Programmable recruitment of transcription factors to endogenous genes

The Protege platform addresses the limitations of current gene regulation methods by using a programmable gene regulator to recruit endogenous transcription factors, achieving precise and reversible gene expression control in response to environmental signals.

JP2025516462APending Publication Date: 2025-05-30SRI INTERNATIONAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024560770
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-05-13
Filing Date
2022-12-20
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Current methods for regulating gene expression, such as administering recombinant proteins or using gene editing technologies, often result in unintended side effects and limited temporal and spatial control over gene activity.

Method used

The Protege platform uses a programmable gene regulator (PGM) that recruits endogenous transcription factors activated by environmental signals to specific genes, allowing for reversible and cell-specific regulation of gene expression.

Benefits of technology

This approach enables precise control over gene expression in response to physiological signals, minimizing off-target effects and ensuring that gene regulation occurs only where and when needed, thereby promoting therapeutic effects while avoiding adverse changes in gene expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025516462000001_ABST
    Figure 2025516462000001_ABST
Patent Text Reader

Abstract

The present disclosure provides a method for regulating gene expression in a cell-specific manner in response to intracellular or extracellular stimuli. **Solution**: The present disclosure provides a platform named the PROTEGE platform, which herein is referred to as PGM, and includes a DNA-binding module and a transcription factor-binding module. PGM binds to the promoter region of a target gene having sequence specificity via the DNA-binding module and also binds to a TF via the TF-binding module. When the TF is activated in response to intracellular or extracellular stimuli, it binds to PGM, and since it is in proximity to the promoter of the gene, it regulates the expression of the target gene in response to the stimuli.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to the field of programmable regulation of gene expression in a cell-specific manner by recruiting transcription factors to one or more genes in response to intracellular and / or extracellular stimuli. The present disclosure provides a platform designated as the Protege platform. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 341,820, filed May 13, 2022, the contents of which are incorporated herein by reference in their entirety. STATEMENT REGARDING ELECTRONICALLY SUBMITTED SEQUENCE LISTINGS This application contains a Sequence Listing that has been submitted electronically in XML format, which is incorporated herein by reference in its entirety. The size of said XML copy is 73,779 kilobytes. [Background technology]

[0002] Organisms respond to disease and injury by regulating the expression of specific genes to promote recovery, healing, or resistance to disease. Cells sense external signals resulting from disease or injury and respond by activating transcription factors that regulate the expression of genes under their control. However, genes that could be beneficial to healing, recovery, or resistance to disease are often not regulated to achieve their beneficial effects. This failure may be due to the gene not being under the control of the relevant transcription factor or to insufficient activation or repression of the gene by the relevant transcription factor. A traditional solution to this problem is to administer the product encoded by a potentially beneficial gene as a pharmaceutical. For example, recombinant human bone morphogenetic protein-2 (rh-BMP-2) is used to promote recovery after spinal surgery. Similarly, recombinant human platelet-derived growth factor (rhPDGF) improves wound healing when applied to diabetic ulcers. This approach often fails to achieve the desired results or has limited utility because the activity of the added gene product is not limited to when and where it is needed, resulting in compensatory effects or negative side effects.

[0003] Another approach, enabled by recent advances in gene editing, is to modify the genome to alter the expression of therapeutic gene products. For example, mutations or polymorphisms that lead to the loss of a specific gene product can be altered to establish beneficial gene expression levels. Such modifications are achieved using gene editors that contain a sequence-specific DNA-binding component and an endonuclease that cleaves DNA at or near the binding site. Altering the cleavage site can be achieved by homology-directed repair (HDR), in which exogenous DNA containing the desired edited sequence acts as a repair template. Several types of sequence-specific nucleases have been used for gene editing, including zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR endonucleases. For example, a ribonucleoprotein complex containing Cas9 (CRISPR-associated protein 9) endonuclease and a guide RNA can bind to and cleave the DNA genomic sequence specified by the guide RNA. Gene editing carries the risk of off-target editing, and the edits are permanent. Therefore, harmful off-target edits or intentional edits confirmed to have harmful effects are irreversible.

[0004] Gene expression can be reversibly regulated by synthetic transcription factors. Similar to natural transcription factors, synthetic transcription factors bind to specific sequences within the promoter or enhancer regions of genes and deliver or recruit endogenous factors to promote or disrupt the assembly of transcription initiation complexes or promote chromatin modifications that regulate transcription. Synthetic transcription factors have been created using zinc fingers, TALEs, and CRISPR-associated (Cas) proteins engineered to eliminate endonuclease activity. For example, Dead Cas9 (dCas9) is a mutant form of Cas9 in which endonuclease activity is abolished by a mutation in the endonuclease domain. dCas9 is still capable of binding to its guide RNA and target DNA strand. dCas9 or a transcription factor linked to its bound guide RNA can be delivered to a target DNA sequence within the promoter or enhancer region of a gene and regulate its transcription. Transcription factors that have been used in this context include Vp64, p65, Hsf1, and the Epstein-Barr virus R transactivator (Rta). Transcription factors used for this purpose to date are non-native to the treated cells (e.g., viral transcription factors in mammalian cells) and / or are artificially covalently fused to dCas9 or other proteins that mediate binding to dCas9. Therefore, they are not endogenously produced transcription factors whose activity depends on physiological signals affecting the cell.

[0005] A significant risk of irreversible and harmful genetic alterations may arise from nucleic acid therapies that regulate gene expression (e.g., ASOs, antagomir, siRNA, therapeutic mRNA). Furthermore, the effects of these therapies are not limited to the physiological conditions in which they are needed. With the exception of mRNA, the ability of these approaches to increase the expression of beneficial genes is limited. Summary of the Invention

[0006] Cells respond to disease and injury by expressing genes in response to environmental cues that indicate their need. However, not all genes that can promote healing and recovery are expressed at optimal levels, or even at all. Current medical procedures aimed at artificially providing beneficial gene products are often ineffective or harmful because their action is not limited to where and when needed in the body. What is needed is a way to turn genes on (or off) in response to physiological signals that indicate beneficial gene regulation.

[0007] The activity of previously reported artificial transcription factors does not respond to environmental signals resulting from disease or injury. This response can be achieved by directing the activity of endogenous transcription factors activated by environmental signals associated with disease or injury to target genes. By reversibly regulating the expression level of a target gene in a manner that depends on the environmental signals resulting from disease or injury, changes in gene expression levels are limited to cells, cell locations, and times where the altered gene expression exerts a therapeutic effect. This therefore avoids changes in gene expression within cells, cell locations, and times where changes in gene expression have adverse effects.

[0008] Previously reported regulators of gene expression have not directly incorporated native, endogenously produced transcription factors into their design. For example, previous designs based on dCas9 have linked transcriptional regulatory domains to the dCas9-guide RNA ribonucleoprotein complex by direct fusion to the dCas9 protein, by fusion with a bacteriophage coat protein (MS2) that binds to the RNA sequence incorporated into the guide RNA, or by conjugation with an antibody that binds to a polypeptide sequence fused to the dCas9 protein. Each of these approaches requires the transcriptional regulatory domain to be covalently conjugated to another protein (e.g., dCas9, MS2, or an antibody), and therefore must be delivered exogenously or by transfection with an expression vector for the fusion protein. This requirement prevents CRISPR-based DNA-binding agents from directly delivering or recruiting endogenous transcription factors to a gene of interest.

[0009] The present inventors describe compositions and methods for transcriptionally regulating a specific gene of interest using an artificial transcription factor that simultaneously binds to a specific sequence in genomic DNA within or near the target gene and one or more endogenously produced native transcription factors that are activated in response to an external signal. The principle is illustrated schematically in Figure 1. The target gene is programmed by the sequence of the crRNA component of the guide RNA, and the transcription factor to which transcriptional regulation responds is programmed by a transcription factor response element incorporated into the guide nucleic acid. The following embodiments are non-limiting examples of the invention provided in this disclosure.

[0010] 1. The following subcomponents: an endonuclease-deficient DNA-binding polypeptide (preferably, a dCas polypeptide); A chimeric nucleic acid (sgCNA) comprising a CRISPR RNA (crRNA), a trans-activating crRNA (tracrRNA), and at least one nucleic acid segment comprising at least one transcription factor binding site. an artificial, non-natural system comprising a programmable gene regulator (PGM), or an sgCNA subcomponent thereof, for reversibly altering expression of a target gene of interest in a cell in response to one or more intracellular or extracellular environmental signals, comprising: An artificial, non-natural system in which the crRNA comprises a sequence complementary to a nucleic acid sequence within the promoter region of a target gene of interest, and each transcription factor binding site within the PGM is activated in a cell containing the PGM in response to an environmental signal, and then binds to at least one endogenous transcription factor that recognizes and binds to the transcription factor binding site of the PGM that is bound to the promoter of the gene of interest via the crRNA, thereby bringing the transcription factor into proximity with the gene of interest and activating or repressing expression of the gene of interest in response to an environmental signal.

[0011] 2. (i) at least one transcription factor binding site in the PGM is also present in the target gene; and / or (ii) at least one transcription factor binding site in the PGM is not an endogenous transcription factor binding site in the target gene; 2. The artificial non-natural system of embodiment 1, or a sgCNA subcomponent thereof. 3. The artificial non-natural system of any one of embodiments 1 and 2, or an sgCNA subcomponent thereof, wherein the PGM recruits the endogenous transcription factor to the gene of interest when the endogenous transcription factor is activated in response to an environmental signal, thereby activating gene expression in response to the environmental signal in a cell-specific manner.

[0012] 4. Transcription factors (i) known to be activated in response to environmental signals, and (ii) known or unknown to activate / repress expression of a target gene of interest; 4. The artificial non-natural system according to any one of embodiments 1 to 3, or a sgCNA subcomponent thereof, identified as a transcription factor. 5. The artificial non-natural system, or sgCNA subcomponent thereof, of any one of embodiments 1 to 4, wherein the DNA-binding polypeptide is a nuclease-deficient cas polypeptide. 6. The artificial non-natural system of any one of embodiments 1-5, or an sgCNA subcomponent thereof, wherein the gene of interest is identified as a gene whose expression (a) results in a beneficial cellular response to an environmental signal, but whose expression is undetectable or increased by PGM compared to gene expression levels in the absence of PGM, or (ii) results in a deleterious effect on the cell, and whose expression is reduced by PGM in response to an environmental signal compared to gene expression levels in the absence of PGM.

[0013] 7. The artificial non-natural system of any one of embodiments 1 to 6, or an sgCNA subcomponent thereof, wherein the gene of interest encodes a protein, a microRNA, or a long non-coding RNA. 8. The artificial non-natural system of any one of embodiments 1-7, or an sgCNA subcomponent thereof, wherein the signal is any physical signal, such as a light signal (e.g., ultraviolet light), ionizing radiation, heat / temperature, hyperosmotic or hypoosmotic conditions; a mechanical signal, such as pressure (e.g., touch), sound wave movement, and / or blood pressure; and / or any chemical signal, such as a growth factor, cytokine, chemokine, cyclic AMP, hormone, neurotransmitter, extracellular matrix component, bacterial antigen, viral antigen, lipid, lipopolysaccharide, gas levels (e.g., oxygen levels, nitric oxide levels), ion levels (e.g., calcium levels, sodium levels), pH, reactive oxygen species, heavy metals, oxidized LDL, and / or free radicals, intercellular signaling (e.g., T cell binding, cell-cell contact), or a combination thereof.

[0014] 9. The artificial non-natural system of any one of embodiments 1 to 8, or an sgCNA subcomponent thereof, wherein the transcription factor is selected from a forkhead transcription factor, a nuclear receptor, a POU domain protein, a SMAD, preferably Nrf2, FOX01, NF-kB, USF2, NFAT, EGR1, STAT3, and / or SREBP. 10. The artificial non-natural system of any one of embodiments 1 to 9, or an sgCNA subcomponent thereof, or an sgCNA subcomponent thereof, wherein the TF binding module (i) comprises at least one TF binding segment (TFBS), wherein the TF binding segment comprises DNA and / or RNA, or (ii) the TF binding module comprises at least one TF binding segment (TFBS), wherein the TF binding segment comprises a DNA or RNA aptamer selected to bind to an endogenous transcription factor. 11. An artificial non-natural system according to any one of embodiments 1 to 10, or an sgCNA subcomponent thereof, wherein the TF binding module comprises a sequence derived from natural RNA.

[0015] 12. The artificial non-natural system of any one of embodiments 1 to 11, or an sgCNA subcomponent thereof, wherein the TF binding segment (TFBS) comprises a double-stranded segment of DNA containing at least one TF response element. 13. The artificial non-natural system according to any one of embodiments 1 to 12, or an sgRNA subcomponent thereof, wherein the strands of the DNA portions of the sgRNA form a duplex and are connected by a loop sequence of any length. 14. The artificial non-natural system, or sgCNA subcomponent thereof, of embodiment 13, wherein the loop comprises 4 nucleotides. 15. The artificial non-natural system, or sgCNA subcomponent thereof, according to any one of embodiments 13 and 14, wherein the sequence of the loop comprises 5'-guanosine-adenosine-adenosine-adenosine-3'.

[0016] 16. The artificial non-natural system of any one of embodiments 1-15, or an sgCNA subcomponent thereof, wherein the crRNA comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleobases that are at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to the target nucleic acid sequence of the target gene of interest. 17. The artificial non-natural system of any one of embodiments 1 to 16, or an sgCNA subcomponent thereof, wherein the endonuclease-deficient sequence-specific DNA-binding protein (preferably a dCas polypeptide) is fused to at least one copy of a nuclear localization signal.

[0017] 18. The artificial non-natural system according to any one of embodiments 1 to 17, or an sgCNA subcomponent thereof, wherein the crRNA comprises any one of the following sequences: SEQ ID NO: 6 to SEQ ID NO: 34. 19. The artificial non-natural system according to any one of embodiments 1 to 18, or an sgCNA subcomponent thereof, wherein the transcription factor binding sequence comprises one or more sequences selected from SEQ ID NOs: 1, 2, 3, 5, and those of Table 2. 20. The artificial non-natural system of any one of embodiments 1 to 19, or an sgCNA subcomponent thereof, wherein tracrRNA binds to dCas9.

[0018] 21. PGM crRNA, TFBS, and tracrRNA have the following molecular structure: 5'-crRNA-TFBS-tracrRNA-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-3' (wherein the TFBS is incorporated anywhere within the sequence of the tracrRNA, including when it is extended into one or more hairpin structures); 5'-crRNA-tracrRNA-TFBS-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-3'; 5'-crRNA-TFBS-tracrRNA-TFBS-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-TFBS-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-tracrRNA''''-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-tracrRNA''''-TFBS-3'; 5'-crRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-3'; 5'-crRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-tracrRNA''''-3'; It is constructed with one of the following: where tracrRNA', tracrRNA'', tracrRNA''', and tracrRNA''' are contiguous segments of the complete tracrRNA sequence. 21. An artificial non-natural system according to any one of embodiments 1 to 20, or an sgCNA subcomponent thereof.

[0019] 22. The artificial non-natural system according to any one of embodiments 1 to 21, or an sgCNA subcomponent thereof, wherein the PGM comprises one or more different TFBSs that comprise response elements for a plurality of different transcription factors. 23. The artificial non-natural system according to any one of embodiments 1 to 22, or an sgCNA subcomponent thereof, wherein the PGM comprises a nucleic acid backbone with one or more different TFBSs, and wherein the continuity of the nucleic acid backbone is interrupted at one or more positions and the complete nucleic acid sequence is constructed by base pairing of nucleotides from the different strands. 24. The artificial non-natural system, or sgCNA subcomponent thereof, of embodiment 23, wherein the nucleic acid backbone discontinuity is within one or more TFBSs.

[0020] 25. The artificial non-natural system of any one of embodiments 1 to 24, or an sgCNA subcomponent thereof, wherein the TFBS is separated from the crRNA or tracrRNA by a linker of at least 1, 5, 10, 20, or 30 DNA, RNA, or modified nucleotides. 26. An isolated nucleic acid comprising any one or more of the sgCNA, crRNA, tracrRNA, transcription factor binding site, or any other segment of the sgCNA of PGM according to any one of embodiments 1 to 25, or encoding a DNA-binding protein of PGM according to any one of embodiments 1 to 25.

[0021] 27. The isolated nucleic acid of embodiment 26, wherein the nucleic acid contains one or more modified or non-natural nucleotides. 28. The isolated nucleic acid of any one of embodiments 26 and 27, wherein the nucleic acid is 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 100, 200, 300, 400, 500, 1 to 5, 5 to 10, 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, 70 to 80, 80 to 90, 90 to 100, 100 to 125, 125 to 150, 150 to 200, 200 to 300, 300 to 400, or 400 to 500 bases in length.

[0022] 29. A vector comprising the isolated nucleic acid of any one of embodiments 26 to 28 under the control of a heterologous promoter, which is preferably an AAV vector or another vector. 30. A virus comprising the isolated nucleic acid according to any one of embodiments 26 to 28, preferably wherein the virus is a lentivirus or an adenovirus. 31. A cell comprising a PGM or sgCNA subcomponent thereof according to any one of embodiments 1 to 25, and / or a nucleic acid according to any one of embodiments 26 to 28, and / or a vector according to embodiment 29, and / or a virus according to embodiment 30. 32. The cell of embodiment 31, wherein the cell is a prokaryotic or eukaryotic cell, preferably a mammalian cell, a non-human primate cell, or a human cell.

[0023] 33. A composition comprising a PGM or sgCNA subcomponent thereof according to any one of embodiments 1 to 25, a nucleic acid according to any one of embodiments 26 to 28, a vector according to embodiment 29, a virus according to embodiment 30, a cell according to embodiment 31, or a combination thereof. 34. The composition of embodiment 33, further comprising a cationic or ionizable lipid, or a cationic or ionizable polymer, preferably in nanoparticles. 35. The composition according to any one of embodiments 33 and 34, wherein the composition is a pharmaceutical composition further comprising a pharmaceutically acceptable excipient. 36. A method for reversibly modifying expression of a target gene of interest in a cell in response to one or more intracellular or extracellular environmental signals, comprising contacting the cell with a PGM or sgCNA subcomponent thereof according to any one of embodiments 1 to 25, a nucleic acid according to any one of embodiments 26 to 28, a vector according to embodiment 29, a virus according to embodiment 30, a composition according to any one of embodiments 33 to 35, or a combination thereof.

[0024] 37. The method of embodiment 36, wherein the cell is a prokaryotic or eukaryotic cell, preferably a mammalian cell, a non-human primate cell, or a human cell. 38. A method for treating a disease, disorder, or injury in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a PGM or sgCNA subcomponent thereof according to any one of embodiments 1 to 25, an isolated nucleic acid according to any one of embodiments 26 to 28, a vector according to embodiment 29, a virus according to embodiment 30, a cell according to any one of embodiments 31 and 32, a composition according to any one of embodiments 33 to 35, or a combination thereof.

[0025] 39. The method of embodiment 38, wherein the disease, disorder, or injury is selected from cellular stress, excision or incision wounds, radiation exposure, viral or bacterial infection, sepsis, diabetic nephropathy, atherosclerosis, cystic fibrosis, Alzheimer's disease, oxidative stress, ischemia-reperfusion injury, inflammation, cancer, anti-cancer drug resistance, genetic diseases or disorders, inflammatory diseases or disorders, autoimmune diseases or disorders, liver diseases or disorders, spleen diseases or disorders, lung diseases or disorders, hematological diseases or disorders, neurological diseases or disorders, gastrointestinal (GI) diseases or disorders, genitourinary diseases or disorders, infectious diseases or disorders, musculoskeletal diseases or disorders, endocrine diseases or disorders, metabolic diseases or disorders, immune diseases or disorders, central nervous system (CNS) diseases or disorders, neurological diseases or disorders, ophthalmological diseases or disorders, or cardiovascular diseases or disorders. 40. The method of embodiment 38, wherein the disease, disorder, or injury is selected from excision or incision wounds, radiation exposure, viral or bacterial infection, sepsis, diabetic nephropathy, atherosclerosis, cystic fibrosis, Alzheimer's disease, oxidative stress, ischemia-reperfusion injury, inflammation, and cancer.

[0026] 41. A kit comprising a PGM or sgCNA subcomponent thereof according to any one of embodiments 1 to 25, a nucleic acid according to any one of embodiments 26 to 28, a vector according to embodiment 29, a virus according to embodiment 30, a composition according to any one of embodiments 33 to 35, or a combination thereof, together with a container and / or instructions for using the kit. The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the U.S. Patent and Trademark Office upon request and payment of the necessary fee. [Brief explanation of the drawings]

[0027] [Figure 1A] Figure 1 illustrates the principle of physiologically responsive gene expression regulators. Transcription factors (TFs) are activated by physiological stimuli. Examples of physiological stimuli include, but are not limited to, oxidative stress or growth factor signaling. The responsive gene expression regulator is a ribonucleoprotein complex composed of a disabled CRISPR-associated protein, such as dCas9, and a chimeric guide nucleic acid. The chimeric guide nucleic acid contains a DNA hairpin incorporating a binding site for the activating TF, a crRNA sequence, and a tracrRNA sequence. This complex binds to a genomic DNA sequence near a target gene that is to be made responsive to a physiological signal. The binding site is programmed by the crRNA sequence within the guide nucleic acid. The activated TF associates with the bound dCas9 complex, bringing the TF into proximity with the target gene and regulating its transcription. [Figure 1B] Figure 1B shows a schematic diagram of the action of PGM. [Figure 1C] Figure 1C illustrates the crRNA module, tracrRNA module, and transcription factor binding site module. [Figure 2A] Figure 2A is a schematic diagram of the conventional structure of an sgRNA. [Figure 2B] FIG. 2B shows an exemplary embodiment of chimeric guide nucleic acid (sgCNA) synthesis highlighting the modules included according to the present disclosure. [Figure 3]FIG. 3 shows various non-limiting examples of different applications of the PROTEGE platform. [Figure 4A] FIG. 4A illustrates the need for a means to turn on therapeutic genes at the right time and place. [Figure 4B] FIG. 4B illustrates how the PROTEGE platform enables the controlled, reversible expression of therapeutic genes in response to injury or disease without altering genomic content. [Figure 5] Demonstration of a physiologically responsive programmable gene regulator (PGM) that recruits activating transcription factors to a target DNA sequence. 5A. Experimental design. The target DNA sequence is a 20-base pair sequence (pink and gold) contained within a DNA duplex immobilized in the wells of a multiwell plate. The gene regulator contains dCas9 (yellow circle) complexed with a single guide nucleic acid containing a crRNA module (turquoise) complementary to the target sequence, a tracrRNA module (cyan), and a DNA module (red) that forms a hairpin structure incorporating an Nrf2 response element in its stem. After binding of the gene regulator to the immobilized target DNA, nuclear extract from HEK293 cells treated with tert-butylhydroquinone (tBHQ) is added to stimulate Nrf2 activation and nuclear localization. After washing the wells to remove unbound Nrf2, bound Nrf2 was detected with an anti-Nrf2 antibody, treated with an HRP-conjugated anti-rabbit secondary antibody, and visualized by absorbance at 450 nm after development with HRP substrate. In Figures 5B–5D, each value is the average of triplicates from separate wells. Error bars represent the standard deviation of the mean. Figure 5B shows the dependence of Nrf2 binding on the presence of PGM. For the "-PGM" wells, PBS was added instead of PGM solution. Figure 5C shows the dependence of Nrf2 binding on the presence of a target DNA sequence immobilized in the wells. In the "-Target DNA sequence" wells, the immobilized duplex contained a scrambled version of the target sequence (same sequence composition, different sequence) instead of the target sequence. Figure 5D shows the dependence of Nrf2 binding on Nrf2 activation. The nuclear extract added to the "-Nrf2" wells was from cells not treated with tBHQ. [Figure 6] Nrf2-dependent regulation of klotho transcription in cultured cells. In Figure 6A, human embryonic kidney cells were treated with PGM, which targets the klotho promoter and contains an Nrf2 response element. After 16 hours, Nrf2 was activated with tBHQ. After an additional 24 hours, total RNA was isolated, and klotho expression relative to GAPDH expression was measured by RT-qPCR. Figure 6B shows the relative expression of klotho normalized to expression without the addition of PGM or tBHQ. Values ​​are the means of three biological replicates, and error bars represent standard deviations. P values ​​are calculated from one-way ANOVA. DETAILED DESCRIPTION OF THE INVENTION

[0028] In order that this disclosure may be more readily understood, certain terms are first defined below. Additional definitions for these and other terms are set forth throughout the specification. As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Unless otherwise stated or clear from context, as used herein, the term "or" is understood to be inclusive, including and covering both "or" and "and."

[0029] The term "and / or," as used herein, is deemed to specifically disclose each of the two specified features or components, regardless of the presence or absence of the other. Thus, the term "and / or" when used in phrases such as "A and / or B" is intended to include A and B, A or B, A alone, and B alone. Similarly, the term "and / or" when used in phrases such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B, or C; A and C; A and B; B and C; A alone; B alone; and C alone. The terms "for example" and "i.e." as used herein are merely used as examples and are not intended to be limiting and should not be construed as referring only to the items explicitly listed herein.

[0030] Terms such as "more than," "at least," and "more than," e.g., "at least one," are used to mean, but are not limited to, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, This is understood to include any recited value of 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 or 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000 or more, as well as any larger number or fraction in between.

[0031] Conversely, the term "less than or equal to" includes each value less than the recited value. For example, "100 or fewer nucleotides" includes 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 5 Includes 3, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, and 0 nucleotides, as well as any smaller numbers or fractions in between.

[0032] Terms such as "plurality," "at least two," "two or more," and "at least a second" are intended to mean, but are not limited to, at least two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty-one, twenty-two, twenty-three, twenty-four, twenty-five, twenty-six, twenty-seven, twenty-eight, twenty-nine, twenty-six ... 3, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 199, 190, 199, 200, 201, 202, 203, This is understood to include 7, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149 or 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000 or more, as well as any larger numbers or fractions in between.

[0033] Throughout this specification, the term "comprising" or variations such as "comprises" will be understood to mean the inclusion of a stated element, integer, or step, or group of elements, integers, or steps, but not the exclusion of any other element, integer, or step, or group of elements, integers, or steps. Where aspects are described herein with the term "comprising," it will be understood that similar aspects described with the terms "consisting of" and / or "consisting essentially of" are also provided. The term "consisting of" excludes any element, step, or ingredient not specified in the claim. In re Gray, 53 F.2d 520, 11 USPQ 255 (CCPA 1931); Ex parte Davis, 80 USPQ 448, 450 (Bd. App. 1948) ("consisting of" is defined as "containing nothing other than the claimed materials, except for inclusions ordinarily incident to the claims"). The term "consisting essentially of" limits the scope of a claim to specified materials or steps that "do not materially affect the basic and novel characteristics" of the claimed invention.

[0034] Unless otherwise specified or clear from the context, as used herein, the term "about" refers to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which depends in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system. For example, "about" or "approximately" can mean within one standard deviation or more than one standard deviation, according to practice in the art. "About" or "approximately" can mean a range of up to 10% (i.e., ±10%). Thus, "about" can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, or 0.001% greater or less than the stated value. For example, approximately 5 mg can include any amount between 4.5 mg and 5.5 mg. Furthermore, particularly with respect to biological systems or processes, the term can mean values ​​up to an order of magnitude or up to 5 times greater or less than the stated value. When a specific value or composition is provided in this disclosure, unless otherwise specified, the meaning of "about" or "approximately" should be assumed to be within an acceptable range of error for that specific value or composition.

[0035] As described herein, any concentration range, percentage range, ratio range, or integer range should be understood to include every integer value within the stated range, and fractions thereof, where appropriate (e.g., tenths and hundredths of integers), unless otherwise specified. The units, prefixes, and symbols used herein are provided using the format accepted by the International System of Units (SI). Numeric ranges are inclusive of the numbers defining the range. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, Juo, "The Concise Dictionary of Biomedicine and Molecular Biology", 2nd ed., (2001), CRC Press; "The Dictionary of Cell & Molecular Biology", 5th ed., (2013), Academic Press; and "The Oxford Dictionary of Biochemistry and Molecular Biology", Cammack et al. eds., 2nd ed., (2006), Oxford University Press provide those skilled in the art with a general dictionary for many of the terms used in this disclosure.

[0036] The terms "transduction" and "transduced" refer to the process by which foreign DNA is introduced into a cell via a viral vector (see Jones et al., "Genetics: principles and analysis," Boston: Jones & Bartlett Publ. (1998)). In some embodiments, the vector is a retroviral vector, a DNA vector, an RNA vector, an adenoviral vector, a baculoviral vector, an Epstein-Barr virus vector, a papovavirus vector, a vaccinia virus vector, a herpes simplex virus vector, an adenovirus-associated vector, a lentiviral vector, or any combination thereof.

[0037] A "therapeutically effective amount," "effective dose," "effective amount," or "therapeutically effective dose" of a therapeutic agent, e.g., a PGM, a small molecule, a "drug," or a "therapeutically effective dose" as described herein is any amount that, when used alone or in combination with another therapeutic agent, protects a subject from developing the disease or promotes disease regression as evidenced by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or prevention of functional impairment or disability due to disease morbidity. Such terms may be used interchangeably. The ability of a therapeutic agent to promote disease regression can be evaluated in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays using various methods known to those skilled in the art. Therapeutically effective amounts and administration regimens can be determined empirically by testing in known in vitro or in vivo (e.g., animal model) systems.

[0038] The term "combination" refers to either a fixed combination in one dosage unit form, or a combined administration in which a compound of the present invention and a combination partner (e.g., another agent described below, also referred to as a "therapeutic agent" or "drug") are administered independently, simultaneously, or separately within a time interval, particularly when these time intervals allow the combination partners to exhibit a cooperative, e.g., synergistic, effect. The single components may be packaged in a kit or individually. One or both of the components (e.g., powder or liquid) may be reconstituted or diluted to the desired dose before administration. As used herein, terms such as "co-administration" or "administration in combination" are meant to encompass the administration of selected combination partners to a single subject (e.g., patient) in need thereof, and are intended to include therapeutic regimens in which the agents are not necessarily administered by the same route of administration or at the same time.

[0039] The terms "genetically engineered" or "engineered" refer to methods of modifying the genome of a cell, including, but not limited to, deleting coding or non-coding regions or portions thereof, or inserting coding regions or portions thereof.

[0040] As used herein, the terms "homology," "homology," or "percent homology" refer to the degree of sequence identity between an amino acid sequence or polynucleotide sequence and a corresponding reference sequence. "Homology" can refer to similar polypeptide or polymeric sequences, such as DNA sequences. Homology can refer to, for example, a nucleic acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity. In other embodiments, a "homologous sequence" of a nucleic acid sequence can exhibit 93%, 95%, or 98% sequence identity with a reference nucleic acid sequence. For example, a "region of homology to a genomic region" can be a region of DNA having a sequence similar to a given genomic region within a genome. The homologous region can be of any length sufficient to facilitate binding of a spacer sequence or protospacer sequence to a genomic region. For example, the homologous region can be at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 450, 555, 600, 650, 705, 755, 805, 905, 955, 1000, 2000, 3000, 4500, 555, 6000, 650 ... The sequences may comprise lengths of 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, or more bases. When percentages of sequence homology or identity are specified, in the context of two nucleic acid sequences or two polypeptide sequences, the percentage of homology or identity generally refers to the alignment of the sequences over a portion of their length when the two or more sequences are compared and aligned for maximum correspondence. When a position in the compared sequence can be occupied by the same base or amino acid, the molecules can be homologous at that position. Unless otherwise specified, sequence homology or identity is measured over the specified length of the nucleic acid, polypeptide, or portion thereof.In some embodiments, homology or identity is evaluated over a functional portion or a specific portion of length. Sequence alignment to evaluate sequence homology can be performed by algorithms known in the art, such as the Basic Local Alignment Search Tool (BLAST) algorithm described in Altschul et al., J. Mol. Biol. 215:403-410, 1990. A publicly available internet interface for performing BLAST analyses can be accessed through the National Center for Biotechnology Information. Additional known algorithms include those published in Smith & Waterman, "Comparison of Biosequences," Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, "A general method applicable to the search for similarities in the amino acid sequence of two proteins," J. Mol. Biol. 48:443, 1970; Pearson & Lipman, "Improved tools for biological sequence comparison," Proc. Natl. Acad. Sci. USA 85:2444, 1988; or automated implementations of these or similar algorithms. Global alignment programs can also be used to align similar sequences of approximately the same size.Examples of global alignment programs include NEEDLE (available at www.ebi.ac.uk / Tools / psa / emboss_needle / ), which is part of the EMBOSS package (Rice P et al., Trends Genet., 2000; 16: 276-277), and the GGSEARCH program fasta.bioch.virginia.edu / fasta_www2 / , which is part of the FASTA package (Pearson W and Lipman D, 1988, Proc. Natl. Acad. Sci. USA, 85: 2444-2448). Both of these programs are based on the Needleman-Wunsch algorithm and are used to find the optimal alignment (including gaps) over the entire length of two sequences. A detailed discussion of sequence analysis can also be found in Unit 19.3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998). Those skilled in the art understand that amino acid (or nucleotide) positions can be determined in homologous sequences based on alignment.

[0041] As used herein, a "patient" or "subject" includes any human suffering from a disease or disorder. The terms "subject" and "patient" are used interchangeably herein. A "subject" to which administration is contemplated refers to a human (i.e., male or female of any age, e.g., a pediatric subject (e.g., an infant, child, or adolescent) or an adult subject (e.g., a young adult, middle-aged adult, or elderly adult)), or a non-human animal. In some embodiments, the non-human animal is a mammal (e.g., a primate (e.g., a cynomolgus or rhesus monkey) or a mouse). The term "patient" refers to a subject in need of treatment for a disease, disorder, or injury. In some embodiments, the subject is a human. In some embodiments, the patient is a human. A human can be male or female at any stage of development. A subject or patient "in need" of treatment for a disease, disorder, or injury includes, but is not limited to, anyone who exhibits risk factors or symptoms of any of the disease, disorder, or injury. In some embodiments, the subject is a non-human experimental animal (e.g., a mouse, rat, dog, or pig).

[0042] As used herein, the term "in vitro cell" refers to any cell cultured ex vivo. In particular, an in vitro cell can be a eukaryotic cell or a prokaryotic cell. The term "in vivo" means within a patient's body.

[0043] The terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide contains at least two amino acids, and there is no limit to the maximum number of amino acids that may comprise a protein or peptide sequence. Polypeptides include any peptide or protein containing two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to both short chains, commonly referred to in the art as peptides, oligopeptides, and oligomers, and the many types of longer chains commonly referred to in the art as proteins. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0044] As used herein, "tissue" refers to a group of cells and their extracellular matrix derived from the same source. Cells together perform a specific function. Multiple tissue types combine to form organs. Cells can be of different types. In some embodiments, the tissue is epithelial tissue. Epithelial tissue is formed by cells that cover organ surfaces (e.g., the surface of the skin, the respiratory tract, soft organs, the lining of the reproductive and digestive tracts, etc.). Epithelial tissue performs protective functions and is also involved in secretion, excretion, and absorption. Examples of epithelial tissue include, but are not limited to, simple squamous epithelium, stratified squamous epithelium, simple cuboidal epithelium, transitional epithelium, pseudostratified epithelium, columnar epithelium, glandular epithelium, etc. In some embodiments, the tissue is connective tissue. Connective tissue is a fibrous tissue composed of cells separated by non-living material (e.g., extracellular matrix). Connective tissue gives organs their shape and holds them in place. Connective tissue includes fibrous connective tissue, skeletal connective tissue, and humoral connective tissue. Examples of connective tissue include, but are not limited to, blood, bone, tendons, ligaments, fat, and loose connective tissue. In some embodiments, the tissue is muscle tissue. Muscle tissue is active contractile tissue formed from muscle cells. Muscle tissue functions to generate force and cause movement. Muscle tissue includes smooth muscle (e.g., found in the lining of organs), skeletal muscle (e.g., typically attached to bone), and cardiac muscle (e.g., found in the heart, which contracts to pump blood throughout the body). In some embodiments, the tissue is nervous tissue. Nervous tissue includes cells that make up the central and peripheral nervous systems. Nervous tissue forms the brain, spinal cord, cranial nerves, and spinal nerves (e.g., motor neurons). In certain embodiments, the tissue is brain tissue. In certain embodiments, the tissue is placental tissue. In some embodiments, the tissue is cardiac tissue.

[0045] The terms "treatment," "treat," and "treating" refer to the progression, alleviation, delay in onset, or inhibition of progression of a disease as described herein. In some embodiments, treatment may be administered after one or more signs or symptoms of disease have appeared or been observed (e.g., prophylactically (as may be further described herein) or when there is suspicion or risk of disease). In other embodiments, treatment may be administered even when there are no signs or symptoms of disease. For example, treatment may be administered to a susceptible subject (e.g., given the subject's or the subject's family's history of the disease) before symptoms appear. Treatment may also be continued after symptoms have subsided, for example, to delay or prevent recurrence. In some embodiments, treatment may be administered after using the methods disclosed herein to observe changes in spatiotemporal gene expression of one or more nucleic acids of interest in a cell or tissue compared to a healthy cell or tissue or a tissue not altered by the methods disclosed herein. The term "treatment" may also refer to restoring a cell to a physiological state, including reversing cellular stress, preventing cell death, restoring normal growth, etc.

[0046] As used herein, the terms "tumor," "cancer," and "neoplasm" refer to a mass of abnormal tissue in which growth exceeds and is uncoordinated with that of normal tissue. Tumors can be "benign" or "malignant" depending on the following characteristics: degree of cellular differentiation (including morphology and functionality), rate of growth, local invasion, metastasis, etc. "Benign neoplasms" are generally well differentiated, grow slower than malignant neoplasms, and are characterized by remaining localized at the site of origin. Furthermore, benign neoplasms lack the ability to infiltrate, invade, or metastasize to distant sites. Exemplary benign neoplasms include, but are not limited to, lipoma, chondroma, adenoma, acrochordon, senile hemangioma, seborrheic keratosis, lentigo, and sebaceous hyperplasia. In some cases, certain "benign" tumors can subsequently give rise to malignant neoplasms, which may arise from additional genetic alterations in a subpopulation of the tumor's neoplastic cells; these tumors are referred to as "premalignant neoplasms." An exemplary premalignant neoplasm is a teratoma. In contrast, "malignant neoplasms" are generally poorly differentiated (anaplastic) and characterized by rapid growth accompanied by progressive infiltration, invasion, and destruction of surrounding tissue. Furthermore, malignant neoplasms generally have the ability to metastasize to distant sites. The terms "metastasis," "metastatic," or "metastasizing" refer to the spread or migration of cancer cells from a primary or original tumor to another organ or tissue, and are typically distinguishable by the presence of a "secondary tumor" or "secondary cell mass" of the tissue type of the primary or original tumor, rather than the presence of a "secondary tumor" or "secondary cell mass" of the tissue type of the organ or tissue in which the secondary (metastatic) tumor resides. For example, prostate cancer that has metastasized to bone is called metastatic prostate cancer and includes cancerous prostate cancer cells growing within the bone tissue.

[0047] PROTEGE Platform: Programmable Gene Regulators In one embodiment, the present disclosure provides a platform for the rational generation of therapeutics that utilize genes beneficial to respond to disease or injury only in cells requiring a therapeutic response. In one embodiment, the platform uses molecular devices, programmable gene regulators ("PGMs"), to recruit transcription factors responsive to physiological conditions of disease or injury to therapeutic genes of choice. PGMs for a given therapeutic target can be designed from base-pairing rules, known transcription factor-binding DNA sequences, and known genomic sequences.

[0048] In one embodiment, using PGM, the described systems and methods eliminate the need to edit a cell's genome, utilizing existing genetic material and metabolism, overcoming safety concerns associated with gene therapy and gene editing. Furthermore, the effects are limited to the relevant cell population in a relevant physiological environment, thus minimizing off-target effects. Furthermore, the modular programmability of the systems and methods allows for application to different gene targets and physiological actuators to address various injuries, diseases, and cell types. An example of the use of this platform, referred to herein as Protege, is shown in Figures 1A and 1B. The target gene is programmed by the sequence of the crRNA component of the guide nucleic acid, and the transcription factor to which transcriptional regulation responds is programmed by a transcription factor response element incorporated into the guide nucleic acid.

[0049] In one embodiment, the novel PGM can function by recruiting endogenous transcription factors to the promoter region of genes of interest. Whereas existing designs for artificial transcription factors rely on the co-delivery of a module that influences gene transcription and a module that recognizes the target gene promoter, the disclosed approach offers versatility and control by utilizing transcription factors already present in cells. Figures 1A and 1B provide an overview of one possible embodiment of a programmable gene regulation platform. As shown here, transcription factors can be activated by physiological stimuli such as oxidative stress or growth factor signaling. In some embodiments, the PGM comprises a ribonucleoprotein complex composed of a disabled CRISPR-associated protein (e.g., dCas9) and a single-guide chimeric nucleic acid (sgCNA), which contains a DNA hairpin incorporating a binding site for an activating TF, a crispr ("cr") RNA sequence, and a trans-activating CRISPR ("tracr") RNA sequence. The crRNA sequence is complementary to the target DNA and can typically be 17-20 nucleotides in length. The tracrRNA sequence serves as a binding scaffold for the Cas protein. This complex binds to genomic DNA sequences near target genes that respond to physiological signals. The binding site is programmed by the crRNA sequence within the guide nucleic acid. Association of the activated TF with the bound dCas9 complex allows the TF to access the target gene and regulate its transcription. In one embodiment, transcription is activated or enhanced. In other embodiments, transcription can be repressed or reduced. In one embodiment, an advantage of the design in which the DNA hairpin caps a pre-existing hairpin structure within the parent guide RNA (rather than being added to the end) is that it provides a cohesive double-stranded site for ligation, facilitating module synthesis (Figure 1C), which can facilitate "mixing and matching" of genomic targets (defined by the crRNA module) and transcription factors (defined by the transcription factor binding module). Swapping modules does not require resynthesis of everything.

[0050] Thus, Figure 2A is a schematic diagram of the traditional structure of an sgRNA, while Figures 2B and 2C show exemplary embodiments of chimeric guide nucleic acid synthesis highlighting the modules included in accordance with the present disclosure. In comparison to the sgRNA shown in Figure 2B, in the sgRNA shown in Figure 2C, a chimeric guide nucleic acid DNA hairpin caps the various hairpins of the sgRNA from which the illustrated sgRNA is derived.

[0051] Thus, in one embodiment, the present disclosure also provides a PGM comprising two modules: (i) a genomic DNA-binding module that defines a target gene, and (ii) a transcription factor-binding module that defines a transcription factor to be recruited. In some embodiments, the transcription factor-binding module is a DNA duplex containing a consensus binding sequence for a transcription factor linked to a therapeutic gene. From the perspective of the entire molecule, the PGM is composed of a Cas protein and a single guide chimeric nucleic acid (sgCNA) containing a crRNA sequence, a tracrRNA sequence, and a transcription factor-binding site. For synthesis purposes, the crRNA and tracrRNA sequences may be flanked by DNA sequences that function to facilitate ligation with T4 DNA ligase. The crRNA / DNA fragment of the sgCNA is referred to herein as the CrRNA module. The tracrRNA / DNA fragment of the sgCNA is referred to herein as the TracrRNA module. The transcription factor-binding site is also surrounded by additional DNA sequences that allow for the formation of a hairpin duplex. This hairpin duplex fragment is referred to herein as the transcription factor-binding module. See Figure 1B. In one embodiment, these three modules are each synthesized separately and then linked to form a chimeric sgCNA molecule.

[0052] Genomic DNA binding module In one embodiment, the genomic DNA binding functional module comprises a nuclease-deficient Cas protein and a single guide chimeric nucleic acid (sgCNA) component that enables binding to target DNA, specifically the RNA element of the sgCNA. The genomic DNA binding module is designed to bind to genomic DNA in the vicinity of a target therapeutic gene under natural conditions. When a transcription factor is activated by a stimulus (e.g., hypoxia), PGM binds to the activated transcription factor, delivers it to the target gene, and regulates the expression of the gene. In one embodiment, the DNA-binding functional module comprises two RNA portions of a chimeric guide nucleic acid comprising a crRNA sequence and a tracrRNA sequence. In one embodiment, a transcription factor binding module, which is a segment of DNA or RNA or a modified nucleic acid that folds into a hairpin duplex, can be inserted between the crRNA and tracrRNA sequences so as not to interfere with the function of the guide RNA in target DNA recognition of the DNA-binding module. In one embodiment, the chimeric guide nucleic acid is synthesized by ligating three modules: a Trac module, a Cr module, and a TF binding module. See, for example, Figure 1C. RNA nucleotides are shown in bold blue and green font, and DNA nucleotides are shown in black.

[0053] In one embodiment, the Trac and Cr modules comprise an RNA segment and a DNA segment. In one embodiment, the DNA segments are complementary to each other and to the 3' overhang of the TF binding module, and the 5' ends of the Trac and TF binding modules are phosphorylated to allow the Trac and Cr modules to ligate to the TF binding module. In one embodiment, the DNA segments of the Trac and Cr modules are long enough that the three modules constitute a substrate for T4 DNA ligase.

[0054] In one embodiment, the DNA segments comprise the sequence 5'-ACCCTGACTTGACGT-3' (SEQ ID NO: 75) for the crRNA module and 5'-AAGTCAGGGT-3' (SEQ ID NO: 76) for the tracrRNA module. In one embodiment, the modules are prepared by conventional solid-phase oligonucleotide synthesis and purified by polyacrylamide gel electrophoresis. Furthermore, because T4 DNA ligase does not efficiently ligate RNA to DNA, constructing the cr, tracr, and transcription factor binding components of an sgCNA by ligation with T4 DNA ligase may require adapter / linker segments added to the cr and tracr components. Those skilled in the art will recognize that many different linker segment sequences are effective. The DNA linker segments should be at least partially complementary and, upon hybridization, form a duplex with an overhang of at least one nucleotide, preferably at least four nucleotides. The overhang may base-pair with a complementary overhang in the DNA duplex at the site of ligation of the sgCNA to the DNA transcription factor binding component. Either the 5' or 3' end of the transcription factor binding component can be a recessed end of the overhang. Any transcription factor binding module sequence with an overhang complementary to the overhang formed by the DNA segments of the Cr and Tracr modules can be ligated, allowing the same Cr and Tracr modules to be used with different TF binding modules. The ligation sites on each strand can be at least 5 nucleotides, preferably at least 10 nucleotides, from the RNA nucleotides of the cr and tracr components of the sgCNA ligation reaction. Numerous sequences can be used for the DNA linker segments, but the sequences should be selected so that they do not have significant internal base pairing or other internal structures (e.g., G-quadruplexes) are not formed within a single linker segment or between the crRNA or tracrRNA components to which they are attached.This requirement can be determined by inspection or by using nucleic acid folding tools well known to those skilled in the art, an example of such a tool is the mfold program.

[0055] In some embodiments, the crRNA comprises an RNA sequence complementary to a nucleic acid sequence within the promoter region of a gene of interest, and each transcription factor binding site of the PGM is activated in cells in response to an environmental signal and then binds to at least one endogenous transcription factor that recognizes and binds to the transcription factor binding site of the PGM bound to the promoter of the gene of interest via the crRNA, thereby bringing the transcription factor into proximity with the gene of interest and activating or repressing expression of the gene of interest in response to the environmental signal. In one embodiment, the target gene and crRNA sequence are selected from those in Table 1.

[0056] [Table 1] TIFF2025516462000003.tif210153 TIFF2025516462000004.tif199153

[0057] In one embodiment, the DNA-binding module comprises a ribonucleoprotein complex further comprising a CRISPR-associated protein, such as Cas9, mutated to eliminate DNA cleavage activity. In one embodiment, the tracrRNA binds to dCas9. In another embodiment, the tracrRNA binds to any other nuclease-deficient DNA-binding protein (DNAbp). In some embodiments, the DNAbp is selected from nuclease-deficient Cas9, Cas12e, Cas12d, Cas12a, Cas12b1, Cas13a, Cas12c, Argonaute, Cas12b2, Cas13a, Cas12c, Cas12d, Cas12e, Cas12h, Cas12i, Cas12g, Cas12f (Cas14), Cas12f1, Cas12j (Casi), and Argonaute.

[0058] Transcription factor binding modules In one embodiment, the PGM recruits endogenous transcription factors to genes of interest when the endogenous transcription factors are activated in response to environmental signals, thereby regulating gene expression in a cell-specific manner in response to environmental signals. In one embodiment, the PGM comprises at least one TFBM / TFBS. Two or more TFBSs can be used in the same PGM to enhance specificity or activity. In one embodiment, the TF binding module is a DNA hairpin incorporating one or more TF binding sequences (TFBSs) within its double-stranded sequence. In one embodiment, the loop sequence of this hairpin is an exceptionally stable GAAA tetraloop, which promotes proper folding of the hairpin and the complete guide nucleic acid. In one embodiment, this module can be ligated to the Trac and Cr modules with a 3' overhang and a 5' phosphate (5'P).

[0059] In one embodiment, at least one of the TFBSs in the PGM is also present in the target gene. In one embodiment, at least one of the TFBSs in the PGM is not an endogenous TFBS of the target gene. In one embodiment, the transcription factor is selected from a forkhead transcription factor, a nuclear receptor, a POU domain protein, a SMAD, preferably Nrf2, FOX01, NF-kB, USF2, NFAT, EGR1, STAT3, and SREBP. In one embodiment, the transcription factor is Nrf2. In one embodiment, the transcription factor is selected from those listed in Table 2.

[0060] [Table 2] TIFF2025516462000006.tif192169 TIFF2025516462000007.tif198169 TIFF2025516462000008.tif75169

[0061] In one embodiment, the transcription factor is selected from public transcription factor databases, such as those listed in the TRRUST database and the Dorothea database. In one embodiment, the specific sequence to which the TF binds, also referred to as a TF motif, can be selected from a TF motif database, such as JASPAR, HOCOMOCO, CIS-BP, etc. (See Stormo, GD (2015). DNA motif databases and their uses. Current Protocols in Bioinformatics, 51, 2.15.1-2.15.6). These motifs can also be used to predict TFBSs in genomes using tools such as PWMscan (Ambrosini, G., Groux, R., & Bucher, P. (2018). PWMScan: A fast tool for scanning entire genomes with a position-specific weight matrix. Bioinformatics, 34, 2483-2484) or MOODS (Korhonen, J., Martinmaki, P., Pizzi, C., Rastas, P., & Ukkonen, E. (2009). MOODS: fast search for position weight matrix matches in DNA sequences. Bioinformatics, 25(23), 3181-3182).Furthermore, recent advances in TF mapping techniques combined with deep learning algorithms to predict TF binding sites have been successfully used to predict direct binding of some TFs (Avsec, Z., Weilert, M., Shrikumar, A., Krueger, S., Alexandari, A., Dalal, K., Fropf, R., McAnany, C., Gagneur, J., Kundaje, A., & Zeitlinger, J. (2021). Base-resolution models of transcription-factor binding reveal soft motif syntax. Nature Genetics, 53, 354-366). Furthermore, profiles of TFs across thousands of cell types are available (e.g., Moore, JE, Purcaro, MJ, Pratt, HE, Epstein, CB, Shoresh, N., Adrian, J., Kawli, T., Davis, CA, Dobin, A., Kaul, R., Halow, J., van Nostrand, EL, Freese, P., Gorkin, DU, Shen, Y., He, Y., Mackiewicz, M., Pauli-Behn, F., Williams, BA ...Weng, Z. (2020). Expanded encyclopaedias of DNA elements in the human and mouse genomes. Nature, 583, 699-710), and databases of experimentally determined TF binding sites (e.g., REMAP, ChIP-Atlas, or GTRD) can be used to select TF binding in specific cell types. In one embodiment, the TF is selected from those listed in Table 3.

[0062] [Table 3]

[0063] In one embodiment, the TF binding site (TFB / TFBS) is separated from the loop by 8 base pairs to ensure that the structure of the TF binding site is not distorted from the native TF-binding conformation. In some embodiments, the PGM comprises two or more TF binding sites. In one embodiment, the PGM module is constructed in one of the following structures:

[0064] 5'-crRNA-TFBS-tracrRNA-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-3' (wherein the TFBSD is incorporated anywhere within the sequence of the tracrRNA, including one or more of its extensions into hairpin structures); 5'-crRNA-tracrRNA-TFBS-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-3'; 5'-crRNA-TFBS-tracrRNA-TFBS-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-TFBS-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-tracrRNA''''-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-tracrRNA''''-TFBS-3'; 5'-crRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-3'; 5'-crRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-tracrRNA''''-3';

[0065] In these structures, tracRNA', tracrRNA'', tracrRNA''', and tracrRNA''' are contiguous segments of the complete tracrRNA sequence. The terms TB binding site vs. TFBS vs. TFB are all used interchangeably.

[0066] PGM delivery In one embodiment, PGM or individual components thereof (i.e., protein component, sgRNA component) are delivered to a subject enterally. In one embodiment, PGM or individual components thereof are delivered to a subject parenterally. In one embodiment, PGM or individual components thereof are delivered topically. In one embodiment, PGM or individual components thereof are delivered topically, subcutaneously, intraocularly, intravitreal, subretinal, intravenous (IV), intracerebroventricularly, intramuscularly, intrathecally (IT), intracapsularly, intraperitoneally, via inhalation, or by direct injection to one or more cells, tissues, or organs. In some embodiments, PGM delivery is targeted to a specific tissue or cell type. In one embodiment, PGM is delivered to cells by nucleic acid transfection (including electroporation, liposome delivery, etc.) or viral transduction. In some embodiments, PGM is delivered with lipid nanoparticles. In other embodiments, PGM is delivered with liposomes. In other embodiments, the PGMs are delivered with polymeric nanoparticles, such as polymersomes, dendrimers, polymeric micelles, or polymeric nanospheres. In other embodiments, the PGMs are delivered with inorganic nanoparticles, such as silica nanoparticles, iron oxide nanoparticles, or gold nanoparticles.

[0067] In one embodiment, PGM is delivered to cells via cell-penetrating peptides, chemical moieties that mediate cellular uptake by binding to one or more receptors on the cell surface, or cell-type-specific peptide delivery agents (including antibodies and peptides derived from combinatorial libraries and peptides discovered by phage display biopanning for selective internalization and / or intracellular localization). In one embodiment, PGM is delivered with peptides discovered by phage display biopanning using the molecular guidance system platform described in PCT International Publications WO2019014199, WO2019014190, and WO2021066931 for selective internalization and / or intracellular localization. In one embodiment, PGM is delivered to relevant cell types using peptides or peptide derivatives that mediate cell-specific uptake of the attached cargo, such as peptides discovered by phage display biopanning for selective internalization and / or intracellular localization. In one such embodiment, the PGM is encapsulated within a lipid nanoparticle or liposome that displays a cell-selective peptide or peptide derivative on its surface. Various formulations of lipid nanoparticles or liposomes can be used in this embodiment, including lipid nanoparticles or liposomes with polyethylene glycol on their surface to minimize immunogenicity. In one embodiment, the lipid nanoparticles can contain cationic or ionizable lipid compounds that complex with the negatively charged PGM and aid in endosomal escape. In another embodiment, the cell-type-selective peptide or peptide derivative is directly conjugated to the PGM, either by conjugation to a protein component or a guide RNA component.

[0068] Typical applications of the PROTEGE platform In addition to being useful for modulating gene expression in vitro, the PROTEGE platform can be used in the treatment of any disease or disorder that would benefit from up- or down-regulating the expression of a specific target gene. Figure 3 provides various non-limiting examples of different applications of the PROTEGE platform. PGMs are designed to regulate gene expression in response to one or more intracellular or extracellular environmental signals. In one embodiment, the environmental signal is a physiological signal. In one embodiment, the environmental signal is associated with a pathological state of disease, cellular stress, and / or injury. In one embodiment, the signal is an endogenous signal, such as one associated with development and differentiation.

[0069] In one embodiment, the signal is a physical signal. In one embodiment, the signal is a light signal (e.g., ultraviolet light), ionizing radiation, heat / temperature, hyperosmotic conditions, or hypoosmotic conditions. In some embodiments, the signal is a mechanical signal. In some embodiments, the signal is selected from pressure (e.g., touch), sonic movement, and blood pressure. In one embodiment, the signal is a chemical signal. In some embodiments, the chemical signal is a growth factor, cytokine, chemokine, cyclic AMP, hormone, neurotransmitter, extracellular matrix component, bacterial antigen, viral antigen, lipopolysaccharide, gas level (e.g., oxygen level, nitric oxide level), ion level (e.g., calcium level, sodium level), pH, reactive oxygen species, heavy metal, oxidized LDL, or free radical. In one embodiment, the signal is sensed by a receptor. In some embodiments, the receptor is an intracellular receptor (e.g., cytoplasmic, nuclear). In some embodiments, the receptor is a cell surface / extracellular / transmembrane receptor. In some embodiments, the membrane receptor is selected from a G-protein coupled receptor, an ion channel receptor, and an enzyme-linked receptor. In some embodiments, the signal triggers a signal transduction cascade. In some embodiments, the signal transduction cascade triggers the activation of a transcription factor, which regulates gene expression. In some embodiments, the receptor is itself a transcription factor, such as a nuclear receptor for a lipid-soluble ligand (e.g., a steroid hormone). In one example, the receptor / transcription factor is an estrogen receptor or a glucocorticoid receptor, which resides in the cytoplasm until it binds to a ligand, translocates to the nucleus, and expresses target genes.

[0070] Non-limiting examples of well-known signaling cascades that lead to TF activation include TGFβ signaling, which activates SMAD family TFs; Jak-STAT signaling, which activates STAT TFs; Erbb2 signaling, which typically activates Jun and Myc; Hippo signaling, which targets TFs of the TEA domain-containing (TEAD) family (TEAD1-TEAD4); and Notch signaling, which induces DNA-bound RBPJ to dissociate from corepressor complexes and instead recruit coactivator complexes. Examples of TFs that are inactivated by signaling include the FOXO family, a subclass of forkhead TFs. In the absence of insulin, FOXO TFs bind to DNA and activate gene expression. In the presence of insulin, FOXO TFs are phosphorylated by downstream kinases in the PI3K-AKT signaling pathway, resulting in TF exclusion from the nucleus and target gene repression.

[0071] In one embodiment, the signal is associated with a physiological condition, ie, a pathological state of disease, cellular stress, or injury, such as wound healing, radiation exposure, viral or bacterial infection, sepsis, diabetic nephropathy, atherosclerosis, cystic fibrosis, Alzheimer's disease, oxidative stress, ischemia-reperfusion injury, inflammation, cancer, anti-cancer drug resistance, a genetic disease or disorder, or other proliferative disease or disorder, inflammatory disease or disorder, autoimmune disease or disorder, liver disease or disorder, spleen disease or disorder, lung disease or disorder, hematological disease or disorder, neurological disease or disorder, gastrointestinal (GI) disease or disorder, genitourinary disease or disorder, infectious disease or disorder, musculoskeletal disease or disorder, endocrine disease or disorder, metabolic disease or disorder, immune system disease or disorder, central nervous system (CNS) disease or disorder, neurological disease or disorder, ophthalmological disease or disorder, or cardiovascular disease or disorder.

[0072] In one embodiment, anti-cancer drugs that cause resistance to signals that activate transcription factors include biologic anti-cancer drugs and chemotherapeutic agents. Exemplary biologic anti-cancer drugs include, but are not limited to, interferons, cytokines (e.g., tumor necrosis factor, interferon a, interferon g), vaccines, hematopoietic growth factors, monoclonal serum therapy, immunostimulatory and / or immunomodulatory agents (e.g., IL-1, 2, 4, 6, or 12), immune cell growth factors (e.g., GM-CSF), and antibodies (e.g., HERCEPTIN (trastuzumab), T-DM1, AVASTIN (bevacizumab), ERBITUX (cetuximab), VECTIBIX (panitumumab), RITUXAN (rituximab), and Bexar (tositumomab)). Examples of chemotherapeutic agents include, but are not limited to, antiestrogens (e.g., tamoxifen, raloxifene, megestrol), LHRH agonists (e.g., goscrilin, leuprolide), antiandrogens (e.g., flutamide, bicalutamide), photodynamic therapy (e.g., verteporfin (BPD-MA), phthalocyanines, photosensitizer Pc4, and demethoxy-hypocrelin A (2BA-2-DMHA)), nitrogen mustards (e.g., cyclophosphamide, ifosfamide, trofosfamide, chlorambucil, estramustine, melphalan), nitrosoureas (e.g., carmustine (BCNU) and lomustine (CCNU)), alkylsulfonates (e.g., busulfan and and treosulfan), triazenes (e.g., dacarbazine and temozolomide), platinum-containing compounds (e.g., cisplatin, carboplatin, oxaliplatin), vinca alkaloids (e.g., vincristine, vinblastine, vindesine, and vinorelbine), taxoids (e.g., paclitaxel or paclitaxel equivalents, such as nanoparticle albumin-bound paclitaxel (Abraxane), docosahexaenoic acid-bound paclitaxel (DHA-paclitaxel, Taxoplexin), polyglutamic acid-bound paclitaxel (PG-paclitaxel, paclitaxel poliglumex, CT-2103, XYOTAX), tumor-activated prodrug (TAP) ANG1005 (Angiopep-2 bound to three molecules of paclitaxel),Paclitaxel-EC-1 (paclitaxel linked to the erbB 2-recognition peptide EC-1) and glucose-conjugated paclitaxel, e.g., 2'-paclitaxel methyl 2-glucopyranosyl succinate; docetaxel, taxol), epipodophyllins (e.g., etoposide, etoposide phosphate, teniposide, topotecan, 9-aminocamptothecin, camptoirinotecan, irinotecan, crisnatol, mitomycin C), antimetabolites, DHFR inhibitors (e.g., methotrexate, dichloroisothiazolinone, methotrexate, trimetrexate, edatrexate), IMP dehydrogenase inhibitors (e.g., mycophenolic acid, tiazofurin, ribavirin, and EICAR), ribonucleotide reductase inhibitors (e.g., hydroxyurea, deferoxamine), uracil analogs (e.g., 5-fluorouracil (5-FU), floxuridine, doxifluridine, latitrexed, tegafur-uracil, capecitabine), cytosine analogs (e.g., cytarabine (ara C), cytosine arabinoside, and fludarabine), purine analogs (e.g., mercaptopurine and thioguanine), vitamin D3 analogs (e.g., EB 1089, CB 1093, and KH 1060), isoprenylation inhibitors (e.g., lovastatin), dopaminergic neurotoxins (e.g., 1-methyl-4-phenylpyridinium ion), cell cycle inhibitors (e.g., staurosporine), actinomycins (e.g., actinomycin D, dactinomycin), bleomycins (e.g., bleomycin A2, bleomycin B2, peplomycin), anthracyclines (e.g., daunorubicin, doxorubicin, pegylated liposomal doxorubicin, idarubicin, epirubicin, pirarubicin, lanin, zombisin, mitoxantrone), MDR inhibitors (e.g., verapamil), Ca2+ ATPase inhibitors (e.g., thapsigargin), imatinib, thalidomide, lenalidomide, tyrosine kinase inhibitors (e.g., axitinib (AG013736), bosutinib (SKI-606), cediranib (RECENTIN™, AZD2171), dasatinib (Sprycel®, BMS-354825), erlotinib (Tarceva®), gefitinib (Iressa®),Imatinib (Gleevec®, CGP57148B, STI-571), lapatinib (TYKERB®, TYVERB®), lestaurtinib (CEP-701), neratinib (HKI-272), nilotinib (TASIGNA®), semaxanib (semakinib, SU5416), sunitinib (SUTENT®, SU11248), toceranib (PALLADIA®), vandetanib (ZACTIMA®, ZD6474), vatalanib (PTK787, PTK / ZK), trastuzumab (HERCEPTIN®), bevacizumab (AVASTIN®), (Trademark), rituximab (RITUXAN®), cetuximab (ERBITUX®), panitumumab (VECTIBIX®), ranibizumab (Lucentis®), nilotinib (TASIGNA®), sorafenib (NEXAVAR®), everolimus (AFINITOR®), alemtuzumab (CAMPATH®), gemtuzumab ozogamicin (MYLOTARG®), temsirolimus (TORISEL®), ENMD-2076, PCI-32765, AC220, dovitinib lactate (TKI258, CHIR-258), BIBW 2992 (TOVOK (trademark)), SGX523, PF-04217903, PF-02341066, PF-299804, BMS-777607, ABT-869, MP470, BIBF 1120 (VARGATEF®), AP24534, JNJ-26483327, MGCD265, DCC-2036, BMS-690154, CEP-11981, tivozanib (AV-951), OSI-930, MM-121, XL-184, XL-647, and / or XL228), proteasome inhibitors (e.g., bortezomib (VELCADE)), mTOR inhibitors (e.g., rapamycin, temsirolimus (CCI-779), everolimus (RAD-001), ridaforolimus, AP23573 (Ariad), AZD8055 (AstraZeneca), BEZ235 (Novartis), BGT226 (Norvartis), XL765 (Sanofi Aventis),PF-4691502 (Pfizer), GDC0980 (Genentech), SF1126 (Semafoe), and OSI-027 (OSI)), oblimersen, gemcitabine, carminomycin, leucovorin, pemetrexed, cyclophosphamide, dacarbazine, procarbidine, prednisolone, dexamethasone, campatecin, plicamycin, asparaginase, aminopterin, methopterin, porfiromycin, melphalan, leurocidin, leurosine, chlorambucil, trabectedin, procarbazine, discodermolide, carminomycin, aminopterin, and hexamethylmelamine.

[0073] In one embodiment, PGM is used to treat an "autoimmune disease or disorder," which typically refers to a disease or disorder resulting from an inappropriate immune response by a subject's body against substances and tissues present in the body. In other words, the immune system mistakes a part of the body for a pathogen and attacks the body's own cells. This dysfunction can be limited to a specific organ (e.g., autoimmune thyroiditis) or can involve specific tissues in various locations (e.g., Goodpasture's disease, which can affect the basement membrane of both the lungs and kidneys). Treatment of autoimmune diseases typically involves the use of immunosuppressants, e.g., drugs that reduce the immune response. Examples of autoimmune diseases include, but are not limited to, glomerulonephritis, Goodpasture's syndrome, necrotizing vasculitis, lymphadenitis, periarteritis nodosa, systemic lupus erythematosus, rheumatoid arthritis, psoriatic arthritis, systemic lupus erythematosus, psoriasis, ulcerative colitis, systemic sclerosis, dermatomyositis / polymyositis, antiphospholipid syndrome, scleroderma, pemphigus vulgaris, ANCA-associated vasculitis (e.g., Wegener's granulomatosis, microscopic polyangiitis), uveitis, Sjogren's syndrome, Crohn's disease, Reiter's syndrome, ankylosing spondylitis, Lyme disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, and cardiomyopathy.

[0074] In one embodiment, PGM is used to treat "cancer", which refers to a class of diseases characterized by the development of abnormal cells that grow uncontrollably and have the ability to invade and destroy normal body tissues. See, for example, Stedman's Medical Dictionary, 25th ed.; Hensyl ed.; Williams & Wilkins: Philadelphia, 1990. Exemplary cancers include, but are not limited to, acoustic neuroma; adenocarcinoma; adrenal cancer; anal cancer; angiosarcoma (e.g., lymphangiosarcoma, lymphangioendothelial sarcoma, hemangiosarcoma); appendix cancer; benign monoclonal gammopathy; biliary tract cancer (e.g., cholangiocarcinoma); bladder cancer; breast cancer (e.g., breast adenocarcinoma, papillary carcinoma, breast adenocarcinoma, medullary breast carcinoma); brain cancer (e.g., meningioma, glioblastoma, glioma (e.g., astrocytoma, oligodendroglioma), medulloblastoma); bronchial cancer; carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma); choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ependymoma; endothelial sarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., for example, uterine cancer, uterine sarcoma; esophageal cancer (e.g., esophageal adenocarcinoma, Barrett's adenocarcinoma); Ewing's sarcoma; eye cancer (e.g., intraocular melanoma, retinoblastoma); familial eosinophilia; gallbladder cancer; gastric cancer (e.g., gastric adenocarcinoma); gastrointestinal stromal tumor (GIST); germ cell cancer; head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma), pharyngeal cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer)); hematopoietic cancer (e.g., leukemia such as acute lymphoblastic leukemia (ALL) (e.g., B-cell ALL, T-cell ALL), acute myeloid leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myeloid leukemia (CML) (e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia (CLL) (e.g., B-cell CLL, T-cell CLL));Lymphomas, such as Hodgkin's lymphoma (HL) (e.g., B-cell HL, T-cell HL) and non-Hodgkin's lymphoma (NHL) (e.g., B-cell NHL, e.g., diffuse large cell lymphoma (DLCL) (e.g., diffuse large B-cell lymphoma), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphoma (e.g., mucosa-associated lymphoid tissue (MALT) lymphoma, lymph node marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt's lymphoma, lymphoplasmacytic lymphoma (i.e., Waldenstrom's macroglobulinemia), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, and primary central nervous system (CNS) lymphoma; and T-cell NHL, e.g., precursor T-lymphoblastic lymphoma / leukemia, peripheral T-cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma (CTCL) (e.g., mycosis fungoides, Sézary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathic T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, and anaplastic large cell lymphoma; mixed leukemia / lymphoma of one or more of the above; and multiple myeloma (MM); heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease); hemangioblastoma, hypopharyngeal carcinoma; inflammatory myofibroblastic tumor; immune cell amyloidosis; kidney cancer (e.g., nephroblastoma, also known as Wilms' tumor, renal cell carcinoma); liver cancer (e.g., hepatocellular carcinoma (HCC), malignant hepatocellular carcinoma); lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), lung adenocarcinoma); leiomyosarcoma (LMS); mastocytosis (e.g., systemic hypertension) myeloma; myelodysplastic syndromes (MDS); mesothelioma; myeloproliferative disorders (MPDs) (e.g., polycythemia vera (PV), essential thrombocytosis (ET), idiopathic myelofibrosis (AMM), also known as myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelogenous leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)); neuroblastoma; neurofibromas (e.g., neurofibromatosis (NF) type 1 or 2, schwannomatosis); neuroendocrine cancers (e.g., gastrointestinal pancreatic neuroendocrine tumors (GEP-NETs), carcinoid tumors); osteosarcomas (e.g., bone cancer);Ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), pancreatic islet cell tumor); penile cancer (e.g., Paget's disease of the penis and scrotum); pinealoma; primitive neuroectodermal tumor (PNT); plasma cell neoplasm; paraneoplastic syndrome; intraepithelial neoplasia; prostate cancer (e.g., prostatic adenocarcinoma); rectal cancer; rhabdomyosarcoma; salivary gland cancer; skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA)) , melanoma, basal cell carcinoma (BCC); small intestine cancer (e.g., appendix cancer); soft tissue sarcomas (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myosarcoma); sebaceous gland carcinoma; small intestine carcinoma; sweat gland carcinoma; synovioma; testicular cancer (e.g., seminoma, testicular embryonal carcinoma); thyroid cancer (e.g., papillary thyroid carcinoma, papillary thyroid adenoma (PTC), medullary thyroid carcinoma); urethral cancer; vaginal cancer; and vulvar cancer (e.g., Paget's disease of the vulva);

[0075] In one embodiment, PGM is used to treat a "genetic disease or disorder," which refers to a disease or disorder caused by one or more abnormalities in a subject's genome, e.g., a disease present from birth. A genetic disease or disorder can be inherited and can be passed down from a parent's genes. A genetic disease or disorder can also be caused by a mutation or change in a subject's DNA and / or RNA. In such cases, the genetic disease or disorder is heritable if it occurs in the germline. Examples of genetic diseases or disorders include, but are not limited to, Askeog-Scott syndrome, Aase syndrome, achondroplasia, epiostosis imperfecta, addiction, adrenoleukodystrophy, albinism, anophthalmia-macrostomia syndrome, Alagille syndrome, alkaptonuria, alpha-1 antitrypsin deficiency, Alport syndrome, Alzheimer's disease, asthma, autoimmune polyglandular syndrome, androgen insensitivity syndrome, Angelman syndrome, and motor Ataxia, ataxia-telangiectasia, atherosclerosis, attention deficit hyperactivity disorder (ADHD), autism, alopecia, Batten disease, Beckwith-Wiedemann syndrome, Best disease, bipolar disorder, brachydactyly, breast cancer, Burkitt lymphoma, chronic myeloid leukemia, Charcot-Marie-Tooth disease, Crohn's disease, cleft lip, Cockayne syndrome, Coffin-Lowry syndrome, colon cancer, congenital adrenal hyperplasia, Cornelia de Lange syndrome, Stellate syndrome, Cowden syndrome, craniofrontonasal dysplasia, Crigler-Najjar syndrome, Creutzfeldt-Jakob disease, cystic fibrosis, hearing loss, depression, diabetes, dysplasia, DiGeorge syndrome, Down syndrome, dyslexia, Duchenne muscular dystrophy, Dubowitz syndrome, ectodermal dysplasia, Ellis-van Creveld syndrome, Ehlers-Danlos syndrome, epidermolysis bullosa, epilepsy, essential tremor, familial hypercholesterolemia disease, familial Mediterranean fever, fragile X syndrome, Riedreich's ataxia, Gaucher's disease, glaucoma, glucose-galactose malabsorption, glutaric aciduria, rotational atrophy, Goldberg-Shprintzen syndrome (palatocardiofacial syndrome), Gorlin syndrome, Hailey-Hailey disease, hemihypertrophy, hemochromatosis, hemophilia, hereditary motor and sensory neuropathy (HMSN), hereditary nonpolyposis colorectal cancer (HNPCC), Huntington's disease,Hyper-IgM immunodeficiency, juvenile-onset diabetes, Klinefelter's syndrome, Kabuki syndrome, Leigh's disease, long QT syndrome, lung cancer, malignant melanoma, bipolar disorder, Marfan's syndrome, Menkes syndrome, miscarriage, mucopolysaccharidosis, multiple endocrine tumors, multiple sclerosis, muscular dystrophy, amyotrophic lateral sclerosis, myotonic dystrophy, neurofibromatosis, Niemann-Pick disease, Noonan syndrome, obesity, ovarian cancer, pancreatic cancer, Parkinson's disease, paroxysmal nocturnal hemoglobinuria, Pendred's syndrome, peroneal muscular atrophy, phenylketonuria (PKU), polycystic kidney disease, Prader-Willi syndrome, primary biliary cirrhosis, These include prostate cancer, REAR syndrome, Refsum's disease, retinitis pigmentosa, retinoblastoma, Rett syndrome, Sanfilippo syndrome, schizophrenia, severe combined immunodeficiency, sickle cell anemia, spina bifida, spinal muscular atrophy, spinocerebellar atrophy, sudden adult death syndrome, Tangier disease, Tay-Sachs disease, thrombocytopenic radial defect syndrome, Townes-Brocks syndrome, tuberous sclerosis complex, Turner syndrome, Usher syndrome, von Hippel-Lindau syndrome, Waardenburg syndrome, Weaver syndrome, Werner syndrome, Williams syndrome, Wilson's disease, xeroderma pigmentosum, and Zellweger syndrome.

[0076] In one embodiment, PGM is used to treat "blood diseases or disorders," including diseases or disorders affecting hematopoietic cells or tissues. Blood diseases or disorders include diseases or disorders associated with abnormal blood content and / or function. Examples of blood diseases or disorders include diseases resulting from bone marrow irradiation or cancer chemotherapy treatment, pernicious anemia, hemorrhagic anemia, hemolytic anemia, aplastic anemia, sickle cell anemia, sideroblastic anemia, anemia associated with chronic infections such as malaria, trypanosomiasis, HTV, hepatitis virus, or other viruses, myelophthisic anemia caused by bone marrow failure, renal failure caused by anemia, anemia, erythrocytosis, infectious mononucleosis (EVI), acute nonlymphocytic leukemia (ANLL), acute myeloid leukemia (AML), acute promyelocytic leukemia (APL), These include acute myelomonocytic leukemia (AMMoL), polycythemia vera, lymphoma, acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia, Wilms' tumor, Ewing's sarcoma, retinoblastoma, hemophilia, diseases with an increased risk of thrombosis, antibody-mediated diseases such as herpes, thalassemia, transfusion reactions and erythroblastosis, mechanical trauma to red blood cells such as microangiolytic anemia, thrombotic thrombocytopenic purpura, disseminated intravascular coagulation, parasitic infections such as malaria parasites, chemical damage such as from lead poisoning, and hypersplenism.

[0077] In one embodiment, PGM is used to treat "inflammatory diseases or disorders" and "inflammatory conditions," which are used interchangeably herein and refer to diseases, disorders, or conditions caused by, resulting from, or resulting from inflammation. Inflammatory diseases or disorders and symptoms include those diseases, disorders, or conditions characterized by signs of pain (due to pain, production of noxious substances, and nerve stimulation), heat (due to heat, vasodilation), redness (due to redness, vasodilation, and increased blood flow), swelling (due to swelling, excessive inflow or restricted outflow of fluid), and / or loss of function (which may be partial or complete, temporary or permanent). Inflammation comes in many forms, including, but not limited to, acute, adhesive, atrophic, catarrhal, chronic, cirrhotic, diffuse, disseminated, exudative, fibrotic, fibrosing, focal, granulomatous, hyperplastic, hypertrophic, interstitial, metastatic, necrotic, obstructive, parenchymal, plastic, productive, proliferative, pseudomembranous, suppurative, sclerosing, serous, serous, simple, specific, subacute, suppurative, toxic, traumatic, and / or ulcerative inflammation. The term "inflammatory disease" can also refer to a dysregulated inflammatory response that triggers an excessive response by macrophages, granulocytes, and / or T lymphocytes, resulting in abnormal tissue damage and / or cell death. Inflammatory diseases can be either acute or chronic inflammatory conditions and can be caused by infectious or non-infectious causes.Inflammatory diseases include, but are not limited to, atherosclerosis, arteriosclerosis, autoimmune diseases, multiple sclerosis, systemic lupus erythematosus, polymyalgia rheumatica (PMR), gouty arthritis, osteoarthritis, tendonitis, bursitis, psoriasis, cystic fibrosis, arthritis, rheumatoid arthritis, inflammatory arthritis, Sjogren's syndrome, giant cell arteritis, progressive systemic sclerosis (scleroderma), ankylosing spondylitis, polymyositis, dermatomyositis, pemphigus, pemphigoid, diabetes (e.g., type 1), myasthenia gravis, Hashimoto's thyroiditis, Graves' disease, Good's disease, and the like. Depasture's disease, mixed connective tissue disease, sclerosing cholangitis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, pernicious anemia, inflammatory skin diseases, usual interstitial pneumonia (UIP), asbestosis, silicosis, bronchiectasis, beryllium disease, talci, pneumoconiosis, sarcoidosis, desquamative interstitial pneumonia, lymphocytic interstitial pneumonia, giant cell interstitial pneumonia, cellular interstitial pneumonia, extrinsic allergic alveolitis, Wegener's granulomatosis and related vasculitis (temporal arteritis and polyarteritis nodosa), inflammatory skin diseases, hepatitis, delayed hypersensitivity reactions (e.g., ivy ivy) dermatitis), pneumonia, respiratory inflammation, adult respiratory distress syndrome (ARDS), encephalitis, immediate hypersensitivity reaction, asthma, hay fever, allergy, acute anaphylaxis, rheumatic fever, glomerulonephritis, pyelonephritis, cellulitis, cystitis, chronic cholecystitis, ischemia (ischemic injury), reperfusion injury, allograft rejection, host-versus-graft rejection, appendicitis, arteritis, blepharitis, bronchiolitis, bronchitis, cervicitis, cholangitis, chorioamnionitis, conjunctivitis, dacryoadenitis, dermatomyositis, endocarditis, endometritis, enteritis, enterocolitis, epicondylitis, epididymitis, fasciitis, These include fibrositis, gastritis, gastroenteritis, gingivitis, ileitis, iritis, laryngitis, myelitis, myocarditis, nephritis, omphalitis, oophoritis, orchitis, osteitis, otitis media, pancreatitis, parotitis, pericarditis, pharyngitis, pleuritis, phlebitis, pneumonia, proctitis, prostatitis, rhinitis, salpingitis, sinusitis, stomatitis, synovitis, orchitis, tonsillitis, urethritis, urinary bladder inflammation, uveitis, vaginitis, vasculitis, vulvitis, vulvovaginitis, angitis, chronic bronchitis, osteomyelitis, optic neuritis, temporal arteritis, transverse myelitis, necrotizing fasciitis, and necrotizing enterocolitis. Ocular inflammatory diseases include, but are not limited to, post-operative inflammation.

[0078] Further exemplary inflammatory conditions include, but are not limited to, inflammation associated with acne, anemia (e.g., aplastic anemia, hemolytic autoimmune anemia), asthma, arteritis (e.g., polyarteritis, temporal arteritis, periarteritis nodosa, Takayasu's arteritis), arthritis (e.g., crystalline arthritis, osteoarthritis, psoriatic arthritis, gouty arthritis, reactive arthritis, rheumatoid arthritis, and Reiter's arthritis), ankylosing spondylitis, amylosis, amyotrophic lateral sclerosis, autoimmune diseases, allergies or allergic reactions, atherosclerosis, bronchitis, bursitis, chronic inflammatory diseases, and chronic inflammatory conditions. prostatitis, conjunctivitis, Chagas' disease, chronic obstructive pulmonary disease, corticomyositis, diverticulitis, diabetes (e.g., type I diabetes, type II diabetes), skin diseases (e.g., psoriasis, eczema, burns, dermatitis, pruritus (itching)), endometriosis, Guillain-Barré syndrome, infections, ischemic heart disease, Kawasaki's disease, glomerulonephritis, gingivitis, hypersensitivity, headaches (e.g., migraine, tension headache), intestinal obstruction (e.g., postoperative ileus, septic ileus), idiopathic thrombocytopenic purpura, interstitial cystitis (painful bladder syndrome), gastrointestinal disorders (e.g., peptic ulcer, regional enteritis, diverticulitis, Gastrointestinal bleeding, eosinophilic gastrointestinal disorders (e.g., eosinophilic esophagitis, eosinophilic gastritis, eosinophilic gastroenteritis, eosinophilic colitis), gastritis, diarrhea, gastroesophageal reflux disease (GORD, or its synonym GERD), inflammatory bowel disease (IBD) (e.g., Crohn's disease, ulcerative colitis, collagen vascular disease, lymphocytic colitis, ischemic colitis, diversion colitis, Behcet's syndrome, atypical colitis), inflammatory bowel syndrome (IBS), lupus, multiple sclerosis, morphea, myasthenia gravis, myocardial ischemia, nephrotic syndrome, pemphigus vulgaris, pernicious anemia, peptic ulcer, polymyositis , primary biliary cirrhosis, neuroinflammation associated with brain damage (e.g., Parkinson's disease, Huntington's disease, and Alzheimer's disease), prostatitis, chronic inflammation associated with cranial radiation injury, pelvic inflammatory disease, reperfusion injury, regional enterocolitis, rheumatic fever, systemic lupus erythematosus, scleroderma, scleroma, sarcoidosis, spondyloarthropathy, Sjogren's syndrome, thyroiditis, transplant rejection, tendonitis, trauma or injury (e.g., frostbite, chemical irritants, toxins, scarring, burns, physical injury), vasculitis, vitiligo, and Wegener's granulomatosis.In certain embodiments, the inflammatory condition is selected from arthritis (e.g., rheumatoid arthritis), inflammatory bowel disease, inflammatory bowel syndrome, asthma, psoriasis, endometriosis, interstitial cystitis, and prostatitis. In certain embodiments, the inflammatory condition is an acute inflammatory condition (e.g., inflammation caused by infection). In certain embodiments, the inflammatory condition is a chronic inflammatory condition (e.g., conditions caused by asthma, arthritis, or inflammatory bowel disease).

[0079] In one embodiment, PGM is used to treat "liver disease or disorder" or "liver disease," which refers to damage or disease of the liver. Non-limiting examples of liver diseases or disorders include intrahepatic cholestasis (e.g., Alagille syndrome, biliary cirrhosis), fatty liver (e.g., alcoholic fatty liver, Reye's syndrome), hepatic vein thrombosis, hepatolenticular degeneration (i.e., Wilson's disease), hepatomegaly, liver abscess (e.g., amebic liver abscess), cirrhosis (e.g., alcoholic cirrhosis, biliary cirrhosis, and experimental cirrhosis), alcoholic liver disease (e.g., fatty liver, hepatitis, cirrhosis), parasitic liver disease (e.g., liver capsules), and the like. Hepatic fascioliasis, fascioliasis, amoebic liver abscess), jaundice (e.g., hemolytic jaundice, hepatocellular jaundice, cholestatic jaundice), cholestasis, portal hypertension, hepatomegaly, ascites, hepatitis (e.g., alcoholic hepatitis, animal hepatitis), chronic hepatitis (e.g., autoimmune hepatitis, hepatitis B, hepatitis C, hepatitis D, drug-induced chronic hepatitis, etc.), toxic hepatitis, viral human hepatitis (e.g., hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E), granulomatous hepatitis, secondary biliary cirrhosis, Hepatic encephalopathy, varices, primary biliary cirrhosis, primary sclerosing cholangitis, hepatocellular adenoma, hemangioma, gallstones, liver failure (e.g., hepatic encephalopathy, acute liver failure), angiomyolipoma, calcified liver metastases, cystic liver metastases, fibrolamellar hepatocellular carcinoma, hepatic adenoma, hepatocellular carcinoma, liver cysts (e.g., simple cyst, polycystic liver disease, hepatobiliary cystadenoma, choledochal cyst), mesenchymal tumors (mesenchymal hamartoma, infantile hemangioendothelioma, hemangioma, hepatic purpura, lipoma, inflammatory pseudotumor), epithelial tumors (e.g., biliary hamartoma) These include: hepatocellular carcinoma, bile duct adenoma), focal nodular hyperplasia, nodular regenerative hyperplasia, hepatoblastoma, hepatocellular carcinoma, cholangiocarcinoma, cystadenocarcinoma, vascular tumors, angiosarcoma, Karposi's sarcoma, hemangioendothelioma, embryonal sarcoma, fibrosarcoma, leiomyosarcoma, rhabdomyosarcoma, carcinosarcoma, teratoma, carcinoid, squamous cell carcinoma, primary lymphoma, peliosis hepatis, erythrocytic hepatic porphyria, hepatic porphyrias (e.g., acute intermittent porphyria, porphyria cutanea tarda), and Zellweger syndrome.

[0080] In one embodiment, PGM is used to treat a "pulmonary disease or disorder" or "pulmonary disease or disorder," which refers to a disease or disorder of the lungs. Examples of pulmonary diseases or disorders include, but are not limited to, bronchiectasis, bronchitis, bronchopulmonary dysplasia, interstitial lung disease, occupational lung disease, emphysema, cystic fibrosis, acute respiratory distress syndrome (ARDS), severe acute respiratory syndrome (SARS), asthma (e.g., intermittent asthma, mild persistent asthma, moderate persistent asthma, severe persistent asthma), chronic bronchitis, chronic obstructive pulmonary disease (COPD), emphysema, interstitial lung disease, sarcoidosis, asbestosis, aspergilloma, aspergillosis, pneumonia (e.g., lobar pneumonia, multilobar pneumonia, bronchopneumonia, interstitial pneumonia), pulmonary fibrosis, pulmonary tuberculosis, rheumatic lung disease, pulmonary embolism, and lung cancer (e.g., non-small cell lung cancer (e.g., adenocarcinoma, squamous cell carcinoma, large cell lung carcinoma), small cell lung carcinoma).

[0081] In one embodiment, PGM is used to treat a "neurological disease or disorder," which refers to any disease or disorder of the nervous system, including diseases or disorders involving the central nervous system (brain, brainstem, and cerebellum), the peripheral nervous system (including cranial nerves), and the autonomic nervous system (portions of which are located in both the central and peripheral nervous systems). Neurodegenerative diseases or disorders refer to a class of neurological diseases or disorders characterized by the loss of nerve cells, including, but not limited to, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, tauopathies (including frontotemporal dementia), and Huntington's disease. Examples of neurological diseases or disorders include, but are not limited to, headaches, stupor and coma, dementia, seizures, sleep disorders, trauma, infections, neoplasms, neuro-ophthalmological, movement disorders, demyelinating diseases, spinal cord disorders, and disorders of the peripheral nerves, muscles, and neuromuscular junction. Addiction and psychiatric disorders include, but are not limited to, bipolar disorder and schizophrenia, and are also included in the definition of neurological disorders, but are not limited to these. Further examples of neurological disorders include acquired epileptiform aphasia; acute disseminated encephalomyelitis; adrenoleukodystrophy; agenesis of the corpus callosum; agnosia; Aicardi syndrome; Alexander disease; Alpers disease; alternating hemiplegia; Alzheimer's disease; amyotrophic lateral sclerosis; anencephaly; Angelman syndrome; angiomatosis; anoxia; aphasia; apraxia; arachnoid cysts; arachnoiditis; Arnold-Chiari malformation; arteriovenous malformations; Asperger's syndrome. Garr syndrome; ataxia-telangiectasia; attention deficit hyperactivity disorder; autism; autonomic dysfunction; back pain; Batten disease; Behçet's disease; Bell's palsy; benign essential blepharospasm; benign focal muscular atrophy; benign intracranial hypertension; Binswanger disease; blepharospasm; Bloch-Sulzberger syndrome; brachial plexus injury; brain abscess; brain injury; brain tumor (including glioblastoma multiforme); spinal cord tumor; Brown-Séquard syndrome;Canavan disease, carpal tunnel syndrome (CTS), causalgia, central pain syndrome, central pontine myelinolysis, head injury, cerebral aneurysm, cerebral arteriosclerosis, cerebral atrophy, cerebral gigantism, cerebral palsy, Charcot-Marie-Tooth disease, chemotherapy-induced neuropathy and neuropathic pain, Chiari malformation, chorea, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic pain, chronic regional pain syndrome, Coffin-Lowry syndrome, coma including persistent vegetative state, congenital facial diplegia, corticobasal degeneration, cranial arteritis, craniosynostosis, Creutzfeldt-Jakob disease Todd-Jakob disease, cumulative trauma disorder, Cushing's syndrome, cytomegalic inclusion body disease (CIBD), cytomegalovirus infection; dancing eyes dancing feet syndrome, Dandy-Walker syndrome, Dawson's disease, de Morsier syndrome, Dejerine-Kramke palsy, dementia, dermatomyositis, diabetic neuropathy, diffuse sclerosis, autonomic dysfunction, dysgraphia, dyslexia, dystonia, early infantile epileptic encephalopathy, empty sella syndrome, encephalitis, encephalocele, cerebral trigeminal angiomatosis, epilepsy, Erb's palsy, essential tremor, Fabry disease, Fahr's syndrome, syncope, familial spastic paraparesis, febrile seizures, Fisher's syndrome, Friedreich's ataxia, frontotemporal dementia and other "tauopathies"; Gaucher's disease, Gerstmann's syndrome, giant cell arteritis, giant cell inclusion disease, globoid cell leukodystrophy, Guillain-Barré syndrome, HTFV-1-associated myelopathy, Hallervorden-Spatz disease, head trauma, headache, hemifacial spasm, hereditary spastic paraplegia, polyneuritis-like genetic disorders, herpes zoster oticus, herpes zoster, Hirayama's syndrome, HIV-associated dementia and dementia. Neuropathy (see also Neurological Manifestations of AIDS), holoprosencephaly, Huntington's disease and other polyglutamine repeat diseases, hydranencephaly, hydrocephalus, hypercortisolism, hypoxia; immune-mediated encephalomyelitis, inclusion body myositis, incontinentia pigmenti, infantile; phytanic acid storage disease, infantile Refsum disease, infantile spasms, inflammatory myopathy, intracranial cysts, intracranial hypertension, Joubert syndrome, Kearns-Sayre syndrome, Kennedy disease, Kinsborn syndrome, Klippel-Feil syndrome, Krabbe disease, Kugelberg-Welander disease, kuru;Fafora disease, Van Beer-Eaton myasthenic syndrome, Van Doer-Kleffner syndrome, lateral bulbar (Wallenberg) syndrome, learning disabilities, Fay's disease, Fenox-Gastaut syndrome, Fesch-Nyhan syndrome, leukodystrophy, Fewy body dementia, lissencephaly, locked-in syndrome, Huh-Gehrig's disease (also known as motor neuron disease or amyotrophic lateral sclerosis), lumbar disc disease, Lyme disease and neurological sequelae; Machado-Joseph disease; megacephaly; megalencephaly; Melkerson-Rosenthal syndrome; Meniere's disease; meningitis; Menkes disease; metachromatic leukodystrophy; microcephaly; migraine; Miller-Fisher syndrome; mini-stroke; mitochondrial myopathy; Moebius syndrome; monomyelinating leukodystrophy Amyotrophy; Motor neuron disease; Moyamoya disease; Mucopolysaccharidosis; Multi-infarct dementia; Multifocal motor neuropathy; Multiple sclerosis and other demyelinating disorders; Multiple system atrophy with orthostatic hypotension; Muscular dystrophy; Myasthenia gravis; Myelinclastic diffuse sclerosis; Infantile myoclonic encephalopathy; Myoclonus; Myopathy; Congenital myotonia; Narcolepsy, Neurofibromatosis, Neuroleptic malignant syndrome, Neurological symptoms of AIDS, Neurological sequelae of lupus, Neuromyotonia, Neuronal ceroid lipofuscinosis, neuronal migration disorder, Niemann-Pick disease, O'Sullivan-McLeod syndrome, occipital neuralgia, latent spinal dysraphism, Ohtahara syndrome, olivopontocerebellar atrophy, blepharoclonic myoclonus, optic neuritis, orthostatic hypotension, overuse syndrome; paresthesias, Parkinson's disease, paramyotonia congenita, paraneoplastic disorders, paroxysmal seizures, Parry-Romberg syndrome, Pelizaeus-Merzbacher disease, periodic paralysis, peripheral neuropathy Harm, painful neuropathy and neuropathic pain, persistent vegetative state, pervasive developmental disorder, photophobia, phytanic acid storage disease, Pick's disease, nerve compression, pituitary tumor, polymyositis, porencephaly, post-polio syndrome, postherpetic neuralgia (PHN), post-infectious encephalomyelitis, orthostatic hypotension, Prader-Willi syndrome, primary lateral sclerosis, prion disease, progressive hemifacial atrophy, progressive multifocal leukoencephalopathy, progressive sclerosing poliodystrophy, progressive supranuclear palsy, pseudotumor cerebri;Ramsay Hunt syndrome (types I and II), Rasmussen's encephalitis, reflex sympathetic dystrophy syndrome, Refsum's disease, repetitive movement disorder, repetitive stress injury, restless legs syndrome, retroviral-associated myelopathy, Rett syndrome, Reye's syndrome; Saint Vitus chorea, Sandhoff disease, Schilder's disease, schizencephaly, septo-optic dysplasia, shaken baby syndrome, shingles, Shy-Drager syndrome, Sjogren's syndrome, sleep apnea, Soto syndrome, spasticity; spina bifida; spinal cord injury, spinal tumor, spinal muscular atrophy, stiff-person syndrome, stroke, Sturge-Weber syndrome, subacute sclerosing panencephalitis, subarachnoid hemorrhage, cutaneous Substances that may be present include: subarachnoid arteriosclerotic encephalopathy, Sydenham chorea, syncope, syringomyelia; tardive dyskinesia, Tay-Sachs disease, temporal arteritis, tethered spinal cord syndrome, Thomsen's disease, thoracic outlet syndrome, painful tics, Todd's palsy, Tourette's syndrome, transient ischemic attack, transmissible spongiform encephalopathy, transverse myelitis, traumatic brain injury, tremor, trigeminal neuralgia, tropical spastic paraplegia, tuberous sclerosis; vascular dementia (multi-infarct dementia), vasculitis including temporal arteritis, von Hippel-Lindau disease (VHL), Wallenberg syndrome, Werdnig-Hoffmann disease, West syndrome, whiplash injury, Williams syndrome, Wilson's disease, and Zellweger syndrome.

[0082] In one embodiment, PGM is used to treat a "neurodegenerative disease or disorder," where neurodegenerative disease or disorder refers to a type of neurological disease or disorder characterized by the loss of nerve cells, including, but not limited to, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, tauopathies (including frontotemporal dementia), and Huntington's disease. In some embodiments, the neurodegenerative disease or disorder is Alzheimer's disease. The cause of Alzheimer's disease is not fully understood, but genetic factors are thought to play a role in most cases. The disease is characterized by the loss of neurons and synapses in the cerebral cortex, resulting in atrophy of the affected area. Biochemically, Alzheimer's disease is characterized by a protein misfolding disorder caused by the accumulation of plaques of abnormally folded amyloid beta and tau proteins in the brain. Symptoms of Alzheimer's disease include, but are not limited to, difficulty recalling recent events, language problems, disorientation, mood swings, loss of motivation, self-neglect, and behavioral problems. Eventually, bodily functions are gradually lost, and Alzheimer's disease ultimately leads to death. Treatments currently aim to treat the cognitive problems caused by the disease (e.g., acetylcholinesterase inhibitors or NMDA receptor antagonists), psychosocial interventions (e.g., behaviorally or cognitively oriented approaches), and general care. Currently, no treatment can completely halt or reverse the progression of the disease.

[0083] In one embodiment, PGM is used to treat a "proliferative disease or disorder," which refers to a disease or disorder caused by abnormal growth or expansion of cells through proliferation (Walker, Cambridge Dictionary of Biology, Cambridge University Press: Cambridge, UK, 1990). A proliferative disease or disorder may be associated with 1) pathological proliferation of normally quiescent cells; 2) pathological migration of cells from their normal location (e.g., metastasis of tumor cells); 3) pathological expression of proteolytic enzymes such as matrix metalloproteinases (e.g., collagenase, gelatinase, and elastase); or 4) pathological angiogenesis, such as proliferative retinopathy and tumor metastasis. Exemplary proliferative diseases include cancer (i.e., "malignant neoplasms"), benign neoplasms, angiogenesis, inflammatory diseases, and autoimmune diseases.

[0084] Target gene The target gene used in the present disclosure is not particularly limited, so long as it is a gene that produces and expresses RNA (e.g., mRNA, IncRNA, miRNA) in vitro or in a cell (preferably, the cell is a prokaryotic or eukaryotic cell, preferably a mammalian cell, a non-human primate cell, or a human cell). In one embodiment, the target gene encodes a protein. In one embodiment, the target gene encodes a microRNA. In one embodiment, the target gene encodes a long non-coding RNA. The target gene can be selected from any gene whose increased or decreased expression is beneficial for treating a selected physiological or pathological condition of disease, disorder, cellular stress, or injury, examples of which are described below. In one embodiment, a target gene has an endogenous TFBS, and the proximity of the TF can cause it to translocate from the PGM to its endogenous binding site. In one embodiment, a TF bound to a PGM can remain bound to the PGM regardless of the presence of a binding site within the gene. Because TF action can depend on their general proximity to the transcription start site or chromatin associated with the gene, co-linearity of the bound DNA and the gene is not required. In one embodiment, the target gene is a gene having a binding site for a TF introduced via PGM. In this case, the TF may be known to regulate the expression of that gene. In some embodiments, the presence of a TFBS in a target gene of a TF in PGM has been initially identified by the methods of the present disclosure.

[0085] In another embodiment, the target gene does not have a known binding site for the TF introduced via PGM. Instead, PGM introduces the TF into proximity with the promoter of the target gene via a DNA-binding module, which is sufficient for the TF to enhance or reduce the expression of the target gene. In other words, the target gene can be controlled via PGM by a TF that would not control the expression of the target gene without PGM. Thus, the PROTEGE platform extends to the regulation of the expression of any desired / undesirable target gene via PGM, because PGM is designed to specifically bind to the promoter of the target gene via the sgRNA / dCas portion, and then delivers a TF activated by a signal associated with the desired condition (e.g., HIF-1α, which is activated by hypoxia) to the target gene via the TFBS of PGM. Thus, the present disclosure provides a method for highly specific control of target gene expression in a cell-specific manner, since only cells exposed to a signal that activates a TF will bring that TF into proximity with the target gene via PGM. In the absence of a signal, PGM may bind to the promoter region of the target gene, but nothing happens because there is no TF on PGM. The TFBS is empty until a signal activates the TF, after which the TF binds to PGM and activates or reduces expression of the target gene.

[0086] In one embodiment, the target gene is selected from the following categories: Fc receptors, IgG-Fc regulatory, cytokines, interleukins, growth factors, kinases, nucleases, proteases, enzymes, stem cell proteins, epigenetic proteins, cancer proteins, immunotherapy proteins, CD molecule proteins, receptor proteins (e.g., cytokines, growth factors, B cell, monocyte, granulocyte, NK cell, stem cell, T cell, and dendritic cell receptors), TNF superfamily, B7 family, TGFβ family, cell therapy proteins, immune checkpoint proteins.

[0087] In one embodiment, the target gene is selected from among pro-inflammatory and anti-inflammatory genes. In one embodiment, such genes are selected from cytokines (GM-CSF, IFNα, IFNγ, IL-1α, IL-1β, IL-4, IL-6, IL-8, IL-10, IL-12p70, IL-13, IL-17A (CTLA-8), and TNFα); chemokines (IP-10 (CXCL10), MCP-1 (CCL2), MIP-1α (CCL3), MIP-1β (CCL4); and / or cell adhesion and inflammatory response genes (ICAM-1, CD62E (E-selectin), CD62P (P-selectin)). In one embodiment, In one embodiment, the target gene encodes an anti-inflammatory cytokine. In one embodiment, the cytokine may be selected from IL-1β, IL-4, IL-6, IL-1RA, IL-4, IL-6, IL-10, IL-11, IL-13, and TGFβ, and it is desirable to upregulate the expression of the cytokine with PGM. In one embodiment, the target gene encodes a pro-inflammatory cytokine, and it is desirable to downregulate the expression of the cytokine with PGM. In one embodiment, the pro-inflammatory cytokine is IL-1β, IL-6, or TNF-α.

[0088] In one embodiment, the target gene is selected from receptors associated with innate immunity (Table 3). Innate immune receptors that recognize pathogens also play important roles in local inflammation, recruitment of new effector cells, containment of local infections, and signaling of inducible responses that govern the initiation of adaptive immune responses. In one embodiment, the target gene is a costimulatory or co-inhibitory immune checkpoint target, useful in the treatment of cancer, and can respond to a variety of intracellular and extracellular signals (Tables 4 and 5).

[0089] [Table 4] TIFF2025516462000011.tif157169 In one embodiment, expression of the target gene is useful in the treatment of cancer. In one embodiment, the target gene is selected from those in Table 5.

[0090] [Table 5]

[0091] In one embodiment, the target gene is a cytokine that plays a role in asthma. Unlike other chronic inflammatory diseases, such as rheumatoid arthritis, Crohn's disease, and psoriasis, asthma exhibits a characteristic cytokine response dominated by Th2 cytokines, most of which are encoded in a small cluster on chromosome 5q32-34. This coordinated regulation of the immune response in favor of Th2 cytokines, including interleukin (IL)-3, IL-4, IL-5, IL-6, IL-9, IL-13, and granulocyte-macrophage colony-stimulating factor (GM-CSF), has been suggested to reduce the inhibitory influence of Th1 cytokines, particularly IL-18, IL-12, and interferon-γ, resulting in a Th2-polarized immune response by default. An imbalance between Th1 and Th2 immunity emerges early in life, sometimes even prenatally, in individuals predisposed to atopic disease.

[0092] In one embodiment, the target gene is a gene involved in rheumatoid arthritis. Rheumatoid arthritis (RA) is a chronic systemic inflammatory disease characterized by persistent and intense immune activity, localized destruction of bone and cartilage, and various systemic symptoms. CD4+ T cells play a central role in the initiation and maintenance of the chronic autoimmune response characteristic of rheumatoid inflammation. In one embodiment, the target gene is IL-4, IFN-γ, IL-10, or a Th1 / Th2 cytokine.

[0093] In one embodiment, the target gene is involved in sepsis. In one embodiment, the target gene is selected from an IL-1 family member, an IL-1 receptor family member, a TNF family member, a TNF receptor family member, an interferon, an IFN receptor, IL-6, IL-10, a member of the IL-6 receptor and IL-10 receptor family, a TGFβ or a member of the TGFβ receptor family, a chemokine, and a chemokine receptor.

[0094] In one embodiment, the target gene is a tumor suppressor gene, the expression of which is advantageous, and PGM is designed to enhance its expression. In one embodiment, the target gene is a mutated tumor suppressor gene, the expression of which is disadvantageous, and PGM is designed to inhibit its expression. The human genome encodes over 2000 different TFs, many of which are expressed in a cell-type-specific manner and coordinate gene expression programs underlying a vast array of cellular processes (see, e.g., Lee TI, Young RA. Transcriptional regulation and its misregulation in disease. Cell. 2013;152:1237-1251). In one embodiment, the target gene is a pro-apoptotic gene, and the expression of some other apoptotic genes is induced by extracellular signals (e.g., glucocorticoids), but it is desirable to express additional pro-apoptotic genes in cells in response to the signal. In this case, PGM is designed to bind to a TF that responds to glucocorticoids, and the PGM TF is brought into proximity with the desired pro-apoptotic gene via the sgCNA. In one embodiment, glucocorticoids normally induce the expression of the pro-apoptotic BIM gene (BCL2-interacting mediator of cell death) in cancer cells, whereas PGM brings glucocorticoid-responsive TFs into close proximity with one or more additional pro-apoptotic target genes, the expression of which is also beneficial but not activated in the absence of PGM. Examples of tumor suppressor genes include TP53 and MYC. Examples of pro-apoptotic genes (i.e., proteins) include caspases, amyloid B peptide, some members of the Bcl-2 protein family, the p53 gene, BAX, BAK, BCLX, BAD, BID, BIK, HRK, and heat shock proteins. Examples of anti-apoptotic genes include BCL-2, BCL-XL, BCL-W, BFL-M, BRAG-1, MCL-1, and A1 / BFL-1. In some embodiments, the target gene is an enzyme. In some embodiments, the enzyme is selected from enzymes having one or more functions listed in Table 5.

[0095] [Table 6] TIFF2025516462000014.tif229153 TIFF2025516462000015.tif233153 TIFF2025516462000016.tif229153

[0096] Exemplary PGMs and Their Applications wound healing In one embodiment, PGM is designed to correct the imbalance between TGF-β1 and TGF-β3 in wounds, which delays wound healing and leads to scarring ( Figures 4A and 4B ). In one embodiment, the transcription factor FOXO1 or SMAD, after activation by inflammatory signals, can be delivered to the promoter of the TGF-β3 gene via the PROTEGE platform to promote its expression, accelerating wound healing while reducing scarring. In one embodiment, this PGM is delivered locally to fibroblasts.

[0097] radiation exposure In one embodiment, PGM is designed to reduce the side effects of radiation exposure. In one embodiment, PGM targets the GCSF gene, the expression of which promotes hematopoiesis and hematopoietic stem cell mobilization. In one embodiment, PGM has TFBSs for NF-kB or Nrf-2 transcription factors. These are activated by free radicals generated during radiation exposure and contact the promoter region of the GCSF gene, promoting its expression via PGM, thereby reducing the side effects of radiation exposure. In one embodiment, PGM is delivered intravenously to bone marrow adipocytes.

[0098] Viral infection In one embodiment, PGM is designed to treat viral infection. In one embodiment, PGM targets IFN gene, and its expression suppresses viral replication. In one embodiment, PGM has TFBS of NF-kB, which is activated in the presence of viral RNA, and then contacts with the promoter of IFN gene by PGM to promote its expression, thereby treating viral infection. In one embodiment, PGM is delivered to respiratory endothelium by intranasal / inhalation. In one embodiment, PGM is delivered by intravenous administration. diabetic nephropathy In one embodiment, PGM is designed to treat diabetic nephropathy. In one embodiment, PGM targets the Klotho gene and can suppress renal fibrosis by its expression. In one embodiment, PGM has a TFBS of USF2, which, after being activated by high glucose levels, can contact the promoter of the Klotho gene by PGM to promote its expression, thereby suppressing renal fibrosis. In one embodiment, PGM is delivered intravenously to glomerular endothelial cells and / or mesangial cells.

[0099] Atherosclerosis In one embodiment, PGM is designed to treat atherosclerosis. In one embodiment, PGM targets the FGF-21 gene and / or Klotho gene, reducing inflammation and oxidative stress through their expression. In one embodiment, PGM has one or more TFBSs of NFAT, EGR1, STAT3, SREBP, and / or Nrf2, which can be activated in the presence of oxidized phospholipids and then contact the promoters of the FGF-21 gene and / or Klotho gene by PGM to promote their expression, thereby reducing inflammation and oxidative stress. In one embodiment, PGM is delivered intravenously to the coronary artery endothelium.

[0100] Cystic fibrosis In one embodiment, PGM is designed to treat cystic fibrosis. In one embodiment, PGM targets the HNF-3β and / or CaCC genes, the expression of which increases mucin levels (HNF-3β), Cl - / Na + In one embodiment, PGM has a TFBS for the NF-kB gene, which is activated by mucosal deposition, and then contacts the promoters of HNF-3β and / or CaCC genes to promote their expression, thereby reducing mucin levels (HNF-3β), Cl- / Na+ balance, and water accumulation (CaCC). In one embodiment, PGM is delivered intranasally / by inhalation to the airway mucosal epithelium.

[0101] Alzheimer's disease In one embodiment, PGM is designed to treat Alzheimer's disease. In one embodiment, PGM targets the NDBF gene and / or NGF gene, and its expression promotes neurite survival. In one embodiment, PGM has NFAT TFBS, which can be activated by the presence of high Ca2+ levels and then contact the promoters of NDBF and / or NGF genes by PGM to promote their expression, thereby promoting neurite survival. In one embodiment, PGM is delivered to entorhinal neurons by intraspinal administration.

[0102] Oxidative stress and inflammation In one embodiment, PGM is designed to treat oxidative stress and / or inflammation. In one embodiment, PGM targets the klotho gene, which encodes a membrane-bound circulating protein that suppresses oxidative stress and inflammation. In one embodiment, the PGM contains the TFBS of Nrf2, which is activated by oxidative stress and / or inflammatory signals (which may be mimicked by the addition of tert-butylhydroquinone (tBHQ)), and can then contact the klotho gene promoter and promote its expression, thereby suppressing oxidative stress and inflammation. In one embodiment, PGM is delivered intranasally / inhaled to the respiratory mucosal epithelium. In one embodiment, PGM is delivered intravenously to the coronary artery endothelium. In one embodiment, PGM is delivered intranasally / inhaled to the respiratory endothelium. In one embodiment, PGM is delivered intravenously to the coronary artery endothelium. In one embodiment, PGM is delivered intranasally / inhaled to the respiratory endothelium. In one embodiment, PGM is delivered intravenously.

[0103] cancer In one embodiment, PGM is designed to treat cancer. In one embodiment, PGM targets BH3-only genes that encode proteins that promote tumor cell apoptosis. In one embodiment, PGM contains one or more TFBSs of HIF-1, p73, Sp1, or Fox03a, which are activated by hypoxia, low pH, and / or high levels of lactic acid in the tumor microenvironment and can contact the promoters of BH3-only genes by PGM, thereby inducing tumor cell apoptosis.

[0104] In one embodiment, the PGM targets one or more genes encoding glycolytic enzymes, such as hexokinase or phosphoglycerate kinase, which stimulate glucose uptake by regulating the glucose transporters GLUT1 and GLUT3. In one embodiment, the PGM includes a TFBS for a TF that responds to glucose levels.

[0105] In one embodiment, the expression of the target gene is at least 1.5-fold, at least 2.0-fold, at least 2.5-fold, at least 3.0-fold, at least 3.5-fold, at least 4.0-fold, at least 4.5-fold, at least 5.0-fold, at least 5.5-fold, at least 6.0-fold, at least 6.5-fold, at least 7.0-fold, at least 7.5-fold, at least 8.0-fold, at least 8.5-fold, at least 9.0-fold, at least 9.5-fold, at least 10.0-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold, at least 22-fold, at least 23-fold, at least 24-fold, at least 25-fold, at least 26-fold, at least 27-fold, at least 28-fold, at least 29-fold, at least 30-fold, at least 31-fold, at least 32-fold, at least 33-fold, at least 34-fold, at least 35-fold, at least 36-fold, at least 37-fold, at least 38-fold, at least 39-fold, at least 40-fold, at least 41-fold, at least 42-fold, at least 43-fold, at least 44-fold, at least 45-fold, at least 46-fold, at least 47-fold, at least 48-fold, at least 49-fold, at least 30-fold, at least 31-fold, at least 32-fold, at fold, at least 34-fold, at least 35-fold, at least 36-fold, at least 37-fold, at least 38-fold, at least 39-fold, at least 40-fold, at least 41-fold, at least 42-fold, at least 43-fold, at least 44-fold, at least 45-fold, at least 46-fold, at least 47-fold, at least 48-fold, at least 49-fold, at least 50-fold, at least 51-fold, at least 52-fold, at least 53-fold, at least 54-fold, at least 55-fold, at least 56-fold, at least 57-fold, at least 58-fold, at least 59-fold, at least 60-fold, at least 61-fold, at least 62-fold, at least 63-fold, at least 64-fold, at least 65-fold, at least 66-fold, at least 67-fold, at least 68-fold, at least 69-fold, at least 70-fold, at least 71-fold, at least 72-fold, at least 73-fold, at least 74-fold, at least 75-fold, at least 100-fold, at least 200-fold, at least 500-fold, or at least 1000-fold increase.

[0106] In one embodiment, target gene expression is at least 1.5-fold, at least 2.0-fold, at least 2.5-fold, at least 3.0-fold, at least 3.5-fold, at least 4.0-fold, at least 4.5-fold, at least 5.0-fold, at least 5.5-fold, at least 6.0-fold, at least 6.5-fold, at least 7.0-fold, at least 7.5-fold, at least 8.0-fold, at least 8.5-fold, at least 9.0-fold, at least 9.5-fold, at least 10.0-fold, at least 11-fold, at least 12-fold, at least 13-fold, at least 14-fold, at least 15-fold, at least 16-fold, at least 17-fold, at least 18-fold, at least 19-fold, at least 20-fold, at least 21-fold, at least 22-fold, at least 23-fold, at least 24-fold, at least 25-fold, at least 26-fold, at least 27-fold, at least 28-fold, at least 29-fold, at least 30-fold, at least 31-fold, at least 32-fold, at least 33-fold , at least 34 fold, at least 35 fold, at least 36 fold, at least 37 fold, at least 38 fold, at least 39 fold, at least 40 fold, at least 41 fold, at least 42 fold, at least 43 fold, at least 44 fold, at least 45 fold, at least 46 fold, at least 47 fold, at least 48 fold, at least 49 fold, at least 50 fold, at least 51 fold, at least 52 fold, at least 53 fold, at least 54 fold, at least 55 fold, at least 56 fold, at least 57 fold, at least 58 fold, at least 59 fold, at least 60 fold, at least 61 fold, at least 62 fold, at least 63 fold, at least 64 fold, at least 65 fold, at least 66 fold, at least 67 fold, at least 68 fold, at least 69 fold, at least 70 fold, at least 71 fold, at least 72 fold, at least 73 fold, at least 74 fold, at least 75 fold, at least 100 fold, at least 200 fold, at least 500 fold, or at least 1000 fold.

[0107] Nucleic acids and vectors In one embodiment, the present disclosure provides a nucleic acid comprising one or more components of a PGM disclosed herein. In one embodiment, the nucleic acid comprises one or more of a cRNA and / or a cRNA module, a tracrRNA and / or a tracrRNA module, and an sgCNA, and / or a nucleic acid having a transcription factor binding site or a transcription factor binding site module.

[0108] In some embodiments, the transcription factor binding site comprises one or more modifications relative to the native sequence. In some embodiments, the one or more modifications comprise one or more transitions, one or more translocations, one or more insertions, one or more deletions, one or more inversions, or any combination thereof. In one embodiment, the one or more transitions are selected from the group consisting of: (a) T to C; (b) A to G; (c) C to T; and (d) G to A. In one embodiment, the one or more translocations are selected from the group consisting of: (a) T to A; (b) T to G; (c) C to G; (d) C to A; (e) A to T; (f) A to C; (g) G to C; and (h) G to T. In one embodiment, the crRNA has one or more modifications relative to a crRNA that fully hybridizes to the target gene. In one embodiment, the one or more modifications comprise altering a native DNA gene sequence encoding a DNA-binding protein (e.g., dCas) to introduce at least one of the following changes: (1) a G:C base pair to a T:A base pair; (2) a G:C base pair to an A:T base pair; (3) a G:C base pair to a C:G base pair; (4) a T:A base pair to a G:C base pair; (5) a T:A base pair to an A:T base pair; (6) a T:A base pair to a C:G base pair; (7) a C:G base pair to a G:C base pair; (8) a C:G base pair to a T:A base pair; (9) a C:G base pair to an A:T base pair; (10) an A:T base pair to a T:A base pair; (11) an A:T base pair to a G:C base pair; or (12) an A:T base pair to a C:G base pair. In one embodiment, the one or more modifications comprise an insertion or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and the one or more edits may comprise an insertion or deletion of 1 to 15 nucleotides. In some embodiments, the transcription factor binding site is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical or homologous to a native sequence.In one embodiment, the nucleic acid contains one or more chemically modified or non-natural nucleotides. In some embodiments, the inclusion of chemically modified or non-natural nucleotides increases the functional life span of the PGM within the cell.

[0109] In some embodiments, the present disclosure provides a vector comprising one or more nucleic acids of the present disclosure. In some embodiments, the vector comprises a nucleic acid encoding a DNA-binding protein (dCas) of the present disclosure. In some embodiments, the vector is a retroviral vector, a DNA vector, an RNA vector, an adenoviral vector, a baculoviral vector, an Epstein-Barr virus vector, a papovavirus vector, a vaccinia virus vector, a herpes simplex virus vector, an adenovirus-associated vector, a lentiviral vector, or any combination thereof.

[0110] composition In one embodiment, the present disclosure provides a composition comprising or consisting of one or more nucleic acids and / or proteins of the present disclosure. In one embodiment, the present disclosure provides a composition comprising one or more cells of the present disclosure (preferably, the cells are prokaryotic or eukaryotic cells, preferably mammalian cells, non-human primate cells, or human cells). In some embodiments, the composition is a pharmacological composition. In some embodiments, the composition comprises or consists of one or more components of the PGMs described herein and can be administered to cells, tissues, or organisms by any suitable means, such as gene therapy, mRNA delivery, virus-like particle delivery, or ribonucleoprotein (RNP) delivery, and combinations thereof, as described above.

[0111] In one embodiment, the present disclosure provides a composition for delivering a nucleic acid of the present disclosure to a cell. In one embodiment, the composition comprises or consists of the RNA, DNA, and / or protein components of a PGM of the present disclosure. In one embodiment, the composition comprises or consists of the entire PGM of the present disclosure. In one embodiment, the composition comprises a cRNA and / or a cRNA module, a tracrRNA and / or a tracrRNA module, a Cas / DNA binding protein, an sgCNA, and / or a nucleic acid having a transcription factor binding site or a transcription factor binding site module. Additional compositions are described above in the delivery methods of the genetic PGM system. In one embodiment, the composition comprises one or more cells comprising crRNA and / or cRNA modules, tracrRNA and / or tracrRNA modules, Cas / DNA-binding proteins, sgCNAs, transcription factor binding sites or nucleic acids having transcription factor binding site modules, and / or PGM. In some embodiments, the composition further comprises a chemical that functions as a signal for activation / upregulation / inhibition / downregulation of PGM-mediated gene expression. In some embodiments, the chemical is a drug.

[0112] In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises any of the compositions disclosed herein. In some embodiments, the pharmaceutical composition comprises any of the compositions disclosed herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises or consists of any of the polynucleotides and / or proteins disclosed herein and a pharmaceutically acceptable carrier. A reference to a composition of the present disclosure "comprising" something also refers to the same composition "consisting of" or "consisting essentially of" something, even if not explicitly disclosed or listed herein.

[0113] Examples of substances that can be used as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) excipients, such as cocoa butter and suppository wax; and (9) oils, such as peanut oil, cottonseed oil, and safflower oil. , sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffers; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids; (23) serum components, such as serum albumin, HDL, and LDL; (23) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances used in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfumes, preservatives, antioxidants may also be present in the formulation. The terms "excipient," "carrier," "pharmaceutically acceptable carrier," and the like are used interchangeably herein.

[0114] kit In one embodiment, the present disclosure provides a kit. In one embodiment, the kit comprises one or more of the nucleic acids and / or vectors of the present disclosure. In one embodiment, the kit further comprises a DNA-binding protein (e.g., dCas). In one embodiment, the kit comprises instructions for use. In one embodiment, the kit comprises components for preparing a pharmaceutical composition comprising the nucleic acids and / or cells of the present disclosure.

[0115] Alternative PGM The present disclosure also provides a modification to the above embodiment in which the DNA-binding molecule does not comprise a Cas protein. Thus, in one embodiment, any moiety with sufficient DNA-binding specificity to address a single site within a target genome (e.g., the human genome) can be used as the DNA-binding module of a PGM. In one embodiment, the DNA-binding molecule is arranged in a tandem array of approximately six zinc finger motif units that bind to a selected, unique site within the human genome. In one embodiment, such zinc finger arrays can be pre-conjugated with DNA-modifying molecules, such as nucleases and transcription factors, to target their DNA-modifying activity to DNA adjacent to the zinc finger recognition sites. In one embodiment, the PGM involves conjugating a nucleic acid to a peptide, e.g., a zinc finger array, and such methods can be used to attach a transcription factor binding module containing a nucleic acid to a zinc finger array DNA-binding module to create a PGM. As an example, synthesis of zinc finger arrays by solid-phase peptide synthesis allows for the incorporation of a dibenzocyclooctyne (DBCO) group at the amino terminus of a zinc finger peptide by standard peptide coupling procedures. Transcription factor binding modules composed of nucleic acids bearing an azide group linked to the 3' or 5' end can be attached to this end group by the well-known strain-promoted azide-alkyne cycloaddition reaction. Nucleic acids bearing an azide group can be easily prepared by reacting an azide-containing linker, such as azidobutyric acid NHS ester, with an amino linker on an oligonucleotide synthesized by solid-phase phosphoramidite chemistry.

[0116] In one embodiment, the DNA-binding module of a PGM comprises a TAL (transcription activator-like) effector protein. The correspondence between the polypeptide sequence of the TAL effector and its DNA recognition sequence allows for the protein embodiment to bind to a desired specific DNA sequence. Any method known to those skilled in the art for conjugating proteins to nucleic acids can be used to attach a nucleic acid-containing transcription factor binding module to a TAL effector DNA-binding module to create a PGM. Such methods include, but are not limited to, attaching a dibenzocyclooctyne (DBCO) group to the protein using any of a variety of crosslinkers, followed by attachment of an azide-bearing nucleic acid module via azide-alkyne cycloaddition, or attaching a maleimide group attached to the nucleic acid module to the polypeptide via a cysteine ​​via Michael addition. In one embodiment, a TAL effector protein can be designed to contain two distinct DNA-binding domains, one that binds to the target DNA sequence of the PGM DNA-binding module and the other that binds to the double-stranded DNA component of the transcription factor binding module.

[0117] In addition to using DNA oligonucleotides that fold to contain the known double-stranded DNA binding site of an endogenous transcription factor, transcription factor binding modules can be derived from DNA or RNA aptamers that bind to the desired transcription factor. Thus, in one embodiment, DNA and RNA aptamers can be generated to bind to a wide range of molecules, including proteins, including transcription factors, using methods known to those skilled in the art. In one embodiment, PGMs with transcription factor binding modules containing DNA aptamers can be ligated to genomic DNA binding modules using the same methodology and chemistry as DNA hairpins, e.g., DNA ligase, to create PGMs. In this case, the aptamer can be synthesized with complementary sequences near the 3' and 5' ends of the DNA to promote the formation of duplex regions with overhangs that can be ligated to the cr and tracr components of the sgCNAs. In the case of RNA aptamers, the entire guide nucleic acid can be generated by transcription of a DNA template.

[0118] All publications, patents, patent applications, and other documents cited in this application are incorporated by reference for all purposes to the same extent as if each individual publication, patent, patent application, or other document was individually indicated to be incorporated by reference for all purposes. While various specific embodiments / aspects have been illustrated and described, it will be understood that various modifications can be made without departing from the spirit and scope of the disclosure.

[0119] An embodiment or description containing "or" between one or more members of a group is considered satisfied if one, more than one, or all of the members of the group are present in, employed in, or otherwise relevant to a given product or process, unless otherwise indicated or clear from the context. The invention includes embodiments in which one member of the group is certainly present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which one or more or all of the members of the group are present in, employed in, or otherwise relevant to a given product or process. Furthermore, the disclosure encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the enumerated claims are introduced into another claim. For example, a claim that depends on another claim can be modified to include one or more limitations identified in other claims that depend from the same base claim. Where elements are presented as lists, e.g., in Markush grouping format, each subgroup of the elements is also disclosed, and any element can be deleted from the group. Generally, when the invention or aspects of the invention are referred to as comprising particular components and / or features, it is understood that certain embodiments of the disclosure or aspects of the disclosure consist of or consist essentially of such elements and / or features. For brevity, these embodiments are not described in detail herein. Also, note that the terms "comprising" and "containing" are intended to be open and allow for the inclusion of additional elements or steps. When ranges are specified, endpoints are included. Furthermore, unless otherwise specified or apparent from the context and the understanding of one of ordinary skill in the art, values ​​expressed as ranges can assume any specific value or subrange within the ranges defined in different embodiments of the invention, to one-tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.

[0120] This application references various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. In the event of a conflict between any incorporated reference and this specification, this specification shall control. Furthermore, any specific embodiment of the present invention that falls within the prior art may be specifically excluded from any one or more of the embodiments. Such embodiments may be excluded even if the exclusion is not explicitly set forth herein, since they are deemed known to those of ordinary skill in the art. Any specific embodiment of the present invention may be excluded from any embodiment for any reason, whether related to the existence of prior art or not. Those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, many equivalents to the specific embodiments described herein. The scope of the embodiments of the present invention described herein is not intended to be limited to the above description, but rather is as defined in the accompanying embodiments. Those skilled in the art will recognize that various changes and modifications can be made to this specification without departing from the spirit or scope of the invention as defined in the embodiments specifically disclosed above, below, and in the claims. [Example]

[0121] Example 1 Preparation of chimeric guide nucleic acids Oligonucleotides for the Cr module, tracr module, and transcription factor binding module were obtained from commercial suppliers, fully deprotected, and gel purified. Cr module: 5'CGGAGGCAGUCCCGGCUCGCGUUUUAGAGCUAdAdCdCdCTdGdAdCTTdGdAdCdGT3' (SEQ ID NO: 64); tracr module: 5'dAdAdGTdCdAdGdGdGTUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU3' (SEQ ID NO: 65); Transcription factor binding modules: 5'dATdGdAdCTdCdAdGdCdAdCdAdATdGdGdCdGdAdAdGdCdCdATTdGTdGdCTdGdAdGTdCdATdAdCdGTdC 3' (SEQ ID NO: 66);

[0122] The Cr module targets the sequence 5'CGGAGGCAGUCCCGGCUCGC3' (SEQ ID NO: 67) within the promoter region of the klotho gene. This site was identified and selected using the target site selection tool CRISPick (https: / / portals.broadinstitute.org / gppx / crispick / public) using the CRISPRa function. The transcription factor binding module is designed to fold into a hairpin structure containing the following Nrf2 response element: 5'-ATGACTCAGCA-3' (SEQ ID NO: 68).

[0123] The Tracr module and transcription factor binding module were each obtained at their 5' phosphates. The Tracr module (7 nmoles) and Cr module (8 nmoles) were annealed in a total volume of 15 μL by heating to 65°C for 1 minute and then cooling to room temperature over 60 minutes. The transcription factor binding module (8 nmoles in 41 μL) was annealed by heating to 95°C for 1 minute and cooling to room temperature over 75 minutes. The annealed oligonucleotide modules were mixed and ligated in an 80 μL reaction mixture containing 1 mM ATP, 1X ligase buffer, and 16,000 units of T4 DNA ligase. After overnight ligation at room temperature, the ligase was inactivated by heating to 65°C for 15 minutes. The mixture was then phenol extracted, and the aqueous layer was desalted by gel filtration and eluted in 400 μL of water. The nucleic acids were precipitated with ethanol and sodium acetate, dissolved in water, and again desalted by gel filtration.

[0124] Example 2 Preparation of programmable gene regulators Chimeric guide nucleic acid (80 pmol) in 10 μL of phosphate-buffered saline was heated to 37°C for 30 minutes and then cooled to room temperature over 30 minutes.

[0125] Chimeric guide nucleic acid sequence: 5'CGGAGGCAGUCCCGGCUCGCGUUUUAGAGCUAdAdCdCdCTdGdAdCTTdGdAdCdGTdATdGdAdCTdCdAdGdCdAdCdAdATdGdGdCdGdAdAdGdCdCdATTdGTdGdCTdGdAdGTdCdATdAdCdGTdCdAdAdGTdCdAdGdGdGTUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU 3' (SEQ ID NO: 69) Example sequence of Klotho / Nrf2 sgNA: 5'- CGGAGGCAGTCCCGGCTCGCGUUUUAGAGCUAdAdCdCdCdTdGdAdCdTdTdGdAdCdGdTdAdTdGdAdCdTdCdAdGdCdAdAdTdGdGdCdGdAdAdGdCdCdAdTdGdTdGdCdTdGdAdGdTdCdAdAdGdTdCdAdGdGdTdCdAdGdGdTUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCCGAGUCGGUGCUUUU-3' (SEQ ID NO: 4) The annealed chimeric guide nucleic acid was mixed with 78 pmoles of recombinant dCas9 with nuclear localization sequences fused to both the N- and C-termini (NLS-dCas9-NLS, Novateinbio, PR-137213B).

[0126] Nuclear localization signal sequence - LGGD-nuclear localization signal sequence (SEQ ID NO: 70) The mixture was incubated at room temperature for 15 minutes to allow the formation of programmable gene regulators (PGMs).

[0127] Example 3 Ex vivo assay for transcription factor recruitment to target DNA Preparation of test wells. Biotin-labeled oligonucleotide duplexes containing a 20-bp target sequence derived from the promoter of the human Klotho gene or a scrambled control sequence were immobilized on 8-well strips coated with high-binding capacity streptavidin. The sense and antisense strands of the duplexes were obtained commercially, fully deprotected, and gel-purified.

[0128] Sense strand target DNA: 5'CCTCGGCGCCCCTGCCCCCGCCCCCAGTGCCAGGGCGGAGGCAGTCCCGGCTCGCAGGTAATTATTGCCAGCGGAGCCCGCCGGGGAGCG3' (SEQ ID NO: 71) Antisense strand target DNA: 5'CGCTCCCCGGCGGGCTCCGCTGGCAATAATTACCTGCGAGCCGGGACTGCCTCCGCCCTGGCACTGGGGGCGGGGGCAGGGGCGCCGAGG-Biotin 3' (SEQ ID NO: 72) Sense strand scrambled target DNA: 5'CCTCGGCGCCCCTGCCCCCGCCCCCAGTGCCAGGGGGACGCGCGGGCACCGCTTCAGGTAATTATTGCCAGCGGAGCCCGCCGGGGAGCG3' (SEQ ID NO: 73) Antisense strand scrambled target DNA: 5' CGCTCCCCGGCGGGCTCCGCTGGCAATAATTACCTGAAGCGGTGCCCGCGCGTCCCCCTGGCACTGGGGGCGGGGGCAGGGGCGCCGAGG-Biotin 3' (SEQ ID NO: 74)

[0129] The antisense strand was labeled with biotin at its 3' end. The sense and antisense oligonucleotides were mixed at a concentration of 8 μM in Tris-buffered saline (TBS), heated to 95°C for 5 minutes to anneal, and then cooled to room temperature over 60 minutes. The hybridized duplex was diluted 2-fold with 5x concentrated TBS, and 100 μL of the resulting solution was added to each streptavidin-coated well and incubated at room temperature for 72 hours. Each DNA-coated well was washed with Tris-buffered EDTA (TE) followed by TBS.

[0130] Preparation of nuclear extracts. HEK293 cells were grown to 50-70% confluence in 10 cm dishes and treated with 50 μM freshly prepared tert-butylhydroquinone (tBHQ) in phosphate-buffered saline (PBS) containing 30% DMSO for 24 hours to activate Nrf2. For controls, cells were treated with PBS / 30% DMSO. Cells were scraped from the dishes in PBS and centrifuged at 3,200 rpm for 5 minutes at 4°C. Cells were washed once with PBS, and the pellet was gently resuspended in 100 μL of cold hypotonic buffer (20 mM Tris-HCl pH 7.4, 500 mM NaCl, 3 mM MgCl2). After incubation on ice for 15 minutes, 5 μL of 10% NP40 lysis buffer (Sigma-Aldrich) was added, and the cells were vigorously vortexed for 10 seconds. The homogenate was centrifuged at 3,000 rpm for 10 minutes at 4°C. The supernatant containing the cytoplasmic fraction was discarded. 50 μL of Invitrogen Cell Extraction Buffer (Cat# FNN0011, Invitrogen) supplemented with 1 mM PMSF and a protease inhibitor cocktail was added to the pellet containing the nuclear fraction and incubated on ice for 30 minutes, vortexing every 10 minutes. The solution was centrifuged at 14,000 × g for 30 minutes at 4°C, and the supernatant containing the nuclear fraction was transferred to a separate tube. Total protein was quantified by Bradford assay using the Pierce Micro-BCA Assay.

[0131] Assay for Nrf2 recruitment. Nrf2 binding to PGM bound to target DNA was assessed using components of the Nrf2 Transcription Factor Assay Kit (Abeam, ab207223). Freshly prepared PGM was added to wells containing immobilized oligonucleotide duplexes as described above and incubated overnight at room temperature. Unbound PGM was removed by washing with TE. Nuclear extracts (20 μg total protein) from HEK298 cells treated with tBHQ or vehicle alone were added to the wells and incubated for 1 h at room temperature. Each well was washed three times with 200 μL of wash buffer provided with the assay kit. The rabbit anti-Nrf2 antibody (100 μL, 1:1000 dilution) provided with the kit was added and incubated for 1 h at room temperature, followed by washing three times with 200 μL of wash buffer provided with the assay kit. The anti-rabbit HRP antibody (100 μL, 1:1000 dilution) was added and incubated for 1 h at room temperature, followed by washing four times with 100 μL of wash buffer. The developing solution (100 μL) was added, and the wells were incubated for 10 minutes at room temperature before adding the stop solution (100 μL). Nrf2 binding to the wells was quantified by absorbance at 450 nm compared to control wells developed without anti-Nrf2 antibody.

[0132] Example 4 Signal-dependent transcriptional regulation in cultured cells HEK293 cells were cultured at 3 x 10 per well in 2 mL of complete growth medium (DMEM with 10% FBS). 5Cells were plated in 6-well plates at a ratio of 1:1. When cells reached 30-50% confluence, they were transfected with PGM as described above. PGM was freshly prepared as described above, and Opti-MEM medium (500 μL) was added to the PGM, followed by 50 μL of Cas9 Plus Reagent (Invitrogen, CMAX00008). The resulting solution was added to a solution of 500 μL of Opti-MEM and 30 μL of CRISPRMAX Transfection Reagent (Invitrogen, CMAX00008). The mixture was vortexed briefly and incubated at room temperature for 10 min. For control experiments lacking PGM, mock PGM solution was prepared by replacing the chimeric guide nucleic acid with water and the NLS-dCas9-NLS with Tris-HCl. PGM or mock PGM solution (250 μL) was added to the cells and incubated for 16 h. Freshly prepared tBHQ solution as above or vehicle was added to each well and the cells were incubated for an additional 24 hours.

[0133] Total RNA was isolated using the PureLink RNA Mini Kit and quantified spectrophotometrically. Total RNA (250 ng) from each sample was reverse transcribed using a 3:1 (volume:volume) mixture of random hexamers and anchored oligo-dT primers in a 30 μL reaction using the Thermo Scientific Verso cDNA Synthesis Kit according to the manufacturer's protocol. Each condition was assayed for the target gene Klotho and the endogenous reference gene GAPDH using Taqman Gene Expression assays (ThermoFisher assays Hs00934627_m1 and Hs02786624_g1, respectively) and Taqman Fast Advanced Master Mix (ThermoFisher). Hs02786624_g1 covers a 157-nt amplicon in GAPDH exon 7. Hs00934627_m1 covers a 108-nt amplicon spanning exons 2 and 3 of KL. Reactions contained 4 μL of 2-fold diluted cDNA in a 20 μL qPCR reaction in a 96-well plate. Data were collected using a Bio-Rad CFX96 Touch Real-Time PCR Detection System and ΔΔC q The analysis was performed using the method, and relative gene expression was calculated.

[0134] Example 5 Association of physiologically responsive transcription factors with target DNA sequences directed by programmable gene regulators (PGMs) As previously described in FIG. 1A, the principle of the physiologically responsive gene expression regulator according to the present disclosure is as follows: a transcription factor (TF) is activated by a physiological stimulus. Examples of physiological stimuli include oxidative stress or growth factor signaling. The responsive gene expression regulator is a ribonucleoprotein complex composed of a disabled CRISPR-associated protein, dCas9, and a chimeric guide nucleic acid. The chimeric guide nucleic acid contains a DNA hairpin incorporating a binding site for the activating TF, a crRNA sequence, and a tracrRNA sequence. This complex binds to a genomic DNA sequence adjacent to a target gene that is to be made responsive to a physiological signal. The binding site is programmed by the crRNA sequence within the guide nucleic acid. Association of the activated TF with the bound dCas9 complex brings the TF into proximity with the target gene, resulting in modulation of transcription of the target gene.

[0135] Here, a gene regulator containing dCas9 and a DNA response element for the transcription factor Nrf2 recruited activated Nrf2 to the DNA sequence targeted by the guide nucleic acid. Figure 5A. The target DNA sequence is a 20-base pair sequence (pink and gold) contained within a DNA duplex immobilized in the wells of a multiwell plate. The gene regulator contains dCas9 (yellow circle) complexed with a single guide nucleic acid containing a crRNA module (turquoise) complementary to the target sequence, a tracrRNA module (cyan), and a DNA module (red) that forms a hairpin structure incorporating an Nrf2 response element in its stem. After binding of the gene regulator to the immobilized target DNA, nuclear extract from Hek293 cells treated with tert-butylhydroquinone (tBHQ) was added to stimulate Nrf2 activation and nuclear localization. After washing the wells to remove unbound Nrf2, bound Nrf2 was detected with an anti-Nrf2 antibody and visualized by absorbance at 450 nm after treatment with an HRP-conjugated anti-rabbit secondary antibody and development with HRP substrate. Figures 3B–3D. Each value is the average of three replicates from separate wells. Error bars represent the standard deviation of the mean. Figure 5B. Dependence of Nrf2 binding on the presence of PGM. For the "-PGM" wells, PBS was added instead of PGM solution. Figure 5C. Dependence of Nrf2 binding on the presence of a target DNA sequence immobilized in the wells. For the "-Target DNA sequence" wells, the immobilized duplex contained a scrambled version of the target sequence (same sequence composition, different sequence) instead of the target sequence. Figure 5D. Dependence of Nrf2 binding on Nrf2 activation. The nuclear extract added to the "-Nrf2" wells was from cells not treated with tBHQ.

[0136] Nrf2 was activated by adding tert-butylhydroquinone (tBHQ) to cultured cells. tBHQ is a well-known activator of Nrf2. It has been shown to react with Keap1, a protein that localizes Nrf2 in the cytoplasm. The reaction of tBHQ with Keap1 promotes the translocation of Nrf2 to the nucleus. Li, W., and Kong, AN (2009). Molecular mechanisms of Nrf2-mediated antioxidant response. Mol. Carcinog. 48, 91-104.

[0137] After PGM was allowed to bind to the target DNA, the addition of nuclear extracts from cells in which Nrf2 was activated resulted in the binding of Nrf2 to the target DNA. Nrf2 binding was not detected in the absence of PGM. Nrf2 binding also depended on the correct sequence of the target DNA: Nrf2 did not bind to wells in which the DNA sequence targeted by the guide nucleic acid was replaced with a scrambled sequence. The association of Nrf2 with immobilized target DNA also depended on the biochemical activation of Nrf2. Addition of nuclear extracts from cells not treated with tBHQ to activate Nrf2 to the wells did not result in Nrf2 binding.

[0138] Example 6 Transcriptional regulation of the target gene klotho by PGM in response to biochemical activation of endogenous transcription factors Figures 6A and 6B show Nrf2-dependent regulation of Klotho transcription in cultured cells. Human embryonic kidney cells were treated with PGM, which targets the klotho promoter and contains an Nrf2 response element. After 16 hours, Nrf2 was activated with tBHQ. After a further 24 hours, total RNA was isolated and klotho expression relative to GAPDH expression was measured by RT-qPCR. (Figure 6A). The target sequence of PGM was a 20-base pair sequence upstream of the transcription start site of the klotho gene, a membrane-bound circulating protein that suppresses oxidative stress and inflammation. The transcription factor binding module of PGM contained an Nrf2 response element. Addition of PGM alone had no significant effect on klotho transcription compared to that of the housekeeping gene GAPDH, whereas treatment of cultured cells with tBHQ slightly reduced klotho transcription. However, activation of Nrf2 with tBHQ after PGM treatment resulted in a two-fold increase in klotho transcription compared to treatment with tBHQ alone. (Figure 6B).

Claims

1. The following subcomponents: an endonuclease-deficient DNA-binding polypeptide (preferably a dCas polypeptide); Chimeric nucleic acid (sgCNA) comprising a CRISPR RNA (crRNA), a transactivating crRNA (tracrRNA), and at least one nucleic acid segment comprising at least one transcription factor binding site. and (c) a programmable gene regulator (PGM), or an sgCNA subcomponent thereof, for reversibly altering expression of a target gene of interest in a cell in response to one or more intracellular or extracellular environmental signals, comprising: An artificial, non-natural system in which the crRNA comprises a sequence complementary to a nucleic acid sequence within the promoter region of a target gene of interest, and each transcription factor binding site within the PGM is activated in a cell containing the PGM in response to an environmental signal and then binds to at least one endogenous transcription factor that recognizes and binds to the transcription factor binding site of the PGM that is bound to the promoter of the gene of interest via the crRNA, thereby bringing the transcription factor into proximity with the gene of interest and activating or repressing expression of the gene of interest in response to the environmental signal.

2. (i) at least one transcription factor binding site in the PGM is also present in the target gene; and / or (ii) at least one transcription factor binding site in the PGM is not an endogenous transcription factor binding site in the target gene; 2. The artificial non-natural system of claim 1, or a sgCNA subcomponent thereof.

3. 3. The artificial non-natural system of any one of claims 1 and 2, or an sgCNA subcomponent thereof, wherein the PGM recruits an endogenous transcription factor to a gene of interest when the endogenous transcription factor is activated in response to an environmental signal, thereby activating gene expression in response to an environmental signal in a cell-specific manner.

4. The transcription factor (i) are known to be activated in response to environmental signals; and (ii) known or not known to activate / repress expression of a target gene of interest; 4. An artificial non-natural system, or an sgCNA subcomponent thereof, according to any one of claims 1 to 3, identified as a transcription factor.

5. 5. The artificial non-natural system, or sgCNA subcomponent thereof, of any one of claims 1 to 4, wherein the DNA-binding polypeptide is a nuclease-deficient cas polypeptide.

6. 6. The artificial non-natural system of any one of claims 1 to 5, or a sgCNA subcomponent thereof, wherein the gene of interest is identified as a gene whose expression (a) results in a beneficial cellular response to an environmental signal, but whose expression is undetectable or is increased by the PGM compared to the gene expression level in the absence of the PGM, or (ii) results in a detrimental effect on the cell, and whose expression is reduced by the PGM in response to an environmental signal, compared to the gene expression level in the absence of the PGM.

7. 7. The artificial non-natural system, or sgCNA subcomponent thereof, of any one of claims 1 to 6, wherein the gene of interest encodes a protein, a microRNA, or a long non-coding RNA.

8. 8. The artificial non-natural system of any one of claims 1 to 7, or a sgCNA subcomponent thereof, wherein the signal is any physical signal, such as a light signal (e.g. ultraviolet light), ionizing radiation, heat / temperature, hyperosmotic or hypoosmotic conditions; a mechanical signal, such as pressure (e.g. touch), sonic movement, and / or blood pressure; and / or any chemical signal, such as growth factors, cytokines, chemokines, cyclic AMP, hormones, neurotransmitters, extracellular matrix components, bacterial antigens, viral antigens, lipids, lipopolysaccharides, gas levels (e.g. oxygen levels, nitric oxide levels), ion levels (e.g. calcium levels, sodium levels), pH, reactive oxygen species, heavy metals, oxidized LDL, and / or free radicals, intercellular signals (e.g. T-cell binding, cell-cell contact), or a combination thereof.

9. 9. The artificial non-natural system according to any one of claims 1 to 8, or a sgCNA subcomponent thereof, wherein the transcription factor is selected from forkhead transcription factors, nuclear receptors, POU domain proteins, SMADs, preferably Nrf2, FOX01, NF-kB, USF2, NFAT, EGR1, STAT3, and / or SREBP.

10. 10. The artificial non-natural system according to any one of claims 1 to 9, or an sgCNA subcomponent thereof, wherein the TF binding module (i) comprises at least one TF binding segment (TFBS), which TF binding segment comprises DNA and / or RNA, or (ii) comprises at least one TF binding segment (TFBS), which TF binding segment comprises a DNA or RNA aptamer selected to bind to an endogenous transcription factor.

11. 11. An artificial non-natural system, or an sgCNA subcomponent thereof, according to any one of claims 1 to 10, wherein the TF binding module comprises a sequence derived from natural RNA.

12. 12. The artificial non-natural system, or sgCNA subcomponent thereof, of any one of claims 1 to 11, wherein the TF binding segment (TFBS) comprises a double-stranded segment of DNA containing at least one TF response element.

13. 13. The artificial non-natural system of any one of claims 1 to 12, or a sgCNA subcomponent thereof, wherein the strands of the DNA portions of the sgRNA form a duplex and are connected by a loop sequence of any length.

14. 14. The artificial non-natural system, or an sgCNA subcomponent thereof, of claim 13, wherein the loop comprises 4 nucleotides.

15. 15. The artificial non-natural system, or an sgCNA subcomponent thereof, according to any one of claims 13 and 14, wherein the sequence of the loop comprises 5'-guanosine-adenosine-adenosine-adenosine-3'.

16. 16. The artificial non-natural system of any one of claims 1 to 15, or an sgCNA subcomponent thereof, wherein the crRNA comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous nucleobases that are at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to a target nucleic acid sequence of a target gene of interest.

17. 17. The artificial non-natural system of any one of claims 1 to 16, or an sgCNA subcomponent thereof, wherein an endonuclease-deficient sequence-specific DNA binding protein, preferably a dCas polypeptide, is fused to at least one copy of a nuclear localization signal.

18. 18. The artificial non-natural system according to any one of claims 1 to 17, or a sgCNA subcomponent thereof, wherein the crRNA comprises any one of the following sequences: SEQ ID NO:6 to SEQ ID NO:

34.

19. 19. The artificial non-natural system according to any one of claims 1 to 18, or a sgCNA subcomponent thereof, wherein the transcription factor binding sequence comprises one or more sequences selected from SEQ ID NO: 1, 2, 3, 5, and those in Table 2.

20. 20. The artificial non-natural system of any one of claims 1 to 19, or an sgCNA subcomponent thereof, wherein tracrRNA binds to dCas9.

21. The crRNA, TFBS, and tracrRNA of PGM have the following molecular structure: 5'-crRNA-TFBS-tracrRNA-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-3', where TFBS is incorporated anywhere within the sequence of the tracrRNA, including one or more instances of its extension into a hairpin structure; 5'-crRNA-tracrRNA-TFBS-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-3'; 5'-crRNA-TFBS-tracrRNA-TFBS-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-TFBS-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-3'; 5'-crRNA-TFBS-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-tracrRNA''''-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-tracrRNA''''-TFBS-3'; 5'-crRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-3'; 5'-crRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-tracrRNA-TFBS-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-3'; 5'-crRNA-tracrRNA'-TFBS-tracrRNA''-TFBS-tracrRNA'''-TFBS-tracrRNA''''-3' It is constructed with one of the following: where tracrRNA', tracrRNA'', tracrRNA''', and tracrRNA''' are contiguous segments of a complete tracrRNA sequence; 21. An artificial non-natural system according to any one of claims 1 to 20, or a sgCNA subcomponent thereof.

22. 22. The artificial non-natural system of any one of claims 1 to 21, or an sgCNA subcomponent thereof, wherein the PGM comprises one or more different TFBSs that comprise response elements for a number of different transcription factors.

23. 23. The artificial non-natural system of any one of claims 1 to 22, or an sgCNA subcomponent thereof, wherein the PGM comprises a nucleic acid backbone with one or more different TFBS, wherein the continuity of the nucleic acid backbone is interrupted at one or more positions and the complete nucleic acid sequence is constructed by base pairing of nucleotides from the different strands.

24. 24. The artificial non-natural system, or sgCNA subcomponent thereof, of claim 23, wherein the discontinuity in the nucleic acid backbone is within one or more TFBS.

25. 25. The artificial non-natural system, or sgCNA subcomponent thereof, of any one of claims 1 to 24, wherein the TFBS is separated from the crRNA or tracrRNA by a linker of at least 1, 5, 10, 20, or 30 DNA, RNA, or modified nucleotides.

26. An isolated nucleic acid comprising any one or more of the sgCNA, crRNA, tracrRNA, transcription factor binding sites, or any other segments of the sgCNA of the PGM of any one of claims 1 to 25, or encoding a DNA-binding protein of the PGM of any one of claims 1 to 25.

27. 27. The isolated nucleic acid of claim 26, wherein the nucleic acid contains one or more modified or non-naturally occurring nucleotides.

28. 28. The isolated nucleic acid of any one of claims 26 and 27, wherein the nucleic acid is 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 100, 200, 300, 400, 500, 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-125, 125-150, 150-200, 200-300, 300-400, or 400-500 bases in length.

29. A vector comprising the isolated nucleic acid of any one of claims 26 to 28 under the control of a heterologous promoter, preferably an AAV vector or another vector.

30. 29. A virus comprising the isolated nucleic acid according to any one of claims 26 to 28, preferably wherein the virus is a lentivirus or an adenovirus.

31. A cell comprising a PGM or an sgCNA subcomponent thereof according to any one of claims 1 to 25, and / or a nucleic acid according to any one of claims 26 to 28, and / or a vector according to claim 29, and / or a virus according to claim 30.

32. 32. The cell of claim 31 , wherein the cell is a prokaryotic or eukaryotic cell, preferably a mammalian cell, a non-human primate cell, or a human cell.

33. A composition comprising a PGM or sgCNA subcomponent thereof according to any one of claims 1 to 25, a nucleic acid according to any one of claims 26 to 28, a vector according to claim 29, a virus according to claim 30, a cell according to claim 31, or a combination thereof.

34. 34. The composition of claim 33, further comprising a cationic or ionizable lipid or a cationic or ionizable polymer, preferably in a nanoparticle.

35. 35. The composition of any one of claims 33 and 34, wherein the composition is a pharmaceutical composition further comprising a pharma- ceutically acceptable excipient.

36. A method for reversibly modifying the expression of a target gene of interest in a cell in response to one or more intracellular or extracellular environmental signals, comprising contacting a cell with a PGM or sgCNA subcomponent thereof according to any one of claims 1 to 25, a nucleic acid according to any one of claims 26 to 28, a vector according to claim 29, a virus according to claim 30, a composition according to any one of claims 33 to 35, or a combination thereof.

37. 37. The method of claim 36, wherein the cell is a prokaryotic or eukaryotic cell, preferably a mammalian cell, a non-human primate cell, or a human cell.

38. A method of treating a disease, disorder or injury in a subject in need of such treatment, comprising administering to the subject a therapeutically effective amount of a PGM or sgCNA subcomponent thereof according to any one of claims 1 to 25, an isolated nucleic acid according to any one of claims 26 to 28, a vector according to claim 29, a virus according to claim 30, a cell according to any one of claims 31 and 32, a composition according to any one of claims 33 to 35, or a combination thereof.

39. 39. The method of claim 38, wherein the disease, disorder, or injury is selected from cellular stress, excision or incision wounds, radiation exposure, viral or bacterial infection, sepsis, diabetic nephropathy, atherosclerosis, cystic fibrosis, Alzheimer's disease, oxidative stress, ischemia-reperfusion injury, inflammation, cancer, anti-cancer drug resistance, genetic disease or disorder, inflammatory disease or disorder, autoimmune disease or disorder, liver disease or disorder, spleen disease or disorder, pulmonary disease or disorder, hematological disease or disorder, neurological disease or disorder, gastrointestinal (GI) disease or disorder, genitourinary disease or disorder, infectious disease or disorder, musculoskeletal disease or disorder, endocrine disease or disorder, metabolic disease or disorder, immune system disease or disorder, central nervous system (CNS) disease or disorder, neurological disease or disorder, ophthalmological disease or disorder, or cardiovascular disease or disorder.

40. 39. The method of claim 38, wherein the disease, disorder, or injury is selected from excision or incisional wounds, radiation exposure, viral or bacterial infection, sepsis, diabetic nephropathy, atherosclerosis, cystic fibrosis, Alzheimer's disease, oxidative stress, ischemia-reperfusion injury, inflammation, and cancer.

41. A kit comprising a PGM or sgCNA subcomponent thereof according to any one of claims 1 to 25, a nucleic acid according to any one of claims 26 to 28, a vector according to claim 29, a virus according to claim 30, a composition according to any one of claims 33 to 35, or a combination thereof, together with a container and / or instructions for using the kit.