and a quencher, respectively; and 4) measuring the fluorescence intensity of the mixture obtained in step 3).

[0124] In one aspect, the invention provides a library suitable for use in the methods described herein to detect 3D molecular surface features of AAV capsid mutants in a sample, the library comprising 1) a DNA duplex consisting of (a) a DNA aptamer comprising a sequence required for target binding and a sequence extended from the 5' end of the target binding sequence, and (b) a single-stranded DNA (G-DNA) complementary to a region of the DNA aptamer comprising the 5' extended region, 2) a single-stranded RNA complementary to the G-DNA and labeled with a fluorophore and a quencher, and 3) RNase H, wherein the length of the single-stranded RNA is equal to or less than the length of the single-stranded DNA.

[0125] In some embodiments, a biosensor based on a fluorescence intensity assay is used to measure the 3D molecular surface features of AAV capsid mutants in a sample.

[0126] The DNA aptamer in step 1) is a molecule with an extended sequence at the 5' end of the established aptamer (5'Ex_aptamer). The G-DNA in this embodiment is a single-stranded DNA molecule complementary to the region of the DNA aptamer including the 5' extended region. The established aptamer is an aptamer that binds to the 3D molecular surface features of the AAV capsid mutant. A DNA duplex consisting of the DNA aptamer and G-DNA can be formed by heating an aqueous solution containing the DNA aptamer and G-DNA and slowly cooling it at room temperature.

[0127] The AAV capsid mutant particle in step 2) may be a protein complex comprising a capsid protein and a DNA genome sequence.

[0128] In some embodiments, F-RNA-Q in step 3) is an RNA sequence having a fluorophore attached to its 5' end and a quencher attached to its 3' end. In some embodiments, the fluorophore is a conventional fluorophore such as fluorescein, tetramethylrhodamine, Cy5, Cy3 and Texas Red. In a preferred embodiment, the quencher may be a conventional quencher such as dabsyl, dabcyl and black quencher. The quencher may be another fluorophore that functions as a fluorescent acceptor in a fluorescence resonance energy transfer (FRET) mechanism. Any fluorophore and fluorescent quencher known to those skilled in the relevant art may be used in the present invention.

[0129] In some embodiments, the RNaseH of the embodiment is an enzyme that recognizes an RNA / DNA duplex and degrades only the RNA portion of the duplex without degrading single-stranded RNA. In the present disclosure, RNaseH is used to degrade F-RNA-Q of an F-RNA-Q / G-DNA duplex.

[0130] The DNA aptamer, G-DNA, F-RNA-Q and RNaseH used in the present disclosure may be commercially available.

[0131] In some embodiments, the fluorescence intensity can be measured by fluorometers known to those skilled in the art, such as a TRIAD multimode detector, a Wal-lac / Victor fluorescence, and a Perkin-Elmer LB50B luminescence spectrometer.

[0132] Below, the methods described herein for detecting 3D molecular surface features of AAV capsid mutants in a sample are described in further detail.

[0133] In step 2), due to the presence of the 3D molecular surface features of the AAV capsid mutant, the 5'Ex_aptamer-containing complex with a partial double-stranded structure preferentially forms a protein-5'Ex_aptamer complex. As a result, a single-stranded G-DNA molecule is released. In step 3), the biosensor system of this embodiment includes a single-stranded RNA probe F-RNA-Q with a fluorophore (F) attached to the 5' end. The intensity of this fluorophore is completely reduced by a quencher (Q) at the 3' end. Since the sequence of F-RNA-Q is complementary to the released G-DNA, an RNA-DNA duplex is formed. The RNA-DNA duplex with quenched fluorescence is degraded by RNaseH. As a result, the RNA fragment containing the fluorophore is separated from the quencher and used to generate a fluorescent signal. If no AAV capsid mutant particles are present in the sample, no fluorescent signal is generated because the DNA aptamer remains bound to the G-DNA and cannot form an RNA-DNA duplex with F-RNA-Q. Degradation of F-RNA-Q by RNase H leaves the G-DNA undamaged and allows reformation of the duplex with another F-RNA-Q molecule, thus providing a mechanism for fluorescent signal amplification through cycles of RNA-DNA duplex formation and subsequent RNase H digestion.

[0134] Furthermore, the method described herein can be used for quantitative analysis of 3D molecular surface features of AAV capsid mutants, because the intensity of the fluorescent signal increases in proportion to the amount of AAV capsid mutant particles. On the other hand, if the F-RNA-Q is much longer than the G-DNA, the G-DNA and F-RNA-Q may form a duplex, inducing the catalytic action of RNaseH even when no AAV capsid mutant particles are present in the sample, generating a false positive signal. Therefore, the length of the single-stranded RNA is not longer than the length of the G-DNA. If the amount of G-DNA is greater than the amount of DNA aptamer, the excess G-DNA remaining after binding to the DNA aptamer may bind to the F-RNA-Q, activating RNaseH and generating a false positive signal.

[0135] Therefore, in the method of the present invention, it is preferable to use the same amount of DNA aptamer and G-DNA.The disclosed method is carried out in a homogenous solution, which is more convenient compared to ELISA (enzyme-linked immunosorbent assay), which is performed with an additional washing step.

[0136] In some embodiments, since the DNA aptamer has high selectivity for AAV capsid mutant particles, no amplification of the fluorescent signal occurs unless the target protein is present in the sample. In conventional stoichiometric detection methods, the amount of detection of the 3D molecular surface features of the AAV capsid mutant varies depending on the binding strength between the AAV capsid mutant particle and the aptamer. In contrast, by using the signal amplification process of the present invention, very small amounts of 3D molecular surface features of the AAV capsid mutant can be detected even when the concentration of the AAV capsid mutant particle is lower than the dissociation constant of the AAV capsid mutant particle-aptamer complex. Fluorescence amplification is obtained by the decomposition cycle of F-RNA-Q by RNaseH caused by a small amount of G-DNA released from the DNA aptamer bound to the AAV capsid mutant particle. For example, thrombin at a concentration of 10 nM, which is much lower than the dissociation constant of the aptamer-thrombin complex (~100 nM), can be easily detected using the present invention. Detection of 3D molecular surface features of AAV capsid mutants is accomplished very rapidly by the methods described herein.

[0137] The library for detecting 3D molecular surface features of AAV capsid mutants in a sample described herein is suitable for use in the methods described herein and is characterized in that it comprises: 1) a DNA duplex consisting of (a) a DNA aptamer comprising a sequence required for target binding and a sequence extended from the 5' end of the target binding sequence, and (b) a single-stranded DNA (G-DNA) complementary to a region of the DNA aptamer comprising the 5' extended region; 2) a single-stranded RNA complementary to the G-DNA and labeled with a fluorophore and a quencher; and 3) RNase H, wherein the length of the single-stranded RNA is equal to or less than the length of the single-stranded DNA.

[0138] The AAV capsid mutant particle may be a protein complex comprising a capsid protein and a DNA genomic sequence.

[0139] Detection of the interaction of the DNA aptamer with any AAV capsid variant can be performed using droplet and / or single cell sequencing techniques, which allow for sequencing of individual AAV aptamer complexes in large quantities and with high sequencing accuracy.

[0140] [Characterization of 3D molecular surface features of AAV capsids using DNA-encoded chemical libraries (DECLs)] A DNA-encoded library (DEL) is a collection of small molecules covalently attached to DNA, carrying unique information about the identity and structure of the library members. Small molecules are often created by the combination of smaller building blocks. DELs allow for the rapid and simultaneous screening of hundreds of billions of small molecule compounds against protein targets of interest. DELs are used in drug discovery programs to provide a tool for the detection and characterization of biosignatures.

[0141] DECL as used herein refers to a library that comprises a plurality of DNA-encoded chemical binding agents.Those skilled in the art can understand that any suitable small molecule can be used as DNA-encoded chemical binding agent to construct a DNA-encoded chemical library.Detailed description of the structure of DECL is disclosed, for example, in PCT Publication No. WO2009 / 077173A2, the entire contents of which are incorporated herein.

[0142] In one aspect, the invention provides a method for characterizing 3D molecular surface features of an AAV capsid, the method comprising the steps of: a) contacting an AAV capsid with a DNA-encoded chemical library (DECL) comprising a pool of one or more AAV capsid-targeted DNA-encoded chemical binding agents, b) removing unbound DNA-encoded chemical binding agents, c) eluting bound DNA-encoded chemical binding agents, d) identifying DNA-encoded chemical binding agents bound to the AAV capsid, e) determining the presence and / or level of the identified DNA-encoded chemical binding agents, and f) characterizing the 3D molecular surface features of the AAV capsid based on the presence and / or level of the identified DNA-encoded chemical binding agents.

[0143] In some embodiments, the enrichment (e.g., contacting, washing and elution steps (steps a-c) of DECL from the AAV sample are repeated 1, 2, 3, 4, 5 or more times.

[0144] The methods described herein can be carried out in any suitable solution or buffer. In some embodiments, enrichment of aptamer library for AAV sample is carried out in DPBS buffer (e.g., 1.47 mM KH2PO4, 8 mM Na2HPO4, 138 mM NaCl, 2.67 mM KCl, 0.5 mM MgCl2, 0.9 mM CaCl2, pH 7.4). Those skilled in the art can easily understand that any other suitable buffer and range of reagents in the buffer can be used in the methods described herein.

[0145] In some embodiments, enrichment of the AAV sample with DECL is performed at room temperature, although one of skill in the art will readily appreciate that other suitable temperatures can be used to carry out the methods described herein.

[0146] In some embodiments, the DNA barcode of the eluted DNA-encoded chemical binding agent is amplified by a PCR reaction, which in some embodiments includes PCR-based methods such as real-time polymerase chain reaction (RT-PCR), quantitative real-time polymerase chain reaction (Q-PCR / qPCR), and electric field-driven polymerase chain reaction (ePCR).

[0147] In some embodiments, each DNA-encoded chemical binding agent within a DECL comprises a) a chemical compound capable of binding to one or more targets on an AAV capsid, b) a DNA barcode, and c) a linker.

[0148] In some embodiments, the sequence of the DNA barcode of the DNA-encoded chemical binding agent is between about 5 bp and about 40 bp. In some embodiments, the sequence of the DNA barcode of the DNA-encoded chemical binding agent is between about 5 bp and about 30 bp. In some embodiments, the sequence of the DNA barcode of the DNA-encoded chemical binding agent is between about 5 bp and about 20 bp. In some embodiments, the length of the sequence of the DNA barcode of the DNA-encoded chemical binding agent is between about 5 bp and about 15 bp. In some embodiments, the length of the sequence of the DNA barcode of the DNA encoded chemical binding agent is about or at least 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, 36 bp, 37 bp, 38 bp, 39 bp, 40 bp, or more than 40 bp.

[0149] In some embodiments, identifying the DNA-encoded chemical binding agent is performed by sequencing the sequence of the DNA barcode. In some embodiments, the sequencing includes performing high-throughput sequencing, droplet sequencing, or single-cell sequencing. The sequence of the barcode may be sequenced using any other suitable sequencing technique described herein or known in the art.

[0150] In some embodiments, the targets of the DNA-encoded chemical linkers in a DECL are known. In some embodiments, the exact targets of the DNA-encoded chemical linkers in a DECL library do not need to be known.

[0151] The AAV capsid in the methods described herein may be in any suitable form.In some embodiments, AAV capsid is in solution before contacting with DECL.In some embodiments, AAV capsid is fixed to support before contacting with DECL.

[0152] In some embodiments, the method further comprises characterizing additional AAV capsid 3D features. The DECL binding profile of an AAV sample may be used as a unique signature to identify and distinguish the AAV sample from other AAV samples. In some embodiments, the DECL binding profile includes the sequence of DNA-encoded chemical binders bound to a particular AAV sample. In some embodiments, the DECL binding profile includes copies of each DNA-encoded chemical binder bound to a particular AAV sample. In some embodiments, one or more parameters in the DECL binding profile can be used to identify the AAV sample (e.g., a population of AAV capsids).

[0153] Any suitable chemical compound may be used for the DNA-encoded chemical binding agent described herein.In some embodiments, the chemical compound is a small molecule.In some embodiments, the small molecule can bind to one or more targets on the surface of AAV capsid.

[0154] DECL described herein may use any suitable linker. In some embodiments, the linker is a cleavable linker. The linker may be any moiety that serves to operably link a chemical moiety to a DNA moiety.

[0155] Linkers vary in structure and length and have at least two characteristics: (1) functional attachment to a compound, and (2) functional attachment to a DNA moiety. The nature of the chemical attachment is diverse, so any of a variety of chemical reactions can be utilized to achieve the designated functional attachment to both the compound and the DNA barcode. The size of the linker moiety can vary widely in terms of the length between the chemical moiety and the DNA moiety. In some embodiments, the link is no longer than sufficient to provide the designated binding function. Thus, in some embodiments, the linker has a chain length of at least 1 to about 20 atoms.

[0156] Exemplary linkers include amino modifiers (e.g., 3'-amino modifier C3, 3'-amino modifier C6dC, 3'-amino modifier C6dT, 3'-amino modifier C7, 3'-PT-amino modifier C3, 3'-PT-amino modifier C6, 5'-amino modifier dT-CE, 5'-amino modifier 5, 5'-amino modifier C12, 5'-amino modifier C3, 5'-amino modifier C6, amino modifier C2dT, amino modifier C6dA, amino modifier C6dC, amino modifier C6dG, amino modifier C6dT, amino modifier C6-U, 5'-amino modifier C12, etc.), thiol modifiers (e.g., 3'-thiol modifier C3 S-S1 The linker may be a 5'-thiol modifier C6, a 3'-C6-thiol modifier SS, a 3'-C6-thiol modifier, a 5'-C6-thiol modifier SS, a 5'-C6-thiol modifier), a carboxy modifier (e.g., a 3'-carboxylate photolabile C6, a 5'-carboxy modifier C10, a carboxy-dT), or an aldehyde modifier (e.g., a 5'-aldehyde modifier C2). Other suitable linkers are known in the art.

[0157] DNA display of combinatorial small molecule libraries relies on multi-step split-and-pool synthesis of the library, coupled with enzymatic addition of DNA tags that code for both the synthetic steps and the building blocks used. Typically, multiple (e.g., three or four) synthetic steps are performed to encode and include diversity positions formed by attaching building blocks, such as amine or carboxylate functional groups, to a chemical scaffold that displays the attached building blocks in a certain orientation. One example of a scaffold (S) that is often used in combinatorial libraries is a triazine moiety that can be orthogonally derivatized at three positions around a ring structure.

[0158] The process of library formation is time consuming and often involves inefficient purification of the products, which can result in unknown reactions in which unwanted and / or unknown molecules are attached to the DNA. Screening and sequencing hits from libraries necessitates the use of massively parallel sequencing due to the inherent "noise" of DNA attached to unintended molecules (e.g., unreacted or by-products) or mistagged DNA.

[0159] In some embodiments, the initiator oligonucleotide from which the small molecule library is constructed contains a primer binding region for polymerase amplification (eg, PCR) in the form of a covalently closed double-stranded oligonucleotide.

[0160] For example, combinatorial chemistry, including split-and-pool chemistry, can be used to synthesize large amounts of compounds. Compounds created in this way can be used in the field of medicinal chemistry and screened for various biochemical activities. These activities include binding to one or more proteins that are known at the time the screening test is performed. Alternatively, the proteins to which the compound being tested binds can be identified only after a binding event has been detected.

[0161] Detailed methods for constructing DECL are disclosed, for example, in PCT Publication No. WO2009 / 077173A2, the entire contents of which are incorporated herein.

[0162] In one aspect, the invention provides a method for generating a DNA-encoded chemical library for detecting and characterizing 3D molecular surface features of AAV capsids. In some embodiments, the method includes the steps of: a) reacting a first functional group of a bifunctional linker to a first chemical building block, where the bifunctional linker has a single functional group that reacts with the chemical building block and a single functional group that reacts with a nucleotide, a nucleotide analog, a nucleoside, or a nucleoside analog; b) reacting a second functional group of the bifunctional linker to a single-stranded hairpin oligonucleotide, where the hairpin oligonucleotide comprises (i) a self-complementary region and (ii) a single-stranded loop comprising at least one naturally occurring nucleoside or nucleoside analog to form a conjugate; and c) reacting the second functional group of the bifunctional linker to a single-stranded hairpin oligonucleotide to form a conjugate. and d) reacting the first and second chemical building blocks of the conjugate under conditions suitable to form a covalent bond between the first and second chemical building blocks of the conjugate; and d) linking a first oligonucleotide tag to the single-stranded hairpin oligonucleotide of the conjugate, wherein the oligonucleotide tag comprises a region encoding the identity of the first chemical building block and / or the identity of the second chemical building block to form a DNA-encoded chemical entity, wherein steps (a) and (b) and / or steps (c) and (d) may be performed in any order.

[0163] In some embodiments, the ligation in step (d) comprises non-enzymatic ligation.

[0164] In some embodiments, the oligonucleotide tag in step (d) comprises a fluorescent tag or a biotin label.

[0165] In some embodiments, the single-stranded hairpin oligonucleotide in step (b) comprises a region encoding the identity of the first building block. In some embodiments, the single-stranded hairpin oligonucleotide in step (b) and / or the oligonucleotide tag in step (d) are modified to enhance the solubility of the DNA-encoded chemical linking agent under organic conditions. In some embodiments, the single-stranded loop of the hairpin oligonucleotide comprises a sequence that can function as a primer binding region for amplification. In some embodiments, the single-stranded hairpin oligonucleotide in step (b) comprises a T or C nucleotide that comprises an aliphatic chain at the C5 position. In some embodiments, the single-stranded hairpin oligonucleotide in step (b) comprises an azobenzene.

[0166] In some embodiments, the bifunctional linker is modified to increase the solubility of the DNA-encoded chemical linking agent under organic conditions. In some embodiments, the bifunctional linker comprises one or more of an alkyl chain, a polyethylene glycol unit, a branched species with a positive charge, or a hydrophobic ring structure. In some embodiments, the bifunctional linker comprises about 10 to about 50 polyethylene glycol units. In some embodiments, the bifunctional linker comprises about 12 to about 45 polyethylene glycol units.

[0167] In some embodiments, the oligonucleotide tag in step (d) comprises a region that encodes the identity of the first chemical building block. In some embodiments, the oligonucleotide tag in step (d) comprises a region that encodes the identity of the second chemical building block.

[0168] In some embodiments, the suitable conditions in step (c) include an organic solvent.

[0169] In some embodiments, the bifunctional linker is attached to the 5' end of the single-stranded hairpin oligonucleotide in step (b), the bifunctional linker is embedded within the single-stranded hairpin oligonucleotide in step (b), or the bifunctional linker is located in the center of the single-stranded hairpin oligonucleotide in step (b).

[0170] In some embodiments, the bifunctional linker is attached to the 5' end of the single-stranded hairpin oligonucleotide in step (b). In some embodiments, the bifunctional linker is embedded within the single-stranded hairpin oligonucleotide in step (b). In some embodiments, the bifunctional linker is located in the center of the single-stranded hairpin oligonucleotide in step (b).

[0171] In some embodiments, the oligonucleotide tag in step (d) comprises a T or C nucleotide that comprises an aliphatic chain at the C5 position.

[0172] In some embodiments, the method further comprises ligating a second oligonucleotide tag, the second oligonucleotide tag encoding the identity of a second chemical building block, to the first oligonucleotide tag.

[0173] In some embodiments, the method further comprises (e) reacting a third chemical building block with the first chemical building block or the second chemical building block. In some embodiments, the method further comprises (f) ligating a third oligonucleotide tag to the second oligonucleotide tag, where the third oligonucleotide tag encodes the identity of the third chemical building block, and steps (e) and (f) may be performed in any order.

[0174] In some embodiments, the method further comprises (e) reacting one or more additional chemical building blocks with the chemical building blocks of the conjugate. In some embodiments, the method further comprises (f) ligating one or more oligonucleotide tags to the oligonucleotide tags of the conjugate, where each oligonucleotide tag encodes the identity of one of the one or more additional building blocks, and steps (e) and (f) may be performed in any order.

[0175] In some embodiments, the method produces a plurality of DNA-encoded chemical binding agents.

[0176] The pool of DNA-encoded chemical binding agents described herein may include any suitable number of DNA-encoded chemical binding agents. In some embodiments, the pool of DNA-encoded chemical binding agents includes at least 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , at least 10 20 Or more different DNA encoded chemical binding agents may be included.

[0177] In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are about 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 1010 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , or at least 10 20 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 20 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 15 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 10 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 5 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 4 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 3 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 2 It is characterized by a DNA-encoded chemical binding agent.

[0178] [Characterization of 3D molecular surface features of AAV capsids using DNA-encoded antibody libraries (DEALs)] Antibody-based reactions are widely used in disease diagnosis. For example, enzyme-linked immunosorbent assays (ELISAs), Western blotting, and indirect fluorescent antibody tests are very useful for identifying single target proteins. Rapid and simultaneous screening of samples for the presence of multiple antibodies is beneficial in both research and clinical applications. Polymerase chain reaction (PCR) and other target amplification methods have rapidly developed powerful tools to detect and quantify DNA targets of interest. Development of comparable target amplification methods for proteins could greatly improve methods for detecting and quantifying targets such as AAV capsids.

[0179] In one aspect, the invention provides a method for characterizing 3D molecular surface features of an AAV capsid, the method comprising the steps of: a) contacting an AAV capsid with a DNA-encoded antibody library (DEAL) comprising a pool of one or more AAV capsid-targeting DNA-encoded antibody binding agents, b) removing unbound DNA-encoded antibody binding agents, c) eluting bound DNA-encoded antibody binding agents, d) identifying DNA-encoded antibody binding agents bound to the AAV capsid, e) determining the presence and / or level of the identified DNA-encoded antibody binding agents, and f) characterizing the 3D molecular surface features of the AAV capsid based on the presence and / or level of the identified DNA-encoded antibody binding agents.

[0180] In some embodiments, the enrichment (e.g., contacting, washing and elution steps (steps a-c) of the DEAL from the AAV sample are repeated one, two, three, four, five or more times.

[0181] The methods described herein can be carried out in any suitable solution or buffer. In some embodiments, enrichment of aptamer library for AAV sample is carried out in DPBS buffer (e.g., 1.47 mM KH2PO4, 8 mM Na2HPO4, 138 mM NaCl, 2.67 mM KCl, 0.5 mM MgCl2, 0.9 mM CaCl2, pH 7.4). Those skilled in the art can easily understand that any other suitable buffer and range of reagents in the buffer can be used in the methods described herein.

[0182] In some embodiments, enrichment of DEAL for AAV samples is performed at room temperature. Those skilled in the art can easily understand that other suitable temperatures can be used to carry out the methods described herein.

[0183] In some embodiments, each DNA-encoded antibody binding agent in a DEAL comprises a) an antibody or antigen-binding fragment thereof capable of binding to one or more targets on the AAV capsid, b) a DNA barcode, and c) a linker.

[0184] In some embodiments, the DNA barcodes of the eluted DNA-encoded antibody binders are amplified by a PCR reaction, which in some embodiments includes PCR-based methods such as real-time polymerase chain reaction (RT-PCR), quantitative real-time polymerase chain reaction (Q-PCR / qPCR), and electric field-driven polymerase chain reaction (ePCR).

[0185] In some embodiments, the sequence of the DNA barcode of the DNA-encoded antibody binding agent is between about 5 bp and about 40 bp. In some embodiments, the sequence of the DNA barcode of the DNA-encoded antibody binding agent is between about 5 bp and about 30 bp. In some embodiments, the sequence of the DNA barcode of the DNA-encoded antibody binding agent is between about 5 bp and about 20 bp. In some embodiments, the length of the sequence of the DNA barcode of the DNA-encoded antibody binding agent is between about 5 bp and about 15 bp. In some embodiments, the sequence of the DNA barcode of the DNA-encoded antibody binding agent is about 5 bp, 6 bp, 7 bp, 8 bp, 9 bp, 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, 36 bp, 37 bp, 38 bp, 39 bp, 40 bp or more in length.

[0186] In some embodiments, identification of the DNA-encoded antibody binding agent is performed by sequencing the sequence of the DNA barcode. In some embodiments, sequencing includes performing high-throughput sequencing, droplet sequencing, or single-cell sequencing. The sequence of the barcode may be sequenced using any other suitable sequencing technique described herein or known in the art.

[0187] In some embodiments, the targets of the DNA-encoded antibody binding agents in a DEAL are known. In some embodiments, the exact targets of the DNA-encoded antibody binding agents in a DEAL library do not need to be known.

[0188] The AAV capsid in the methods described herein can be in any suitable form.In some embodiments, AAV capsid is in solution before contacting with DEAL.In some embodiments, AAV capsid is fixed to support before contacting with DEAL.

[0189] In some embodiments, the method further comprises characterizing additional AAV capsid 3D features. The DEAL binding profile of an AAV sample may be used as a unique signature to identify and distinguish the AAV sample from other AAV samples. In some embodiments, the DEAL binding profile includes the sequence of DNA-encoded antibody binding agents bound to a particular AAV sample. In some embodiments, the DEAL binding profile includes copies of each DNA-encoded antibody binding agent bound to a particular AAV sample. In some embodiments, one or more parameters in the DEAL binding profile can be used to identify the AAV sample (e.g., a population of AAV capsids).

[0190] The pool of DNA-encoded antibody binding agents described herein may include any suitable number of DNA-encoded antibody binding agents. In some embodiments, the pool of DNA-encoded antibody binding agents includes at least 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , at least 10 20 Or more different DNA encoded antibody binding agents are included.

[0191] In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are about or at least 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 108 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , or 10 20 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 20 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 15 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 10 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 5 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 4 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 3 In some embodiments, in the methods described herein, one or more 3D molecular surface features of the AAV capsid are characterized by about 10 to about 10 2 The present invention is characterized by a DNA-encoded antibody binding agent.

[0192] DEALs described herein may use any suitable linker described herein. In some embodiments, the linker is a cleavable linker. The linker may be any moiety that serves to functionally link an antibody or an antigen-binding fragment thereof to a DNA barcode.

[0193] Linkers vary in structure and length and have at least two characteristics: (1) functional attachment to an antibody or antigen-binding fragment thereof, and (2) functional attachment to a DNA barcode. The nature of the chemical attachment is diverse, so any of a variety of chemical reactions can be utilized to achieve the designated functional attachment to both the compound and the DNA barcode. The size of the linker moiety can vary widely in terms of the length between the antibody or antigen-binding fragment and the DNA barcode. In some embodiments, the link is no longer than sufficient to provide the designated binding function. Thus, in some embodiments, the linker has a chain length of at least 1 to about 20 atoms.

[0194] The term "antibody" is used herein to refer to any antibody-like molecule having an antigen-binding region, including antibody fragments having an antigen-binding domain such as Fab', Fab, F(ab')2, single domain antibodies (DABs or VHH), TandAbs dimers, Fv, scFv (single chain Fv), dsFv, ds-scFv, Fd, linear antibodies, minibodies, diabodies, bispecific antibody fragments, bibodies, tribodies (scFv-Fab fusions, bispecific or trispecific, respectively); sc-diabodies; kappa (lambda) bodies (scFv-CL fusions); DVD-Ig (dual variable domain antibodies, bispecific format); SIP (small immune proteins, a type of minibody); SMIP ("small modular immunopharmaceutical" scFv-Fc dimers), DART (ds stabilized diabody "dual affinity retargeting"); small antibody mimetics comprising one or more CDRs, etc. The techniques for preparing and using various antibody-based constructs and fragments are well known in the art.

[0195] In some embodiments, the antibody is a monoclonal antibody. To prepare monoclonal antibodies useful in the present disclosure, mice or other suitable host animals are immunized with the desired form of antigen at appropriate intervals (e.g., twice weekly, once weekly, twice monthly, or once monthly). The animals may be administered a final "boost" of antigen within one week after sacrifice. During vaccination, it is often desirable to use an immune adjuvant. Suitable immune adjuvants include Freund's complete adjuvant, Freund's incomplete adjuvant, alum, Libya adjuvant, Hunter's Titermax, saponin adjuvants such as QS21 or Quil A, or CpG-containing immunostimulatory oligonucleotides. Other suitable adjuvants are well known in the art. Animals may be immunized subcutaneously, intraperitoneally, intramuscularly, intravenously, intranasally, or by other routes. A particular animal may be immunized with multiple forms of antigen by multiple routes. Briefly, a recombinant antigen of interest may be provided by expression using a recombinant cell line. The antigen of interest may be provided in the form of human cells expressing the antigen of interest on their surface. A recombinant form of the antigen of interest may be provided using any of the methods previously described. In accordance with immunotherapy, lymphocytes are isolated from the spleen, lymph nodes, or other organs of an animal and fused with a suitable myeloma cell line using an agent such as polyethylene glycol to form a hybridoma. After fusion, the cells are placed in a medium suitable for the growth of the hybridoma, but not the fusion partner, using standard methods, as described (Coding, Monoclonal Antibodies: Principles and Practice: Production and Application of Monoclonal Antibodies in Cell Biology, Biochemistry and Immunology, 3rd edition, Academic Press, New York, 1996). Following cultivation of the hybridoma, the cell supernatant is analyzed to determine the presence of the desired specificity, i.e., antibodies that selectively bind to the antigen. Suitable analytical techniques include ELISA, flow cytometry, immunoprecipitation, Western blotting, and the like.Other screening techniques are well known in the art, preferred techniques are those that confirm the binding of the antibody to a conformationally intact, natively folded antigen, such as non-denaturing ELISA, flow cytometry, immunoprecipitation, etc.

[0196] In particular, as is well known in the art, only a small portion of an antibody molecule, the paratope, is involved in binding the antibody to its epitope (see, e.g., Clark, WR (1986) The Experimental Foundations of Modern Immunology, Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th ed., Blackwell Scientific Publications, Oxford). For example, the Fc' and Fc regions are effectors of the complement cascade but are not involved in antigen binding. Antibodies whose pFc' region has been enzymatically cleaved or which have been produced without the pFc' region, designated F(ab')2 fragments, retain both antigen-binding sites of the intact antibody. Similarly, antibodies whose Fc region has been enzymatically cleaved or which have been produced without the Fc region, designated Fab fragments, retain one of the antigen-binding sites of the intact antibody molecule. Furthermore, a Fab fragment consists of a covalently bound antibody light chain and a portion of the antibody heavy chain, designated Fd, which is the primary determinant of antibody specificity (a single Fd fragment can bind up to 10 different light chains without altering antibody specificity) and which retains epitope binding ability when isolated.

[0197] Thus, in some embodiments, the antibody or antigen-binding fragment thereof in the methods described herein refers to F(ab')2, Fab, Fv and Fd fragments. Antibodies can be fragmented using conventional techniques. For example, F(ab')2 fragments can be generated by treating the antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bonds to obtain Fab' fragments. Papain digestion can lead to the formation of Fab fragments. Fab, Fab' and F(ab')2, scFv, Fv, dsFv, Fd, dAb, TandAb, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be synthesized recombinantly or chemically. Techniques for generating antibody fragments are well known in the art and described in the literature. For example, Beckman et al., 2006; Holliger & Hudson, 2005; Le Gall et al., 2004; Reff & Heard, 2001, Reiter et al., 1996, and Young et al., 1995 each further describe and enable the generation of effective antibody fragments. The various antibody molecules and fragments may be derived from any of the commonly known immunoglobulin classes, including but not limited to IgA, secretory IgA, IgE, IgG, and IgM. IgG subclasses are also well known to those skilled in the art and include but are not limited to human IgG1, IgG2, IgG3, and IgG4.

[0198] The antibodies or antigen-binding fragments thereof described herein also include so-called single chain antibodies. The term "single domain antibody" (sdAb) or "VHH" refers to a single heavy chain variable domain of a type of antibody found in mammals of the Camelidae family that does not naturally have a light chain. Such VHHs are also called "nanobodies®". According to the present invention, the sdAb may in particular be a llama sdAb.

[0199] In some embodiments, the antibody is an antibody or antigen-binding fragment thereof that targets one or more AAV capsid proteins or fragments thereof, hi some embodiments, the antibody or antigen-binding fragment thereof is a neutralizing antibody or fragment thereof.

[0200] The antibodies or antigen-binding fragments thereof described herein may target a protein target, a carbohydrate target, or a glycosylated protein. For example, the antibodies may target a glycosylated group on an AAV capsid protein.

[0201] In some embodiments, DNA-encoded antibody binding agents are also referred to as binding antibodies or "DNAbs."

[0202] The present disclosure also relates to antibodies bound to at least one nucleic acid molecule (e.g., DNA barcodes) and their use for characterizing 3D molecular surface features of AAV capsids. Specifically, the present disclosure relates to antibodies (named DNAbs) that use DNA barcodes to detect 3D molecular surface features of AAV capsid variants in a sample. The claimed method is based at least in part on the recognition capabilities of antibodies and relies on the general idea that each antibody is associated with a different oligonucleotide DNA barcode, allowing multiple AAV capsids in a sample to be revealed and quantified.

[0203] Thus, in one aspect, the present disclosure provides a method for the preparation of a linker (e.g., at least one nucleic acid molecule comprising an enzyme-cleavable sequence (CL)) and a DNA barcode having the sequence N1N2N3N4N n (wherein N represents a nucleotide and n is an integer greater than 4).

[0204] In one embodiment, the antibody or antibody combination can distinguish between active and inactive forms of AAV particles.Therefore, the use of such antibodies may be particularly relevant to determine whether the aforementioned AAV mutants are activated.Therefore, DNAb can be used as a sensor and may find various applications for screening the infectivity of AAV mutants.

[0205] [Characterization of the 3D molecular surface features of AAV capsids using phage display libraries] Phage display libraries, which express transgenic peptides on the surface of bacteriophage, were originally developed to map epitope binding sites on immunoglobulins. Such libraries can be generated by inserting random oligonucleotides into cDNAs encoding phage surface proteins, generating a collection of phage particles displaying unique peptides in a permutation.

[0206] This system has been used to identify endothelial cell surface markers expressed in mice, in addition to identifying individual targeting peptides selective for organs, tissues, or cell types. Attaching therapeutic agents to the targeting peptides allows for selective delivery of the agent to the organ, tissue, or cell type of interest in mouse model systems. Targeted delivery of chemotherapeutic drugs and pro-apoptotic peptides to receptors located in tumor angiogenic structures significantly improves therapeutic efficacy and reduces systemic toxicity in tumor-bearing mouse models.

[0207] Previous in vivo methods of phage display screening have had a relatively high background of non-specific phage binding. This was especially true for tissues belonging to the reticuloendothelial system. Improved methods of phage display that reduce non-specific phage binding while maintaining the specific interaction between the target peptide and the cellular receptor are needed. There is also a need to target receptors of specific cell populations within an organ, tissue, or cell type. Often tissues and organs can contain very heterogeneous populations of different cell types. There is a need to be able to target phage display screening to specific cell populations.

[0208] Identification of previously unknown receptors and previously uncharacterized ligands has been a time-consuming and labor-intensive process. These new receptors and ligands may form the basis of new methodologies for affinity-based surface mapping using phage display.

[0209] Thus, in one aspect, a library of viral particles is provided comprising a plurality of viral particles displaying a plurality of different fusion proteins on their surface, each fusion protein comprising at least a portion of a filamentous phage coat protein of protein III or protein VIII and a heterologous polypeptide, said heterologous polypeptide being fused to the carboxyl terminus of said filamentous phage coat protein.

[0210] The claimed libraries and methods solve a long-standing need in the art by providing compositions and methods for identifying and using target peptides selective for the 3D surface of AAV capsid mutants. In some embodiments, the methods relate to Biopanning and Rapid Analysis of Selective Interaction Ligands (BRASIL), a novel method of phage display that reduces background non-specific phage binding while maintaining selective binding of phages to the 3D surface of AAV capsid mutants. In some embodiments, the target peptides are identified by exposing a subject to a phage display library, collecting a sample of one or more AAV capsid mutant libraries, separating the sample into isolated AAV particles and phages suspended in an aqueous phase, overlaying the aqueous phase with an organic phase, centrifuging the two phases to pellet the AAV-phage complexes to the bottom of the centrifuge tube, and collecting the AAV-phage complexes from the pellet. In some embodiments, the organic phase is dibutyl phthalate.

[0211] In some embodiments, phage that bind to a specific AAV capsid variant may be pre-screened or post-screened against a purified specific AAV capsid variant (which may approach 100% purity). Phage that bind to a purified specific AAV capsid variant may be sequenced and used as a combinatorial DNA signature to identify this specific AAV capsid variant.

[0212] In some embodiments, target phages may be recovered from one or more AAV capsid mutant libraries after mixing and incubation using droplet and / or single cell sequencing techniques, which allow for sequencing of individual AAV aptamer complexes in large quantities and with high sequencing accuracy.

[0213] In some embodiments, a phage display library is prepared that displays antigen-binding portions of the 3D surface of the AAV capsid mutant from the library, and the library is screened against one or more 3D surfaces of the AAV capsid mutant, and phages that bind to the antigen are collected. In a more preferred embodiment, the antigen is a combination of 3D peptides derived from the 3D surface of the AAV capsid mutant.

[0214] In some embodiments, the methods and compositions may be used to identify one or more 3D surface antigens on the 3D surface of an AAV capsid mutant, hi some embodiments, the compositions and methods may be used to identify naturally occurring 3D surface antigens on the 3D surface of a known or newly identified AAV capsid mutant.

[0215] In some embodiments, the method may include contacting a partial AAV capsid that is part of an AAV capsid mutant library. In alternative embodiments, the target peptide may comprise a random amino acid sequence.

[0216] A person skilled in the art can understand that the contacting step can utilize a complete AAV capsid mutant or a partially complete AAV capsid mutant. In some embodiments, the AAV particles contacted can be genetically engineered to express a recombinant peptide of the target peptide. In some embodiments, the target peptide is modified with a reactive moiety that allows covalent attachment to the 3D surface of the AAV capsid mutant. In some embodiments, the reactive moiety is a photoreactive group that covalently binds to a receptor when activated by light. In some embodiments, the peptide is attached to a solid support and the receptor is purified by affinity chromatography. In some embodiments, the solid support comprises magnetic beads, sepharose beads, agarose beads, nitrocellulose membrane, nylon membrane, column chromatography matrix, high performance liquid chromatography (HPLC) matrix, or high performance liquid chromatography (HPLC) matrix. A person skilled in the art can understand that the activity of the AAV capsid mutant can be assayed by various methods known in the art, including but not limited to catalytic activity, binding activity, and TCID50 assay.

[0217] In some embodiments, the disclosed methods and compositions allow for the identification of one or more AAV capsid mutants of interest. One or more target peptides that mimic part or all of the naturally occurring 3D surface of the AAV capsid mutant may be identified by in vivo or in vitro phage display and biopanning.

[0218] In some embodiments, the 3D molecular surface characteristics of the AAV capsid indicate an affinity profile and / or a neutralization profile (e.g., the ability to evade neutralizing antibodies).

[0219] [Library enrichment methods for characterizing 3D molecular surface features of AAV capsids] Further provided herein is a method of enriching a binding library for characterizing 3D molecular surface features of AAV capsids, comprising: (a) contacting a pool of binding agents with a first population of AAV capsids; and (b) enriching a subpool of binding agents that bind to the first population of AAV capsids, thereby enriching the binding library for characterizing 3D molecular surface features of AAV capsids.

[0220] In some embodiments, the method further comprises (c) contacting the subpool of binding agents that bind to the first population of AAV capsids with a second population of AAV capsids; and (d) selecting a group of binding agents that have preferential affinity for the AAV capsid population by depleting the second subpool of aptamers that show affinity for the second population of AAV capsids.

[0221] In some embodiments, the positive and negative selection is repeated about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more times.

[0222] The pool of binding agents described herein may include any suitable number of binding agents. In some embodiments, the pool of binding agents includes at least 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 One or more binders may be included.

[0223] The subpools of binding agents described herein may include any suitable number of binding agents. In some embodiments, the subpools of binding agents include at least 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 One or more binders may be included.

[0224] The first and / or second population of AAV capsids described herein may comprise any suitable number of AAV capsids. In some embodiments, the first and / or second population of AAV capsids comprises at least 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 The nucleic acid sequence includes one or more AAV capsids.

[0225] Any suitable binding library described herein or known in the art can be enriched using the methods described herein, in some embodiments, the library of binding agents is an aptamer library, a DNA-encoded chemical library (DECL), a phage display library, or a DNA-encoded antibody library (DEAL).

[0226] In some embodiments, the first and / or second population of AAV capsids include one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVhu.37, AAVrh.8, AAVrh.10, AAVrh.39, AAV11, AAV12, and AAV13, or combinations thereof. In some embodiments, the first and / or second population of AAV capsids include other variants resulting from mutation, peptide insertion, or shuffling.

[0227] In some embodiments, the 3D molecular surface features are binding profiles of the library, hi some embodiments, the binding profile is the number, sequence, and copy number of bound binding agents.

[0228] In some embodiments, the 3D molecular surface characteristics of the AAV capsid indicate an affinity profile and / or a neutralization profile (e.g., the ability to evade neutralizing antibodies).

[0229] Further provided herein is a kit comprising the enriched combinatorial library described herein. Also provided is a kit for carrying out the enrichment of the combinatorial library described herein. Also provided is a kit for carrying out the characterization of the 3D molecular surface features of the AAV capsid described herein. In some embodiments, the kit includes one or more of a buffer, a primer, a probe, a fluorophore, a quencher, an aptamer, a DNA-encoded chemical binder, a DNA-encoded antibody binder, and an AAV sample. In some embodiments, the kit also includes a manual for carrying out the method described herein.

[0230] [Example] The invention is further described in the following examples, which, however, do not limit the scope of the invention described in the claims. EXAMPLES

[0231] Example 1: Mapping 3D features of AAV capsids using aptamer libraries Materials and Methods In the examples below, the following materials and methods were used:

[0232] DPBS buffer (1.47 mM KH2PO4, 8 mM Na2HPO4, 138 mM NaCl, 2.67 mM KCl, 0.5 mM MgCl2, 0.9 mM CaCl2, pH 7.4) was used for screening of the aptamer library. Screening was performed at room temperature.

[0233] A representative aptamer from the linear aptamer library is shown in Figure 1A. A representative aptamer from the cyclic aptamer library is shown in Figure 1B.

[0234] The enrichment of the aptamer library was carried out as follows.

[0235] Week 1: The circular aptamer library was enriched against AAV Mix 01. Three rounds of enrichment were performed to obtain Pool-1, Pool-2, and Pool-3, respectively.

[0236] Round 1: a) 5OD of the library was dissolved in 450μL of DPBS buffer. Renaturation was performed in a PCR machine. b) The renatured library was filtered using an Amicon (100 kDa) system. c) The filtered liquid was transferred to a 2 mL Eppendorf tube and added to 50 μL of the AAV mixture (aptamer to viral particle ratio of 10:1 or higher) and incubated for 1 h at room temperature on a shaker. d) After incubation, the mixture was filtered using an Amicon system. e) The AAV-aptamer complexes were washed three times with 450 μL of DPBS buffer (wash 1, wash 2, wash 3). f) The AAV-aptamer complexes were resuspended in 200 μL of DPBS and collected in a 1.5 mL centrifuge tube. g) Heat in a boiling water bath for 10 minutes (elution). H) The eluted products were amplified by electric field-driven polymerase chain reaction (ePCR) for 8 to 12 cycles, followed by SDS-PAGE electrophoresis and dialysis to obtain single-stranded library pool-1. i) The concentration of Pool-1 was measured by OD260.

[0237] The procedure for the second and third rounds of enrichment was the same as that of the first round, with 0.1 OD of aptamers used in each round. The resulting pool-2 and pool-3 were sequenced. The screening and enrichment of the aptamer library are shown in Figure 2A.

[0238] Week 2: The circular aptamer library was enriched against AAV Mix 02. Three rounds of enrichment were performed to obtain Pool-4, Pool-5, and Pool-6, respectively. The procedures of the first, second, and third rounds of enrichment were the same as those of the enrichment in week 1. The screening and enrichment of the aptamer library are shown in Figure 2B.

[0239] Week 3: The linear aptamer library was enriched against AAV Mix 01. Three rounds of enrichment were performed to obtain Pool-7, Pool-8, and Pool-9, respectively. The procedures for the first, second, and third rounds of enrichment were the same as those for week 1 enrichment.

[0240] Week 4: The linear aptamer library was enriched against AAV Mix 02. Three rounds of enrichment were performed to obtain Pool-10, Pool-11 and Pool-12, respectively. The procedures for the first, second and third rounds of enrichment were the same as those for the first week of enrichment.

[0241] Samples of AAV Mix 01 and AAV Mix 02 are shown in Table 1.

[0242] [Table 1] Details of library screening and enrichment are shown in Table 2.

[0243] [Table 2] TIFF2025514322000004.tif119170

[0244] [Table 3] Below are the DNA primer sequences used to sequence each enrichment pool. For example, LibP1S021 is the forward sequencing primer for the sample labeled Pool 01-1 (see Table 3 above). LibP1S025 is the primer sequence for the blank control sample.

[0245] LibP1 Sample LibP1S021 ATATCATTCAGCACTCCACGCATAGC Pool 1 sequence primer LibP1S022 ATCTCCTTCAGCACTCCACGCATAGC Pool 2 sequence primer LibP1S023 ATGTCGTTCAGCACTCCACGCATAGC Pool 4 sequence primer LibP1S024 ATTTCTTTCAGCACTCCACGCATAGC Pool 5 sequence primer LibP1S025 CAATGATTCAGCACTCCACGCATAGC Mix 1 Sequence primer.

[0246] LibTOR Sample LibTORS021 ATATCACCTCTCTATGGGCAGTCGGTGAT Pool 7 sequence primer LibTORS022 ATCTCCCCTCTCTATGGGCAGTCGGTGAT Pool 8 sequence primers LibTORS023 ATGTCGCCTCTCTATGGGCAGTCGGTGAT Pool 10 sequence primers LibTORS024 ATTTCTCCTCTCTATGGGCAGTCGGTGAT Pool 11 sequence primer LibTORS025 CAATGACCTCTCTATGGGCAGTCGGTGAT Mix 2 sequence primer.

[0247] [Enrichment of the same aptamer library against two different AAV samples] Figure 6 shows the results of enrichment of the same circular aptamer library for two different AAV samples (AAV Mix 01 and AAV Mix 02) and the distribution of shared aptamer sequences between the enriched libraries for the two samples. The results of two rounds of enrichment are shown, and the enrichment was repeated in two parallel experiments.

[0248] Specifically, in the first parallel experiment, there were 161 enriched aptamers with counts greater than 50 in either enrichment round. In the second parallel experiment, there were 172 enriched aptamers with counts greater than 50 in either enrichment round. These results indicate good reproducibility of the enrichment of the aptamer library.

[0249] In the enrichment of the circular aptamer library against AAV Mix01, there were 80 aptamers enriched after the second round of enrichment in the first parallel experiment and 86 aptamers enriched after the second round of enrichment in the second parallel experiment, indicating good reproducibility of the enrichment.

[0250] In the enrichment of the circular aptamer library against AAV Mix 02, there were 69 aptamers enriched after the second round of enrichment in the first parallel experiment and 73 aptamers enriched after the second round of enrichment in the second parallel experiment, indicating good reproducibility of the enrichment.

[0251] Enrichment of the same linear aptamer library was performed on two different AAV samples (AAV Mix 01 and AAV Mix 02), and the distribution of shared aptamer sequences between the enriched libraries for the two samples was analyzed. The results of two rounds of enrichment are shown, and the enrichment was repeated in two parallel experiments.

[0252] Specifically, in the first parallel experiment, there were 49 enriched aptamers with counts greater than 50 in both enrichment rounds. In the second parallel experiment, there were 49 enriched aptamers with counts greater than 50 in both enrichment rounds. These results indicate good reproducibility of the enrichment of the aptamer library.

[0253] For the enrichment of the linear aptamer library against AAV Mix01, there were 45 aptamers enriched after the second round of enrichment in the first parallel experiment and 41 aptamers enriched after the second round of enrichment in the second parallel experiment, indicating good reproducibility of the enrichment.

[0254] For the enrichment of the linear aptamer library against AAV mix 02, 45 aptamers were enriched after the second round of enrichment in the first parallel experiment and 40 aptamers were enriched after the second round of enrichment in the second parallel experiment, indicating good reproducibility of the enrichment.

[0255] In conclusion, the number of aptamer sequences shared between enriched aptamer libraries for two different AAV samples remained relatively constant across multiple parallel experiments, indicating that enrichment of AAV sample-specific aptamer libraries was reproducible and effective.

[0256] Next, we analyzed the counts of aptamer sequences shared between the enriched aptamer libraries for the two different AAV samples to examine their ability to distinguish between the two AAV samples.

[0257] As shown in Figures 7A-7B, the counts of shared circular aptamer sequences in each enriched aptamer library are significantly different (p values ​​of 9.9x10 for the first and second rounds, respectively). -12 and 3.8x10 -12 (It is.)

[0258] As shown in Figures 7C-7D, the counts of shared linear aptamer sequences in each enriched aptamer library are significantly different (p-values ​​for the first and second rounds are 0.02 and 0.01, respectively).

[0259] [Data Quality Analysis] The quality of the enriched aptamer library was evaluated, and the results are shown in Table 4. Specifically, the percentage of aptamer sequences whose lengths were outside the range of 36 to 45 bp was calculated.

[0260] [Table 4] For the enriched aptamers, the distribution of counts and the number of sequences corresponding to the counts are plotted for each of the enriched circular and linear libraries. Figures 8A-8B show the enrichment distributions of the enriched circular library in the first and second rounds, respectively. Figures 9A-9B show the enrichment distributions of the enriched linear library in the first and second rounds, respectively. Based on these data, it is reasonable to set the cutoff value of the enriched aptamer counts at 50 for further analysis. EXAMPLES

[0261] Example 2: Mapping 3D features of the AAV capsid using DNA-encoded libraries (DELs) Materials and Methods In the examples below, the following materials and methods were used: Figures 10-13 show a schematic of the enrichment of the DECL library described herein.

[0262] The aptamer library was screened and enriched against the AAV target using DPBS buffer (1.47 mM KH2PO4, 8 mM Na2HPO4, 138 mM NaCl, 2.67 mM KCl, 0.5 mM MgCl2, 0.9 mM CaCl2, pH 7.4). Screening was performed at room temperature.

[0263] Specifically, one tube of the DEL library (3.23 nmol / tube) was centrifuged at 12,000 rpm for 10 minutes and dissolved in 150 μL of DPBS. The dissolved DEL library was allowed to dissolve overnight at 4°C.

[0264] Four AAV samples were used for enrichment: wild-type AAV2, an AAV2 mutant with a single point mutation, AAV2.7m8, wild-type AAV9, and an AAV9 mutant with a single point mutation, AAV-PHP.eB. Two tubes (50 μL per tube) were used for each sample, and 100 μL of each sample was obtained.

[0265] Label 13 centrifuge tubes (2 mL each) as tubes 1 to 13. Add 460 µL of DPBS and 10 µL of DEL library to each tube. Add 30 µL of AAV sample to each tube, as shown in Table 5.

[0266] [Table 5] 500 μL of liquid from each independent group was added to a 100 kDa Amicon Ultra-0.5 system, filtered, and centrifuged at 14000 g for 5 min. After centrifugation, 450 μL of DPBS was added to each tube and mixed gently. The mixtures were incubated for 30 min and then centrifuged at 14000 g for 5 min. This washing step was repeated twice, so that each sample was washed three times in total.

[0267] After the washing step, about 30 μL of the AAV-DEL mixture in each ultracentrifuge tube was collected for PCR amplification. The forward primer (primer F) (4 nmol / tube) and reverse primer (primer R) (4 nmol / tube) were taken from the kit, centrifuged at 12000 rpm for 10 minutes, and dissolved in 400 μL of ddH2O. 10 μM of each primer was obtained.

[0268] The AAV-DEL mixture obtained in the above steps was used as a template for PCR amplification. The PCR reaction is shown in Table 6.

[0269] [Table 6] The PCR amplification conditions are shown in Table 7.

[0270] [Table 7] The PCR products were purified using the QIAGEN-MinElute kit (QIAGEN, 28006). 10 μL of purified product was obtained from each reaction. The tubes were labeled as independent groups 1 to 13.

[0271] The packing list of the DEL kit is shown in Figure 14. The protocol of the QIAGEN-MinElute kit is shown below.

[0272] MinElute PCR Purification Kits (Part Nos. 28004 and 28006) can be stored at room temperature.

[0273] Unless otherwise specified on the label, the product can be stored for up to 12 months at 15-25°C. Upon arrival, the spin columns should be stored at 2-8°C.

[0274] Before you begin: This protocol is for cleanup of up to 5 µg of PCR product (70 bp - 4 kb). Add ethanol (96-100%) to Buffer PE before use (see bottle label for volume). All centrifugation steps are performed at 17,900 x g (13,000 rpm) at room temperature (15-25 °C) using a conventional benchtop microcentrifuge. Add 1:250 volume of pH indicator I to Buffer PB. Add pH indicator I to entire contents of buffer. Do not add pH indicator I to aliquots of buffer. The yellow color of Buffer PB with pH indicator I indicates pH 5, 7.5. DNA adsorption to membranes is efficient only at pH 5 and 7.5.

[0275] NOTE: If the purified PCR products are to be used in high-sensitivity microarray applications, it is effective to use buffer PB without adding pH indicator I.

[0276] Table 8 below shows the quality check of the PCR products before and after purification.

[0277] [Table 8]

[0278] [Enriched DEL library for AAV samples] Four AAV sample groups were used in this experiment: wild-type AAV2, the AAV2 mutant with a single point mutation AAV2.7m8, wild-type AAV9, and the AAV9 mutant with a single point mutation AAV-PHP.eB. Three parallel experiments were performed for each AAV sample group, and control samples were also included. Each of the 13 groups of samples was 14 Each group was incubated with the same DEL library consisting of candidates. Candidates that bound to each group were sequenced and the results are shown in Table 9.

[0279] [Table 9] In Table 9, the "1 Sample Enriched" column indicates the number of DEL barcodes obtained from one of the three samples, the "2 Sample Enriched" column indicates the number of DEL barcodes obtained from two of the three samples, and the "3 Sample Enriched" column indicates the number of DEL barcodes obtained from all three samples.

[0280] Figure 15 shows the Venn diagram of the DEL barcodes sequenced from each group. The 1056 duplicated sequences obtained from two or three samples of each group were further analyzed with clustering analysis. The results are shown in Figures 16A-16D. The clustering analysis was performed using principal component analysis (PCA). The sequences of the enriched DEL barcodes were projected into five dimensions, and in the first experiment in which the duplicated sequences obtained from two or three samples of each group were analyzed, 31% of the data on the first axis fell into the first principal component (PC), 12% fell into the second PC, 10% fell into the third PC, 8% fell into the fourth PC, and 7% fell into the 5% PC. The explained variance ratios of the first five principal components (PCs) are [0.31003056 0.12142214 0.10250243 0.08667515 0.07822148]. In the second experiment, in which duplicated sequences from two samples from each group were analyzed, 36% of the data on the first axis fell into the first principal component (PC), 13% into the second PC, 10% into the third PC, 8% into the fourth PC, and 5% into the fifth PC. The explained variance ratios of the first five PCs are [0.36153258 0.13173036 0.10887119 0.08723116 0.05947605].

[0281] [Other embodiments] While the present invention has been described in conjunction with its detailed description, it is to be understood that the foregoing description is intended to illustrate, but not to limit, the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

[0282] [Additional embodiments] Embodiment A1. A viral particle library comprising a plurality of viral particles displaying a plurality of different fusion proteins on their surface, each of said fusion proteins comprising at least a portion of a filamentous phage coat protein of protein III or protein VIII and a heterologous polypeptide, wherein said heterologous polypeptide is fused to the carboxyl terminus of said filamentous phage coat protein.

[0283] Embodiment A2. The library of embodiment A1, wherein the fusion protein comprises a full-length phage coat protein.

[0284] Embodiment A3. The library of embodiment A1, wherein the phage coat protein is a wild-type protein.

[0285] Embodiment A4. The library of embodiment A1, wherein the heterologous polypeptide comprises from about 4 to about 80 amino acid residues.

[0286] Embodiment A5. The library of embodiment A1, wherein the heterologous polypeptide comprises at least about 100 amino acid residues.

[0287] Embodiment A6. The library of embodiment A1, wherein the heterologous polypeptide is attached to the coat protein via a linker peptide.

[0288] Embodiment A7. The library of embodiment A6, wherein the linker peptide has from about 4 to about 30 residues.

[0289] Embodiment A8. The library of embodiment A7, wherein the linker peptide has from about 8 to about 20 residues.

[0290] Embodiment A9. The library of embodiment A6, wherein about 50% or more of the residues in the linker peptide are glycine or serine.

[0291] Embodiment A10. The library of embodiment A1, wherein the filamentous phage is selected from the group consisting of M13, fl, and fd filamentous phage.

[0292] Embodiment A11. A composition comprising modified AAV capsid proteins, including AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and other variants derived from mutation, peptide insertion, or shuffling.

[0293] Embodiment A12. A pharmaceutical formulation comprising the composition of embodiment A11, further comprising one or more pharma- ceutically acceptable carriers, buffers, diluents, or excipients.

[0294] Embodiment A13. A nucleic acid vector comprising a nucleic acid segment encoding a modified AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and other variants resulting from mutation, peptide insertion, or shuffling.

[0295] Embodiment A14. The nucleic acid vector of embodiment A13, wherein the nucleic acid segment is integrated into a host cell.

[0296] Embodiment A15. The nucleic acid vector of embodiment A14, wherein the host cell is a mammalian cell.

[0297] Embodiment A16. A pharmaceutical formulation comprising a host cell according to embodiment A14, further comprising one or more pharma- ceutically acceptable carriers, buffers, diluents or excipients.

[0298] Embodiment A17. A method for enriching barcoded constructs from a sequence library generated from a plurality of AAV particles or phage viruses, comprising targeting one or more AAV particle identification barcodes and / or target transcripts to capture DNA library molecules from the library.

[0299] Embodiment A18. The method of embodiment A17, in which an AAV variant library of any size, from a library containing one type of AAV variant to a library containing many different types of AAV variants, is mixed with a phage display library, any phage display library for affinity screening.

[0300] Embodiment A19. A method for identifying genomes of AAV particles from at least one phage virus or subpopulation of phage viruses, the method comprising enriching library molecules from at least one phage virus or subpopulation of phage viruses based on one or more unique AAV particle identification barcodes, wherein the targeted barcodes identify transcripts of a single phage represented in a sequencing library. The method of embodiment A18.

[0301] Embodiment A20. a) simultaneously capturing AAV particle genome sequences and phage DNA library molecules from a mixture of AAV libraries and phage display libraries by single droplet sequencing and / or improved single cell sequencing techniques; b) sequencing the captured DNA library molecules containing the AAV capsid genomic sequence and the phage genomic sequence; and c) identifying AAV particle-specific barcodes associated with the captured phage DNA library molecules; and d) capturing phage DNA library molecules from the phage display library by targeting the identified AAV particle identification barcodes; and Including, The method of any one of embodiments A17 to A19, thereby enriching for phage DNA constructs associated with a single AAV variant.

[0302] Embodiment A21. The method of any one of embodiments A17 to A20, wherein capture comprises PCR amplification of one or more AAV particles and phage DNA library molecules with a primer pair complementary to each of the one or more AAV particles and phage DNA library molecules, the primer pair having one primer that comprises a sequence complementary to all or a portion of the AAV particle and phage identification barcode, or one primer that comprises a sequence complementary to a target transcript sequence for each of the one or more AAV particles and phage DNA library molecules.

[0303] Embodiment A22. The method of any one of embodiments A17-A21, wherein capture comprises PCR amplification of one or more AAV particles and phage DNA library molecules specific for a single or subpopulation of at least one of the AAV mutant library and the phage display library.

[0304] Embodiment A23. The method of embodiment A22, wherein PCR amplification comprises contacting the library with a 5' primer and a 3' primer and amplifying library molecules comprising unique barcodes of single AAV particles and phage DNA, wherein the 5' primer or the 3' primer comprises a nucleotide sequence complementary to the unique barcodes of single viral genomes from the AAV mutant library and the phage display library, thereby obtaining multiple transcription products from the single AAV particle and phage DNA.

[0305] Embodiment A24. a) the 5' primer comprises a nucleotide sequence complementary to a 5' universal primer site contained in each library molecule and a nucleotide sequence complementary to the unique barcode, and the 3' primer comprises a nucleotide sequence complementary to a 3' universal primer site contained in each library molecule; or b) the 5' primer comprises a nucleotide sequence complementary to a 5' universal primer site contained in each library molecule, and the 3' primer comprises a nucleotide sequence complementary to a 3' universal primer site contained in each library molecule and a nucleotide sequence complementary to the unique barcode; c) the 5' primer comprises a nucleotide sequence complementary to a 5' universal primer site that is different from the 5' universal primer site contained in each library molecule and a nucleotide sequence complementary to the unique barcode, and the 3' primer comprises a nucleotide sequence complementary to a 3' universal primer site contained in each library molecule; Or, The method of embodiment A23, wherein d) the 5' primer comprises a nucleotide sequence complementary to a 5' universal primer site contained in each library molecule, and the 3' primer comprises a nucleotide sequence complementary to a 3' universal primer site that is different from the 3' universal primer site contained in each library molecule and a nucleotide sequence complementary to the unique barcode.

[0306] Embodiment A25. The method of any one of embodiments A1-A24, wherein single or combinations of AAV variant capsids are identified by a combination index of any combination of phage display DNA and / or peptide sequences, said combination index representing different binding affinities between any AAV variant particle and its corresponding phage virus, which may differ in binding affinity.

[0307] Embodiment A26. The method of embodiment A25, wherein the combined index of phage-displayed DNA and / or peptide sequences of any AAV mutant particle is used as training and test data for computational prediction of other AAV capsid affinities using various deep learning algorithms.

[0308] Embodiment A27. Enzyme-cleavable sequence (CL) and DNA barcode sequence N1N2N3N4N n wherein N represents a nucleotide and n represents an integer greater than 4.

[0309] Embodiment A28. The antibody of embodiment A27, wherein the antigen-binding domain, such as a monoclonal antibody, Fab', Fab, F(ab')2, is selected from the group consisting of antibody fragments, single domain antibodies (DAB or VHH), TandAbs dimers, Fv, scFv (single chain Fv), dsFv, ds-scFv, Fd, linear antibodies, minibodies, diabodies, bispecific antibody fragments, bibodies, tribodies (scFv-Fab fusions, bispecific or trispecific, respectively); sc-diabodies; kappa (lambda) bodies (scFv-CL fusions); DVD-Ig (dual variable domain antibodies, bispecific format); SIP (small immune proteins, a type of minibody); SMIP ("small modular immunopharmaceutical" scFv-Fc dimers), DART (ds stabilized diabody "dual affinity retargeting"); small antibody mimetics comprising one or more CDRs.

[0310] Embodiment A29. The antibody of embodiment A28 which is a monoclonal and / or multiclonal antibody.

[0311] Embodiment A30. The antibody of embodiment A27, wherein the nucleic acid molecule is attached to an acceptor glutamine residue present in the antibody via a linking reagent.

[0312] Embodiment A31. A linking reagent is used to link an enzyme-cleavable sequence (CL) and the sequence N1N2N3N4N of the DNA barcode n wherein N represents a nucleotide and n represents an integer greater than 4.

[0313] Embodiment A32. The antibody of any one of embodiments A27 to A31, wherein the linker is covalently attached to the side chain of an acceptor glutamine within the primary sequence of the antibody.

[0314] Embodiment A33. The antibody of any one of embodiments A27-A32, wherein the linker is covalently attached to the side chain of an amino acid in the CH2 domain.

[0315] Embodiment A34. The antibody of any one of embodiments A27 to A33, wherein the acceptor glutamine is within an enzyme recognition tag fused to the C-terminus of the CH3 domain.

[0316] Embodiment A35. The antibody of any one of embodiments A27 to A34, wherein the acceptor glutamine is within an enzyme recognition tag fused to the C-terminus of the Cκ domain.

[0317] Embodiment A36. The antibody of embodiment A35, wherein the acceptor glutamine is within the primary sequence of CH2 at a position corresponding to residue Q295 according to Kabat EU numbering.

[0318] Embodiment A37. The antibody of any one of embodiments A27 to A36, wherein the CH2 domain does not contain an N-linked glycosylation.

[0319] Embodiment A38. The antibody of any one of embodiments A27 to A36, wherein the CH2 domain comprises an N-linked glycosylation.

[0320] Embodiment A39. The antibody of any one of the preceding embodiments, comprising a functionalized acceptor glutamine having formula IVa. (Q)-NH-(C)-(CL-(P 1 -ZP 2 )) q Formula IVa Where: -Q is a glutamine residue present in the antibody. -C is a bond or linking moiety. -q is an integer selected from 1, 2, 3, or 4. -CL is an enzyme-cleavable nucleic acid sequence. -P 1is independently absent or a nucleic acid having at least 10 nucleotides. -Z is the DNA barcode sequence N1N2N3N4N n where N represents a nucleotide and n represents an integer greater than 4. -P 2 is independently absent or a nucleic acid having at least 10 nucleotides.

[0321] Embodiment A40. The antibody of any one of the previous embodiments, comprising a functionalized acceptor glutamine residue having Formula IVb. (Q)-NH-(C)-((M)) q Formula IVb Where: -Q is a glutamine residue present in the antibody. -C is a bond or linking moiety. -q is an integer selected from 1, 2, 3, or 4. -M is independently (RR')-C'-(CL'-(P 1 -ZP 2 ) q’ It is. -where: -(RR') is the addition product between R and the complementary reactive group R'. -C' is a bond or linking moiety. -CL' is an enzyme-cleavable nucleic acid sequence. -P 1 is independently absent or a nucleic acid having at least 10 nucleotides. -Z is the DNA barcode sequence N1N2N3N4N n where N represents a nucleotide and n represents an integer greater than 4. -P 2 is independently absent or a nucleic acid having at least 10 nucleotides. -q' is an integer selected from 1, 2, 3, or 4.

[0322] Embodiment A41. A linking reagent having the general formula Ia, or an antibody-bound linking reagent. G-NH-C-(CL-(P1 -ZP 2 )) q Formula Ia Where: -G is H, an amine protecting group, or an antibody or antibody fragment attached via an amide bond upon conjugation. -C is a bond or linking moiety. -q is an integer selected from 1, 2, 3, or 4. -CL' is independently absent or is an enzyme-cleavable nucleic acid sequence. -P 1 is independently absent or a nucleic acid having at least 10 nucleotides. -Z is the DNA barcode sequence N1N2N3N4N n where N represents a nucleotide and n represents an integer greater than 4. -P 2 is independently absent or a nucleic acid having at least 10 nucleotides.

[0323] Embodiment A42. The antibody or linking reagent of any one of embodiments A39 to A41, wherein C is a substituted or unsubstituted alkyl or heteroalkyl chain, optionally where any carbon in the chain is substituted with alkoxy, hydroxyl, alkylcarbonyloxy, alkyl-S-, thiol, alkyl-C(O)S-, amine, alkylamine, amide, or alkylamide.

[0324] Embodiment A43. C is the unit -(C n The antibody or linking reagent of any one of embodiments A39 to A41, comprising -XL-. Here, (C) nis a substituted or unsubstituted alkyl or heteroalkyl chain, preferably where any carbon in the chain is substituted with alkoxy, hydroxyl, alkylcarbonyloxy, alkyl-S-, thiol, alkyl-C(O)S-, amine, alkylamine, amide, or alkylamide. n is an integer selected from the range of 2 to 20. X is NH, O, S, absent, or a bond. L is independently absent, a bond, or a continuation of bonds, or a carbon-containing framework of 5-200 atoms substituted with one or more atoms. Preferably, the carbon-containing framework comprises a linear framework of 5-30 carbon atoms substituted with one or more atoms. Preferably, the carbon-containing framework is a linear hydrocarbon, a symmetrically or asymmetrically branched hydrocarbon, a monosaccharide, a disaccharide, a linear or branched oligosaccharide (asymmetrically or symmetrically branched), other naturally occurring linear or branched oligomer (asymmetrically or symmetrically branched), or a dimer, trimer, or higher oligomer (linear, asymmetrically or symmetrically branched) resulting from any chain-growth or step-growth polymerization process.

[0325] Embodiment A44. RR' is an addition product of thiomaleimide (or haloacetamide) addition, e.g. N,S-disubstituted-3-thiopyrrolidine-2,5-diones, Staudinger ligation, e.g. N,3- or N,4-substituted-5-diphenylphosphine oxide-benzoic acid amides, Huisgen 1,3-cycloaddition (click reaction), e.g. N,S-disubstituted-3-thiopyrrolidine-2,5-diones, 1,4-disubstituted-1,2,3-triazoles, 3,5-disubstituted-isoxazoles, or 3,5-disubstituted-tetrazoles, e.g. O or N The antibody of any one of embodiments A40 or A42-A43, comprising a Diels-Alder cycloaddition adduct such as a 2,4-cycloaddition product between a substituted 5-norbornene-2-carboxylic acid ester or amide, an N-substituted 5-norbornene-2,3-dicarboxylic acid imide, an O- or N-substituted 7-oxonorbornene-5-carboxylic acid ester or amide, or an N-substituted 7-oxonorbornene-5,6-dicarboxylic acid imide and a 9-substituted anthracene or a 3-substituted 1,2,4,5-tetrazine, or a high yield selective amidation or imidization reaction.

[0326] Embodiment A45. The antibody of any one of embodiments A40 or A42-A43, wherein RR' comprises the result of the reaction of an alkyne with an azide.

[0327] Embodiment A46. The antibody of embodiment A45, wherein RR' comprises the structure:

[0328] [ka] Embodiment A47. A compound having the structure of Formula III: R'-L-(CL-(P 1 -ZP 2 )) q Formula III Where: R' is a reactive group. L is independently absent or a carbon-containing framework of 1-200 atoms substituted with one or more atoms. Preferably, the carbon-containing framework comprises a linear framework of 5-30 atoms substituted with one or more atoms. Preferably, the carbon-containing framework is a linear hydrocarbon, a symmetric or asymmetric branched hydrocarbon, a monosaccharide, a disaccharide, a linear or branched oligosaccharide (asymmetric or symmetric branched), other naturally occurring linear or branched oligomer (asymmetric or symmetric branched), or a dimer, trimer, or higher oligomer (linear, asymmetric or symmetric branched) resulting from any chain-growth or step-growth polymerization process. CL is either independently absent or is an enzyme-cleavable nucleic acid sequence. P 1 are independently absent or are nucleic acids having at least 10 nucleotides. Z is the DNA barcode sequence N1N2N3N4N n where N represents a nucleotide and n represents an integer greater than 4. P 2 is independently absent or a nucleic acid having at least 10 nucleotides. q is an integer selected from 1, 2, 3, or 4.

[0329] Embodiment A48. The antibody of any one of the preceding embodiments which is specific for an immune cell modulatory molecule, a cancer antigen, a viral antigen, a bacterial antigen, or a CD molecule.

[0330] Embodiment A49. The antibody of any one of the preceding embodiments, wherein the enzyme-cleavable sequence CL comprises a restriction enzyme cleavage site.

[0331] Embodiment A50. The antibody of embodiment A49, wherein the enzyme-cleavable sequence is selected from Table B.

[0332] Embodiment A51. The antibody of any one of the previous embodiments, wherein the DNA barcode comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides.

[0333] Embodiment A52. The antibody described in embodiment A51, wherein the sequence P1 comprises 10 to 15 nucleotides.

[0334] Embodiment A53. The antibody of any one of the previous embodiments, wherein the nucleic acid molecule further comprises a sequence P1 of at least 10 nucleotides.

[0335] Embodiment A54. The nucleic acid molecule has the general formula 3'-CL-P1-N1N2N3N4N n The antibody of embodiment A50 or A52, having a -5'.

[0336] Embodiment A55. The antibody of any one of the previous embodiments, wherein the nucleic acid molecule further comprises a second sequence P2 having at least 10 nucleotides.

[0337] Embodiment A56. The antibody described in embodiment A55, wherein the sequence P2 comprises 10 to 15 nucleotides.

[0338] Embodiment A57. The antibody of embodiment A56, wherein the nucleic acid molecule has the general formula: 3'-CL-P1-N1N2N3N4N n -P2-5' Where: -CL represents an enzyme-cleavable sequence. -P1 represents a first sequence capable of hybridizing to the first forward primer. -N1N2N3N4N n represents a DNA barcode, N represents a nucleotide, and n represents an integer greater than 4. -P2 represents a second sequence capable of hybridizing to the second reverse primer.

[0339] Embodiment A58. The antibody of any one of the previous embodiments, wherein the nucleic acid molecule comprises the sequence GAATTCCCATCTCATCCCTGCGTGTCTCCGACTCAGNNNNNNNNNNATCACCGACTGCCCATAGAGAGG.

[0340] Embodiment A59. A method of binding a sequence of a DNA barcode to an antibody, comprising: a) providing an antibody having at least one acceptor glutamine residue; b) coupling the antibody to a coupling reagent comprising a primary amine and a compound, the compound comprising (i) a nucleic acid molecule comprising an enzyme-cleavable sequence (CL) and a DNA barcode having the sequence N1N2N3N4N n wherein N represents a nucleotide and n represents an integer greater than 4, in the presence of TGase under conditions sufficient to obtain an antibody comprising an acceptor glutamine linked to a sequence of the DNA barcode via a linking reagent; A method comprising:

[0341] Embodiment A60. A method of binding a sequence of a DNA barcode to an antibody, comprising: a) providing an antibody having at least one acceptor glutamine residue; b) reacting the antibody with a linking reagent comprising a primary amine and a reactive group (R), in the presence of TGase, under conditions sufficient to obtain an antibody comprising an acceptor glutamine bound (covalently) to the reactive group (R) via the linking reagent; c) eluting the antibody obtained in step b) with a compound, the compound comprising (i) an enzyme-cleavable sequence (CL) and a DNA barcode sequence N1N2N3N4N n and (ii) a reactive group (R') capable of reacting with a reactive group R, where N represents a nucleotide and n represents an integer greater than 4, under conditions sufficient to obtain an antibody comprising a receptor glutamine linked to the sequence of the DNA barcode via a linking reagent; A method comprising:

[0342] Embodiment A61. The method of embodiment A59 or A60, wherein the linking reagent in step (a) covalently bonds to the side chain of an acceptor glutamine within the primary sequence of the antibody.

[0343] Embodiment A62. The method of embodiment A59 or A60, wherein the linking reagent in step (a) is covalently attached to the side chain of an amino acid in the CH2 domain.

[0344] Embodiment A63. The method of embodiment A59 or A60, wherein the acceptor glutamine is within an enzyme recognition tag fused to the C-terminus of the CH3 domain.

[0345] Embodiment A64. The method of embodiment A59 or A60, wherein the acceptor glutamine is within an enzyme recognition tag fused to the C-terminus of the Cκ domain.

[0346] Embodiment A65. The method of embodiment A64, wherein the acceptor glutamine is within the primary sequence of CH2 at a position corresponding to residue Q295 according to Kabat EU numbering.

[0347] Embodiment A66. The method of any one of embodiments A59 to A65, wherein the CH2 domain does not contain an N-linked glycosylation.

[0348] Embodiment A67. The method of any one of embodiments A59 to A65, wherein the CH2 domain comprises an N-linked glycosylation.

[0349] Embodiment A68. The method of any one of Embodiments A59-A65, wherein the linking reagent containing a reactive group has the general formula Ib. G-NH-(C)-(R)q Formula Ib Where: G is H, an amine protecting group, or an antibody or antibody fragment attached via an amide bond upon conjugation. C is a bond or linking moiety. q is an integer selected from 1, 2, 3, or 4. R is a reactive group.

[0350] Embodiment A69. C is the unit -(C n The antibody or linking reagent of embodiment A58, comprising -XL-. Where: (C) n is a substituted or unsubstituted alkyl or heteroalkyl chain, preferably any carbon of the chain is substituted with alkoxy, hydroxyl, alkylcarbonyloxy, alkyl-S-, thiol, alkyl-C(O)S-, amine, alkylamine, amide, or alkylamide. n is an integer selected from the range of 2 to 20. X is NH, O, S, absent, or a bond. L is not independently present and is a bond, or a continuation of bonds, or a carbon-containing framework of 5-200 atoms substituted with one or more atoms. Preferably, the carbon-containing framework comprises a linear framework of 5-30 carbon atoms substituted with one or more atoms. Preferably, the carbon-containing framework is a linear hydrocarbon, a symmetric or asymmetric branched hydrocarbon, a monosaccharide, a disaccharide, a linear or branched oligosaccharide (asymmetric or symmetric branched), other naturally occurring linear or branched oligomer (asymmetric or symmetric branched), or a dimer, trimer, or higher oligomer (linear, asymmetric or symmetric branched) resulting from any chain-growth or step-growth polymerization process.

[0351] Embodiment A70. The method of any one of embodiments A59 to A69, wherein the compound comprising the sequence of the dNA barcode and the reactive group (R') has the general formula III. R'-L-(CL-(P 1 -ZP 2 )) q Formula III Where: R' is a reactive group. L is independently absent or a carbon-containing framework of 1-200 atoms substituted with one or more atoms. Preferably, the carbon-containing framework comprises a linear framework of 5-30 atoms substituted with one or more atoms. Preferably, the carbon-containing framework is a linear hydrocarbon, a symmetric or asymmetric branched hydrocarbon, a monosaccharide, a disaccharide, a linear or branched oligosaccharide (asymmetric or symmetric branched), other naturally occurring linear or branched oligomer (asymmetric or symmetric branched), or a dimer, trimer, or higher oligomer (linear, asymmetric or symmetric branched) resulting from any chain-growth or step-growth polymerization process. CL is either independently absent or is an enzyme-cleavable nucleic acid sequence. P 1 are independently absent or are nucleic acids having at least 10 nucleotides. Z is the DNA barcode sequence N1N2N3N4N n where N represents a nucleotide and n represents an integer greater than 4. P 2 are independently absent or are nucleic acids having at least 10 nucleotides. q' is an integer selected from 1, 2, 3 or 4.

[0352] Embodiment A71. An antibody obtained according to the method of any one of embodiments A59 to A70.

[0353] Embodiment A72. A method for detecting the presence of at least one antigen (wherein the antigen refers to a 3D molecular surface feature of an AAV capsid mutant) in a sample (wherein the sample refers to AAV particles in a solution or on a solid support), comprising the steps of providing at least one antibody of any one of embodiments A27-A58 or A71 specific for said antigen, contacting the sample with an amount of said at least one antibody under conditions effective to allow binding of the antibody to the antigen, washing the sample to remove unbound antibody, contacting the sample with an enzyme capable of cleaving sequence CL, isolating the released DNA barcodes, and sequencing the DNA barcodes, wherein the presence and amount of the barcodes indicates the presence and amount of the antigen in the sample.

[0354] The method of embodiment A72, wherein the antigen is carried by a DNAb-AAV particle.

[0355] Embodiment A74. The method of any one of embodiments A72-A73, wherein the sample consists of a heterogeneous DNAb-AAV particle mixture.

[0356] Embodiment A75. The method of embodiment A74, wherein the heterogeneous DNAb-AAV particle mixture is split into spatially separated single cells in a random or specific order and placed on a multiwell plate, microarray, microfluidic device, or slide.

[0357] Embodiment A76. The method of embodiment A75, wherein the microarray comprises microwells each large enough to accommodate a single cell.

[0358] Embodiment A77. The method of any one of embodiments A72-A76, wherein the cells are pre-sorted by a microfluidic sorter, flow cytometry, or microscopy.

[0359] Embodiment A78. The method of any one of embodiments A72-A77, wherein a single test allows for the detection and quantification of at least 5, 10, 30, 50 or more antigens.

[0360] Embodiment A79. The method of any one of embodiments A72-A78, wherein at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 antibodies are provided, each of which is conjugated to a unique DNA barcode.

[0361] Embodiment A80. The method of any one of embodiments A72 to A79, wherein the released DNA barcodes are sequenced by deep high-throughput sequencing.

[0362] Embodiment A81. The method of embodiment A80, wherein the DNA barcode is amplified prior to sequencing.

[0363] Embodiment A82. A kit comprising an antibody according to any one of embodiments A27 to A58 or A71, a restriction endonuclease, and optionally a number of primers.

[0364] Embodiment B1. A method for detecting 3D molecular surface features of AAV capsid mutants in a sample, comprising: 1) forming a DNA duplex consisting of (a) a DNA aptamer library containing sequences required for binding of AAV capsid mutants and sequences extended from the 5' end of the target binding sequence, and (b) a single-stranded DNA (Guard-DNA or G-DNA) complementary to the region of the DNA aptamer containing the 5' extended region; 2) mixing the sample containing the target AAV capsid mutant with the DNA duplex in step 1), releasing single-stranded G-DNA molecules; 3) mixing the mixture obtained in step 2) with RNaseH and single-stranded RNA complementary to G-DNA, the single-stranded RNA being labeled with a fluorophore and a quencher at its 5'-end and 3'-end, respectively; 4) measuring the fluorescence intensity of the mixture obtained in step 3) and performing further droplet and / or single cell sequencing techniques; The method includes:

[0365] Embodiment B2. The method of embodiment B1, wherein the length of the single-stranded RNA is equal to or less than the length of the single-stranded DNA.

[0366] Embodiment B3. The method of embodiment B1, wherein the fluorophore is selected from the group consisting of fluorescein, tetramethylrhodamine, Cy5, Cy3 and Texas Red.

[0367] Embodiment B4. The method of embodiment B1, wherein the quencher is selected from the group consisting of dabsyl, dabcyl, and a black quencher.

[0368] Embodiment B5. The method of embodiment B1, wherein the quencher is a fluorophore that acts as a fluorescence acceptor in a fluorescence resonance energy transfer (FRET) mechanism.

[0369] Embodiment B6. The method of embodiment B1, wherein the AAV capsid mutant particle is an antibody, a ligand, a natural compound, a synthetic peptide, or a drug candidate compound.

[0370] Embodiment B7. The method of embodiment B1, wherein the fluorescence intensity is measured by a fluorometer.

[0371] Embodiment B8. A DNA aptamer library suitable for use in the method of claim 1 for detecting 3D molecular surface features of AAV capsid mutants in a sample, comprising: 1) (a) a DNA duplex consisting of a DNA aptamer library containing a sequence required for binding of an AAV capsid mutant and a sequence extended from the 5' end of the target binding sequence, and (b) a single-stranded DNA (G-DNA) complementary to a region of the DNA aptamer containing the 5' extended region; 2) a single-stranded RNA complementary to the G-DNA and labeled with a fluorophore and a quencher; 3) RNase H, whose single-stranded RNA is shorter than or equal to the length of single-stranded DNA; A library containing:

[0372] Embodiment B9. The library of embodiment B8, wherein the fluorophore is selected from the group consisting of fluorescein, tetramethylrhodamine, Cy5, Cy3 and Texas Red.

[0373] Embodiment B10. The library of embodiment B8, wherein said quencher is selected from the group consisting of dabsyl, dabcyl, and a black quencher.

[0374] Embodiment B11. The library of embodiment B8, wherein the quencher is a fluorophore that acts as a fluorescence acceptor in a fluorescence resonance energy transfer (FRET) mechanism.

[0375] Embodiment B12. The library of any one of embodiments B1-B8, wherein the AAV capsid mutant particles are protein complexes comprising capsid proteins and DNA genomic sequences.

[0376] Embodiment B13. A method for detecting 3D molecular surface features of AAV capsid mutants in a sample, comprising: 1) mixing one or more DNA aptamer libraries comprising DNA and / or RNA oligos with one or more AAV capsid mutant particles in solution; 2) identifying interactions of DNA and / or RNA aptamers with one or more AAV capsid mutant particles using droplet and / or improved single-cell sequencing technologies (wherein droplet and / or improved single-cell sequencing technologies refer to technologies and methods for identifying individual AAV-DNA / RNA-aptamer complexes within droplets that are sequenced in large quantities and with high sequence accuracy, including but not limited to NGS (next generation sequencing), PacBio, or NanoPore sequencing technologies and methods); The method includes:

[0377] Embodiment C1. A method of producing a DNA-encoded chemical, comprising: a) reacting a first functional group of a bifunctional linker with a first chemical building block, said bifunctional linker having a single functional group reactive with a chemical building block and a single functional group reactive with a nucleotide, a nucleotide analog, a nucleoside, or a nucleoside analog; b) reacting a second functional group of the bifunctional linker with a single-stranded hairpin oligonucleotide, the hairpin oligonucleotide comprising (i) a self-complementary region and (ii) a single-stranded loop comprising at least one natural nucleoside or nucleoside analog, thereby forming a complex; c) reacting said second chemical building block of said conjugate with said first chemical building block under conditions suitable for the formation of a covalent bond between said first and second chemical building blocks of said conjugate; d) linking a first oligonucleotide tag to the single stranded hairpin oligonucleotide of the complex, the oligonucleotide tag comprising a region encoding the identity of the first chemical building block and / or the identity of a second chemical building block, thereby forming a DNA encoded chemical entity; Including, A method wherein steps (a) and (b) and / or steps (c) and (d) can be performed in any order.

[0378] Embodiment C2. The method of embodiment C1, wherein the ligation in step (d) comprises non-enzymatic ligation.

[0379] Embodiment C3. The method of embodiment C1, wherein the oligonucleotide tag in step (d) comprises a fluorescent tag or a biotin label.

[0380] Embodiment C4. The method of embodiment C1, wherein the single-stranded hairpin oligonucleotide in step (b) comprises a region encoding the identity of the first building block.

[0381] Embodiment C5. The method of embodiment C1, wherein the bifunctional linker is modified to increase the solubility of the DNA-encoded chemical entity under organic conditions.

[0382] Embodiment C6. The method of embodiment C5, wherein the bifunctional linker comprises one or more of an alkyl chain, a polyethylene glycol unit, a branched species carrying a positive charge, or a hydrophobic ring structure.

[0383] Embodiment C7. The method of embodiment C6, wherein the bifunctional linker comprises 12 to 45 polyethylene glycol units.

[0384] Embodiment C8. The method of embodiment C1, wherein the single-stranded hairpin oligonucleotide in step (b) and / or the oligonucleotide tag in step (d) are modified to increase the solubility of the DNA-encoded chemical under organic conditions.

[0385] Embodiment C9. The method of embodiment C1, wherein the oligonucleotide tag in step (d) comprises a region that encodes the identity of the first chemical building block.

[0386] Embodiment C10. The method of embodiment C1, wherein the oligonucleotide tag in step (d) comprises a region that encodes the identity of the second chemical building block.

[0387] Embodiment C11. The method of embodiment C1, wherein the suitable conditions in step (c) comprise an organic solvent.

[0388] Embodiment C12. The method of embodiment C1, wherein the single-stranded loop of the hairpin oligonucleotide comprises a sequence that can function as a primer binding region for amplification.

[0389] Embodiment C13. The method of embodiment C1, wherein the bifunctional linker is attached to the 5' end of the single-stranded hairpin oligonucleotide in step (b); the bifunctional linker is embedded within the single-stranded hairpin oligonucleotide in step (b); or the bifunctional linker is located in the center of the single-stranded hairpin oligonucleotide in step (b).

[0390] Embodiment C14. The method of embodiment C13, wherein the bifunctional linker is attached to the 5' end of the single-stranded hairpin oligonucleotide in step (b).

[0391] Embodiment C15. The method of embodiment C13, wherein the bifunctional linker is embedded within the single-stranded hairpin oligonucleotide in step (b).

[0392] Embodiment C16. The method of embodiment C13, wherein the bifunctional linker is positioned in the center of the single-stranded hairpin oligonucleotide in step (b).

[0393] Embodiment C17. The method of embodiment C1, wherein the single stranded hairpin oligonucleotide in step (b) comprises a T or C nucleotide with an aliphatic chain at the C5 position.

[0394] Embodiment C18. The method of embodiment C1, wherein the single stranded hairpin oligonucleotide in step (b) comprises an azobenzene.

[0395] Embodiment C19. The method of embodiment C1, wherein the oligonucleotide tag in step (d) comprises a T or C nucleotide with an aliphatic chain at the C5 position.

[0396] Embodiment C20. The method of embodiment C9, further comprising linking a second oligonucleotide tag to the first oligonucleotide tag, the second oligonucleotide tag encoding the identity of the second chemical building block.

[0397] Embodiment C21. The method of embodiment C20, further comprising: (e) reacting a third chemical building block with said first chemical building block or said second chemical building block.

[0398] The method of embodiment C21, further comprising (f) linking a third oligonucleotide tag to said second oligonucleotide tag, said third oligonucleotide tag encoding the identity of a third chemical building block, and wherein steps (e) and (f) can be performed in any order.

[0399] Embodiment C23. The method of embodiment C1, further comprising: (e) reacting one or more additional chemical building blocks with the chemical building blocks of the complex.

[0400] Embodiment C24. The method of embodiment C23, further comprising (f) linking one or more oligonucleotide tags to the oligonucleotide tag of the complex, each oligonucleotide tag encoding the identity of one of the one or more additional building blocks, and wherein steps (e) and (f) can be performed in any order.

[0401] Embodiment C25. The method of embodiment C1, wherein the DNA encoded chemical has an octanol / water partition coefficient of 1.0 to 2.5.

[0402] Embodiment C26. The method of embodiment C1, producing a plurality of DNA-encoded chemical compounds.

[0403] Embodiment C27. The method of embodiment C26 comprising at least 1,000,000 different DNA-encoded chemical entities.

[0404] Embodiment C28. The method of any one of embodiments C1-C27, wherein the DNA encoded chemicals and / or libraries are used to mix with any AAV capsid mutant in solution and / or on a solid support.

[0405] Embodiment C29. The method of embodiment C28, wherein the mixture of DNA-encoded chemicals and / or libraries and any AAV capsid variants in solution and / or on a solid support is sequenced by droplet and / or single-cell like sequencing techniques.

Claims

1. 1. A method for characterizing 3D molecular surface features of an AAV capsid, comprising: a) contacting said AAV capsid with one or more AAV capsid-targeting aptamer libraries; b) removing unbound aptamers; c) eluting the bound aptamers; d) identifying the aptamer that is bound to the AAV capsid; e) determining the presence and / or levels of said identified aptamers; f) characterizing the 3D molecular surface features of the AAV capsid based on the presence and / or levels of the identified aptamers; A method comprising:

2. Steps a) to c) are repeated one, two, three or more times; The method of claim 1.

3. The eluted aptamer is amplified by a PCR reaction. The method according to claim 1 or 2.

4. The aptamers in the aptamer library are linear aptamers or cyclic aptamers. The method according to any one of claims 1 to 3.

5. Each aptamer in the aptamer library comprises at least one primer binding region and one random sequence. The method according to any one of claims 1 to 4.

6. The primer binding region of the aptamer in the aptamer library is about 20 bp in length. The method according to claim 5.

7. The random sequences of the aptamers in the aptamer library are from about 36 to about 40 bp. The method according to claim 5 or 6.

8. Each aptamer in the aptamer library comprises a double-stranded oligonucleotide sequence; The method according to any one of claims 1 to 7.

9. Each aptamer in the aptamer library comprises a single-stranded oligonucleotide sequence; The method according to any one of claims 1 to 7.

10. At least one aptamer in the aptamer library is capable of binding to a target on the AAV capsid via a random sequence. The method according to any one of claims 1 to 9.

11. Each aptamer in the aptamer library comprises a single stranded DNA (Guard-DNA or G-DNA) that is complementary to a region of a DNA aptamer that contains a 5' extension region. The method according to any one of claims 1 to 10.

12. When the AAV capsid is contacted with the aptamer library, the single-stranded G-DNA molecule is released. The method of claim 11.

13. Identifying the aptamer bound to the AAV capsid includes contacting the mixture obtained in step a) with RNase H and single-stranded RNA complementary to G-DNA, and measuring the fluorescence intensity of the mixture, wherein the 5'-end and 3'-end of the single-stranded RNA are labeled with a fluorophore and a quencher, respectively.

12. The method according to claim 10 or 11.

14. The fluorophore is selected from the group consisting of fluorescein, tetramethylrhodamine, Cy5, Cy3 and Texas Red; The method of claim 13.

15. The quencher is selected from the group consisting of dabsyl, dabcyl, and a black quencher; 15. The method according to claim 13 or 14.

16. Identifying the aptamer that is bound to the AAV capsid is carried out by sequencing. The method according to any one of claims 1 to 10.

17. The sequencing includes performing high-throughput sequencing or droplet sequencing.

17. The method of claim 16.

18. The targets of the aptamers in the aptamer library are known; The method according to any one of claims 1 to 17.

19. The exact targets of the aptamers in the aptamer library do not need to be known. The method according to any one of claims 1 to 17.

20. The AAV capsid is in solution prior to contact with the aptamer library. The method according to any one of claims 1 to 19.

21. The AAV capsid is immobilized on a support prior to contacting with the aptamer library.

21. The method of claim 20.

22. characterizing additional 3D molecular surface features of the AAV capsid; The method according to any one of claims 1 to 21.

23. 1. A method for characterizing 3D molecular surface features of an AAV capsid, comprising: a) contacting the AAV capsid with a DNA-encoded chemical library (DECL) comprising a pool of one or more AAV capsid-targeting DNA-encoded chemical binding agents; b) removing unbound DNA-encoded chemical binding agents; c) eluting the bound DNA-encoded chemical binding agent; d) identifying the DNA-encoded chemical binding agent that is bound to the AAV capsid; and e) determining the presence and / or levels of said identified DNA-encoded chemical binding agents; f) characterizing the 3D molecular surface features of the AAV capsid based on the presence and / or level of the identified DNA-encoded chemical binding agents; The method includes:

24. Steps a) to c) are repeated one, two, three or more times; 24. The method of claim 23.

25. Each DNA-encoded chemical linker in the DECL comprises: a) a compound capable of binding to one or more targets on the AAV capsid; and b) a DNA barcode; and c) a linker; and Including, 25. The method of claim 23 or 24.

26. the DNA barcode of the eluted DNA-encoded chemical binding agent is amplified by a PCR reaction; The method according to any one of claims 23 to 25.

27. the length of the sequence of the DNA barcode of the DNA-encoded chemical binding agent is about 5 bp to about 15 bp; The method according to any one of claims 23 to 26.

28. the sequence of the DNA barcode of each DNA-encoded chemical binding agent is associated with the identity of the chemical binding agent; The method according to any one of claims 23 to 27.

29. Identifying the DNA-encoded chemical binding agent is performed by sequencing the sequence of the DNA barcode. The method according to any one of claims 23 to 28.

30. The sequencing includes performing high-throughput sequencing, droplet sequencing, or single-cell sequencing.

30. The method of claim 29.

31. The target of the DNA-encoded chemical binding agent in the DECL is known; The method according to any one of claims 23 to 30.

32. The exact target of the DNA-encoded chemical binding agent in the aptamer library does not need to be known; The method according to any one of claims 23 to 30.

33. The AAV capsid is in solution prior to contact with the DECL. The method according to any one of claims 23 to 32.

34. The AAV capsid is immobilized on a support prior to contact with the DECL.

34. The method of claim 33.

35. The linker is a cleavable linker. The method according to any one of claims 25 to 34.

36. characterizing additional 3D molecular surface features of the AAV capsid; The method according to any one of claims 23 to 35.

37. 1. A method for characterizing 3D molecular surface features of an AAV capsid, comprising: a) contacting the AAV capsid with a DNA-encoded antibody library (DEAL) comprising a pool of DNA-encoded antibody binding agents targeting one or more AAV capsids; b) removing unbound DNA-encoded antibody binding agents; c) eluting the bound DNA-encoded antibody binding agent; d) identifying the DNA-encoded antibody binding agent that binds to the AAV capsid; and e) determining the presence and / or level of said identified DNA encoded antibody binding agents; f) characterizing the 3D molecular surface features of the AAV capsid based on the presence and / or level of the identified DNA-encoded antibody binding agents; The method includes:

38. Steps a) to c) are repeated one, two, three or more times; 38. The method of claim 37.

39. Each DNA-encoded antibody binding agent in the DECL comprises: a) an antibody or antigen-binding fragment thereof capable of binding to one or more targets on the AAV capsid; b) a DNA barcode; and c) a linker; and Including, 39. The method of claim 37 or 38.

40. the DNA barcodes of the eluted DNA-encoded antibody binders are amplified by a PCR reaction; 40. The method according to any one of claims 37 to 39.

41. the sequence of the DNA barcode of the DNA-encoded antibody binding agent is about 5 bp to about 15 bp in length; The method according to any one of claims 37 to 40.

42. Identifying the DNA-encoded antibody binding agent is performed by sequencing. The method according to any one of claims 37 to 41.

43. The sequencing includes performing high-throughput sequencing or droplet sequencing.

43. The method of claim 42.

44. The target of the DNA-encoded antibody binding agent in the DEAL is known; The method according to any one of claims 37 to 43.

45. It is not necessary to know the exact target of the DNA-encoded antibody binding agent in the DEAL library. The method according to any one of claims 37 to 44.

46. The AAV capsid is in solution prior to contact with the DEAL. The method according to any one of claims 37 to 45.

47. The AAV capsid is immobilized on a support prior to contact with the DEAL.

47. The method of claim 46.

48. The linker is a cleavable linker.

48. The method according to any one of claims 39 to 47.

49. The linker comprises at least one nucleic acid molecule having an enzyme-cleavable sequence (CL); 49. The method of claim 48.

50. characterizing additional 3D molecular surface features of the AAV capsid; 50. The method according to any one of claims 37 to 49.

51. 1. A method for enriching a combinatorial library for characterizing 3D molecular surface features of an AAV capsid, comprising: (a) contacting a pool of binding agents with a first population of AAV capsids; (b) enriching the binding library for characterizing 3D molecular surface features of the AAV capsids by enriching a subpool of binding agents that bind to the first population of AAV capsids; The method includes:

52. (c) contacting the subpool of binding agents that bind to the first population of AAV capsids with a second population of AAV capsids; (d) selecting a group of binding agents having preferential affinity for said first population of AAV capsids by depleting a second subpool of binding agents that exhibit affinity for said second population of AAV capsids; Further comprising:

52. The method of claim 51.

53. The library of binding agents is an aptamer library, a DNA-encoded chemical library (DECL) or a DNA-encoded antibody library (DEAL); 53. The method of claim 51 or 52.

54. The AAV capsid or the first population of AAV capsids comprises one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVhu.37, AAVrh.8, AAVrh.10, AAVrh.39, AAV11, AAV12 and AAV13, and other variants derived from mutation, peptide insertion or shuffling.

54. The method according to any one of claims 1 to 53.

55. The 3D molecular surface features are the binding profile of the library.

55. The method according to any one of claims 1 to 54.

56. The binding profile is the number, sequence, and copy number of binding agents that are bound.

56. The method of claim 55.

57. The 3D molecular surface characteristics of the AAV capsid indicate an affinity profile and / or a neutralization profile (e.g., the ability to evade neutralizing antibodies).

57. The method of any one of claims 1 to 56.

58. A kit for carrying out the method for enriching a combinatorial library according to any one of claims 1 to 57.

Images