A drug delivery system comprising an agent effective for treating or preventing esophageal diseases applied to the esophageal mucosa

The drug delivery system for esophageal diseases uses a sheet-like formulation with a release mechanism and trigger mechanism to achieve controlled release of active ingredients along the esophagus, addressing challenges of low drug concentration and side effects, and enhancing treatment efficacy.

JP2025519490APending Publication Date: 2025-06-26ESOCAP AG
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2024572085
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-14
Filing Date
2023-06-02
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Current drug delivery systems for treating esophageal diseases, such as Barrett's esophagus and esophageal cancer, face challenges in achieving high local concentrations of drugs due to degradation, dilution, poor absorption, and short residence time at the treatment site.

Method used

A drug delivery system comprising a sheet-like formulation with a release mechanism and a trigger mechanism, applied to the esophageal mucosa, which allows for controlled release of the active ingredient as it moves along the esophagus, enhancing local efficacy and reducing systemic side effects.

Benefits of technology

The system enables effective treatment of esophageal diseases with enhanced local efficacy, allowing for lower doses of active ingredients, reduced systemic bioavailability, and minimized side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025519490000001_ABST
    Figure 2025519490000001_ABST
Patent Text Reader

Abstract

The present invention relates to a drug delivery system for application to the esophageal mucosa, which includes at least one sheet-like, particularly film-shaped, foil-shaped, or oblate-shaped formulation, a release mechanism, and a trigger mechanism, the formulation containing an agent effective for the treatment or prevention of esophageal diseases, and the trigger mechanism being adapted to cause release by the release mechanism of the sheet-like formulation at a predetermined site of action.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention specifically relates to a drug delivery system containing an agent effective for the treatment or prevention of esophageal diseases, for application to lumens including but not limited to the esophageal mucosa, and for the treatment of esophageal diseases, particularly Barrett's esophagus, esophageal stricture, and / or esophageal cancer.

Background Art

[0002] Examples of esophageal diseases include Barrett's esophagus or Barrett's disease. Barrett's esophagus (BE) is a premalignant condition characterized by the presence of intestinal metaplasia in which specialized columnar epithelium with scattered goblet cells, which normally exist only in the small intestine and large intestine, replaces normal squamous epithelium in the distal esophagus. The cells of Barrett's esophagus are classified into four categories: non-dysplastic (metaplasia), low-grade dysplasia, high-grade dysplasia, and adenocarcinoma. High-grade dysplasia and early adenocarcinoma can be treated by endoscopic mucosal resection, endoscopic submucosal dissection, radiofrequency ablation, or cryoablation necrosis therapy. Advanced adenocarcinoma can be treated by surgical resection or palliation. Persons with non-dysplastic mucosa are managed by annual endoscopic observation. The new guidelines of the 2022 edition of the American College of Gastroenterology recommend endoscopic radical therapy for patients with BE and high-grade dysplasia, as well as for patients with BE and low-grade dysplasia. The European Society of Gastrointestinal Endoscopy recommends endoscopic eradication for persistent (more than 6 months) low-grade dysplasia. In high-grade dysplasia, the risk of developing esophageal cancer is approximately 28% or more per person-year of observation (Non-Patent Document 1).

[0003] Esophageal cancer is the sixth most common cancer in the world, with an estimated 450,000 deaths annually. Esophageal cancer is histologically classified into two types: squamous cell carcinoma and adenocarcinoma. Esophageal squamous cell carcinoma is more common in countries in East Asia and the Middle East, such as China, Iran, and Turkmenistan, while adenocarcinoma is more prevalent in Western European countries. The prevalence of adenocarcinoma has increased over the past few decades, while the proportion of squamous cell carcinoma has remained stable. Esophageal squamous cell carcinoma (ESCC) is counted among the most lethal forms of human malignancies, characterized by late diagnosis, metastasis, treatment resistance, and frequent recurrence.

[0004] Targeted drug delivery to the gastrointestinal tract, particularly to the esophageal lumen, is usually carried out by submucosal application guided by endoscopy. The local application of active ingredients is accompanied by drug-coated esophageal stents or oral viscous drugs. Currently under research are orally dispersible or orally disintegrating tablets, aerosols, or gel-like drugs with high viscosity to increase the contact time.

[0005] However, the local application of active ingredients to the membranes of the gastrointestinal tract, particularly the esophagus, has several challenges. For example, it is very difficult to locally apply high doses of drugs over a sufficient period to achieve a therapeutically effective local concentration. Possible causes for the concentration at the treatment site being too low include the degradation or activation of the drug by digestive secretions and enzymes, the dilution effect by intestinal fluids, poor absorption, prodrugs that require activation that is not possible at the treatment site, and the residence time at the site of action being too short to effectively express the drug action. When using liquid or gel-like drug delivery systems, the short residence time and / or too low local concentration at the site of action are particularly problematic. Therefore, high doses must be administered to achieve a sufficient concentration at the treatment site. Usually, administering the active ingredient at a higher dose is associated with an increase in side effects due to intestinal absorption and higher bioavailability. Therefore, the dose of the active ingredient should be kept as low as possible.

[0006] BMP2 / 4 inhibitors are known to be efficient in the treatment of Barrett's esophagus and are thus effective in preventing esophageal adenocarcinoma. Patent Document 1 discloses several BMP2 / 4 inhibitors such as extracellular molecules that bind to BMP and inhibit or enhance BMP activity, microRNAs that interfere with intracellular signaling of BMP2 / 4, SMAD inhibitors, and protein phosphatases. Furthermore, Non-Patent Document 2 describes small interfering RNAs (siRNAs) against BMP-2. Non-Patent Document 2 discloses several BMP2 / 4 inhibitors including isolated, synthetic, or recombinant antibodies that efficiently inhibit BMP2 and BMP4 signaling. By effectively inhibiting this signaling, normal tissue covering the esophagus is reconstructed, which is effective for the treatment of Barrett's esophagus to prevent esophageal adenocarcinoma. Although these inhibitors are extremely effective, state-of-the-art liquid or gel-like drug delivery systems still show low concentrations at the treatment site.

[0007] PD-1 (programmed cell death protein 1) is an immunosuppressive receptor that is mainly expressed on activated T cells and B cells. It has been shown both in vitro and in vivo that the interaction with its ligand attenuates the T cell response. Blocking the interaction between PD-1 and PD-L1, one of its ligands, has been found to enhance tumor-specific CD8+ T cell immunity and thus can contribute to the elimination of tumor cells by the immune system. The role of PD-1 in cancer has been established in the literature. The tumor microenvironment is known to be able to protect tumor cells from efficient immune destruction. PD-L1 has been found to be expressed in several mouse and human tumors (and is also induced by IFN gamma in the majority of PD-L1-negative tumor cell lines) and is hypothesized to mediate immune evasion (Non-Patent Document 3; Non-Patent Document 4). Blocking the PD-1 / PD-L1 interaction can result in enhanced tumor-specific T cell immunity and thus can contribute to the elimination of tumor cells by the immune system and the development of cancer immunotherapy.

[0008] Pembrolizumab is a humanized monoclonal antibody that targets PD-1 and thereby blocks the interaction of PD-1 with its ligands PD-L1 and PD-L2. Pembrolizumab is approved for the treatment of melanoma, Hodgkin lymphoma, lung cancer, head and neck cancer, gastric cancer, urothelial cancer, cervical cancer, and breast cancer. More recently, pembrolizumab has been approved for the treatment as first-line therapy for advanced or metastatic esophageal cancer in combination with chemotherapy. Pembrolizumab is administered parenterally by injection to achieve systemic exposure and is associated with serious adverse effects such as inflammation due to autoimmune reactions. Antibodies against PD-1 are promising targets for local / regional delivery, particularly to the esophageal mucosa, and can reduce adverse effects.

[0009] Paclitaxel belongs to the group of taxanes and is a chemotherapeutic agent currently used in the treatment of various cancers including ovarian cancer, esophageal cancer, breast cancer, lung cancer, Kaposi's sarcoma, cervical cancer, and pancreatic cancer. Since paclitaxel has low oral bioavailability, it is usually administered systemically by intravenous injection, and its administration is associated with serious side effects such as hair loss, heart problems, myelosuppression, paralysis, allergic reactions, increased risk of infections, muscle pain, and diarrhea. Therefore, chemotherapeutic agents are promising targets for local / regional delivery, particularly to the esophageal mucosa, and can reduce the toxicity of chemotherapy.

[0010] There remains a need for an appropriate drug delivery system for delivering an agent effective for the treatment or prevention of esophageal diseases for effective treatment while reducing side effects by enabling administration at the lowest possible dose and / or delivery of a stable polynucleotide or polypeptide, particularly for delivery to the esophagus.

Prior Art Documents

Patent Documents

[0011]

Patent Document 1

Patent Document 2

Non-Patent Literature

[0012]

Non-Patent Literature 1

Non-Patent Literature 2

Non-Patent Literature 3

Non-Patent Literature 4

Summary of the Invention

Problems to be Solved by the Invention

[0013] One object of the present invention is to provide a drug delivery system that enables oral / local administration of an agent effective for the treatment or prevention of esophageal diseases used for the treatment of esophageal diseases having enhanced local efficacy.

[0014] A further object of the present invention is to provide a delivery system that enables the application of stable polynucleotides and polypeptides.

[0015] A further object of the present invention is to provide a delivery system that enables the application of an agent effective for the treatment or prevention of esophageal diseases such as Barrett's esophagus or esophageal cancer, for example, adenocarcinoma, esophageal junction cancer, or squamous cell carcinoma, at a low dose, thereby minimizing potential side effects.

[0016] The object of the present invention is achieved by the subject matter of the independent claims. Preferred embodiments are the subject of the dependent claims. **Means for Solving the Problems**

[0017] The present invention is a drug delivery system for application to the esophageal mucosa, comprising at least one sheet-like, particularly film-shaped, foil-shaped, or oblate-shaped formulation containing a pharmaceutically active ingredient, a release mechanism, and a trigger mechanism wherein the trigger mechanism is adapted to cause release by the release mechanism of the formulation at a predetermined site of action, and the release mechanism is adapted to release the formulation while moving along the esophageal mucosa, the drug delivery system further comprises a shell that houses the formulation, the shell includes an opening configured as part of the release mechanism for the formulation to exit the shell, and the trigger mechanism is a holding device that is part of the formulation or attached to the formulation, such that the formulation opens or spreads as the dosage form descends along the esophageal mucosa and exits through the opening from the shell, characterized in that the pharmaceutically active ingredient contains, preferably in combination with one or more additional pharmaceutically active ingredients, an agent effective for the treatment or prevention of esophageal diseases. A drug delivery system is provided.

[0018] In one embodiment, the agent effective for the treatment or prevention of esophageal diseases comprises or consists of an inhibitory polynucleotide, preferably an inhibitory polynucleotide combined with a nucleic acid delivery system, an antibody, or an anti-proliferative agent.

[0019] In one embodiment, the inhibitory polynucleotide is selected from the group consisting of siRNA molecules, antisense oligonucleotides, and aptamers.

[0020] In one embodiment, the inhibitory polynucleotide comprises or consists of an siRNA molecule or an antisense oligonucleotide and targets an RNA transcript encoding a BMP2 and / or BMP4 polypeptide, preferably the BMP2 and / or BMP4 polypeptide shown in SEQ ID NO: 15 or SEQ ID NO: 16, or a portion thereof, or the inhibitory polynucleotide comprises an aptamer that interferes with the activity of a BMP2 or BMP4 polypeptide, preferably the BMP2 or BMP4 polypeptide shown in SEQ ID NO: 15 or SEQ ID NO: 16.

[0021] In one embodiment, the inhibitory polynucleotide comprises or consists of an siRNA molecule or an antisense oligonucleotide and targets the RNA transcript shown in SEQ ID NO: 20 or SEQ ID NO: 21 or a portion thereof.

[0022] In one embodiment, the siRNA molecule comprises or consists of a double-stranded region comprising the sequence shown in SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19, preferably SEQ ID NO: 18, or any other sequence having at least 80% sequence identity between the siRNA molecule and the target RNA transcript or a portion thereof, and preferably the target RNA transcript or a portion thereof encodes a BMP2 and / or BMP4 polypeptide, preferably the BMP2 and / or BMP4 polypeptide shown in SEQ ID NO: 15 or SEQ ID NO: 16.

[0023] In one embodiment, the siRNA molecule comprises or consists of a double-stranded region, the double-stranded region comprising a sense strand and an antisense strand, the sense strand and the antisense strand together forming the double-stranded region, and the antisense strand being complementary to a target RNA transcript shown in SEQ ID NO: 20 or SEQ ID NO: 21 or a portion thereof. In one embodiment, the siRNA molecule does not contain overhangs. In another embodiment, the siRNA molecule contains overhangs of one or more nucleotides.

[0024] In one embodiment, the siRNA molecule comprises or consists of a double-stranded region having a length of 15 to 30 base pairs, preferably 19 to 25 base pairs.

[0025] In one embodiment, the siRNA molecule comprises or consists of BMP2-siRNA 1, BMP2-siRNA 2, or BMP2-siRNA 3 shown in the following table, preferably BMP2-siRNA 2, and each of the sequences in the following table contains overhangs of 2 nucleotides dTdT (deoxythymidine) or UU (uridine) attached to the 3'-end of each strand.

[0026] JPEG2025519490000002.jpg56153

[0027] In one embodiment, the nucleic acid delivery system is selected from the group consisting of liposomes, lipid bilayers, micelles, emulsions, cationic polymers, and nanoparticles, preferably lipid nanoparticles or polymer nanoparticles.

[0028] In one embodiment, the antibody or its binding fragment is an isolated or recombinant or synthetic antibody or its binding fragment.

[0029] In one embodiment, the antibody or its binding fragment is a) residues 10-17, 45-56, and 69 of BMP4 (SEQ ID NO: 1) b) residues 24 - 31, 57 - 68, 70 - 72, 89, 91, 101, 103, 104, and 106 of BMP4 (SEQ ID NO: 1), or c) residues 34, 35, 39, 86 - 88, 90, 97, 98, 100, 102, and 109 of BMP4 (SEQ ID NO: 1) within an epitope consisting of, preferably binding to the epitope, preferably, the binding of the antibody or its fragment is determined by epitope binning (surface plasmon resonance (SPR) sandwich cross - linking) and / or HADDOCK modeling.

[0030] In one embodiment, an antibody or its binding fragment that binds within residues 10 - 17, 45 - 56, and 69 of BMP4 specifically binds to at least Lys12, Arg15, Asp46, and Pro50 of BMP4 (SEQ ID NO: 1), or an antibody or its binding fragment that binds within residues 24 - 31, 57 - 68, 70 - 72, 89, 91, 101, 103, 104, and 106 of BMP4 specifically binds to at least Asp30, Trp31, Leu66, and Lys101 of BMP4 (SEQ ID NO: 1), or an antibody or its binding fragment that binds within residues 34, 35, 39, 86 - 88, 90, 97, 98, 100, 102, and 109 of BMP4 specifically binds to at least Ala34, Gln39, Ser88, Leu90, and Leu100 of BMP4 (SEQ ID NO: 1), preferably, the specific binding of the antibody or its fragment is determined by epitope binning (surface plasmon resonance (SPR) sandwich cross - linking) and / or HADDOCK modeling.

[0031] In one embodiment, an antibody or a binding fragment thereof that binds to at least Lys12, Arg15, Asp46, and Pro50 of BMP4 comprises a heavy-chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 2 or a sequence that differs by no more than one amino acid therefrom, a heavy-chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 3 or a sequence that differs by no more than one amino acid therefrom, and a heavy-chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 4 or a sequence that differs by no more than one amino acid therefrom, or In one embodiment, an antibody or a binding fragment thereof that binds to at least Asp30, Trp31, Leu66, and Lys101 of BMP4 comprises a heavy-chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 5 or a sequence that differs by no more than one amino acid therefrom, a heavy-chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 6 or a sequence that differs by no more than one amino acid therefrom, and a heavy-chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 7 or a sequence that differs by no more than one amino acid therefrom, or In one embodiment, an antibody or a binding fragment thereof that binds to at least Ala34, Gln39, Ser88, Leu90, and Leu100 of BMP4 comprises a heavy-chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 8 or a sequence that differs by no more than one amino acid therefrom, a heavy-chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 9 or a sequence that differs by no more than one amino acid therefrom, and a heavy-chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 10 or a sequence that differs by no more than one amino acid therefrom.

[0032] In one embodiment, an antibody or a binding fragment thereof that binds to at least Lys12, Arg15, Asp46, and Pro50 of BMP4 comprises the amino acid sequence of SEQ ID NO: 11 or a sequence that is at least 70%, preferably 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or In one embodiment, an antibody or a binding fragment thereof that binds to at least Asp30, Trp31, Leu66, and Lys101 of BMP4 comprises the amino acid sequence of SEQ ID NO: 12 or a sequence that is at least 70%, preferably 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or Antibodies or binding fragments thereof that bind to at least Ala34, Gln39, Ser88, Leu90, and Leu100 of BMP4 include an amino acid sequence of SEQ ID NO: 13 or a sequence that is at least 70%, preferably 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto.

[0033] In one embodiment, the antibody or binding fragment thereof is a single-chain antibody.

[0034] In one embodiment, the pharmaceutically active ingredient comprises two different antibodies or binding fragments thereof.

[0035] In one embodiment, the antibody or antibody fragment binds to PD-1, preferably human PD-1.

[0036] In one embodiment, the antibody or antibody fragment that binds to PD-1, preferably human PD-1, a. at least one CDR (complementary determining region) selected from the group consisting of SEQ ID NOs: 30, 31, 32, 36, 37, and 38, or a variant of any of the foregoing sequences, and / or b. at least one CDR selected from the group consisting of SEQ ID NOs: 33, 34, 35, 39, 40, and 41, or a variant of any of the foregoing sequences is included.

[0037] In one embodiment, the antibody or antibody fragment that binds to PD-1, preferably human PD-1, a. light chain CDR SEQ ID NOs: 30, 31, and 32, or a variant of any of the foregoing sequences, and / or heavy chain CDR SEQ ID NOs: 33, 34, and 35, or a variant of any of the foregoing sequences, or b. light chain CDR SEQ ID NOs: 36, 37, and 38, or a variant of any of the foregoing sequences, and / or heavy chain CDR SEQ ID NOs: 39, 40, and 41, or a variant of any of the foregoing sequences is included.

[0038] In one embodiment, an antibody or antibody fragment that binds to PD-1, preferably human PD-1, is a. i. The amino acid sequence of SEQ ID NO: 26 or a variant thereof, ii. The amino acid sequence of SEQ ID NO: 28 or a variant thereof, iii. Amino acid residues 20-139 of SEQ ID NO: 42 or a variant thereof, and iv. An amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% sequence identity to amino acid residues 20-139 of SEQ ID NO: 42 and comprises a heavy chain variable region selected from the group consisting of and further, b. i. The amino acid sequence of SEQ ID NO: 27 or a variant thereof, ii. The amino acid sequence of SEQ ID NO: 29 or a variant thereof, iii. Amino acid residues 20-130 of SEQ ID NO: 44 or a variant thereof, iv. Amino acid residues 20-130 of SEQ ID NO: 45 or a variant thereof, v. Amino acid residues 20-130 of SEQ ID NO: 46 or a variant thereof, and vi. An amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% sequence identity to amino acid residues 20-130 of SEQ ID NO: 44, 45, or 46 and comprises a light chain variable region selected from the group consisting of and contains.

[0039] In one embodiment, an antibody or antibody fragment that binds to PD-1, preferably human PD-1, is a. i. Amino acid residues 20-466 of SEQ ID NO: 43 or a variant thereof, and ii. Amino acid residues 20-469 of SEQ ID NO: 47 or a variant thereof and comprises a heavy chain selected from the group consisting of, and b. i. Amino acid residues 20-237 of SEQ ID NO: 48 or a variant thereof, ii. The amino acid residues 20 to 237 of SEQ ID NO: 49 or a variant thereof, and iii. The amino acid residues 20 to 237 of SEQ ID NO: 50 or a variant thereof A light chain comprising an amino acid sequence selected from the group consisting of is included.

[0040] In one embodiment, the antibody or antibody fragment binds to PD-1, and the antibody or antibody fragment a. Binds to human PD-1 with a KD of about 100 pM or less, b. Binds to human PD-1 with a KD of about 30 pM or less, c. Binds to human PD-1 with a KD substantially the same as that of an antibody having a heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a light chain comprising the amino acid sequence of SEQ ID NO: 44, d. Binds to human PD-1 with a KD substantially the same as that of an antibody having a heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a light chain comprising the amino acid sequence of SEQ ID NO: 45, e. Binds to human PD-1 with a k 5 of about 7.5×10 assoc 1 / M·s or more, f. Binds to human PD-1 with a k 6 of about 1×10 assoc 1 / M·s or more, g. Binds to human PD-1 with a k -5 of about 2×10 dissoc 1 / s or less, h. Binds to human PD-1 with a k -5 of about 2.7×10 dissoc 1 / s or less, i. Binds to human PD-1 with a k -5 of about 3×10 dissoc 1 / s or less, and / or j. Blocks the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC 50 of about 1 nM or less.

[0041] In one embodiment, the anti-proliferative agent is selected from the group consisting of taxanes, pyrimidine analogs, and platinum-based agents.

[0042] In one embodiment, the anti-proliferative agent is a taxane selected from the group consisting of paclitaxel ((2α,4α,5β,7β,10β,13α)-4,10-bis(acetyloxy)-13-{[(2R,3S)-3-(benzoylamino)-2-hydroxy-3-phenylpropanoyl]oxy}-1,7-dihydroxy-9-oxo-5,20-epoxytaxa-11-en-2-yl-benzoate), docetaxel ((2R,3S)-4-acetoxy-2α-benzyloxy-13-[3-(N-tert-butoxycarbonyl)amino-2-hydroxy-3-phenyl]propionyl-5β,20-epoxy-1,7β,10β-trihydroxy-9-oxotaxa-11-en-13α-yl ester; Taxotere (registered trademark)), and cabazitaxel (Jevanta (registered trademark)), and is preferably paclitaxel.

[0043] In one embodiment, the anti-proliferative agent is a pyrimidine analog, and the pyrimidine analog is a uracil analog, preferably 5-fluorouracil or capecitabine.

[0044] In one embodiment, the anti-proliferative agent is a platinum-based agent, and the platinum-based agent is selected from the group consisting of cisplatin ((SP-4-2)-diamminedichloroplatinum(II); DDP) or a salt thereof, carboplatin (diammineplatinum(II)-cyclobutane-1,1-dicarboxylato) or a salt thereof, nedaplatin (Aqupla (registered trademark)) or a salt thereof, and oxaliplatin (Pt-(oxalato)-trans-l-diaminocyclohexane) or a salt thereof. The platinum-based agent may be further selected from the group consisting of triplatin tetranitrate (BBR3464) or a salt thereof, phenanthriplatin (cis-[Pt(NH3)2-(phenanthridine)Cl]NO3) or a salt thereof, picoplatin or a salt thereof, and satraplatin ((OC-6-43)-bis(acetato-O)ammine dichloro(cyclohexylamine)platinum; JM216) or a salt thereof.

[0045] In one embodiment, the drug delivery system according to the present invention is for use in therapy.

[0046] In one embodiment, the drug delivery system according to the present invention is used for the treatment or prevention of esophageal diseases.

[0047] In one embodiment, the drug delivery system according to the present invention is used for the treatment or prevention of esophageal diseases caused by or related to immune system defects. In one embodiment, the drug delivery system according to the present invention is used for the treatment or prevention of cancer.

[0048] In one embodiment, the drug delivery system according to the present invention is used for the treatment or prevention of esophageal diseases such as esophageal cancer.

[0049] In one embodiment, the drug delivery system according to the present invention is used for the treatment or prevention of Barrett's esophagus, esophageal stricture, and / or esophageal cancer such as adenocarcinoma, esophageal junction cancer, or squamous cell carcinoma.

[0050] In one embodiment, the drug delivery system according to the present invention is used for diagnosis, preferably the pharmaceutically active ingredient is combined with a diagnostic marker.

[0051] In one embodiment, the drug delivery system according to the present invention is used for in vitro diagnosis, preferably the pharmaceutically active ingredient is combined with a diagnostic marker.

[0052] In one embodiment, the diagnosis includes monitoring of cellular uptake of the pharmaceutically active ingredient, monitoring of the pathway of the pharmaceutically active ingredient in tissues or organs, or monitoring of the success of treatment, such as monitoring of tumor size.

Mode for Carrying Out the Invention

[0053] Unless otherwise defined specifically, all scientific and technical terms used in this specification have the same meaning as commonly understood by those skilled in the technical field to which this disclosure belongs.

[0054] Note that the use of the indefinite articles "a" or "an" means "one or more". Thus, for example, the term "an esophageal disease" includes the incorporation of "one" and "two or more" esophageal diseases.

[0055] As used herein, the terms "comprising" or "comprises" mean "including, but not limited to". This term is open-ended and is intended to specify the presence of any of the recited features, elements, integers, steps, or components, but does not preclude the addition of one or more other features, elements, integers, steps, components, or groups thereof. Thus, the terms "comprising" or "comprises" include the more restrictive terms "consisting of" and "consisting essentially of". In one embodiment, the terms "comprising" or "comprises" used throughout this application and particularly within the claims may be replaced with the terms "consisting of" or "consisting essentially of".

[0056] Drug delivery systems, including pharmaceuticals, but with different drug active ingredients and their applications, are described in the specification of PCT / EP2015 / 002601, the entire text of which is incorporated herein by reference, particularly with respect to the embodiments of Figures 8a, 8b, and 8c of the specification of PCT / EP2015 / 002601. In other words, the size, shape, and composition of the shell, the opening, the release and trigger mechanisms, and the holding device are already described in the said reference document, at least to a considerable extent.

[0057] The drug delivery system described in the specification of PCT / EP2015 / 002601 is designed to include at least one sheet-like, in particular film-shaped, foil-shaped, or oblate-shaped formulation containing a pharmaceutically active ingredient, a release mechanism, and a trigger mechanism, and the trigger mechanism is adapted to cause the release by the release mechanism of the sheet-like formulation, in particular at a predetermined site of action in the gastrointestinal tract. From the embodiments of Figures 8a, 8b, and 8c of the specification of PCT / EP2015 / 002601, it can be seen that the dosage form has an elongated strip-shaped formulation, which contains a pharmaceutically active ingredient. The formulation can be arranged in a compact state and a deployed state. The dosage form includes a capsule device having a hollow space for accommodating the miniaturized formulation, for example having a shell, the capsule device having an opening, and the first end of the formulation in the compact state extending from this opening, so that the formulation can be withdrawn from the hollow space to the surrounding area of the capsule, thereby causing the formulation to transition from the compact state to the deployed state.

[0058] The drug delivery system according to the present invention is administered orally and improves the local utility of an agent effective for the treatment or prevention of esophageal diseases contained in the formulation. This is in contrast to oral administration systems such as conventional tablets or capsules that are delivered to the treatment target site / place only by entering the blood circulation through gastrointestinal absorption.

[0059] The utility is improved locally because an agent effective for the treatment or prevention of esophageal diseases is provided in a formulation in the form of a sheet, particularly in the form of a film, foil, oblate, or elongated strip. Advantageously, this enables the sheet-like formulation (and the agent effective for the treatment or prevention of esophageal diseases present therein) to be directly released to the treatment target site / location (treatment site), for example, the esophageal mucosa. Thereby, preferably, the large area of the sheet-like formulation is exposed to the mucosa, i.e., the esophageal mucosa, particularly the lumen including but not limited to the esophageal mucosa. When exposed to the mucosa, the sheet-like formulation releases an agent effective for the treatment or prevention of esophageal diseases. Further, as a result of the preferred direct contact between the mucosa and the formulation, the agent effective for the treatment or prevention of esophageal diseases acts effectively at the treatment site. Since the agent is directly delivered to the treatment site, a small amount of the agent suffices, and as a result, the systemic bioavailability is reduced compared to the use of conventional formulations such as suspensions or solutions, and the concentration in adjacent, for example, healthy regions decreases. Further, the effective action of the agent effective for the treatment or prevention of esophageal diseases through the membrane of the absorption site of the digestive tract such as the small intestine or buccal mucosa with a large number of formed blood vessels reduces side effects. The direct delivery to the treatment site further enables the dose of the agent effective for the treatment or prevention of esophageal diseases contained in the formulation to be reduced, thereby advantageously further reducing side effects. Therefore, the drug delivery system of the present invention is particularly useful for the delivery of any agent with limited therapeutic use due to high systemic toxicity or low systemic utility due to, for example, high first-pass effect or loss / impairment of activity due to passage through the digestive tract.

[0060] The drug delivery system according to the present invention further advantageously allows for simple, particularly space-saving storage and relatively simple and straightforward handling. The agent effective for the treatment or prevention of esophageal diseases included in the drug delivery system according to the present invention has improved stability, for example, in high temperature and high humidity, compared to solutions and gels. Usually, there is no free water remaining in the drug delivery system according to the present invention, which further improves the stability of the composition and reduces the risk of, for example, mold growth in the composition or otherwise rendering it unusable. Additional additives such as preservatives or other stabilizers can be avoided, which is advantageous since such additives are known to cause allergies or further side effects.

[0061] Also, the degradation of the drug active ingredient by, for example, gastric acid and / or digestive enzymes before reaching the predetermined site of action is advantageously minimized by the drug delivery system according to the present invention.

[0062] Release mechanism The release mechanism relates to a mechanism for deploying and releasing a sheet-like formulation from a capsule device, such as a shell. The shell accommodates the sheet-like formulation in a compact form. The release mechanism releases the formulation from the shell after a trigger mechanism has initiated the release. The release of the sheet-like formulation by the release mechanism preferably occurs by at least partially pulling the formulation out of the shell. Thus, the sheet-like formulation is configured such that the sheet-like formulation can be deployed by the release mechanism to a predetermined extent. For example, the shell accommodates the formulation in a folded form, and the release mechanism deploys the formulation from a small, for example, folded form to an unfolded, for example, spread-out form. Thus, the release mechanism causes the spread of the formulation. In the compact form, the formulation has a smaller spatial extent, for example, the formulation is in a lump, coiled, or rolled, or otherwise in a smaller spatial pattern. This also enables the provision of a small dosage form, i.e., a small shell, which in particular makes the oral intake of the drug delivery system more convenient for the patient. In the unfolded form, the surface area of the sheet-like formulation increases due to the deployment of the sheet-like formulation, for example, due to spreading, and in particular, the surface area of a formulation containing an agent effective for the treatment or prevention of esophageal diseases increases. Preferably, the surface area of the formulation, in particular the surface area in contact with the esophageal mucosa and containing an agent effective for the treatment or prevention of esophageal diseases, is approximately the same as the surface area of the esophageal mucosa. The release of the formulation occurs while the shell descends along the esophageal mucosa. For example, while the patient swallows the dosage form, the formulation is released from the shell through an opening. Thus, the shell includes an opening configured as part of the release mechanism such that the formulation can exit the shell.

[0063] Opening In this regard, the opening forms an aperture in the shell, i.e., the capsule device. In a preferred embodiment of the drug delivery system, the opening is formed as a slit. The slit is arranged such that the sheet-like formulation is released from the shell through this opening. Such slits can be embodied in various arrangements and configurations. Such openings are described, for example, in European Patent No. 21175427.0, European Patent No. 21175436.1, PCT / EP2015 / 002601, and PCT / EP2020 / 056934, which are incorporated herein by reference in their entirety with respect to the capsule device and the opening.

[0064] Trigger mechanism / Holding device The drug delivery system includes a trigger mechanism that is adapted to cause the release by the release mechanism of the sheet-like formulation at a predetermined site of action. The trigger mechanism is a holding device that is part of the formulation or attached to the formulation.

[0065] Preferably, the formulation includes a holding device, and more preferably, the formulation includes a holding device at one end of the formulation, and one end, in particular, protrudes from the shell through the opening. When the holding device is fixed, the formulation can be pulled from the capsule device by a pulling movement and / or force. The fixing of the holding device is preferably obtained by connecting the holding device to a holder. Such a holder can be a cord member such as a cord, string, or ligature. In a preferred embodiment, the holding device is connected to one end of the formulation and one end of the cord, while the other end of the cord is fixed to an applicator, for example, to a holder of the applicator.

[0066] Preferably, the holding device is attached to the sheet-like formulation. Thereby, the holder, i.e., the cord member, or a part of the cord member, forms the holding device. For example, one end of the cord connected to the formulation forms the holding device.

[0067] Instead, the holding device is adapted to be fixed in the oral cavity or held by hand during administration of the drug delivery system, so that the dosage form opens and / or spreads as the formulation descends the esophageal mucosa, opening from the shell and exiting through the opening.

[0068] In a preferred embodiment, a part of the string member is connected to the end portion of the formulation protruding from the opening of the capsule device. Thereby, a holding device is formed by the protruding end portion of the formulation and the string member connected thereto, and a further part of the string member acts as a holder to hold the holding device so as not to move during swallowing of the formulation, thereby generating an attractive force acting on the formulation, and this attractive force pulls the formulation out of the capsule device while the capsule device descends the esophagus.

[0069] It should be understood that the terms "site of action" and "site of application" as used herein are used interchangeably. In this regard, it should also be understood that "site of action" and "site of application" refer to a predetermined location where the formulation is released. Further, an agent effective for the treatment or prevention of esophageal diseases released at each "site of action" and "site of application" can exert its actual biochemical effect at another location in the body or at another site in the biochemical cycle, for example, during or after metabolism by the liver, or when or after the agent reaches the target molecule. The "site of action" and "site of application" as used herein do not necessarily refer to the location of the biochemical and medical effects of the active pharmaceutical ingredient.

[0070] Capsule device / shell The drug delivery system according to the present invention further includes a shell, the shell accommodating at least one sheet-like, particularly film-shaped, foil-shaped, or oblate-shaped formulation containing an agent effective for the treatment or prevention of esophageal diseases, the shell including an opening configured such that the formulation exits the shell as part of the release mechanism, so that the formulation opens or spreads as the dosage form descends the esophageal mucosa and exits through the opening from the shell. The shell can be further prepared to protect the formulation from inadvertent release. The shell is a capsule device and particularly has the shape of a capsule.

[0071] In a preferred embodiment, the shell includes a first half of the capsule shell and a second half of the capsule shell, and the capsule device is formed by sliding the first half of the capsule shell into the second half of the capsule shell to a bonding position, so that an opening is formed at the bonding position by the second half of the capsule shell overlapping the cross-section of the opening in the first half of the capsule shell.

[0072] In a further embodiment, the two capsule halves fit into each other, but the opening of the first half of the capsule shell is further covered by an overlapping wall portion, such as a piece of cloth or tape, provided, and the wall portion is attached to the first half of the capsule shell and / or the second half of the capsule shell.

[0073] In an alternative embodiment, the capsule halves are shaped like two nut shells and are positioned one above the other to form a capsule. The opening is formed, in particular, by a cutout at the edge of one of the two shells. Alternatively, the cutout may be formed at the edges of both halves, in which case the two halves are positioned one above the other and aligned to form an opening when they are aligned.

[0074] In a preferred embodiment of the drug delivery system according to the present invention, the shell is made of a material selected from the group including hard gelatin, polymers, such as thermoplastic materials such as Eudragit. In this regard, in particular, materials that have already been successfully tested, used, and / or approved, for example, for oral dosage forms, may be beneficial.

[0075] Such a capsule device or shell is further described, for example, in European Patent No. 21175427.0, European Patent No. 21175436.1, and PCT / EP2020 / 056934, and with respect to the capsule device, the entire contents of which are incorporated herein by reference.

[0076] The condition to be treated The drug delivery system described in this specification is for therapeutic use. In one embodiment, the drug delivery system is for the treatment and prevention of esophageal diseases, preferably esophageal diseases caused by or associated with immune system deficiencies. In one embodiment, the drug delivery system is for the treatment and prevention of cancer, preferably esophageal cancer. As used herein, "esophageal cancer" refers to cancer that originates in or is present in the esophagus, including but not limited to squamous cell carcinoma, esophageal junction cancer, particularly esophagogastric junction cancer, and adenocarcinoma. In one embodiment, the drug delivery system is for the treatment and prevention of Barrett's esophagus. In one embodiment, the drug delivery system is for the treatment and prevention of esophageal adenocarcinoma. In one embodiment, the drug delivery system is for the treatment and prevention of esophageal squamous cell carcinoma. In one embodiment, the drug delivery system is for the treatment and prevention of esophageal stricture.

[0077] In the present application, the term "treatment and / or prevention" includes any method that improves a particular condition to be treated or prevents the occurrence of a condition to be treated. This term also includes prevention of the worsening of a condition and minimization of the severity of a condition.

[0078] An esophageal disease can be any disease or disorder that interferes with the function or structure of the esophagus.

[0079] Esophageal diseases can include a chronic inflammatory state that can progress to tumorigenesis through a series of changing abnormal states, and can also occur due to the reflux of both gastric acid and bile, or be associated with immune system deficiencies. Esophageal diseases also include, but are not limited to, for example, refractory esophageal diseases after primary treatment. For example, refractory esophageal diseases refer to esophageal diseases where the treatment has been unsuccessful or insufficient, that is, symptoms specific to the esophageal disease remain despite treatment. Refractory esophageal diseases can also refer to recurrence after treatment. Thus, in one embodiment, the present invention relates to the treatment of refractory esophageal diseases in the sense of secondary treatment. For example, surgical treatment or resection treatment in cancer treatment may require post-treatment or secondary treatment with chemotherapeutic agents sometimes in combination with radiotherapy to ensure complete destruction of cancerous tissue. Therefore, the present invention also includes the secondary treatment of esophageal diseases such as cancer.

[0080] In another embodiment, the present invention relates to primary treatment or pre-treatment of esophageal diseases, such as prophylactic treatment or adjuvant chemotherapy before surgical treatment. For example, surgical or resection treatment in cancer treatment may sometimes require primary treatment or pre-treatment with chemotherapeutic agents in combination with radiotherapy, such as neoadjuvant therapy, to reduce the size of the tumor to a surgically operable size. Therefore, the present invention also includes primary treatment or pre-treatment of esophageal diseases such as cancer, such as neoadjuvant therapy.

[0081] Preferred esophageal diseases include esophageal diseases caused by or associated with immune system deficiencies. For example, esophageal diseases are caused by or associated with a decrease in the proliferation or activity of immune system cells, thereby disrupting esophageal homeostasis, and, for example, the occurrence and / or progression of cancer is promoted by cancer cells evading the immune surveillance mechanism.

[0082] One option for cancer treatment is resection or surgery of the affected tissue as a stand-alone treatment, or in combination with chemotherapy or radiotherapy, for example, as neoadjuvant therapy. As used herein, "neoadjuvant therapy" refers to chemotherapy and / or radiotherapy that precedes resection or surgery and is aimed at reducing the size of the tumor, preferably to a size that is operable. Resective treatment or surgery may be accompanied by postoperative chemotherapy to prevent the spread of the tumor and / or the formation of metastases. Alternatively, particularly in inoperable cancers, chemotherapy as a stand-alone treatment, or chemotherapy in combination with radiotherapy (radical chemoradiotherapy), is the treatment of choice.

[0083] Regardless of the point in the treatment regimen, chemotherapy is typically administered systemically by intravenous injection, which is associated with high toxicity for the patient. Thus, there is a need for new options for cancer treatment with reduced toxicity.

[0084] Barrett's esophagus is a condition in which normal multilayered squamous epithelium is replaced by (specialized) columnar epithelium (i.e., intestinal or other columnar types of metaplasia). This process is thought to be the result of long-term gastroesophageal reflux disease and is most common in middle-aged white males. In particular, intestinal-type specialized columnar metaplasia confers a significantly increased risk of esophageal adenocarcinoma. Esophageal adenocarcinoma is a highly malignant disease with a very poor prognosis and arises from the epithelial cells lining the esophagus. The incidence of Barrett's esophagus and esophageal adenocarcinoma is increasing rapidly, and it is very important to develop new preventive and therapeutic strategies.

[0085] The terms "Barrett's disease" and "Barrett's esophagus" are used interchangeably herein.

[0086] Patients with Barrett's esophagus may have symptoms associated with gastroesophageal reflux disease, but Barrett's esophagus does not have any specific symptoms. However, Barrett's esophagus increases the risk of developing esophageal adenocarcinoma, a potentially lethal and serious esophageal cancer. The diagnosis of Barrett's esophagus can be made by endoscopy, histological examination, and / or using biomarkers such as those described in, for example, U.S. Patent Application Publication No. 20120009597 A1.

[0087] The treatment of Barrett's esophagus without malignant features aims to reduce inflammation and epithelial-mesenchymal transition and includes treatment with compounds that reduce reflux or anti-reflux surgery. In the case of malignant transformation, the treatment is by endoscopic resection or surgical removal of the affected part of the esophagus. The resection or surgery may be accompanied by neoadjuvant therapy and / or postoperative chemotherapy. As described herein, chemotherapy is highly toxic to patients for parenteral systemic delivery. Therefore, there is still a need in the art for new treatment options for esophageal cancer.

[0088] Esophageal squamous cell carcinoma (ESCC) arises from the epithelial cells that line the esophagus. Regions with a high incidence include areas around the geologic belt running from East Asia to Central Asia and from East Africa to South Africa. The causes of ESCC are many and vary between regions. Initial studies in France have associated heavy smoking and alcohol consumption with high ESCC rates, and other risk factors for ESCC include polycyclic aromatic hydrocarbons from various sources, hot foods, diet, and oral hygiene. Esophageal squamous cell carcinoma is diagnosed by endoscopic biopsy. ESCC is the eighth most common cancer in the world and has a poor prognosis because diagnosis is often delayed. Therefore, it is very important to develop new preventive and therapeutic strategies. Furthermore, esophageal squamous cell carcinoma is usually treated by neoadjuvant therapy followed by surgery or, alternatively, by radical chemoradiation therapy, which is highly toxic to patients. Therefore, there is still a need in the art for new treatment options.

[0089] The drug delivery system described in this specification can be used for treatment, preferably for the treatment of esophageal diseases. The esophageal diseases to be treated according to the present invention include, but are not limited to, esophageal diseases, preferably those caused by or related to immune system defects, or preferably cancers, esophageal diseases.

[0090] Preferably, in the context of the present invention, the esophageal diseases to be treated are Barrett's esophagus, particularly different stages of Barrett's esophagus including metaplasia, low-grade dysplasia, and high-grade dysplasia. In another embodiment, the esophageal diseases to be treated in the context of the present invention are preferably esophageal cancers such as adenocarcinoma, esophageal junction cancer, or squamous cell carcinoma, including but not limited to refractory cancers. In one embodiment, the treatment of esophageal cancer includes neoadjuvant therapy, i.e., chemotherapy before surgery. In one embodiment, the treatment of esophageal cancer includes the treatment of inoperable esophageal cancer by chemotherapy, for example, as an independent treatment without subsequent surgery or resection treatment. In one embodiment, the treatment of esophageal cancer includes postoperative chemotherapy, i.e., the treatment of esophageal cancer by chemotherapy after surgery. In another embodiment, the esophageal disease to be treated in the context of the present invention is preferably esophageal stricture.

[0091] In a preferred embodiment of the present invention, the drug delivery system according to the present invention is for the treatment of esophageal diseases such as Barrett's esophagus, particularly different stages of Barrett's esophagus including metaplasia, low-grade dysplasia, and high-grade dysplasia. In a further preferred embodiment of the present invention, the drug delivery system according to the present invention is for the treatment of esophageal cancers such as adenocarcinoma, esophageal junction cancer, or squamous cell carcinoma, including but not limited to refractory cancers. In one embodiment, the drug delivery system according to the present invention is for the treatment of esophageal cancer by neoadjuvant therapy, i.e., chemotherapy before surgery. In one embodiment, the drug delivery system according to the present invention is for the treatment of inoperable esophageal cancer by chemotherapy, for example, as an independent treatment without subsequent surgery or resection treatment. In one embodiment, the drug delivery system according to the present invention is for the treatment of esophageal cancer by postoperative chemotherapy, i.e., chemotherapy after surgery. In another embodiment, the drug delivery system according to the present invention is for the treatment of esophageal stricture.

[0092] The dosing frequency, treatment period, or timing of administration of the drug delivery device is not limited and is determined by the specific disease to be treated and / or the amount of the pharmaceutically active ingredient per drug delivery device. For example, the drug delivery device can be administered once a day or twice a day. When the drug delivery device is administered once a day, it is preferably administered in the evening to enhance patient compliance. The drug delivery system of the present invention is preferably administered before bedtime, i.e., after dinner and after oral hygiene. The treatment period can be from 7 days to 40 days, preferably from 14 days to 30 days, more preferably from 20 days to 28 days. The treatment can include the treatment period of a single treatment cycle or multiple cycles, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more cycles.

[0093] Diagnosis The drug delivery system described herein can also be used for diagnosis. Diagnosis can include monitoring the uptake of the agent into cells after administration or the route of the agent into tissues, organoids, cell cultures, or organs. Diagnosis can also include monitoring the success of treatment, such as tumor size or the time from when the agent is released from drug delivery until it is taken up by cells, tissues, or organs. For example, a formulation containing a pharmaceutically active ingredient in combination with a diagnostic marker can be administered to cells, tissues, organs, cell cultures, or organs. The route of the pharmaceutically active ingredient can be traced by monitoring the diagnostic marker described herein. For the purposes of the present invention, diagnosis can include in vivo and / or in vitro diagnosis.

[0094] For diagnostic purposes, the agent effective for the treatment of esophageal diseases of the present invention can be combined with a diagnostic marker. Any diagnostic marker suitable for in vivo or in vitro diagnosis can be used. For example, the agent can be conjugated or otherwise associated with the diagnostic marker, such as embedded, included, or complexed. Alternatively, one or more atoms or functional groups of the agent can be substituted with the diagnostic marker. In principle, but not limited to, radioactive isotopes, paramagnetic labels such as gadolinium or iron oxide, fluorophores, near-infrared (NIR) fluorescent dyes or pigments, echogenic microbubbles, affinity labels (such as biotin, avidin, etc.), enzymes, or any other suitable agent detectable by imaging diagnostic methods, any known diagnostic marker can be used for diagnosis. In certain non-limiting examples, an agent effective for the treatment or prevention of esophageal diseases, such as an antibody of the present invention, can be conjugated to a near-infrared fluorescence (NIRF) imaging dye, such as but not limited to Cy5.5, Alexa680, Dylight680, or Dylight800, tritium (trideuterium), 11C (carbon), 13N (nitrogen), 15O (oxygen), 18F (fluorine), 32P (phosphorus), or 35S (sulfur) and other radioactive isotopes. In another specific non-limiting example, an agent effective for the treatment or prevention of esophageal diseases, such as siRNA or antisense oligonucleotide, can be conjugated to a fluorophore such as Atto633 (Figure 10). In one embodiment, an inhibitory polynucleotide of the present invention, such as siRNA, aptamer, or antisense oligonucleotide, is used in combination with a diagnostic marker. In one embodiment, an antibody of the present invention is used in combination with a diagnostic marker. In one embodiment, an anti-proliferative agent of the present invention is used in combination with a diagnostic marker. Imaging devices suitable for diagnosis, particularly in vivo diagnosis, include, but are not limited to, PET scans and SPECT scans that require radioactive isotopes.

[0095] Drug active ingredient As used herein, the term "drug active ingredient" is used interchangeably with the terms "active ingredient" or "API" and refers to an agent effective for the treatment or prevention of esophageal diseases.

[0096] The term "therapeutically effective amount" or "effective amount" means an amount or quantity that produces the desired effect for which it is administered. The exact amount or quantity depends on the purpose of the treatment and can be determined using skills known to those of ordinary skill in the art. The term "therapeutically effective amount" is an amount effective to improve the disease (symptoms). Since prevention can be considered a form of treatment, a therapeutically effective amount can be a "prophylactically effective amount".

[0097] "An agent effective for the treatment or prevention of esophageal diseases" refers to a compound that reduces, alleviates, prevents, inhibits, or interferes with esophageal diseases or disorders. In particularly preferred embodiments, an agent effective for the treatment of esophageal diseases is an agent with limited therapeutic application due to high systemic toxicity, or with low systemic bioavailability, for example, due to a high first-pass effect and / or loss of activity upon passage through the gastrointestinal tract. The present invention enables or increases the therapeutic use of such agents through the local utility of the agent at the treatment site. An agent effective for the treatment or prevention of esophageal diseases refers to any type of compound, including, but not limited to, polynucleotides such as inhibitory polynucleotides, for example, siRNA molecules, antisense oligonucleotides, microRNA (miRNA), antagomirs, or aptamers; small molecules; or polypeptides such as antibodies or ligands. This term also refers, as appropriate, to salts or any other derivatives of an agent effective for the treatment or prevention of esophageal diseases.

[0098] The term "sequence identity" or "identical sequences" is used to assess the similarity of two sequences, for example, a polynucleotide sequence or a polypeptide sequence, and is determined by calculating the percentage of the same residues when the two sequences are aligned so that the residue positions match maximally. Sequence identity can be calculated using any known method, for example, computer software for calculating sequence identity is available. Without wishing to be limiting, sequence identity can be calculated by software such as BLAST-P or BLAST-N of the National Center for Biotechnology Information, or any other suitable software known in the art. Importantly, the assessment of sequence similarity between a comparison sequence and a given sequence is determined over the entire length of the comparison sequence. For example, if the sequence of an siRNA molecule is the comparison sequence, the sequence identity to a given sequence is determined by the default algorithm for aligning two or more sequences in the BLAST-N program. In another example, if the antibody sequence shown in SEQ ID NO: 11 is the comparison sequence, the sequence identity to a given sequence is determined by the default algorithm for aligning two or more sequences in the BLAST-P program.

[0099] In one aspect of the invention, an agent effective for the treatment or prevention of esophageal diseases comprises an inhibitory polynucleotide, preferably an inhibitory polynucleotide such as an siRNA molecule, miRNA, antagomir, antisense oligonucleotide, and aptamer, more preferably an inhibitory polynucleotide such as an siRNA molecule, antisense oligonucleotide, or aptamer, or is an inhibitory polynucleotide. In one embodiment, the inhibitory polynucleotide has a length of 10 to 100 nucleotides, preferably 15 to 50 nucleotides, more preferably 19 to 25 nucleotides. The polynucleotide can be "deoxyribonucleic acid" (DNA) or "ribonucleic acid" (RNA) or a derivative or modified version thereof. The polynucleotide can be double-stranded or single-stranded.

[0100] In a preferred embodiment, the agent effective for treating or preventing esophageal diseases comprises, preferably consists of, or is an siRNA molecule.

[0101] As used herein, the terms "small interfering RNA" or "siRNA" refer to exogenous synthetic RNA duplexes. Any method known in the art for producing siRNAs can be used. Such methods are known to those skilled in the art. siRNAs comprise, or consist of, two RNA strands, an antisense (or guide) strand and a sense (or passenger) strand. These molecules generally exhibit 15 to 35 base pairs, preferably 19 to 25 base pairs, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 base pairs, and are typically prepared by enzymatic cleavage of larger RNA duplexes intracellularly. siRNAs can contain varying degrees of sequence complementarity to a target mRNA or RNA transcript in the antisense strand. Preferably, the siRNA molecules of the present invention have sufficient sequence identity and / or sequence complementarity to the target RNA transcript, preferably under physiological conditions, thereby interfering with, reducing, diminishing, inhibiting, and / or preventing the expression and / or function of the polypeptide encoded by the target RNA transcript. Some, but not all, siRNA molecules contain structures with overhangs. Overhangs have been described as being advantageous and can be present at the 5' or 3' termini of both strands, reducing recognition by ribonucleases. Some siRNA molecules have overhangs at the 3' termini of both strands, while other siRNA molecules have overhangs on only one strand. Other siRNA molecules can have blunt end structures. Without being bound by any theory, these overhangs are said to further enhance resistance to nuclease (ribonuclease) degradation. As used herein, the terms "overhang" or "tail" refer to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more consecutive nucleotides at the 3' termini of one or both of the sense and antisense strands that do not form base pairs. The term siRNA refers to a duplex of two separate strands and also to a single-stranded duplex formed by self-complementary sequence segments that form a duplex region such as a hairpin structure.

[0102] As used herein, the term "double-stranded region" refers to a region that forms base pairs with each other in two complementary or partially complementary polynucleotides (e.g., a sense strand or an antisense strand).

[0103] The terms "complementary" or "sequence complementary" refer to nucleotide hybridization or base pairing. Hybridization preferably refers to stringent hybridization conditions such as washing at 45°C, preferably 48°C, more preferably 50°C for 1 hour in 1×SSC and 0.1% SDS, especially washing for 1 hour in 0.2×SSC and 0.1% SDS. Base pairing can include any base pairing, including but not limited to Watson-Crick base pairing.

[0104] The term "RNA transcript" or "mRNA transcript" includes, but is not limited to, a primary transcript, a pre-mRNA transcript, a transcript processing intermediate, a translatable mature mRNA, a transcript of one or more genes, or a nucleic acid derived from an mRNA transcript. Processing of pre-mRNA transcripts that may involve the use of alternative promoters and alternative polyadenylation sites allows for the generation of many different mature RNAs from a single gene by changing the splicing pattern in a process known as alternative splicing. Alternative splicing can also affect the translation, localization, or stability of mRNA by the introduction or removal of regulatory elements. These alternatively spliced mRNAs are translated into alternatively spliced form proteins, which contain different amino acid sequences compared to the corresponding wild-type or standard proteins produced by mRNAs that have undergone normal splicing.

[0105] In one embodiment, the inhibitory polynucleotide comprises an siRNA molecule that targets an RNA transcript or a portion thereof that encodes a polypeptide involved in the development of an esophageal disease or disorder, or that encodes a polypeptide that may be expressed or the expression of which may increase as a result of a disease or disorder. The siRNA molecule has sufficient sequence complementarity and / or sequence identity to the target RNA transcript to inhibit, prevent, reduce, or decrease the expression and / or function of the polypeptide encoded by the RNA transcript. In one embodiment, the polypeptide preferably comprises a BMP2 or BMP4 polypeptide as set forth in SEQ ID NO: 15 or SEQ ID NO: 16, or is a BMP2 or BMP4 polypeptide.

[0106] In one embodiment, the siRNA molecule comprises a double-stranded region, the double-stranded region comprises a sense strand and an antisense strand, the sense strand and the antisense strand together form the double-stranded region, and the antisense strand is complementary to a target RNA transcript encoding a BMP2 or BMP4 polypeptide. The complementarity is sufficient to inhibit, block, reduce, or decrease the expression and / or function of BMP2 and / or BMP4. In one embodiment, the siRNA molecule has sufficient complementarity to an RNA transcript encoding BMP2 and / or BMP4 to inhibit, block, reduce, or decrease the function of BMP2 and / or BMP4, such as BMP2 and / or BMP4 signaling, thereby reconstructing or providing normal tissue covering the esophagus, or enhancing the formation of normal tissue covering the esophagus, and preventing or treating esophageal cancer. In a preferred embodiment, the RNA transcript is as set forth in SEQ ID NO: 20 or SEQ ID NO: 21. Preferably, the siRNA molecule comprises the sequence shown in SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19, preferably the sequence shown in SEQ ID NO: 18, or any other sequence comprising 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity between the siRNA molecule and the target RNA transcript or a portion thereof. The double-stranded region can have a length of 15 to 35 base pairs, preferably 17 to 30 base pairs, more preferably 19 to 25 base pairs.

[0107] In one embodiment, the inhibitory polynucleotide comprises an siRNA molecule that targets an RNA transcript as set forth in SEQ ID NO: 20 or SEQ ID NO: 21 or a portion thereof. In one embodiment, the siRNA molecule comprises or consists of a double-stranded region, the double-stranded region comprises a sense strand and an antisense strand, the sense strand and the antisense strand together form the double-stranded region, and the antisense strand is complementary to a target RNA transcript as set forth in SEQ ID NO: 20 or SEQ ID NO: 21 or a portion thereof.

[0108] In one embodiment, the siRNA molecule does not exhibit an overhang, i.e., has blunt ends. In another embodiment, the siRNA molecule exhibits at least one overhang. The overhangs are thought to play a structural role in presenting the duplex to RISC. Each overhang can have one or more, preferably two, up to six consecutive nucleotides. The nucleotides in the overhang can include nucleosides having nucleobases such as adenine, cytosine, guanine, thymine, or uracil. Preferably, the overhang contains or consists of deoxyribonucleotides containing two consecutive nucleotides, preferably deoxyribonucleotides, such as deoxythymidine (dTdT). The deoxyribonucleotides in the overhang are thought to confer nuclease resistance. It is also possible to use ribonucleotides in the overhang. The ribonucleotides can be complementary to the target transcript or can contain nucleoside uridine, preferably UU.

[0109] In a preferred embodiment, the siRNA molecule consists of a duplex region containing the sequence shown in SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19, i.e., has blunt ends. In another preferred embodiment, the siRNA molecule consists essentially of a duplex region containing the sequence shown in SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19, i.e., consists of the duplex region and one or more consecutive overhang nucleotides described herein, preferably two, up to six consecutive nucleotides.

[0110] In a preferred embodiment, the siRNA molecule contains, preferably consists of, BMP2-siRNA 1, BMP2-siRNA 2, or BMP2-siRNA 3 shown in the following table, and each of the sequences in Table 1 below contains an overhang of 2 nucleotides dTdT (deoxythymidine) or UU (uridine) attached to the 3' end of each strand.

[0111] JPEG2025519490000003.jpg61166

[0112] The siRNA molecules of the present invention may contain chemically modified nucleotides or modified nucleotides. These modified nucleotides refer to non-standard nucleotides, including unnatural deoxyribonucleotides or ribonucleotides. Such modifications are introduced to increase or improve nuclease resistance, intracellular uptake, target cell specificity, and / or stability. Of course, such modifications are introduced without affecting the original inhibitory, blocking, reducing, or decreasing activity of the siRNA molecule against the target RNA transcript. Modifications can be introduced into the backbone, sugar moiety, and / or nucleobase moiety of the polynucleotide.

[0113] For example, the modification may be present in the backbone of the polynucleotide. For example, to increase the stability of the siRNA molecule, all or part of the phosphodiester bonds of the sense strand or antisense strand of the siRNA molecule can be replaced with phosphorothioate or boranophosphate bonds.

[0114] Another modification may be present in the sugar moiety of the ribonucleotides of the siRNA molecule. For example, the ribose portion of the nucleoside may contain one or more bridged nucleic acids to increase the rigidity of the sugar moiety, thereby increasing the binding affinity and stability of the siRNA. Examples thereof are LNA (locked nucleic acid) or ENA (ethylene-bridged nucleic acid). Such modifications can be introduced into the ribose portion of all or some of the nucleotides, preferably the nucleotides at the 3'-end or 5'-end or both ends of the siRNA molecule strand.

[0115] In yet another example, as described in U.S. Patent No. 9,080,171 and U.S. Patent Application Publication No. 2019 / 0024082, the entire texts of which are incorporated herein by reference, the 2'-OH group of the ribose moiety may be substituted with -NH2, -NHR, -NR2, -COOR, -OR, -H, -F, -Cl, -Br, -I, -SH, -SR, -O-Me (or CH3, methyl group), -2’O-MOE (methoxyethyl), and R is substituted or unsubstituted C1-C6 alkyl, alkenyl, alkynyl, aryl, etc. For example, the 2'-OH group of the ribose moiety of the nucleotides at positions 1 and 2 of the sense strand may be substituted with 2'-O-Me (methyl), or the 2'-OH group of the ribose moiety of the nucleotide at position 2 of the antisense strand may be substituted with 2'-O-Me, or the 2'-OH of the ribose moiety of the nucleotide containing guanine (G) or uridine (U) may be substituted with 2'-O-Me or 2'-F.

[0116] In yet another aspect of the present invention, an agent effective for treating or preventing esophageal diseases is an antisense oligonucleotide. Antisense oligonucleotides include polymers of deoxyribonucleotides or ribonucleotides. Usually, antisense oligonucleotides are single-stranded molecules and may contain various degrees of complementarity to the target mRNA or RNA transcript. Antisense oligonucleotides have sufficient sequence complementarity to inhibit, block, reduce, or decrease the expression and / or function of the polypeptide encoded by the RNA transcript with respect to the target RNA transcript. These molecules generally exhibit a length of 15 to 35 nucleotides, preferably 19 to 25 nucleotides, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length and are usually synthesized exogenously. The antisense oligonucleotides of the present invention may contain chemically modified nucleotides or modified nucleotides in order to increase the binding affinity and / or stability of the antisense oligonucleotides. Modifications that may be present in the backbone, sugar moiety, or nucleobase moiety of the polynucleotide are disclosed herein in the context of siRNA molecules. In one embodiment, the antisense oligonucleotide is a morpholino. Any method known in the art for producing antisense oligonucleotides can be used, including but not limited to exogenous chemical synthesis. Those methods are known to those skilled in the art. The term antisense oligonucleotide may also refer to oligonucleotides present within cells.

[0117] In one embodiment, the antisense oligonucleotide preferably targets an RNA transcript encoding a BMP2 or BMP4 polypeptide, or a portion thereof, as set forth in SEQ ID NO: 15 or SEQ ID NO: 16. In yet another embodiment, the antisense oligonucleotide comprises or consists of an antisense strand, which is complementary to a target RNA transcript or a portion thereof as set forth in SEQ ID NO: 20 or SEQ ID NO: 21. The complementarity between the antisense strand and the target RNA transcript is sufficient to inhibit, prevent, reduce, or decrease the expression and / or function of BMP2 and / or BMP4. In one embodiment, the antisense strand has sufficient complementarity to an RNA transcript encoding a BMP2 and / or BMP4 polypeptide to inhibit, prevent, reduce, or decrease the function of BMP2 and / or BMP4, such as BMP2 and / or BMP4 signaling, thereby reconstructing or providing normal tissue covering the esophagus, or enhancing the formation of normal tissue covering the esophagus, and preventing or treating esophageal cancer.

[0118] In one embodiment, the antisense oligonucleotide comprises the sequence set forth in SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 24, preferably SEQ ID NO: 23, or any other sequence having 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity between the complementary sequence of the antisense oligonucleotide molecule and the target RNA transcript. The duplex between the antisense oligonucleotide and the target transcript can have a length of 15 to 35 base pairs, preferably 17 to 30 base pairs, preferably 19 to 25 base pairs.

[0119] In another aspect of the present invention, an agent effective for the treatment or prevention of esophageal diseases is an aptamer. An aptamer is a single-stranded polynucleotide that typically contains one or more double-stranded regions formed by self-complementary sequence portions such as hairpins. The aptamer specifically binds to a target polypeptide due to its specific three-dimensional structure. In one embodiment, the binding of the aptamer interferes with the activity of BMP2 or BMP4 polypeptide, preferably BMP2 or BMP4 shown in SEQ ID NO: 15 or SEQ ID NO: 16. To interfere means to inhibit, block, reduce, or lessen the activity of BMP2 and / or BMP4, such as BMP2 and / or BMP4 signaling. Preferably, the aptamer interferes with the activity of BMP2 and / or BMP4 by binding to the active site of BMP2 and / or BMP4, for example, to the receptor-binding site that binds to a receptor on the target cell. In one embodiment, the binding of the aptamer to the BMP2 and / or BMP4 polypeptide inhibits, blocks, reduces, or lessens the function of BMP2 and / or BMP4, such as BMP2 and / or BMP4 signaling, thereby reconstructing or providing normal tissue covering the esophagus, or enhancing the formation of normal tissue covering the esophagus, and preventing or treating esophageal cancer. The binding usually occurs by non-covalent bonds, such as electrostatic interactions, stacking of flat portions, shape complementarity, and / or hydrogen bonds. Any method known in the art for producing aptamers can be used. Those methods, including but not limited to SELEX (in vitro evolution method), are known to those skilled in the art.

[0120] Inhibitory polynucleotides, such as siRNA molecules or antisense oligonucleotides, act intracellularly. Thus, inhibitory polynucleotides administered using the drug delivery system of the present invention are advantageously introduced into the cells of the esophagus. For the purposes of the present invention, it is useful to administer an inhibitory polynucleotide in combination with a nucleic acid delivery system. The nucleic acid delivery system can increase or enable the intracellular delivery of the inhibitory polynucleotide. The inhibitory polynucleotide can be complexed, linked, embedded, bound, or encapsulated with or in the nucleic acid delivery system. For the purposes of the present invention, examples of the nucleic acid delivery system include, but are not limited to, liposomes, lipid bilayers, cationic polymers, micelles, emulsions, or nanoparticles such as lipid nanoparticles or polymer nanoparticles. Examples of cationic polymers for delivering nucleic acids include natural polymers such as chitosan, atelocollagen, cationic polypeptides, etc., and synthetic polymers such as poly(L-lysine), linear or branched polyethyleneimine (PEI), cyclodextrin-based polycations, dendrimers, etc.

[0121] The inhibitory polynucleotide of the present invention may also include a diagnostic marker. Such a diagnostic marker can be attached, for example conjugated, to any site of the polynucleotide, preferably to the 3' end and / or 5' end of the polynucleotide. Diagnostic markers containing inhibitory polynucleotides such as antisense oligonucleotides or siRNA molecules can be used for the diagnosis described herein.

[0122] In another aspect of the present invention, an agent effective for the treatment or prevention of esophageal diseases is an antibody or a binding fragment thereof.

[0123] In one embodiment, the antibody or a binding fragment thereof targets a polypeptide or a portion thereof involved in the development of an esophageal disease or disorder, or a polypeptide that may be expressed or the expression of which may increase as a result of the disease or disorder.

[0124] In one embodiment, the target polypeptide preferably encodes a BMP2 or BMP4 polypeptide as set forth in SEQ ID NO: 15 or SEQ ID NO: 16. In another embodiment, the target polypeptide encodes PD-1. In a further embodiment, the target polypeptide encodes an EGF receptor such as erb-b2 receptor tyrosine kinase 2.

[0125] As used herein, the term "BMP2" is preferably used to refer to mature bone morphogenetic protein 2, preferably of human origin. The nucleotide sequence of human pro-BMP2 is generally available by querying GenBank accession number NM_001200. A portion of the amino acid sequence of mature BMP2 is shown herein as SEQ ID NO: 14. The residue numbering used herein refers to the positions of SEQ ID NO: 14.

[0126] As used herein, the term "BMP4" is used to refer to human mature bone morphogenetic protein 4. The nucleotide sequence of human pro-BMP4 is generally available by querying GenBank accession number NM_130851. A portion of the amino acid sequence of mature BMP4 is shown herein as SEQ ID NO: 1. The residue numbering used herein refers to the positions of SEQ ID NO: 1.

[0127] As used herein, the term "BMP4 signaling" refers to the ability of BMP4 to activate the canonical (phosphorylation of SMAD 1 / 5 / 8). Assays for testing BMP4 signaling are described, for example, in Shaifur Rahman et al., "TGF-β / BMP signaling and other molecular events: regulation of osteoblast genesis and bone formation" Bone Research 3, Article number: 15005 (2015).

[0128] As used herein, the term "BMP2 signaling" refers to the ability of BMP2 to activate the canonical (phosphorylation of SMAD 1 / 5 / 8).

[0129] As used herein, the term "list" of BMP4 refers to the region within the BMP4 protein that binds to type I receptors such as BMPR1a and BMPR1b.

[0130] As used herein, the term "knuckle" of BMP4 refers to the region within the BMP4 protein that binds to type II receptors such as BMPR2, ActRII, and ActRIIB.

[0131] In a preferred embodiment, the epitope is in the list within residues 10-17, 24-31, 45-72, 89, 91, 101, 103, 104, and 106 of BMP4 (SEQ ID NO: 1).

[0132] As used herein, the term "binds within" a particular epitope refers to an Ig-like molecule that binds to one, but preferably at least two, three, five, six, seven, eight, or more residues within an epitope of BMP4. In a preferred embodiment, the Ig-like molecule does not (substantially) bind to any other epitope of BMP4.

[0133] As used herein, in the context of the interaction between an Ig-like molecule and an epitope, the term "binds to" means that the Ig-like molecule binds to the antigen with a dissociation constant KD of 1×10 -6 M or less, preferably 1×10 -7 M or less, more preferably 1×10 -8 M or less, more preferably 6×10 -9 M or less, more preferably 3×10 -9 M or less, more preferably 2×10 -9 M or less, and is intended to refer to the ability to bind to the antigen.

[0134] As used herein, an Ig-like molecule that "specifically binds" to a particular epitope is intended to refer to an Ig-like molecule that binds to the particular epitope but preferably does not (substantially) bind to another epitope.

[0135] The term "does not substantially bind" to an epitope, as used herein, means that it does not bind to the epitope or binds to the epitope with low affinity, i.e., with a KD of 1×10 -6 M or more, more preferably 1×10 -5 M or more, more preferably 1×10 -4 M or more, more preferably 1×10 -3 M or more, even more preferably 1×10 -2 M or more, meaning that it binds to the epitope with a KD of 1×10

[0136] The term "antigen-binding portion" (or "antigen-binding fragment thereof" or "antigen-binding fragment" or "binding fragment" or "binding fragment thereof" or "antibody fragment") of an antibody, as used herein, refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., an epitope within the BMP4 or PD-1 protein). Typically, a "binding fragment" or "antibody fragment" retains at least 10% of the activity when expressed on a molar basis of the parental binding activity. Preferably, the antibody fragment retains at least 20%, 50%, 70%, 80%, 90%, 95%, or 100% or more of the binding affinity of the parental antibody for the target. It has been found that the antigen-binding function of Ig-like molecules can be carried out by fragments of full-length antibodies. Antibody fragments can be obtained by manipulation of naturally occurring antibodies or can be obtained using recombinant methods. Examples of binding fragments included within the term "antigen-binding portion" of an antibody include: (i) a Fab fragment, which is a monovalent fragment consisting of the VL, VH, CL, and CHI domains; (ii) an F(ab')2 fragment, which is a divalent fragment containing two Fab fragments linked by a disulfide bridge in the hinge region; (iii) a Fab' fragment {see FUNDAMENTAL IMMUNOLOGY (Paul ed, 3.sup.rd ed. 1993)}, which is essentially a Fab and has a part of the hinge region; (iv) an Fd fragment consisting of the VH and CHI domains; (v) an Fv fragment consisting of the VL and VH domains of a single arm of an antibody; (vi) a dAb fragment consisting of the VH domain (Ward et al., (1989) Nature 341:544-546); (vii) an isolated complementarity-determining region (CDR); and (viii) a nanobody, which is a heavy-chain variable region containing one variable domain and two constant domains.Furthermore, the two domains of the Fv fragment, VL and VH, are encoded by separate genes but can be linked by a synthetic linker using recombinant methods, thereby allowing the VL and VH regions to pair and form a single protein chain that is a monovalent molecule (known as single-chain Fv (scFv); see, for example, Bird et al. (1988) Science 242:423-426; and Huston et al. (1988), Proc. Natl. Acad. ScL USA 85:5879-5883). Such single-chain antibodies are also intended to be included within the term "antigen-binding portion" of an antibody. These antibody fragments are obtained using conventional techniques known to those of skill in the art and the fragments are selected for use in the same manner as intact antibodies. In one non-limiting example, the antibody fragment can be a single domain antibody (single-domain antibody) derived from a naturally occurring source. The term single domain antibody can also refer to its multimeric forms. Camelid heavy chain antibodies lack light chains, so their antigen-binding sites consist of one domain and they are called VHH. Single domain antibodies have also been observed in sharks and are called VNAR. Other single domain antibodies can be designed based on human heavy or light chain sequences. As used herein, the term "single domain antibody" includes those directly isolated from any source of VL, VH, VHH, or VNAR repertoire by phage display or other display methods, and those generated by further modification of such single domain antibodies by humanization, affinity maturation, stabilization, solubilization (e.g., camelization), or other antibody engineering methods. The invention also includes homologs, derivatives, or fragments that retain or improve the antigen-binding function and specificity of single domain antibodies. Those of skill in the art will be familiar with the structure of single domain antibodies. A single domain antibody contains one immunoglobulin domain that retains the immunoglobulin fold and, in particular, only three CDRs form the antigen-binding site. However, not all CDRs may be required for antigen binding.For example, although not wishing to be limiting, one, two, or three of the CDRs may contribute to the binding and recognition of an antigen by the single domain antibody of the invention. The CDRs of the single domain antibody are referred to herein as CDR1, CDR2, and CDR3 and are based on Kabat numbering (Kabat et al. 1991). The single domain antibody may be of camelid origin and thus may be based on a camelid framework region, but alternatively, the CDRs may be grafted into the framework region of another antibody domain, such as but not limited to a VNAR, human VH, or human VL framework region. In yet another alternative, the CDRs described above may be grafted into the framework region of other types of antibody fragments (Fv, scFv, Fab). The invention also includes diabodies. A "diabody" is a small antibody fragment having two antigen binding sites. The fragment includes a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (VH-VL or VL-VH). By using a linker that is short enough so that the two domains cannot pair on the same chain, the domains must pair with the complementary domain of the other chain, resulting in two antigen binding sites. Diabodies are described in more detail, for example, in European Patent No. 404,097, International Publication No. 93 / 11161 Pamphlet, and Holliger et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6444-6448.

[0137] Preferred antibodies of the invention are disclosed in International Publication No. 2016 / 043577 Pamphlet and International Publication No. 2018 / 193129 Pamphlet, the entire contents of which are incorporated herein by reference.

[0138] Preferably, the antibody or binding fragment thereof according to the present invention binds preferably within the epitope consisting of residues 10-17, 45-56, and 69 of BMP4 (SEQ ID NO: 1), and binds to the epitope. This epitope has a hydrophobic groove, which is considered important for BMP4-specific binding. One advantage of the antibody or binding fragment thereof according to this embodiment is that the antibody or binding fragment thereof has a low affinity for other members of the BMP family and is extremely effective for specific inhibition of BMP4 signaling. Preferably, the antibody or binding fragment thereof does not substantially bind to BMP2, BMP5, BMP6, or BMP7. A further advantage is that the antibody or binding fragment thereof does not inhibit BMP2-mediated signaling, thereby reducing or even avoiding harmful side effects when used in vivo. More preferably, the antibody or binding fragment thereof specifically binds to at least one residue selected from the group consisting of Lys10, Asn11, Lys12, Asn13, Cys14, Arg15, Arg16, and His17 of BMP4, at least one residue selected from the group consisting of Gly45, Asp46, Cys47, Pro48, Phe49, Pro50, Leu51, Ala52, Asp53, His54, Leu55, and Asn56, and Ser69. Preferably, the antibody or binding fragment thereof binds to more than 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, preferably more than 16 residues of BMP4. In a highly preferred embodiment, the antibody or binding fragment thereof specifically binds to at least Lys12, Arg15, Asp46, and Pro50 of BMP4.

[0139] In a preferred embodiment, the antibody or binding fragment thereof according to the present invention is a single-chain antibody. In a preferred embodiment, the antibody or binding fragment thereof comprises a heavy-chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 3 or a sequence differing by no more than two amino acids therefrom, a heavy-chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 4 or a sequence differing by no more than one amino acid therefrom, and preferably further a heavy-chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 2 or a sequence differing by no more than one amino acid therefrom. In a highly preferred embodiment, the antibody or binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 11.

[0140] In another embodiment, the antibody or binding fragment thereof according to the present invention preferably binds within an epitope consisting of residues 24-31, 57-68, 70-72, 89, 91, 101, 103, 104, and 106 of BMP4 (SEQ ID NO: 1), and preferably binds to the epitope. This region represents a "hydrophobic pocket" within the linear epitope of BMP4. One advantage of antibodies or binding fragments thereof that bind to this region is that these antibodies or binding fragments thereof have very high affinity for BMP4 and BMP2, and also have the ability to efficiently inhibit BMP4 and BMP2 signaling. Preferably, the antibody or binding fragment thereof specifically binds to at least one residue selected from the group consisting of Ser24, Asp25, Val26, Gly27, Trp28, Asn29, Asp30, Trp31 of BMP4, at least one residue selected from the group consisting of Ser57, Thr58, Asn59, His60, Ala61, Ile62, Val63, Gln64, Thr65, Leu66, Val67, and Asn68, at least one residue selected from the group consisting of Val70, Asn71, and Ser72, at least one residue selected from the group consisting of Tyr103 and Gln104, and up to Met89, Tyr91, Lys101, and Met106. Preferably, the antibody or binding fragment thereof binds to more than 9, preferably 14 residues of BMP4. In a highly preferred embodiment, the antibody or binding fragment thereof specifically binds to Asp30, Trp31, Leu66, and Lys101 of BMP4.

[0141] In a preferred embodiment, the antibody or its binding fragment is a single-chain antibody. In a preferred embodiment, the single-chain antibody or its binding fragment can bind to the "hydrophobic pocket" region within the listed epitope of BMP4 as described above. In a preferred embodiment, the antibody or its binding fragment according to the present invention comprises a heavy-chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 7 or a sequence that differs by no more than one amino acid therefrom. Without wishing to be bound by theory, this CDR3 is thought to be important for the binding interaction with the hydrophobic pocket of the BMP4 list. Preferably, the antibody or its binding fragment further comprises a heavy-chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 5 or a sequence that differs by no more than one amino acid therefrom, and a heavy-chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 6 or a sequence that differs by no more than one amino acid therefrom. In a highly preferred embodiment, the antibody or its binding fragment comprises the amino acid sequence of SEQ ID NO: 12.

[0142] In yet another embodiment, the antibody or its binding fragment of the present invention binds preferably to an epitope consisting of residues 34, 35, 39, 86 - 88, 90, 97, 98, 100, 102, and 109 of BMP4 (SEQ ID NO: 1), within the epitope. This region represents the so-called "knuckle" epitope of BMP4. An antibody or its binding fragment that specifically binds to the residues of this region has high affinity not only for BMP4 but also for BMP2, and has slightly lower affinity for BMP5 and BMP6 than for the former. Preferably, the antibody or its binding fragment specifically binds to Ala34, Gln39, Ser88, Leu90, and Leu100 of BMP4.

[0143] In a preferred embodiment, the antibody or its binding fragment is a single-chain antibody. In a preferred embodiment, the antibody or its binding fragment capable of binding to the above-mentioned knuckle comprises a heavy-chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 8 or a sequence differing by no more than one amino acid therefrom, and a heavy-chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 9 or a sequence differing by no more than one amino acid therefrom. Without wishing to be bound by theory, these CDRs are thought to be important for the binding interaction with the knuckle of BMP4. The antibody or its binding fragment preferably further comprises a heavy-chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 10 or a sequence differing by no more than one amino acid therefrom. In a preferred embodiment, the antibody or its binding fragment comprises the amino acid sequence of SEQ ID NO: 13.

[0144] In a preferred embodiment, an antibody or a binding fragment thereof that binds to the hydrophobic pocket of the BMP4 list, preferably to an epitope consisting of the hydrophobic pocket, is used. These antibodies or binding fragments thereof inhibit the signaling of both BMP2 and BMP4. Such antibodies or binding fragments thereof are disclosed on pages 22-24 of WO 2016 / 042050 pamphlet. Preferably, the antibody specifically binds to at least one residue selected from the group consisting of Ser24, Asp25, Val26, Gly27, Trp28, Asn29, Asp30, Trp31 of BMP4 (SEQ ID NO: 1), at least one residue selected from the group consisting of Ser57, Thr58, Asn59, His60, Ala61, Ile62, Val63, Gln64, Thr65, Leu66, Val67, and Asn68, at least one residue selected from the group consisting of Val70, Asn71, and Ser72, at least one residue selected from the group consisting of Tyr103 and Gln104, and up to Met89, Tyr91, Lys101, and Met106. Preferably, the antibody or binding fragment thereof binds to more than 9, preferably 14 residues of BMP4. In a highly preferred embodiment, the antibody or binding fragment thereof specifically binds to Asp30, Trp31, Leu66, and Lys101.

[0145] In a preferred embodiment, the antibody or its binding fragment is a single-chain antibody. In a preferred embodiment, the antibody or its binding fragment according to the present invention comprises a heavy-chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 7 or a sequence differing by no more than one amino acid therefrom. Without wishing to be bound by theory, this CDR3 is thought to be important for the binding interaction with the hydrophobic pocket of the BMP4 epitope list. Preferably, the antibody or its binding fragment further comprises a heavy-chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 5 or a sequence differing by no more than one amino acid therefrom, and a heavy-chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 6 or a sequence differing by no more than one amino acid therefrom. In a highly preferred embodiment, the antibody or its binding fragment comprises the amino acid sequence of SEQ ID NO: 12.

[0146] In a preferred embodiment, the present invention provides a hetero- or homo-multimeric molecule having increased antigen affinity for an antigen and / or an increased inhibitory effect on BMP signaling. The present invention thus provides a multimeric antibody comprising at least one, more preferably at least two, antibodies that bind to the hydrophobic pocket of the BMP4 epitope list described above, or a multimeric antibody comprising at least one, more preferably at least two, antibodies that bind to the knuckle epitope of BMP4 described above.

[0147] In another preferred embodiment, the antibody or its binding fragment may have a sequence substantially identical to SEQ ID NO: 11, 12, or 13. A substantially identical sequence may contain one or more conservative amino acid mutations. It is known in the art that one or more conservative amino acid mutations relative to a reference sequence can result in a mutant peptide that has no substantial change in physiological, chemical, or functional properties compared to the reference sequence, and in such cases, the reference sequence and the mutant sequence are considered to be substantially the same polypeptide.

[0148] Conservative amino acid mutations as used herein can include amino acid additions, deletions, or substitutions. In one non-limiting example, the conservative amino acid mutation is a conservative amino acid substitution. Conservative amino acid substitutions are defined herein as substituting one amino acid residue with another amino acid residue having similar chemical properties (e.g., size, charge, or polarity).

[0149] Conservative amino acid substitutions as used herein can substitute basic, neutral, hydrophobic, or acidic amino acids with another amino acid of the same group. The term "basic amino acid" means a hydrophilic amino acid having a side chain pK value greater than 7, and they are typically positively charged at physiological pH. Examples of basic amino acids include histidine (His or H), arginine (Arg or R), and lysine (Lys or K). The term "neutral amino acid" (also referred to as "polar amino acid") means a hydrophilic amino acid having a side chain that is not charged at physiological pH but has at least one bond in which the electron pair shared by two atoms is strongly pulled towards one of the atoms. Examples of polar amino acids include serine (Ser or S), threonine (Thr or T), cysteine (Cys or C), tyrosine (Tyr or Y), asparagine (Asn or N), and glutamine (Gln or Q). The term "hydrophobic amino acid" (also referred to as "non-polar amino acid") is taken to include amino acids that exhibit a hydrophobicity greater than zero according to the normalized consensus hydrophobicity scale of Eisenberg (1984). Examples of hydrophobic amino acids include proline (Pro or P), isoleucine (Ile or I), phenylalanine (Phe or F), valine (Val or V), leucine (Leu or L), tryptophan (Trp or W), methionine (Met or M), alanine (Ala or A), and glycine (Gly or G).

[0150] "Acidic amino acids" refer to hydrophilic amino acids with a side-chain pK value below 7, which are typically negatively charged at physiological pH. Examples of acidic amino acids include glutamic acid (Glu or E) and aspartic acid (Asp or D).

[0151] Substantially identical sequences of the present invention can be at least 70% identical at the amino acid level to the sequences described herein. In another example, substantially identical sequences can be at least 70, 71, 72, 73, 74, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical. Importantly, substantially identical sequences retain the activity and specificity of the reference sequence. As those skilled in the art will know, amino acid residues in an antibody or its binding fragment, particularly within the framework region, can be mutated (substituted or deleted) without affecting the functional properties (antigen recognition and binding) of the antibody or its binding fragment.

[0152] Standard assays for evaluating the binding ability of Ig-like molecules to one or more epitopes are known in the art and include, for example, ELISA, Western blot, flow cytometry, and RIA. The binding kinetics of an antibody (e.g., binding affinity) can also be evaluated by standard assays known in the art such as ELISA, Scatchard, and BIAcore analysis. Preferably, when determined using surface plasmon resonance analysis, the Ig-like molecule has an affinity KD for BMP4 of less than 1590 pM. -1 Preferably, the KD is less than 1000 pM. -1 More preferably, it is less than 1500 pM. -1 1400 pM -1 1300 pM -1 1200 pM -1 1100 pM -1 1000 pM -1 900 pM -1 800 pM -1 750 pM -1 700 pM -1 650 pM -1 635 pM -1, 600 pM -1 , 575 pM -1 , 513 pM -1 , 393 pM -1 , 100 pM -1 , 91 pM -1 , 75 pM -1 , 50 pM -1 , 32 pM -1 , 25 pM -1 , 10 pM -1 is less than.

[0153] Furthermore, the Ig-like molecule of the present invention is described as inhibiting BMP4 signaling to the same extent as noggin. This can be explained by the extensive contact points of noggin that simultaneously cover both the BMPRIa epitope and the BMPR2 epitope. While the C-terminal finger-like region of noggin is responsible for blocking BMPR2 binding, the N-terminal clip-like region binds to the BMPRIa epitope. This prominent structural range is conserved among BMP antagonists and can explain their lack of BMP specificity. Assays for determining whether an Ig-like molecule competes with noggin are known in the art. In a preferred embodiment, such assays include surface plasmon resonance (SPR) sandwich cross-linking, or an "epitope binning" assay, preferably as described in Examples 7 and 8 on pages 48 - 52 of WO 2016 / 043577 pamphlet.

[0154] The binding epitope of the antibody can be determined by standard methods known in the art, including but not limited to the "epitope binning" experiment (surface plasmon resonance (SPR) sandwich cross-linking) as described in Examples 7, 8, and 9 on pages 48-55 of WO 2016 / 043577, which is incorporated herein by reference, and is preferably subsequently verified by HADDOCK (High Ambiguity Driven protein-protein DOCKing) modeling, for example using HADDOCK software (Domininguez et al, 2003).

[0155] Specifically, in an "epitope binning" or surface plasmon resonance (SPR) sandwich cross-linking assay, a ligand is bound to a control molecule immobilized on a support such as a chip. After binding of the ligand, the ligand bound to the control molecule is contacted with a second molecule. The second molecule binds to the ligand only if the epitope on the bound ligand is still accessible. Thus, if the control molecule and the second molecule compete for binding to the ligand, no binding occurs because their epitopes are identical. For the purposes of the present invention, the control molecule can be the first antibody of the present invention, the ligand can be an antigen such as BMP4, and the secondary molecule can be a second antibody of the present invention different from the first antibody.

[0156] Mutagenesis experiments using mutant variants of a second molecule such as an antibody can be performed to further verify the modeling or confirm binding to a specific epitope. Mutant variants can be produced by any method known in the art, including but not limited to site-directed mutagenesis by overlap extension PCR.

[0157] The antibodies of the present invention are not limited to the methods described in WO 2016 / 043577 pamphlet (the full text of which is incorporated herein, particularly from line 15 of page 26 to line 28 of page 33), but can be produced by any method known in the art, including those.

[0158] In another embodiment of an antibody or fragment thereof that targets a polypeptide or a portion thereof involved in the development of an esophageal disease or disorder, or a polypeptide that is expressed or the expression of which is increased as a result of a disease or disorder, the antibody or fragment thereof targets a polypeptide encoding PD-1, preferably human PD-1.

[0159] In some embodiments, the antibody or antibody fragment blocks the binding of PD-L1 and / or PD-L2 to PD-1, preferably the binding of human PD-L1 and / or human PD-2 to human PD-1.

[0160] The term "chimeric" antibody refers to an antibody in which a portion of the heavy and / or light chain is derived from a particular species or belongs to a particular antibody class or subclass, while the remaining portion of the chain is derived from another species or belongs to another antibody class or subclass, and also refers to fragments of such antibodies as long as they exhibit the desired biological activity (see, for example, U.S. Patent No. 4,816,567, and Morrison et al., 1984, Proc. Natl. Acad. Sci. USA 81:6851-6855).

[0161] The "humanized" form of a non-human (e.g., mouse) antibody is a chimeric antibody that minimally contains sequences derived from non-human immunoglobulins. A humanized antibody is mostly human immunoglobulin (recipient antibody), and the residues derived from the hypervariable regions of the recipient are replaced with residues derived from the hypervariable regions of a non-human species such as a mouse, rat, rabbit, or non-human primate (donor antibody) that have the desired specificity, affinity, and capacity. In some examples, the Fv framework region (FR) residues of the human immunoglobulin are replaced with the corresponding non-human residues. Additionally, a humanized antibody may contain residues not found in the recipient antibody or donor antibody. These modifications are made to further improve the performance of the antibody. Generally, a humanized antibody substantially contains at least one, typically two, variable domains, where all or substantially all of the hypervariable loops correspond to those of the non-human immunoglobulin and all or substantially all of the FR regions are those of the FR regions of the human immunoglobulin sequence. Optionally, a humanized antibody also contains at least a portion of the constant region (Fc), typically of a human immunoglobulin. For further details, see Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).

[0162] As used herein, the term "hypervariable region" refers to the amino acid residues of an antibody that are responsible for antigen binding. Hypervariable regions include the amino acid residues of "complementary determining regions" or "CDRs" as defined by sequence alignment, e.g., residues 24-34 (L1), 50-56 (L2), and 89-97 (L3) of the light chain variable domain, and 31-35 (H1), 50-65 (H2), and 95-102 (H3) of the heavy chain variable domain (see Kabat et al., 1991, Sequences of proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md.), and / or the residues of "hypervariable loops" (HVLs) defined structurally, e.g., residues 26-32 (L1), 50-52 (L2), and 91-96 (L3) of the light chain variable domain, and 26-32 (H1), 53-55 (H2), and 96-101 (H3) of the heavy chain variable domain (see Chothia and Leskl, 1987, J. MoI. Biol. 196:901-917). "Framework" or "FR" residues are the residues of the variable domain other than those of the hypervariable regions as defined herein.

[0163] A "human antibody" is an antibody having an amino acid sequence corresponding to an amino acid sequence of an antibody produced by a human, and / or an antibody made using any of the methods for making human antibodies disclosed herein. This definition specifically excludes humanized antibodies that contain non-human antigen-binding residues.

[0164] As used herein, the term "monoclonal antibody" refers to a population of antibodies that are substantially homogeneous, i.e., antibodies obtained from a population where the individual antibodies that make up the population are identical except for naturally occurring mutations that may be present in small amounts. Monoclonal antibodies are highly specific and are directed against a single antigenic site. Further, in contrast to conventional (polyclonal) antibody preparations that typically include various antibodies directed against various determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The modifier "monoclonal" indicates the characteristic of the antibody being obtained from a substantially homogeneous population of antibodies and should not be construed to require that the antibodies be produced by any particular method. For example, the monoclonal antibodies used in accordance with the present invention can be made by the hybridoma method first described by Kohler et al., 1975, Nature 256:495, or by recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567). "Monoclonal antibodies" can also be isolated from phage antibody libraries using, for example, the techniques described in Clackson et al., 1991, Nature 352:624-628, and Marks et al., 1991, J. Mol. Biol. 222:581-597. The monoclonal antibodies herein specifically include "chimeric" antibodies.

[0165] Preferred antibodies of the present invention are disclosed in WO 2008 / 156712 pamphlet, the full text of which is incorporated herein by reference, especially pages 6 to 11.

[0166] In one embodiment, the PD-1 antibodies or antibody fragments of the present invention include a. at least one CDR (complementary determining region) selected from the group consisting of SEQ ID NOs: 30, 31, 32, 36, 37, and 38, or a variant of any of the foregoing sequences, and / or b. at least one CDR selected from the group consisting of SEQ ID NOs: 33, 34, 35, 39, 40, and 41, or a variant of any of the foregoing sequences Antibodies or antibody fragments that bind to PD-1, preferably human PD-1, including

[0167] In one embodiment, the antibody or antibody fragment that binds to PD-1, preferably human PD-1, a. light chain CDR SEQ ID NO: 30, 31, and 32, or variants of any of the foregoing sequences, and / or heavy chain CDR SEQ ID NO: 33, 34, and 35, or variants of any of the foregoing sequences, or b. light chain CDR SEQ ID NO: 36, 37, and 38, or variants of any of the foregoing sequences, and / or heavy chain CDR SEQ ID NO: 39, 40, and 41, or variants of any of the foregoing sequences including.

[0168] In one embodiment, the antibody or antibody fragment that binds to PD-1, preferably human PD-1, a. i. SEQ ID NO: 26 or a variant thereof, ii. SEQ ID NO: 28 or a variant thereof, iii. amino acid residues 20-139 of SEQ ID NO: 42 or a variant thereof, and iv. an amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% sequence identity to amino acid residues 20-139 of SEQ ID NO: 42 a heavy chain variable region comprising an amino acid sequence selected from the group consisting of including, and further, b. i. SEQ ID NO: 27 or a variant thereof, ii. SEQ ID NO: 29 or a variant thereof, iii. amino acid residues 20-130 of SEQ ID NO: 44 or a variant thereof, iv. amino acid residues 20-130 of SEQ ID NO: 45 or a variant thereof, v. amino acid residues 20-130 of SEQ ID NO: 46 or a variant thereof, and vi. An amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to amino acid residues 20 to 130 of SEQ ID NO: 44, 45, or 46 A light chain variable region comprising an amino acid sequence selected from the group consisting of including.

[0169] Specifically, in one embodiment, the present invention includes an antibody or antigen-binding fragment thereof comprising a heavy chain variable region of SEQ ID NO: 26 or a variant thereof, and / or a light chain variable region comprising SEQ ID NO: 27 or a variant thereof.

[0170] In one embodiment, the present invention includes an antibody or antigen-binding fragment thereof comprising a heavy chain variable region of SEQ ID NO: 28 or a variant thereof, and / or a light chain variable region comprising SEQ ID NO: 29 or a variant thereof.

[0171] In one embodiment, the present invention includes an antibody or antigen-binding fragment thereof comprising a heavy chain variable region comprising amino acid residues 20 to 139 of SEQ ID NO: 42 or a variant thereof, and / or a light chain variable region comprising amino acid residues 20 to 130 of SEQ ID NO: 44 or a variant thereof.

[0172] In one embodiment, the present invention includes an antibody or antigen-binding fragment thereof comprising a heavy chain variable region comprising amino acid residues 20 to 139 of SEQ ID NO: 42 or a variant thereof, and / or a light chain variable region comprising amino acid residues 20 to 130 of SEQ ID NO: 45 or a variant thereof.

[0173] In one embodiment, the present invention includes an antibody or antigen-binding fragment thereof comprising a heavy chain variable region comprising amino acid residues 20 to 139 of SEQ ID NO: 42 or a variant thereof, and / or a light chain variable region comprising amino acid residues 20 to 130 of SEQ ID NO: 46 or a variant thereof.

[0174] In one embodiment, the present invention includes a heavy chain variable region comprising an amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% sequence identity to amino acid residues 20 to 139 of SEQ ID NO: 42, and / or a light chain variable region comprising an amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% sequence identity to amino acid residues 20 to 130 of SEQ ID NO: 44, 45, or 46, and includes an antibody or antigen-binding fragment.

[0175] In one embodiment, an antibody or antibody fragment that binds to PD-1, preferably human PD-1, a. i. an amino acid sequence selected from the group consisting of amino acid residues 20 to 466 of SEQ ID NO: 43 or a variant thereof, and ii. amino acid residues 20 to 469 of SEQ ID NO: 47 or a variant thereof comprising a heavy chain, and b. i. amino acid residues 20 to 237 of SEQ ID NO: 48 or a variant thereof, ii. amino acid residues 20 to 237 of SEQ ID NO: 49 or a variant thereof, and iii. amino acid residues 20 to 237 of SEQ ID NO: 50 or a variant thereof comprising a light chain selected from the group consisting of is included.

[0176] In one embodiment, the present invention provides an isolated antibody or antibody fragment that binds to human PD-1, comprising a heavy chain comprising amino acid residues 20 to 466 of SEQ ID NO: 43 or a variant thereof, and / or a light chain comprising amino acid residues 20 to 237 of SEQ ID NO: 48 or a variant thereof.

[0177] In one embodiment, the present invention provides an isolated antibody or antibody fragment that binds to human PD-1, comprising a heavy chain comprising amino acid residues 20 to 466 of SEQ ID NO: 43 or a variant thereof, and / or a light chain comprising amino acid residues 20 to 237 of SEQ ID NO: 49 or a variant thereof.

[0178] In one embodiment, the present invention provides an isolated antibody or antibody fragment that binds to human PD-1 and comprises a heavy chain comprising amino acid residues 20 to 466 of SEQ ID NO: 43 or a variant thereof, and / or a light chain comprising amino acid residues 20 to 237 of SEQ ID NO: 50 or a variant thereof.

[0179] In one embodiment, the present invention provides an isolated antibody or antibody fragment that binds to human PD-1 and comprises a heavy chain comprising amino acid residues 20 to 469 of SEQ ID NO: 47 or a variant thereof, and / or a light chain comprising amino acid residues 20 to 237 of SEQ ID NO: 48 or a variant thereof.

[0180] In one embodiment, the present invention provides an isolated antibody or antibody fragment that binds to human PD-1 and comprises a heavy chain comprising amino acid residues 20 to 469 of SEQ ID NO: 47 or a variant thereof, and / or a light chain comprising amino acid residues 20 to 237 of SEQ ID NO: 49 or a variant thereof.

[0181] In one embodiment, the present invention provides an isolated antibody or antibody fragment that binds to human PD-1 and comprises a heavy chain comprising amino acid residues 20 to 469 of SEQ ID NO: 47 or a variant thereof, and / or a light chain comprising amino acid residues 20 to 237 of SEQ ID NO: 50 or a variant thereof.

[0182] In one embodiment, a variant of the antibody or antibody fragment of the present invention that binds to PD-1, preferably human PD-1, may comprise up to three, i.e., one, two, or three, conservative amino acid substitutions.

[0183] In one embodiment, the antibody or antibody fragment that binds to PD-1, preferably human PD-1, a. a human heavy chain constant region or a variant thereof, wherein the variant comprises up to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 conservative amino acid substitutions, a human heavy chain constant region or a variant thereof, and / or b. A human light chain constant region or a variant thereof, wherein the variant contains up to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 conservative amino acid substitutions, of the human light chain constant region or a variant thereof further comprises.

[0184] In one embodiment, the human heavy chain constant region of the antibody or antibody fragment of the invention that binds to PD-1, preferably human PD-1, may comprise a γ4 or γ1 human heavy chain constant region or a variant thereof, and the variant contains up to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 conservative amino acid substitutions.

[0185] In one embodiment, the antibody or antibody fragment of the invention that binds to PD-1 a. can bind to human PD-1 with a KD of about 100 pM or less, b. can bind to human PD-1 with a KD of about 30 pM or less, c. can bind to human PD-1 with a KD substantially the same as that of an antibody having a heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a light chain comprising the amino acid sequence of SEQ ID NO: 44, d. can bind to human PD-1 with a KD substantially the same as that of an antibody having a heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a light chain comprising the amino acid sequence of SEQ ID NO: 45, e. can bind to human PD-1 with a k 5 of about 7.5×10 assoc 1 / M·s or more, f. can bind to human PD-1 with a k 6 of about 1×10 assoc 1 / M·s or more, g. can bind to human PD-1 with a k -5 of about 2×10 dissoc 1 / s or less, h. can bind to human PD-1 with a k -5 of about 2.7×10 dissoc 1 / s or less, i. can bind to human PD-1 with a k -5 of about 3×10dissoc capable of binding and / or j. blocking the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC 50 of about 1 nM or less.

[0186] KD, k assoc , and k dissoc values can be measured using any available method. In a preferred embodiment, the dissociation constant is measured using a Biolite interference method (e.g., the ForteBio Octet method described in Example 2 on page 45 of WO 2008 / 156712 pamphlet). In other preferred embodiments, the dissociation constant can be measured using surface plasmon resonance (e.g., Biacore) or Kinexa.

[0187] Furthermore, in any embodiment, the antibody or antibody fragment of the present invention can block the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC 50 of about 1 nM or less. Blocking of ligand binding can be measured by any method known in the art, e.g., FACS or FMAT (fluorescent quantitative microassay technology) methods described in the "Ligand Blockage" section of Example 2 on pages 46 - 47 of WO 2008 / 156712 pamphlet, and the IC 50 can be calculated.

[0188] The present invention also includes an antibody or antibody fragment that competes with the binding of any antibody of the present invention targeting PD-1, preferably human PD-1, to an epitope on PD-1, and the antibody or antibody fragment a. binds to human PD-1 with a KD of about 100 pM or less, b. binds to human PD-1 with a KD of about 30 pM or less, c. binds to human PD-1 with a KD substantially the same as an antibody having a heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a light chain comprising the amino acid sequence of SEQ ID NO: 44, d. binds to human PD-1 with an approximately the same KD as an antibody having a heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a light chain comprising the amino acid sequence of SEQ ID NO: 45, e. binds to human PD-1 with a k 5 of 7.5×10 assoc 1 / M·s or more, f. binds to human PD-1 with a k 6 of 1×10 assoc 1 / M·s or more, g. binds to human PD-1 with a k -5 of 2×10 dissoc 1 / s or less, h. binds to human PD-1 with a k -5 of 2.7×10 dissoc 1 / s or less, i. binds to human PD-1 with a k -5 of 3×10 dissoc 1 / s or less, and / or j. blocks the binding between human PD-L1 or human PD-L2 and human PD-1 with an IC 50 of about 1 nM or less, and has one of the characteristics described above.

[0189] In one embodiment, the antibody or antibody fragment of the present invention that binds to PD-1, preferably human PD-1, is a. a chimeric antibody or a fragment thereof, b. a human antibody or a fragment thereof, c. a humanized antibody or a fragment thereof, and / or d. an antibody fragment selected from the group consisting of Fab, Fab’, Fab’-SH, Fv, scFv, F(ab’)2, and diabody and may be.

[0190] In one embodiment, the antibody or antibody fragment of the present invention that binds to PD-1, preferably human PD-1, can increase the activity of T cells.

[0191] In one embodiment, the antibody or antibody fragment that binds to human PD-1 is a monoclonal and / or humanized antibody, or a fragment of a monoclonal and / or humanized antibody. In one embodiment, the antibody or antibody fragment that binds to human PD-1 is a chimeric antibody or a fragment of a chimeric antibody. In one embodiment, the antibody that binds to human PD-1 is pembrolizumab (Keytruda) or a fragment thereof. In another embodiment, the antibody that binds to the EGF receptor, specifically ERBB2, is trastuzumab (Herceptin) or a fragment thereof.

[0192] The preparation of chimeric, human, humanized, or monoclonal antibodies, as well as methods for purifying antibodies, are known in the art and can be prepared, for example, as described in WO 2008 / 156712 pamphlet, the full text of which, particularly with respect to pages 27 - 31, is incorporated herein by reference.

[0193] In a further preferred aspect of the present invention, the agent effective for treating or preventing esophageal diseases is an anti-proliferative agent.

[0194] "The anti-proliferative agent used herein" refers particularly to a substance that prevents, blocks, reduces, lessens, or inhibits the cell proliferation and / or cell growth of cancer cells. This term also relates to an agent that is active in preventing, reducing, decreasing, or inhibiting the spread of cells, particularly malignant cells, to surrounding tissues. Thus, an anti-proliferative agent can interfere with the formation of metastases. This term can further relate to an agent that kills cells, particularly cancer cells. Agents include, but are not limited to, chemotherapeutic agents such as alkylating agents, antimetabolites, antitumor antibiotics, plant alkaloids, plant taxanes, platinum-based agents, or steroid hormones. The anti-proliferative agents described herein are known in the art and can be prepared according to any known method. The anti-proliferative agents described herein are also commercially available.

[0195] In one embodiment, the anti-proliferative agent is selected from the group consisting of taxanes, pyrimidine analogs, and platinum-based agents.

[0196] Taxanes belong to the class of diterpenes. They were first identified from natural sources, such as plants of the genus Taxus. Taxanes are poorly water-soluble, making their pharmaceutical formulation difficult. In principle, for the purposes of the present invention, although limited, any taxane can be used, including isolated natural taxanes, naturally modified taxanes, such as semi-synthetic taxanes, or first and / or second generation taxanes. Taxanes are mitotic inhibitors and are also known as spindle poisons. Taxanes inhibit the process of cell division by disrupting microtubule function and preventing microtubule depolymerization. In one embodiment, the taxane is selected from the group consisting of paclitaxel, docetaxel, and cabazitaxel, preferably paclitaxel. In one embodiment, the taxane is present within a carrier, such as a liposome, preferably a cationic liposome.

[0197] Pyrimidine analogs are heterocyclic organic compounds based on pyrimidine. Pyrimidine analogs are used in cancer treatment due to their antimetabolic activity. Specifically, pyrimidine analogs interfere with DNA production either by acting as components of DNA and incorporating nucleotides chemically modified in the growing DNA strand or by depleting the supply of deoxynucleotides required for DNA growth and DNA replication. Pyrimidine analogs halt normal cell division and interfere with tumor growth because tumor cells take more time for cell division than other cells. Thus, tumor cells are particularly affected by pyrimidine analogs. In a preferred embodiment, the pyrimidine analog is a uracil analog, preferably 5-fluorouracil, or capecitabine. In one embodiment, the pyrimidine analog is present within the nucleic acid carrier system described herein.

[0198] Platinum-based agents are coordination complexes of platinum and are used in the treatment of approximately half of the patients suffering from cancer. Without being bound by any theory, platinum-based agents cause DNA cross-linking, and the cross-links formed inhibit DNA repair and / or DNA synthesis. In a preferred embodiment, the platinum-based agent is selected from the group consisting of cisplatin or a salt thereof, carboplatin or a salt thereof, nedaplatin or a salt thereof, and oxaliplatin or a salt thereof. The platinum-based agent may further be selected from the group consisting of triplatin tetranitrate or a salt thereof, phenanthriplatin or a salt thereof, picoplatin or a salt thereof, and satraplatin or a salt thereof. The platinum-based agent may also include a platinum salt, preferably a cisplatin salt, a carboplatin salt, or an oxaliplatin salt.

[0199] The present invention provides a drug delivery system comprising an agent effective for the treatment or prevention of an esophageal disease described herein. The drug delivery system described herein may also include one agent or a combination (e.g., two or more different) of agents effective for the treatment or prevention of an esophageal disease described herein, or a further agent effective for the treatment or prevention of an esophageal disease.

[0200] For example, an inhibitory polynucleotide, antibody or antibody fragment, or anti-proliferative agent of the present invention can be combined with a treatment that is a standard treatment for cancer. The rationale for such a combination is that such a combination induces or promotes an initial clinical response to treatment by the standard treatment and induces a durable clinical response and long-term immune control of the disease.

[0201] In one embodiment, treatment with the inhibitory polynucleotide, antibody or antibody fragment of the present invention can be combined with chemotherapy. Chemotherapy results in the death of cancer cells, thereby increasing the release of tumor antigens. Such increased availability of tumor antigens can result in a synergistic effect with treatment with the inhibitory polynucleotide, antibody or antibody fragment of the present invention. One non-limiting example is provided by combining an inhibitory polynucleotide, antibody or antibody fragment, or antiproliferative agent, with the antiproliferative agent of the present invention. In one embodiment, treatment with the antiproliferative agent of the present invention can be combined with chemotherapy, i.e., an antiproliferative agent different from the antiproliferative agent of the present invention, to result in a synergistic effect.

[0202] In one embodiment, treatment with the inhibitory polynucleotide, antibody or antibody fragment, or antiproliferative agent of the present invention can be combined with radiotherapy. Radiotherapy induces the death of cancer cells, and an increase in the availability of presented tumor antigens, and the activation of immune cells. In another embodiment, treatment with the inhibitory polynucleotide, antibody or antibody fragment, or antiproliferative agent of the present invention can be combined with surgery to remove cancer cells from a subject.

[0203] Additional active pharmaceutical ingredient (API) The API within this dosage form can be administered together with additional API.

[0204] Additional API that may be present in addition to an agent effective for the treatment or prevention of esophageal disorders is referred to herein as "additional active pharmaceutical ingredient" or "additional active ingredient" or "additional API". In principle, any additional pharmaceutically active agent that enhances or increases the effectiveness of an agent effective for the treatment or prevention of esophageal disorders may be used. Such additional API can be selected by one of ordinary skill in the art, based on their general knowledge, according to the condition to be treated and / or prevented.

[0205] For example, the present invention also includes immune complexes comprising an antibody or antibody fragment of the present invention conjugated to a therapeutic agent such as a bacterial toxin, an anti-proliferative agent, or a radiotoxin. Non-limiting examples of cytotoxic agents include taxol, cytochalasin B, mitomycin, etoposide, and vincristine, or other antimetabolites, alkylating agents, antibiotics, and mitotic inhibitors. As used herein, "immune complex" refers to an antibody or fragment thereof conjugated to a therapeutic agent moiety such as a bacterial toxin, cytotoxic agent, anti-proliferative agent, or radiotoxin. The toxic moiety can be conjugated to the antibodies of the present invention using methods available in the art.

[0206] In some embodiments, the inhibitory polynucleotide, antibody or antibody fragment, or anti-proliferative agent of the present invention can be combined with a second therapeutic agent or treatment modality. In one embodiment, the inhibitory polynucleotide, antibody or antibody fragment, or anti-proliferative agent of the present invention can be combined with cancer treatment involving the application of a recombinant cytokine or secreted immune factor, or an additional anti-proliferative agent such as a taxane, pyrimidine analog, such as a fluoropyrimidine analog, or a platinum-based agent. Non-limiting examples of combinations include combinations of the inhibitory polynucleotide, antibody or antibody fragment, or anti-proliferative agent of the present invention with recombinant IL-2, a chemotherapeutic agent, or recombinant EFNα2. Recombinant IL-2 enhances T cell proliferation in the body of cancer patients. Recombinant EFNα2 inhibits cancer cell proliferation in the body of treated patients, but also increases the expression of the inhibitory ligand of PD-1 on cancer cells, antigen-presenting cells, and other somatic cells. The inhibitory polynucleotide, antibody or antibody fragment, or anti-proliferative agent of the present invention can be combined with other cytokines that may be useful in cancer treatment.

[0207] In certain embodiments, the antibodies or binding fragments thereof used in the present invention, such as antibodies targeting polypeptides encoding PD-1, preferably antibodies such as pembrolizumab (Keytruda) or fragments thereof that bind to human PD-1, or antibodies that bind to the EGF receptor, preferably trastuzumab or fragments thereof, are combined with platinum-based and / or fluoropyrimidine-based anti-proliferative agents for the treatment of esophageal diseases or disorders. In one embodiment, the platinum-based anti-proliferative agent is, for example, cisplatin. In one embodiment, the fluoropyrimidine-based anti-proliferative agent is 5-fluorouracil and / or capecitabine. In one embodiment, the esophageal disease or disorder is esophageal squamous cell carcinoma, preferably advanced or metastatic esophageal squamous cell carcinoma, more preferably esophageal squamous cell carcinoma having a PD-L1-expressing tumor, or esophageal adenocarcinoma / esophageal junction carcinoma, preferably advanced or metastatic esophageal adenocarcinoma, more preferably esophageal adenocarcinoma having a PD-L1-expressing tumor that may be HER-2 positive or HER-2 negative, such as esophageal cancer. In a preferred embodiment, the treatment is primary treatment.

[0208] Formulation In a preferred embodiment of the drug delivery system according to the present invention, the sheet-like formulation is an oblate or formed as an oblate. As used herein, the term "oblate" refers to a sheet that includes several layers and is used to encapsulate an agent effective for the treatment or prevention of esophageal diseases.

[0209] Such an oblate can follow the irregular surface contour of a predetermined site of action, particularly the esophageal mucosa, especially after the oblate absorbs the moisture contained in the esophageal mucosa. In addition, the sheet-like formulation of the dosage form according to the present invention can be gellable or swellable.

[0210] In a preferred embodiment of the drug delivery system according to the present invention, the thickness of the sheet-like formulation is 0.01 mm to 2 mm, preferably 0.03 mm to 1 mm, preferably 0.05 mm to 0.1 mm. This is beneficial for providing a relatively thin sheet-like formulation.

[0211] In a preferred embodiment of the drug delivery system according to the present invention, the sheet-like preparation has an area of 0.5 to 25 cm 2 , preferably 1 to 10 cm 2 .

[0212] The sheet-like preparation can have different shapes. In particular, the sheet-like preparation can have a round, triangular, square, or polygonal shape. In one embodiment, the opening is adapted to the respective shape of the preparation.

[0213] In a preferred embodiment of the drug delivery system according to the present invention, a sheet-like preparation, particularly a film-shaped, foil-shaped, or oblate-shaped preparation, containing an agent effective for the treatment or prevention of esophageal diseases contains an agent effective for the treatment or prevention of esophageal diseases in an amount of 0.0001 to 50% by weight, preferably 0.001 to 25% by weight, most preferably 0.01 to 10% by weight.

[0214] The sheet-like preparation containing an agent effective for the treatment or prevention of esophageal diseases can have a single-layer or multi-layer structure, and at least one (preferably the first) layer contains an agent effective for the treatment or prevention of esophageal diseases.

[0215] In a preferred embodiment, the sheet-like preparation has a multi-layer structure of multiple layers, at least one first layer contains an agent effective for the treatment or prevention of esophageal diseases, and at least one additional layer contains at least one additional pharmaceutically active ingredient, which is either an agent effective for the treatment or prevention of the same or different esophageal diseases or is not an agent effective for the treatment or prevention of esophageal diseases such as steroids.

[0216] In a preferred embodiment, the layer containing an agent effective for the treatment or prevention of esophageal diseases and / or the additional layer containing an additional pharmaceutically active ingredient includes a polymer, preferably a film-forming polymer.

[0217] The polymer in the layer can function simply as a carrier for an agent effective in the treatment or prevention of esophageal diseases and / or additional APIs, or can function as a reservoir thereof. Such a layer can release an agent effective in the treatment or prevention of esophageal diseases and / or additional pharmaceutically active ingredients under the influence of a fluid. The agent effective in the treatment or prevention of esophageal diseases and / or additional APIs may be released immediately or in a sustained release manner.

[0218] In a preferred embodiment of the drug delivery system according to the present invention, the sheet-like formulation comprises at least one first layer containing an agent effective in the treatment or prevention of esophageal diseases, and / or a further layer containing an agent effective in the treatment or prevention of esophageal diseases and / or additional APIs, wherein the at least one first layer and / or the further layer is an adhesive layer.

[0219] In a preferred embodiment of the drug delivery system according to the present invention, the at least one first layer containing an active ingredient and / or the further layer containing an active ingredient comprises a polymer, preferably a film-forming polymer, and the polymer is a water-dispersible and / or hydrolyzable and / or water-disintegrable film-forming polymer.

[0220] The polymer of the first layer containing the active substance and / or the polymer of a further layer containing the active substance may in particular be selected from the group comprising polyvinyl alcohol, polyvinylpyrrolidone, polyvinyl acetate, polyethylene glycol, polyethylene oxide polymer, polyurethane, polyacrylic acid, polyacrylate, polymethacrylate, poly(methyl vinyl ether-maleic anhydride), starch, starch derivatives, natural gums, alginates, pectin and gelatin, pullulan, proteins forming gels, chitosan, agar, agarose, carrageenan, xanthan, tragacanth, dextran, and cellulose ethers such as ethyl cellulose, hydroxyethyl cellulose, propyl cellulose, carboxymethyl cellulose, sodium-carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxypropylethyl cellulose, cellulose acetate, povidone, and copovidone. In a preferred embodiment, the polymer is polyvinyl alcohol, preferably polyvinyl alcohol 18-88.

[0221] The polymers can be used individually or in combination to produce a sheet-like formulation for a dosage form according to the invention having the desired properties as adhesion, release, or disintegration properties. The sheet-like formulation according to the invention can consist of one polymer layer.

[0222] The sheet-like formulation for a dosage form according to the invention can also have a structure of two or more layers, in which case at least one of these layers contains, optionally in combination with a nucleic acid delivery system and / or a further excipient for stabilizing an agent effective for the treatment or prevention of esophageal diseases, an agent effective for the treatment or prevention of esophageal diseases. It is also possible for the plurality of layers to contain either an agent effective for the treatment or prevention of esophageal diseases or an additional API.

[0223] In a preferred embodiment of the drug delivery system according to the present invention, the sheet-like formulation containing an anti-proliferative agent comprises or consists of a single-layer structure, and the (preferably first) layer contains, preferably is coated with, an anti-proliferative agent, preferably paclitaxel. The layer comprises a polymer, preferably a film-forming polymer, and the polymer is a water-dispersible and / or hydrolyzable and / or water-disintegrating film-forming polymer. The polymer is a polymer described herein, preferably polyvinyl alcohol, preferably polyvinyl alcohol 4-88 or polyvinyl alcohol 18-88. The layer further comprises additives such as plasticizers described herein, preferably glycerol, and surfactants, preferably lauryl alcohols such as ethoxylated lauryl alcohol. Such surfactants are commercially available and include, but are not limited to, Brij™ L23. The purpose of the surfactant is to provide further stability by reducing hydrolysis and adsorption to undesirable substances.

[0224] In a further preferred embodiment of the drug delivery system according to the present invention, the sheet-like formulation containing an inhibitory polynucleotide comprises or consists of a single-layer structure, and the (preferably first) layer contains, preferably is coated with, an inhibitory polynucleotide, preferably siRNA, an antisense oligonucleotide, or an aptamer, optionally combined with a nucleic acid delivery system. The layer comprises a polymer, preferably a film-forming polymer, and the polymer is a water-dispersible and / or hydrolyzable and / or water-disintegrating film-forming polymer. The polymer is a polymer described herein, preferably polyvinyl alcohol, preferably polyvinyl alcohol 18-88. The layer further comprises additives described herein, such as plasticizers, preferably glycerol, and / or stabilizers, preferably sucrose.

[0225] In a further preferred embodiment of the drug delivery system according to the present invention, the sheet-like formulation containing the antibody comprises or consists of a single-layer structure, and the (preferably first) layer contains the antibody and is preferably coated with the antibody. The layer contains a polymer, preferably a film-forming polymer, and the polymer is a water-dispersible and / or hydrolyzable and / or water-disintegrable film-forming polymer. The polymer is a polymer described herein, preferably polyvinyl alcohol, preferably polyvinyl alcohol 18-88.

[0226] In another preferred embodiment of the drug delivery system according to the present invention, the sheet-like formulation containing an agent effective for the treatment or prevention of esophageal diseases comprises at least one first active ingredient-free layer that does not contain the drug active ingredient.

[0227] In a preferred embodiment of the drug delivery system according to the present invention, the sheet-like formulation, particularly in the form of a film, foil, or oblate, containing the drug active ingredient comprises at least one additional active ingredient-free layer that does not contain the drug active ingredient.

[0228] In a preferred embodiment of the drug delivery system according to the present invention, the first active ingredient-free layer and / or at least one additional active ingredient-free layer are non-water-soluble layers, preferably selected from the group consisting of ethyl cellulose and / or a combination of ethyl cellulose and other non-water-soluble substances, a hydrophobic plasticizer, particularly triethyl citrate, and / or a dye, and / or a fragrance, and / or a flavoring agent.

[0229] In particular, the use of ethyl cellulose can be beneficial due to its properties including good processability, biocompatibility, and non-water-solubility.

[0230] In a preferred embodiment of the drug delivery system according to the present invention, the first active ingredient-free layer and / or at least one additional active ingredient-free layer are adhesion layers of a desired thickness.

[0231] The adhesion layer can be a mucoadhesive polymer selected from the group including cellulose derivatives such as hydroxypropyl cellulose, starch and starch derivatives, polyvinyl alcohol, polyethylene oxide, polyethylene, polypropylene, polyacrylic acid and polyacrylate derivatives, polyvinyl pyrrolidone, povidone, copovidone, sodium alginate, gelatin, xanthan gum, carrageenan, pectin, dextran, lectin, chitosan, pullulan, and mixtures thereof.

[0232] In addition or alternatively, the adhesion layer can include a solvent selected from the group including water, ethanol, methanol, acetone, organic solvents, and mixtures thereof.

[0233] Furthermore, the formulation may additionally contain additives such as colorants, fragrances, flavorings, preservatives, antioxidants, penetration enhancers, solubilizers, disintegration accelerators, pore formers, lubricants, stabilizers, and mixtures thereof. In particular, the following substances: lubricants, lubricants, flow accelerators, binders, additional active ingredients, disintegrants, antioxidants, chelating agents, coating agents, flow agents, preservatives, fillers, surfactants, plasticizers, stabilizers, and pigments are suitable as additives. Furthermore, the additives include the following groups: pore formers, penetration enhancers, solubilizers, polyethoxylated sorbitan fatty acid esters, ethoxylated fatty alcohols, and emulsifiers including lecithin; plasticizers including polyethylene glycol, glycerol and other polyhydric alcohols, higher alcohols such as dodecanol, undecanol, or octanol, sorbitol, mannitol and other sugar alcohols, dexpanthenol and triglycerides; fillers including highly dispersible silicon dioxide, titanium oxide, zinc oxide, chalk, and starch; colorants; sweeteners and flavorings; wetting agents; preservatives; pH adjusters and antioxidants; disintegration accelerators; penetration enhancers that improve the absorption of the pharmaceutically active ingredient into the mucosa, such as cell uptake, such as fatty acids, and their salts, and fatty acid esters, preferably saturated fatty acids such as octanoic acid (C8), decanoic acid (C10), octadecanoic acid (C18), or unsaturated fatty acids such as oleic acid (C18), S-acetylcysteine (NAC) or its salts, terpenes, glycolipids, medium-chain triglycerides, synthetic waxes such as isopropyl myristate, branched fatty alcohols such as eutanol G (registered trademark), urea, polypropylene glycol, dimethyl sulfoxide, azone, azone analogs, polyhydric alcohols such as propanediol, tocopherol, or essential oils such as menthol, may be more preferably selected. A preferred plasticizer is glycerol.

[0234] The sheet-like preparation may further contain at least one flavoring additive. This advantageously enables hiding bitter or otherwise unpleasant-tasting pharmaceutically active ingredients, but may also be beneficial for accelerating the manifestation of the effects of the pharmaceutically active ingredients. Flavoring additives are known to those skilled in the art. Such flavoring additives may include, in particular, sugar alcohols selected from mannitol, sorbitol, xylitol, maltitol, lactitol, erythritol, trehalose, and isomalt, and sodium hydrogen carbonate.

[0235] In particular, additives such as penetration enhancers can improve the local utility of the active ingredient.

[0236] According to a preferred embodiment, the drug delivery system according to the present invention, in particular the sheet-like preparation, is intended to enable a time-delayed release of the active ingredient. An agent effective for the treatment or prevention of esophageal diseases is preferably released over 4 hours, preferably over 6 hours, and most preferably over 8 hours. In the case of a two-layer or multi-layer preparation, at least one layer containing an agent effective for the treatment or prevention of esophageal diseases, in particular a polymer layer, has a delayed release of the active ingredient to achieve a delayed release of the active ingredient.

[0237] For the delayed release of the active ingredient, the film-shaped medicament is preferably formulated as a slowly soluble or slowly disintegrating film that completely disintegrates or dissolves only after several hours. Preferably, they completely disintegrate or completely dissolve only after 4 hours, preferably only after 6 hours, even more preferably only after 8 hours, or even only after 24 hours.

[0238] In particular, an agent effective for the treatment or prevention of esophageal diseases and optionally additional APIs present are released within a period of 15 minutes to 24 hours, 2 hours to 24 hours, 3 hours to 12 hours, 4 hours to 8 hours, or 5 to 6 hours.

[0239] The sheet-like preparation can be prepared by a method basically known to those skilled in the art, for example, a liquid composition containing a polymer, an agent / additional pharmaceutically active ingredient effective for the treatment or prevention of esophageal diseases, and optionally additives, and a solvent, and coating an inert support by a method involving a doctor blade (for example, the solvent casting method), a spray processor, or an extrusion processor. The thin film layer obtained by such a method is dried. In the case of a multilayer sheet-like preparation, one or more coatings can be applied to the existing film layer as well, or they can be separately manufactured and then laminated.

[0240] During the manufacture of the preparation, it may be necessary to take into account the temperature sensitivity, pH sensitivity, enzymatic stability, and / or solubility of the agent effective for the treatment or prevention of esophageal diseases used. Naturally, the characteristics inherent to the pharmaceutically active ingredient should also be considered throughout the entire process of manufacturing the drug delivery device. Thus, and in addition, from the perspective of the required low dose, an impregnation method can be used. In such a method preferred in the present invention, a solution containing an agent effective for the treatment or prevention of esophageal diseases is simply applied, for example sprayed or dropped, onto the polymer film, and finally dried. Such methods are known to those skilled in the art and are described in the examples provided herein.

[0241] In another example, an agent effective for the treatment or prevention of esophageal diseases can be incorporated so as to be embedded in a polymer film, for example by the solvent casting method.

[0242] In all of these methods, consideration is required for the solvents used and the drying conditions. As a very simple drying method, lyophilization can be used.

[0243] Furthermore, depending on the stability of the agent effective for the treatment or prevention of esophageal diseases to be incorporated, for example as described in Example 5 herein, melt extrusion of the polymer and the agent effective for the treatment or prevention of esophageal diseases is also conceivable. Alternatively, a solution containing an agent effective for the treatment or prevention of esophageal diseases can be applied to the polymer film by the inkjet method.

[0244] In one embodiment, the formulation is manufactured such that an agent effective for treating or preventing esophageal diseases is present only in a specific portion within the film, thereby enabling mucosal treatment of only the individualized designated area.

[0245] Alternatively, and preferably, a first region of the sheet-like formulation can contact the esophageal mucosa, and a second region of the sheet-like formulation can contact the buccal mucosa. In this way, while the esophageal mucosa can be treated with an agent effective for treating or preventing esophageal diseases, the buccal mucosa can be treated, not treated, or additives can be released to the buccal mucosa with an agent effective for treating or preventing a second esophageal disease, an additional API. In particular, flavorings and / or local anesthetics can be released, thereby in particular increasing or decreasing saliva production, and / or making the application of the drug delivery system more comfortable, and / or suppressing nausea. Alternatively, a first region of the sheet-like formulation can contact the esophageal mucosa, and a second region of the sheet-like formulation can contact the mucosa of the upper stomach such as the cardia, or the mucosa of the cardia and the fundus of the stomach. Therefore, it becomes possible to locally treat each part of the esophagus and the stomach.

[0246] In another preferred embodiment, the drug delivery system, particularly the capsule device, includes a weight device. The weight device is configured to provide negative buoyancy to the capsule device. In the experiments of the inventors underlying the findings of this preferred embodiment, it has been found that, for example, reducing buoyancy by increasing the mass of the capsule device increases the reliability of the mechanical process by which the formulation unfolds from the miniaturized state to the deployed state. In the case of an elongated strip-like formulation, it has become significantly easier and more efficient for the elongated strip-like formulation to unwind from the state where it is wound around a spool to the unwound and deployed state. The problem underlying this preferred embodiment is that malfunctions are sometimes observed during the transition of the formulation from the miniaturized state to the deployed state. The present invention already improves the efficiency of unfolding or, individually, unwinding by providing a gap between the opening and the formulation, but the weight device further increases the efficiency of unfolding. Also, it is presumed that even if the patient swallows appropriately in the presence of water or an aqueous solution, the capsule device will not be completely filled with water, and air bubbles may remain inside the capsule device. That air contributes to buoyancy, and the weight device assists in counteracting the buoyancy effect by assisting in expelling the air or by utilizing gravity through the use of a material denser than water. Further details regarding the weight can be inferred from WO 2020 / 183005, which is incorporated herein by reference.

[0247] A preferred embodiment of the drug delivery system according to the present invention is adapted to be applied to the nasopharyngeal mucosa.

[0248] When a sheet-like formulation locally and / or over a long period of time releases an agent effective for the treatment or prevention of esophageal diseases, optionally together with additional APIs, the response to treatment can be improved, and in particular, the local effect of the agent effective for the treatment or prevention of esophageal diseases can be enhanced, for example, by a penetration enhancer. Such penetration enhancers are known in the art. Furthermore, particularly because the area of action spatially expands, the need for systemic administration can be reduced.

[0249] In a preferred embodiment of the drug delivery system according to the present invention, the sheet-like preparation has an area and / or surface area greater than 0.5 cm 2 and preferably greater than 2 cm 2 and preferably greater than 5 cm 2 and preferably greater than 5 cm and less than 15 cm 2 and preferably greater than 0.5 cm 2 and preferably less than 40 cm 2 Preferably, the ratio of the length of the sheet-like preparation to the width of the sheet-like preparation is from 40:1 to 400:1, or preferably from 60:1 to 300:1, or preferably from 80:1 to 200:1. The width can be, for example, the average of the widths of the sheet-like preparation measured perpendicular to the length of the sheet-like preparation. The ratio can be the ratio of the length of the sheet-like preparation to the perimeter of the sheet-like preparation, particularly its average, and the perimeter can be, for example, twice the width of the sheet-like preparation in the case of an elongated sheet-like preparation.

[0250] In a particular embodiment of the drug delivery system according to the present invention, the sheet-like preparation is in a solid state, particularly while in a small form and / or immediately after release. This can usefully enhance, enable, or facilitate some of the advantages described above. In particular, this can enhance the storage stability when the sheet-like preparation is in a solid state before release. In particular, this can enhance and / or enable the targeted and / or sustained release of an agent effective in the treatment or prevention of esophageal diseases when the sheet-like preparation is in a solid state after release. Additionally, or alternatively, in a particular embodiment of the drug delivery system according to the present invention, the sheet-like preparation is made to dissolve, for example, undergo in vivo degradation, immediately after release, after a delay, in a time-controlled manner, or upon receiving a stimulus. This can usefully enhance, enable, or facilitate some of the advantages described above. In particular, this can improve the user convenience since there is no need to recover the sheet-like preparation.

[0251] Additionally, or alternatively, in certain embodiments of the dosage forms according to the present invention, the sheet-like formulation is preferably made to dissolve, e.g., undergo in vivo degradation, in a time-controlled manner, e.g., within 1 hour, or within 1 - 2 hours, or within 1 - 5 hours, or within 1 - 12 hours, or within 1 - 24 hours. This improves user convenience as there is no need to retrieve the sheet-like formulation.

[0252] Applicator / Holder In one embodiment, an applicator having a holder functions to assist in the swallowing of a capsule device in combination with a drinking cup. The applicator used in combination with the drinking cup enables the patient to ingest the drug delivery system as if drinking from a bottle. Thus, the applicator is placed in the drinking cup as a mouthpiece. The drug delivery system is located within the holder of the applicator. When drinking, the liquid in the drinking cup flows through the applicator and the holder therein, thereby releasing the formulation from the holder and transporting it into the patient's mouth, which the patient then swallows. The string member is the holder and is wound around the holder. The string member is further connected to the holder and the formulation end, and the formulation end extends through the opening. Thus, when the formulation exits the holder during drinking, the holder unwinds until it is taut. Thereby, a force is exerted on the formulation, and the formulation is pulled out of the capsule.

[0253] Such applicators and drinking cups are described, for example, in PCT / EP2020 / 056927, and with respect to the applicator, drinking cup, and string, the entire content thereof is incorporated herein by reference in its entirety. Such holders are further described, for example, in European Patent No. 21175427.0 and European Patent No. 21175436.1, and with respect to the holder, the entire content thereof is incorporated herein by reference in its entirety.

[0254] In a preferred embodiment, the retainer is wrapped around the support structure of the holder, with one end of the retainer attached to the support structure and the other end connected to the formulation of the capsule device. Thus, the capsule device is positioned and held within the applicator holder. When the patient swallows the dosage form, the retainer begins to disengage from the support structure. Since the applicator and the support structure have a cylindrical shape such that the support structure fits within the applicator and is rotatably installed, in particular, within the applicator, the retainer can be disengaged from the structure by rotating the structure.

[0255] This is particularly beneficial as it enables the administration of the capsule device without the assistance of a professional, especially when the dosage form is administered regularly, particularly daily.

[0256] In a preferred embodiment of the drug delivery system according to the present invention, the release mechanism includes a retainer, which is preferably a string that can be deployed from a compact form to a deployed form and is connected to one end of the formulation that protrudes from the capsule device.

[0257] Exemplary embodiments of the present invention are described in more detail below with reference to the accompanying drawings and samples, from which further features, advantages, and embodiments may be known.

Brief Description of the Drawings

[0258]

Fig. 1a-b

Fig. 2

Fig. 3

Fig. 4

Fig. 5a-b

Fig. 6

Fig. 7

Fig. 8a-b

Fig. 9a-b

Fig. 10a-b

Fig. 11

Fig. 12

Fig. 13

Fig. 14

Fig. 15

Fig. 16

Fig. 17a-b

Fig. 18a-b

Fig. 19

Fig. 20

[0259] Figure 1a shows a schematic view of a drug delivery system 1 having a capsule device 2 in which a first capsule shell half 2a and a second capsule shell half 2b are fitted together to form an opening 3. A formulation 4 in a compact form is shown within the capsule 2, with one end 4a of it extending from the opening 3. The direction of movement of the formulation 4 when it is drawn out from the capsule 2, i.e., from the first capsule shell half 2a, through the opening 3, is indicated by an arrow. In Figure 1a, an opening 3 is shown which is formed laterally with respect to the central axis A of the capsule 2 and is disposed in the first capsule shell half 2a. In Figure 2b, an opening 3 is shown which is formed along the central axis A of the capsule 2 and is disposed in the first capsule shell half 2a.

[0260] Figure 2 shows a schematic view of the formulation 4 in a partially expanded form. A formulation 4 having a sheet-like shape is depicted. The central region of the formulation 4 is indicated by a dashed line in order to show, in Figure 2, essentially the end 4a of the formulation 4 protruding from the opening 3 of the capsule device 2 and the end 4b of the formulation 4 which is still slightly coiled. The coiled end 4b represents the compact form of the formulation 4. At the end 4a extending from the opening 3, a holding device 5 is shown. The holding device 5 includes an elongate piece 5a. The elongate piece 5a functions as a connector connecting the holding device 5 and the end 4a of the formulation 4 in the embodiment shown in Figure 2. Alternatively, the end 4a of the formulation 4 is directly connected to a holding body, such as a string. In such an embodiment, the holding devices 5, 5a are formed by the holding body itself.

[0261] Figure 3 shows this preferred embodiment. The end 4a of the formulation 4 having a sheet-like shape is shown, where a holding body 6 overlaps with the end portion having the length d of the formulation 4 and forms the holding devices 5, 5a. The connection between the holding body 6 and the end 4a of the formulation 4 is made such that, for example, when the holding body 6 is stretched upon swallowing of the dosage form 1, a pulling force can be transferred through this connection and the formulation 4 can be drawn out from the capsule device 2.

[0262] Figure 4 shows a formulation 4 divided into several layers. In the embodiment shown in Figure 4, the formulation is an oblate containing three separate layers 7. One upper layer 7a is formed as an adhesion layer, the central layer 7b contains an agent effective for the treatment or prevention of esophageal diseases, and the layer depicted at the bottom in Figure 4 represents a protective layer, for example, a protective layer against water.

[0263] Figures 5a and 5b respectively show schematic views of a capsule device 2 of a drug delivery system 1 having an opening 3 formed by overlapping wall portions 9 or by fitting two capsule shell halves 2a and 2b into each other. As shown in Figure 5a, the first capsule shell half 2a is slid over the second capsule shell half as indicated by the dashed line. The second capsule shell half includes a recess 8. By partially overlapping and sliding the two halves 2a and 2b over each other, the first capsule shell half 2a partially covers the recess 8 of the second capsule shell half 2b. Thereafter, the further provided wall portion 9 covers the remaining opening space formed by the recess 8, and thus the opening 3 is formed as an opening through which the formulation 4 can exit the shell 2.

[0264] Alternatively, Figure 5b shows an embodiment in which the two capsule shell halves 2a and 2b overlap at the joining position to such an extent that one wall of the first capsule shell half, particularly a cylindrical wall, overlaps the opening 10 of the second capsule shell half 2b to form the opening 3.

[0265] Figure 6 shows a translucent schematic view of the drug delivery system 1. The first and second half capsule shells 2a, 2b are joined at the joining position, thereby forming an opening 3 by covering the opening 10 of the second half capsule shell 2b at this position. The end portion 4a of the formulation 4 extending through the opening 3 is shown. The pharmaceutical dosage form 1 further includes a weight element 11, and the weight element 11 is within the first half capsule shell 2a. The weight extends from the first half capsule shell 2a into the second half 2b, but a step 11a protrudes from the outside to the inner space of the capsule device 2 to position the weight 11 and prevent the weight from moving within the capsule. In Figure 6, the formulation 4 located below the weight 11 is shown. The step prevents the weight 11 from slipping into the formulation 4.

[0266] Figure 7 shows a schematic view of an applicator 12 having a holder 13 and a retainer 6 wound around the holder 13, with the drug delivery system 1 located within the holder 13. The applicator and the holder preferably have a cylindrical shape. The capsule device 2 is located within the holder 13, with the first half 2a facing towards the applicator cap 12a. The cap 12a is removed during use. In the embodiment shown in Figure 7, the capsule device 2 further includes a weight 11 within the first half capsule shell 2a and a formulation 4 within the second half capsule shell 2b. In the embodiment shown in Figure 7, the first half capsule shell 2a is further pressed towards the bottom of the applicator 12. Thus, a curved holder 13a is located above the capsule device 2. The holder 13a is curved such that its shape follows the shape of the first half capsule shell 2a. Pushing the capsule 2 into the holder 13 is achieved by a compression spring 14, one end of which is attached to the cap 12a of the applicator 12 and the other end is attached to the curved holder 13a. A drying element 15 is located within the applicator 12, at the cap 12a of the applicator 12. This prevents the formulation 4 from being damaged by moisture. The applicator 12 does not necessarily include the curved holder 13, the drying element 15, or the compression spring 14.

[0267] Figures 8a and 8b respectively show schematic diagrams of the drug delivery system 1 before swallowing (Figure 8a) and during swallowing (Figure 8b) when the patient ingests the drug delivery system using the applicator and the drinking cup. Figure 8a shows the administration of the drug delivery system including the capsule device 2 described herein by the patient. The drinking cup 16 is filled with liquid and the applicator 12 is attached to the cup 16. The applicator 12 includes the holder 6 and the drug delivery system 1, the drug delivery system 1 further includes the capsule device 2, the holder 6 is connected to the formulation 4, and the formulation 4 is at least partially coiled within the capsule device 2. Figure 8b illustrates the procedure when the dosage form 1 is sent towards the stomach through the esophagus when the patient swallows the dosage form 1. The holder 6 pulls the formulation 4 out of the capsule device 2. Then the formulation 4 spreads along the esophagus and the active ingredient of the dosage form 1 is delivered to the esophageal mucosa.

Description of Reference Numerals

[0268] 1 Drug delivery system 2 Capsule device 2a First half of the capsule shell 2b Second half of the capsule shell 3 Opening 4 Formulation 4a Formulation end extending from the opening 4b Coiled formulation end 5 Holding device 5a Elongated piece 6 Holder 7 Layer 7a Adhesive layer 7b Drug active ingredient-containing layer 7c Protective layer 8 Dimple 9 Wall portion 10 Opening 11 Weight element 11a Step 12 Applicator 12a Applicator cap 13 Holder 13a Curved holder 14 Spring 15 Drying element 16 Drinking cap

[0269] Abbreviation list: hPD-1.08 Mouse monoclonal anti-hPD-1 antibody hPD-1.09 Mouse monoclonal anti-hPD-1 antibody 109A-H Humanized IgG1 09A heavy chain sequence without reverse mutation 409A-H Humanized IgG4 09A heavy chain sequence without reverse mutation in the antibody framework region K09A-L-11 Humanized 09A-kappa sequence with a framework originally having a CDR1 length of 11aa K09A-L-16 Humanized 09A-kappa sequence with a framework originally having a CDR1 length of 16aa K09A-L-17 Humanized 09A-kappa sequence with a framework originally having a CDR1 length of 17aa

Example 1

[0270] Example 1: Preparation of a polymer film using paclitaxel A "base polymer mixture" was prepared with the components and amounts listed in Table 2 without adding paclitaxel. After film preparation, the film was coated with paclitaxel.

[0271] JPEG2025519490000004.jpg56163

[0272] A polymer film was prepared using the solvent casting method according to the following protocol.

[0273] Solvent casting method: 1. Preparation of polymer mixture 2. Preparation of film laminate 3. Cutting of wet laminate 4. Coating of wet laminate 5. Drying at room temperature

[0274] The obtained film was flexible, bubble-free, visually homogeneous, and showed a uniform film surface.

[0275] Furthermore, the paclitaxel content of the film was analyzed. For this purpose, five circular samples with a size of 1 cm 2 were cut out at random positions on the film, dissolved in Brij® L23-buffer / methanol (MeOH), and HPLC analysis was performed using Hypersil ODS 150×4.6 mm as the stationary phase and acetonitrile / phosphate buffer as the mobile phase. The HPLC results are shown in Fig. 11 in comparison with blank film samples and calibration samples. From the comparison between the results of the film samples loaded with the API and the results of the calibration samples, it was confirmed that paclitaxel can be stably prepared in the film used for the drug delivery device of the present invention.

[0276] Furthermore, the paclitaxel content on the film was as shown in Table 3.

[0277] JPEG2025519490000005.jpg42114

[0278] From the results of Table 3, it can be seen that a loading of about 0.2 μg is possible for a 1 cm 2 film. It should be noted that the standard deviation and the maximum drug loading are determined by the process technology and are not intended to indicate any limitation in principle.

[0279] Paclitaxel is insoluble in water and has poor absorbability. Nevertheless, the inventors of the present invention were able to surprisingly show a stable loading of paclitaxel into the film that can be used in the drug delivery system of the present invention. Furthermore, in the art, the parenteral administration of paclitaxel for chemotherapy is 220 mg / m with a 3-week drug-free period 2requires high doses and is accompanied by side effects such as hair loss, nausea, vomiting, diarrhea, changes in blood cell counts, neuropathy, and muscle pain. Local and / or topical administration of paclitaxel by the drug delivery system of the present invention enables improved local administration to the target site, thereby increasing the value of the drug particularly in the treatment of esophageal diseases.

Example 2

[0280] Example 2: Preparation of Polymer Films Using RNA To test the stability of RNA as a drug active ingredient in the drug delivery system of the present invention, the following sequence: 5’ UGC GCA GAA UGA GAU GAG UUG 3’ (SEQ ID NO: 25) was synthesized.

[0281] A "base polymer mixture" was prepared without adding paclitaxel with the components and amounts listed in Table 4.

[0282] JPEG2025519490000006.jpg38122

[0283] Polymer films were prepared using the solvent casting method according to the following protocol.

[0284] Solvent Casting Method 1. Preparation of "base polymer mixture" 2. Sterilization 3. Preparation of film laminate 4. Drying 5. Cutting (A = 0.25 cm 2 ) 6. Application of RNA sample to polymer film 7. Drying of final sample Points 3 to 7 were carried out under aseptic conditions.

[0285] The stability of RNA on the film was analyzed using a 20% denaturing polyacrylamide (PAA) gel. As shown in Figure 12, the film has no effect on the stability of RNA. This experiment was repeated with commercially available siRNA. The inventors observed equivalent stability with a commercially available siRNA targeting IL-6 (Thermo Fisher; Figure 13).

[0286] The stability of RNA on the film before and after film solubilization was further analyzed. As shown in Figure 14, the storage of dry samples on the film has no effect on the stability of RNA, indicating that drug delivery devices containing RNA as an active pharmaceutical ingredient have storage stability. Storage after film solubilization showed slight degradation of RNA in the solvent, which could be covered by the addition of a ribonuclease inhibitor (Figure 15).

[0287] What these results show is that RNA remains stable after coating on the film and under various storage conditions, and thus can be used as an active pharmaceutical ingredient together with a drug delivery system, thereby providing a novel therapeutic option for the drug delivery system, particularly in the treatment of esophageal diseases.

Example 3

[0288] Example 3: Analysis of the stability of antisense RNA against BMP2 on the film under various coating conditions and storage conditions To test the stability of antisense RNA against BMP2 as an active pharmaceutical ingredient in the drug delivery system of the present invention, the following sequence: 5’-AUU UCG AGU UGG CUG UUG C-3’ (SEQ ID NO: 23) (where an overhang consisting of UU (two uridine nucleotides) is attached to the 3’ end) was synthesized.

[0289] In the stability experiment, this sequence was used in non-labeled and labeled forms (labeled with the dye Atto633 attached to the 3’ end to visualize the ribonucleic acid during preparation (Figure 10)).

[0290] As described in Example 2, except that PVA 4-88 was used instead of PVA 18-88, a film containing antisense RNA against BMP2 was prepared.

[0291] The stability of antisense BMP2 RNA under various coating conditions shown in FIG. 16 and the legend of FIG. 16 was analyzed. 10 pmol of each probe was loaded onto a 20% denaturing polyacrylamide gel. Gel electrophoresis was performed at 140 volts for 3 hours, followed by staining with SYBR Gold for 20 minutes.

[0292] The stability of labeled antisense BMP2 RNA under various coating conditions shown in FIG. 17 and the legend of FIG. 17 was analyzed in comparison with unlabeled antisense BMP2 RNA. 5 pmol of the probe was loaded onto a 20% denaturing polyacrylamide gel in lanes 1-5, and 10 pmol of each probe was loaded in lanes 4-6. Gel electrophoresis was performed at 140 volts for 3 hours, followed by staining with ethidium bromide for 30 minutes (FIG. 17a), or excitation with light at a wavelength of 630 nm and measurement of luminescence at 675 nm (FIG. 17b). The band of labeled BMP2 RNA in FIG. 17b corresponds to the band of unlabeled BMP2 RNA in FIG. 17a. Since unlabeled BMP2 RNA does not have a fluorescent marker, the band of unlabeled BMP2 RNA is not visible in FIG. 17b.

[0293] The stability of labeled antisense BMP2 RNA after storing the dry film at 4°C for 10 days was analyzed in comparison with unlabeled antisense BMP2 RNA. The probe was loaded onto a 20% denaturing polyacrylamide gel. Gel electrophoresis was performed at 140 volts for 3 hours, followed by staining with ethidium bromide for 30 minutes (FIG. 18b), or excitation with light at a wavelength of 630 nm and measurement of luminescence at 675 nm (FIG. 18a). The band of labeled BMP2 RNA in FIG. 18a corresponds to the band of unlabeled BMP2 RNA in FIG. 18b.

[0294] The results can be summarized as follows: After applying BMP2 RNA to the film, no differences were observed between the test samples and the stock samples in each of the individual experiments. This also applies to the labeled samples with increased sensitivity. BMP2 RNA is not degraded by the film. Slight bending of the bands in the gel can be explained by the presence of the polymer in the gel. The polymer did not have a negative impact on the stability of RNA at each of the time points tested in the experiment. Even after storing the dry film at 4 °C for 10 days, no RNA degradation was observed. The above results indicate that the drug delivery system of the present invention is suitable for the administration of RNA, expanding new treatment options for the drug delivery system.

Example 4

[0295] Example 4: Encapsulation of RNA in Liposomes Preparation of Liposomes Liposome preparation was carried out by the thin-film hydration (TLH) method based on the protocol of Bangham [1]. For this purpose, a chloroform solution containing an appropriate amount of 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) was placed in a glass tube and dried under a nitrogen stream. To dry thoroughly, the sample was incubated overnight under reduced pressure.

[0296] The dried lipid film was dissolved in 1 mL of Tris-HCl (pH 8) containing 250 mM sucrose (1.66 mg / mL).

[0297] Next, the vesicles were frozen 8 times in liquid nitrogen and thawed at 54 °C. Homogenization was carried out using the extrusion method with a 100 nm polycarbonate membrane.

[0298] Encapsulation of RNA in Liposomes In the experiment, the RNA sequence 5'-AUU UCG AGU UGG CUG UUG CUU-3' (SEQ ID NO: 23) was used because this sequence was part of the siRNA that was stated by Wu et al. [2] to be a highly efficient siRNA against BMP-2. The RNA for this study was purchased from biomers.net as HPLC-pure grade.

[0299] For encapsulation, 7.5 nmol of RNA was used [3] and later redissolved in 150 μL of liposome solution. To the mixture of liposome and RNA, 100 μL of ethanol containing 10 mM of CaCl2 was slowly added dropwise at room temperature while constantly mixing. Subsequently, the sample was dialyzed against liposome buffer at 4°C overnight.

[0300] Purification of Liposome-Encapsulated RNA Free RNA was separated from liposome-encapsulated RNA using magnetic particles. These particles are coated with a silica layer and have quaternary aminoethyl groups on the surface [4]. As a result, the surface is positively charged, causing free RNA to bind via a negative backbone [4] and thus be separable from liposome-encapsulated RNA.

[0301] This protocol was inspired by the publication of Ye and Beverly [4]. All separations were carried out at room temperature. For one sample of liposome, in the first step, 20 μL and 5 μL of resuspended magnetic particles were added to the reaction tube respectively. After applying to a magnetic separator for 2 minutes, the supernatant was recovered from these. For particle purification and equilibration, 200 μL of liposome buffer was added to the particles and incubated for 2 minutes. After magnetic separation for 2 minutes, the supernatant could be recovered. Subsequently, liposome was added to the reaction vessel containing 20 μL of magnetic particle suspension, and after resuspension, incubated for 30 seconds. After separation for 2 minutes, the liposome sample could be recovered. This procedure was repeated with a reaction tube containing 5 μL of equilibrated magnetic particle suspension.

[0302] Size Determination The size of liposomes was determined using the dynamic light scattering (DSL) method. Before use in drug delivery systems, 100 μL of a 1:100 diluted sample was placed in a microcuvette with a 10 mm path length. The measurements were carried out at 25 °C after a 2-minute equilibration period. Water was used as the standard (refractive index 1.33, absorbance 0.001, viscosity 0.833).

[0303] Encapsulation efficiency The encapsulation efficiency (EE) can be calculated when the RNA concentration in the liposomes after purification is determined and applied as a ratio together with the amount of the substance used (Equation 1). n(end): Amount of substance after purification of liposomes from free RNA n(start): Amount of substance used in liposome preparation

[0304] The RNA concentration was determined using Quant-it™ RiboGreen. The RNA used for encapsulation was also used for the preparation of a series of standards.

[0305] In this experiment, when determining only the RNA outside the liposomes, a pH 7.5 TE buffer consisting of 10 mM Tris-HCl and 1 mM EDTA was used. When determining total RNA, 2% Triton X-100 was added to the TE buffer.

[0306] ​A series of standard liposomes were diluted 1:500. Using the diluted liposome sample and stock RNA solution (1 μmol / L), a series of standards (0, 6, 30, 50, 100, 150 nmol / L) were prepared, each with an amount of 100 μL. Each sample was also diluted 1:500. Subsequently, 100 μL of 1:200 diluted dye was added to each standard or sample. After brief mixing, the samples were shielded from light and incubated for 3 minutes. Fluorescence measurements were performed at an excitation wavelength of approximately 480 nm. Emission was measured at 525 nm. To determine the encapsulated RNA, the difference in the amount of substance with and without Triton X-100 was taken. The results were used for the calculation of EE (Equation 2 below).

[0307] Application to drug delivery devices For the application of liposome-encapsulated RNA, films approximately 1 cm in size, with and without the addition of sucrose, were used for analysis. 2

[0308] JPEG2025519490000008.jpg44165

[0309] For drying, approximately 40 pmol of liposome-encapsulated RNA was applied to the film. The film was dried in a dryer under reduced pressure for 3 hours. After drying, the film was stored in a refrigerator at 4 °C.

[0310] For the analysis of the dried liposomes, the film was dissolved with 100 μL of deionized water each. Subsequently, the retention rate of RNA and the size of the liposomes were determined.

[0311] For measurements by DLS, 100 μL of the dissolved film diluted 1:10 was used in a microcuvette. Using water as a standard and only needing to adjust the viscosity, a rotational rheometer was used to determine 2.4 mPa * s.

[0312] ​For the determination of the retention rate, the concentration of RNA in the sample without Triton X-100 was determined using the Quanti-it (trademark) RiboGreen reagent. In this case, the lysis film was diluted 1:84.

[0313] Since a small amount of RNA still exists outside the liposomes after separation, it must be subtracted from the determined amount of RNA. Subsequently, the retention rate can be calculated according to Equation 2. Here, n(outside) is the amount of determined RNA substance outside the liposomes after drying, minus the RNA that was already outside the liposomes before drying, and n(inside,sol) is the amount of RNA substance determined to be encapsulated before drying.

Number

[0314] JPEG2025519490000010.jpg37120

[0315] Results After the preparation step of encapsulating RNA, the average size of the liposomes was 191.7 nm (Table 6). For the same batch, the EE could be determined to be 10.72%, and thus, 0.804 nmol was encapsulated. Along with the co-encapsulation of 0.804 nmol, there was still 120 pmol outside the liposomes. This had to be taken into account when determining the retention rate. Subsequently, drying was carried out in three different ways and then they were compared for changes in the size of the liposomes and the RNA retention rate. Figure 20a shows a graph of the size determination of the liposomes after drying and rehydration. For comparison, a light gray curve of the liposomes before drying was inserted. The curve of the liposomes dried on the film without added sucrose is shown in gray. After rehydration, the average size of the dried liposomes was slightly smaller than before drying (187 nm) (Figure 20a). The samples of the black curve and the dark gray curve were both dried on the film with added sucrose. In addition, to the sample of the black curve, the liposome buffer was added as a protective buffer in the same volume fraction and then applied to the film and dried. In both samples, a clear decrease in the liposome diameter could be measured (Figure 20a).

[0316] Regarding the RNA retention rate after liposome drying, values exceeding 95% were obtained for all samples. This was a better retention rate than the control, which was 90.255% slightly higher than that previously published by Wolkers et al [5]. For the samples dried on the film without added sucrose, the release of RNA could not be measured. The other two samples dried on the film with added sucrose also showed very good retention rates of 95.13% and 96.13% (with added protective buffer).

[0317] The retention rate of all experiments exceeded that of the control experiment, and all liposomes generally remained within at least the size range recommended for systemic therapy [3].

Example 5

[0318] Example 5: Preparation of Polymer Films by Melt Extrusion - Appropriate selection of the polymer base: Select a polymer base that is compatible with the active ingredient intended for use. Typical polymers are polyvinyl alcohol (PVA), cellulose ether, and polyethylene glycol (PEG), which are combined with suitable plasticizers. - Preparation of the active ingredient: The active ingredient is usually prepared in a suitable formulation (e.g., as a powder or granule). - Mixing of the components: Mix the polymer base and the active ingredient with a mixer to form a homogeneous mixture. - Extrusion: Feed the mixture into an extruder, melt it at a high temperature, and extrude it through a die. The die forms a film, and the film is placed on a cooling plate. - After the polymer compound is extruded from the die by melt extrusion, the extruded film can be subjected to a rolling process to further optimize its thickness and properties. The rolling process can include either cold rolling or hot rolling, depending on the requirements specific to the film. - Post-treatment: After the extrusion process, cut the extruded film into the desired size and shape. Next, the film is usually subjected to further processes such as drying, coating, or lamination to improve its physical and pharmaceutical properties.

[0319] List of reference documents: 1 Trucillo P, Campardelli R, Reverchon E. Liposomes: From Bangham to Supercritical Fluids. Processes. August 21, 2020;8(9):1022. 2.Wu JB, Fu HQ, Huang LZ, Liu AW, Zhang JX. Effectsof siRNA-targeting BMP-2 on the abilities of migration and invasion of humanliver cancer SMMC7721 cells and its mechanism. Cancer Gene Ther. January2011;18(1):20-5. 3. Somiya M, Yamaguchi K, Liu Q, Niimi T, Maturana AD, Iijima M, et al. One-step scalable preparation method for non-cationic liposomes with high siRNA content. International Journal of Pharmaceutics. July 2015;490(1-2):316-23. 4. Ye G, Beverly M. The use of strong anion-exchange (SAX) magnetic particles for the extraction of therapeutic siRNA and their analysis by liquid chromatography / mass spectrometry. Rapid Communications in Mass Spectrometry. 2011;25(21):3207-15. 5. Wolkers WF, Oldenhof H, Tablin F, Crowe JH. Preservation of dried liposomes in the presence of sugar and phosphate. Biochimica et Biophysica Acta (BBA) - Biomembranes. March 2004;1661(2):125-34.

[0320] SEQ ID NO: 1 Lys His His Ser Gln Arg Ala Arg Lys Lys Asn Lys Asn Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr Gln Ala Phe Tyr Cys His Gly Asp Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr AsnHis Ala Ile Val Gln Thr Leu Val Asn Ser Val Asn Ser Ser Ile ProLys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala Ile Ser Met Leu TyrLeu Asp Glu Tyr Asp Lys Val Val Leu Lys Asn Tyr Gln Glu Met ValVal Glu Gly Cys Gly Cys Arg SEQ ID NO:2: Gly Arg Thr Phe Ser Thr Tyr Ala SEQ ID NO:3: Ser Lys Gly Gly Gly Ile Thr Tyr SEQ ID NO:4: Asp Pro Val Ser Ser Val Ala Lys Ser Pro Val Ala Tyr Pro SEQ ID NO:5: Gly Arg Thr Phe Arg Ile Asn Asp SEQ ID NO:6: Thr Ser Gly Gly Asn Thr Asn SEQ ID NO:7: Asp Gly Leu Arg Phe Asp Ser Thr Arg Tyr Arg Pro Phe Asp SEQ ID NO:8: Gly Ser Ile Arg Gly Phe Val Ala SEQ ID NO:9: Thr Asn Gly Gly Thr Leu SEQ ID NO:10: Arg Gln Ile Gly Ala Ser Gly Tyr Asp SEQ ID NO:11: Glu Val Gln Leu Val Glu Ser Gly Gly Gly LeuVal Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly ArgThr Phe Ser Thr Tyr Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Ala Ala Ile Ser Lys Gly Gly Gly Ile Thr Tyr Tyr Ser Asp Ser Val Arg Gly Arg Phe Thr Ile Ser Lys Glu Asn Ala Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala Asp Pro Val Ser Ser Val Ala Lys Ser Pro Val Ala Tyr Pro Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Sequence number 12: Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Arg Ile Asn Asp Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Ser Arg Asp Met Val Ala Arg Ile Thr Ser Gly Gly Asn Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Ala Asp Gly Leu Arg Phe Asp Ser Thr Arg Tyr Arg Pro Phe Asp Ser Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser SEQ ID NO: 13 Glu Val Gln Leu Val Glu Ser Gly Gly Gly LeuVal Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly SerIle Arg Gly Phe Val Ala Met Ala Trp Tyr Arg Gln Ala Pro Gly LysGln Arg Glu Trp Val Ala Thr Val Thr Asn Gly Gly Thr Leu Tyr GlyAsp Ser Val Lys Gly Arg Phe Thr Gly Ser Arg Asp Asn Ala Lys AsnThr Val Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala ValTyr Tyr Cys Ala Leu Arg Gln Ile Gly Ala Ser Gly Tyr Asp Tyr TrpGly Gln Gly Thr Gln Val Thr Val Ser Ser SEQ ID NO: 14 Gln Ala Lys His Lys Gln Arg Lys Arg Leu LysSer Ser Cys Lys Arg His Pro Leu Tyr Val Asp Phe Ser Asp Val GlyTrp Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr His Ala Phe Tyr CysHis Gly Glu Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr AsnHis Ala Ile Val Gln Thr Leu Val Asn Ser Val Asn Ser Lys Ile ProLys Ala Cys Cys Val Pro Thr Glu Leu Ser Ala Ile Ser Met Leu TyrLeu Asp Glu Asn Glu Lys Val Val Leu Lys Asn Tyr Gln Asp Met ValVal Glu Gly Cys Gly Cys Arg SEQ ID NO: 15: Met Val Ala Gly Thr Arg Cys Leu Leu Ala LeuLeu Leu Pro Gln Val Leu Leu Gly Gly Ala Ala Gly Leu Val Pro GluLeu Gly Arg Arg Lys Phe Ala Ala Ala Ser Ser Gly Arg Pro Ser SerGln Pro Ser Asp Glu Val Leu Ser Glu Phe Glu Leu Arg Leu Leu SerMet Phe Gly Leu Lys Gln Arg Pro Thr Pro Ser Arg Asp Ala Val ValPro Pro Tyr Met Leu Asp Leu Tyr Arg Arg His Ser Gly Gln Pro GlySer Pro Ala Pro Asp His Arg Leu Glu Arg Ala Ala Ser Arg Ala AsnThr Val Arg Ser Phe His His Glu Glu Ser Leu Glu Glu Leu Pro GluThr Ser Gly Lys Thr Thr Arg Arg Phe Phe Phe Asn Leu Ser Ser IlePro Thr Glu Glu Phe Ile Thr Ser Ala Glu Leu Gln Val Phe Arg Glu Gln Met Gln Asp Ala Leu Gly Asn Asn Ser Ser Phe His His Arg Ile Asn Ile Tyr Glu Ile Ile Lys Pro Ala Thr Ala Asn Ser Lys Phe Pro Val Thr Arg Leu Leu Asp Thr Arg Leu Val Asn Gln Asn Ala Ser Arg Trp Glu Ser Phe Asp Val Thr Pro Ala Val Met Arg Trp Thr Ala Gln Gly His Ala Asn His Gly Phe Val Val Glu Val Ala His Leu Glu Glu Lys Gln Gly Val Ser Lys Arg His Val Arg Ile Ser Arg Ser Leu His Gln Asp Glu His Ser Trp Ser Gln Ile Arg Pro Leu Leu Val Thr Phe Gly His Asp Gly Lys Gly His Pro Leu His Lys Arg Glu Lys Arg Gln Ala Lys His Lys Gln Arg Lys Arg Leu Lys Ser Ser Cys Lys Arg His Pro Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr His Ala Phe Tyr Cys His Gly Glu Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His Ala Ile Val Gln Thr Leu Val Asn Ser Val Asn Ser Lys Ile Pro Lys Ala Cys Cys Val ProThr Glu Leu Ser Ala Ile Ser Met Leu Tyr Leu Asp Glu Asn Glu LysVal Val Leu Lys Asn Tyr Gln Asp Met Val Val Glu Gly Cys Gly CysArg SEQ ID NO: 16: Met Ile Pro Gly Asn Arg Met Leu Met Val ValLeu Leu Cys Gln Val Leu Leu Gly Gly Ala Ser His Ala Ser Leu IlePro Glu Thr Gly Lys Lys Lys Val Ala Glu Ile Gln Gly His Ala GlyGly Arg Arg Ser Gly Gln Ser His Glu Leu Leu Arg Asp Phe Glu AlaThr Leu Leu Gln Met Phe Gly Leu Arg Arg Arg Pro Gln Pro Ser LysSer Ala Val Ile Pro Asp Tyr Met Arg Asp Leu Tyr Arg Leu Gln SerGly Glu Glu Glu Glu Glu Gln Ile His Ser Thr Gly Leu Glu Tyr ProGlu Arg Pro Ala Ser Arg Ala Asn Thr Val Arg Ser Phe His His GluGlu His Leu Glu Asn Ile Pro Gly Thr Ser Glu Asn Ser Ala Phe ArgPhe Leu Phe Asn Leu Ser Ser Ile Pro Glu Asn Glu Val Ile Ser SerAla Glu Leu Arg Leu Phe Arg Glu Gln Val Asp Gln Gly Pro Asp Trp Glu Arg Gly Phe His Arg Ile Asn Ile Tyr Glu Val Met Lys Pro Pro Ala Glu Val Val Pro Gly His Leu Ile Thr Arg Leu Leu Asp Thr Arg Leu Val His His Asn Val Thr Arg Trp Glu Thr Phe Asp Val Ser Pro Ala Val Leu Arg Trp Thr Arg Glu Lys Gln Pro Asn Tyr Gly Leu Ala Ile Glu Val Thr His Leu His Gln Thr Arg Thr His Gln Gly Gln His Val Arg Ile Ser Arg Ser Leu Pro Gln Gly Ser Gly Asn Trp Ala Gln Leu Arg Pro Leu Leu Val Thr Phe Gly His Asp Gly Arg Gly His Ala Leu Thr Arg Arg Arg Arg Ala Lys Arg Ser Pro Lys His His Ser Gln Arg Ala Arg Lys Lys Asn Lys Asn Cys Arg Arg His Ser Leu Tyr Val Asp Phe Ser Asp Val Gly Trp Asn Asp Trp Ile Val Ala Pro Pro Gly Tyr Gln Ala Phe Tyr Cys His Gly Asp Cys Pro Phe Pro Leu Ala Asp His Leu Asn Ser Thr Asn His Ala Ile Val Gln Thr Leu Val Asn Ser Val Asn Ser Ser Ile Pro Lys Ala Cys Cys Val Pro Thr Glu Leu SerAla Ile Ser Met Leu Tyr Leu Asp Glu Tyr Asp Lys Val Val Leu LysAsn Tyr Gln Glu Met Val Val Glu Gly Cys Gly Cys Arg SEQ ID NO: 17: gcaggucuuu gcaccaaga SEQ ID NO: 18: gcaacagcca acucgaaau SEQ ID NO: 19: gcuguaccuu gacgagaau SEQ ID NO: 20: gccgccgccg ccgucgccgc cgccggaguc cucgccccgccgcgcugcgc ccggcucgcg 60 cugcgcuagu cgcuccgcuu cccacacccc gccggggacuggcagccgcc gccgcacauc 120 ugccgccaca gccuccgccg gcuacccgaa cguucucggggccagcgccg aguggaucac 180 cggggaccgc gaggcacccg cgcgccgcag accccgcgcgggcuggagca cccggcagag 240 cgcgccacag cgccguggcc ucugcugccc gggcugcgccagagccgcgg acgggcgcgc 300 agagcgccgg ggacuccgga gccgaucccu agcgccgcgaugcggagcac cuacugcagg 360 agaucggggg ccugggacgc gcuggccgag gugugaucggaccccaggcu agccacaaag 420 ggcacuuggc cccagggcua ggagagcgag gggagagcacagccacccgc cucggcggcc 480 cgggacucgg cucgacucgc cggagaaugc gcccgaggacgacggggcgc cagagccgcg 540 gugcuuucaa cuggcgagcg cgaauggggg ugcacuggaguaaggcagag ugaugcgggg 600 gggcaacucg ccuggcaccg agaucgccgc cgugcccuucccuggacccg gcgucgccca 660 ggauggcugc cccgagccau gggccgcggc ggagcuagcgcggagcgccc gacccucgac 720 ccccgagucc cggagccggc cccgcgcggg gccacgcgucccucgggcgc ugguuccuaa 780 ggaggacgac agcaccagcu ucuccuuucu cccuucccuucccugccccg cacuccuccc 840 ccugcucgcu guuguugugu gucagcacuu ggcuggggacuucuugaacu ugcagggaga 900 auaacuugcg caccccacuu ugcgccggug ccuuugccccagcggagccu gcuucgccau 960 cuccgagccc caccgccccu ccacuccucg gccuugcccgacacugagac gcuguuccca 1020 gcgugaaaag agagacugcg cggccggcac ccgggagaaggaggaggcaa agaaaaggaa 1080 cggacauucg guccuugcgc cagguccuuu gaccagaguuuuuccaugug gacgcucuuu 1140 caauggacgu guccccgcgu gcuucuuaga cggacugcggucuccuaaag gucgaccaug 1200 guggccggga cccgcugucu ucuagcguug cugcuuccccagguccuccu gggcggcgcg 1260 gcuggccucg uuccggagcu gggccgcagg aaguucgcggcggcgucguc gggccgcccc 1320 ucaucccagc ccucugacga gguccugagc gaguucgaguugcggcugcu cagcauguuc 1380 ggccugaaac agagacccac ccccagcagg gacgccguggugccccccua caugcuagac 1440 cuguaucgca ggcacucagg ucagccgggc ucacccgccccagaccaccg guuggagagg 1500 gcagccagcc gagccaacac ugugcgcagc uuccaccaugaagaaucuuu ggaagaacua 1560 ccagaaacga gugggaaaac aacccggaga uucuucuuuaauuuaaguuc uauccccacg 1620 gaggaguuua ucaccucagc agagcuucag guuuuccgagaacagaugca agaugcuuua 1680 ggaaacaaua gcaguuucca ucaccgaauu aauauuuaugaaaucauaaa accugcaaca 1740 gccaacucga aauuccccgu gaccagacuu uuggacaccagguuggugaa ucagaaugca 1800 agcagguggg aaaguuuuga ugucaccccc gcugugaugcgguggacugc acagggacac 1860 gccaaccaug gauucguggu ggaaguggcc cacuuggaggagaaacaagg ugucuccaag 1920 agacauguua ggauaagcag gucuuugcac caagaugaacacagcugguc acagauaagg 1980 ccauugcuag uaacuuuugg ccaugaugga aaagggcauccucuccacaa aagagaaaaa 2040 cgucaagcca aacacaaaca gcggaaacgc cuuaaguccagcuguaagag acacccuuug 2100 uacguggacu ucagugacgu gggguggaau gacuggauuguggcuccccc gggguaucac 2160 gccuuuuacu gccacggaga augcccuuuu ccucuggcugaucaucugaa cuccacuaau 2220 caugccauug uucagacguu ggucaacucu guuaacucuaagauuccuaa ggcaugcugu 2280 gucccgacag aacucagugc uaucucgaug cuguaccuugacgagaauga aaagguugua 2340 uuaaagaacu aucaggacau gguuguggag gguugugggugucgcuagua cagcaaaauu 2400 aaauacauaa auauauauau auauauauau uuuagaaaaaagaaaaaaac aaacaaacaa 2460 aaaaacccca ccccaguuga cacuuuaaua uuucccaaugaagacuuuau uuauggaaug 2520 gaauggaaaa aaaaacagcu auuuugaaaa uauauuuauaucuacgaaaa gaaguuggga 2580 aaacaaauau uuuaaucaga gaauuauucc uuaaagauuuaaaauguauu uaguuguaca 2640 uuuuauaugg guucaacccc agcacaugaa guauaauggucagauuuauu uuguauuuau 2700 uuacuauuau aaccacuuuu uaggaaaaaa auagcuaauuuguauuuaua uguaaucaaa 2760 agaaguaucg gguuuguaca uaauuuucca aaaauuguaguuguuuucag uuguguguau 2820 uuaagaugaa aagucuacau ggaagguuac ucuggcaaagugcuuagcac guuugcuuuu 2880 uugcagugcu acuguugagu ucacaaguuc aaguccagaaaaaaaaagug gauaauccac 2940 ucugcugacu uucaagauua uuauauuauu caauucucaggaauguugca gagugauugu 3000 ccaauccaug agaauuuaca uccuuauuag guggaauauuuggauaagaa ccagacauug 3060 cugaucuauu auagaaacuc uccuccugcc ccuuaauuuacagaaagaau aaagcaggau 3120 ccauagaaau aauuaggaaa acgaugaacc ugcaggaaagugaaugaugg uuuguuguuc 3180 uucuuuccua aauuagugau cccuucaaag gggcugaucuggccaaagua uucaauaaaa 3240 cguaagauuu cuucauuauu gauauugugg ucauauauauuuaaaauuga uaucucgugg 3300 cccucaucaa ggguuggaaa uuuauuugug uuuuaccuuuaccucaucug agagcucuuu 3360 auucuccaaa gaacccaguu uucuaacuuu uugcccaacacgcagcaaaa uuaugcacau 3420 cguguuuucu gcccacccuc uguucucuga ccuaucagcuugcuuuucuu uccaagguug 3480 uguguuugaa cacauuucuc caaauguuaa accuauuucagauaauaaau aucaaaucuc 3540 uggca 3545 SEQ ID NO: 21: agacgcagac gcagaggucg agcgcaggcc gaaagcuguucaccguuuuc ucgacuccgg 60 ggaacaugga gccauuccgu agugccaucc cgagcaacgcacugcugcag cuucccugag 120 ccuuuccagc aaguuuguuc aagauuggcu gucaagaaucauggacuguu auuauaugcc 180 uuguuuucug ucaagacacc augauuccug guaaccgaaugcugaugguc guuuuauuau 240 gccaaguccu gcuaggaggc gcgagccaug cuaguuugauaccugagacg gggaagaaaa 300 aagucgccga gauucagggc cacgcgggag gacgccgcucagggcagagc caugagcucc 360 ugcgggacuu cgaggcgaca cuucugcaga uguuugggcugcgccgccgc ccgcagccua 420 gcaagagugc cgucauuccg gacuacaugc gggaucuuuaccggcuucag ucuggggagg 480 aggaggaaga gcagauccac agcacugguc uugaguauccugagcgcccg gccagccggg 540 ccaacaccgu gaggagcuuc caccacgaag aacaucuggagaacauccca gggaccagug 600 aaaacucugc uuuucguuuc cucuuuaacc ucagcagcaucccugagaac gaggugaucu 660 ccucugcaga gcuucggcuc uuccgggagc agguggaccagggcccugau ugggaaaggg 720 gcuuccaccg uauaaacauu uaugagguua ugaagcccccagcagaagug gugccugggc 780 accucaucac acgacuacug gacacgagac ugguccaccacaaugugaca cggugggaaa 840 cuuuugaugu gagcccugcg guccuucgcu ggacccgggagaagcagcca aacuaugggc 900 uagccauuga ggugacucac cuccaucaga cucggacccaccagggccag caugucagga 960 uuagccgauc guuaccucaa gggaguggga auugggcccagcuccggccc cuccugguca 1020 ccuuuggcca ugauggccgg ggccaugccu ugacccgacgccggagggcc aagcguagcc 1080 cuaagcauca cucacagcgg gccaggaaga agaauaagaacugccggcgc cacucgcucu 1140 auguggacuu cagcgaugug ggcuggaaug acuggauuguggccccacca ggcuaccagg 1200 ccuucuacug ccauggggac ugccccuuuc cacuggcugaccaccucaac ucaaccaacc 1260 augccauugu gcagacccug gucaauucug ucaauuccaguauccccaaa gccuguugug 1320 ugcccacuga acugagugcc aucuccaugc uguaccuggaugaguaugau aaggugguac 1380 ugaaaaauua ucaggagaug guaguagagg gaugugggugccgcugagau caggcagucc 1440 uugaggauag acagauauac acaccacaca cacacaccacauacaccaca cacacacguu 1500 cccauccacu cacccacaca cuacacagac ugcuuccuuauagcuggacu uuuauuuaaa 1560 aaaaaaaaaa aaaaaggaaa aaaucccuaa acauucaccuugaccuuauu uaugacuuua 1620 cgugcaaaug uuuugaccau auugaucaua uauuuugacaaaauauauuu auaacuacgu 1680 auuaaaagaa aaaaauaaaa ugagucauua uuuuaaagguaaa 1723 SEQ ID NO: 22: ucuuggugca aagaccugc SEQ ID NO: 23: auuucgaguu ggcuguugc SEQ ID NO: 24: auucucguca agguacagc SEQ ID NO: 25: ugcgcagaau gagaugaguu g SEQ ID NO: 26: (hPD-1.08A heavy chain variable region): QVQLQQPGAE LVKPGASVKL SCKASGYTFT SYYLYWMKQRPGQGLEWIGG VNPSNGGTNF SEKFKSKATL TVDKSSSTAY MQLSSLTSED SAVYYCTRRD SNYDGGFDYWGQGTTLTVSS AK Sequence number 27 (hPD-1.08A light chain variable region): DIVLTQSPTS LAVSLGQRAT ISCRASKSVS TSGFSYLHWYQQKPGQPPKL LIFLASNLES GVPARFSGSG SGTDFTLNIH PVEEEDAATY YCQHSWELPL TFGAGTKLEL K Sequence number 28 (hPD-1.09A heavy chain variable region): QVQLQQPGAE LVKPGTSVKL SCKASGYTFT NYYMYWVKQRPGQGLEWIGG INPSNGGTNF NEKFKNKATL TVDSSSSTTY MQLSSLTSED SAVYYCTRRD YRFDMGFDYWGQGTTLTVSS AK Sequence number 29 (hPD-1.09A light chain variable region): DIVLTQSPAS LAVSLGQRAA ISCRASKGVS TSGYSYLHWYQQKPGQSPKL LIYLASYLES GVPARFSGSG SGTDFTLNIH PVEEEDAATY YCQHSRDLPL TFGTGTKLEL K Sequence number 30 (hPD-1.08A light chain CDR1): RASKSVSTSG FSYLH Sequence number 31 (hPD-1.08A light chain CDR2): LASNLES Sequence number 32 (hPD-1.08A light chain CDR3): QHSWELPLT Sequence number 33 (hPD-1.08A heavy chain CDR1): SYYLY Sequence number 34 (hPD-1.08A heavy chain CDR2): GVNPSNGGTN FSEKFKS Sequence number 35 (hPD-1.08A heavy chain CDR3): RDSNYDGGFD Y Sequence number 36 (hPD-1.09A light chain CDR1): RASKGVSTSG YSYLH Sequence number 37 (hPD-1.09A light chain CDR2): LASYLES Sequence number 38 (hPD-1.09A light chain CDR3): QHSRDLPLT Sequence number 39 (hPD-1.09A heavy chain CDR1): NYYMY Sequence number 40 (hPD-1.09A heavy chain CDR2): GINPSNGGTN FNEKFKN Sequence number 41 (hPD-1.09A heavy chain CDR3): RDYRFDMGFD Y Sequence number 42 (109A-H heavy chain variable region): MDWTWSILFL VAAPTGAHSQ VQLVQSGVEV KKPGASVKVSCKASGYTFTN YYMYWVRQAP GQGLEWMGGI NPSNGGTNFN EKFKNRVTLT TDSSTTTAYM ELKSLQFDDTAVYYCARRDY RFDMGFDYWG QGTTVTVSS Sequence number 43 (409A-H heavy chain full length): MAVLGLLFCL VTFPSCVLSQ VQLVQSGVEV KKPGASVKVSCKASGYTFTN YYMYWVRQAP GQGLEWMGGI NPSNGGTNFN EKFKNRVTLT TDSSTTTAYM ELKSLQFDDTAVYYCARRDY RFDMGFDYWG QGTTVTVSSA STKGPSVFPL APCSRSTSES TAALGCLVKD YFPEPVTVSWNSGALTSGVH TFPAVLQSSG LYSLSSVVTV PSSSLGTKTY TCNVDHKPSN TKVDKRVESK YGPPCPPCPAPEFLGGPSVF LFPPKPKDTL MISRTPEVTC VVVDVSQEDP EVQFNWYVDG VEVHNAKTKP REEQFNSTYRVVSVLTVLHQ DWLNGKEYKC KVSNKGLPSS IEKTISKAKG QPREPQVYTL PPSQEEMTKN QVSLTCLVKGFYPSDIAVEW ESNGQPENNY KTTPPVLDSD GSFFLYSRLT VDKSRWQEGN VFSCSVMHEA LHNHYTQKSL SLSLGK Accession No. 44 (K09A-L-11 light chain variable region): MAPVQLLGLL VLFLPAMRCE IVLTQSPATL SLSPGERATLSCRASKGVST SGYSYLHWYQ QKPGQAPRLL IYLASYLESG VPARFSGSGS GTDFTLTISS LEPEDFAVYYCQHSRDLPLT FGGGTKVEIK Accession No. 45 (K09A-L-16 light chain variable region): MAPVQLLGLL VLFLPAMRCE IVLTQSPLSL PVTPGEPASISCRASKGVST SGYSYLHWYL QKPGQSPQLL IYLASYLESG VPDRFSGSGS GTDFTLKISR VEAEDVGVYYCQHSRDLPLT FGQGTKLEIK Accession No. 46 (K09A-L-17 light chain variable region): MAPVQLLGLL VLFLPAMRCD IVMTQTPLSL PVTPGEPASISCRASKGVST SGYSYLHWYL QKPGQSPQLL IYLASYLESG VPDRFSGSGS GTAFTLKISR VEAEDVGLYYCQHSRDLPLT FGQGTKLEIK Accession No. 47 (109A-H heavy chain full length): MAVLGLLFCL VTFPSCVLSQ VQLVQSGVEV KKPGASVKVSCKASGYTFTN YYMYWVRQAP GQGLEWMGGI NPSNGGTNFN EKFKNRVTLT TDSSTTTAYM ELKSLQFDDTAVYYCARRDY RFDMGFDYWG QGTTVTVSSA STKGPSVFPL APSSKSTSGG TAALGCLVKD YFPEPVTVSWNSGALTSGVH TFPAVLQSSG LYSLSSVVTV PSSSLGTQTY ICNVNHKPSN TKVDKKVEPK SCDKTHTCPPCPAPELLGGP SVFLFPPKPK DTLMISRTPE VTCVVVDVSH EDPEVKFNWY VDGVEVHNAK TKPREEQYNSTYRVVSVLTV LHQDWLNGKE YKCKVSNKAL PAPIEKTISK AKGQPREPQV YTLPPSRDEL TKNQVSLTCLVKGFYPSDIA VEWESNGQPE NNYKTTPPVL DSDGSFFLYS KLTVDKSRWQ QGNVFSCSVM HEALHNHYTQ KSLSLSPGK Sequence number 48 (K09A-L-11 full-length light chain): MAPVQLLGLL VLFLPAMRCE IVLTQSPATL SLSPGERATLSCRASKGVST SGYSYLHWYQ QKPGQAPRLL IYLASYLESG VPARFSGSGS GTDFTLTISS LEPEDFAVYYCQHSRDLPLT FGGGTKVEIK RTVAAPSVFI FPPSDEQLKS GTASVVCLLN NFYPREAKVQ WKVDNALQSGNSQESVTEQD SKDSTYSLSS TLTLSKADYE KHKVYACEVT HQGLSSPVTK SFNRGEC Sequence number 49 (K09A-L-16 full-length light chain): MAPVQLLGLL VLFLPAMRCE IVLTQSPLSL PVTPGEPASISCRASKGVST SGYSYLHWYL QKPGQSPQLL IYLASYLESG VPDRFSGSGS GTDFTLKISR VEAEDVGVYYCQHSRDLPLT FGQGTKLEIK RTVAAPSVFI FPPSDEQLKS GTASVVCLLN NFYPREAKVQ WKVDNALQSGNSQESVTEQD SKDSTYSLSS TLTLSKADYE KHKVYACEVT HQGLSSPVTK SFNRGEC Sequence number 50 (K09A-L-17 light chain full length): MAPVQLLGLL VLFLPAMRCD IVMTQTPLSL PVTPGEPASISCRASKGVST SGYSYLHWYL QKPGQSPQLL IYLASYLESG VPDRFSGSGS GTAFTLKISR VEAEDVGLYYCQHSRDLPLT FGQGTKLEIK RTVAAPSVFI FPPSDEQLKS GTASVVCLLN NFYPREAKVQ WKVDNALQSGNSQESVTEQD SKDSTYSLSS TLTLSKADYE KHKVYACEVT HQGLSSPVTK SFNRGEC

Claims

**Claim 1** A drug delivery system for application to the esophageal mucosa, comprising: at least one sheet-like, in particular film-shaped, foil-shaped or oblate-shaped formulation containing a pharmaceutically active ingredient; a release mechanism; and a trigger mechanism wherein the trigger mechanism is adapted to cause release of the formulation by the release mechanism at a predetermined site of action, and the release mechanism is adapted to release the formulation while moving along the esophageal mucosa; the drug delivery system further comprises a shell that houses the formulation, the shell includes an opening configured as part of the release mechanism through which the formulation exits the shell, and the trigger mechanism is a retaining device that is part of the formulation or attached to the formulation, such that the formulation opens or spreads as the dosage form descends along the esophageal mucosa and exits through the opening from the shell; the pharmaceutically active ingredient comprises an agent effective for the treatment or prevention of esophageal diseases, preferably in combination with one or more additional pharmaceutically active ingredients; Drug delivery system. **Claim 2** The drug delivery system according to claim 1, wherein the agent effective for the treatment or prevention of esophageal diseases comprises an inhibitory polynucleotide, preferably an inhibitory polynucleotide in combination with a nucleic acid delivery system, an antibody, or an anti-proliferative agent. **Claim 3** The drug delivery system according to claim 2, wherein the inhibitory polynucleotide is selected from the group consisting of small interfering RNA (siRNA) molecules, antisense oligonucleotides, and aptamers. **Claim 4** The inhibitory polynucleotide comprises an siRNA molecule or an antisense oligonucleotide and targets an RNA transcript or a portion thereof encoding a BMP2 or BMP4 polypeptide, preferably the BMP2 or BMP4 polypeptide shown in SEQ ID NO: 15 or SEQ ID NO: 16, or the inhibitory polynucleotide comprises an siRNA molecule or an antisense oligonucleotide targeting an RNA transcript or a portion thereof shown in SEQ ID NO: 20 or SEQ ID NO: 21, or the inhibitory polynucleotide comprises an aptamer that interferes with the activity of a BMP2 or BMP4 polypeptide, preferably the BMP2 or BMP4 polypeptide shown in SEQ ID NO: 15 or SEQ ID NO: 16; the drug delivery system according to claim 2 or 3. **Claim 5** The siRNA molecule is (a) A double-stranded region comprising the sequence shown in SEQ ID NO: 17, SEQ ID NO: 18, or SEQ ID NO: 19, preferably the sequence shown in SEQ ID NO: 18, or any other sequence having at least 80% sequence identity with the siRNA molecule and a target RNA transcript encoding a BMP2 or BMP4 polypeptide, preferably the BMP2 or BMP4 polypeptide shown in SEQ ID NO: 15 or SEQ ID NO: 16, or a portion thereof. (b) A double-stranded region comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand together form the double-stranded region, and the antisense strand is complementary to a target RNA transcript shown in SEQ ID NO: 20 or SEQ ID NO: 21 or a portion thereof, and / or (c) The following table: BMP2-siRNA 1, BMP2-siRNA 2, or BMP2-siRNA 3 shown in the table above, wherein each of the sequences in the table contains an overhang of 2 nucleotides dTdT (deoxythymidine) or UU (uridine) attached to the 3' end of each strand. The drug delivery system according to claim 3 or 4, comprising

6. (i) The antibody or a binding fragment thereof a) binds to residues 10-17, 45-56, and 69 of BMP4 (SEQ ID NO: 1), b) binds to residues 24-31, 57-68, 70-72, 89, 91, 101, 103, 104, and 106 of BMP4 (SEQ ID NO: 1), or c) binds to residues 34, 35, 39, 86-88, 90, 97, 98, 100, 102, and 109 of BMP4 (SEQ ID NO: 1) and (ii) The antibody or a binding fragment thereof that binds to at least Lys12, Arg15, Asp46, and Pro50 of BMP4 comprises a heavy chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 2 or a sequence differing by no more than one amino acid therefrom, a heavy chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 3 or a sequence differing by no more than one amino acid therefrom, and a heavy chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 4 or a sequence differing by no more than one amino acid therefrom, or The antibody or binding fragment thereof that binds to at least Asp30, Trp31, Leu66, and Lys101 of BMP4 comprises a heavy-chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 5 or a sequence differing from it by no more than one amino acid, a heavy-chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 6 or a sequence differing from it by no more than one amino acid, and a heavy-chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 7 or a sequence differing from it by no more than one amino acid, or The antibody or binding fragment thereof that binds to at least Ala34, Gln39, Ser88, Leu90, and Leu100 of BMP4 comprises a heavy-chain CDR1 consisting of the amino acid sequence of SEQ ID NO: 8 or a sequence differing from it by no more than one amino acid, a heavy-chain CDR2 consisting of the amino acid sequence of SEQ ID NO: 9 or a sequence differing from it by no more than one amino acid, and a heavy-chain CDR3 consisting of the amino acid sequence of SEQ ID NO: 10 or a sequence differing from it by no more than one amino acid, and / or iii) The antibody or binding fragment thereof that binds to at least Lys12, Arg15, Asp46, and Pro50 of BMP4 comprises the amino acid sequence of SEQ ID NO: 11 or a sequence that is at least 70%, preferably 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or The antibody or binding fragment thereof that binds to at least Asp30, Trp31, Leu66, and Lys101 of BMP4 comprises the acid sequence of SEQ ID NO: 12 or a sequence that is at least 70%, preferably 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or The antibody or binding fragment thereof that binds to at least Ala34, Gln39, Ser88, Leu90, and Leu100 of BMP4 comprises the acid sequence of SEQ ID NO: 13 or a sequence that is at least 70%, preferably 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, The drug delivery system according to claim 2.

7. The antibody is i) a. at least one CDR (complementary determining region) selected from the group consisting of SEQ ID NOs: 30, 31, 32, 36, 37, and 38, or a variant of any of said sequences, and / or b. At least one CDR selected from the group consisting of SEQ ID NOs: 33, 34, 35, 39, 40, and 41, or a variant of any of said sequences An antibody or antibody fragment that binds to PD-1, preferably human PD-1, comprising ii) a. Light chain CDR SEQ ID NOs: 30, 31, and 32, or a variant of any of said sequences, and / or heavy chain CDR SEQ ID NOs: 33, 34, and 35, or a variant of any of said sequences, or b. Light chain CDR SEQ ID NOs: 36, 37, and 38, or a variant of any of said sequences, and / or heavy chain CDR SEQ ID NOs: 39, 40, and 41, or a variant of any of said sequences An antibody or antibody fragment that binds to PD-1, preferably human PD-1, comprising iii) a. i. SEQ ID NO: 26 or a variant thereof, ii. SEQ ID NO: 28 or a variant thereof, iii. Amino acid residues 20-139 of SEQ ID NO: 42 or a variant thereof, and iv. An amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% sequence identity to amino acid residues 20-139 of SEQ ID NO: 42 A heavy chain variable region comprising an amino acid sequence selected from the group consisting of and further comprising b. i. SEQ ID NO: 27 or a variant thereof, ii. SEQ ID NO: 29 or a variant thereof, iii. Amino acid residues 20-130 of SEQ ID NO: 44 or a variant thereof, iv. Amino acid residues 20-130 of SEQ ID NO: 45 or a variant thereof, v. Amino acid residues 20-130 of SEQ ID NO: 46 or a variant thereof, and vi. An amino acid sequence having at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99% sequence identity to amino acid residues 20-130 of SEQ ID NO: 44, 45, or 46 A light chain variable region comprising an amino acid sequence selected from the group consisting of An antibody or antibody fragment that binds to PD-1, preferably human PD-1, and / or iv) a. i. Amino acid residues 20-466 of SEQ ID NO: 43 or a variant thereof, and ii. Amino acid residues 20-469 of SEQ ID NO: 47 or a variant thereof A heavy chain comprising an amino acid sequence selected from the group consisting of b. i. Amino acid residues 20-237 of SEQ ID NO: 48 or a variant thereof, ii. Amino acid residues 20-237 of SEQ ID NO: 49 or a variant thereof, and iii. A light chain comprising an amino acid sequence selected from the group consisting of amino acid residues 20 to 237 of SEQ ID NO: 50 or a variant thereof An antibody or antibody fragment that binds to PD-1, preferably human PD-1, comprising The drug delivery system according to claim 2, comprising

8. Wherein the antibody is The drug delivery system according to claim 2 or 7, comprising an antibody or antibody fragment. a. Having a K of about 100 pM or less for binding to human PD-1 D for binding thereto b. Binds to human PD-1 with a K of about 30 pM or less D thereby c. An antibody having a heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a light chain comprising the amino acid sequence of SEQ ID NO: 44 that binds to human PD-1 with substantially the same K D and binds d. An antibody having a heavy chain containing the amino acid sequence of SEQ ID NO: 43 and a light chain containing the amino acid sequence of SEQ ID NO: 45 that binds to human PD-1 with substantially the same K D as binding e. binds to human PD-1 with a k of about 7.5×10 5 1 / M·s or more assoc and f. binds to human PD-1 with a k of about 1×10 6 1 / M·s or more assoc and g. binds to human PD-1 with a k of about 2×10 -5 1 / s or less dissoc ​ h. binds to human PD-1 with a k of about 2.7×10 -5 1 / s or less dissoc ​ i. binds to human PD-1 with a k of about 3×10 -5 1 / s or less, and / or dissoc ​ j. Inhibiting the binding of human PD-L1 or human PD-L2 to human PD-1 with an IC of about 1 nM or less 50 thereby blocking

9. Wherein the antiproliferative agent is preferably selected from the group consisting of paclitaxel, docetaxel, and cabazitaxel, a taxane, more preferably paclitaxel; a pyrimidine analog, preferably a uracil analog, more preferably 5-fluorouracil or capecitabine; and preferably selected from the group consisting of cisplatin or a salt thereof, carboplatin or a salt thereof, nedaplatin or a salt thereof, and oxaliplatin or a salt thereof, a platinum-based agent, The drug delivery system according to claim 2, comprising

10. The drug delivery system according to any one of the preceding claims, for use in therapy.

11. For use in the treatment or prevention of esophageal diseases, preferably the esophageal diseases are caused by or related to immune system defects such as cancer, the drug delivery system according to any one of the preceding claims.

12. For use in the treatment or prevention of Barrett's esophagus, esophageal stricture, and / or esophageal cancer such as adenocarcinoma, esophageal junction cancer, or squamous cell carcinoma, the drug delivery system according to any one of the preceding claims.

13. Preferably for use in diagnosis, wherein the drug active ingredient is combined with a diagnostic marker, the drug delivery system according to any one of claims 1 to 9.

14. Use of the drug delivery system according to any one of claims 1 to 9 for in vitro diagnosis, preferably wherein the drug active ingredient is combined with a diagnostic marker.

15. The drug delivery system for use according to claim 13, or the use according to claim 14, wherein the diagnosis comprises monitoring the cellular uptake of the drug active ingredient, monitoring the pathway of the drug active ingredient in a tissue or organ, or monitoring the success of treatment, such as tumor size. ​

Citation Information

Patent Citations

  • US9912293-122972002

  • IG-like molecules binding to BMP4

    WO2016043577A1

  • Inhibitors of BMP2 and BMP4 signalling for use in the treatment of barrett's esophagus

    WO2018193129A1