Methods and compositions for treating retinal degenerative diseases using AIMP2-DX2 and optionally target sequences for miR-142

By administering a nucleic acid molecule encoding AIMP2-DX2, retinal degenerative diseases can be treated, addressing the challenge of irreversible visual impairment by inhibiting apoptosis and reducing neuronal cell death.

JP2025516639APending Publication Date: 2025-05-30GENEROATH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2024566533
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-05-13
Filing Date
2023-05-13
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Current treatments for retinal degenerative diseases, such as age-related macular degeneration and retinitis pigmentosa, are ineffective in reversing the irreversible visual impairment caused by retinal cell degeneration.

Method used

Administration of a nucleic acid molecule, such as a viral or non-viral vector, encoding an exon 2-deleted AIMP2 variant (AIMP2-DX2) to treat retinal degenerative diseases, potentially combined with a miR-142 target sequence to restrict expression to neuronal cells.

Benefits of technology

The use of AIMP2-DX2 has shown potential in inhibiting apoptosis and reducing neuronal cell death, thereby slowing or halting the progression of retinal degeneration and potentially restoring visual function.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025516639000001_ABST
    Figure 2025516639000001_ABST
Patent Text Reader

Abstract

Disclosed herein is a method for treating a retinal degenerative disease, which comprises administering to a subject in need of treating a retinal degenerative disease a vector comprising a target sequence for AIMP2-DX2 and optionally miR-142. The present invention provides, for example, a method for treating a retinal degenerative disease in a subject in need of treating a retinal degenerative disease, which comprises administering to the subject a pharmaceutically effective amount of a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Reference to Electronically Submitted Sequence Listing The content of the electronically submitted sequence listing of the ST26 file (name: 2493-0006WO01.xml_Sequence Listing_ST25.txt; size: 36 KB; and creation date: May 8, 2023) submitted together with this application is hereby incorporated by reference in its entirety into this specification.

[0002] Field of the Invention Disclosed herein is a method for treating retinal degenerative diseases, the method comprising administering to a subject in need of treating a retinal degenerative disease a vector comprising target sequences for AIMP2-DX2 and optionally miR-142.

Background Art

[0003] Background of the Invention Retinal degenerative diseases are characterized by the degeneration of one or two retinal cell types, such as the loss of retinal pigment epithelium (RPE) and / or photoreceptor cells in age-related macular disease (AMD) and retinitis pigmentosa (RP), and the death of retinal ganglion cells (RGC) in glaucoma. Typically, the visual impairment caused by the degeneration of retinal cells is irreversible because retinal cells lack the ability to self-repair.

[0004] Abnormal RPE cells can be observed by optical coherence tomography (OCT) in AMD patients. In patients with retinitis pigmentosa (RP), morphological and functional abnormalities of the RPE and photoreceptor layers are caused by genetic abnormalities. Stargardt disease or juvenile macular degeneration, characterized by the loss of RPE and photoreceptors in the macular region, causes a decrease in central vision at a young age. The loss of retinal ganglion cells (RGC) can be observed in patients with glaucoma. Once retinal cell degeneration is caused, there is no treatment that can reverse it.

[0005] In the retina, light signals are converted into electrical signals. Various interconnected cell types, such as photoreceptor cells, bipolar cells, horizontal cells, amacrine cells, and retinal ganglion cells (RGCs), are required to achieve this important process in the retina. Each cell type plays an essential role in the visual signal transduction process. Visual signal transduction mainly begins with photoreceptor cells that express light-sensitive proteins in the outer segment. Jin ZB et al. (2019).

[0006] In the human retina, two types of photoreceptor cells, rods and cones, are responsible for scotopic and photopic (including color) vision, respectively. Rods are mainly present in the peripheral retina, and cones are concentrated in the macula, which is a small part of the retina and provides high-resolution central vision. Bipolar cells receive visual signals from photoreceptor cells and transmit these signals to RGCs that are regulated by horizontal cells and amacrine cells. Finally, all signals are collected by the optic nerve and transmitted to the brain. Both cell degeneration and synaptic disintegration can cause permanent visual impairment or even blindness. See Jin 2019.

[0007] Age-related macular disease (AMD) is the most major cause of vision loss in Europe, the United States, and Australia. Almost two-thirds of the population over 80 years old have symptoms of AMD due to the wet or exudative form, which is characterized by the presence of drusen and choroidal neovascularization (CNV) (subfoveal choroidal neovascularization). AMD is a chronic progressive disease characterized by damage to the central retinal zone. Changes in the choroidal capillaries, retinal pigment epithelium (RPE), and Bruch's membrane (typical of aging) underlie AMD pathogenesis, but the mechanism by which the transition of typical age-related changes in the pathological process begins is unknown. Photoreceptor death and irreversible vision loss are the result of pathological changes in the RPE and choroid. Recent studies have demonstrated that not only apoptosis but also autophagy and necrosis signaling cascades are involved in the cell death of retinal cells (Telegina 2017).

[0008] The "dry" and "wet" forms of the disease are classified. Approximately 90% of cases are the "dry" atrophic form of AMD; currently, there is no treatment for it. In the "dry" form of AMD, drusen are diagnosed in the macula, pigment redistribution occurs, defects in the pigment epithelium and choroidal capillary lamina appear, and photoreceptor death occurs against the background of RPE cell atrophy. The "wet" (exudative) form develops in approximately 10% of AMD patients and is characterized by the ingrowth of newly formed blood vessels due to a defect in Bruch's membrane under the retinal pigment epithelium or subneuroepithelially. When the permeability of the newly formed blood vessels increases, retinal edema, exudation, and hemorrhage occur in the vitreous and retina (which ultimately cause vision loss).

[0009] Currently, the laser-induced Bruch's membrane photocoagulation model is the most widely accepted and most frequently used experimental mouse CNV model. The model described here consists of a laser-induced rupture of Bruch's membrane, which leads to the growth of new blood vessels from the choroid into the subretinal space, mimics the main features of the exudative form of human AMD, and provides an opportunity to explore the molecular mechanisms of CNV by using a large number of transgenic mice. This model has proven to be suitable for testing the efficacy of novel drugs by systemic or local (intraocular) administration. For example, vascular endothelial growth factor receptor (VEGFR) traps or anecortave acetate have shown predictive values of drug effects in patients with AMD (Telegina 2017).

[0010] There are three main drugs that produce indirect anti-angiogenesis by blocking vascular endothelial growth factor (VEGF) in the retina. Ranibizumab (Lucentis, Genentech Inc., South San Francisco CA; commercialized worldwide by Novartis) was approved by the US Food and Drug Administration (FDA) in 2006 for the treatment of neovascular AMD (Hernandez-Zimbron 2018). This is a recombinant humanized immunoglobulin (Ig) G1 kappa isotype monoclonal antigen-binding fragment (Fab) that targets and binds to VEGF-A with high affinity. Aflibercept (Regeneron, Tarrytown, NY; commercialized worldwide by Bayer AG) was approved by the FDA in 2011. This is a fusion protein that combines two major binding domains of human VEGF receptors 1 and 2 with the crystallizable fragment (Fc) region of human IgG1. Finally, bevacizumab (Genentech Inc., South San Francisco, CA; commercialized worldwide by Roche) is a full-length humanized antibody that binds to and blocks all VEGF isoforms.

[0011] Oxidative stress can induce apoptosis, activate and mobilize macrophages, and induce inflammation. Apoptosis can be one of the triggers of choroidal inflammation and subsequent angiogenesis in the CNV model (Du 2013).

[0012] The most common form of X-linked RP is X-linked RP, which is caused by mutations in the retinitis pigmentosa GTPase regulator (RPGR) gene. Talib M et al. (2018). X-linked RP is characterized by degeneration of rod and cone photoreceptors in childhood and causes visual field constriction and severe blindness at a young age. Despite promising results in animal models (Bennett J (2017); Boye SE et al. (2013); Sahel JA et al. (2014); Vandenberghe LH (2015)), gene therapy targeting photoreceptor degeneration in humans for RPGR-related RP has not been fully developed to date. Gene therapy using adeno-associated virus vectors is considered the most promising approach to treat this condition (Megaw RD et al. (2015)), but the inherent instability of the RPGR coding sequence poses a challenge in translating this therapy to human trials.

[0013] The approval of gene therapy targeting RPE65-related retinal degeneration was a major breakthrough in clinical gene therapy applications and offered the potential to treat a number of hereditary diseases. Russell S et al. (2017). However, the RPGR coding sequence contains repetitive purine-rich regions, undergoes alternative splicing, and has inherent instability, which poses a challenge in translating this therapy to human trials. Deng WT et al. (2015); Pawlyk BS et al. (20016); Sun X et al. (2016); Wu Z et al. (2015).

[0014] Neurodegenerative disorders (NDDs) represent a heterogeneous group of diseases characterized by progressive structural and functional degeneration of the central and peripheral nervous systems. Due to its special connection to the brain and its accessibility for measurement, the eye provides a unique window into the brain and thereby offers non-invasive access to a set of potentially useful biomarkers for the early diagnosis and clinical care of NDDs.

[0015] In addition to visual conditions related to conventional age - and genetics - related characteristics such as macular degeneration, central nervous system conditions including Parkinson's disease and Alzheimer's disease can affect a patient's vision. These diseases can cause direct or degenerative changes in the optic nerve, retinal cells, and surrounding visual structures. In many cases, although not obvious, these conditions affect coordination, motility, and visual perception, increasing the risk of falls and related injuries.

[0016] AIMP2 - DX2 is a selective and antagonistic splicing variant of the multifactor apoptosis gene AIMP2. AIMP2 - DX2 is known to suppress cell apoptosis by interfering with the function of AIMP2. Acting as a competitive inhibitor of AIMP2, AIMP2 - DX2 suppresses TNF - alpha - mediated apoptosis by inhibiting the ubiquitination / degradation of TRAF2. In addition, it has been reported that AIMP2 - DX2 has been identified as an existing lung cancer inducer, and in existing studies, it has been confirmed that AIMP2 - DX2, which appears extensively in cancer cells, induces cancer by interfering with the cancer - suppressing function of AIMP2. Furthermore, it has been discovered that the expression of AIMP2 - DX2 in normal cells promotes cell carcinogenesis, while the suppression of AIMP2 - DX2 expression suppresses cancer growth, thereby showing a treatment effect. It has also been determined that AIMP2 - DX2 may be useful for the treatment of neuronal diseases (KR10 - 2015 - 0140723(2017) and US2019 / 0298858(2019).

Prior Art Documents

Patent Documents

[0017]

Patent Document 1

Patent Document 2

Summary of the Invention

Means for Solving the Problem

[0018] Summary of the Invention Disclosed herein is a method for treating a retinal degenerative disease in a subject in need thereof, the method comprising administering to the subject a pharmaceutically effective amount of a nucleic acid molecule comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2 or DX2). In some embodiments, the nucleic acid molecule is a viral vector or a non-viral vector, such as a recombinant vector.

[0019] Also disclosed herein is the use of a pharmaceutically effective amount of a nucleic acid molecule comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2 or DX2) for the treatment of a retinal degenerative disease in a subject in need thereof. Also disclosed herein is a pharmaceutically effective amount of a nucleic acid molecule comprising AIMP2-DX2 for use in the treatment of a retinal degenerative disease in a subject in need thereof. Also disclosed herein is the use of a pharmaceutically effective amount of a nucleic acid molecule comprising AIMP2-DX2 for the manufacture of a medicament for the treatment of a retinal degenerative disease in a subject in need thereof.

[0020] Disclosed herein is a method for treating a retinal degenerative disease in a subject in need thereof, the method comprising administering to the subject a pharmaceutically effective amount of a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2 or DX2) gene.

[0021] Also disclosed herein is the use of a pharmaceutically effective amount of a recombinant vector comprising the exon 2 deleted AIMP2 variant (AIMP2-DX2 or DX2) for the treatment of retinal degenerative diseases in a subject in need thereof. Also disclosed herein is a pharmaceutically effective amount of a recombinant vector comprising AIMP2-DX2 for use in the treatment of retinal degenerative diseases in a subject in need thereof. Also disclosed herein is the use of a pharmaceutically effective amount of a recombinant vector comprising AIMP2-DX2 for the manufacture of a medicament for the treatment of retinal degenerative diseases in a subject in need thereof.

[0022] In some embodiments, the nucleic acid molecule is administered by chemical conjugation with Galnac, cell-penetrating peptides, nucleic acid- or glycopeptide-mediated tools, synthetic compound vectors; lipid-mediated delivery such as lipid nanoparticle encapsulation; inorganic vector-mediated delivery such as inorganic vectors; biological delivery such as exosome-mediated delivery; or physical delivery such as by micro / nanoneedles, pressure-perfusion, microprojectiles, electrical energy / electroporation / iontophoresis, sonoporation, magnetoporation, or optoporation / photodynamic energy.

[0023] In some embodiments, the retinal degenerative disease is retinitis pigmentosa, Leber congenital amaurosis, cone-rod dystrophy, glaucoma, or diabetic retinopathy. In some embodiments, the retinal degenerative disease precedes or is associated with Parkinson's disease, Alzheimer's disease, or amyotrophic lateral sclerosis. In some embodiments, the retinal degenerative disease is not age-related macular disease. In some embodiments, the method of treating a retinal degenerative disease does not include treating age-related macular disease (AMD). In some embodiments, the AMD is wet AMD. In some embodiments, the AMD is dry AMD.

[0024] The recombinant vector may further comprise a miR-142 target sequence.

[0025] The vector may further include a promoter operably linked to AIMP2-DX2. In some embodiments, the promoter is a retroviral (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-actin promoter, a CAG promoter, an RPE65 promoter, or an opsin promoter.

[0026] The miR-142 target sequence may be at the 3' of the AIMP2-DX2 gene.

[0027] In some embodiments, the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0028] In some embodiments, the AIMP2-DX2 gene comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0029] In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11.

[0030] In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10 or 11.

[0031] The miR-142 target sequence may comprise a nucleotide sequence containing ACACTA. In some embodiments, the miR-142 target sequence comprises ACACTA and 1 to 17 additional consecutive nucleotides of SEQ ID NO: 5. In some embodiments, the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA; miR-142-3p target sequence). In some embodiments, the miR-142 target sequence may comprise the nucleotide sequence of SEQ ID NO: 5.

[0032] In some embodiments, the miR-142 target sequence contains ACTTTA. In some embodiments, the miR-142 target sequence comprises ACTTTA and 1 to 15 additional consecutive nucleotides of SEQ ID NO: 7. In some embodiments, the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG; miR-142-5p target sequence). In some embodiments, the miR-142 target sequence may comprise the nucleotide sequence of SEQ ID NO: 7.

[0033] The miR-142 target sequence may be repeated 2 to 10 times in the vectors disclosed herein.

[0034] The vector can be a viral vector. The viral vector can be an adenovirus, an adeno-associated virus, a lentivirus, a retrovirus, a human immunodeficiency virus (HIV), a murine leukemia virus (MLV), an avian sarcoma / leukosis (ASLV), a spleen necrosis virus (SNV), a Rous sarcoma virus (RSV), a mouse mammary tumor virus (MMTV), a herpes simplex virus, or a vaccinia virus vector.

[0035] In some embodiments, the recombinant vector is administered locally to the subject, by intravitreal injection, by subconjunctival injection, or into the subretinal space of the subject.

[0036] The methods disclosed herein may further include administering an additional therapeutic agent to a subject. In some embodiments, the additional therapeutic agent is ranibizumab, aflibercept, or bevacizumab.

Brief Description of the Drawings

[0037]

Figure 1

[0038]

Figure 2

[0039]

Figure 3

[0040]

Figure 4

[0041]

Figure 5

[0042]

Figure 6A

Figure 6B

Figure 6C

[0043]

Figure 7-1

Figure 7-2

Figure 7-3

Figure 7-4

[0044]

Figure 8-1

Figure 8-2

[0045]

Figure 9-1

Figure 9-2

[0046]

Figure 10

[0047]

Figure 11

[0048]

Figure 12-1

Figure 12-2

Figure 12-3

[0049]

Figure 13

[0050]

Figure 14

[0051]

Figure 15

[0052]

Figure 16

[0053]

Figure 17

[0054]

Figure 18-1

Figure 18-2

Figure 18-3

Figure 18-4

Figure 18-5

Figure 18-6

Figure 18-7

[0055]

Figure 19-1

Figure 19-2

[0056]

Figure 20-1

Figure 20-2

Figure 20-3

Figure 20-4

Figure 20-5

[0057]

Figure 21

[0058]

Figure 22

[0059]

Figure 23-1

Figure 23-2

Mode for Carrying Out the Invention

[0060] Detailed Description of the Invention Neurodegenerative disorders (NDDs) represent a heterogeneous group of diseases characterized by progressive structural and functional degeneration of the central and peripheral nervous systems. Due to its unique connection to the brain and its accessibility for measurement, the eye provides an inherent window to the brain, thereby offering non-invasive access to a set of potentially useful biomarkers that can aid in the early diagnosis and clinical care of NDDs.

[0061] Hereditary retinal diseases, particularly RP or Leber congenital amaurosis, are a collective concept referring to heterogeneous eye diseases caused by mutations in dozens of different genes, with their presence and frequency varying according to race and region. In recent years, gene therapy that replaces mutated genes with normal WT genes has emerged as a promising treatment method. However, currently, most gene therapy drugs undergoing clinical phase trials are treatment methods based on the introduction of a single normal WT gene to replace the mutant gene, and there is a limitation in that it can only be expected to be effective in a very limited number of patients. In addition, the clinical trial results of single mutant gene replacement gene therapy (e.g., Luxturna) are still far from restoring normal vision so far. Only the effectiveness of enhancing the light detection ability that enables patients to live independently in their daily lives has been reported. This suggests that in addition to single mutant gene replacement, there are more complex cellular-level mechanisms for restoring normal vision.

[0062] In addition to vision states related to conventional age - and genetics - related characteristics such as macular degeneration, central nervous system conditions including Parkinson's disease and Alzheimer's disease can affect a patient's vision. These diseases can cause direct or degenerative changes in the optic nerve, retinal cells, and surrounding visual structures. In many cases, although not obvious, these conditions affect coordination, motility, and visual perception, increasing the risk of falls and related injuries.

[0063] Parkinson's disease is a progressive neurodegenerative disorder. The destruction of dopaminergic neurons in the substantia nigra, accompanied by a reduction resulting from the action of dopamine in the striatum, which is part of the basal ganglia system involved in motor control, is considered the pathophysiological mechanism of Parkinson's disease. Parkinson's disease is mainly characterized by tremors, rigidity, and postural instability, but vague visual symptoms such as blurred vision and diplopia, uncontrollable eye movements, photosensitivity, eye strain, and difficulty reading are commonly seen. Mild eye movement abnormalities occur in 75 percent of patients with idiopathic Parkinson's disease but often remain untreated. However, these symptoms may further reduce the quality of life and functionality that the patient is already at risk for, thus requiring specialized treatment.

[0064] Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease in which the function of motor neurons is gradually lost. Complaints of eye disorders are not currently considered classical symptoms of ALS, but retinal changes such as thinning, axonal degeneration, and inclusions have been found in many patients. Retinal abnormalities observed in post - mortem human tissues and animal models are similar to the spinal cord changes in ALS. Since the retina shares ontogenetic relationships with the brain and many genes are associated with both neurodegenerative and retinal diseases, these findings are not dramatically unexpected. See Soldatov 2021.

[0065] Alzheimer's disease is the most common form of dementia and is characterized by disrupted and damaged connections between nerve cells. These injuries occur due to the abnormal accumulation of beta-amyloid protein (Abeta) in the form of neurofibrillary changes composed of amyloid plaques and / or aggregated tau protein. Eye degeneration in Alzheimer's disease occurs when the retinal nerve fiber layer becomes thinner. Neurons responsible for visual processing tend to be more damaged than primary visual neurons, resulting in unclear visual symptoms in the early stages of the disease. Defects in object recognition, color perception, and visual motion processing can occur at any stage, increasing the risk of accidents such as falls, lacerations, and burns.

[0066] DX2, an antagonistic splicing variant of AIMP2 exon 2 deletion, effectively impairs AIMP2-induced neuronal death. AIMP2 is one of three auxiliary proteins that form a multi-tRNA synthetase complex. In addition to their role in supporting tRNA ligation during translation, AIMP2 has been reported to act as a multifunctional and potent cell death-inducing gene.

[0067] AIMP2 either hyperactivates cell apoptosis signaling pathways such as PARP-1 or p53, or suppresses cell survival signaling pathways such as TRAF signaling or LR expression.

[0068] As a splicing variant of AIMP2, DX2 acts as an antagonistic competitor to AIMP2, thereby directly and indirectly inhibiting AIMP2-induced cell death.

[0069] DX2 inhibits PARP-1 and p53-induced neuronal death in a Parkinson's disease model. Overexpression of DX2 using AAV in the substantia nigra rescues motor activity and neuronal cell death in a PD-induced mouse model.

[0070] In ALS, DX2 inhibits TRAF2-dependent and 67LR-mediated neuronal death in ALS disease. Overexpression of DX2 improved motor activity and survival rate and reduced neuronal cell death in ALS model mice.

[0071] Without being bound by any theory, considering the anatomical and ontogenetic interrelationships between the eye and the brain, as well as the clinical evidence of retinal damage in NDD, there may be a common pathophysiological pathway for the destruction of neuronal cell lines in the CNS and the degeneration of the optic nerve, retinal cells, and surrounding visual structures.

[0072] Gene therapy is a promising treatment for irreversible retinal cell death in various diseases such as age-related macular degeneration (AMD), Stargardt disease, retinitis pigmentosa (RP), and glaucoma. Adeno-associated virus (AAV) has emerged as a preferred vector for targeting gene expression to the retina. By injecting AAV subretinally or intravitreally, efficient transduction of retinal pigment epithelium and the inner layer of the retina can be achieved. AAV is also being evaluated as a suitable gene delivery approach due to its relative safety resulting from the lack of pathogenicity (20). The use of the survival gene DX2 could be a potential option for the treatment of retinal degenerative diseases.

[0073] AIMP2-DX2 is an alternative, antagonistic splicing variant of the multifactor apoptosis gene AIMP2 (aminoacyl-tRNA synthetase complex interacting multifunctional protein 2). AIMP2-DX2 is known to suppress cell apoptosis by interfering with the function of AIMP2.

[0074] AIMP2-DX2, which acts as a competitive inhibitor of AIMP2, suppresses TNF-alpha-mediated apoptosis by inhibiting the ubiquitination / degradation of TRAF2.

[0075] It has also been demonstrated that AIMP2-DX2 can treat neuronal diseases (US2019 / 0298858A1).

[0076] Furthermore, it has also been demonstrated that when AIMP2-DX2 is inserted into an adeno-associated virus and the resulting product is introduced into the subretinal space, choroidal neovascularization can be effectively inhibited.

[0077] Disclosed herein is a method for treating a retinal degenerative disease in a subject in need thereof, the method comprising administering to the subject a pharmaceutically effective amount of a nucleic acid molecule comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2 or DX2). In some embodiments, the nucleic acid molecule is a viral vector or a non-viral vector, such as a recombinant vector.

[0078] Disclosed herein is a method for treating a retinal degenerative disease in a subject in need thereof, the method comprising administering to the subject a pharmaceutically effective amount of a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2 or DX2) gene.

[0079] In some embodiments, the retinal degenerative disease is retinitis pigmentosa, Leber congenital amaurosis, cone-rod dystrophy, glaucoma, or diabetic retinopathy. In some embodiments, the retinal degenerative disease precedes or is associated with Parkinson's disease, Alzheimer's disease, or amyotrophic lateral sclerosis. In some embodiments, the retinal degenerative disease is not an age-related macular disease. In some embodiments, the method for treating a retinal degenerative disease does not include treating an age-related macular disease. In some embodiments, AMD is wet AMD. In some embodiments, AMD is dry AMD.

[0080] Disclosed herein is a method for reducing vascular leakage in the eye or the periocular region, reducing choroidal neovascularization area, reducing the formation of choroidal neovascularization, or reducing VEGF expression in a subject suffering from a retinal degenerative disease, comprising administering to the subject a pharmaceutically effective amount of a recombinant vector comprising the exon 2-deleted AIMP2 variant (AIMP2-DX2) gene.

[0081] The recombinant vectors disclosed herein may further comprise an miR-142 target sequence. The vector may further comprise a promoter operably linked to AIMP2-DX2. In some embodiments, the promoter is a retroviral (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-actin promoter, a CAG promoter, an RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, an Hb9 promoter, or an opsin promoter.

[0082] In the methods disclosed herein, in some embodiments, the recombinant vector may comprise the exon 2-deleted AIMP2 variant (AIMP2-DX2) gene and an miR-142 target sequence. The miR-142 target sequence may be located 3' to the AIMP2-DX2 gene. The vectors described herein can express AIMP2-DX2 in neuronal cells but not in hematopoietic cells such as leukocytes and lymphoid cells.

[0083] The AIMP2-DX2 polypeptide (SEQ ID NO: 2) is a splice variant of AIMP2 (e.g., the aa sequence of SEQ ID NO: 12; e.g., the nt sequence of SEQ ID NO: 3), and the second exon of AIMP2 (SEQ ID NO: 10; the nt sequence of SEQ ID NO: 4) is omitted. In some embodiments, the AIMP2-DX2 gene has the nucleotide sequence set forth in SEQ ID NO: 1, and the AIMP2-DX2 polypeptide has the amino acid sequence set forth in SEQ ID NO: 2. Variants or isoforms of the AIMP2-DX2 polypeptide are also known and can be determined by those skilled in the art (see, e.g., SEQ ID NOs: 13-19. For example, FIGS. 6A-6C show a comparison of AIMP2 (SEQ ID NO: 2) and variants, SEQ ID NOs: 13-19, and the consensus or core sequence of AIMP2 or AIMP2-DX2 (SEQ ID NO: 20).

[0084] In some embodiments, the AIMP2-DX2 gene may include a nucleotide sequence encoding an amino acid sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical to SEQ ID NOs: 2, 13, 14, 15, 16, 17, 18, 19, or 20, or any range of those identity percentages. The AIMP2-DX2 gene may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NOs: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0085] The AIMP2-DX2 gene may include a nucleotide sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical to the nucleotide sequence of SEQ ID NO: 1, or any range of those identity percentages. The AIMP2-DX2 gene may include the nucleotide sequence of SEQ ID NO: 1.

[0086] In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 10 or 11. In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10 or 11. In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 4.

[0087] In some embodiments, a nucleic acid molecule comprising AIMP2-DX2 may optionally comprise a miR-142 target sequence. The miR-142 target sequence (miR-142T) may comprise a nucleotide sequence comprising ACACTA. The miR-142 target sequence may comprise a nucleotide sequence comprising ACACTA and 1 to 17 additional consecutive nucleotides of SEQ ID NO: 5. For example, the miR-142 target sequence may comprise a nucleotide sequence comprising ACACTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 additional nucleotides consecutive to the 5' or 3' of ACACTA shown in SEQ ID NO: 5.

[0088] The miR-142 target sequence may include a nucleotide sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA; miR-142-3pT). The miR-142 target sequence may include the nucleotide sequence of SEQ ID NO: 5.

[0089] The miR-142 target sequence may include a nucleotide sequence containing ACTTTA. The miR-142 target sequence may include a nucleotide sequence containing ACTTTA and 1 to 15 additional consecutive nucleotides of SEQ ID NO: 7. For example, the miR-142 target sequence may include a nucleotide sequence containing ACTTTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 additional nucleotides consecutive to the 5' or 3' of ACTTTA shown in SEQ ID NO: 7.

[0090] The miR-142 target sequence may include a nucleotide sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG; miR-142-5pT). The miR-142 target sequence may include the nucleotide sequence of SEQ ID NO: 7.

[0091] Examples of the miR142-3pT variant sequence are as follows:

Chemical formula

[0092] The variant sequence refers to one or more regions, for example, four regions of the core sequence of miR142 3pT that are substituted as follows: (5’-AACACTAC-3’ → 5’-CCACTGCA-3’). Inhibition of DX2 expression in HEK293 cells transfected with the vector was observed with miR142-3p target sequences repeated (100 pmol) of miR142-3p×1, and miR142-3p inhibition of DX2 expression increased as the number of core binding sequences in the miR142-3p target seq increased. The Tseq×3 core sequence-containing vector showed significant inhibition, but no inhibition was observed with the mutated 3× sequence.

[0093] MicroRNA (miRNA) is a non-coding RNA molecule that functions to regulate gene expression. miRNA functions by forming base pairs with complementary sequences within mRNA molecules, i.e., miRNA target sequences. miRNA can bind to target messenger RNA (mRNA) transcripts of genes encoding proteins and negatively regulate their translation or cause degradation of the mRNA. Currently, more than 2,000 human miRNAs have been identified, and the miRbase database is publicly available. Many miRNAs are expressed tissue-specifically and play important roles in maintaining tissue-specific functions and differentiation.

[0094] miRNA acts at the post-transcriptional stage of genes, and in mammals, it is known that approximately 60% of gene expression is controlled by miRNA. miRNA plays important roles in various processes in vivo and has been disclosed to have a correlation with cancer, heart disorders, and nerve-related disorders. For example, miR-142 has miR-142-3p and miR-142-5p, and any of their target sequences can be used. Therefore, “miR-142” or “miRNA-142” refers to, for example, miR-142-3p and / or miR-142-5p and can bind to miR-142 target sequences, for example, miR-142-3pT or miR-142-5pT.

[0095] The miR-142 target sequence can be located at the 5' or 3' of the AIMP2-DX2 gene.

[0096] For example, "miR-142-3p" may be present in the region where translocation of its gene occurs in progressive B-cell leukemia and is known to be expressed in hematopoietic tissues (such as bone marrow, spleen, and thymus). In addition, the expression of miR-142-3p has been confirmed in the liver of mouse fetuses (hematopoietic tissues of mice), and it is known to be involved in the differentiation of the hematopoietic system.

[0097] In some embodiments, the miR-142-3p and / or miR-142-5p target sequences are repeated at least 2 to 10 times, at least 2 to 8 times, at least 2 to 6 times, at least 4 times, or any range or number of times thereof.

[0098] As an example, for instance, miR-142-3p having the nucleotide sequence of SEQ ID NO: 23 may have a corresponding target sequence, such as the miR-142-3p target sequence (miR-142-3pT) having the nucleotide sequence of SEQ ID NO: 5, but is not limited thereto. For example, miR-142-5p having the nucleotide sequence of SEQ ID NO: 24 may have a corresponding target sequence, such as the miR-142-5p target sequence (miR-142-5pT) having the nucleotide sequence of SEQ ID NO: 7, but is not limited thereto.

[0099] In some embodiments, miR-142-3p may have the nucleotide sequence of SEQ ID NO: 23, and miR-142-5p may have the nucleotide sequence of SEQ ID NO: 24.

[0100] Disclosed herein is a recombinant vector capable of controlling side effects of overexpression of the AIMP2-DX2 variant by inserting miR-142-3p target sequence and / or miR-142-5p target sequence (miR-142-3pT and / or miR-142-5pT, respectively) into the end of AIMP2-DX2 and controlling the suppression of AIMP2-DX2 expression in CD45-derived cells, particularly in lymphoid and leukocytes. Thus, the expression of the AIMP2-DX2 variant can be restricted to only the injected neuronal cells and tissues, rather than non-neuronal hematopoietic cells which are the major population in the injected tissue region. miR142-3p is expressed only in hematopoietic cells.

[0101] Disclosed herein is a recombinant vector containing a target sequence for miR-142-3p and / or miR-142-5p. Disclosed herein is a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene, and a miR-142-3p and / or miR-142-5p target sequence disclosed herein.

[0102] The term "recombinant vector" refers to a vector capable of encoding a target protein or RNA in a suitable host cell, or a gene construct containing regulatory factor(s) operably linked that are essential for enabling proper expression of the inserted gene.

[0103] The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a targeted protein and RNA so as to perform a general function. For example, it can affect the expression of a nucleic acid sequence encoding a promoter and a protein or RNA linked for the operability of the nucleic acid sequence. Operable linkage by a recombinant vector can be produced by using gene recombination techniques well-known in the corresponding technical field, and using enzymes generally known in the corresponding technical field for site-specific DNA cleavage and ligation.

[0104] The recombinant vector may further comprise a promoter operably linked to AIMP2-DX2, as disclosed herein. In some embodiments, the promoter is a retroviral (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-actin promoter, a CAG promoter, an RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, an Hb9 promoter, or an opsin promoter.

[0105] The recombinant vector may further contain a heterologous promoter and a heterologous gene operably linked to the promoter.

[0106] As used herein, "heterologous gene" may include an encoding sequence of a target product such as a protein or polypeptide with biologically appropriate activation, and an immunogen or antigenic protein or polypeptide, or a therapeutic activation protein or polypeptide.

[0107] The polypeptide can supplement the deficiency or absence of the expression of the endogenous protein in the host cell. The gene sequence can be derived from various sources including DNA, cDNA, synthetic DNA, RNA or combinations thereof. The gene sequence can include genomic DNA that contains or does not contain natural introns. In addition, the genomic DNA can be obtained together with a promoter sequence or a polyadenylation sequence. Genomic DNA or cDNA can be obtained in various ways. Genomic DNA can be extracted and purified from appropriate cells by methods publicly known in the corresponding field. Alternatively, cDNA can be produced by reverse transcription or other methods by separating from cells using mRNA. Alternatively, the polynucleotide sequence can contain a sequence complementary to the RNA sequence, for example, an antisense RNA sequence, and the antisense RNA can be administered to an individual to suppress the expression of the complementary polynucleotide in the cells of the individual.

[0108] For example, the heterologous gene is an AIMP-2 splicing variant lacking exon 2, and the miR-142-3p target sequence can be linked to the 3’UTR of the heterologous gene. The sequences of the AIMP2 protein (312aa version: AAC50391.1 or GI:1215669; 320aa version: AAH13630.1, GI:15489023, BC013630.1) are described in the literature (312aa version: Nicolaides, N.C., Kinzler, K.W. and Vogelstein, B. Analysis of the 5' region of PMS2 reveals heterogeneous transcripts and a novel overlapping gene, Genomics 29 (2), 329-334 (1995) / 320aa version: Generation and initial analysis of more than 15, 000 full-length human and mouse cDNA sequences, Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002)).

[0109] The term "AIMP2 splicing variant" refers to variants resulting from partial or complete deletion of exon 2 among exons 1-4. Thus, the variant means inhibition of the normal function of AIMP2 by forming AIMP2 protein and heterodimers. The injected AIMP2-DX2 gene is hardly expressed in tissues other than the injected tissue. However, as an additional safety measure, inserting the miR142 target sequence can completely block the possibility that AIMP2-DX2 is expressed in hematopoietic cells, which are the major population of non-neuronal cells in the injected tissue region.

[0110] The recombinant vector may contain SEQ ID NO: 1 and 5.

[0111] The terms "sequence homology %", "identity %" or "identical %" with respect to a nucleotide or amino acid sequence can be determined, for example, by comparing two optimally aligned sequences with a comparison domain, where a portion of the nucleotide sequence in the comparison domain may include additions or deletions (i.e., gaps) as compared to the reference sequence (without additions or deletions) in the optimal alignment of the two sequences.

[0112] The proteins disclosed herein include not only those having their native amino acid sequences but also those having variant amino acid sequences.

[0113] A protein variant means a different sequence due to deletion, insertion, non-conservative or conservative substitution of the native amino acid sequence, or a combination thereof, and a protein having more than one amino acid residue. Amino acid exchanges in proteins and peptides that do not alter the activation of the molecule as a whole are known in the corresponding field (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979).

[0114] A protein or its variant can be produced by natural extraction, synthesis (Merrifield, J. Amer. Chem. Soc. 85: 2149-2156, 1963), or recombinant DNA sequence-based (Sambrook et al, Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2 nd Ed., 1989).

[0115] Amino acid mutations can occur based on the relative similarity of amino acid side chain substituents such as hydrophilicity, hydrophobicity, charge, and size. According to the analysis of the size, shape, and type of amino acid side chain substituents, it can be recognized that arginine, lysine, and histidine are residues with a positive charge; alanine, glycine, and serine have similar sizes; and phenylalanine, tryptophan, and tyrosine have similar shapes. Therefore, based on such considerations, arginine, lysine, and histidine; alanine, glycine, and serine; and phenylalanine, tryptophan, and tyrosine can be regarded as biologically functional equivalents.

[0116] When introducing one or more mutations, the hydrophobicity index of amino acids can be considered. The hydrophobicity index is assigned to each amino acid according to hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

[0117] When assigning the biologically interacting functions of proteins, the hydrophobic amino acid index is very important. When the substitution is made with amino acids having a similar hydrophobicity index, it is only possible to have similar biological activities. When introducing mutations by referring to the hydrophobicity index, substitutions are made between amino acids with a difference in hydrophobicity index within ±2, within ±1, or within ±0.5.

[0118] It is also well known that substitutions between amino acids having similar hydrophilicity values can lead to proteins having equivalent biological activities. As shown in U.S. Patent No. 4,554,101, the following hydrophilicity values are assigned to each of the amino acid residues: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0 ± 1); glutamic acid (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

[0119] When introducing one or more mutations by referring to hydrophilicity values, substitutions can be made between amino acids with a difference in hydrophilicity values within ±2, within ±1, or within ±0.5, but are not limited thereto.

[0120] Amino acid exchanges in proteins that do not change the activation of the molecule as a whole have been reported in the corresponding field (H. Neurath, R.L.Hill, The Proteins, Academic Press, New York, 1979). The most common exchanges are exchanges between amino acid residues including Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu and Asp / Gly. Vector systems can be constructed by various methods published in the corresponding industry. Specific methods are described in Sambrook et al. (2001), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press.

[0121] The vectors disclosed in this specification can be constructed as typical vectors for cloning or for expression. In addition, the vectors can be constructed using prokaryotic cells or eukaryotic cells as hosts. When the vector is an expression vector and a prokaryotic cell is used as the host, it generally contains a strong promoter for carrying out transcription (for example, tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL X promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, T7 promoter, etc.), a ribosome binding site for the start of decoding, and a transcription / decoding termination sequence. When using E. coli (such as HB101, BL21, DH5a, etc.) as the host cell, the promoter and operator sites of the tryptophan biosynthesis pathway of E. coli (Yanofsky, C. (1984), J. Bacteriol., 158: 1018-1024) and the leftward promoter of phage X (pLX promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet., 14: 399-445) can be used as control sites.

[0122] On the other hand, the vectors that can be used may be more than one type, such as viral vectors, linear DNA, or plasmid DNA.

[0123] The "viral vector" refers to a viral vector that can deliver genes or genetic materials to desired cells, tissues, and / or organs.

[0124] Viral vectors can include more than one species from the group consisting of, but not limited to, adenovirus, adeno-associated virus, lentivirus, retrovirus, HIV (human immunodeficiency virus), MLV (mouse leukemia virus), ASLV (avian sarcoma / leukosis virus), SNV (spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (mouse mammary tumor virus), and herpes simplex virus. In some embodiments, the viral vector can be an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, vaccinia virus, or herpes simplex virus vector.

[0125] Retroviruses have the ability to integrate into the genome of host cells and are harmless to the human body. However, they can have characteristics including suppression of normal cell function at the time of integration, the ability to infect a diverse range of cells, ease of proliferation, accommodation of exogenous genes of about 1 - 7 kb, and the generation of replication-defective viruses. Nevertheless, retroviruses can also have disadvantages including difficulty in infecting post-mitotic cells, difficulty in gene transfer under in vivo conditions, and the need to proliferate somatic cells under in vitro conditions. In addition, retroviruses can integrate into oncogenes, thereby posing a risk of spontaneous mutation and indicating the possibility of cell necrosis.

[0126] On the other hand, adenoviruses, as cloning vectors, have various advantages including replicating in the cell nucleus with a medium-level size, being clinically non-toxic, being stable even when an exogenous gene is inserted, having no gene rearrangement or loss, eukaryotic transformation, and stable and high-level expression even when integrated into the host cell chromosome. Good host cells for adenoviruses are cells that cause hematopoiesis, lymph, and myeloma in humans. However, because it is linear DNA, it is difficult to proliferate, and in addition to a low viral infection rate, it is not easy to recover the infected virus. In addition, the expression of the delivered gene is most extensive within 1 - 2 weeks and persists only in some cells over 3 - 4 weeks. Another problem is that it has high immunogenicity.

[0127] Adeno-associated virus (AAV) can complement the above problems and has many advantages as a gene therapy agent, so it has been favored in recent years. It is also called adeno-satellite virus. The diameter of adeno-associated virus particles is 20 nm, and it is known to have little harm to the human body. Therefore, its sale has been approved as a gene therapy agent in Europe.

[0128] AAV is a provirus with a single strand that requires a helper virus for replication. The AAV genome has 4,680 bp that can be inserted into a specific region of chromosome 19 of infected cells. The transgene is inserted into plasma DNA linked by two inverted terminal repeat (ITR) sequence parts and a signal sequence part, each having 145 bp. Transfection is carried out together with other plasmid DNAs expressing the AAV rep and cap parts, and adenovirus is added as a helper virus. AAV has the advantages of a wide range of host cells for gene delivery, few immunological side effects during repeated administration, and a long gene expression period. Furthermore, the AAV genome is safe even when integrated into the host cell chromosome and does not alter or rearrange the host's gene expression.

[0129] Adeno-associated virus is known to have a total of four serotypes. Among the many serotypes of adeno-associated virus that can be used for the delivery of target genes, the most widely studied vector is adeno-associated virus serotype 2, which is currently used for the delivery of clinical genes for cystic fibrosis, hemophilia, and Canavan disease. In addition, in recent years, the potential of recombinant adeno-associated virus (rAAV) has been increasing in the field of cancer gene therapy (Du 2013). In some embodiments, adeno-associated virus serotype 2 can be used. It is possible to select and apply an appropriate viral vector, but it is not limited to this.

[0130] In addition, when the vector is an expression vector and eukaryotic cells are used as the host, a promoter derived from the genome of mammalian cells (for example, metallothionein promoter) or a promoter derived from mammalian viruses (for example, post-adenovirus promoter, vaccine virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and HSV TK promoter) can be used. Specifically, it can include, but is not limited to, more than one species selected from the group consisting of promoters selected from the group consisting of the LTR of retrovirus, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter and opsin promoter. Furthermore, it generally has a polyadenylation sequence as a transcription termination sequence.

[0131] The vectors disclosed herein can be fused with other sequences as needed to facilitate protein purification. For example, fusion sequences such as glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6×His (hexahistidine; Qiagen, USA) can be used, but are not limited thereto. In addition, the expression vector can include, as a selection marker including, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline, a resistance gene to antibiotics commonly used in the corresponding industry.

[0132] In addition, disclosed herein is a gene carrier comprising a recombinant vector containing target sequences for miR-142 (miR-142-3pT and / or miR-142-5pT) such as miR-142-3p and / or miR-142-5p, respectively.

[0133] The term "gene transfer" generally includes the delivery of genetic material into cells for transcription and expression. The method is ideal for protein expression and treatment purposes. Various delivery methods such as DNA transfection and viral transduction have been published. This means the possibility of targeting specific receptors and / or cell types, as well as virus-mediated gene transfer due to natural compatibility or pseudotyping as appropriate, with high delivery efficiency and high expression levels of the delivered genes.

[0134] A gene carrier can be a transformed entity transformed into a recombinant vector, and transformation includes all methods of introducing nucleic acids into organic entities, cells, tissues or organs, and it is possible to select and perform appropriate standard techniques according to the host cell as published in the corresponding field. Such methods include, but are not limited to, electroporation, protoplast fusion, calcium phosphate (CaP0 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, mixing with the use of silicon carbide fibers, Agrobacteria-mediated transformation, PEG, dextran sulfate and lipofectamine, etc.

[0135] The gene carrier is for the purpose of heterologous gene expression in neurons. Therefore, it can suppress the expression of heterologous genes in CD45-derived cells and increase the expression of heterologous genes in brain tissue. Most of CD45 is a transmembrane protein tyrosine phosphatase present in hematopoietic cells. Cells can be defined according to the molecules present on the cell surface, and CD45 is a cell marker for all leukocyte groups and B lymphocytes. The gene carrier is not expressed in CD45-derived cells, especially cells in the lymphoid and leukocyte ranges.

[0136] The gene carrier may further contain a carrier, additive or diluent that is pharmacologically permitted for use.

[0137] In addition, disclosed herein is a method for delivering and expressing a heterologous gene in a neuron, which includes introducing a recombinant vector into a corresponding entity.

[0138] The delivery method disclosed herein can increase the expression of a heterologous gene in brain tissue and control the expression of the heterologous gene in other tissues.

[0139] In addition, disclosed herein is a vector comprising an expression cassette comprising: 1) a promoter; 2) a nucleotide sequence encoding a target protein operably linked to the promoter; and 3) a nucleotide sequence targeting miR-142-3p inserted into the 3’UTR of the nucleotide sequence. In some embodiments, the vector may comprise an expression cassette comprising: 1) a promoter; 2) a nucleotide sequence encoding a target protein operably linked to the promoter; and 3) a nucleotide sequence targeting miR-142-5p inserted into the 3’UTR of the nucleotide sequence.

[0140] The term “expression cassette” refers to a unit cassette that can effectuate the expression for the production and secretion of a target protein operably linked downstream of a signal peptide, since it includes a gene encoding the target protein, as well as nucleotide sequences encoding a promoter and a signal peptide. The secretory expression cassette can be used in combination with a secretion system. A variety of factors that can assist in the efficient production of the target protein can be included inside and outside such an expression cassette.

[0141] In addition, disclosed herein is a prophylactic or therapeutic agent for retinal degenerative diseases, comprising a nucleotide sequence encoding an AIMP-2 splicing variant lacking exon 2, and a nucleotide sequence targeting miR-142-3p linked to the 3’UTR of the nucleotide sequence.

[0142] Accordingly, also disclosed herein is a method of treating a retinal degenerative disease in a subject in need thereof, the method comprising administering any of the vectors disclosed herein. In some embodiments, the retinal degenerative disease does not include AMD. AMD can be wet AMD. In some embodiments, AMD is dry AMD.

[0143] The vectors disclosed herein can prevent or treat retinal degenerative diseases because they can affect, among other things, apoptosis inhibition, dyskinesia improvement, and / or oxidative stress inhibition.

[0144] The term "treatment" includes not only the complete treatment of a retinal degenerative disease but also the partial treatment, amelioration and / or alleviation of the overall symptoms of AMD as a result of the application of the pharmacological agents disclosed herein.

[0145] The term "prevention" means the prevention of the occurrence of the overall symptoms of a pre-existing retinal degenerative disease by suppressing or blocking symptoms or phenomena such as cognitive impairment, behavioral disorders and destruction of cranial nerves by applying the pharmacological agents disclosed herein to an entity having a cerebral degenerative disorder.

[0146] Adjuvants other than the active ingredient may be included in addition to the pharmacological agents disclosed herein. Any adjuvant can be used without limitation as long as it is known in the corresponding technical field. For example, it is possible to increase immunity by further including Freund's complete adjuvant and incomplete adjuvant.

[0147] The pharmacological agents disclosed in this specification can be manufactured in a form in which the active ingredient is mixed with a pharmacologically acceptable carrier. Here, the pharmacologically acceptable carrier includes carriers, additives, and diluents commonly used in the field of pharmacology. Examples of pharmacologically acceptable carriers that can be used in the pharmacological agents disclosed in this specification include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0148] The pharmacological agents disclosed in this specification can be used by being manufactured in various forms such as oral dosage forms such as powders, granules, pills, capsules, suspension solutions, emulsions, syrups, and aerosols, as well as various forms including external use, suppositories, or sterile injection solutions, according to their respective common manufacturing methods.

[0149] When manufacturing the preparation, diluents or additives such as commonly used fillers, extenders, binders, humectants, disintegrants and surfactants can be used during the manufacturing process. Solid preparations for oral administration include pills, tablets, powders, granules and capsule preparations. Such solid preparations can be manufactured by mixing one or more additives such as starch, calcium carbonate, sucrose, lactose and gelatin with the active ingredient. In addition, lubricants such as magnesium stearate and talc can also be used in addition to simple additives. Liquid preparations for oral administration include, in addition to water and liquid paraffin which are commonly used diluents, various additives such as humectants, sweeteners, flavoring and odor-correcting agents, and preservatives, including suspension solutions, oral solutions, oils and syrups. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, oils, lyophilized agents and suppositories. Vegetable oils such as propylene glycol, polyethylene glycol and olive oil, as well as injection esters such as ethylate can be used as non-aqueous solvents and suspension solutions. Examples of agents for suppositories can include witepsol, tween61, cacao butter, laurin oil and glycerogelatin.

[0150] The pharmacological agents disclosed herein can be administered to a subject via a variety of channels. Oral administration, as well as all forms of administration such as intravenous injection, intramuscular injection, subcutaneous injection and intraperitoneal injection can be used.

[0151] In some embodiments, the recombinant vector is administered locally to the subject, by intravitreal injection, by subconjunctival injection, into or within the subretinal space of the subject.

[0152] The methods disclosed herein can further include administering an additional therapeutic agent to the subject. In some embodiments, the additional therapeutic agent is ranibizumab, aflibercept, and / or bevacizumab.

[0153] The desirable dosage of the therapeutic agent disclosed in this specification varies depending on various factors including the method of manufacturing the formulation, the form of administration, the age, weight and gender of the patient, the degree of symptoms of the disease, food, the duration of administration, the route of administration, the excretion rate, and the sensitivity to the reaction. Nevertheless, this can be appropriately selected by the corresponding manufacturer.

[0154] Furthermore, for the treatment effect, a skilled physician can determine and prescribe the effective dosage for the targeted treatment. For example, the routes of administration can include, but are not limited to, subretinal injection, intravitreal injection, intravenous injection, subcutaneous injection, intramuscular injection, and direction injection into the eye, ventricle, or spinal cord by using microneedles. In some embodiments, the dosage per eye is 1×10 8 vg (viral genome) ~ 1×10 11 vg, 1×10 8 vg ~ 1×10 10 vg, 1×10 8 vg ~ 1×10 9 vg, and any specific dosage or dosage range among them, for example, 2×10 8 vg ~ 5×10 8 vg, 2×10 9 vg ~ 4×10 10 vg, 4×10 8 vg ~ 6×10 10 vg, 5×10 8 vg ~ 4×10 10 vg, 5×10 8 vg ~ 1×10 11 vg, 1×10 9 vg ~ 5×10 10 vg, 2×10 9 vg ~ 1×10 10 vg, 5×10 9 vg ~ 1×10 10 vg, or 5×10 9 vg ~ 8×10 10 vg can be. Multiple injections per day and repeated administrations are possible. For example, the effective dosage can be, for example, per eye, in the case of a vector, 0.05 - 15 mg / kg, and in the case of a recombinant virus, 5×10 11 ~ 3.3×1014 Viral particles (2.5×10 12 ~1.5×10 16 IU) / kg, and in cells it can be 5×10 2 ~5×10 7 cells / kg. Desirably, the dosage is at a rate of administration 2 - 3 times per week. In the case of vectors, it is 0.1 - 10 mg / kg, and in the case of recombinant viruses, it is 5×10 12 ~3.3×10 13 particles (2.5×10 13 ~1.5×10 15 IU) / kg, and in the case of cells, it is 5×10 3 ~5×10 6 cells / kg. The dosage is not strictly limited. Rather, the dosage can be changed according to the patient's condition and the degree of manifestation of neuropathy. The effective dosage for other subcutaneous fat and intramuscular injections, as well as direct administration to the affected area, is 9×10 10 ~3.3×10 14 recombinant viral particles at a rate of 2 - 3 times per week at 10 cm intervals. The dosage is not strictly limited. Rather, the dosage can be changed according to the patient's condition and the degree of manifestation of neuropathy. More specifically, the pharmacological agents disclosed herein can contain recombinant adeno-associated virus at 1×10 10 ~1×10 12 vg (viral genome) / mL, and generally, it is desirable to inject 1×10 12 vg once every two days over a two-week period. This can also be administered by dividing the dosage for once-a-day or several times-a-day administration. In some embodiments, the vector is 0.1×10 8 vg~500×10 8 vg, 1×10 8 vg~100×10 8 vg, 1×10 8 vg~10×10 8 vg, for example, 5×10 8vg, or any particular amount or range of dosages derived therefrom, may be administered. In the case of IV injection, for example, vg can be converted to a dosage for humans based on body weight for IV injection. In the case of local tissue injection, for example, vg can also be converted to a dosage for humans based on the number of target cells and the effective MOI (multiplicity of infection).

[0155] In some embodiments, the vectors disclosed herein can be injected into a subject, for example, by subretinal injection, intravitreal injection, or subchoroidal injection. The injection may be in liquid form. In other embodiments, the vectors disclosed herein can be administered to a subject in the form of eye drops or ointments.

[0156] Nucleic acid molecules containing AIMP2-DX2, such as vectors, can be delivered by methods well known in the art. Nucleic acid molecules containing AIMP2-DX2 may also be combined with other genes or nucleic acid delivery tools or materials as needed. Delivery methods include viral vectors and non-viral vectors; chemical conjugation with Galnac, cell-penetrating peptides, nucleic acid or glycopeptide-mediated tools, or synthetic compound vectors; lipid-mediated delivery such as lipid nanoparticle encapsulation; inorganic vector-mediated delivery such as inorganic vectors; biological delivery such as exosome-mediated delivery; physical delivery such as micro / nano needles, pressure-perfusion, microprojectiles, electrical energy / electroporation / iontophoresis, sonoporation, magnetoporation, or optoporation / photodynamic energy, but are not limited thereto.

[0157] Pharmacological formulations can be manufactured in various oral and parenteral administrable forms. In some embodiments, the vectors disclosed herein can be administered to the brain or spinal cord. In some embodiments, the vectors disclosed herein can be administered to the brain by stereotactic injection.

[0158] Oral dosage forms include pills, tablets, hard and soft capsules, liquids, suspended solutions, oils, syrups, and granules. These dosage forms may contain, in addition to the active ingredient, diluents (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, and / or glycine) and glidants (e.g., silica, talc, and stearic acid and its magnesium or calcium salts, and / or polyethylene glycol). In addition, pills may contain binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanthin, methylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidine, and, depending on the circumstances, disintegrants such as starch, agar, alginic acid or its sodium salt, or similar mixtures, and / or absorbents, coloring agents, flavoring agents, and sweetening agents. The dosage forms can be manufactured by common mixing, granulation, or coating methods.

[0159] In addition, injections are a typical form of parenteral dosage forms. Solvents for such injections include water, Ringer's solution, isotonic saline, and suspensions. Sterilized fixed oils for injections can be used as solvents or suspension media, and any non-irritating fixed oil containing monoglycerides and diglycerides can be used for such purposes. In addition, fatty acids such as oleic acid can also be used for injections.

[0160] The present invention will be described in more detail by using the following examples. However, the following examples are for the sole purpose of specifying the content of the present invention, and the application of the present invention is not limited to such examples.

Examples

[0161] (Example 1) Preparation of Recombinant Vector Most of CD45 is a transmembrane protein tyrosine phosphatase of hematopoietic cells, which can be used to define cells according to the molecules on the cell surface. CD45 is a marker for all leukocyte groups and B lymphocytes. A recombinant vector that specifically and uniquely expresses in neurons was prepared without expression in cells derived from CD45, particularly lymphoid cells and leukocyte cells. This recombinant vector contains a splicing variant lacking exon 2 of aminoacyl-tRNA synthetase complex interacting multifunctional protein 2 (AIMP2), and a miRNA capable of controlling the expression of the AIMP2 splicing variant.

[0162] To induce specific expression of the AIMP2 splicing variant in the injected neuronal tissue, a recombinant vector was prepared as a distribution safety measure. Also, this was done to completely block any possibility that AIMP2-DX2 is expressed in hematopoietic cells, which are the major population of non-neuronal cells in the injected tissue area. (Example 1-1) Preparation of AIMP2 Variant

[0163] AIMP2 is one of the proteins involved in the formation of aminoacyl-tRNA synthetase (ARS) and functions as a multifactor apoptosis protein. To construct a plasmid expressing a variant lacking exon 2 of AIMP2, the cDNA of the AIMP2 splicing variant was cloned into pcDNA3.1-myc. Subcloning into pcDNA3.1-myc was performed by amplifying the AIMP2 splicing variant using primers with EcoR1 and Xho1 linkers attached to the H322 cDNA and then using EcoR1 and Xho1.

[0164] The AIMP2 variant having the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 was used. (Example 1-2) Selection of miRNA and Selection of Its Target Sequence

[0165] As described above, as a distribution safety measure, in order to limit the expression of the AIMP2 variant to within the injected neuron cells and completely block the possibility of expression in hematopoietic cells, which are the major population of non-neuronal cells in the tissue area injected with AIMP2-DX2, the recombinant vector was prepared as described above.

[0166] For this purpose, miR-142-3p, which is specifically expressed only in hematopoietic cells that generate white blood cells and lymphoid-related cells, was selected as the target. To create a sequence that targets only miR-142-3p, mouse B cell microarray data and computer programming (mirSVR score) of the genes targeted by miR - 142-3p were used. miR-142-3p has the nucleotide sequence shown by the sequence number. The miR-142-3p target sequence of SEQ ID NO: 5 binds to miR-142-3p.

[0167] The miR-142-3p target sequence contains Nhe 1 and Hind III, Bmt 1 site sequences (ccagaagcttgctagc; SEQ ID NO: 21) and Hind H site sequences (aagcttgtag; SEQ ID NO: 22). miR-142-3pT can contain the nucleotide sequence of SEQ ID NO: 5 repeated 4 times, and those nucleotide sequences are linked by linkers (tcac and gatatc) (Figure 4; SEQ ID NO: 6). (Example 1-3) Preparation of Recombinant Vector

[0168] To prepare the recombinant vector, the miR-142-3p target sequence (SEQ ID NO: 5) was inserted into the 3'UTR of the AIMP2 variant (SEQ ID NO: 1). The ligation of the AIMP-2 variant and the miR-142-3p target sequence is shown by nucleotide sequence number 6. Specifically, it was cut and inserted by using Nhe I and Hind III sites. The recombinant vector is shown in Figure 1. (Example 1-4) Confirmation of Neuron-Specific Expression of Recombinant Vector in vitro

[0169] Since miR142-3p is specifically expressed only in hematopoietic cells, the degree of AIMP2 variant expression in specific cells was confirmed according to the knockdown of the AIMP2 variant corresponding to the expression of the miR142-3p target sequence of the recombinant vector.

[0170] Specifically, there were an untreated group of the recombinant vector (SHAM), an empty / control vector-treated group (NC vector), a single AIMP2 variant vector-treated group (pscAAV_DX2), and a group treated with the recombinant vector (pscAAV-DX2-miR142-3pT). The concentration of all vectors was in the unit of ug / ul, and each group was treated with 2.5 ul (2.5 ug). In each of the treatment groups, while confirming the knockdown of the AIMP2 variant, treatment was performed on the THP-1 cell line (human leukemia monocyte cells) and the SH-SY5Y cell line (neuroblastoma). qPCR was performed by using the primers shown in Table 1 below (denaturation for 15 seconds, and annealing and extension for 40 cycles at a temperature of 60 °C for 30 seconds).

Table 1

[0171] As a result, it was confirmed that the AIMP2 variant was not expressed in the SHAM and NC vector groups. In addition, it was confirmed that expression was present in both the THP-1 cell line and the SH-SY5Y cell line of the single AIMP2 variant vector-treated group (pscAAV-DX2), thereby confirming that neuron-specific expression was not induced. On the other hand, in the group treated with the recombinant vector, it was confirmed that the AIMP2 variant was specifically expressed only in the SH-SY5Y cell line (Figure 2). (Example 1-5) Materials and Methods (Example 1-5-1) qRT-PCR

[0172] Total RNA was isolated from the spinal cord using TRIzol (Invitrogen, Waltham, MA, USA) according to the manufacturer's protocol. The extracted RNA was quantified by a spectrophotometer (ASP - 2680, ACTgene, USA) for quantification. To generate cDNA, reverse transcription was performed using SuperScript III First - Strand (Invitrogen) according to the manufacturer's protocol. The resulting cDNA was used for real - time PCR using SYBR green PCR master mix (ThermoFisher Scientific, USA). The expression data of duplicate results were used for 2 - ΔΔCt statistical analysis, and GADPH expression was used for normalization. (Example 1 - 5 - 2) miR142 - 3p inhibition experiment

[0173] Inhibition of miR - 142 - 3p on DX2 expression was observed from the ×1 miR - 142 - 3p target sequence. HEK293 cells were transiently transfected with ×1, ×2, and ×3 repeated miR - 142 - 3p target sequence vectors, and also transiently transfected with 100 pmol of miR - 142 - 3p using Lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hours. The amount of DX2 mRNA was analyzed by PCR. Inhibition of miR142 - 3p on DX2 expression was observed from the Tseq ×1 repeated miR142 - 3p target seq (Figure 4B). (Example 1 - 6) Three types of vectors generated for the inhibitory effect of the core - binding sequence

[0174] Tseq ×1 contains one core - binding sequence, Tseq ×2 contains two core - binding sequences, and Tseq ×3 contains three core - binding sequences (Figure 4A).

[0175] Inhibition of miR142-3p (100 pmol) on DX2 expression began to be observed from the miR142-3p target sequence with 1× repetition. HEK293 cells were transiently transfected with miR-142-3p T seq vectors with 1×, 2×, and 3× repetitions, and 100 pmol of miR-142-3p was transiently transfected using Lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hours. The amount of DX2 mRNA was analyzed by PCR. As the number of core binding sequences in the miR142-3p target seq increased, the inhibition of miR142-3p on DX2 expression also increased. The Tseq ×3 core sequence containing the vector showed significant inhibition (Figure 4B). (Example 1-7) Core sequence mutation.

[0176] Using mouse B cell microarray data and the mirSVR score of the miR-142-3p target gene, the core sequence was predicted. Four regions of the core sequence were replaced as follows: (5'-AACACTAC-3' → 5'-CCACTGCA-3') (see Figure 3 for the original sequence and Figure 4A for the schematic diagram). (Example 1-8) The core binding sequence is important for DX2 inhibition

[0177] Four core sequences were replaced (Figure 4A). HEK293 cells were transiently transfected with the repeated vector of DX2-miR-142-3p T seq ×3 (Tseq3×) or the core sequence mutant vector (mut), and 100 pmol of miR-142-3p was transiently transfected by using Lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hours. The expression of DX2 mRNA was analyzed by PCR. The repeated vector of Tseq ×3 that showed significant inhibition of DX2 (Figure 4B) and the DX2 construct were used as controls. Treatment with 100 pmol of miR142-3p significantly inhibited the Tseq ×3 vector, but DX2 and the mut sequence were not inhibited (Figure 5). (Example 2) Treatment of RP (retinitis pigmentosa)

[0178] To investigate the possibility of a safe and specific target for treating RP (retinitis pigmentosa), AIMP2 was examined as a target for inhibiting cell death. The accumulation of AIMP2 leads to the activation of poly(ADP-ribose) polymerase-1 (PARP-1) and subsequent neuronal degeneration: DX2 impairs the apoptosis-promoting activity of AIMP2 by competitively inhibiting the binding of AIMP2 to PARP-1.

[0179] The enzyme poly(ADP-ribose) polymerase-1 (PARP-1) is the most studied member of the PARP family (also called ADPRT, PARS, ART), which includes 17 members responsible for poly(ADP-ribose) (PAR) synthesis. Kim JH et al. (2014). PARP enzymes are involved in DNA repair and are activated by single-strand and double-strand DNA breaks. Their involvement in DNA repair appears to require the addition of PAR chains (referred to herein as PARylation) to the PARP enzymes themselves or other proteins involved in the repair process. Kim JH et al. (2014). In addition, abnormal activation of PARP-1 is involved in pathological processes such as stroke, trauma, diabetes, and Parkinson's disease (Ko HS et al. (2005); Corti O. et al. (2003); Ko HS et al. (2010)), and in such or similar situations, excessive accumulation of PAR can cause parthanatos, a characteristic type of cell death. Narne P et al. (2017); and Mao K et al. (2022). In this context, apoptosis-inducing factor (AIF) can be redistributed from mitochondria to the nucleus by excessive PARylation, leading to further rapid DNA fragmentation and cell death. Hone SJ et al. (2004); Narne P et al. (2017); Mao K et al. (2022); Szabo C et al. (1996); Virag L et al. (1988). Excessive PARP activity has also been observed in photoreceptor cell death in several rat and mouse models of RP, which increases the level of PARylation in degenerating photoreceptor cells. Sahaboglu A et al. (2017).

[0180] Therefore, the efficacy of DX2, which inhibits the function of AIMP2 in the overactivation of PARP-1, was tested. First, to examine whether DX2 is a competitive inhibitor of AIMP2 and regulates neuronal cell death, SH-SY5Y cells were co-transfected with PARP-1, AIMP2, and DX2 expression plasmids, and PARP-1 was immunoprecipitated. As shown in Figure 7A, DX2 binds more strongly to PARP-1 than AIMP2.

[0181] To determine whether the intracellular DX2 protein level affects the binding of PARP-1 and AIMP2, before immunoprecipitation analysis, an overexpression plasmid of DX2 (Figure 7B) or DX2 siRNA (Figure 7C) was transfected into neuroblastoma SH-SY5Y cells. In this assay, SH-SY5Y cells were transfected with a vehicle (Con) or DX2 expression (DX2) plasmid, incubated for 24 hours, and lysed. Then, the cell lysates were incubated with protein agarose beads to immunoprecipitate AIMP2 bound to PARP-1 and analyzed by immunoblot analysis (Figure 7B). Similarly, before immunoprecipitation and immunoblot analysis, DX2 siRNA (DX2) and control siRNA (Con) were transfected into SH-SY5Y cells and incubated for 48 hours (Figure 7C).

[0182] In cells overexpressing DX2, the amount of AIMP2 bound to PARP-1 decreased (Figure 7B), while in cells with DX2 knockdown, the amount of AIMP2 bound to PARP-1 increased (Figure 7C), suggesting that DX2 expression plays an important role in the interaction between PARP1 and AIMP2.

[0183] To elucidate the mechanism by which DX2 regulates the cleavage of PARP-1 (e.g., activation of PARP-1) under oxidative stress conditions, the binding affinity of AIMP2 and DX2 was evaluated. An AIMP2 and / or DX2 expression vector was introduced into HEK293 cells. The cells were incubated for 24 hours, lysed, and immunoprecipitation was performed.

[0184] When AIMP2 was expressed alone, the formation of AIMP2 homodimers was observed. However, the amount of DX2 homodimers was significantly lower compared to AIMP2 - AIMP2 homodimers or AIMP2 - DX2 heterodimers (Figure 7D - 7E, the third lane in the upper - left panel). Collectively, these observations suggest that DX2 preferentially binds to AIMP2 and inhibits AIMP2 - induced cell death.

[0185] PARylation is a post - translational process that regulates biological events such as DNA damage response and apoptosis. Szabo C et al. (1996) and Virag l et al. (1998). PARP - 1 is an enzyme that recognizes damaged DNA in the nucleus, forms PAR chains, and induces the degradation of damaged proteins and cell death through PARylation. To evaluate how AIMP2 or DX2 affects the activation (e.g., cleavage of PARP - 1) and PARylation of PARP - 1 under oxidative stress conditions, SH - SY5Y cells were transfected with vectors expressing an empty vector (EV), AIMP2, or DX2, and then treated with hydrogen peroxide (H2O2) for 4 hours. The cells were then lysed, and the amount of activated PARP - 1 protein levels (Figure 7F) and PARylation (Figure 7G) were evaluated by Western blot analysis X.

[0186] Cells transfected with AIMP2 showed significantly increased cleavage of PARP - 1 compared to the expression seen in cells transfected with others under oxidative stress conditions. However, cleavage of PARP - 1 was not observed in cells transfected with DX2 (Figure 7F). PARylation of AIMP2 increased in the presence of H2O2, while PARylation of DX2 did not change (Figure 7G).

[0187] To examine the protein half - life between AIMP2 and DX2, a cycloheximide - treated pulse - chase assay was performed. DX2 showed similar stability to full - length AIMP2 from 0 to 4 hours after the cessation of de novo protein synthesis (Figure 7H).

[0188] Therefore, these results indicate that DX2 is an important factor for neuron cell survival rate, and overexpression of DX2 can reduce neuron cell death in neurodegenerative diseases.

[0189] As observed, when DX2 is insufficiently expressed, AIMP2 forms a homodimer, interacts with PARP-1, activates PARP-1, and induces neuron cell death. However, since DX2 has a significantly higher binding affinity for PARP-1 than AIMP2, the binding affinity between AIMP2 and PARP-1 decreases in DX2-expressing cells, thereby resulting in inhibition of PARP-1 activity and reduction of neuron cell death. Therefore, DX2 is a major regulatory protein in AIMP2-induced PARP-1 activation and cell death (Figure 7I).

[0190] In summary, DX2 impairs the apoptosis-promoting activity of AIMP2 by competitively inhibiting the binding of AIMP2 to PARP-1. (Example 3) DX2 attenuates H2O2-induced neuron cell death.

[0191] Based on the above results that DX2 is an inhibitor of oxidative stress-induced cleavage of PARP-1, it was further investigated whether DX2 suppresses cell death of neuron cells. To examine the cell survival rate under the overexpression conditions of AIMP2 and DX2, an AIMP2 or DX2 expression plasmid was introduced into N2A cells (Neuro-2a, a mouse neuroblastoma cell line), and the transfected cells were incubated with 400 μM H 2 O 2 for 4 hours. MTT assay was performed to determine the level of cell death.

[0192] Under normal conditions, overexpression of AIMP2 or DX2 did not affect cell survival rate, but H 2 O 2Under the treatment conditions, cell death was significantly increased by overexpression of AIMP2 and reduced by overexpression of DX2 (Figure 8A).

[0193] To test whether DX2 or AIMP2 controls cell viability under conditions of damage-induced cell death, SH-SY5Y cells were co-transfected with EV, AIMP2, and DX2 expression plasmids and treated with 400 μM H 2 O 2 for 4 hours. MTT assay was performed to determine cell death. Even when the expression of AIMP2 was increased (from 1 μg to 2 μg), transfection of 1 μg of DX2 suppressed AIMP2 / H 2 O 2 -induced cell death to a level similar to that of transfection with 2 μg of DX2 (Figure 8B). In contrast, the expression level of AIMP2 could not significantly affect neuronal cell death under the conditions of DX2-expressing cells (from 1 μg to 2 μg) (Figure 8B), and DX2-expressing cells had significantly reduced cell death compared to control cells under oxidative stress conditions (Figure 8C). In summary, the anti-apoptotic effect of DX2 seems to be much stronger than the apoptosis induction by AIMP2 under the coexistence conditions of the two proteins. (Example 4) TRAF-dependent pathway: DX2 impairs the TNF-α-dependent apoptosis-promoting activity of AIMP2 by competitively inhibiting the binding of AIMP2 to TRAF2.

[0194] DX2 impairs the TNF-α-dependent apoptosis-promoting activity of AIMP2 by competitively inhibiting the binding of AIMP2 to TRAF2.

[0195] Eye inflammation is a common cause of vision impairment. Olivares-Gonzalez L et al. (2021). It is thought to be a chronic inflammation involving the persistent activation of glial cells (microglia, astrocytes) and the recruitment of other immune cells to neural tissue (brain, spinal cord, or retina). Streit WJ (2004). Microglial cells, which are resident innate immune cells in the retina and other neural tissues, are potential cellular regulators of inflammation. Karlstetter M et al. (2015). Activated microglia and macrophages secrete inflammatory mediators such as TNF-alpha and t on retinal cells (e.g., photoreceptor cells). Murakami Y et al. (2019). In the eye, TNF-α appears to be involved in the etiology of inflammation, edema, angiogenesis, and neurodegenerative diseases. Rodrigues EB et al. (2009).

[0196] In TNF-α signaling, TRAF2 plays an important role in cell death. When TNF-α signaling is activated, TRADD (TNF receptor-associated death domain) and TRAF2 bind to TNFR1, which is the TNF-α receptor, and then the activated complex mediates the activation of IκB kinase (IKK). When caspase-8 is inactivated, TRAF2 is released from the TRADD complex, and the released TRAF2 is ubiquitinated by cIAP, an E3 ubiquitin ligase, to promote cell death. AIMP2 promotes the ubiquitination of TRAF2 by cIAP and stimulates cell death. Choi JW et al. (2009).

[0197] To understand how DX2 impairs the apoptotic activity of TNF-a signaling, the inventors evaluated the ability of DX2 to compete with AIMP2 for interaction with TRAF2 and affect NF-kB-dependent transcriptional activity. For co-immunoprecipitation assays, HEK293 cells were transfected with 0, 1, or 2 μg of Myc-tagged DX2 or AIMP2 expression plasmids (Figure 9A). The expression of endogenous (endo) and exogenous (exo) AIMP2 and DX2 was confirmed by immunoblotting of whole cell lysates (WCL) using an anti-AIMP2 antibody. TRAF2 was immunoprecipitated using its specific antibody, and AIMP2 or DX2 bound to TRAF2 was detected using an anti-Myc antibody.

[0198] To test NF-kB-dependent transcriptional activity, HEK293 cells were transfected with an NF-kB-luciferase vector and selected with G418 (1 mg / ml) for one week to establish stable expressing cells. After selection of viable cells, the cells were transfected with a pcDNA3.1 empty vector (as a control) or a pcDNA3.1 expression vector encoding AIMP2 or DX2. After 16 hours, the transfected cells were treated with TNF-a (20 ng / ml) for 12 hours. The cells were harvested and cell lysates were prepared for quantification of luciferase using a luciferase assay kit according to the manufacturer's protocol (Promega).

[0199] As the expression of DX2 increased, the interaction between AIMP2 and TRAF2 decreased. Conversely, when AIMP2 was introduced, the interaction between DX2 and TRAF2 was inhibited in a dose-dependent manner (Figure 9A). The increase in NF-kB activity suppressed the apoptosis-promoting signal of TNF-α. As expected, DX2 increased NF-kB activity, while AIMP2 had the opposite effect (Figure 9B). Overexpression of DX2 abolished TNF-α-induced cell death (Figure 9C).

[0200] Next, to evaluate whether DX2 suppresses TNF-α-dependent neuronal cell death, N2A and primary mouse neuronal cells were transfected with either an EV (empty vector) or a DX2 expression plasmid. The transfected cells were incubated for 6 hours in the presence or absence of TNF-α (20 ng / ml) + cycloheximide (CHX, 10 μM). Subsequently, the cell viability was evaluated using the MTT assay. As shown in FIGS. 10A and 10B, overexpression of DX2 did not affect the cell viability of N2A or primary mouse neuronal cells under normal conditions (con), but in the presence of TNF-α treatment, cell death in the cells transfected with DX2 (DX2) was significantly reduced compared to the cells transfected with EV (empty vector).

[0201] In summary, DX2 competes with AIMP2 and interacts more strongly with TRAF2 than AIMP2, thus inhibiting apoptosis of neuronal cells induced by AIMP2 stimulation under TNF-α activation conditions. (Example 5) Design of AAV2-DX2: Self-complementary AAV2 encoding DX2

[0202] Since it is generally difficult to treat retinal degenerative diseases (RDDs) using conventional pharmacological methods, more effective strategies are being explored. Among these options, gene therapy can be a strategy for accessing RDDs with minimal invasiveness by subretinal microinjection and treating diseases such as RP. Christine CW et al. (2009); Eberling JL et al. (2008); Castle MJ et al. (2020).

[0203] AAV vectors are efficient shuttles capable of delivering transgenes to retinal cells, with the property of efficient transduction into non-dividing retinal cells. AAV is also being evaluated as a suitable gene delivery approach due to its relative safety resulting from the lack of pathogenicity. Wang D et al. (2019). Here, we investigate the potential of an adeno-associated virus serotype 2 (AAV2) delivery system for effectively delivering the therapeutic gene DX2 to patients with RDD.

[0204] To determine which viral system to use between single-stranded AAV (ssAAV) and self-complementary AAV (scAAV), SH-SY5Y cells were infected with ssAAV-GFP (green fluorescent protein) or scAAV-GFP at 10, 100, 1000, or 104 multiplicity of infection (MOI). After 48 hours, GFP expression was measured by microscopy. Figure 11A represents the percentage of GFP-positive cells, and Figure 11B shows an image of GFP-expressing cells by microscopy. In Figures 11A and 11B, when both viruses were used to treat SH-SY5Y at different concentrations, scAAV was more effective in terms of virus infection rate. (Example 6) AAV2-DX2 transduction suppresses cell signaling related to neuron death.

[0205] To examine whether AAV2-DX2 impairs the H2O2-induced cytotoxic effect in MEF (mouse embryonic fibroblasts), hepatocytes, MSC (mesenchymal stem cells), and primary neurons (neurons), cells were infected with 104 MOI of AAV-DX2 (AAV2-DX2) for 48 hours. Then, the transduced cells were treated with 400 μM H2O2 for 4 hours to induce cell death, and cell viability was measured by MTT assay (Figure 12A).

[0206] AAV2-DX2 transfected cells (DX2) usually showed a significant decrease in cell death compared to AAV-GFP transfected cells (GFP) after H2O2 treatment (Figure 12A), suggesting that AAV2-DX2 is an effective anti-apoptotic agent. Interestingly, under normal conditions, cell viability was not affected by the presence or absence of AAV2-DX2 (Figure 12B). Therefore, DX2 functions only when stressors induce an apoptotic state.

[0207] To investigate how overexpression of DX2 changes intracellular signaling in neuronal cells, RNA sequencing was performed on neuronal cells after inducing the DX2 gene by an AAV delivery system. SK-N-SH neuroblastoma cells were infected with scAAV2-GFP or AAV2-DX2. Cells were harvested 48 hours after infection, RNA was isolated, and RNA sequencing was performed. DX2 was predicted to be involved in the suppression of p53-related cell death pathways and TNF-α or interleukin-related signaling (Figure 12C). Gene sets were analyzed based on two cell types, SK-N-SH (Figure 12D) and N2A (Figure 12E), to evaluate differentially expressed genes (DEGs) classified into signaling pathways or ontology databases. DX2 appears to reduce inflammatory or apoptotic signaling in both N2A (Figure 12D) and SK-N-SH cells (Figure 12E), showing a significant downregulation of many related genes. Statistical significance was visualized by the distribution of p-value graphs for all pathways after DX2 overexpression (Figures 12F - 12G). (Example 7) DX2 increases the viability of 661W cells, which are retinal photoreceptors and ganglion precursor-like cell lines.

[0208] To investigate whether DX2 can rescue retinal photoreceptors and ganglion neurons from ROS-induced cell death, similar to the other neuronal cells described in the above paragraphs, the inventors used various concentrations of H 2 O 2Cell viability tests were performed on cells infected with AAV-DX2 and non-infected cells treated with [chemical]. As a result, it was shown that cells infected with AAV-DX2 exhibited higher resistance to [chemical] concentration and remained viable. 2 O 2

[0209] Figure 13 shows that DX2 increased the survival rate of retinal photoreceptor neurons. 661W cells were seeded in 96-well plates at 5×10 4 cells per well and subsequently infected with AAV-DX2 virus at 5000 MOI. After 48 hours, the cells were treated with various concentrations of H2O2. Cell viability was evaluated using the MTT assay 24 hours later.

[0210] To further investigate the anti-apoptotic effect of AAV-DX2, 661W cells were infected with AAV-DX2 and then [chemical] 2 O 2 treatment was used to induce cell death. The mRNA level of BAX, a pro-apoptotic marker, was evaluated. As a result, in cells infected with the control virus AAV-GFP, it was shown that the BAX level increased by more than 2.5 times compared to untreated cells after [chemical] 2 O 2 treatment. However, in cells treated with AAV-DX2, when treated with [chemical], the BAX level was significantly reduced compared to the AAV-GFP treatment group. 2 O 2

[0211] Figure 14 shows that DX2 reduces the level of BAX induced by H2O2. 661W cells were infected with either AAV-GFP or AAV-DX2 at 5,000 MOI each. After 72 hours, the cells were treated with 2 mM [chemical] 2 O 2 for 6 hours, and then the RNA level of BAX was evaluated. (Example 8) DX2 increases the expression level of 67LR in retinal neurons. ​​

[0212] To further investigate the anti-apoptotic signaling pathway of DX2, the inventors examined the regulatory role of DX2 in 67LR. DX2 was overexpressed in 661W, a retinal photoreceptor and ganglion precursor-like cell line, and the change in 67LR expression was examined. When DX2 was overexpressed, an increase in the expression of both 67LR and 37LRP was observed (Figure 15A). This observation was further confirmed when the inventors performed immunofluorescent staining of 67LR in 661W cells under the same experimental conditions. Cells overexpressing DX2 showed a fluorescence intensity approximately 2.5-fold stronger than that of non-overexpressing cells (Figure 15B).

[0213] Next, both AIMP2 and DX2 were overexpressed and subsequently immunoprecipitated using KRS to evaluate the binding affinity between DX2 and KRS. The results showed that both AIMP2 and DX2 exhibited a similar binding affinity to KRS.

[0214] Figure 16 shows that DX2 binds to KRS in the same manner as AIMP2. Cells transfected with 2 μg of flag-tag-AIMP2 and flag-tag-DX2 were lysed using NP-40 lysis buffer. Subsequently, a mixture of 15 μl of agarose A / G plus beads and KRS antibody was used for the pull-down assay.

[0215] As previously reported, H2O2-induced ROS stress causes a decrease in 67LR, weakens cell survival signaling, and induces cell death. Yan X et al. (2017). Under conditions where retinal cells are killed by ROS, the inventors examined the changes in KRS and the effects of DX2 by infecting 661W cells with AAV-DX2. When treated with the control virus AAV-GFP, a reduction in 67LR levels due to H2O2 treatment was observed, and KRS levels also decreased. However, when treated with AAV-DX2, there was no decrease in 67LR levels due to H2O2, and no change in KRS levels was observed (Figure 17A).

[0216] To determine whether the changes in KRS and 67LR had the greatest impact in either the cytosol or the membrane, the inventors analyzed the fractionated cells. As a result, it was shown that the decrease in KRS levels caused by H 2 O 2 was in the membrane form rather than the cytosolic form, and that the increase in 67LR levels also occurred in the membrane (Figure 17B). Collectively, these results suggest that by binding to KRS, DX2 causes an increase in the membrane form of KRS and, as a result, the expression of 67LR expression, thereby preventing apoptosis of neuronal cells. (Example 9) In vivo study to evaluate the effect of AAV2-DX2 on RDD

[0217] To understand the potential efficacy for patients with retinal degenerative diseases, the preventive and therapeutic effects of AAV2-DX2 were evaluated in three RDD animal models of mice and rabbits, namely, laser-induced choroidal neovascularization, Mdm1- / -(CRISPR / Cas9 KO), and the retinal degeneration model induced by sodium iodate. Overall, AAV2-DX2 was determined to be effective in both preventive and therapeutic settings. These studies are summarized below. (Example 9-1) AAV2-DX2 exhibits the preventive effect of DX2 in the mouse Mdm1- / -(CRISPR / Cas9 KO) model.

[0218] Mouse double minute 1 (Mdm1) may be involved in the function and structure of the centrosome and degeneration. Son et al. demonstrated that the Mdm1 protein is localized to the connecting cilia (CC) of photoreceptors in the retina. Depletion of the Mdm1 transcript may underlie the mechanism leading to the development of progressive retinal degeneration.

[0219] Mdm1- / - mice were generated using CRISPR / Cas9 and show retinal degeneration and electrophysiological abnormalities of the eye. 39 . Transduction of the retina with AAV-DX2 resulted in restoration of the overall thickness of the neural retina (Figure 18B). Transduction with DX2 showed a thicker RPE layer (Figure 18C) and outer segment layer of photoreceptors (Figure 18D), suggesting that DX2 expression blocks RPE degeneration and photoreceptor cilium degradation. Transduction with DX2 also showed a thicker outer nuclear layer of photoreceptors (Figure 18E) and outer plexiform layer (Figure 18F), indicating that DX2 expression reduces photoreceptor degeneration.

[0220] Figure 18G shows the integrity and proliferation of the RPE (retinal pigment epithelium). Transduction of the DX2 gene resulted in restoration of RPE integrity by activating RPE proliferation. Figure 18H shows the recovery of PRs (photoreceptors). Transduction of the DX2 gene resulted in recovery of the PR population by activating PR proliferation.

[0221] Figure 18I shows cell proliferation of the RPE and PRs. Ki67 expression was measured to analyze proliferation in the RPE and photoreceptor layers. Proliferation in the RPE (left panel) and outer segment layer of photoreceptors (right panel) was significantly higher in samples transfected with AAV2-DX2.

[0222] Figures 18J - 18O show functional recovery of the retina. AAV2-DX2 transduction showed an increase in a-wave amplitude (Figure 18L) and a reduction in latency (Figure 18M) compared to the RDD model (mdm1- / -) or negative control (mdm1- / - + AAV-GFP), indicating that DX2 expression reduces electrophysiological function and vision impairment of photoreceptors. Samples transfected with AAV2-DX2 did not show a change in b-wave amplitude (Figure 18N), but showed a reduction in latency compared to the RDD model (mdm1- / -) (Figure 18O), suggesting that DX2 affects only the RPE and photoreceptors and not bipolar cells (post-photoreceptor neurons).

[0223] The electroretinogram of the samples transfected with AAV2-DX2 showed an increase in the recovery of the normal ERG graph format (Figs. 18J and 18K). The samples transfected with AAV2-DX2 showed a slightly increased a-wave amplitude (Fig. 18L) and a reduced latency (Fig. 18M) compared to dry AMD (mdm1- / -), indicating that DX2 expression reduced the damage to the electrophysiological function of photoreceptors. The samples transfected with AAV2-DX2 did not show a change in the b-wave amplitude (Fig. 18N), but showed a reduced latency compared to the RDD model (mdm1- / -). (Fig. 18O).

[0224] The survival effect and anti-apoptotic efficacy of DX2 on retinal degeneration of DX2 delivered to the rabbit retina via subretinal (SR) and intravitreal (IV) injection by adeno-associated virus (AAV). (Example 9-2) Materials and Methods

[0225] 1. Animal experiments (knockout mice)

[0226] In the retinal degeneration mouse model experiment, Mdm1- / - (CRISPR / Cas9 KO) mice showing progressive photoreceptor and RPE degeneration were generated. The animals were housed individually in cages under specific pathogen-free conditions and certain environmental conditions (temperature of 21°C to 23°C, humidity of 50% to 60%, and 12-hour light / dark cycle) in the animal facility. AAV2-DX2 and negative control (AAV2-GFP) were injected into the subretinal space of 3-week-old mice. Histological measurement and functional recovery of the retina were performed at 3 months of age. For 3-week-old Mdm1- / - mice, AAV2-DX2 / AAV2-GFP was injected into the subretinal space by transscleral injection using a 38G sterile microchip needle (INCYTO, KR) with a volume of 4 μl to minimize damage to the retina. AAV2-GFP / DX2 was injected into the same animals. AAV2-GFP was injected into the OS (left). AAV2-DX2 was injected into the OD (right).

[0227] 2. Evaluation of electrophysiological function

[0228] Three-week-old Mdm1- / - mice were injected subretinally with AAV2-DX2 / AAV2-GFP in a volume of 4 μl using a 38G sterile needle to minimize retinal damage. Three-month-old mice were used. At the final measurement, WT (n = 11), mdm1- / - (n = 6), mdm1- / - (AAV2+GFP) (n = 6) and mdm1- / - (AAV2+DX2) (n = 7) were evaluated. For electroretinogram evaluation of photoreceptor function, OcuScience® HMsERG was used. Mice were induced with anesthesia using avertin (1%) and maintained under anesthesia by inhalation of 3% isoflurane and placed on a heating pad to maintain the physiological state of the mice. To maintain contact with the cornea and keep the cornea moist, one drop of 2% hypromellose was placed on a contact lens for rodents equipped with a silver-embedded thread electrode. Mice were placed under a 76-mm diameter Ganzfeld dome for darkness and uniform eye illumination. Measurements were performed according to the ISCEV-Extended full-field ERG standard protocol. Data were analyzed using ERGVIEW, and combined standard rod and cone response values were selected and analyzed at a flash intensity of 3000 mcd.s / m2, 0.10 Hz. A-wave analysis was performed for photoreceptor cell function. B-wave analysis was performed for bipolar cell function and horizontal cell function. Amplitude and latency values for a-waves and b-waves were analyzed.

[0229] 3. Histological analysis

[0230] All mice were euthanized after ERG, and their eyeballs were harvested. The eyeballs were fixed overnight at 4 °C in 4% PFA. The eyeballs were dehydrated with 30% sucrose and embedded in OCT compound for tissue cryosections. All retinal cryosection samples were taken from sections containing the optic nerve with a thickness of 10 μm. Retinal cryosections were analyzed. H&E was used for analysis of layer thickness. Analysis of layer thickness was performed using the Leica LAS program. Immunofluorescence was used for RPE65 and opsin expression, and proliferation evaluation (Ki67). Immunofluorescence ROI sets and overlap coefficient measurements were performed using Image J.

[0231] 4. Statistical analysis

[0232] Student's t-test was used for the primary analysis. The P-value was compared between mdm1- / - (AAV2+DX2). For the recovery evaluation, the P-value was compared with WT. For the complete data, Levene's test for equality of variances, ANOVA test, and post-hoc (Dunnett (T3), Tukey HSD) evaluations were performed using IBM SPSS Statistics 23. (Example 10) AAV2-DX2 shows the preventive efficacy of DX2 in a laser-induced choroidal neovascularization (CNV) mouse model. (Example 10-1) Mice treated with AAV2-DX2 attenuate laser-induced choroidal neovascularization.

[0233] The laser-induced choroidal neovascularization (CNV) model is a widely used animal model for retinal degenerative diseases (RDDs). In this model, a laser is used to disrupt Bruch's membrane, allowing the underlying choroidal blood vessels to penetrate and grow into the space beneath the pigment epithelium. Subretinal injections of scAAV2-GFP (control) or AAV2-DX2 were performed on 5-week-old male C57BL / 6 mice (n = 12) (day 0). Twenty-one days after injection, CNV was induced by laser photocoagulation (day 21). Fourteen days after laser treatment, fluorescein angiography and ICG angiography were performed (day 35). The next day, the mice were sacrificed, choroidal flat mounts were prepared, and stained with (FITC) conjugated isolectin B4 (Figure 19A) (day 36). Vascular leakage caused by new angiogenesis was clearly observed at the laser-induced photocoagulation site by fluorescein angiography. ICG angiography was used to obtain angiograms of the choroid. Flat mounts were used to evaluate the presence and area of clearly demarcated isolectin-positive CNV. DX2 injection showed a decrease in vascular leakage in fluorescein angiography compared to the GFP injection control (Figure 19A). Similarly, mice injected with DX2 showed a reduction in CNV area in ICG angiography compared to mice injected with GFP (Figure 19A). Also, choroidal flat mounts stained with isolectin-B4 demonstrated a significant reduction in CNV formation area in mice injected with DX2 (Figure 19A).

[0234] The ratio of the leakage area to the CNV area was estimated by measuring the total fluorescence area using fluorescein angiography (FA) and the CNV area using ICGA (Figure 19B). The average CNV area in Bruch's membrane using isolectin B4 staining was also significantly smaller in mice injected with DX2 compared to the GFP control (n = 12) (Figure 19C). Based on this result, DX2 had a preventive effect in the CNV mouse model. Inflammatory cells, particularly (macrophages), have been histologically demonstrated to be in the vicinity / inside of the degenerative lesions, including the disruption of Bruch's membrane, atrophy of the RPE, and CNV. (Macrophages) in the CNV lesion have been shown to secrete angiogenesis-promoting factors such as VEGF and inflammatory cytokines such as TNF. In Figure 19D, the number of inflammatory cells in mice injected with DX2 was significantly less compared to the CNV cells of the GFP control. An excessive amount of vascular endothelial growth factor (VEGF) causes abnormal blood vessel growth and leakage under the macula, resulting in irreversible loss of central vision. In this context, many attempts have been made towards the development of anti-angiogenic therapies targeting VEGF for the treatment of retinal degenerative diseases. These drugs have been shown to slow down the progression of RDD and, in some cases, improve vision by suppressing angiogenesis. Here, the inventors treated mice with DX2 prior to laser-induced choroidal neovascularization and compared them with mice treated with GFP for VEGF expression (n = 6) (Figure 19E). Mice treated with DX2 showed less VEGF expression compared to mice treated with GFP. This data also demonstrated the preventive effect of DX2 on CNV model mice. (Example 10-2) Materials and Methods

[0235] 1. Animal Experiment (Mouse)

[0236] Animals were housed individually in cages under certain environmental conditions (temperature of 21°C to 23°C, humidity of 50 to 60%, and 12-hour light / dark cycle) in an animal facility under conditions free of specific pathogens. In each group, the left eye (OS, left eye) of the mouse was treated with AAV-GFP, and the right eye (OD, right eye) was treated with AAV-DX2. (Injection: 5×108 vg). One week and ten weeks after subretinal injection, a laser was induced in the RPE layer of the fundus using a laser photocoagulation device to create a retinal degeneration disease model for 3 weeks and 3 months, respectively. Two weeks and two months after laser treatment, the eyeballs of the mice were isolated.

[0237] 2. Subretinal injection protocol.

[0238] Anesthetize the rodent. Use an intraperitoneal injection of 100 mg / ml ketamine and 10 mg / ml xylazine (20 μl / 10 g body weight) instead of isofluorane inhalation. Grasp one paw of the animal to confirm that the animal is deeply anesthetized. If the animal twitches, wait a few more minutes and try again before starting the subretinal injection. Position the rodent on its side so that the eye to be injected faces the ceiling. Gently pull the skin under the anatomical microscope so that the eyeball protrudes slightly from the socket (temporary exophthalmos), and hold the head with two fingers just above the ear and at the jaw to make it more accessible. Gently pull the skin parallel to the eyelid so that the eyeball protrudes slightly from the socket. Using a 38G sterile microchip needle (INCYTO, KR), make a hole just below the corneal limbus at an angle that avoids touching the lens with the needle. With the head held in place, withdraw the disposable sharp needle from the eye. Attach a syringe pre-mounted with a blunt needle to the micromanipulator or hold it by hand, then insert the tip of the syringe with the blunt needle through the hole, again taking care not to touch the lens, and gently push the needle through the eye very gently until resistance is felt. Inject the virus into the subretinal space carefully and slowly while minimizing all movements. Inject AAV2-GFP into the OS (left). Inject AAV2-DX2 into the OD (right). Slowly withdraw the syringe. Apply a moisturizing eye drop to keep the eye moist. Continue monitoring until the animal returns to the sternal recumbent position.

[0239] 3. Mouse laser-induced CNV model protocol.

[0240] Before guiding the laser to the mouse, place the laser and the slit lamp in an easily accessible location. Turn on the laser and set it to pre-determined parameters. Anesthetize the rodent. Use an intraperitoneal injection of 100 mg / ml ketamine and 10 mg / ml xylazine (20 μl / 10 g body weight) rather than isoflurane inhalation. Place the mouse on its side and drip 1 drop (about 30 μl) of tetracaine hydrochloride into each eye for local anesthesia. Wait for 2 minutes until the solution takes effect. Drop 1 drop of topical tropicamide for pupil dilation and repeat the previous step. Alternatively, use phenylephrine hydrochloride (2.5%) for dilation. After an appropriate amount of time has passed, quickly place the mouse on the mouse stage and position the stage against the jaw rest of the slit lamp. Set the slit lamp to the lowest brightness and check the degree of pupil dilation. If the pupil is not sufficiently dilated (about 2.5 - 3 mm), return the mouse to the animal warmer and wait. Alternatively, administer another drop of tropicamide. Once the eye is sufficiently dilated, proceed with the laser treatment. Adjust the position of the mouse on the mouse stage so that it is in an ideal position for visualization of the optic nerve. Align the direction of the mouse on the holder so that it is horizontal, perpendicular to the slit lamp beam, with the head on one side and the tail on the other. Slightly rotate the mouse so that the head is closer to the laser operator at an angle of approximately 170°. After positioning the mouse ideally, drip 1 drop of artificial tear solution onto a 25 mm × 25 mm glass coverslip. Also drip 1 drop of artificial tears onto the opposite eye of the mouse. This ensures that the eyes are moist and helps delay the formation of cataracts. Hold the corner of the coverslip between the thumb and index finger and position it so that the glass is sandwiched between the tips of both fingers. Support and gently wrap the remaining 3 fingers around the animal's body to steady the hand. Place the hand so that the glass coverslip can be easily applied to the mouse's eye. Once a stable position is obtained, carefully press the glass coverslip (with the dropped artificial tear solution still attached) onto the mouse's eye. Ensure that the coverslip is positioned as perpendicular as possible to the laser beam to prevent scattering or reflection of the laser beam. The coverslip functions as a contact lens to flatten the cornea.Look through the slit lamp and switch the focus until the retina can be seen by hand. The retina shows bright yellow / red depending on the visualized position, and distinct red blood vessels can be seen. Slowly and carefully manipulate the mouse's head and / or coverslip until the optic nerve can be visualized. The optic nerve is yellow, and multiple blood vessels radiate from it. Once the operator confirms the visualization of the optic nerve, turn on the power of the laser focusing beam. After turning on the power of the laser beam, move the laser focusing beam to the desired position (about 1 disc diameter from the optic nerve). Focus the laser beam on the RPE of the fundus. The appropriate focus is achieved by having the sharpest and clearest laser beam. If the aiming beam appears elliptical or is out of focus, switch the focus of the slit lamp or reposition the glass coverslip. Once the aiming beam is focused on the RPE, use the laser foot trigger to start laser delivery. Monitor the appearance of bubbles immediately after laser delivery. The outline of the laser shot should be distinct and never blurred. Repeat the previous 3 steps for all desired CNV positions (usually at the 3 o'clock, 6 o'clock, 9 o'clock, and 12 o'clock positions around the optic nerve). Record in a note the position and result of each laser shot administration, as well as the result (success, blurring, bleeding, etc.) of each shot administered to the eye. Always put the laser in standby mode when not in use. If necessary, use the opposite hand for stabilization and repeat all the previous steps for the other eye of the mouse using a new coverslip. After administering all the desired laser shots, turn off the power of the laser and the slit lamp. Discard the coverslip and place the mouse in an incubator for recovery from anesthesia. Visually inspect the eye macroscopically for any injuries, drop 1 drop of artificial tears to keep the eye moist, and prevent possible future cataract development. Once the mouse has recovered from anesthesia, return it to the cage.

[0241] 4. Fluorescein Angiography

[0242] After removing the cornea and lens, the eye was fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) for 2 hours. The posterior eye cup of the RPE / choroid / sclera was incised and the vitreous was removed. To label the invading choroidal blood vessels, the eye cup was incubated overnight at 4 °C with (AlexaFluor 647 or FITC) conjugated isolectin B4 (1:200, Invitrogen, Carlsbad, CA).

[0243] 5. Expression of angiogenic factors by Western blot

[0244] Cells were harvested and lysed in PBS containing 1% Triton® X-100. Equal amounts of protein were loaded into the wells of an SDS-PAGE gel and transferred to a nitrocellulose membrane filter at 100 V for 2 hours. The membrane was blocked with PBST (phosphate buffered saline containing Tween® 20) containing 1% BSA at room temperature for 1 hour and probed with anti-VEGF and anti-beta-actin antibodies at room temperature for 1 hour. The membrane was washed 3 times with PBST and then incubated with a secondary antibody at room temperature for 1 hour. After washing 3 times with PBST, immunoreactive bands were detected. Data were quantified using Image J software.

[0245] 6. Statistical analysis

[0246] Student's t-test was used for primary analysis. P-values were compared with mdm1- / - (AAV2+DX2). For recovery assessment, P-values were compared with WT. For complete data, Levene's test for equality of variances, ANOVA test, and post-hoc (Dunnett(T3), Tukey HSD) assessments were performed using IBM SPSS Statistics 23. (Example 11) AAV2-DX2 improves retinal degeneration in a sodium iodate (SI)-induced rabbit RDD model.

[0247] Sodium iodate (SI) is a photoreceptor cell 40 41It is an oxidizing agent that is widely used to create a retinal degeneration model by inducing death of retinal pigment epithelial cells (RPE). A sodium iodate solution was intravenously injected once at a dose of 30 mg / kg to create an RDD model. 42 Twenty-one days after the first induction of retinal neurodegeneration, fundus images showed that the RPE degeneration area in the group induced by sodium iodate (G2) was significantly degenerated compared to the normal control group (G1). The RPE degeneration area (%) levels in the groups treated with the test substance (G5 and G6) were significantly recovered compared to G2 (Figs. 20A - 20B).

[0248] In histological examinations, the retinal pigment epithelium (RPE) degeneration area (%) levels in the group induced by sodium iodate (G2) were significantly degenerated compared to the normal control group (G1) (p < 0.001). The RPE degeneration area (%) levels in the groups treated with the test substance (G5 and G6) were significantly recovered compared to G2 (p < 0.01, p < 0.05) (Fig. 20D). The outer segment levels of the photoreceptor layer in the group induced by sodium iodate (G2) were significantly reduced compared to the normal control group (G1) (p < 0.001), and the levels in the groups treated with the test substance (G5 and G6) were recovered compared to G2 (p < 0.01) (Fig. 20E). The retinal thickness levels in the group induced by sodium iodate (G2) were significantly reduced compared to G1 (p < 0.001). The levels in the groups treated with the test substance (G5 and G6) were recovered compared to G2 (p < 0.05) (Fig. 20F).

[0249] In immunohistochemical analysis, the rhodopsin-positive area (%) levels in G2 were significantly reduced compared to G1 (p < 0.001, p < 0.01). The rhodopsin-positive area (%) levels in G5 and G6 were significantly recovered compared to G2 (p < 0.01) (Figs. 20G - 20J). The ganglion-positive cell (%) levels in G2 were significantly reduced compared to G1 (p < 0.001). The ganglion-positive cell (%) levels in G3, G4, and G6 were significantly recovered compared to G2 (p < 0.05).

[0250] Twenty-one days after the first induction of retinal neurodegeneration, the amplitude levels of the A-wave and B-wave in the group induced by sodium iodate (G2) were significantly decreased compared to the normal control group (G1) (p < 0.001). The amplitude levels of the A-wave and B-wave in the groups treated with the test substance (G5 and G6) were significantly recovered compared to G2 (p < 0.05) (Figures 20K - 20L).

[0251] Finally, the inventors created a very severe RDD model to confirm that DX2 plays a role in survival and rescues retinal function even in a very severely damaged retina. A sodium iodate solution was intravenously injected once at a dose of 60 mg / kg to create a very severe RDD model. Koster C et al. (2022).

[0252] Statistically significant improvements in the amplitude levels of the A-wave and B-wave were observed in both HG groups treated with DX2 (i.e., 5*10 10 VG dose of AAV2-DX2 injected via the subretinal or intravitreal route) compared to HG2 (very severe RDD group) (p < 0.05). See Table 2 below.

Table 2

[0253] Figures 21A - 21B show the electroretinogram measurements of the A-wave (Figure 21A) and B-wave (Figure 21B).

[0254] Materials and Methods

[0255] 1. Animal experiments (rabbits)

[0256] Fifty-two male chinchilla rabbits (about 13 weeks old, 2.5 - 3.0 kg, Dream Bio Co., Ltd.) were used for in vivo experiments. Environmental control was set to maintain the following conditions: a temperature range of 23 ± 3 °C, a relative humidity range of 55 ± 15%, ventilation of 10 - 20 air exchanges / hour, a light intensity of 150 - 300 Lux, and a 12-hour light / 12-hour dark cycle. The animals were allowed free access to experimental animal feed manufactured by Cargill Agri Purina Inc. and purchased from Dream Bio. Also, water was freely available through polycarbonate water bottles. At the end of the experiment, all surviving animals were anesthetized and then euthanized. The right eyeballs were enucleated, the first half of the eyeballs in each group were punctured at the center of the cornea, and fixed in 10% neutral buffered formalin solution. The retinas (including choroid) of the second half of the right eyeballs in each group were collected, placed in microtubes labeled with animal identification numbers, and stored in a freezer maintained at a temperature lower than -70 °C.

[0257] 2. Sodium iodate-induced retinal neurodegenerative disease rabbit model.

[0258] On the first induction day (day 0), sodium iodate (Sigma-Aldrich Co.) solution was intravenously injected once into the animals designated to induce degenerative eye diseases at a dose of 5 mg / kg. On the second induction day (day 14), according to the test group settings, sodium iodate solution was intravenously injected once at a dose of 30 mg / kg or 60 mg / kg. Generally, retinal degeneration research is conducted using a 25 - 30 mg / kg sodium iodate solution. However, in order to test whether DX2 is effective in neuron survival even in situations where the optic nerve is destroyed and complete vision loss occurs, a very high dose of sodium iodate solution (60 mg / kg) was used to induce retinal degeneration. The test substance was injected once on the administration day (day 5). In the case of intravitreal injection, the animals were anesthetized and the test substance was intravitreally injected into the right eyeball using a syringe equipped with a 31-gauge needle. In the case of subretinal injection, the animals were anesthetized and the test substance was injected subretinally into the right eyeball using a syringe equipped with a 31-gauge needle through the sclera.

[0259] The test groups were set up according to Table 3 below. [Table 3]

[0260] 3. Fundus photography

[0261] Before inducing degenerative eye diseases and before the end of the experiment, after applying eye drops (Mydriacyl oph soln, 1%) to both eyes, the animals were anesthetized and fundus images were taken using a fundus camera (TRC-50IX, TOPCON, Japan). The degenerated area of the retinal pigment epithelium (RPE) in the fundus images was analyzed using Image J (NIH, Bethesda, MD). Degenerated area (%) = Degenerated area / Total area.

[0262] 4. Electrophysiological function evaluation

[0263] Before the end of the experiment, the right eyes of all surviving animals were subjected to electroretinogram (ERG). After anesthetizing the animals, they were adapted in a dark room for 60 minutes, and ERG measurements were performed using an ERG device (HMs-ERG, Ocuscience, USA). ERG was measured using a flashlight in a dark room and evaluated by comparing the amplitudes of the A-wave and B-wave with those of normal controls.

[0264] 5. Histopathological examination

[0265] The fixed eye tissues were subjected to general tissue processing such as cutting, dehydration, paraffin embedding, and sectioning to prepare specimens for histopathological examination. Then, hematoxylin and eosin staining were performed, and the thickness of the retinal pigment epithelium (RPE), the outer segments of photoreceptors, the outer nuclear layer, the outer plexiform layer, and the entire retina was measured using an optical microscope (Olympus BX53, Japan).

[0266] 6. Expression of DX2 by RT-PCR

[0267] Total RNA was isolated from the retinas (including choroids) of rabbits using the RNA isolation Geneall hybrid-R Kit (GeneAll Biotechnology Co., Ltd., Korea), and reverse transcription was performed using a cDNA synthesis kit (Toyobo, Japan). Subsequently, the complementary DNA was used for real-time PCR using qPCRBIO SyGreen Blue Mix (PCR Biosystems Ltd., UK). Amplification, detection, and data analysis were performed using CFX96 touch (BioRad, USA).

[0268] 7. Statistical analysis

[0269] The results of this study were assumed to be normally distributed and analyzed by parametric or non-parametric multiple comparison methods. When the results of one-way analysis of variance (ANOVA) were significant, Dunnett's multiple comparison method was used as a post-hoc analysis.

[0270] Statistical analysis was performed using Prism 7.04 (GraphPad Software Inc., San Diego, CA, USA), and statistical significance was set at a P-value of less than 0.05. (Example 12) AAV2-DX2 shows the preventive efficacy of DX2 in a laser-induced choroidal neovascularization (CNV) rabbit model.

[0271] Laser-induced choroidal neovascularization (CNV) was performed using 15 male chinchilla rabbits to establish a retinal degenerative disease (RDD) rabbit model. As shown in Figure 22A, as a result of choroidal neovascularization (CNV) area analysis, the fluorescein intensity levels G3 (SR), G4 (IVT), and positive control (G5) were significantly decreased compared to G2 at 14, 21, and 28 days after CNV induction (p < 0.001, p < 0.01, or p < 0.05).

[0272] Figure 22B shows the analysis of the CNV area using isolectin B4 staining. The CNV area levels of the values in the groups treated with all test substances (G3, G4) and the positive control group (G5) tended to decrease, but did not reach statistical significance. (Example 13) AAV2-DX2 did not induce histopathological abnormalities or neoplastic patterns in systemic organs.

[0273] To test the potential toxicity of any tumorigenicity of AAV2-DX2, a systemic histopathological analysis was performed. As summarized in Table 4, the animals administered with AAV2-DX2 did not show histopathological abnormalities or neoplastic patterns in the kidneys, liver, spleen, brain, lymph nodes, lungs, etc. Survival was not affected compared to the control (G1) group.

Table 4-1

Table 4-2

[0274] To observe the biodistribution pattern of DX2 using the miR-3P T VECTOR system, the animals were sacrificed and qPCR was used to analyze the expression of DX2 in the thymus, liver, testis, brain, spleen, kidney, heart, stomach, mesenteric lymph nodes, spinal cord, pancreas, and lungs (Figures 23B - 23M). It was confirmed by qPCR analysis that the expression of DX2 was observed only in the injected tissue area (Figure 23A).

[0275] Materials and Methods

[0276] 1. Animal experiments (rabbits)

[0277] Fifteen male chinchilla rabbits (about 13 weeks old, 2.5 - 3.0 kg, Dream Bio Co., Ltd.) were used for in vivo experiments. Environmental control was set to maintain the following conditions: a temperature range of 23 ± 3°C, a relative humidity range of 55 ± 15%, ventilation of 10 - 20 air exchanges / hour, a light intensity of 150 - 300 Lux, and a 12-hour light / 12-hour dark cycle. The animals were allowed free access to experimental animal feed manufactured by Cargill Agri Purina Inc. and purchased from Dream Bio. Also, water was provided freely through polycarbonate water bottles. At the end of the experiment, all surviving animals were anesthetized and then euthanized. The right eyeballs were enucleated, the first half of the eyeballs in each group were punctured at the center of the cornea, and fixed in 10% neutral buffered formalin solution. The retina (including choroid) of the right eyeballs of the second half of each group was collected, placed in microtubes labeled with animal identification numbers, and stored in a freezer maintained at a temperature lower than -70°C. For intravitreal injection, the animals were anesthetized, and the test substance was injected intravitreally into the right eyeballs using a syringe equipped with a 31-gauge needle.

[0278] For subretinal injection, the animals were anesthetized, and the test substance was injected intravitreally into the right eyeballs through the sclera using a syringe equipped with a 31-gauge needle. After the rabbits were anesthetized, systemic perfusion was performed on the rabbits in G1 and the rabbits labeled with the above-mentioned numbers in each group using sterile saline, and the following organs were excised and stored in a freezer set at a temperature lower than -70°C before analysis.

[0279] Excised organs: brain, testis, kidney, liver, lung, spinal cord, spleen, stomach, heart, thymus, pancreas, lymph nodes, and retina / choroid of the right eye (both eyes of G1).

[0280] At the end of the experiment, the rabbits labeled with subsequent numbers were anesthetized and then euthanized. After that, the right eyeballs were enucleated, the center of the cornea was punctured with a needle, and fixed in 10% neutral buffered formalin. The following organs were excised and fixed.

[0281] Excised organs: brain, testis, kidney, liver, lung, spinal cord, spleen, stomach, heart, thymus, pancreas, and lymph nodes.

[0282] The test groups were set up according to Table 5 below.

Table 5

[0283] Laser-induced CNV model protocol for rabbits

[0284] After applying eye drops (Mydriacyl oph soln, 1%) to the right eye of the rabbit, the animal was anesthetized. The eye was irradiated with a laser (Elite, Lumenis, USA) at 532 nm, an output of 150 mW, and a time of 0.1 second, and then six spots were generated at approximately 6 o'clock on the optic nerve.

[0285] Fluorescein angiography

[0286] After applying eye drops (Mydriacyl oph soln, 1%) to the right eye, the animal was anesthetized on days 0, 7, 14, 21, and 28. Then, 1 mL of fluorescein sodium salt solution (2%) was injected intravenously, and photographs were taken within 2 minutes using a fundus camera (TRC-50IX, TOPCON, Japan).

[0287] The evaluation of the retinal CNV area and efficacy was performed using fundus fluorescein photography. Image analysis was performed using ImageJ software (NIH, Bethesda, MD) to verify the fluorescence intensity at the irradiation site.

[0288] The fluorescein intensity (%) was calculated as follows:

[0289] Fluorescein intensity (%) = (fluorescein intensity value - average of background values (G1) 1) ) / average of fluorescein intensity values of G2

[0290] The fluorescein intensity of the retina without CNV spots was measured and used as the background value.

[0291] Pathological histological analysis

[0292] The fixed tissues were subjected to general tissue processing such as cutting, dehydration, paraffin embedding, and sectioning to prepare specimens for pathological histological examination. After that, hematoxylin and eosin staining were performed, and pathological histological changes were observed using an optical microscope (Olympus BX53, Japan). To analyze the CNV region, the eye tissues were fixed and isolectin B4 staining was performed using the choroid flat mount method.

[0293] Expression of DX2 by RT-PCR

[0294] Total RNA was isolated from rabbit eye tissues and each organ using the RNA isolation Geneall hybrid-R Kit (GeneAll Biotechnology Co., Ltd., Korea), and reverse transcription was performed using a cDNA synthesis kit (Toyobo, Japan).

[0295] Subsequently, the complementary DNA was used for real-time PCR using qPCRBIO SyGreen Blue Mix (PCR Biosystems Ltd., UK). Amplification, detection, and data analysis were performed using CFX96 touch (BioRad, USA). RT-PCR analysis of the target gene was performed using the excised organs and eye tissues to confirm the expression level of the target gene compared with GAPDH expression.

[0296] Regarding the results of this study, the normality of the data was assumed, and parametric one-way ANOVA was used to verify the significance between the test groups. When significant, a post hoc test was performed using Dunnett's multiple comparison test. Statistical analysis was performed using Prism 7.04 (GraphPad Software Inc., San Diego, CA, USA), and it was determined that the result was statistically significant when the p-value was less than 0.05.

[0297] Conclusion

[0298] In this study, the following were demonstrated: (1) the survival effect of DX2 against retinal degeneration; (2) the use of DX2 as a treatment for retinal degenerative diseases; the anti-apoptotic effect of DX2 delivered by adeno-associated virus (AAV) to the retinas of mice and rabbits by subretinal (SR) and intravitreal (IV) injection. Therefore, the efficacy of gene therapy using the survival gene DX2 as a potential option for the treatment of retinal degenerative diseases was also confirmed.

[0299] References

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

[0300] The foregoing description of specific embodiments is sufficient to disclose the general nature of the present invention, so that others can, without departing from the general concept of the present invention, readily modify and / or adapt it for various applications by applying knowledge within the scope of the relevant art. Accordingly, such modifications and adaptations are intended to be within the meaning and scope of the equivalents of the disclosed embodiments based on the teachings and guidance presented herein. It should be understood that the terms or phrases of this specification are for the purpose of explanation and not for limitation, and should be construed by those skilled in the art in light of the teachings and guidance of this specification.

[0301] The breadth and scope of the present invention should not be limited by any of the above exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

[0302] All of the various aspects, embodiments, and alternatives described in this specification can be combined in any and all variations.

[0303] All publications, patents, and patent applications mentioned in this specification are hereby incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

Claims

Claim 1 A method for treating a retinal degenerative disease in a subject in need of treating a retinal degenerative disease, the method comprising administering to the subject a pharmaceutically effective amount of a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene. Claim 2 The method according to claim 1, wherein the retinal degenerative disease is retinitis pigmentosa, Leber congenital amaurosis, cone-rod dystrophy, glaucoma, or diabetic retinopathy. Claim 3 The method according to claim 1 or 2, wherein the retinal degenerative disease precedes or is associated with Parkinson's disease, Alzheimer's disease, or amyotrophic lateral sclerosis. Claim 4 The method according to any one of claims 1 to 3, wherein the retinal degenerative disease is not an age-related macular disease. Claim 5 The method according to any one of claims 1 to 4, wherein the vector further comprises an miR-142 target sequence. Claim 6 The method according to any one of claims 1 to 5, wherein the vector further comprises a promoter operably linked to the AIMP2-DX2. Claim 7 The method according to claim 6, wherein the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-actin promoter, a CAG promoter, an RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, an Hb9 promoter, or an opsin promoter. Claim 8 The method according to any one of claims 5 to 7, wherein the miR-142 target sequence is located 3' to the AIMP2-DX2 gene. Claim 9 The method according to any one of claims 1 to 8, wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20. Claim 10 The method according to claim 9, wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20. Claim 11 The method according to any one of claims 1 to 10, wherein the AIM2-DX2 gene does not have an exon containing a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11.

12. The method according to any one of claims 1 to 11, wherein the AIM2-DX2 gene does not have an exon containing a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10 or 11.

13. The method according to any one of claims 5 to 12, wherein the miR-142 target sequence contains ACACA.

14. The method according to claims 5 to 12, wherein the miR-142 target sequence contains ACACA and 1 to 17 additional consecutive nucleotides of SEQ ID NO:

5.

15. The method according to any one of claims 5 to 12, wherein the miR-142 target sequence contains a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA).

16. The method according to claim 15, wherein the miR-142 target sequence contains the nucleotide sequence of SEQ ID NO:

5.

17. The method according to any one of claims 5 to 12, wherein the miR-142 target sequence contains ACTTT.

18. The method according to claims 5 to 12, wherein the miR-142 target sequence contains ACTTT and 1 to 15 additional consecutive nucleotides of SEQ ID NO:

7.

19. The method according to any one of claims 5 to 12, wherein the miR-142 target sequence contains a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG).

20. The method according to claim 19, wherein the miR-142 target sequence contains the nucleotide sequence of SEQ ID NO:

7.

21. The method according to any one of claims 5 to 20, wherein the miR-142 target sequence is repeated 2 to 10 times.

22. The method according to any one of claims 1 to 21, wherein the vector is a viral vector.

23. The method according to claim 22, wherein the viral vector is an adenovirus, an adeno-associated virus, a lentivirus, a retrovirus, a human immunodeficiency virus (HIV), a murine leukemia virus (MLV), an avian sarcoma / leukosis (ASLV), a spleen necrosis virus (SNV), a Rous sarcoma virus (RSV), a murine mammary tumor virus (MMTV), a vaccinia virus, or a herpes simplex virus vector.

24. The method according to any one of claims 1 to 23, wherein the recombinant vector is administered locally to the subject by intravitreal injection, by subconjunctival injection, or into the subretinal space of the subject.

25. The method according to any one of claims 1 to 24, further comprising administering an additional therapeutic agent to the subject.

26. The method according to claim 25, wherein the additional therapeutic agent is ranibizumab, aflibercept, or bevacizumab.

Citation Information

Patent Citations

  • Methods and compositions for integration of an exogenous sequence within the genome of plants

    KR1020150140723A

  • Pharmaceutical composition comprising AIMP2-DX2 for preventing or treating neuronal diseases and use thereof

    US20190298858A1