Recombinant virus expressing interleukin 12

Abstract

The present disclosure relates to a recombinant poxvirus that contains a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome. Provided are a recombinant poxvirus, a method for producing a composition (e.g., a pharmaceutical composition) containing the recombinant poxvirus, a method for treating cancer using the recombinant poxvirus, and a kit containing the recombinant poxvirus.

Description

Technical Field

[0001] Cross - Reference to Related Applications This international application claims the benefit of priority of U.S. Provisional Application No. 63 / 351,255, filed on June 10, 2022, and U.S. Provisional Application No. 63 / 369,623, filed on July 27, 2022, each of which is hereby incorporated by reference in its entirety.

[0002] Reference to a Sequence Listing Submitted in Electronic Format The content of the electronically - submitted XML sequence listing (name: 2943_201PC02_SequenceListing_ST26; size: 39,761 bytes; and creation date: June 7, 2023) submitted in this application is hereby incorporated by reference in its entirety.

[0003] The present disclosure relates to recombinant poxviruses that contain heterologous nucleic acid sequences encoding interleukin - 12 (IL - 12) in their genomes. Recombinant poxviruses, methods for producing pharmaceutical compositions containing recombinant poxviruses, methods for treating cancer using recombinant poxviruses, and kits containing recombinant poxviruses are provided.

Background Art

[0004] For example, recombinant viruses, including recombinant poxviruses, have become a new therapeutic platform for cancer treatment because they are advantageous over conventional treatment modalities such as chemotherapy. For example, recombinant viruses can selectively replicate in cancer cells while sparing normal cells and tissues, thereby suppressing off-target cell death and toxicity and potentially providing a much higher level of efficacy and specificity than conventional cancer treatments. Recombinant viruses can be engineered to express therapeutic transgenes, such as transgenes important in cancer biological pathways, intracellularly. Cancer cells can be ideal hosts for many viruses because they can inactivate the antiviral interferon pathway or have mutated tumor suppressor genes that allow viral replication to proceed without interference.

[0005] Interleukin 12 (IL-12) has been considered a potential candidate for anti-cancer therapy and has been evaluated following introduction into viral vectors such as adenoviral vectors. IL-12 is a cytokine with immunomodulatory and anti-angiogenic functions. IL-12 acts as an important regulator of the cell-mediated immune response through induction of T helper 1 differentiation and induces cellular immunity by promoting IFN-γ production, proliferation, and cytolytic activity of natural killer cells and T cells. The multifunctionality of IL-12 has led to the investigation of this cytokine as an anti-cancer agent.

[0006] However, despite promising results in animal models, expectations for the successful use of this cytokine have waned due to the very limited anti-tumor effects of IL-12 and unacceptable adverse events in early clinical trials. Therefore, there remains a need for new cancer therapies that increase efficacy and / or reduce adverse events. SUMMARY OF THE INVENTION MEANS FOR SOLVING THE PROBLEMS

[0007] In some aspects of the present disclosure, there is provided a recombinant poxvirus that contains a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter. In some aspects, the poxvirus belongs to the genus Orthopoxvirus. In some aspects, the poxvirus belonging to the genus Orthopoxvirus is a oncolytic vaccinia virus. In some aspects, the oncolytic vaccinia virus is selected from the group consisting of Western Reserve (WR), Elstree, Wyeth, Lister, Tian Tan, LIVP, and Copenhagen (Cop) virus strains. In some aspects, the genome comprises at least 150 kb, at least about 175 kb, at least about 180 kb, at least about 185 kb, at least about 190 kb, at least about 192 kb, or at least about 194 kb.

[0008] In some aspects of the recombinant poxvirus described herein, the poxvirus is attenuated. In some aspects, the poxvirus is not NYVAC.

[0009] In some embodiments of the recombinant poxviruses described herein, the late promoter is selected from pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R. In some embodiments, the late promoter is selected from pA14L, pA26L, and pF17R. In some embodiments, the late promoter is pA14L. In some embodiments, the late promoter is pF17R. In some embodiments, the late promoter comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 11 or 13. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 11 or 13. In some embodiments, the intermediate promoter is selected from pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L. In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of the nucleotide sequences of SEQ ID NOs: 25 - 31. In some embodiments, the intermediate promoter comprises any one of the nucleotide sequences of SEQ ID NOs: 25 - 31.

[0010] In some embodiments of the recombinant poxvirus described herein, IL-12 is human IL-12. In some embodiments, IL-12 is a fusion protein comprising an IL-12 p40 subunit and an IL-12 p35 subunit. In some embodiments, the IL-12 p40 subunit is at the N-terminus of the IL-12 p35 subunit. In some embodiments, the IL-12 p40 subunit comprises the amino acid sequence of SEQ ID NO: 17, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO: 17. In some embodiments, the IL-12 p35 subunit comprises the amino acid sequence of SEQ ID NO: 19, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the IL-12 p40 subunit and the IL-12 p35 subunit are fused into a single polypeptide via an amino acid linker. In some embodiments, the amino acid linker is about 5 to about 10 amino acids in length. In some embodiments, the amino acid linker is 7 amino acids in length. In some embodiments, the amino acid linker is a glycine-serine linker. In some embodiments, the amino acid linker comprises the amino acid sequence of SEQ ID NO: 18.

[0011] In some embodiments of the recombinant poxvirus described herein, IL-12 comprises the amino acid sequence of SEQ ID NO: 20, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO: 20.

[0012] In some embodiments of the recombinant poxvirus described herein, the IL-12 p40 subunit and the IL-12 p35 subunit are directly fused to a single polypeptide.

[0013] In some embodiments of the recombinant poxvirus described herein, the heterologous nucleic acid sequence encoding IL-12 comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 comprises the nucleotide sequence of SEQ ID NO: 21.

[0014] In some embodiments of the recombinant poxvirus described herein, the poxvirus lacks thymidine kinase (TK) activity. In some embodiments, the poxvirus lacks a functional J2R gene. In some embodiments, the poxvirus lacks ribonucleotide reductase (RR) activity.

[0015] In some embodiments of the recombinant poxvirus described herein, the poxvirus lacks a functional I4L gene. In some embodiments, the poxvirus lacks a functional F4L gene.

[0016] In some embodiments of the recombinant poxvirus described herein, the heterologous nucleic acid sequence encoding IL-12 is inserted within the J2R locus of the poxvirus genome. In some embodiments, the J2R gene is rendered non-functional by the insertion, and optionally, the J2R locus is completely deleted by the insertion.

[0017] In some embodiments of the recombinant poxvirus described herein, the heterologous nucleic acid sequence encoding IL-12 is inserted into the I4L locus of the poxvirus genome. In some embodiments, the I4L gene is non-functional due to the insertion, and optionally, the I4L locus is not sufficiently deleted by the insertion.

[0018] In some embodiments of the recombinant poxvirus described herein, the heterologous nucleic acid sequence encoding IL-12 is inserted into the F4L locus of the poxvirus genome. In some embodiments, the F4L gene is non-functional due to the insertion, and optionally, the F4L locus is not sufficiently deleted by the insertion.

[0019] In some embodiments of the recombinant poxvirus described herein, the poxvirus further comprises one or more therapeutic genes within its genome. In some embodiments, the one or more therapeutic genes are selected from the group consisting of suicide genes, immunomodulatory genes, anti-angiogenic genes, immune checkpoint inhibitory genes, antibody-encoding genes, extracellular matrix degrading or regulatory genes, and combinations thereof.

[0020] In some embodiments of the recombinant poxvirus described herein, the recombinant poxvirus can lyse one or more cancer cell types. In some embodiments, the recombinant poxvirus is 10 -2At a multiplicity of infection (MOI) of [[ID=]], the cancer cells can express at least 50 ng / mL, at least 100 ng / mL, at least 300 ng / mL, at least 500 ng / mL, at least 1.0 μg / mL, at least 2.0 μg / mL, at least 3.0 μg / mL, at least 4.0 μg / mL, at least 5.0 μg / mL, at least 6.0 μg / mL, at least 7.0 μg / mL, at least 8.0 μg / mL or about 8.3 μg / mL of IL-12 72 hours after infection. In some embodiments, the cancer cells are renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, cholangiocarcinoma, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma cells. In some embodiments, the cancer cells are A549, HT29, MIA PaCa-2, A375, RPMI7591, Sk-Mel-5, OVCAR3, OVCAR4, NCI-H292, NCI-H460, SW780, TCCSUP, T24, Huh7, Hep3B, Panc1, Hup-T3, DAN-G, MDA-MB-435, HCC38, BT20, SW1417, WiDr, HCT116, SNU5, NCI-N87, Kato III, A CHN, A 498, PC-3, or MM.1R cells.

[0021] In some embodiments of the recombinant poxvirus described herein, the virus is produced in chicken embryo fibroblasts (CEF), HeLa cells, EB66® cells, Vero cells, HEK293 cells, PerC6 cells, BHK21 cells, or MRC5 cells. In some embodiments of the recombinant poxvirus described herein, the virus is produced in chicken embryo fibroblasts (CEF).

[0022] In some embodiments, the recombinant poxvirus can increase interferon (IFN)-γ.

[0023] In some aspects of the present disclosure, a method for producing a recombinant poxvirus as described herein, comprising: a) obtaining or preparing producer cells; b) infecting the obtained or prepared producer cells with a recombinant poxvirus; c) culturing the infected producer cells under suitable conditions that allow for the production of the recombinant poxvirus; d) recovering the produced recombinant poxvirus from the culture of the producer cells; and optionally, e) purifying the recovered recombinant poxvirus. Optionally, provided herein is a method for producing a recombinant poxvirus, wherein the producer cells are chicken embryo fibroblasts (CEF), HeLa, EB66®, Vero, HEK293, PerC6, BHK21, or MRC5 cells.

[0024] In some aspects of the present disclosure, provided is a recombinant poxvirus produced by the method described herein.

[0025] In some aspects of the present disclosure, provided are pharmaceutical compositions and pharmaceutically acceptable carriers comprising the recombinant poxvirus described herein. In some aspects, the composition comprises a therapeutically effective amount of the recombinant poxvirus and a pharmaceutically acceptable carrier. In some aspects, the therapeutically effective amount for an individual dose is 1×10 3 pfu~1×10 12 pfu, optionally 1×10 4 pfu~1×10 11 pfu, optionally 1×10 5 pfu~1×10 10 pfu, optionally 5×10 7 pfu~4×10 9 pfu.

[0026] A pharmaceutical composition comprising the recombinant poxvirus described herein for use in treating or preventing a proliferative disorder, optionally wherein the proliferative disorder is cancer, is also provided herein. In some embodiments, the cancer is selected from the group consisting of renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, cholangiocarcinoma, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, and malignant glioma.

[0027] A method of inducing apoptosis in cancer cells, comprising contacting the cancer cells with the recombinant poxvirus described herein or a pharmaceutical composition comprising the recombinant poxvirus described herein under conditions that induce apoptosis, is also provided herein.

[0028] A method of inhibiting the growth of cancer cells or promoting the death of cancer cells, comprising contacting the cancer cells with the recombinant poxvirus described herein or a pharmaceutical composition comprising the recombinant poxvirus described herein under conditions that inhibit growth or promote the death of the cancer cells, is also provided herein. In some embodiments, the cancer cells are renal cancer cells, prostate cancer cells, breast cancer cells, bladder cancer cells, colorectal cancer cells, lung cancer cells, liver cancer cells, gastric cancer cells, cholangiocarcinoma cells, endometrial cancer cells, pancreatic cancer cells, ovarian cancer cells, head and neck cancer cells, melanoma cells, glioblastoma cells, multiple myeloma cells, or malignant glioma cells. In some embodiments of the methods provided herein, the method is performed in vitro.

[0029] A method of treating cancer in a subject, comprising administering to the subject an effective amount of the recombinant poxvirus described herein or a pharmaceutical composition comprising the recombinant poxvirus described herein to treat the cancer, is also provided herein.

[0030] A method for reducing the amount of cancer cells in a subject, comprising administering to the subject a recombinant poxvirus described herein or a pharmaceutical composition comprising the recombinant poxvirus described herein in an amount effective to reduce the amount of cancer cells in the subject. A method for reducing the amount of cancer cells is also provided herein.

[0031] A method for inducing an anti-cancer immune response in a subject, comprising contacting cancer cells with a recombinant poxvirus described herein or a pharmaceutical composition comprising the recombinant poxvirus described herein in an amount effective to induce an anti-cancer immune response. A method for inducing an anti-cancer immune response is also provided herein. In some embodiments, the anti-cancer immune response comprises activation of an innate or adaptive immune response against cancer.

[0032] In some embodiments of the methods provided herein, administration comprises systemic administration. In some embodiments, systemic administration is selected from subcutaneous, intramuscular, oral, intravenous, intranasal, transdermal, intraperitoneal, intralesional, and intramuscular administration.

[0033] In some embodiments of the methods provided herein, administration comprises local administration. In some embodiments, local administration comprises intratumoral administration.

[0034] In some embodiments of the methods provided herein, the recombinant poxvirus is administered two or more times.

[0035] In some aspects of the methods provided herein, the method further comprises administering at least one additional therapeutic agent. In some aspects, the at least one additional therapeutic agent is selected from chemotherapy, radiation therapy, anti-proliferative therapy, viral therapy, immunotherapy (e.g., checkpoint inhibitors), and combinations thereof. In some aspects, the at least one additional therapeutic agent is administered to the patient prior to administration of the recombinant poxvirus. In some aspects, the at least one additional therapeutic agent is administered to the patient simultaneously with the recombinant poxvirus. In some aspects, the at least one additional therapeutic agent is administered to the patient after administration of the recombinant poxvirus. In some aspects, the at least one additional therapeutic agent is administered to the patient prior to administration of the recombinant poxvirus. In some aspects, the at least one additional therapeutic agent is administered to the patient simultaneously with the recombinant poxvirus.

[0036] In some aspects of the methods provided herein, the method further comprises administering at least one therapeutic intervention. In some aspects, the therapeutic intervention is surgery.

[0037] In some aspects of the methods provided herein, the recombinant poxvirus increases IFN-γ.

[0038] In some aspects, the disclosure also provides for the use of the recombinant poxvirus described herein or a pharmaceutical composition comprising the recombinant poxvirus provided herein in any of the methods provided herein.

[0039] In some aspects, the disclosure also provides a kit comprising the recombinant poxvirus described herein or a unit dosage form of a pharmaceutical composition comprising the recombinant poxvirus described herein.

[0040] In some aspects of the methods provided herein, the cancer is renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, cholangiocarcinoma, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma.

Brief Description of the Drawings

[0041]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32

Figure 33

Figure 34

Figure 35

Modes for Carrying Out the Invention

[0042] To make the present disclosure more readily understandable, certain terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Throughout this application, further definitions are set forth.

[0043] Definitions Generally, the nomenclature and techniques used in connection with cell and tissue culture, molecular biology, and protein and oligonucleotide or polynucleotide chemistry, and hybridization described herein are well - known and commonly used in the art. In this specification, amino acids may be referred to by either the generally known three - letter symbols or the one - letter symbols recommended by the IUPAC - IUB Biochemical Nomenclature Commission. Nucleotides may likewise be referred to by the generally accepted one - letter codes.

[0044] Throughout this application, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an") and "one or more" and "at least one" are used interchangeably herein. In certain embodiments, the term "a" or "an" means "singular". In other embodiments, the term "a" or "an" includes "two or more" or "plural".

[0045] The term "about" includes the recited number ± 10%. Thus, "about 10" means 9 - 11. References herein to "about" values or parameters include (and describe) aspects directed to the value or parameter itself. For example, an explanation referring to "about X" includes an explanation of "X".

[0046] The term "or" is used to mean "and / or" unless expressly stated otherwise to refer only to alternatives or if the alternatives are mutually exclusive, but the disclosure supports definitions that refer only to alternatives and "and / or". Further, as used herein, "and / or" should be considered to be each specific disclosure of two specific features or components, whether or not other features or components are present. Thus, the term "and / or" as used in phrases such as "A and / or B" herein is intended to include "A and B", "A or B", "A" (alone), and "B" (alone). Similarly, the term "and / or" when used in expressions such as "A, B, and / or C" includes the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0047] As used in this specification and the claims, the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. Any aspect discussed herein is contemplated to be practiced with respect to any recombinant virus (e.g., poxvirus), method, system, host cell, expression vector, and / or composition of the present disclosure.

[0048] The use of the term "for example" and its corresponding abbreviation "e.g." (whether italicized or not) means that the specific terms cited are representative examples of the present disclosure not intended to be limiting to the specific examples referred to or described, unless otherwise expressly stated.

[0049] The terms "nucleic acid", "nucleic acid molecule", "nucleotide", "nucleotide sequence", "oligonucleotide", or "polynucleotide" refer to a polymeric compound containing covalently linked nucleotides. The term "nucleic acid" includes ribonucleic acid (RNA) and deoxyribonucleic acid (DNA), both of which can be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA.

[0050] A "gene" refers to a collection of nucleotides that encodes the production of either RNA or protein. Genes include cDNA and genomic DNA molecules.

[0051] As used herein, a "functional" gene (including a functional transgene) refers to a gene capable of expressing an RNA or protein product, where the RNA or protein product retains at least one functional activity. As used herein, a "non-functional" gene (including a non-functional transgene) refers to a gene incapable of expressing an RNA or protein product that retains any functional activity. A non-functional gene can refer to a gene that has been completely removed or replaced. A non-functional gene can also refer to a gene that has been partially removed or replaced, such that the remaining portion of the gene is unable to express an active RNA or protein product.

[0052] A "coding sequence" is a nucleic acid sequence that can be transcribed and translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. "Regulatory sequences" include nucleotide sequences located upstream (5' non-coding sequence), within, or downstream (3' non-coding sequence) of the coding sequence that influence transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include promoters, translational leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, and stem-loop structures. The boundaries of the coding sequence are determined by the start codon at the 5' (amino) terminus and the translation stop codon at the 3' (carboxyl) terminus. Coding sequences include, but are not limited to, prokaryotic sequences, cDNA from mRNA, genomic DNA sequences, and synthetic DNA sequences. When the coding sequence is intended for expression in eukaryotic cells, a polyadenylation signal and transcription termination sequence can be located at the 3' of the coding sequence.

[0053] An "open reading frame", abbreviated as ORF, refers to a nucleic acid sequence of a length potentially translatable into a polypeptide sequence, which includes a translation initiation signal or start codon, such as ATG or AUG, and a stop codon, and can be either DNA, cDNA, or RNA.

[0054] "Homologous recombination" refers to the insertion of a foreign DNA sequence (the "insert DNA sequence") into another DNA molecule (the "target DNA sequence"). In some cases, the insert DNA sequence is targeted to a specific site within the target DNA sequence for homologous recombination. In the case of targeted homologous recombination, the insert DNA sequence typically contains a sufficiently long region that is homologous to the sequence of the target DNA sequence, enabling complementary binding and integration of the insert DNA sequence into the target DNA sequence. Longer regions of complementarity and a greater degree of sequence similarity generally increase the efficiency of homologous recombination.

[0055] "Heterologous" describes the relationship between one nucleic acid or amino acid sequence and one or more different nucleic acid or amino acid sequences, indicating that the sequences are not found to be joined at the same location, in the same structure, and in the same orientation in nature. The joining of heterologous sequences creates a juxtaposition of non-natural sequences. Such joining is the product of engineering performed in the laboratory. The products of such joining may be referred to as "recombinant."

[0056] Two heterologous nucleic acid or amino acid sequences can also be joined directly (fused) or joined by a "linker." In certain embodiments, the linker is a chemical linker. In certain embodiments, the linker contains one or more amino acids. A glycine-serine linker is one that contains both glycine and serine amino acids in any proportion, for example GGGS.

[0057] "Operably linked" means that a polynucleotide of interest is linked to regulatory elements so as to enable expression of the polynucleotide sequence. In some embodiments provided herein, the regulatory element is a promoter.

[0058] A "promoter" refers to a nucleic acid sequence that directly or indirectly regulates the transcription of a nucleic acid coding sequence to which it is operably linked.

[0059] An "endogenous promoter" is a promoter that is naturally associated with a gene or nucleic acid sequence. An endogenous promoter can be obtained, for example, by isolating a 5' non-coding sequence located upstream of a coding segment and / or exon. A "recombinant" or "heterologous" promoter is a promoter that is not normally associated with a nucleic acid sequence in its natural environment.

[0060] A "late promoter" is a promoter that is naturally associated with the expression of late genes. An "intermediate promoter" is a promoter that controls the expression of genes following the expression of early genes but is not controlled by a late promoter. Genes that are expressed early in the viral life cycle and precede intermediate and late gene expression are named "early promoters". The expression of late and intermediate genes controlled by an intermediate / late promoter is dependent on viral replication (in contrast to the expression of early genes whose expression is not dependent on viral replication). The temporal expression profiles of early, intermediate, and late promoters are distinguishing factors as discussed in Yang, et.al. J.Virol., Vol. 85, No. 19, p. 9899-9908 (2011), citing Baldick et al., J.Virol., 67:3515-3527, (1993), each of which is incorporated herein by reference. Baldick disclosed that early-, intermediate-, and late-type mRNAs can be detected at 20 minutes, 100 minutes, and 140 minutes, respectively, after synchronous infection of HeLa cells with VACV. Yang generated whole-genome early, intermediate, and late transcription maps and characterized the distinctive properties of intermediate and late promoters. As used herein, the terms "intermediate promoter" and "late promoter" can refer to either the intermediate and late promoters discussed in Yang, particularly the promoters shown in FIG. 8.

[0061] Representative late promoters include, but are not limited to, pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R. Representative intermediate promoters include, but are not limited to, pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L.

[0062] "Vector" refers to a carrier nucleic acid molecule or vehicle that can be introduced into a replicable cell. "Expression vector" refers to a vector containing a nucleic acid sequence encoding at least a portion of a gene product that can be transcribed. An expression vector typically contains one or more control sequences necessary for the transcription and / or translation of the operably linked coding sequence. The vector can be introduced into a desired host cell by known methods including, but not limited to, transfection, transduction, cell fusion, and lipofection.

[0063] "Transfection" refers to the introduction of an exogenous nucleic acid molecule into a cell. A "transfected" cell contains an exogenous nucleic acid molecule inside the cell, and a "transformed" cell is one in which the exogenous nucleic acid molecule inside the cell induces a change in the phenotype of the cell.

[0064] The terms "peptide", "polypeptide", and "protein" are used interchangeably herein and refer to a polymeric form of amino acids of any length, including coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.

[0065] The starting point of a protein or polypeptide is known as the "N-terminus" (or amino terminus, NH2 terminus, N-terminal part, or amine terminus), which refers to the free amine (-NH2) group of the first amino acid residue of the protein or polypeptide. The ending point of a protein or polypeptide is known as the "C-terminus" (or carboxy terminus, carboxyl terminus, C-terminal part, or COOH terminus), which refers to the free carboxyl group (-COOH) of the last amino acid residue of the protein or polypeptide.

[0066] As used herein, "amino acid" refers to a compound containing both a carboxyl (-COOH) and an amino (-NH2) group. "Amino acid" refers to both natural and non-natural (e.g., synthetic) amino acids. Natural amino acids with three-letter and one-letter abbreviations include alanine (Ala; A); arginine (Arg, R); asparagine (Asn; N); aspartic acid (Asp; D); cysteine (Cys; C); glutamine (Gln; Q); glutamic acid (Glu; E); glycine (Gly; G); histidine (His; H); isoleucine (Ile; I); leucine (Leu; L); lysine (Lys; K); methionine (Met; M); phenylalanine (Phe; F); proline (Pro; P); serine (Ser; S); threonine (Thr; T); tryptophan (Trp; W); tyrosine (Tyr; Y); and valine (Val; V).

[0067] "Amino acid substitution" in a polypeptide or protein refers to a polypeptide or protein that contains one or more substitutions at an amino acid residue of a wild-type or natural amino acid with an amino acid that is different from the wild-type or natural amino acid. The substituted amino acid can be a synthetic or natural amino acid. In some embodiments, the substituted amino acid is a natural amino acid selected from the group consisting of A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, and V. Substitution variants can be described using an abbreviation system. For example, a substitution variant in which the 5th amino acid residue is substituted can be abbreviated as "X5Y", where "X" is the wild-type or natural amino acid to be replaced, "5" is the position of the amino acid residue within the amino acid sequence of the protein or polypeptide, and "Y" is the substituted amino acid, or a non-wild-type or non-natural amino acid.

[0068] An "isolated" polypeptide, protein, peptide, or nucleic acid has been removed from its natural environment. It should also be understood that an "isolated" polypeptide, protein, peptide, or nucleic acid can be formulated with excipients, such as diluents or adjuvants, and still be considered isolated.

[0069] The term "recombinant", when used with respect to a nucleic acid molecule, peptide, polypeptide, or protein, means a new combination of genetic material not known to exist in nature or something resulting from such a combination. Recombinant molecules can be produced by any of the well-known techniques available in the field of recombinant technology, including but not limited to: polymerase chain reaction (PCR), gene splicing (e.g., using restriction endonucleases), gene splicing, and solid-phase synthesis of nucleic acid molecules, peptides, or proteins.

[0070] "Poxvirus" refers to a virus of the Poxviridae family, including, for example, viruses of the Orthopoxvirus genus. The "genome" of the recombinant poxvirus provided herein includes a poxvirus genome containing one or more deletions (removals) of endogenous sequences (genes or nucleotides) and / or the addition of one or more heterologous sequences (genes and / or nucleotides). For example, the genome of a recombinant poxvirus can refer to the genome of an attenuated poxvirus.

[0071] "Oncolytic virus" refers to a DNA or RNA virus that preferentially infects and kills cancer cells compared to normal cells. Oncolytic viruses can kill cancer cells through a number of mechanisms, including direct tumor regression or apoptosis of infected cells, apoptosis death of non-infected cells, and induction of an immune response against cancer cells. In direct tumor regression, the virus causes lysis or apoptosis of host cells as a direct result of replication or infection.

[0072] "Oncolytic activity" refers to the ability of a virus to preferentially infect and kill cancer cells relative to normal cells. Cancer cell death can be caused by preferential infection, replication, and destruction of cancer cells (referred to as "direct cytotoxic activity") and by simulating and amplifying the host's anti-cancer immune response, and in addition to destroying existing cancer cells, a permanent immunity can be established. Oncolytic activity can be detected by known methods including, but not limited to, detection of cell death or apoptosis, inhibition of cell proliferation, and / or detection of reduction in tumor size.

[0073] A virus is considered "cytotoxic" if it reduces the cell viability of treated target cells compared to untreated target cells. Methods for determining the cytotoxicity of a virus are known and include, for example, cytotoxicity assays that measure necrosis and / or apoptosis of cells after virus infection, such as the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay and other related tetrazolium salt-based assays (e.g., XTT, MTS, or WST), ATP assays, apoptosis assays such as TUNEL staining of infected cells, DNA fragmentation assays, DNA laddering assays, and cytochrome C release assays. Another method for measuring cytotoxicity is to monitor tumor size and location before and after treatment. In some cases, it may be desirable to monitor size over several time points to obtain information regarding an increase or decrease in the size of a tumor or metastasis.

[0074] "Attenuated virus" refers to a virus that is non-pathogenic and has reduced toxicity to normal or non-cancerous cells. An attenuated virus can be attenuated or recombinantly modified so that it does not exhibit pathogenicity in normal tissue. In some embodiments, the modification does not affect or minimally affects the oncolytic ability of the virus.

[0075] "Pathogenic virus" is a virus that causes disease. In some embodiments, the recombinant poxviruses provided herein are not pathogenic viruses.

[0076] "Replicable" refers to the ability of a virus to replicate in a cell or cell line and produce infectious progeny virus particles. A virus that can produce infectious progeny virus particles in a cell or cell line is considered "replicable", while a virus that cannot produce infectious progeny virus particles in a cell or cell line is considered "replication-deficient". The replication of a virus can be expressed by the ratio of the amount of virus produced by infected cells to the amount used to infect the cells, and is referred to as the "amplification rate". An amplification rate of 1 or more means that the amount of virus produced from infected cells is the same as or more than the amount used for cell infection, indicating that replication has occurred. An amplification rate of less than 1 means that the amount of virus produced from infected cells is less than the amount used for cell infection, indicating that no replication has occurred within the cells.

[0077] As used herein, the terms "interleukin 12", "IL-12", and "IL12" refer to a protein comprising the p35 subunit (IL-12A) and the p40 subunit (IL-12B). The p35 subunit and the p40 subunit can be expressed as separate proteins that heterodimerize, or can be expressed together as a single fusion protein.

[0078] The terms "cell proliferative disorder" and "proliferative disorder" refer to disorders associated with some degree of abnormal cell proliferation. Cell proliferative disorders can include cancer.

[0079] "Cancer" or "cancerous" refers to a physiological state in mammals characterized by unregulated cell growth, lack of differentiation, local tissue invasion and / or metastasis. "Tumor" refers to an abnormal growth of cells in a tissue. The terms "cancer", "cancerous", "cell proliferative disorder", "proliferative disorder" and "tumor" are not mutually exclusive.

[0080] "Effective amount" refers to an amount that, for example, when administered in vitro or to a patient, produces a detectable result reproducibly. "Therapeutically effective amount" refers to an amount that, when administered to a patient having a condition, produces a therapeutically significant change in the symptoms of one or more conditions. In one aspect, the therapeutically effective amount is sufficient to treat cancer.

[0081] "Patient", "subject", and "individual" are used interchangeably and refer to an animal to which treatment is provided, including humans and non-human animals such as, for example, primates, cattle, pigs, sheep, goats, dogs, cats, rabbits, and rodents, as well as non-mammals such as chickens, amphibians, and reptiles. In one aspect, the subject is a human. In one aspect, the subject is a human having cancer. In another aspect, the subject is an experimental animal or an animal disease model.

[0082] The term "treating" or "treatment" refers to a therapeutic treatment whose purpose is to reduce or eliminate one or more symptoms. Beneficial or desirable results include, but are not limited to, removal of symptoms, alleviation of symptoms, reduction in the degree of a condition, stabilization of a condition (e.g., not worsening), delay or retardation of the progression of a condition. Treating cancer can include inducing cell death of cancer cells or cells within a tumor.

[0083] "Tumor progression" refers to the stages of a tumor including tumorigenesis, tumor growth and proliferation, invasion, and metastasis. "Inhibition of tumor progression" refers to inhibiting the occurrence, growth, proliferation, or spread of a tumor, for example, inhibition or reduction of tumor growth; reduction in the number of cancer cells; reduction in tumor size; inhibition or reduction of cancer cell invasion into adjacent peripheral organs and / or tissues; inhibition or reduction of metastasis; increase in the survival period of a patient or patient population after treatment; and / or decrease in the mortality rate of a patient or patient population at a predetermined time point after treatment.

[0084] Recombinant poxvirus, method for producing recombinant poxvirus, and composition containing the same A recombinant poxvirus containing a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, is provided herein. Such a recombinant poxvirus is particularly advantageous in that it exhibits cell specificity that preferentially kills cancer cells while minimizing harmful effects on healthy non-cancerous cells.

[0085] In some embodiments, the poxvirus belongs to the genus Orthopoxvirus. In some embodiments, the poxvirus belonging to the genus Orthopoxvirus is vaccinia virus. In some embodiments, the poxvirus belonging to the genus Orthopoxvirus is oncolytic vaccinia virus. In some embodiments, the oncolytic vaccinia virus is selected from the group consisting of Western Reserve (WR), Elstree, Wyeth, Lister, Tian Tan, LIVP, and Copenhagen (Cop) strains. In some embodiments, the oncolytic vaccinia virus is selected from the Copenhagen (Cop) strain.

[0086] In some embodiments of the recombinant poxvirus provided herein, the genome of the recombinant poxvirus comprises at least 150 kilobases (kb), at least 175 kb, at least 180 kb, at least 185 kb, at least 190 kb, at least 192 kb, or at least 194 kb. In some embodiments of the recombinant poxvirus provided herein, the genome of the recombinant poxvirus comprises about 150 kb to 200 kb.

[0087] In some embodiments, the recombinant poxvirus is attenuated.

[0088] As provided herein, various late promoters can be used in recombinant poxviruses. In some embodiments of the recombinant poxviruses disclosed herein, the recombinant poxvirus comprises a late promoter selected from pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R. In some embodiments, the late promoter is selected from pA14L, pA26L, and pF17R. In some embodiments, the late promoter is pA14L or pF17R. In some embodiments, the late promoter is pA14L. In some embodiments, the late promoter is pF17R.

[0089] The sequences of the late promoters pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R are provided in Table 1 below.

[0090]

Table 1

[0091] As provided herein, various intermediate promoters can be used in recombinant poxviruses. In some embodiments of the recombinant poxviruses disclosed herein, the recombinant poxvirus comprises an intermediate promoter selected from pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L.

[0092] The sequences of the intermediate promoters pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L are provided in Table 2 below.

[0093]

Table 2

[0094] In some embodiments, the late promoter comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 11.

[0095] In some embodiments, the late promoter comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 22.

[0096] In some embodiments, the late promoter comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 13.

[0097] In some embodiments, the late promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 23.

[0098] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 25. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 25.

[0099] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 26.

[0100] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 27. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 27.

[0101] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 28. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 28.

[0102] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 29. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 29.

[0103] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 30.

[0104] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 31. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 31.

[0105] As described above, the recombinant poxvirus provided herein contains a heterologous nucleic acid sequence encoding IL-12 in its genome. The IL-12 can be human IL-12. The IL-12 can be mouse IL-12.

[0106] In some embodiments of the recombinant poxvirus disclosed herein, IL-12 is a fusion protein comprising an IL-12 p40 subunit and an IL-12 p35 subunit. The IL-12 p40 subunit can be at the N-terminus of the IL-12 p35 subunit. Alternatively, the IL-12 p40 subunit can be at the C-terminus of the IL-12 p35 subunit. The IL-12 p40 subunit and the IL-12 p35 subunit can be fused directly (i.e., without a linker) or via a linker. The linker can be, for example, a chemical linker or an amino acid linker. The amino acid linker can be a glycine-serine linker. In some embodiments, the linker is about 5 to about 10 amino acids in length. In some embodiments, the linker is 7 amino acids in length. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO: 18.

[0107] Examples of widely used vaccinia virus vectors include highly attenuated strains such as New York vaccinia virus (NYVAC). In some embodiments of the recombinant poxvirus disclosed herein, the recombinant poxvirus is not NYVAC.

[0108] In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p40 subunit comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO: 17. In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p40 subunit is the amino acid sequence of SEQ ID NO: 17.

[0109] In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p35 subunit comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p35 subunit is the amino acid sequence of SEQ ID NO: 19.

[0110] In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p40 subunit comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO: 17, and the IL-12 p35 subunit comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p40 subunit is the amino acid sequence of SEQ ID NO: 17, and the IL-12 p35 subunit is the amino acid sequence of SEQ ID NO: 19.

[0111] In some embodiments of the recombinant poxvirus disclosed herein, the heterologous nucleic acid sequence encoding IL-12 comprises a nucleotide sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 comprises the nucleotide sequence of SEQ ID NO: 21.

[0112] In some embodiments of the recombinant poxvirus disclosed herein, the heterologous nucleic acid sequence encodes an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the IL-12 amino acid sequence of SEQ ID NO: 20, or the amino acid sequence of SEQ ID NO: 20.

[0113] In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus is deficient in thymidine kinase (TK). In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus lacks a functional J2R gene.

[0114] In some embodiments of the recombinant poxviruses disclosed herein, the poxvirus lacks ribonucleotide reductase (RR) activity. In some embodiments of the recombinant poxviruses disclosed herein, the poxvirus lacks a functional I4L gene. In some embodiments of the recombinant poxviruses disclosed herein, the poxvirus lacks a functional F4L gene. In some embodiments of the recombinant poxviruses disclosed herein, the poxvirus lacks a functional I4L gene and lacks a functional F4L gene.

[0115] In some embodiments of the recombinant poxviruses disclosed herein, the poxvirus lacks thymidine kinase (TK) and / or ribonucleotide reductase (RR) activity. In some embodiments of the recombinant poxviruses disclosed herein, the poxvirus lacks a functional J2R gene and lacks a functional I4L gene. In some embodiments, the poxvirus lacks a functional J2R gene and lacks a functional F4L gene. In some embodiments, the poxvirus lacks a functional J2R gene, lacks a functional I4L gene, and lacks a functional F4L gene.

[0116] In some embodiments of the recombinant poxviruses disclosed herein, the heterologous nucleic acid sequence encoding IL-12 is inserted within the J2R locus of the poxvirus genome. In some embodiments, the J2R gene is rendered non-functional by the insertion. In some embodiments, the J2R locus is completely deleted by the insertion. In some embodiments, the J2R locus is not sufficiently deleted by the insertion.

[0117] In some embodiments of the recombinant poxvirus disclosed herein, the heterologous nucleic acid sequence encoding IL-12 is inserted into the I4L locus of the poxvirus genome. In some embodiments, the I4L gene is non-functional due to the insertion. In some embodiments, the I4L locus is completely deleted by the insertion. In some embodiments, the I4L locus is not sufficiently deleted by the insertion.

[0118] In some embodiments of the recombinant poxvirus disclosed herein, the heterologous nucleic acid sequence encoding IL-12 is inserted into the F4L locus of the poxvirus genome. In some embodiments, the F4L gene is non-functional due to the insertion. In some embodiments, the F4L locus is completely deleted by the insertion. In some embodiments, the F4L locus is not sufficiently deleted by the insertion.

[0119] In some embodiments of the recombinant poxvirus disclosed herein, in addition to encoding IL-12, the poxvirus further encodes one or more therapeutic genes. In some embodiments, the one or more therapeutic genes are selected from the group consisting of suicide genes, immunomodulatory genes, anti-angiogenic genes, immune checkpoint inhibitory genes, antibody-encoding genes, extracellular matrix degradation or regulatory genes, or combinations thereof.

[0120] In some embodiments of the recombinant poxvirus disclosed herein, the recombinant poxvirus is capable of lysing one or more cancer cells.

[0121] In some embodiments, the recombinant poxvirus is 10 -2At a multiplicity of infection (MOI) of, it can express at least 50 ng / mL, at least 100 ng / mL, at least 300 ng / mL, at least 500 ng / mL, at least 1.0 μg / mL, at least 2.0 μg / mL, at least 3.0 μg / mL, at least 4.0 μg / mL, at least 5.0 μg / mL, at least 6.0 μg / mL, at least 7.0 μg / mL, at least 8.0 μg / mL, or approximately 8.3 μg / mL of IL-12 in cancer cells (e.g., A549 cells) 72 hours after infection. In some embodiments, the recombinant poxvirus is 10 -2 At a multiplicity of infection (MOI) of, it can express from about 50 ng / mL to about 50 μg / mL of IL-12 in cancer cells 72 hours after infection. In some embodiments, the recombinant poxvirus is 10 -2 At a multiplicity of infection (MOI) of, it can express from about 1 μg / mL to about 50 μg / mL of IL-12 in cancer cells 72 hours after infection. In some embodiments, the recombinant poxvirus is 10 -2 At a multiplicity of infection (MOI) of, it can express from about 2 μg / mL to about 50 μg / mL of IL-12 in cancer cells 72 hours after infection. In some embodiments, the recombinant poxvirus is 10 -2 At a multiplicity of infection (MOI) of, it can express from about 3 μg / mL to about 50 μg / mL of IL-12 in cancer cells 72 hours after infection. In some embodiments, the recombinant poxvirus is 10 -2 At a multiplicity of infection (MOI) of, it can express from about 1 μg / mL to about 40 μg / mL of IL-12 in cancer cells 72 hours after infection. In some embodiments, the recombinant poxvirus is 10 -2 At a multiplicity of infection (MOI) of, it can express from about 2 μg / mL to about 40 μg / mL of IL-12 in cancer cells 72 hours after infection. In some embodiments, the recombinant poxvirus is 10 -2can express from about 3 μg / mL to about 40 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. In some embodiments, the recombinant poxvirus is 10 -2 can express from about 1 μg / mL to about 30 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. In some embodiments, the recombinant poxvirus is 10 -2 can express from about 2 μg / mL to about 30 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. In some embodiments, the recombinant poxvirus is 10 -2 can express from about 3 μg / mL to about 30 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. In some embodiments, the recombinant poxvirus is 10 -2 can express from about 1 μg / mL to about 25 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. In some embodiments, the recombinant poxvirus is 10 -2 can express from about 2 μg / mL to about 25 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. In some embodiments, the recombinant poxvirus is 10 -2 can express from about 3 μg / mL to about 25 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10.

[0122] In some embodiments, cancer cells that can be lysed by the recombinant poxviruses provided herein and / or that can express Il-12 from the recombinant poxviruses provided herein include, but are not limited to, renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, cholangiocarcinoma, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma cells. In some embodiments, such cancer cells are A549, HT29, or MIA PaCa-2 cells.

[0123] In some embodiments of the recombinant poxviruses disclosed herein, the virus is produced in chicken embryo fibroblasts (CEF), HeLa cells, EB66® cells, Vero cells, HEK293 cells, PerC6 cells, BHK21 cells, or MRC5 cells. In some embodiments of the recombinant poxviruses described herein, the virus is produced in chicken embryo fibroblasts (CEF).

[0124] In some embodiments, the recombinant poxviruses disclosed herein are produced in a suitable host cell line or suitable producer cells using conventional techniques that include culturing the transfected or infected host cells under suitable conditions to allow for the production and recovery of infectious poxvirus particles.

[0125] A method for producing a recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, is also provided herein. In some embodiments, the method for producing a recombinant poxvirus comprises: a) obtaining or preparing producer cells; b) infecting the obtained or prepared producer cells with a recombinant poxvirus; c) culturing the infected producer cells under suitable conditions that allow for the production of the recombinant poxvirus. In some embodiments, such a method further comprises: d) recovering the produced recombinant poxvirus from the culture of the producer cells. In some embodiments, such a method further comprises: e) purifying the recovered recombinant poxvirus. In some embodiments, the producer cells are chicken embryo fibroblasts (CEF), HeLa, EB66®, Vero, HEK293, PerC6, BHK21, or MRC5 cells. Recombinant poxviruses produced by such methods are also provided herein.

[0126] In some embodiments, the producer cells can be cultured in a suitable medium that can be supplemented with serum and / or suitable growth factors as needed in step a) (e.g., a chemically defined medium that does not include animal or human-derived production can be used). The appropriate medium can be selected by one of ordinary skill in the art depending on the producer cells. Such media are commercially available. The producer cells are cultured at a temperature of +30°C to +38°C (e.g., about 37°C) for 1 to 8 days prior to infection. If necessary, several passages can be performed over 1 to 8 days to increase the total cell number.

[0127] A pharmaceutical composition comprising a recombinant poxvirus containing a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, is also provided herein. In some embodiments, the present disclosure provides a pharmaceutical composition comprising the recombinant poxvirus described herein and a pharmaceutically acceptable carrier. In some embodiments, the present disclosure provides a composition comprising a therapeutically effective amount of the recombinant poxvirus and a pharmaceutically acceptable carrier. In some embodiments, the therapeutically effective amount for an individual dose of the recombinant poxvirus described herein is 1×10 3 pfu to 1×10 12 pfu. In some embodiments, the therapeutically effective amount for an individual dose of the recombinant poxvirus described herein is 1×10 4 pfu to 1×10 11 pfu. In some embodiments, the therapeutically effective amount for an individual dose of the recombinant poxvirus described herein is 1×10 5 pfu to 1×10 10 pfu. In some embodiments, the therapeutically effective amount for an individual dose of the recombinant poxvirus described herein is 5×10 7 pfu to 4×10 9 pfu.

[0128] In some embodiments, the present disclosure provides a recombinant poxvirus pharmaceutical composition comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter for use in treating or preventing a proliferative disease such as cancer. In some embodiments, the cancer is selected from the group consisting of renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, cholangiocarcinoma, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, and malignant glioma.

[0129] Kit A kit is provided herein that includes a recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter as described herein, or a pharmaceutical composition comprising the recombinant poxvirus described herein. In certain embodiments, the kit includes a unit dosage form of such a recombinant virus or pharmaceutical composition. In certain embodiments, a kit is provided herein that includes one or more containers filled with one or more of the components of the compositions described herein, such as the recombinant poxvirus described herein, optionally accompanied by instructions for use.

[0130] Therapeutic Use and Methods A method for inducing apoptosis in cancer cells, comprising contacting the cancer cells, under conditions that induce apoptosis, with a recombinant poxvirus that contains a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein. In some embodiments, the cancer cells can include, but are not limited to, renal cancer cells, prostate cancer cells, breast cancer cells, bladder cancer cells, colorectal cancer cells, lung cancer cells, liver cancer cells, gastric cancer cells, cholangiocarcinoma cells, endometrial cancer cells, pancreatic cancer cells, ovarian cancer cells, head and neck cancer cells, melanoma cells, glioblastoma cells, multiple myeloma cells, or malignant glioma cells.

[0131] A method for inhibiting the growth of cancer cells or promoting the death of cancer cells, comprising contacting the cancer cells, under conditions that inhibit growth or promote the death of the cancer cells, with a recombinant poxvirus that contains a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein. In some embodiments, the cancer cells can include, but are not limited to, renal cancer cells, prostate cancer cells, breast cancer cells, bladder cancer cells, colorectal cancer cells, lung cancer cells, liver cancer cells, gastric cancer cells, cholangiocarcinoma cells, endometrial cancer cells, pancreatic cancer cells, ovarian cancer cells, head and neck cancer cells, melanoma cells, glioblastoma cells, multiple myeloma cells, or malignant glioma cells.

[0132] In some aspects of the present disclosure, methods of inducing apoptosis in cancer cells are performed in vitro. In some aspects of the present disclosure, methods of inhibiting the growth of cancer cells or promoting the death of cancer cells are performed in vitro. In some aspects of the present disclosure, methods of inducing apoptosis in cancer cells are performed in vivo. In some aspects of the present disclosure, methods of inhibiting the growth of cancer cells or promoting the death of cancer cells are performed in vivo.

[0133] Also provided herein is a method of treating cancer in a subject, comprising administering to the subject an effective amount of a recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, for treating cancer.

[0134] Also provided herein is a method of reducing the amount of cancer cells in a subject, comprising administering to the subject an effective amount of a recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, for reducing the amount of cancer cells in the subject.

[0135] A method of inducing an anti-cancer immune response in a subject, comprising contacting cancer cells with a recombinant poxvirus that contains a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, in an amount effective to induce an anti-cancer immune response. Also provided herein are methods. In some embodiments, the anti-cancer immune response comprises activation of a innate immune response or an adaptive immune response against cancer. In some embodiments, the anti-cancer immune response comprises activation of an innate immune response against cancer. In some embodiments, the anti-cancer immune response comprises activation of an adaptive immune response against cancer. In some embodiments, the anti-cancer immune response comprises activation of both an innate immune response and an adaptive immune response against cancer.

[0136] In some embodiments of the methods comprising administration as described herein, the administration comprises systemic administration. In some embodiments, the systemic administration is selected from subcutaneous, intramuscular, oral, intravenous, intranasal, transdermal, subcutaneous, and intramuscular administration. In some embodiments, the recombinant poxvirus is administered two or more times.

[0137] In some embodiments of the methods comprising administration as described herein, the administration comprises local administration. In some embodiments, the local administration comprises intratumoral administration. In some embodiments, the recombinant poxvirus is administered two or more times.

[0138] In some embodiments of the methods described herein, the method further comprises administering at least one additional therapeutic agent. In some embodiments, the at least one additional therapeutic agent is selected from chemotherapy, radiation therapy, anti-proliferative therapy, viral therapy, and combinations thereof. In some embodiments, the at least one additional therapeutic agent is administered to the patient prior to administration of the recombinant poxvirus. In some embodiments, the at least one additional therapeutic agent is administered to the patient concurrently with the recombinant poxvirus. In some embodiments, the at least one additional therapeutic agent is administered to the patient after administration of the recombinant poxvirus.

[0139] In some embodiments of the methods provided herein, the method further comprises administering at least one therapeutic intervention. In some embodiments, the therapeutic intervention is surgery.

[0140] In some embodiments, the present disclosure provides the use of a recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late or intermediate promoter, in a method of inducing apoptosis of cancer cells described herein, or a pharmaceutical composition comprising the recombinant poxvirus described herein.

[0141] In some embodiments, the present disclosure provides the use of a recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late or intermediate promoter, in a method of inhibiting the growth of cancer cells or promoting the death of cancer cells described herein, or a pharmaceutical composition comprising the recombinant poxvirus described herein.

[0142] In some embodiments, the present disclosure provides the use of a recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, in a method for treating cancer in a subject described herein, or a pharmaceutical composition comprising the recombinant poxvirus described herein.

[0143] In some embodiments, the present disclosure provides the use of a recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, in a method for reducing the amount of cancer cells in a subject described herein, or a pharmaceutical composition comprising the recombinant poxvirus described herein.

[0144] In some embodiments, the present disclosure provides the use of a recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, in a method for reducing the amount of cancer cells in a subject described herein, or a pharmaceutical composition comprising the recombinant poxvirus described herein.

[0145] In some aspects, the present disclosure provides a recombinant poxvirus that contains a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome for use in a method of inducing an anti-cancer immune response in the subjects described herein, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or the use of a pharmaceutical composition comprising the recombinant poxvirus described herein.

Example

[0146] The examples in the section of this example are provided by way of illustration and not limitation.

[0147] The generation of the COPTG19673 and COPTG19674 vectors, which are recombinant vaccinia (VACV) viruses that express human IL-12 (hIL-12) under the control of two different promoters, pF17R and pA14L, respectively, is described below. Experiments and analyses regarding the selection of the pF17R and pA14L promoters are also described.

[0148] The COPTG19673 and COPTG19674 vectors encode human IL-12 (hIL-12) as a fusion of the p40 and p35 subunits linked by a glycine-serine (GS)-linker. The same hIL-12 coding sequence was inserted into two viruses but was under the control of two different late promoters: COPTG19673 contains the pF17R promoter, while COPTG19674 contains the pA14L promoter. The IL-12 transgene was vectorized in the vaccinia virus Copenhagen strain that has both the deleted thymidine kinase gene (J2R) and ribonucleotide reductase gene (I4L) as described in WO 2009 / 065546 (which is incorporated herein by reference in its entirety). These two deletions restrict virus replication in highly proliferating cells such as tumor cells (which contain high concentrations of nucleotides). Thus, the expression of the transgene that is directly dependent on virus genome replication is limited to tumor cells (see, for example, Foloppe et al., 2019, Mol Ther Oncolytics 14:1-14, and Kleinpeter et al., 2016, Oncoimmunology 5:e1220467). The expression cassette containing the promoter and the IL-12 transgene was inserted into the J2R locus of the double-deleted vaccinia virus Copenhagen strain.

[0149] The in vitro characteristics of the oncolytic vaccinia viruses COPTG19673 and COPTG19674 that express interleukin-12 are also described below.

[0150] Materials Viruses VVTG18058 (empty VACV, VACV control, or no-arm control VACV) is a vaccinia virus (Copenhagen strain) lacking the J2R and I4L genes. VVTG18058 was used as the no-arm control VACV. VVTG18058 was produced in chicken embryo fibroblasts (CEF). Titration was performed by plaque assay using Vero cells.

[0151] COPTG19104 is a vaccinia virus (Copenhagen strain) that expresses the fluorescent protein mCherry under the control of the pH5R promoter at the J2R locus. The I4L gene is deleted. It was used as the starting parental virus for the generation of recombinant viruses.

[0152] VACVwt (also called COPwt) is a wild-type vaccinia virus (Copenhagen strain) without deletions. VACVwt was produced in CEF.

[0153] Cells and cell lines Chicken embryo fibroblasts (CEF): CEF cells were isolated from 11-day-old specific pathogen-free (SPF) embryonated eggs (Charles River).

[0154] Vero cells: The African green monkey (Cercopithecus aethiops) kidney cell line Vero (ATCC® CCL-81™) was cultured in DMEM (Gibco) supplemented with 10% FBS, 2 mM L-glutamine, and containing gentamicin at a final concentration of 40 mg / L and 4.5 g / l glucose. The growth conditions were 37°C - 5% CO2.

[0155] Human tumor cell lines The human lung cancer cell line A549 (ATCC® CCL-185™) was cultured in DMEM (Gibco) supplemented with 10% FBS, 2 mM L-glutamine, and containing gentamicin at a final concentration of 40 mg / L and 4.5 g / l glucose. The growth conditions were 37°C - 5% CO2.

[0156] The human cervical tumor cell line HeLa (ATCC® CCL-2™) was cultured in DMEM (Gibco) supplemented with 10% FBS and 40 mg / L gentamicin at 37°C, 5% CO2.

[0157] The human pancreatic tumor cell line MIA PaCa-2 (ATCC® CCL-1420™) was cultured in DMEM (ATCC®) supplemented with 10% FBS and containing gentamicin at a final concentration of 40 mg / L at 37°C, 5% CO2.

[0158] The human colorectal tumor cell line HCT116 (ATCC® CCL-247™) was cultured in McCoy’s 5A (ATCC®) supplemented with 10% FBS and containing gentamicin at a final concentration of 40 mg / L at 37°C, 5% CO2.

[0159] The human colorectal cancer cell line HT-29 (ATCC® HTB-38) was cultured in McCoy’s 5A (Gibco) supplemented with 10% FBS and containing gentamicin at a final concentration of 40 mg / L.

[0160] HEK-Blue® IL-12 cells (InvivoGen, ref hkb-il12) were cultured in DMEM (Gibco) supplemented with 10% heat-inactivated FBS, 100 μg / ml Normocin® (InvivoGen), HEK Blue® selection (Invivogen), and containing penicillin and streptomycin at final concentrations of 100 U / mL and 100 μg / mL, respectively.

[0161] The natural killer cell line NK-92 (ATCC® CRL-2407™) was cultured in alpha minimum essential medium (Gibco) supplemented with 1× Glutamax (Gibco), 1.5 g / L sodium bicarbonate (Gibco), 0.2 mM inositol (Sigma), 0.1 mM β-mercaptoethanol (Sigma), 0.02 mM folic acid (Sigma), 150 U / ml recombinant IL-2, and 25% fetal bovine serum.

[0162] Chicken fibroblasts and human cell lines The continuous cell line DF-1 of chicken embryo fibroblasts (ATCC® CRL-12203™) was cultured at 39°C and 10% CO2 in DMEM (Gibco) supplemented with 10% FBS, 2 mM L-glutamine, and 40 mg / L gentamicin.

[0163] Human peripheral blood mononuclear cells (PBMCs) from healthy donors (EFS: Etablissement francais du sang) were prepared by Ficoll gradient and cultured in RPMI (SIGMA®) supplemented with 10% FBS and containing gentamicin and glutamine at final concentrations of 40 mg / L and 2 mM, respectively.

[0164] Bacteria Escherichia Coli DH5α strain (genotype: F-Φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 λ-; Invitrogen, 1826312) was used for cloning and plasmid amplification in LB medium supplemented with 100 μg / mL ampicillin.

[0165] DNA cloning Cloning, plasmid amplification, and other molecular biology procedures were performed according to standard procedures.

[0166] DNA sequencing DNA was sequenced by the Sanger method.

[0167] Example 1: Comparative Evaluation of Vaccinia Virus Promoters Construction of Reporter-Introduced Plasmids Reporter-introduced plasmids were designed to evaluate the strength of different poxvirus promoters to be evaluated. The reporter gene encoded a fusion of Renilla luciferase (RLuc) and Aequorea victoria green fluorescent protein (GFP) separated by a linker (Ala)5-Thr (GenBank: ABZ79968.1). Different poxvirus promoters were inserted upstream of the RLuc-GFP fusion (SEQ ID NO: 1). The expression cassette was inserted into a poxvirus-introduced plasmid designed to be able to insert a nucleotide sequence into the J2R locus of the vaccinia virus genome by homologous recombination. This plasmid was derived from plasmid pUC18 that cloned the adjacent sequences of the left arm (L arm) and the right arm (R arm) surrounding the J2R locus. SEQ ID NO: 1: Nucleic Acid Sequence of RLuc / GFP

Chemical Formula

[0168] A synthetic fragment named "RLuc-GFP" containing a fusion gene encoding the RLuc-GFP protein was synthetically generated. It was inserted by homologous recombination into a set of introduced plasmids containing a poxvirus early / late promoter restricted with PvuII, resulting in the plasmids listed in Table 3. A schematic diagram of plasmid pTG19409 containing the RLuc-GFP coding gene under the expression control of the pH5R promoter is shown in Figure 1.

[0169]

Table 3

[0170] To evaluate the late promoter, the sequence encoding the RLuc-GFP fusion was cloned immediately downstream of the promoter using its natural start codon. A synthetic fragment containing the late promoter and the start of the RLuc-GFP fusion was generated synthetically and inserted by homologous recombination into pTG19409 restricted by SmaI-MscI, yielding the plasmids described in Table 4.

[0171]

Table 4

[0172] The resulting reporter plasmids were first tested in transient infection / transfection expression assays to identify the best candidates. In a second step, some of them were used for the generation of recombinant poxviruses as described below.

[0173] Cloning, plasmid amplification, and other molecular biology procedures were performed according to standard procedures.

[0174] Transient Infection / Transfection with Luciferase Reporter Plasmids Reporter plasmids using the RLuc-GFP reporter enable the evaluation of cell infection and the accurate measurement of the accompanying reporter expression levels.

[0175] To better control the expression level and minimize the off-target expression of different transgenes, several VACV promoters can be used according to their strength or the timing of expression (early, intermediate, or late) during poxvirus infection. Some poxvirus promoters (such as p7.5K or pH5R) have both early and late elements and can express the transgene in the early stage after virus infection and in the late stage after viral genome replication, respectively. Therefore, to further minimize the off-target expression of potentially toxic transgenes such as IL-12, the expression of the transgene can be driven by a late promoter that is only activated after viral genome replication.

[0176] For pre-evaluation in transient infection-transfection experiments, six late promoters: pA10L (SEQ ID NO: 9), pA11R (SEQ ID NO: 10), pA14L (SEQ ID NO: 11), pA26L (SEQ ID NO: 12), pF17R (SEQ ID NO: 13), and pG7L (SEQ ID NO: 14) were selected. Their late promoters were cloned upstream of the gene encoding the fusion RLuc-GFP in the transfection plasmid. These plasmids were evaluated by transient infection-transfection experiments in DF-1 cells. A plasmid encoding firefly luciferase under the control of the p11K7.5 promoter was co-transfected to normalize the transfection variability. Both luciferases were measured 24 hours later.

[0177] Briefly, after culturing DF-1 cells in a 24-well culture plate, they were infected with the empty vaccinia virus (VVTG18058) without the transgene at an MOI of 1. After 2 hours, 0.5 ng of different Renilla reporter plasmids (see Table 2), 0.5 ng of a control reporter plasmid encoding firefly luciferase under the control of p11K7.5, and 250 ng of the control plasmid pTG15839 encoding GFP under the control of the CMV promoter, complexed with 0.625 μL of Lipofectamine 2000 (Invitrogen) in opti-MEM medium, were added to each well. Transfection was performed three times in succession. Then, the plates were incubated at 37 °C and 5% CO2 for 24 hours. For luciferase measurement, the supernatant was removed, the cells were lysed, and processed according to the "Dual-Luciferase Reporter Assay System" (Promega).

[0178] The results obtained with six late promoters are illustrated in Figure 2. For each promoter, the Renilla luciferase / firefly luciferase (R / F) ratio is reported, showing the results of two independent experiments. The highest level of expression was obtained with the pF17R promoter, which was 3 to 4 times stronger than the pA14L and pA10L promoters. The pA11R, pA26L, and pG7L promoters were 8 to 10 times weaker than the pF17R promoter.

[0179] Three promoters of different strengths: pF17R (SEQ ID NO: 13), pA14L (SEQ ID NO: 11), and pA26L (SEQ ID NO: 12) were selected for further evaluation in the context of recombinant poxvirus.

[0180] Generation of recombinant poxvirus for comparative evaluation of vaccinia virus promoters An expression plasmid containing the fusion reporter gene RLuc-GFP under the control of various promoters was constructed. Four early / late promoters: p7.5K (SEQ ID NO: 4), pH5R (SEQ ID NO: 2), p11K7.5 (SEQ ID NO: 3) and pSE / L (SEQ ID NO: 8) were tested, and three early promoters: pB2R (SEQ ID NO: 5), pA35R (SEQ ID NO: 7) and pC11R (SEQ ID NO: 6) were also evaluated. Three late promoters (pF17R (SEQ ID NO: 13), pA14L (SEQ ID NO: 11) and pA26L (SEQ ID NO: 12)) previously tested by transient infection-transfection were also tested with recombinant VACV. See Tables 3 and 4.

[0181] Ten different VACV-RLuc-GFP vectors were generated by homologous recombination in CEF by inserting the RLuc-GFP expression cassette into the J2R locus of the double-deleted vaccinia virus Copenhagen strain under the transcriptional control of different poxvirus promoters as described herein. All of these viruses are deficient in the activities of thymidine kinase (TK, J2R locus) and ribonucleotide reductase (RR, I4L locus).

[0182] The recombinant vaccinia virus was generated by homologous recombination in CEF using an introduced plasmid containing an expression cassette that is integrated with the adjacent sequences (L arm and R arm) surrounding the J2R locus, using COPTG19104 as the starting parental virus. Homologous recombination of the introduced plasmid and the parental vaccinia virus (Copenhagen strain) enables the generation of a recombinant vaccinia virus that loses the mCherry expression cassette and yields an expression cassette that produces white (non-fluorescent) plaques. More specifically, CEF in F175 flasks were infected with COPTG19104 at an MOI of 0.05 at room temperature for 1 hour. The virus suspension was then discarded, and the infected cells were incubated in MBE + 5% FBS at 37 °C + 5% CO2 for 2 hours, then trypsinized and counted. 10 million infected cells were transfected with 2 μg of the I-SceI restriction-introduced plasmid by nucleofection. The transfected cells were then transferred to the wells of a 6-well plate, incubated at 37 °C for 48 hours, and then frozen. After sonication, CEF were infected using serial dilutions of the introduced mixture for the selection of recombinant virus. Non-fluorescent white plaques were excised and used for a second plaque purification. The selected non-fluorescent white plaques were excised and amplified in a 6-well plate at 37 °C, 5% CO2 for 72 hours. The amplicon was used for PCR, followed by the selection of the recombinant vaccinia virus.

[0183] The primary stock was produced by infecting 100 μL of the selected clone into CEF grown 72 hours prior to infection. Virus amplification was carried out for 72 hours at 37 °C and 5% CO2 in MBE supplemented with 5% FBS. The infected cells and the medium were subjected to freeze-thaw cycles and then homogenized by sonication. This so-called primary stock was then characterized and stored in aliquots until use. After virus amplification in F500 flasks seeded with CEF, a purified bulk was produced. The infected cells and the medium were collected to generate a crude harvest stored at -80 °C. The virus was purified according to the procedure described in WO 2007 / 147528 pamphlet (which is incorporated herein by reference in its entirety).

[0184] Recombinant vaccinia viruses are referred to for identification as follows: COPTG19409 (VACV containing promoter pH5R), COPTG19410 (VACV containing promoter p11K7.5), COPTG19411 (VACV containing promoter p7.5K), COPTG19412 (VACV containing promoter pB2R), COPTG19415 (VACV containing promoter pA14L), COPTG19416 (VACV containing promoter pA26L), COPTG19417 (VACV containing promoter pF17R), COPTG19431 (VACV containing promoter pC11R), COPTG19436 (VACV containing promoter pA35R), and COPTG19437 (VACV containing promoter pSE / L).

[0185] Comparative evaluation of vaccinia virus promoters in human tumor cell lines and human PBMC Human tumor cell lines HeLa, MIA PaCa-2, and HCT116 were infected with 10 previously obtained recombinant vaccinia viruses at an MOI of 0.1 or 1 in 96-well plates as described in the following protocol. Cells were harvested at 6 hours and 24 hours for quantification of luciferase expression and detection of GFP-expressing cells.

[0186] For these human tumor cell lines, cells were seeded the day before at 1E+05 cells / well / 200 μL in 96-well plates. Before infection, the medium was removed and replaced with 200 μL of medium containing FBS and the virus to infect at an MOI of 0.1 or 1.

[0187] For these human PBMCs, cells were seeded the day before at 2E+05 cells / well / 125 μL in 96-well plates. For infection, 50 μl of virus dilution was added per well in medium containing FBS and infected at an MOI of 1. The infection was performed in 3 independent replicates on 2 separate plates (1 for luciferase measurement and the other for GFP analysis). For luciferase measurement, the supernatant was removed, the cells were lysed and processed according to the "Renilla Reporter Assay System" (Promega).

[0188] For GFP quantification, the supernatant was removed, then the cells were trypsinized, centrifuged, washed with 100 μL of PBS, stained with 100 μL of 100-fold diluted live / dead near-IR and incubated for 15 minutes at room temperature in the dark. The cells were then centrifuged, washed and resuspended in 100 μL of PBS. Then, the detection of GFP was performed by flow cytometry using a MACS Quant 16 instrument (Miltenyi Biotec) and analyzed using Kaluza software (manufactured by Beckman Coulter). The results were expressed as the percentage of live GFP-positive cells (infected cells). FACS (fluorescently labeled cell sorting) analysis showed that for all MOIs and cell lines, approximately 70 - 90% of the cells were GFP-positive 24 hours after infection (data not shown). All viruses gave the same result and showed a similar level of infectivity for all of the viruses.

[0189] Renilla luciferase was measured at 6 and 24 hours post-infection, and the results obtained in MIA PaCa-2 cells are shown in Figures 3A and 3B, respectively. Expression was normalized to the weakest promoter, pA26L. At 6 hours post-infection, the late promoters pF17R, pA14L, and pA26L yielded very low levels of expression. The highest levels of expression were obtained with the early / late promoter pH5R, followed by the early promoters pB2R and pC11R, and the early / late promoters pSE / L and p11K7.5. Similar results were obtained regardless of the MOI of infection and in two other cell lines (HeLa and HCT116) (data not shown). At 24 hours post-infection, the results were different for the early promoters pB2R, pC11R, and pA35R, which yielded low levels of expression. Higher expression levels were detected with the promoters of p11K7.5, pSE / L, pF17R, pH5R (11 - 21-fold that of pA26L), while p7.5K and pA14L yielded intermediate levels of expression (7 - 11-fold that of pA26L).

[0190] HeLa cells and HCT-116 cells were infected, and the results obtained at 24 hours post-infection are shown in Figures 4 and 5, respectively. The results were similar to those obtained in MIA Paca-2 cells. The differences in strength between the promoters were more evident at MOI 0.1 rather than MOI 1 (up to 14-fold and up to 7-fold that of pA26L, respectively).

[0191] From the results obtained in the three cell lines, the promoters could be classified into three strength groups. Weak promoters included the three early promoters (pB2R, pA35R, and pC11R) and the late promoter A26L. Intermediate promoters were 2 - 5-fold more efficient than the weak promoters. They corresponded to the early / late promoters p7.5K and pH5R, and the late pA14L promoter. The most powerful promoters were 2 - 3-fold more powerful than the intermediate promoters. They corresponded to the early / late promoters p11K7.5 and pSE / L, and the late pF17R promoter.

[0192] Next, 10 recombinant vaccinia viruses were used to infect human PBMCs at an MOI of 1 in a 96-well plate. After 6 hours and 24 hours, cells were collected for quantification of luciferase expression and detection of GFP-expressing cells.

[0193] The results of flow cytometry analysis are shown in Figure 6. After 6 hours, after infection with viruses containing early or early / late promoters, approximately 12% of the cells were detected as GFP-positive cells. In contrast, after infection with viruses containing late promoters, a very low number of cells were detected as GFP-positive (less than 4% for pA26L, less than 1% for pF17R and pA26L). Due to death of infected cells and lack of replication of recombinant vaccinia virus, the percentage of GFP-positive cells decreased after 24 hours of infection. Subsequently, the percentage of infected cells was approximately 5% for viruses containing early and early / late promoters and very low for viruses containing late promoters.

[0194] Renilla luciferase was measured at 6 hours and 24 hours, and the results are shown in Figure 7. Expression was normalized to the weakest promoter, pA26L. The levels of luciferase were lower (about 100-fold lower) than the levels detected after infection of human tumor cells. Furthermore, due to death of infected cells, expression decreased between 6 hours and 24 hours. Cells infected with viruses containing late promoters (pF17R, pA14L, and pA26L) expressed very low levels of luciferase, which were about 100-fold to 300-fold less than the expression detected with early or early / late promoters.

[0195] The vaccinia virus used in this test was derived from the Copenhagen strain and lacked both the thymidine kinase gene (J2R) and the ribonucleotide reductase gene (I4L). These two deletions restrict virus replication in highly proliferative cells such as tumor cells (which contain high concentrations of nucleotides). Since these viruses cannot replicate efficiently in primary human PBMC, the late promoter is not activated in these cells.

[0196] Conclusion This test enabled the identification of two late promoters, pF17R and pA14L, which induce strong or moderate expression in human tumor cells but little expression was detected in primary human cells. Therefore, these promoters were selected to minimize off-target expression of potentially harmful transgenes such as IL-12.

[0197] Example 2: Generation and production of recombinant vaccinia virus encoding IL-12 by homologous recombination Construction of the transfer plasmids pTG19673 and pTG19674 Plasmids pTG19673 and pTG19674 contain the human IL-12 gene under the control of the pF17R and pA14L promoters, respectively.

[0198] Endogenous human IL-12 is unique among cytokines in that it is a disulfide-linked heterodimer of two separately encoded subunits (p35 and p40). A single-chain IL-12 protein was expressed from a vaccinia construct in which the full-length p40 subunit was fused via a G6S linker to the p35 subunit with its leader sequence cleaved (i.e., IL-12.p40.delta p35) (see Lieschke et al., 1997, Nat Biotechnol. 1997 Jan;15(1):35-40).

[0199] The primary protein structure of the hIL-12 fusion protein contains IL-12 p40 linked to IL-12 p35 by a 7-amino acid polypeptide linker, as shown in the following sequence (SEQ ID NO: 15). Fusion IL-12.p40.delta p35 (SEQ ID NO: 15):

Chem.

[0200] The mature IL-12 fusion protein contains amino acids 23 - 532 of SEQ ID NO: 15, as shown in SEQ ID NO: 20 below. Mature fusion IL-12.p40.delta p35 (SEQ ID NO: 20):

Chem.

[0201] The nucleotide sequence of fusion IL-12.p40.delta p35 was optimized for human codon usage and optimal gene expression using Geneart's GeneOptimizer algorithm. The sequence of the expression cassette present in pTG19673 is shown in Figure 8 (SEQ ID NO: 21). SEQ ID NO: 21 is provided below.

Chem.

[0202] The vaccinia virus-introduced plasmids pTG19535 and pTG19537 were designed to be able to insert nucleotide sequences into the J2R locus of the vaccinia virus genome by homologous recombination. They are derived from plasmid pUC18 and cloned the sequences (L arm and R arm) adjacent to both sides of the J2R locus. Plasmid pTG19535 contains the pF17R promoter, while pTG19537 contains the pA14L promoter.

[0203] A fragment containing the IL-12 fusion was synthetically generated and inserted into a plasmid by Geneart. The corresponding plasmid was restricted by SnaB1, and the resulting fragment "hIL-12" was inserted by homologous recombination into pTG19535 (pF17R promoter) or pTG19537 (pA14L promoter) restricted by PvuII, yielding pTG19673 (Figure 9) or pTG19674 (Figure 10), respectively. In these plasmids, the expression cassette is inserted between the recombinant arms, enabling homologous recombination at the J2R locus of the vaccinia virus genome. Maxi preparations of both plasmids were produced and analyzed by sequencing the recombinant arms and the expression cassette inserted between them. The alignment of the analyzed sequence and the theoretical sequence showed 100% homology in both plasmids.

[0204] Two different late poxvirus promoters were used. The natural start codons of the pA14L and pF17R genes were not used for the expression of IL-12. Therefore, instead of the natural ATG, the sequence ATA was added downstream of the promoter.

[0205] The sequences of these two promoters, pA14L and pF17R, and the downstream ATA are as follows: pA14L (SEQ ID NO: 22) TTTGTTCATTCGGCGATTTAAAATTTTTATTAGTTAAATA pF17R (SEQ ID NO: 23) AAAATATAGTAGAATTTCATTTTGTTTTTTTCTATGCTATAAATA

[0206] Generation of recombinant vaccinia virus by homologous recombination Recombinant COPTG19673 and COPTG19674 were generated by homologous recombination in CEF using the introduction plasmids pTG19673 and pTG19674 encoding hIL-12 under the control of pF17R and pA14L, respectively, with COPTG19104 as the starting parental virus. COPTG19104 contains an mCherry expression cassette at the J2R locus. By homologous recombination of the introduction plasmid and the parental vaccinia virus, recombinant vaccinia viruses (COPTG19673 and COPTG19674) that lost the mCherry expression cassette and obtained the hIL-12 expression cassette can be generated (for the method of generating recombinant vaccinia virus, see Example 1).

[0207] The research primary stock of recombinant virus COPTG19673 obtained by homologous recombination of the introduction plasmid pTG19673 and the parental COPTG19104 is hereinafter referred to as the COPTG19673 primary stock.

[0208] The research primary stock of recombinant virus COPTG19674 obtained by homologous recombination of the introduction plasmid pTG19674 and the parental COPTG19104 is subsequently referred to as the COPTG19674 primary stock. The expression of IL-12 in the supernatants of A549 cells infected with COPTG19673 and COPTG19674 measured by ELISA is shown in Figure 11.

[0209] These primary research stocks were used for the in vitro characterization in Example 3.

[0210] Example 3: In Vitro Characterization of Recombinant Oncolytic Vaccinia Viruses COPTG19673 and COPTG19674 Expressing Interleukin 12 The vaccinia viruses COPTG19673, COPTG19674, and VVTG18058 described herein in Example 2 were used in the following tests.

[0211] VACVwt (also called COPwt) is a wild-type vaccinia virus (Copenhagen strain) without deletions. VACVwt was produced in CEF. Determination of the infectious titer in the following assays was performed by plaque assay using Vero cells.

[0212] Virus Replication Assay Replication in Human Tumor Cell Lines Replication of COPTG19673 and COPTG19674 was evaluated in three neoplastic human cell lines (A549, HT-29, and MIA PaCa-2) and compared to that of the armless control VACV VVTG18058 as a benchmark. The A549, HT-29, and MIA PaCa-2 tumor cell lines were infected with each virus at an MOI of 10 -3 . Subsequently, the infected cells were plated in 6-well plates and incubated at 37 °C in a 5% CO2 atmosphere for 24 hours, 48 hours, and 72 hours. The amount of virus produced in each cell line at each time point was determined by plaque assay using Vero cells.

[0213] Figures 12A - C show that the replication of COPTG19673, COPTG19674, and VVTG18058 was similar in the three human tumor cell lines.

[0214] Replication in Production Cells The replication of COPTG19673 and COPTG19674 was evaluated in CEF and human cell line (HeLa) (as virus production cells) and compared with that of armless control VACV as a benchmark. Seeded HeLa or CEF in 6-well plates were infected with each virus at an MOI of 0.05. Then, the plates were incubated at 37 °C in a CO2 atmosphere for 72 hours. Virus production in each cell type was determined by titration using Vero cells with the plaque assay method. Figure 13 shows that the replication of COPTG19673, COPTG19674, and VVTG18058 is similar in each of the two cells (CEF and HeLa) (i.e., a difference of less than 0.7 logarithm at 72 hours).

[0215] Oncolytic activity assay The oncolytic activities of COPTG19673 and COPTG19674 were evaluated in three human tumor cell lines (A549, HT-29, and MIA PaCa-2) and compared with the activity of armless control VACV (VVTG18058). Oncolytic activity was evaluated by quantifying cell viability after 5-day incubation.

[0216] Method for comparing the two viruses: Tumor cell lines were infected with each virus at 10 MOIs according to the cell lines used (i.e., A549 and HT-29: 3.10 -5 ~1, MIA PaCa-2: 10 -5 ~3.10 -1 ). Then, the infected tumor cells were incubated in 96-well plates at 37 °C under a CO2 atmosphere for 5 days. Cell viability was determined using the cell titer blue cell viability assay according to the protocol provided by the manufacturer.

[0217] The oncolytic activity, expressed as cell viability, represents the lytic activity of the tested virus samples against tumor cells. The oncolytic activity of each sample is expressed as a percentage of the cell viability of mock-infected cells. Figures 14A - C show the oncolytic activities of COPTG19673, COPTG19674, and VVTG18058 at different MOIs. From these results, the EC50 values (the MOI at which 50% of the cells are killed) of each virus in each cell line were calculated. The comparison of EC50s shows that the oncolyticities of COPTG19673, COPTG19674, and the armless control VACV are very similar in MIA PaCa-2. In A549 and HT-29, COPTG19673 showed a higher EC50 than VVTG18058, but at high MOIs, both VACVs showed equally strong oncolytic activity, with the remaining viable cells being less than 20%. The EC50s of both viruses were calculated using GraphPad Prism and are as follows. For A549: The EC50 of COPTG19673 is 6.3.10 -3 and the EC50 of COPTG19674 is 1.9.10 -3 and the EC50 of VVTG18058 is 3.8.10 -3 respectively. For Mia PaCa-2: The EC50 of COPTG19673 is 4.8.10 -3 and the EC50 of COPTG19674 is 2.7.10 -3 and the EC50 of VVTG18058 is 4.4.10 -3 respectively. For HT29: The EC50 of COPTG19673 is 1.2.10 -2 and the EC50 of COPTG19674 is 7.6.10 -3 and the EC50 of VVTG18058 is 4.9.10 -3 respectively.

[0218] The expression level of vIL-12 determined by ELISA After infecting with an MOI of 0.01 for 3 days, the expression levels of cytokine vhIL-12 in the supernatants of three tumor cell lines were measured. The terms vIL-12 and vhIL-12 refer to IL-12 expressed by VACV according to the present disclosure.

[0219] Supernatant preparation The starting material for measuring the expression level of vIL-12 is the supernatant recovered from MIA PaCa-2, A549, and HT-29 cells. The tumor cell lines were seeded in 6-well plates, infected with an MOI of 10-2, and incubated for 72 hours in 3 mL of an appropriate medium without fetal bovine serum. The supernatants were collected and then filtered to remove the virus.

[0220] Determination of IL-12 expression in the supernatant by ELISA The IL-12 concentration in the supernatants of the infected tumor cell lines was determined using the DuoSet® ELISA Development System Human IL-12 (R&D Systems ref DY1270-05). Three tumor cell lines, A549, HT-29, and MIA PaCa-2, were infected with VVTG18058, COPTG19673, or COPTG19674 at an MOI of 0.01 for 72 hours. Then, the IL-12 concentration in the supernatants of the infected cells was measured by ELISA. The supernatant of VVTG18058-infected cells was used as a negative control. The results are shown in Figure 15 as the mean value and standard deviation (SD) of duplicate measurements of three samples. Both the cell line and the promoter controlling the transcription of the transgene affect the level of transgene expression. The highest expression was obtained in A549 cells infected with COPTG19673. However, for both viruses and the three tumor cell lines tested, high-level expression of vIL-12 was obtained at concentrations ranging from 0.3 to 8.3 μg / mL.

[0221] Protein vIL-12 functional assay in the supernatant of infected tumor cells During the transgene expression assay of the "supernatant preparation" of this example, the functionality of IL-12 produced by the virus was evaluated by cell proliferation assay using HEK-Blue™ IL-12 reporter cells and using NK-92 cells.

[0222] Biological activity of vIL-12 in HEK Blue IL-12 reporter cells The biological activity of vhIL-12 produced in the supernatant of human tumor cell lines was assayed using HEK-Blue™ IL-12 reporter cells. The biological activity of vIL-12 produced in three human tumor cell lines infected with COPTG19673 and COPTG19674 was measured and compared with the biological activity of human recombinant hIL-12 (hereinafter rhIL-12).

[0223] HEK-Blue™ IL-12 cells are designed to detect bioactive IL-12 in humans and mice by monitoring the activation of the STAT-4 pathway. When IL-12 binds to the IL-12 receptor on the surface of HEK-Blue™ IL-12 cells, the signaling cascade leads to the activation of STAT-4 and then the production of the secreted alkaline phosphatase (SEAP) marker protein. Detection of SEAP in the supernatant of HEK-Blue™ IL-12 cells can be easily evaluated using QUANTI-Blue™.

[0224] In summary, HEK-Blue™ IL-12 cells were plated in 96-well flat-bottom microtiter plates at 5E+04 cells / well. Different dilutions of culture supernatant and rhIL-12 standard (concentrations ranging from 10 pg / mL to 100 ng / mL) were added to the 96-well cell culture microplate. The plate was incubated at 37°C. After 24 hours of incubation, detection of SEAP in the supernatant of HEK-Blue™ IL-12 cells was determined using QUANTI-Blue™ (Invivogen, ref rep-qbs) according to the provider's protocol. As negative controls, the supernatants of mock-infected cells and armless control VACV-infected cells were used.

[0225] The results shown in FIGS. 16A - F indicate that all three different samples tested contained biologically active vhIL-12. As controls, medium without rIL-12, supernatant (SN) from mock-infected cells, and SN from an armless control VACV-infected cell line were added, but these did not show SEAP expression. The comparison of the biological activities of vhIL-12 and rhIL-12 was performed after administering the same ELISA to all samples. At equivalent concentrations, vhIL-12 and rhIL-12 produced by the three infected tumor cell lines induced relatively similar levels of absorbance. The results showed that vIL-12 produced from two VACV-IL12 activated the HEK-Blue IL-12 cell line with a better EC50 than rhIL-12. These results demonstrated that IL-12 produced by VACV-infected tumor cells retained its cytokine activity.

[0226] Biological activity of vIL-12 against NK-92 cells The biological activity of vIL-12 produced in the supernatant of infected human tumor cell lines was assayed using a cytokine-dependent cell proliferation assay of the NK-92 cell line. The proliferation of NK-92 cells can be induced by IL-12. The biological activity of vhIL-12 produced by three human tumor cell lines infected with COPTG19673 and COPTG19674 was measured and compared with the biological activity of human recombinant hIL-12.

[0227] NK-92 is an interleukin 2-dependent natural killer cell line derived from peripheral blood mononuclear cells. NK-92 cells also proliferate in dependence on IL-12 and can then be used to control IL-12 functionality.

[0228] Briefly, NK-92 cells were plated in 96-well flat-bottom microtiter plates at 1E+04 cells / well. Different dilutions of culture supernatant and rhIL-12 standard (concentrations ranging from 1 pg / mL to 100 ng / mL) were added to the 96-well cell culture microplates. The plates were incubated at 37°C. After 48 hours of incubation, CellTiter-Glo® was added according to the provider's protocol. As negative controls, the supernatants of mock-infected cells and armless control VACV-infected cells were used.

[0229] The results shown in FIGS. 17A-E indicate that for both viruses, COPTG19673 and COPTG19674, all three different samples tested contained biologically active vhIL-12. As negative controls, SN from mock-infected cells and SN from the empty VACV-infected cell line were added and did not stimulate the proliferation of NK-92. The comparison of the biological activities of vhIL-12 and rhIL-12 was performed after administering the same ELISA to all samples. At equivalent concentrations, vhIL-12 from both viruses and rhIL-12 induced similar levels of proliferation of NK-92 from three tumor cell lines. Similar to the HEK-Blue IL12 cell line, the EC50 value was lower for vIL-12 than for rhIL-12. These results also demonstrated the functionality and potent efficiency of IL-12 produced from VACV.

[0230] In vitro safety assay Replication rate in normal human hepatocytes To monitor the safety profiles of COPTG19673 and COPTG19674, normal human hepatocytes were selected as these primary cells that can be obtained directly and regularly from donors.

[0231] Hepatocytes were provided by Biopredic in 6-well plates. The hepatocytes were infected with each virus at an MOI of 10 -3It was infected and incubated at 37°C in a CO2 atmosphere for 72 hours. The amount of virus produced after 72 hours of incubation was determined by virus titration per well by plaque assay in Vero cells. The results are expressed as the replication yield corresponding to the ratio of the amount of virus to the input / output. The results are the average of 3 wells.

[0232] VACVwt spread well with a replication yield of 837 (ratio of input virus and output virus). In the case of the armless control virus VVTG18058, the replication rate was dramatically reduced to 1 (Figure 18). Similarly, in human hepatocytes, COPTG19673 and COPTG19674 did not replicate, and the replication rate was less than 1. These results indicate that the replication attenuation to normal cells provided by the two deletions (TK and RR) is conserved between the armless control VACV (VVTG18058) and the VACV expressing IL-12 (COPTG19673 and COPTG19674).

[0233] Virus Replication in hPBMC To evaluate the safety profile of the newly generated VACV, human PBMCs were selected as the second normal primary cells. Wild-type VACV or armless VACV generally do not replicate in hPBMCs. The presence of cytokines or immunostimulatory molecules expressed by VACV can activate or stimulate immune cells, and as a result, change the replication profile of VACV in these cells. Therefore, the replication of COPTG19673 and COPTG19674 in these cells (i.e., hPBMCs) was evaluated and compared with the benchmark VACVwt and VVTG18058. Virus production was measured by plaque assay in Vero cells after infection at an MOI of 1 and 3 days of incubation.

[0234] The virus replication yield was determined as the ratio of the total infectious particles detected after 72 hours of infection (output) and the virus particles used for PBMC infection (input).

[0235] Figure 19 shows that two VACVs expressing IL-12, COPTG19673 and COPTG19674, as well as VACVwt and the armless control VACV, did not replicate in hPBMCs. In other words, vectorization of human IL-12 did not change the replication behavior of VACV on hPBMCs. Furthermore, Figures 27A - C show that amplification of COPTG19673 was not observed in human PBMCs and only minimal replication was observed in normal human hepatocytes and skin fibroblasts, indicating that replication is relatively specific to tumor cells.

[0236] Example 4: Efficacy of COPTG19673 (“VACV IL-12”) against human tumor cell lines The VACV expressing IL-12 COPTG19673 (hereinafter referred to as “VACV IL-12”) was further evaluated.

[0237] Cultured human tumor cells were grown on tissue culture plastic and incubated with VACV IL-12 at different MOIs ranging from 6.4E - 06 to 10 to determine the efficacy of virus-mediated tumor regression. After incubating the cells with the virus for 5 days, the Cell Titer Blue® cell viability assay was used to measure the cell viability in culture. The data were analyzed using GraphPad Prism software version 9.0.0, and the MOI (PFU) of the virus required for maximum half-maximal cell death extrapolated from the sigmoid dose-response curve (EC50 value) was determined. In the graph of Figure 20, the Y-axis shows the mean and standard deviation of the EC50 values for each cell line determined in independent experiments. The tumor type from which each cell line is derived is shown below the x-axis. The dashed line is arbitrarily set at an MOI of 0.1 PFU, which represents the amount of virus that infects and lyses one-tenth of a cynomolgus monkey Vero cell in the plaque formation assay used for PFU measurement. These results, as well as those shown in Figures 29B and 29C, demonstrate that VACV IL-12 has efficacy across various human tumor cell lines.

[0238] To further characterize the oncolytic activity of VACV IL-12, cell death in vitro was evaluated in 30 human cancer cell lines representing 12 tumor indications. Tumor cells were infected with VACV-LUC or VACV IL-12 at multiple MOIs, and cell death was evaluated on day 5 (see also Figures 29A - B, 20). The IL-12 receptor is mainly expressed in immune cells and not in tumor cells. Therefore, the difference in cell death between VACV-LUC and VACV IL-12 using this in vitro model was not expected. VACV-LUC and VACV IL-12 effectively killed tumor cells at low MOIs, demonstrating similar EC 50 values across the tumor panel (Pearson's r 2 = 0.89, p-value < 0.0001), further indicating that encoding IL-12 does not interfere with VACV replication (Figure 29C). Tumor regression mediated by VACV IL-12 was widely observed in tumor cell lines of various cancer types, with 27 / 30 tumor cell lines showing mean EC 50 values of 0.1 MOI or less. Transgene production and virus replication were also evaluated in tumor cell lines 5 days post-infection (MOI 0.004) (Figures 29D - E).

[0239] Example 5: Amounts of VACV IL12 virus and human IL-12 recovered from human bladder tumors after intravenous administration to tumor-bearing mice Tumors derived from SW780 human bladder cancer cells were transplanted into the flanks of immunodeficient NOD / SCID mice. 10 5 , 10 6 , or 10 7After a single intravenous administration of PFU of VACV IL-12, tumors were removed and analyzed for viral infiltration by plaque formation assay (PFU of virus per gram of tumor tissue) and IL-12 transgene produced by virus-infected cells (ng of IL-12 per gram of tumor) using a human IL12-specific ELISA (Figure 21A). In Figure 21B, the X-axis indicates the time points after viral administration. Asterisks indicate time points at which no virus or transgene determination was performed. Zero on the X-axis indicates that no measurable virus or transgene was recovered. The results in Figure 21A demonstrate that the amount of virus isolated from the tumor correlates with the amount of IL-12 detected in the tumor (Pearson's correlation coefficient 0.20, p=0.03).

[0240] Additional experiments were performed to evaluate transgene production and replication in SW780 tumor-bearing mice. In treated tumors, viral replication increased in a dose- and time-dependent manner. At 96 hours post-injection, 1 × 10 5 From mice treated with PFU, 2.5 × 10 4 ±4.3×10 4 PFU / g recovered: 1 x 10 6 9.5 × 10 from mice treated with PFU 7 ±1.0×10 8 PFU / g recovered: 1 x 10 7 From mice treated with PFU, 1.3 × 10 8 ±1.2×10 8 PFU / g were recovered (Figure 30A). Similarly, IL-12 production increased over time in the tumor (Figure 30E), whereas IL-12 was detectable in the periphery, although at low concentrations (Figure 30F).

[0241] To further determine the antitumor efficacy of VACV IL-12 in NOD / SCID mice bearing subcutaneous tumors from NCI-H292, SW780, or HCT-116 cell lines, mice were treated with VACV-LUC or VACV IL-12 (10 5 , 10 6 , and 10 7Treated with a single intravenous administration of PFU (Figs. 30A - C). In the NCI - H292 and HCT - 116 models, significant tumor control was observed with a single administration of 10 5 PFU (p - value < 0.001). With a single administration of 10 6 PFU of VACV IL - 12, significant tumor control was observed in the SW780 model (p - value < 0.001). Due to the lack of an intact immune system, VACV - LUC and VACV IL - 12 demonstrated similar tumor control, indicating that the oncolytic activity of VACV is an important factor in tumor control.

[0242] Example 6: Activity of VACV muIL - 12 against syngeneic murine tumors The activity of VACV encoding murine IL - 12 was evaluated after multiple and intratumoral administrations to C57BL / 6 mice implanted with subcutaneous MC38 colorectal tumors (Fig. 22A). Since human IL - 12 does not bind to the murine IL - 12 receptor, murine IL - 12 was selected as the cytokine encoded by VACV IL - 12 in these experiments. Tumors were randomly assigned to treatment groups after growing to a median of approximately 80 mm 3 . A total of 5 doses of 1e 7 PFU of virus were administered twice weekly for 14 days. Blood was collected 4 hours and 24 hours after the first administration, and subsequent tumor volumes were recorded. Tumor growth was evaluated in vehicle - treated control mice, mice administered VACV without the transgene (empty VACV), and mice administered VACV encoding muIL - 12 (VACV muIL - 12). Tumor growth is shown as individual tumor spider plots in Figs. 22B - D, and the survival of tumor - bearing mice is shown in the form of a Kaplan - Meier plot in Fig. 22E (CR, complete response of the tumor to therapy where no tumor volume is detected, *, p = 0.0024 by Log - rank (Mantel - Cox) comparing more than 3 groups performed in GraphPad Prism 9). These results demonstrate that VACV muIL - 12 is effective against syngeneic murine tumors.

[0243] Example 7: Expression of mouse IL-12 and induction of inflammatory cytokines by VACV muIL-12 Expression of mouse IL-12 was detected in the peripheral blood of mice 4 hours and 24 hours after intratumoral administration of VACV muIL-12, but not after administration of empty VACV and vehicle. (Figure 23A). Similarly, peripheral blood IFNγ levels (Figure 23B) were significantly higher in VACV muIL-12-treated mice compared to mice administered empty VACV or vehicle. Other inflammatory cytokines detected in peripheral blood showed a tendency to be higher in VACV muIL-12-treated mice compared to controls, including the IFNγ-inducible cytokine CXCL10 (Figure 23C), and the inflammatory cytokines IL6 (Figure 23D) and TNFα (Figure 23E).

[0244] Example 8: Activity of VACV luc in primary human patient-derived tumor xenografts The antitumor activity of luciferase-expressing VACV (VACV luc) was determined using primary tumors (PDX: patient-derived xenografts) from 47 patients with cancer transplanted into immunodeficient NOD / SCID mice (Table 5) (Figure 24A - H). Each tumor tested was either left untreated (white circles, grey lines) or administered 1x10 7 pfu VACV luc virus (black squares, black lines) intravenously (IV) weekly (protocol shown in Figure 28A), and administered a total of 3 times starting from the time when the tumor reached an average volume of approximately 200 mm 3 . Since each patient-derived primary tumor contains only one untreated tumor and one treated tumor, the white circles and black squares each represent a pair, but are graphed grouped by tumor type for simplicity. The response rate was determined according to the tumor volume relative to the untreated control (complete response (CR): no measurable tumor, partial response (PR): tumor volume decreased by >30%, stable disease (DS): tumor increase less than 100%, and progressive disease (PD): tumor growth progressing). On balance, animals treated with VACV Luc virus showed antitumor activity compared to untreated controls across tumor types. (Figure 28B and Table 5).

[0245] To evaluate the replication kinetics of VACV, viral replication in tumors was evaluated 48 hours after the first and third administrations. Infectious virus was recovered from all tumor models, demonstrating a significant increase in viral replication at the first and third administrations (p-value = 0.0079), indicating that VACV accumulates and replicates in the treated tumors (Figure 28C).

[0246]

Table 5

[0247] Example 9: Increasing IL-12R, NK cells, PDL1, CXCL9 and 10 by VACV infection As shown in Figures 25A - F, the mRNA expression levels of IL12RB1, IL12RB2, NKp46, PD-L1, CXCL9, and CXCL10 genes in whole mouse stroma isolated from VACV-luciferase treated mice and from patient-derived xenograft (PDX) models of bladder cancer, head and neck cancer, liver cancer, colon cancer, lung cancer, and ovarian cancer were measured at 0 days to 48 hours and 14 days. Total RNA was isolated from fresh frozen PDX tissues and ribosomal RNA and globin transcripts were removed. Strand RNAseq libraries were created and paired-end sequencing was performed.

[0248] Paired-end reads were aligned to the mouse genome reference build mm10 using the STAR aligner, and gene-level read counts were generated using Salmon. The read counts were further normalized for sequencing depth and gene length using tximport to generate TPM (Transcripts per kilobase million) values for plotting. All plots were generated using R version 4.1. These results demonstrate that VACV infection increases IL-12R, NK cells, PDL1, CXCL9 / 10, thereby priming the tumor microenvironment (TME) to induce potent anti-tumor immunity.

[0249] Example 10: VACV-IL-12 efficiently infects human tumors in vitro, resulting in blockade of IL-12 and early B8R-dependent IFN-γ. The efficiency of in vitro infection of VACV-IL12 in human tumors was examined. Specifically, the efficacy of VACV IL-12 was evaluated in melanoma, bladder cancer, colon cancer, lung cancer, ovarian cancer, and tumor tissue slice cultures (TSCs) derived from dissociated human tumor cells (DTCs) from patients with melanoma, head and neck squamous cell carcinoma, and ovarian cancer. DTCs of different tumor types were thawed in culture medium supplemented with 1X CTL anticoagulant wash solution. 50,000 cells were plated in 96-well U-bottom flasks and cultured with PBS (control), VACV-luciferase (MOI 1), or VACV-IL-12 (MOI 1). Supernatants were collected 72 hours after treatment from the cultured DTCs. IL-12 (i.e., IL12p70) concentrations were measured using the custom U-Plex human IL-12p70 assay or U-PLEX mouse IL-12p70 assay (catalog numbers K151UAK, K152UAK, Meso Scale Diagnostics), respectively, according to the manufacturer's protocol. Expression of human IL-12 was detected in the supernatant of tumor tissue slice cultures (TSCs) 3 days after infection with VACV IL-12, but not after infection with VACV-GFP or in mock-infected tissues (Figure 26A), and the same was true for DTCs (Figure 26B). Increased levels of IFNγ mRNA were detected in tissue slice cultures treated with VACV IL-12 compared to slices treated with VACV-GFP or mock infection, but differences in IFNγ protein expression were not detected in supernatants from the same tissues (Figures 26C-D).

[0250] Vaccinia virus encodes several immunomodulatory genes that suppress the activation of immune cells. For example, B8R sequesters and neutralizes IFNγ. VACV-IL-12 infection of TSCs resulted in the expression of B8R, which has been shown to sequester IFNγ into the supernatant. Significantly higher B8R levels were detected in TSCs infected with either VACV-GFP or VACV-IL-12 compared to mock-infected tissues (Figure 26E). In Figure 26E, each dot represents 1 slice and 1-4 replicates per condition. The data were analyzed using GraphPad Prism software version 9.0.0. A schematic diagram of VACV infection, transgene production, and tumor cell lysis is shown in Figure 26F.

[0251] IL-12p70 was produced in 19 / 19 of the DTC samples tested (17984 pg / mL ± SD 49523) by VACV IL-12 (COPTG1673) infection. In contrast, IL-12 concentrations in the supernatants from DTCs were negligible in mock-infected (6.15 pg / mL ± SD 9.13) or VACV GFP-treated (4.99 pg / mL ± SD 6.36) (Figure 31A-D). IFNγ RNA transcripts increased significantly after VACV IL-12 infection compared to mock infection (1.5-fold, p-value < 0.001) and VACV GFP in TSCs (1.4-fold, p < 0.001), but assessment in the supernatants of both DTCs and TSCs demonstrated that IFNγ protein was not produced after VACV IL-12 treatment (Figure 26B, 26D, and 31A-D).

[0252] Example 11: VACV encoding mouse IL-12 in an in vivo rat model overcomes the inhibitory effect of B8R and results in IFN-γ induction Since IFNγ signaling is important for the efficacy of IL-12, the effect of B8R on downstream IL-12 and IFNγ activation was evaluated. B8R encoded by VACV does not bind to mouse IFNγ, but B8R binds to and neutralizes human and rat IFNγ. To confirm the binding of B8R to rat IFNγ, competitive ELISA was performed. Recombinant B8R protein or filtered supernatant from VACV-infected HeLa cells (MOI 1) was incubated with recombinant IFNγ at 37 °C for 1 hour. Next, ELISA was performed to measure the available rat IFNγ. Incubation with rB8R resulted in more than 50% neutralization, but the supernatant of infected cells could dose-dependently inhibit the detection of IFNγ, confirming that B8R binds to rat IFNγ (Figure 32A).

[0253] Based on the ability of B8R to bind to rat IFNγ, a syngeneic genetic rat tumor model was utilized to evaluate VACV IL-12 (COPTG1673) in an immunocompetent model. Since muIL12 has been shown to cross-react in rats, an alternative VACV-muIL12 virus was used. Furthermore, VACV-muIL12 replicates effectively in rat tumor cells and produces the muIL-12 transgene compared to mouse tumor cells (Figures 32B - C). Similarly, VACV-muIL12 mediates strong tumor regression of rat tumor cell lines but has low cytotoxic activity against mouse tumor cell lines (Figures 32D - F). Rats were transplanted with F98 tumor cells and on days 0, 4, and 7 were treated intravenously with VACV-LUC (1×10 7 PFU) or VACV-muIL12 (1×10 5 , 1×10 6 , 1×10 7 ). Cytokine analysis in plasma confirmed the production of IL12p70, and 1×10 5 and 1×10 6A gradual increase was seen between the rats treated with [treatment method not specified] (Figure 32G). Furthermore, IFN-γ could be detected in the plasma of rats treated with VACV-muIL12, but not in the VACV-LUC control group (Figure 32H). These results indicate that IL12 encoded by VACV induces peripheral IFNγ production and that it is not inhibited by B8R.

[0254] Interferon-γ competitive ELISA Recombinant rat IFN-γ (1 ng / ml) (R&D) was incubated with PBS, recombinant B8R (50 ng / ml) (Vendor), or 0.2 μm filtered supernatant of HeLa cells infected with VACV IL-12 (MOI1). The mixture was incubated at 37 °C for 1 hour. Since B8R binds to IFN-γ and interferes with antibody binding and detection by ELISA, ELISA was performed to determine the recovery rate of IFN-γ as described below. The recovery rate was calculated relative to IFN-γ alone.

[0255] ELISA Rat interferon-γ was measured at the indicated time points in the plasma of rats treated with VACV. Plasma was diluted and measured using the Rat IFN-γ DuoSet Elisa according to the manufacturer's protocol (R&D systems). This demonstrates that recombinant poxvirus can increase interferon (IFN)-γ.

[0256] Example 12: VACV expressing IL12 improves the therapeutic effect in a murine syngeneic genetic tumor model To evaluate the immunomodulatory effect of IL-12, the murine alternative VACV-muIL12 virus was tested in murine tumor cell lines and tumor models. VACV-muIL12 demonstrated similar replication, tumor regression, and bioactivity of the transgene in human and murine tumor cell lines (Figures 33A-E and 34A-F). Mice bearing subcutaneous CT26 tumors were treated with five intratumoral (i.t.) administrations (107 PFU) of either vehicle control, VACV-LUC, or alternative VACV-muIL12 (Figures 35A-D). Treatment with VACV-LUC did not result in control of CT26 tumors (0 / 10 complete responses), similar to the vehicle group (Figures 35B-D). However, treatment with VACV-muIL12 resulted in regression of CT26 tumors, with 6 / 10 having complete responses (Figure 35E).

[0257] VACV-LUC and VACV-muIL12 demonstrated similar oncolytic activity and replication in murine tumor cells (Figures 34A-F). Therefore, the observed differences in tumor control were hypothesized to be due to the immunomodulatory effects of muIL12. Therefore, animals were treated according to the protocol shown in Figure 35A. Evidence of IL12 production in serum was detected 4 hours after injection (Figure 35F). Induction of IFNγ, an important feature of IL-12 signaling, was detected at 4 and 24 hours after injection in VACV-muIL12-treated mice (Figure 35G). Similar results were observed in the MC38 syngeneic tumor model (Figures 22A-E, 23A-B, 23E). Overall, these results suggest that VACV encoding IL-12 is involved in the adaptive immune response to control tumor growth, but the oncolytic activity of VACV-LUC alone is insufficient to control the tumor burden.

[0258] Example 13: Methods for In Vivo and Ex Vivo Tests In Vivo Tests Xenografts derived from cell lines were established by subcutaneous (sc) injection of 5 × 10 6 cells / 200 μL suspended in PBS into the right flank of 8- to 12-week-old animals. Tumors were 150-250 mm before randomization3 was reached. Animal body weight was measured twice a week for 4 weeks and then once a week, and weight loss was monitored for protection purposes.

[0259] To establish the MC38 mouse syngeneic tumor model, Accutase solution was used to remove cells from tissue culture plastic. The collected cells were stored on ice (not exceeding 3 hours) during the period from collection to transplantation. The transplantation site of each animal was shaved at least 24 hours before cell injection. Into the right flank of 7 - 9 - week - old C57BL / 6J female animals, 5×10 5 cells suspended in 100 μL of phosphate - buffered saline (PBS) were subcutaneously injected to establish syngeneic tumors. When the tumor volume reached 200 mm 3 , the mice were randomized. The body weight of the mice was monitored throughout the study.

[0260] To establish CT26 tumors, trypsin solution was used to remove cells from a T - 150 flask before transplantation, and trypsin was neutralized by adding RPMI + 10% FBS. The collected cells were stored on ice (not exceeding 3 hours) during the period from collection to transplantation. The transplantation site of each animal was shaved at least 24 hours before cell injection. Into the right flank of 9 - 12 - week - old Balb / c female animals, 5×10 5 cells suspended in 200 μL of PBS were subcutaneously injected to establish syngeneic tumors. When the tumor volume reached 150 - 250 mm 3 , the mice were randomized. The body weight of the mice was monitored throughout the study.

[0261] To establish 47 PDX models, cryovials containing tumor cells were thawed and prepared for injection into mice. The thawed cells were washed with RPMI medium, counted, and resuspended in cold RPMI at a concentration of 50,000 - 100,000 viable cells / 50 μL. The cell suspension was mixed with an equal volume of CULTUREX™ extracellular matrix (ECM) and stored on ice during transport to the animal breeding room. The cells were withdrawn into a chilled 1 ml slip tip syringe containing the ECM - cell mixture and prepared for injection. The filled syringe was stored on ice to avoid solidification of the ECM. The animals were shaved prior to injection. One mouse at a time was immobilized and the injection site was disinfected with an alcohol swab. 100 μL of the cell suspension (50,000 - 100,000 cells) in ECM was subcutaneously injected into the hind flanks of NOD - SCID mice aged 9 - 29 weeks. 100 μL of the cell suspension per syringe was injected into a maximum of 5 animals.

[0262] To inoculate tumor chunks, frozen tumor pieces were thawed and cut into tumor chunks approximately 2 - 3 mm in diameter. Each mouse was injected once with buprenorphine 30 minutes prior to tumor chunk transplantation. One tumor chunk was loaded onto a trocar needle and injected into the right anterior flank of the mouse for tumor development. The mice were tagged with ear tags and left undisturbed for up to 7 days prior to observing tumor growth. After the tumor reached approximately 130 - 230 mm 3 in size, they were assigned to the treatment groups. The anti - cancer effect of VACV Luc was determined by comparing the growth curves of each treated tumor to the growth curves of untreated tumors of a matched size. In this way, the best overall response of the treated tumors compared to the untreated tumors was designated as complete response (CR), partial response (PR), stable disease (SD), or progressive disease (PD). Tumors that did not fit into the classification were considered non - evaluable (NE).

[0263] To establish F98 tumors in rats, trypsin solution was used to remove cells from a 10 - layer flask, and trypsin was neutralized by adding DMEM + 10% FBS. The collected cells were stored on ice (not exceeding 3 hours) from collection until transplantation. The F98 cell line was suspended in 0.2 mL of PBS at 5.0×106 The cells were transplanted by subcutaneous (SC) injection into the right flank of 7- to 9-week-old animals. The tumors were left untreated until they reached approximately 300-350 mm 3 prior to randomization.

[0264] Ex vivo analysis To evaluate viral replication in the tumors, the mice were euthanized, blood was collected, and the tumors and normal tissues were excised and snap-frozen. The frozen tumors and normal tissues were weighed and suspended in ice-cold homogenization buffer (PBS supplemented with 1× antibiotic-antifungal and 1× HALT™ protease-phosphatase inhibitor). The tissue containing the homogenization buffer was transferred to Matrix A tubes and homogenized at 4 m / sec for 20 seconds using a Fast-prep-24 lysing system. The tissue homogenate was then subjected to two freeze-thaw cycles, aliquoted, and stored at -80°C. Two additional aliquots that were not subjected to freeze-thaw were prepared for DNA isolation or cytokine analysis by MSD.

[0265] Cytokine analysis Aliquots of tumor homogenates and spleen homogenates were centrifuged at 1,500 RPM for 5 minutes at 4°C. The supernatants were collected and stored at -80°C for cytokine measurement. Blood was collected from the mice at the indicated time points and centrifuged at 13,000 RPM for 10 minutes at 4°C. Plasma was collected and stored at -80°C. The plasma, tumor, and spleen lysates were diluted and measured using the mouse and human IL12p70 U-Plex assay (Meso Scale Diagnostics) or a custom U-Plex mouse cytokine panel according to the manufacturer's protocol.

[0266] Statistical analysis Differences in tumor mass size at the indicated times during the experiment were evaluated using one-way analysis of variance (ANOVA) with Tukey's correction for multiple comparisons, using GraphPad Prism software (San Diego, California, USA). Statistical differences in the calculated tumor growth rates were evaluated using a two-sided Mann-Whitney U-test (also known as the Wilcoxon rank sum test). The mean growth rate and growth rate inhibition statistics are reported along with the p-value of the Mann-Whitney U-test. Differences in virus recovery rate (PFU) from tumors, human IL-12 transgene detected in tumors (pg / mL), and IL-12 transgene detected in mouse plasma (pg / mL) were determined using ANOVA with Tukey's correction for multiple comparisons. Significant p-values obtained from ANOVA analysis.

Claims

**Claim 1** A recombinant poxvirus comprising a heterologous nucleic acid sequence encoding interleukin 12 (IL-12) in its genome, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter. **Claim 2** The recombinant poxvirus according to claim 1, wherein the poxvirus belongs to the genus Orthopoxvirus. **Claim 3** The recombinant poxvirus according to claim 2, wherein the poxvirus belonging to the genus Orthopoxvirus is a oncolytic vaccinia virus. **Claim 4** The recombinant poxvirus according to claim 3, wherein the oncolytic vaccinia virus is selected from the group consisting of Copenhagen (Cop), Western Reserve (WR), Elstree, Wyeth, Lister, Tian Tan, and LIVP virus strains. **Claim 5** The recombinant poxvirus according to any one of claims 1 to 4, wherein the genome comprises at least 150 kb, at least about 175 kb, at least about 180 kb, at least about 185 kb, at least about 190 kb, at least about 192 kb, or at least about 194 kb. **Claim 6** The recombinant poxvirus according to any one of claims 1 to 5, wherein the poxvirus is attenuated. **Claim 7** The recombinant poxvirus according to any one of claims 1 to 6, wherein the poxvirus is not NYVAC. **Claim 8** The recombinant poxvirus according to any one of claims 1 to 7, wherein the late promoter is selected from pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R. **Claim 9** The recombinant poxvirus according to claim 8, wherein the late promoter is selected from pA14L, pA26L, and pF17R. **Claim 10** The recombinant poxvirus according to claim 9, wherein the late promoter is pA14L. **Claim 11** The recombinant poxvirus according to claim 9, wherein the late promoter is pF17R. **Claim 12** The recombinant poxvirus according to any one of claims 1 to 11, wherein the late promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23. **Claim 13** The recombinant poxvirus according to any one of claims 1 to 11, wherein the late promoter comprises the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23. **Claim 14** The recombinant poxvirus according to any one of claims 1 to 7, wherein the intermediate promoter is selected from pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L. **Claim 15** The recombinant poxvirus according to claim 14, wherein the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to any one of the nucleotide sequences of SEQ ID NOs: 25 to 31. **Claim 16** The recombinant poxvirus according to any one of claims 1 to 15, wherein the IL-12 is human IL-12. **Claim 17** The recombinant poxvirus according to any one of claims 1 to 16, wherein the IL-12 is a fusion protein comprising an IL-12 p40 subunit and an IL-12 p35 subunit. **Claim 18** The recombinant poxvirus according to claim 17, wherein the IL-12 p40 subunit is at the N-terminus of the IL-12 p35 subunit. **Claim 19** The recombinant poxvirus according to claim 17 or 18, wherein the IL-12 p40 subunit comprises the amino acid sequence of SEQ ID NO: 17, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO:

17.

20. The recombinant poxvirus according to any one of claims 17 to 19, wherein the IL-12 p35 subunit comprises the amino acid sequence of SEQ ID NO: 19, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO:

19.

21. The recombinant poxvirus according to any one of claims 17 to 20, wherein the IL-12 p40 subunit and the IL-12 p35 subunit are fused to a single polypeptide via an amino acid linker.

22. The recombinant poxvirus according to claim 21, wherein the amino acid linker is about 5 to about 10 amino acids in length.

23. The recombinant poxvirus according to claim 21 or 22, wherein the amino acid linker is 7 amino acids in length.

24. The recombinant poxvirus according to any one of claims 21 to 23, wherein the amino acid linker is a glycine-serine linker.

25. The recombinant poxvirus according to any one of claims 21 to 24, wherein the amino acid linker comprises the amino acid sequence of SEQ ID NO:

18.

26. The recombinant poxvirus according to any one of claims 1 to 25, wherein the IL-12 comprises the amino acid sequence of SEQ ID NO: 20, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO:

20.

27. The recombinant poxvirus according to any one of claims 17 to 20, wherein the IL-12 p40 subunit and the IL-12 p35 subunit are directly fused to a single polypeptide.

28. The recombinant poxvirus according to any one of claims 1 to 25, wherein the heterologous nucleic acid sequence encoding IL-12 comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO:

21.

29. The recombinant poxvirus according to claim 28, wherein the heterologous nucleic acid sequence encoding IL-12 comprises the nucleotide sequence of SEQ ID NO:

21.

30. The recombinant poxvirus according to any one of claims 1 to 29, wherein the poxvirus lacks thymidine kinase (TK) activity.

31. The recombinant poxvirus according to any one of claims 1 to 30, wherein the poxvirus lacks a functional J2R gene.

32. The recombinant poxvirus according to any one of claims 1 to 31, wherein the poxvirus lacks ribonucleotide reductase (RR) activity.

33. The recombinant poxvirus according to any one of claims 1 to 32, wherein the poxvirus lacks a functional I4L gene.

34. The recombinant poxvirus according to any one of claims 1 to 33, wherein the poxvirus lacks a functional F4L gene.

35. The recombinant poxvirus according to any one of claims 1 to 34, wherein the heterologous nucleic acid sequence encoding IL-12 is inserted into the J2R locus of the poxvirus genome.

36. Upon said insertion, the J2R gene ceases to function, and optionally, the J2R locus is completely deleted by said insertion, the recombinant poxvirus according to claim 35.

37. The recombinant poxvirus according to any one of claims 1 to 34, wherein the heterologous nucleic acid sequence encoding IL-12 is inserted into the I4L locus of the poxvirus genome.

38. Upon said insertion, the I4L gene does not function, and optionally, the I4L locus is not sufficiently deleted by said insertion, the recombinant poxvirus according to claim 37.

39. The recombinant poxvirus according to any one of claims 1 to 34, wherein the heterologous nucleic acid sequence encoding IL-12 is inserted into the F4L locus of the poxvirus genome.

40. Upon said insertion, the F4L gene does not function, and optionally, the F4L locus is not sufficiently deleted by said insertion, the recombinant poxvirus according to claim 39.

41. The recombinant poxvirus according to any one of claims 1 to 40, wherein the poxvirus further comprises one or more therapeutic genes in its genome.

42. The recombinant poxvirus according to claim 41, wherein the one or more therapeutic genes are selected from the group consisting of suicide genes, immunomodulatory genes, anti-angiogenic genes, immune checkpoint inhibitory genes, antibody-encoding genes, extracellular matrix degrading or regulatory genes, and combinations thereof.

43. The recombinant poxvirus according to any one of claims 1 to 42, capable of lysing one or more cancer cell types.

44. The recombinant poxvirus is at least 50 ng / mL, at least 100 ng / mL, at least 300 ng / mL, at least 500 ng / mL, at least 1.0 μg / mL, at least 2.0 μg / mL, at least 3.0 μg / mL, at least 4.0 μg / mL, at least 5.0 μg / mL, at least 6.0 μg / mL, at least 7.0 μg / mL, at least 8.0 μg / mL or about 8.3 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10 －２ The recombinant poxvirus according to claim 43, which is capable of expressing IL-12.

45. The recombinant poxvirus according to claim 43 or 44, wherein the cancer cells are renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, cholangiocarcinoma, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma cells.

46. The recombinant poxvirus according to any one of claims 43 to 45, wherein the cancer cells are A549, HT29, MIA PaCa-2, A375, RPMI7591, Sk-Mel-5, OVCAR3, OVCAR4, NCI-H292, NCI-H460, SW780, TCCSUP, T24, Huh7, Hep3B, Panc1, HuP-T3, DAN-G, MDA-MB-435, HCC38, BT20, SW1417, WiDr, HCT-116, SNU5, NCI-N87, Kato III, A CHN, A498, PC-3, or MM.1R cells.

47. The recombinant poxvirus according to any one of claims 1 to 46, wherein the virus is produced in chicken embryo fibroblasts (CEF), HeLa cells, EB66® cells, Vero cells, HEK293 cells, PerC6 cells, BHK21 cells, or MRC5 cells.

48. The recombinant poxvirus according to any one of claims 1 to 47, wherein the recombinant poxvirus can increase interferon (IFN)-γ.

49. A method for producing the recombinant poxvirus according to any one of claims 1 to 48, comprising: a) obtaining or preparing producer cells; b) infecting the obtained or prepared producer cells with the recombinant poxvirus; c) culturing the infected producer cells under suitable conditions that allow the production of the recombinant poxvirus; d) recovering the produced recombinant poxvirus from the culture of the producer cells; Optionally, e) purifying the recovered recombinant poxvirus, and wherein optionally the producer cells are chicken embryo fibroblasts (CEF), HeLa, EB66®, Vero, HEK293, PerC6, BHK21, or MRC5 cells.

50. A recombinant poxvirus produced by the method according to claim 49.

51. ​ A pharmaceutical composition comprising a recombinant poxvirus according to any one of claims 1 to 48 and 50, and a pharmaceutically acceptable carrier.

52. The pharmaceutical composition according to claim 51, wherein the composition comprises a therapeutically effective amount of the recombinant poxvirus and a pharmaceutically acceptable carrier.

53. The said therapeutically effective amount for each dose is 1×10 ３ pfu to 1×10 １２ pfu, optionally 1×10 ４ pfu to 1×10 １１ pfu, optionally 1×10 ５ pfu to 1×10 １０ pfu, optionally 5×10 ７ pfu to 4×10 ９ The pharmaceutical composition according to claim 51 or 52, comprising pfu.

54. A pharmaceutical composition according to any one of claims 51 to 53 for use in treating or preventing a proliferative disease, optionally wherein the proliferative disease is cancer.

55. The pharmaceutical composition according to claim 54, wherein the cancer is selected from the group consisting of renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, cholangiocarcinoma, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, and malignant glioma.

56. A method of inducing apoptosis in cancer cells, comprising contacting the cancer cells with a recombinant poxvirus according to any one of claims 1 to 48 and 50 or a pharmaceutical composition according to any one of claims 51 to 55 under conditions that induce apoptosis.

57. A method of inhibiting the growth of cancer cells or promoting the death of cancer cells, comprising contacting the cancer cells with a recombinant poxvirus according to any one of claims 1 to 48 and 50 or a pharmaceutical composition according to any one of claims 51 to 55 under conditions that inhibit proliferation or promote the death of the cancer cells.

58. The method according to claim 56 or 57, wherein the cancer cells are renal cancer cells, prostate cancer cells, breast cancer cells, bladder cancer cells, colorectal cancer cells, lung cancer cells, liver cancer cells, gastric cancer cells, cholangiocarcinoma cells, endometrial cancer cells, pancreatic cancer cells, ovarian cancer cells, head and neck cancer cells, melanoma cells, glioblastoma cells, multiple myeloma cells, or malignant glioma cells.

59. The method according to any one of claims 56 to 58, wherein the method is performed in vitro.

60. A method of treating cancer in a subject, comprising administering to the subject a recombinant poxvirus according to any one of claims 1 to 48 and 50 or a pharmaceutical composition according to any one of claims 51 to 55 in an amount effective to treat the cancer.

61. A method for reducing the amount of cancer cells in a subject, comprising administering to the subject a recombinant poxvirus according to any one of claims 1 to 48 and 50 or a pharmaceutical composition according to any one of claims 51 to 55 in an amount effective to reduce the amount of cancer cells in the subject.

62. A method for inducing an anti-cancer immune response in a subject, comprising contacting cancer cells with a recombinant poxvirus according to any one of claims 1 to 48 and 50 or a pharmaceutical composition according to any one of claims 51 to 55 in an amount effective to induce the anti-cancer immune response.

63. The method according to claim 62, wherein the anti-cancer immune response comprises activation of an innate immune response or an adaptive immune response against the cancer.

64. The method according to any one of claims 60 to 63, wherein the administration comprises systemic administration.

65. The method according to claim 64, wherein the systemic administration is selected from subcutaneous, intramuscular, oral, intravenous, intranasal, transdermal, subcutaneous, and intramuscular administration.

66. The method according to any one of claims 56 to 63, wherein the administration comprises local administration.

67. The method according to claim 66, wherein the local administration comprises intratumoral administration.

68. The method according to any one of claims 56 to 67, wherein the recombinant poxvirus is administered two or more times.

69. The method according to any one of claims 56 to 68, further comprising administering at least one additional therapeutic agent.

70. The method according to claim 69, wherein the at least one additional therapeutic agent is selected from chemotherapy, radiation therapy, anti-proliferative therapy, virus therapy, and combinations thereof.

71. The method according to claim 69 or 70, wherein the at least one additional therapeutic agent is administered to the patient before administration of the recombinant poxvirus.

72. The method according to claim 69 or 70, wherein the at least one additional therapeutic agent is administered to the patient simultaneously with the recombinant poxvirus.

73. The method according to claim 69 or 70, wherein the at least one additional therapeutic agent is administered to the patient after administration of the recombinant poxvirus.

74. The method according to any one of claims 55 to 73, further comprising administering at least one therapeutic intervention, and optionally, wherein the therapeutic intervention is surgery.

75. The method according to any one of claims 56 to 74, wherein the recombinant poxvirus increases IFN-γ.

76. Use of a recombinant poxvirus according to any one of claims 1 to 48 and 50 or a pharmaceutical composition according to any one of claims 51 to 55 in the method according to any one of claims 56 to 75.

77. A kit comprising a unit dosage form of a recombinant poxvirus according to any one of claims 1 to 48 and 50 or a pharmaceutical composition according to any one of claims 51 to 55.

78. The method according to any one of claims 57 to 75, wherein the cancer is renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, cholangiocarcinoma, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma.

Images