A tuberculosis vaccine composition comprising an immunologically active site fusion protein
A tuberculosis vaccine composition utilizing an Rv2299c-ESAT6 fusion protein with specific domains and BCG cell wall skeleton binding addresses purification challenges and enhances immune response, achieving effective prevention and treatment of tuberculosis.
Patent Information
- Application Number
- JP2024573759
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-17
- Filing Date
- 2023-06-14
- Publication Date
- 2025-07-03
- Estimated Expiration
- 2043-06-14
AI Technical Summary
Current tuberculosis vaccines, such as Mycobacterium bovis Bacillus Calmette-Guérin (BCG), have varying preventive effects and lack efficacy against latent tuberculosis reactivation and adult tuberculosis, while existing fusion protein-based vaccines face challenges in standardizing purification due to large molecular weights and denaturation during processing.
A tuberculosis vaccine composition is developed using an immunologically active site fusion protein of Rv2299c and ESAT6, with specific domains (D2 and D3) of Rv2299c and additional Mycobacterium tuberculosis-derived antigens, bound to a BCG cell wall skeleton to enhance immune response, and produced through recombinant methods to maintain a manageable molecular weight.
The vaccine effectively activates the immune system, providing high protective efficacy against tuberculosis by inducing robust cytokine production and inhibiting intracellular bacterial growth, thus addressing the limitations of existing vaccines.
Smart Images

Figure 2025520500000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a tuberculosis vaccine composition containing an immunologically active site fusion protein.
Background Art
[0002] Tuberculosis is an infectious disease caused by Mycobacterium tuberculosis (Mtb), and it is one of the infectious diseases that have claimed the most human lives to date. In 2019, 1.4 million people died from tuberculosis globally, and in 2020, the mortality rate further increased due to restrictions on medical accessibility caused by COVID-19. Among OECD member countries, South Korea is also one of the countries with the most serious tuberculosis problems.
[0003] What is most needed to solve such tuberculosis problems is a safe and highly protective vaccine. However, Mycobacterium bovis Bacillus Calmette-Guérin (BCG), the only vaccine for tuberculosis, has different reported preventive effects ranging from 0 to 80% by different reporters, and there are many discussions. It has also been reported that it has no effect on latent tuberculosis reactivation or adult tuberculosis prevention. However, although it is inoculated in many countries because it is effective in preventing severe tuberculosis in children, a vaccine with better efficacy than BCG has still not been developed.
[0004] The goal of the World Health Organization (WHO)'s End TB strategy is to reduce the tuberculosis incidence rate by 90% and the mortality rate by 95% by 2035 based on 2015. South Korea has also established a tuberculosis control plan for 2030 and is promoting it with the goal of achieving a tuberculosis incidence rate of less than 10 per 100,000 people. To create a world without tuberculosis, the development of a tuberculosis vaccine that can be a game-changer is essential.
[0005] The three tuberculosis vaccine development goals proposed by the WHO are as follows: (1) A tuberculosis vaccine at an appropriate price for infants and young children with effects and safety comparable to BCG; (2) A safe and effective tuberculosis vaccine at an appropriate price for adolescents and adults; (3) A therapeutic vaccine for increasing tuberculosis treatment efficiency.
[0006] Currently, 14 tuberculosis vaccines are in clinical trials worldwide. Classifying them by function, there are: (1) Live bacteria-based vaccines as BCG alternatives, which are prime vaccines; (2) BCG booster vaccines applying immune enhancers or viral vectors; (3) Others, such as immune therapy vaccines based on bacterial cell extracts or killed non-tuberculous mycobacterial species for the purpose of shortening the treatment period or suppressing recurrence. However, among these, there is still no vaccine close to the tuberculosis vaccine development goals.
[0007] The development of live bacteria-based vaccines as BCG alternatives mainly includes recombinant forms of BCG strains and tuberculosis strains with two genes simultaneously deleted. These live bacteria-based vaccines contain more antigens than subunit vaccines and can induce diverse immune responses, so high protective effects cannot be expected. However, the development of recombinant strains or gene-deficient strains takes a long time due to issues such as the removal of antibacterial resistance markers and the demonstration of safety. Even after development, strict quality control is required in the manufacturing process of vaccine strains. Due to such limitations, the development of BCG alternative vaccines has focused on the development of subunit vaccines utilizing proteins. However, such subunit vaccines have limitations in replacing BCG and are mainly developed as BCG booster vaccines.
[0008] On the one hand, in recent years, due to the increase in the elderly population, the increase in immunosuppressive therapy, the increase in HIV infection, etc., the incidence of tuberculosis caused by the reactivation of latent tuberculosis has been increasing. In addition, due to the emergence of drug-resistant tuberculosis, it is difficult to treat, so the development of a kind of therapeutic vaccine that can assist in treatment has also become an important issue. Currently, most of the vaccines under development as therapeutic vaccines are nontuberculous mycobacteria (NTM), but since cell extracts are used, it would be ideal to develop a fusion protein-based therapeutic vaccine composed of several proteins.
[0009] As a conventional technique, Patent Document 1: Korean Registered Patent No. 1749165 disclosed a composition for promoting the maturation of dendritic cells containing a protein obtained by fusing Rv2299c or Rv2299c and ESAT6, and presented a method for differentiating immature dendritic cells into dendritic cells. Also, in Patent Document 2: Korean Registered Patent No. 2193304, a composition for boosting BCG vaccine containing the Rv2299c-ESAT6-HspX-RipA fusion protein was disclosed. In Patent Document 3: Korean Published Patent No. 2021-0157659, a composition for tuberculosis immunotherapy containing the Rv2882c-Rv2005c fusion protein was disclosed. In Patent Document 4: Korean Registered Patent No. 1452983, a composition for inducing the maturation of dendritic cells containing the Rv2005c protein of Mycobacterium tuberculosis as an active ingredient was disclosed. However, as described above, due to the problem that the molecular weight of the fused protein becomes large, there are difficulties in standardizing the purification process. Therefore, it is necessary to develop a vaccine composition that maximizes the immune activity while reducing the molecular weight of the protein.
Prior Art Documents
Patent Documents
[0010]
Patent Document 1
Patent Document 2
Patent Document 3
Patent Document 4
Summary of the Invention
Problems to be Solved by the Invention
[0011] An object of the present invention is to provide a tuberculosis vaccine composition containing an immunologically active site fusion protein. Another object of the present invention is to provide a tuberculosis preventive vaccine or a tuberculosis therapeutic vaccine containing the immunologically active site fusion protein.
Means for Solving the Problems
[0012] The present invention provides a composition for a tuberculosis vaccine containing a fusion protein of an immunologically active site of Rv2299c and ESAT6.
[0013] The immunologically active site of Rv2299c may be composed of one amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 5. Further, the immunologically active site of Rv2299c may be domain 2 (D2) composed of the amino acid sequence of SEQ ID NO: 3, domain 3 (D3) composed of the amino acid sequence of SEQ ID NO: 4, or a conjugate of domain 2 and domain 3 (D2D3) composed of the amino acid sequence of SEQ ID NO: 5.
[0014] The present invention provides a composition for a tuberculosis vaccine containing a fusion protein of an immunologically active site of Rv2299c and ESAT6.
[0015] The immunologically active site of Rv2299c may be composed of one amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 5. Further, the immunologically active site of Rv2299c may be domain 2 (D2) composed of the amino acid sequence of SEQ ID NO: 3, domain 3 (D3) composed of the amino acid sequence of SEQ ID NO: 4, or a conjugate of domain 2 and domain 3 (D2D3) composed of the amino acid sequence of SEQ ID NO: 5.
[0016] The present invention provides a composition for a tuberculosis vaccine, characterized in that a BCG cell wall skeleton (Bacillus Calmette-Gu rin-Cell Wall Skeleton, BCG-CWS) is bound to the immunologically active site of Rv2299c and the terminal of the fusion protein with ESAT6.
[0017] All the compositions for a tuberculosis vaccine provided by the present invention may be a vaccine for preventing tuberculosis or a vaccine for treating tuberculosis.
[0018] The terminal of the immunologically active site of Rv2299c and the fusion protein of ESAT6 according to the present invention may further contain one or more Mycobacterium tuberculosis-derived antigens or their immunologically active sites selected from the group consisting of RpfE, Rv3463, Rv2005c, Rv2882c, Rv2145c, Rv1605, Rv2220 and Rv0869c. At this time, the Mycobacterium tuberculosis-derived antigen or its immunologically active site may be an antigen or its immunologically active site composed of one or more amino acid sequences selected from the group consisting of SEQ ID NOs: 1 to 22.
[0019] More specifically, the present invention provides a composition for a tuberculosis vaccine, further comprising any one mycobacterium tuberculosis-derived antigen or its immunologically active site selected from the group consisting of RpfED1 composed of the amino acid sequence of SEQ ID NO: 8, Rv3463 composed of the amino acid sequence of SEQ ID NO: 19, Rv2005cD3-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 18 and SEQ ID NO: 19 are sequentially linked and fused, Rv2882cD2-Rv2005cD3-Rv3463D2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 12, SEQ ID NO: 18, and SEQ ID NO: 21 are sequentially linked and fused, Rv2005cD3-Rv1605-Rv3463D2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 18, SEQ ID NO: 22, and SEQ ID NO: 21 are sequentially linked and fused, Rv3463D2-Rv2882cD2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21 and SEQ ID NO: 12 are sequentially linked and fused, Rv3463D2-Rv2882cD2-Rv2145cD2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 12, and SEQ ID NO: 15 are sequentially linked and fused, Rv3463D2-Rv2882cD2-RpfED1 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 12, and SEQ ID NO: 8 are sequentially linked and fused, Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 12, SEQ ID NO: 8, and SEQ ID NO: 15 are sequentially linked and fused, Rv3463D2-Rv2005cD3 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21 and SEQ ID NO: 18 are sequentially linked and fused, and Rv3463D2-Rv2005cD3-RpfED1 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 18, and SEQ ID NO: 8 are sequentially linked and fused.
[0020] In the present invention, the fusion protein designated as Rv2299cD2D3-ESAT6 means a polypeptide composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 5 and SEQ ID NO: 6 are sequentially linked and fused, and refers to a polypeptide in which the end of Rv2299cD2D3 and the other end of ESAT6 are linked. The production of the Rv2299cD2D3-ESAT6 fusion protein is carried out by the recombinant protein production method using pET-22b(+)_Rv2299cD2D3-ESAT6 in Example 1.2 below.
[0021] Hereinafter, in the present invention, a fusion protein containing two or more Mycobacterium tuberculosis-derived antigens or their immunologically active sites means a polypeptide composed of an amino acid sequence in which each amino acid sequence of the Mycobacterium tuberculosis-derived antigen or its immunologically active site sequence is sequentially linked and fused with or without a linker.
[0022] In the present invention, a prophylactic vaccine refers to a vaccine that is inoculated in advance before exposure to a pathogenic bacterium, and then, even if the pathogenic bacterium invades the body, activates the immune system to prevent diseases. A therapeutic vaccine refers to a vaccine that has a preventive function for the most part but is made for the purpose of treating patients who have already been infected. The prophylactic vaccine for tuberculosis includes a priming vaccine and a boosting vaccine. The priming vaccine is administered in infancy for the purpose of early exposure to M. tuberculosis. The boosting vaccine is administered to adolescents or adults and is used for the purpose of inducing an increase in the immune response after the priming vaccine or latent tuberculosis infection. The therapeutic vaccine is a method of directly administering drugs in a short period.
[0023] The fusion protein containing the Mycobacterium tuberculosis-derived antigen or its immunologically active site according to the present invention can increase its immunological activity by further binding BCG cell wall skeleton (BCG-Cell Wall Skeleton, BCG-CWS) to its end.
[0024] In addition, the present invention provides a composition for a tuberculosis vaccine, which comprises any one fusion protein selected from the group consisting of Rv2882c-Rv2005c-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 16, and SEQ ID NO: 19 are sequentially linked and fused; Rv2882c-Rv2005cD3-ESAT6-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 16, SEQ ID NO: 6, and SEQ ID NO: 19 are sequentially linked and fused; Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 21 are sequentially linked and fused; Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2; Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 22, SEQ ID NO: 12, SEQ ID NO: 18, SEQ ID NO: 6, and SEQ ID NO: 21 are sequentially linked and fused; Rv2220-ESAT6-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 23, SEQ ID NO: 6, SEQ ID NO: 19, SEQ ID NO: 6, and SEQ ID NO: 21 are sequentially linked and fused; Rv0869c-ESAT6-Rv2005cD3-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 24, SEQ ID NO: 6, SEQ ID NO: 18, and SEQ ID NO: 19 are sequentially linked and fused; and Rv1605-ESAT6-Rv2005cD3-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 22, SEQ ID NO: 6, SEQ ID NO: 18, and SEQ ID NO: 19 are sequentially linked and fused.
[0025] In addition, BCG cell wall skeleton (BCG-CWS) can be bound to the end of the fusion protein to increase the immune activity, and the composition for a tuberculosis vaccine may be a vaccine for preventing tuberculosis or a vaccine for treating tuberculosis.
[0026] The fusion protein contained in the tuberculosis vaccine composition according to the present invention may be produced by a known method known in this technical field. For example, it may be produced recombinantly or synthetically using an automated polypeptide synthesizer, inserted into a vector by a known method, and the fusion protein may be produced by mass culturing after transforming Escherichia coli or the like. The fusion protein or antigen may contain an appropriate purification tag (or affinity tag) that allows purification from an unpurified biological source (for example, a recombinant expression system). Purification tags include, but are not limited to, His-tag, chitin binding protein (CBP), maltose binding protein (MBP), and glutathione-S-transferase (GST).
Effects of the Invention
[0027] The present invention provides a fusion protein vaccine composition that identifies the immunologically active domain (domain; site or segment) in the Rv2299c protein, removes unnecessary sites, or selects only the necessary parts and links other immunologically active proteins or sites, thereby effectively activating the immune response of tuberculosis patients and making an epoch-making contribution to the prevention and treatment of tuberculosis.
Brief Description of the Drawings
[0028]
Figure 1
[0029]
Figure 2
[0030]
Figure 3
[0031]
Figure 4
[0032]
Figure 5
[0033]
Figure 6
[0034]
Figure 7
[0035]
Figure 8
[0036]
Figure 9
[0037]
Figure 10
[0038]
Figure 11
[0039]
Figure 12
[0040]
Figure 13
[0041]
Figure 14
[0042]
Figure 15
[0043]
Figure 16
[0044]
Figure 17
[0045]
Figure 18
[0046]
Figure 19
[0047]
Figure 20
[0048]
Figure 21
[0049]
Figure 22
[0050]
Figure 23
Mode for Carrying Out the Invention
[0051] The present inventors have conducted research to develop a fusion protein-based BCG substitute or BCG booster and therapeutic vaccine that is excellent in defensive effects and very advantageous in terms of safety. In particular, the present inventor group has strived to develop a vaccine with more excellent defensive effects that overcomes the disadvantages of the tuberculosis vaccine applying Rv2299c-ESAT6 presented in the prior patent, Patent Document 1: Korean Patent Registration No. 1749165. When fusing highly immunologically active proteins, even if the vaccine efficacy was good, there were many problems in standardizing the purification method during the commercialization process. That is, the fused protein had problems that it was difficult to purify while the molecular weight increased, and it was likely to denature during the purification process. In the process of overcoming this, it was confirmed that protein-based vaccines are more advantageous in terms of standardizing the purification process as the molecular weight is smaller, and can show higher efficiency by complexly linking other proteins.
[0052] Therefore, assuming that a vaccine with more excellent effects can be obtained when identifying the immunologically active domains (domains; sites or segments) in the Rv2299c protein and removing unnecessary sites or selecting only necessary parts to construct a fusion protein, the research was repeated, and the present invention was completed.
[0053] Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described here and may be embodied in other forms. The following embodiments are rather provided to thoroughly and completely convey the content introduced here and fully convey the idea of the present invention to those skilled in the art.
[0054] <Experimental Materials and Methods>
[0055] 1. Cloning, production, and purification for recombinant protein production
[0056] 1.1 Cloning for the production of recombinant proteins by protein domain
[0057] For the generation of each recombinant protein required for the experiment, the gene was amplified by PCR using the primers in Table 1 with genomic DNA from Mycobacterium tuberculosis H37Rv (ATCC 27294) as a template. The generated PCR product was inserted into the pET-22b(+) vector (Novagen, Madison, WI, USA) using the inserted restriction enzyme sequences, and the generated plasmid was confirmed by sequence analysis.
[0058] [Table 1]
[0059] 1.2 Cloning for the production of fusion proteins (1) pET-22b(+)_Rv2299cD2D3-ESAT6
[0060] Rv2299c DNA and ESAT6 DNA were obtained by PCR using genomic DNA of Mycobacterium tuberculosis H37Rv (ATCC 27294) as a template, and an Rv2299c D2D3-ESAT6 DNA fragment with NdeI at the 5' end and HindIII restriction enzyme inserted at the 3' end was prepared using the overlapping PCR (overlapping PCR) method and inserted into the pET22b vector. The primers used at this time are as follows.
[0061] D2D3-ESAT6_NdeI_F:AAGGAGATATACATATGtcgatgaaggcgctgtgg
[0062] D2D3-ESAT6_HindIII_R:GTGCGGCCGCAAGCTTtgcgaacatcccagtgacg
[0063] D2D3-ESAT6_intP: aagaaggtgctgtccacg
[0064] (2) pET-22b(+)_Rv2299cD3-ESAT6
[0065] Using the same method as above, Rv2299c and ESAT6 DNA were used to prepare an Rv2299c D3-ESAT6 DNA fragment with NdeI at the 5' end and HindIII restriction enzyme inserted at the 3' end by overlapping PCR method, and inserted into the pET22b vector. At this time, the primers used are as follows.
[0066] D3-ESAT6_NdeI_F: AAGGAGATATACATATGctcggtatttcttcgtttgtctc
[0067] D3-ESAT6_HindIII_R: GTGCGGCCGCAAGCTTtgcgaacatcccagtgac
[0068] (3) pET-22b(+)_Rv2299cD2D3-ESAT6-RpfE D1
[0069] Using the RpfE DNA and Rv2299c D2D3-ESAT6 DNA obtained by the same method as above as templates, an Rv2299c D2D3-ESAT6-RpfE D1 DNA fragment with NdeI at the 5' end and XhoI restriction enzyme inserted at the 3' end was prepared by overlapping PCR method, and inserted into the pET22b vector. At this time, the primers used are as follows.
[0070] Rv2299c(D2D3)+ESAT6_NdeI_F:
[0071] AAGGAGATATACATATGTCGATGAAGGCGCT
[0072] Rv2299c(D2D3)+ESAT6_R: TGCGAACATCCCAGTGAC
[0073] RpfE domain1_F: GTCACTGGGATGTTCGCAGCCGACGACGCGGGCTTG
[0074] RpfE domain1_XhoI_R:
[0075] GGTGGTGGTGGTGGTGCTCGAGGTTGTAGGCCACGGGCAC
[0076] (4) pET-22b(+)_Rv2299c-Rv3463-ESAT6
[0077] Using the same method as above, the Rv2299c, Rv3463, and ESAT6 DNAs obtained were used as templates, and finally, an Rv2299c-Rv3463-ESAT6 DNA fragment with NdeI inserted at the 5'-end and XhoI restriction enzyme inserted at the 3'-end was prepared by PCR and inserted into the pET22b vector. At this time, the primers used were as follows.
[0078] Rv2299c-Nde-F: CATATGAACGCCCATGTCGAGCAGTTG
[0079] Rv2299c-EcoR-R: GAATTCGGCAAGGTACGCGCGAGACGTTC
[0080] Rv3463-EcoR-F: GAATTCGATGACCAATTGTGCCGCC
[0081] Rv3463-Hind-R: AAGCTTAGTCAGTCGGAGCGGCTT
[0082] ESAT6-Hind-F: AAGCTTATGACAGAGCAGCAGTGGAAT
[0083] ESAT6-Xho-R: CTCGAGTGCGAACATCCCAGTGACGTT
[0084] (5) pET-22b(+)_Rv2299c-ESAT6-Rv3463
[0085] Using the same method as described above, the Rv2299c, ESAT6, and Rv3463 DNAs were used as templates, and a DNA fragment of Rv2299c-ESAT6-Rv3463 with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0086] Rv2299c-Nde-F: CATATGAACGCCCATGTCGAGCAGTTG
[0087] Rv2299c-EcoR-R: GAATTCGGCAAGGTACGCGCGAGACGTTC
[0088] ESAT6-EcoR-F: GAATTCGATGACAGAGCAGCAGTGGAAT
[0089] ESAT6-Hind-R: AAGCTTTGCGAACATCCCAGTGACGTT
[0090] Rv3463-Hind-F: AAGCTTATGACCAATTGTGCCGCC
[0091] Rv3463-Not-R: GCGGCCGCAGTCAGTCGGAGCGGCTT
[0092] (6) pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463
[0093] Using the same method as described above, the Rv2299c D2D3, ESAT6, and Rv3463 DNA obtained were used as templates to finally prepare an Rv2299c D2D3-ESAT6-Rv3463 DNA fragment with NdeI at the 5'-end and NotI restriction enzyme inserted at the 3'-end by the overlapping PCR method, and it was inserted into the pET22b vector. At this time, the primers used were as follows.
[0094] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG
[0095] Rv2299c_D2D3_R:CAAGGTACGCGCGAGACG
[0096] ESAT-6_F:
[0097] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0098] ESAT-6_R:TGCGAACATCCCAGTGAC
[0099] Rv3463_F:
[0100] GTCACTGGGATGTTCGCAAAGCTTATGACCAATTGTGCCGCC
[0101] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0102] (7)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv2005cD3-Rv3463
[0103] Using the same method as described above, Rv2299c D2D3, ESAT6, Rv2005c D3, and Rv3463 DNA obtained were used as templates, and finally, an Rv2299c D2D3-ESAT6-Rv3463 DNA fragment with an NdeI restriction enzyme inserted at the 5'-end and a NotI restriction enzyme inserted at the 3'-end was prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0104] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG
[0105] Rv2299c_D2D3_R:CAAGGTACGCGCGAGACG
[0106] ESAT-6_F:
[0107] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0108] ESAT-6_R:TGCGAACATCCCAGTGAC
[0109] Rv2005c_D3_HindIII_F:
[0110] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0111] Rv2005c_R:CGACTGCCGTGCCACGAT
[0112] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0113] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0114] (8) pET-22b(+)_Rv2299cD2D3-ESAT6-Rv2882cD2-Rv2005cD3-Rv3463D2
[0115] Using the same method as described above, Rv2299cD2D3, ESAT6, Rv2882cD2, Rv2005cD3, and Rv3463 D2 DNA obtained were used as templates, and an Rv2299cD2D3-ESAT6-Rv2882cD2-Rv2005cD3-Rv3463D2 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0116] Rv2299c_D2D3_NdeI_F: AAGGAGATATACATATGTCGATGAAGGCGCTG
[0117] Rv2299c_D2D3_R: CAAGGTACGCGCGAGACG
[0118] ESAT-6_F:
[0119] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0120] ESAT-6_R: TGCGAACATCCCAGTGAC
[0121] Rv2882c_D2_HindIII_F:
[0122] GATGTTCGCAAAGCTTATGGACGGCGCCCTTATTC
[0123] Rv2882c_D2_R: GACCTCCAGCAGCTCGC
[0124] Rv2005c_D3_F:
[0125] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0126] Rv2005c_D3_R1:GCTAGCCGACTGCCGTGCCACGAT
[0127] Rv3463_D2_F1:GCACGGCAGTCGGCTAGCATGGCACTGGGCCCCCG
[0128] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0129] (9)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv2005cD3-Rv1605-Rv3463D2
[0130] Using the same method as described above, Rv2299c D2D3, ESAT6, Rv1605, Rv2005cD3, and Rv3463 D2 DNA obtained were used as templates, and finally, an Rv2299cD2D3-ESAT6-Rv2005cD3-Rv1605-Rv3463D2 DNA fragment with NdeI restriction enzyme inserted at the 5'-end and NotI at the 3'-end was prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0131] Rv2299c_D2D3_NdeI_F:AAGGAGATATACATATGTCGATGAAGGCGCTG
[0132] Rv2299c_D2D3_R:CAAGGTACGCGCGAGACG
[0133] ESAT-6_F:
[0134] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0135] ESAT-6_R: TGCGAACATCCCAGTGAC
[0136] Rv2005c_D3_HindIII_F:
[0137] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0138] Rv2005c_D3_R2: TCTAGACGACTGCCGTGCCACGAT
[0139] Rv1605_F: GCACGGCAGTCGTCTAGAATGTATGCCGACCGTGAC
[0140] Rv1605_R: GCTAGCTCGCACGGTGATTCCTTC
[0141] Rv3463_D2_F2: ATCACCGTGCGAGCTAGCATGGCACTGGGCCCCCG
[0142] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0143] (10)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-RpfED1-Rv2145cD2
[0144] Using the same method as above, the Rv2299c D2D3, ESAT6, Rv3463D2, Rv2882cD2, RpfED1, and Rv2145cD2 DNA obtained were used as templates, and finally, an Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2 DNA fragment with NdeI at the 5'-end and XhoI restriction enzyme inserted at the 3'-end was prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0145] Rv2299c D2+D3_NdeI_F:
[0146] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0147] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0148] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0149] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0150] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0151] Rv3463_D2_R:TGCGGCCGCAGTCAGTCGGAGCG
[0152] Rv2882c_D2_F:CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG
[0153] Rv2882c_D2_XhoI_R:
[0154] GTGGTGGTGGTGCTCGAGGACCTCCAGCAGCTCGCC
[0155] RpfE_D1_Rv2882D2_F:
[0156] GAGCTGCTGGAGGTCATGGCCGACGACGCGGGCTTGGAC
[0157] RpfE_D1_R:GTTGTAGGCCACGGGCAC
[0158] Rv2145c_D2_RpfED1_F: CCCGTGGCCTACAACATGGTCTCGGCGGGGATG
[0159] Rv2145c_D2_XhoI_R:
[0160] GTGGTGGTGGTGCTCGAGGTTTTTGCCCCGGTTGAATTGATC
[0161] (11)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2005cD3
[0162] Using the same method as above, Rv2299c D2D3, ESAT6, Rv3463 D2, and Rv2005cD3 DNA obtained were used as templates, and finally, an Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3 DNA fragment with NdeI at the 5'-end and XhoI restriction enzyme inserted at the 3'-end was prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0163] Rv2299c D2+D3_NdeI_F:
[0164] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0165] Rv2299c-EcoR-R: GAATTCGGCAAGGTACGCGCGAGACGTTC
[0166] ESAT6-EcoR-F: GAATTCGATGACAGAGCAGCAGTGGAAT
[0167] ESAT6_R: GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0168] Rv3463 D2_F: ATGGCACTGGGCCCCCGG
[0169] Rv3463_D2_R: TGCGGCCGCAGTCAGTCGGAGCG
[0170] Rv2005c_D3_F: CTGACTGCGGCCGCAATGTGGAGTGACGTCGAAGT
[0171] Rv2005c_D3_XhoI_R:
[0172] GGTGGTGGTGGTGCTCGAGCGACTGCCGTGCCACGATCAC
[0173] (12)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2005cD3-RpfED1
[0174] Using the same method as described above, Rv2299c D2D3, ESAT6, Rv3463 D2, Rv2005cD3, and RpfED1 DNA obtained were used as templates, and finally, an Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3-RpfED1 DNA fragment with NdeI at the 5'-end and XhoI restriction enzyme inserted at the 3'-end was prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0175] Rv2299c D2+D3_NdeI_F:
[0176] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0177] Rv2299c-EcoR-R: GAATTCGGCAAGGTACGCGCGAGACGTTC
[0178] ESAT6-EcoR-F: GAATTCGATGACAGAGCAGCAGTGGAAT
[0179] ESAT6_R: GGGGGCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0180] Rv3463 D2_F: ATGGCACTGGGCCCCCGG
[0181] Rv3463_D2_R: TGCGGCCGCAGTCAGTCGGAGCG
[0182] Rv2005c_D3_F: CTGACTGCGGCCGCAATGTGGAGTGACGTCGAAGT
[0183] Rv2005c_D3_R: CGACTGCCGTGCCACGATCAC
[0184] RpfE_D2_Rv2005cD3_F:
[0185] GTGGCACGGCAGTCGATGGCCGACGACGCGGGCTTGGAC
[0186] RpfE_D1_XhoI_R: GTGGTGGTGGTGCTCGAGGTTGTAGGCCACGGGCAC
[0187] (13)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2
[0188] Using the same method as described above, the Rv2299cD2D3, ESAT6, and Rv3463D2 DNAs obtained were used as templates, and an Rv2299cD2D3-ESAT6-Rv3463D2 DNA fragment with NdeI at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0189] Rv2299c D2+D3_NdeI_F:
[0190] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0191] Rv2299c-EcoR-R: GAATTCGGCAAGGTACGCGCGAGACGTTC
[0192] ESAT6-EcoR-F: GAATTCGATGACAGAGCAGCAGTGGAAT
[0193] ESAT6_R: GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0194] Rv3463 D2_F: ATGGCACTGGGCCCCCGG
[0195] Rv3463 D2_NotI_R:
[0196] TGGTGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTTC
[0197] (14)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2
[0198] Using the same method as described above, the Rv2299cD2D3, ESAT6, Rv3463 D2, and Rv2882cD2 DNAs obtained were used as templates, and an Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2 DNA fragment with NdeI inserted at the 5'-end and XhoI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0199] Rv2299c D2+D3_NdeI_F:
[0200] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0201] Rv2299c-EcoR-R: GAATTCGGCAAGGTACGCGCGAGACGTTC
[0202] ESAT6-EcoR-F: GAATTCGATGACAGAGCAGCAGTGGAAT
[0203] ESAT6_R: GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0204] Rv3463 D2_F: ATGGCACTGGGCCCCCGG
[0205] Rv3463_D2_R: TGCGGCCGCAGTCAGTCGGAGCG
[0206] Rv2882c_D2_F: CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG
[0207] Rv2882c_D2_XhoI_R:
[0208] GTGGTGGTGGTGCTCGAGGACCTCCAGCAGCTCGCC
[0209] (15)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-Rv2145cD2
[0210] Using the same method as described above, Rv2299cD2D3, ESAT6, Rv3463 D2, Rv2882cD2, and Rv2145cD2 DNA obtained were used as templates, and an Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-Rv2145cD2 DNA fragment with NdeI at the 5'-end and XhoI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0211] Rv2299c D2+D3_NdeI_F:
[0212] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0213] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0214] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0215] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0216] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0217] Rv3463_D2_R:TGCGGCCGCAGTCAGTCGGAGCG
[0218] Rv2882c_D2_F:CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG
[0219] Rv2882c_D2_R:GACCTCCAGCAGCTCGCC
[0220] Rv2145c_D2_Rv2882cD2_F:
[0221] GAGCTGCTGGAGGTCATGGTCTCGGCGGGGATG
[0222] Rv2145c_D2_XhoI_R:
[0223] GTGGTGGTGGTGCTCGAGGTTTTTGCCCCGGTTGAATTGATC
[0224] (16)pET-22b(+)_Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-RpfED1
[0225] Using the same method as described above, Rv2299cD2D3, ESAT6, Rv3463 D2, Rv2882cD2, and RpfED1 DNA obtained were used as templates, and an Rv2299cD2D3-ESAT6-Rv3463 D2-Rv2882cD2-RpfED1 DNA fragment with NdeI inserted at the 5'-end and XhoI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0226] Rv2299c D2+D3_NdeI_F:
[0227] GAAGGAGATATACATATGAACCTGGTCAAGAAATACTCC
[0228] Rv2299c-EcoR-R:GAATTCGGCAAGGTACGCGCGAGACGTTC
[0229] ESAT6-EcoR-F:GAATTCGATGACAGAGCAGCAGTGGAAT
[0230] ESAT6_R:GGGGCCCAGTGCCATAAGCTTTGCGAACATCCCAGTGACGT
[0231] Rv3463 D2_F:ATGGCACTGGGCCCCCGG
[0232] Rv3463_D2_R:TGCGGCCGCAGTCAGTCGGAGCG
[0233] Rv2882c_D2_F:CTGACTGCGGCCGCAATGGACGGCGCCCTTATTCG
[0234] Rv2882c_D2_R:GACCTCCAGCAGCTCGCC
[0235] RpfE_D1_Rv2882D2_F:
[0236] GAGCTGCTGGAGGTCATGGCCGACGACGCGGGCTTGGAC
[0237] RpfE_D1_XhoI_R:GTGGTGGTGGTGCTCGAGGTTGTAGGCCACGGGCAC
[0238] (17)pET-22b(+)_Rv2882c-Rv2005c-Rv3463
[0239] Using the same method as described above, the Rv2882c, Rv2005c, and Rv3463 DNAs obtained were used as templates, and an Rv2882c-Rv2005c-Rv3463 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0240] Rv2882c_NdeI_F:AAGGAGATATACATATGATTGATGAGGCTCTCTTCG
[0241] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0242] Rv2005c_F:GCGAGCTGCTGGAGGTCGAATTCATGTCTAAACCCCGCAAG
[0243] Rv2005c(HindIII)_R:AAGCTTCGACTGCCGTGCCACGAT
[0244] Rv3463(HindIII)_F:GCACGGCAGTCGAAGCTTATGACCAATTGTGCCGCC
[0245] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0246] (18) pET-22b(+)_Rv2882c-Rv2005cD3-ESAT6-Rv3463
[0247] Using the same method as described above, Rv2882c, Rv2005cD3, ESAT6, and Rv3463 DNA obtained were used as templates, and an Rv2882c-Rv2005cD3-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0248] Rv2882c_NdeI_F: AAGGAGATATACATATGATTGATGAGGCTCTCTTCG
[0249] Rv2882c_D2_R: GACCTCCAGCAGCTCGC
[0250] Rv2005c_D3_F:
[0251] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0252] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0253] ESAT-6_F:
[0254] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0255] ESAT-6_R: TGCGAACATCCCAGTGAC
[0256] Rv3463(HindIII)_F: GCACGGCAGTCGAAGCTTATGACCAATTGTGCCGCC
[0257] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0258] (19)pET-22b(+)_Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0259] Using the same method as above, Rv2220, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA obtained were used as templates, and finally, an Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI at the 5' end and NotI restriction enzyme inserted at the 3' end was prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0260] Rv2220_NdeI_F: AAGGAGATATACATATGACGGAAAAGACGCCC
[0261] Rv2220_R: AACGTCGTAGTACAGCGC
[0262] Rv2882c_D2_F:
[0263] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0264] Rv2882c_D2_R: GACCTCCAGCAGCTCGC
[0265] Rv2005c_D3_F:
[0266] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0267] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0268] ESAT-6_F:
[0269] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0270] ESAT-6_R:TGCGAACATCCCAGTGAC
[0271] Rv3463_D2_F3:
[0272] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG
[0273] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0274] (20)pET-22b(+)_Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0275] Using the same method as described above, Rv0869c, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA obtained were used as templates, and an Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463 D2 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0276] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG
[0277] Rv0869c_NheI_R:CGCCGTCCATGCTAGCGCCACCGATCGCGCTCA
[0278] Rv2882c_D2_F:
[0279] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0280] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0281] Rv2005c_D3_F:
[0282] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0283] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0284] ESAT-6_F:
[0285] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0286] ESAT-6_R:TGCGAACATCCCAGTGAC
[0287] Rv3463_D2_F3:
[0288] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG
[0289] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0290] (21)pET-22b(+)_Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0291] Using the same method as described above, the Rv1605, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNAs obtained were used as templates, and an Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0292] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC
[0293] Rv1605_NheI_R:CGCCGTCCATGCTAGCTCGCACGGTGATTCCTTC
[0294] Rv2882c_D2_F:
[0295] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0296] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0297] Rv2005c_D3_F:
[0298] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0299] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0300] ESAT-6_F:
[0301] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0302] ESAT-6_R: TGCGAACATCCCAGTGAC
[0303] Rv3463_D2_F3:
[0304] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG
[0305] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0306] (22)pET-22b(+)_Rv2220-ESAT6-Rv3463
[0307] Using the same method as above, with Rv2220, ESAT6, and Rv3463 DNA obtained as templates, an Rv2220-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0308] Rv2220_NdeI_F: AAGGAGATATACATATGACGGAAAAGACGCCC
[0309] Rv2220_EcoRI_R: GCTCTGTCATGAATTCAACGTCGTAGTACAGCGC
[0310] ESAT-6_F:
[0311] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0312] ESAT-6_R: TGCGAACATCCCAGTGAC
[0313] Rv3463_F: GTCACTGGGATGTTCGCAAAGCTTATGACCAATTGTGCCGCC
[0314] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0315] (24)pET-22b(+)_Rv0869c-ESAT6-Rv2005cD3-Rv3463
[0316] Using the same method as above, Rv0869c, ESAT6, Rv2005cD3, and Rv3463 DNA obtained were used as templates, and an Rv0869c-ESAT6-Rv2005cD3-Rv3463 DNA fragment with NdeI at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0317] Rv0869c_NdeI_F: AAGGAGATATACATATGACACTGACCGCGCTGGG
[0318] Rv0869c_EcoRI_R: GCTCTGTCATGAATTCGCCACCGATCGCGCTCAT
[0319] ESAT-6_F:
[0320] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0321] ESAT-6_R: TGCGAACATCCCAGTGAC
[0322] Rv2005c_D3_HindIII_F:
[0323] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0324] Rv2005c_R: CGACTGCCGTGCCACGAT
[0325] Rv3463(NheI)_F:GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0326] Rv3463_NotI_R:TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0327] (25)pET-22b(+)_Rv1605-ESAT6-Rv2005cD3-Rv3463
[0328] Using the same method as above, Rv1605, ESAT6, Rv2005cD3, and Rv3463 obtained were used as templates, and an Rv1605-ESAT6-Rv2005cD3-Rv3463 DNA fragment with NdeI at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0329] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC
[0330] Rv1605_EcoRI_R:GCTCTGTCATGAATTCTCGCACGGTGATTCCTTC
[0331] ESAT-6_F:
[0332] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0333] ESAT-6_R:TGCGAACATCCCAGTGAC
[0334] Rv2005c_D3_HindIII_F:
[0335] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0336] Rv2005c_R: CGACTGCCGTGCCACGAT
[0337] Rv3463(NheI)_F: GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0338] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0339] (26)pET-22b(+)_Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0340] Using the same method as above, Rv2220, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA obtained were used as templates, and an Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0341] Rv2220_NdeI_F: AAGGAGATATACATATGACGGAAAAGACGCCC
[0342] Rv2220_R: AACGTCGTAGTACAGCGC
[0343] Rv2882c_D2_F:
[0344] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0345] Rv2882c_D2_R: GACCTCCAGCAGCTCGC
[0346] Rv2005c_D3_F:
[0347] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0348] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0349] ESAT-6_F:
[0350] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0351] ESAT-6_R:TGCGAACATCCCAGTGAC
[0352] Rv3463_D2_F3:
[0353] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG
[0354] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0355] (27)pET-22b(+)_Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0356] Using the same method as above, Rv0869c, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA obtained were used as templates, and finally, an Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463 D2 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0357] Rv0869c_NdeI_F:AAGGAGATATACATATGACACTGACCGCGCTGGG
[0358] Rv0869c_NheI_R: CGCCGTCCATGCTAGCGCCACCGATCGCGCTCA
[0359] Rv2882c_D2_F:
[0360] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0361] Rv2882c_D2_R: GACCTCCAGCAGCTCGC
[0362] Rv2005c_D3_F:
[0363] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0364] Rv2005c_D3_EcoRI_R: GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0365] ESAT-6_F:
[0366] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0367] ESAT-6_R: TGCGAACATCCCAGTGAC
[0368] Rv3463_D2_F3:
[0369] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG
[0370] Rv3463_NotI_R: GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0371] (28)pET-22b(+)_Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2
[0372] Using the same method as described above, Rv1605, Rv2882cD2, Rv2005cD3, ESAT6, and Rv3463D2 DNA obtained were used as templates, and an Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by the overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0373] Rv1605_NdeI_F:AAGGAGATATACATATGTATGCCGACCGTGACCTTC
[0374] Rv1605_NheI_R:CGCCGTCCATGCTAGCTCGCACGGTGATTCCTTC
[0375] Rv2882c_D2_F:
[0376] GCGCTGTACTACGACGTTGCTAGCATGGACGGCGCCCTTATTC
[0377] Rv2882c_D2_R:GACCTCCAGCAGCTCGC
[0378] Rv2005c_D3_F:
[0379] GCGAGCTGCTGGAGGTCTCTAGAATGTGGAGTGACGTCGAAG
[0380] Rv2005c_D3_EcoRI_R:GCTCTGTCATGAATTCCGACTGCCGTGCCACGAT
[0381] ESAT-6_F:
[0382] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0383] ESAT-6_R:TGCGAACATCCCAGTGAC
[0384] Rv3463_D2_F3:
[0385] GTCACTGGGATGTTCGCAAAGCTTATGGCACTGGGCCCCCG
[0386] Rv3463_NotI_R:GCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0387] (29)pET-22b(+)_ Rv1605-Rv2220-ESAT6-Rv3463
[0388] Using the same method as above, the Rv1605, Rv2220, ESAT6, and Rv3463 DNAs obtained were used as templates, and an Rv1605-Rv2220-ESAT6-Rv3463 DNA fragment with NdeI inserted at the 5'-end and NotI restriction enzyme inserted at the 3'-end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0389] Rv2220_NdeI_F:AAGGAGATATACATATGACGGAAAAGACGCCC
[0390] Rv2220_EcoRI_R:GCTCTGTCATGAATTCAACGTCGTAGTACAGCGC
[0391] ESAT-6_F:
[0392] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0393] ESAT-6_R:TGCGAACATCCCAGTGAC
[0394] Rv3463_F: GTCACTGGGATGTTCGCAAAGCTTATGACCAATTGTGCCGCC
[0395] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0396] (30)pET-22b(+)_Rv0869c-ESAT6-Rv2005cD3-Rv3463
[0397] Using the same method as above, the Rv0869c, ESAT6, Rv2005cD3, and Rv3463 DNAs obtained were used as templates, and an Rv0869c-ESAT6-Rv2005cD3-Rv3463 DNA fragment with NdeI at the 5' end and NotI restriction enzyme inserted at the 3' end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0398] Rv0869c_NdeI_F: AAGGAGATATACATATGACACTGACCGCGCTGGG
[0399] Rv0869c_EcoRI_R: GCTCTGTCATGAATTCGCCACCGATCGCGCTCAT
[0400] ESAT-6_F:
[0401] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0402] ESAT-6_R: TGCGAACATCCCAGTGAC
[0403] Rv2005c_D3_HindIII_F:
[0404] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0405] Rv2005c_R: CGACTGCCGTGCCACGAT
[0406] Rv3463(NheI)_F: GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0407] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0408] (31)pET-22b(+)_Rv1605-ESAT6-Rv2005cD3-Rv3463
[0409] Using the same method as described above, Rv1605, ESAT6, Rv2005cD3, and Rv3463 obtained were used as templates, and an Rv1605-ESAT6-Rv2005cD3-Rv3463 DNA fragment with NdeI inserted at the 5' end and NotI restriction enzyme inserted at the 3' end was finally prepared by overlapping PCR method and inserted into the pET22b vector. At this time, the primers used were as follows.
[0410] Rv1605_NdeI_F: AAGGAGATATACATATGTATGCCGACCGTGACCTTC
[0411] Rv1605_EcoRI_R: GCTCTGTCATGAATTCTCGCACGGTGATTCCTTC
[0412] ESAT-6_F:
[0413] CGTCTCGCGCGTACCTTGGAATTCATGACAGAGCAGCAGTGG
[0414] ESAT-6_R: TGCGAACATCCCAGTGAC
[0415] Rv2005c_D3_HindIII_F:
[0416] GATGTTCGCAAAGCTTATGTGGAGTGACGTCGAAG
[0417] Rv2005c_R: CGACTGCCGTGCCACGAT
[0418] Rv3463(NheI)_F: GCACGGCAGTCGGCTAGCATGACCAATTGTGCCGCC
[0419] Rv3463_NotI_R: TGCTCGAGTGCGGCCGCAGTCAGTCGGAGCGGCTT
[0420] 1.3 Production of Recombinant Protein
[0421] All the recombinant plasmids produced above were transformed into E. coli BL21 cells. The E. coli cells containing the recombinant plasmids were grown in a shaker incubator at 37°C. When the optical density (OD) reached at a wavelength of 600 nm, isopropyl-D-thiogalactopyranoside (IPTG; Daejoon, Korea, ELPIS-Biotech) was added at a concentration of 1 mM. After 4 - 6 hours, the bacterial cells were harvested by centrifugation and suspended in 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM imidazole, 6 M urea, and 1 mM phenylmethylsulfonyl fluoride (Sigma). For the purification of single proteins, the same composition except for urea was used. After lysis by sonication, the recombinant proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) agarose chromatography according to the manufacturer's instructions (Qiagen, Chatsworth, CA, USA). Each purification step was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) with Coomassie Brilliant Blue (CB) staining and Western blot (WB) analysis using an anti-His antibody (Santa Cruz). The purified proteins were concentrated and dialyzed against phosphate buffered saline (PBS, pH 7.4). PBS was used for the dialysis of all single proteins. To remove endotoxin, the dialyzed proteins were incubated with polymyxin B-agarose (PMB, Sigma) at 4°C for 2 hours. Finally, the purified endotoxin-free recombinant proteins were filter-sterilized and frozen at -70°C. The protein concentration was calculated using a bicinchoninic acid (BCA) protein assay kit (Pierce, Rockford, IL) with bovine serum albumin (BSA) as a standard. The purity of all proteins was evaluated by Coomassie Blue (CB) staining and Western blot (WB) using an anti-histidine antibody.
[0422] 2. Culture of Mouse Bone-marrow-derived Dendritic Cells (BMDCs)
[0423] Bone marrow-derived dendritic cells (BMDCs) were cultured at 37 °C and 5% CO2 using RPMI 1640 medium (Roswell Park Memorial Institute) supplemented with 10% fetal bovine serum (FBS), 1% antibiotic (Welgene, Korea), and 0.1% 2-mercaptoethanol. Non-adherent cells and loosely attached proliferating DC aggregates were harvested on day 7 or 8 and used for additional experiments in the presence of 5 mM HEPES buffer, 1% MEM solution, 20 ng / ml granulocyte-macrophage colony-stimulating factor (GM-CSF), and 2 ng / ml IL-4.
[0424] 3. Culture of mouse bone marrow-derived macrophages (BMDMs)
[0425] BMDMs obtained from femurs and pelvises were cultured in a cell incubator at 5% CO2 and 37 °C using DMEM (Dulbecco’s modified Eagle’s medium) medium containing 10% FBS (fetal bovine serum), 50 ng / μl M-CSF (macrophage colony stimulating factor) (R&D System, USA), and 1% antibiotic (Welgene, Korea).
[0426] 4. Preparation of Mtb strains
[0427] Mtb H37Rv (Mtb H37Rv, ATCC 27294) and H37Ra (Mtb H37Ra, ATCC 25177) were cultured using 7H9 medium containing 0.5% glycerol, 0.05% Tween-80, 10% oleic acid, albumin, dextrose, and catalase.
[0428] 5. Animal preparation
[0429] Female C57BL / 6 mice, 5 - 6 weeks old and not infected with specific pathogens, were bred in the Biological Containment Animal Laboratory of Chonnam National University Medical School. The breeding conditions were under a 12 - hour light / 12 - hour dark cycle, with sterilized regular diet provided. The mice were monitored daily, and no clinical symptoms or diseases occurred in any of the mice during the experiment.
[0430] 6. Cell infection experiment and intracellular Mycobacterium tuberculosis growth test
[0431] BMDMs were dispensed into plates at a density of 1×10 5 per well and cultured. After that, they were treated with Mtb H37Rv (MOI = 1) for 4 hours to be infected. Then, to remove the Mycobacterium tuberculosis remaining outside the BMDMs without infection, the antibacterial agent amikacin was added at a concentration of 200 μg / ml and treated for 2 hours, followed by washing with PBS. Specific antigens were added here and cultured for 3 or 5 days, and the number of intracellular Mycobacterium tuberculosis was measured.
[0432] Alternatively, lymphocytes activated by culturing BMDCs stimulated by each antigen and spleen cells or T cells separated from spleen cells at a ratio of 1:10 for 3 days were co - cultured with BMDMs infected with Mycobacterium tuberculosis for 3 or 5 days, and the number of intracellular Mycobacterium tuberculosis was measured.
[0433] Measurement of the number of intracellular bacteria: BMDMs were collected and treated with distilled water for 30 minutes to lyse the cells and obtain lysates. After continuously diluting the obtained lysates, they were spread on 7H10 solid medium and cultured at 37°C. After culturing, the number of colonies (colony forming unit, CFU) formed on the solid medium was analyzed.
[0434] 7. In vitro T - cell proliferation analysis
[0435] Responder T cells participating in the naive T - cell response were separated from total mononuclear cells extracted from BALB / c mice using a MACS column (Miltenyi Biotec). The responder's OVA - specific CD4 +T cells were obtained from the spleen cells of OT-2 mice respectively. These T cells were stained with 1 μM CFSE (Invitrogen). In the presence of 10 μg / ml of tuberculin antigen for 24 hours, DCs treated with OVA peptide (2 × 10 5 cells) were co-cultured with CFSE-stained CD4 + T cells (2 × 10 6 ) at a DC:T cell ratio of 1:10. On the 3rd or 4th day of co-culture, each T cell batch was stained with PerCP-Cy5.5-conjugated anti-CD4 + monoclonal Ab and analyzed by flow cytometry, and the supernatant was harvested and the levels of IFN-γ, IL-2 and IL-4 were analyzed by ELISA.
[0436] 8. Enzyme-linked immunosorbent assay (ELISA)
[0437] Cytokines generated after stimulating BMDMs or BMDCs with antigens and cytokines generated under various conditions were detected for TNF-α, IL-1β, IFN-γ, IL-2, IL-4 and IL-12p70 in the culture medium using a sandwich enzyme-linked immunosorbent assay. Cytokine analysis in the culture medium was performed according to the recommendations of the manufacturers (eBioscience and BD Biosciences). The levels of cytokines released into the culture medium were determined by measuring the absorbance at a wavelength of 450 nm with a microplate reader. The concentration of cytokines was calculated using a standard curve of recombinant cytokines, and the results were shown in picograms per milliliter.
[0438] 9. Preparation of BCG cell wall skeleton (BCG-CWS) and covalent binding with proteins
[0439] BCG-CWS was prepared according to the method of Paik et al. (PMID; 20937311) after culturing BCG strains and killing them by autoclaving. The finally prepared CWS was suspended in 2-propanol (100%) and stored in a freezer. Covalent binding with proteins was performed according to the method of Baik et al. (PLOS One, 2019, PMID 30849108). CWS was suspended in coupling buffer [20 mM EDC and 50 mM NHS / 100% 2-propanol; NHS (N-hydroxysulfosuccinimide), EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride)], a certain amount of protein was added, and the mixture was reacted overnight in a refrigerator. Unbound proteins were removed by washing three times with suspension buffer (0.02% Tween 80 and 1% ethanol / PBS), and the final product was suspended in suspension buffer to measure the protein concentration and used as a vaccine antigen.
[0440] 10. Mixing of Protein with DDA / MPL
[0441] Mixing of protein with dimethyldioctadecylammonium bromide (DDA) and monophosphoryl lipid A (MPL) was prepared according to the method of Andersen et al. (PMID; 10639447). After mixing 5 μg of protein, 250 μg of DDA, and 25 μg of MPL, 0.2% triethylamine was added to make the final volume 200 μl. Then, the mixture was heated in a water bath at 70 °C for 30 seconds and sonicated for 30 seconds. This process was repeated 2 to 3 times. Mixing of protein with DDA and MPL was all mixed immediately before use.
[0442] 11. Vaccine Experiment
[0443] For the preventive vaccine experiment, first, the immunogenic vaccine composition to be tested was immunized subcutaneously three times, challenged with Mtb (H37Ra or H37Rv) 4 or 6 weeks later, and then the bacterial count was measured from the organs of the mice after a certain period.
[0444] For the therapeutic vaccine experiment, first, the mice were anesthetized with 1.2% 2,2,2-tribromoethanol (Avertin), the trachea was exposed by a small median incision, and then Mtb contained in 50 μl of saline was inoculated intratracheally (IT). Three weeks after infection with "short-course" chemotherapy, isoniazid (INH, 0.1 g / L) and rifampin (RIF, 0.1 g / L) were administered, and free drinking water was provided for 4 weeks. The vaccine composition was immunized three times at regular intervals after the start of treatment, and the bacterial count was measured from the lungs after a certain time. The measurement of the bacterial count in the lungs was performed by euthanizing the mice with CO 2 and then excising and homogenizing the lungs. After that, the lung homogenate was serially diluted and plated on Middlebrook 7H10 agar (Difco Laboratories, Detroit, MI) supplemented with 10% OADC (Difco Laboratories), amphotericin (Sigma-Aldrich, St. Louis), and 2 μg / ml 2-thiophenecarboxylic acid hydrazide (Sigma-Aldrich). The colonies were counted and measured after culturing at 37°C for 4 weeks. The data for CFU and the evaluation of lung inflammation were performed with log 10 CFU ± interquartile range (IQR).
[0445] 12. Statistical analysis
[0446] All experiments were repeated three or more times. The significance level for the comparison between samples was determined by Tukey's multiple comparison test distribution using statistical software (GraphPad Prism Software, version 4.03; GraphPad Software, San Diego, CA). The data in the graphs were presented as mean ± SEM, and a difference from each value with * p < 0.05, ** p < 0.01, or *** p < 0.001 was considered statistically significant.
[0447] <Example 1. Identification of Active Sites Using Domain (Site)-Specific Immunoassays of Mtb Antigens>
[0448] To construct a tuberculosis vaccine with high efficacy, it is advantageous to fuse multiple highly immunologically active proteins. However, when multiple proteins are fused, the molecular weight increases, making purification difficult, and denaturation is likely to occur during the purification process. Even if a vaccine with a large molecular weight has good efficacy, there are many difficulties in standardizing the purification method during the commercialization process. In fact, due to the problems of recombinant protein production, the vaccine development period becomes long, and furthermore, the possibility of failure is high. For efficient vaccine production, it is necessary to develop a vaccine with high vaccine efficacy but a small molecular weight.
[0449] The present inventors have reported that a protein obtained by fusing Rv2299c (molecular weight 72 kDa), which is a dendritic cell activating protein, and ESAT6 (molecular weight 10 kDa), which is a T cell activating protein, is a tuberculosis vaccine showing very high BCG booster efficacy (Ref, Oncotarget. PMID: 28193909). However, since the Rv2299c-ESAT6 fusion protein basically has a large molecular weight of about 80 kDa, while maintaining the same protective effect, the molecular weight was reduced, and a new immunologically active protein was added here to examine the possibility of fusion. Therefore, the present inventors have identified highly immunologically active sites among the proteins developed by the present inventors to date, and conducted research to develop a vaccine composed of these active sites.
[0450] 1.1. Identification of Active Sites Using Domain (Site)-Specific Immunoassays of Rv2299c Protein
[0451] First, the Rv2299c protein, a dendritic cell activating protein, was divided into three parts as shown in Figure 1A to identify the active domain, and each recombinant protein was expressed in Escherichia coli and purified. As a result of treating each domain with C57BL / 6 mouse bone marrow-derived dendritic cells (BMDCs), as shown in Figure 1B, the D2 and D3 regions induced IL-1β and IL-12 production, but the D1 portion could not produce IL-1β or IL-12. Also, as shown in Figure 1C, naive T cells separated from the spleens of BMDCs and C57BL / 6 activated with each protein were co-cultured for 3 days and added to Mycobacterium tuberculosis-infected bone marrow-derived macrophages (BMDMs). After 3 or 5 days, the degree of Mycobacterium tuberculosis growth in BMDMs was measured by CFU (colony forming unit) and shown in Figure 1D. As seen in Figure 1D, T cells activated by BMDCs stimulated with the full-length Rv2299c protein, the D2, and D3 regions significantly inhibited intracellular bacterial growth, but the D1 site could not inhibit intracellular bacterial growth. Also, as seen in Figure 1E, IFN-γ and IL-17 produced at this time appeared in proportion to the inhibition of bacterial growth.
[0452] As a result of the above, the anti-tuberculosis activity against the D2 and D3 sites of the Rv2299c protein, which was confirmed to have excellent Mycobacterium tuberculosis growth inhibitory activity, was re-measured and shown in Figure 2. As seen in Figure 2, T cells activated by BMDCs stimulated with the D3 region showed significantly higher inhibition of intracellular Mycobacterium tuberculosis growth than those stimulated with the D2 region, and in addition, induced high IFN-γ production. On the other hand, the D2 site was found to specifically and significantly increase IL-2 production.
[0453] Based on the above results, after preparing the recombinant protein with the D2 and D3 regions of Rv2299c fused as shown in Figure 3A, the T cells activated by BMDCs stimulated with each protein were added to BMDMs infected with Mycobacterium tuberculosis and cultured for 3 days. As a result, as shown in Figure 3B, it was confirmed that the full-length Rv2299c protein, the D3 region, and the D2+D3 region exhibited high anti-tuberculosis activity. Such results mean that the same vaccine efficacy can be induced when using only the D2+D3 or D3 domain other than the D1 part instead of the full-length Rv2299c protein.
[0454] The amino acid sequences of the full-length Rv2299c protein and D1, D2, D3, D2+D3, and ESAT6 are shown in Table 2 below.
[0455]
Table 2
[0456] 1.2. Identification of the immunologically active domain of the RpfE protein The RpfE protein, a dendritic cell activating protein, was divided into regions D1 and D2 as shown in Fig. 4A, and recombinant proteins for each domain were produced and purified in E. coli as shown in Fig. 4B. Cytokines produced by stimulating BMDCs with each of the produced domains were measured and shown in Fig. 4C. As a result, when stimulating with the D1 and D2 domains of the RpfE protein, IL-1β and IL-12 were similar, but IL-23 appeared at a very low concentration when stimulating with the D2 region. Next, the anti-tuberculosis activity of T cells stimulated with BMDCs activated with each purified domain was measured and shown in Fig. 4D. As seen in Fig. 4D, the whole RpfE protein and the D1 region of RpfE showed similar anti-tuberculosis activity. The concentrations of cytokines IFN-γ, IL-2, and IL-17 produced at this time were measured and shown in Fig. 4E. As seen in Fig. 4E, the RpfE, D1, and D2 domains all showed similar effects, but IL-17 production appeared significantly lower in the D2 domain. Furthermore, cytokines produced by co-culturing BMDCs matured with each domain with T cells isolated from spleen cells isolated from mice infected with BCG or the Mtb H37Ra strain were measured. As a result, as seen in Fig. 5, there was no significant difference in IFN-γ production, but IL-2 and IL-17 production appeared very low when treated with the D2 domain. The above results suggest that sufficient vaccine efficacy can be induced even by using only the D1 region of RpfE.
[0457] The entire RpfE protein and the D1 and D2 amino acid sequences are shown in Table 3 below.
[0458]
Table 3
[0459] 1.3. Identification of the immunologically active domain of the Rv2882c protein
[0460] The Rv2882c protein, which is a macrophage activating protein, was also cloned into an expression vector by dividing it into a D1 site and a D2 site as shown in Fig. 6A, and then a recombinant protein was produced in E. coli. However, the D2 site was not expressed during this process (Fig. 6A). When BMDMs infected with Mycobacterium tuberculosis were stimulated with the whole Rv2882c protein and the D1 site, as shown in Fig. 6B, there was no significant inhibitory effect on intracellular bacterial growth. When mouse spleen cells were added here, the growth of Mycobacterium tuberculosis in BMDMs stimulated with the whole Rv2882c protein was maximally inhibited. However, when spleen cells were added after stimulation with the D1 site, the growth of Mycobacterium tuberculosis in BMDMs was not different from that without any treatment. This suggests that the D2 domain of the Rv2882c protein is the site with anti-tuberculosis efficacy.
[0461] The amino acid sequences of the whole Rv2882c protein and D1 and D2 are shown in Table 4 below.
[0462]
Table 4
[0463] 1.4. Identification of the immunologically active domain of the Rv2145c protein The present inventor has reported that the Rv2145c macrophage activating protein is a protein that induces IL-10 production and increases the growth of Mycobacterium tuberculosis rather than having an anti-tuberculosis activity effect (Ref, Front Microbiol, PMID: 34017340). In addition, as a result of measuring the anti-tuberculosis active region of Rv2145c, it has been confirmed that the D2 portion from amino acid 91 to 260 at the C-terminal part is the domain showing activity. In the composition of the tuberculosis vaccine, in addition to the immunologically active site, a pathogenicity-related domain was added, and the Rv2145c protein was selected to analyze the vaccine efficacy.
[0464] The amino acid sequences of the whole Rv2145c protein and D1 and D2 are shown in Table 5 below.
[0465]
Table 5
[0466] 1.5 Identification of the immunologically active domain of Rv2005c protein The Rv2005C protein is a protein associated with inducing Mycobacterium tuberculosis reactivation and is a protein that activates BMDCs (Ref. Vaccine 2020, PMID: 32664238). To identify the active site of Rv2005c, recombinant proteins were produced by dividing them into three domains as shown in Figure 7A. However, the D2 site did not express, so it could not be produced. BMDMs infected with Mycobacterium tuberculosis were stimulated with the full-length Rv2005c protein, the D1 region, or the D3 region, or mouse spleen cells were added thereto, and the intracellular bacterial growth inhibitory effect was measured 72 hours later. As a result, the D3 domain showed the highest anti-tuberculosis activity (Figure 7B).
[0467] The amino acid sequences of the full-length Rv2005C protein and D1 and D2 are shown in Table 6 below.
[0468]
Table 6
[0469] 1.6 Identification of the immunologically active domain of Rv3463 protein The Rv3463 protein, which is a macrophage-activating protein, was also cloned into an expression vector by dividing it into the D1 site and the D2 site, and then recombinant protein was produced in Escherichia coli. However, the D1 site did not express (Figure 8A). After stimulating BMDMs infected with Mycobacterium tuberculosis with the full-length Rv3463 protein and the D2 site, the intracellular Mycobacterium tuberculosis growth was measured 72 hours later. Both the full-length Rv3463 protein and the D2 site suppressed intracellular bacterial growth identically (Figure 8B). At this time, bacterial growth was suppressed only by protein treatment without adding T cells. Such results mean that the anti-tuberculosis activity is sufficient even with only the D2 domain of Rv3463.
[0470] The amino acid sequences of the full-length Rv3463 protein and D1 and D2 are shown in Table 7 below.
[0471]
Table 7
[0472] In addition, the amino acid sequences of the Mycobacterium tuberculosis-derived antigens used in the present invention are shown in Table 8.
[0473]
Table 8
[0474] <In vitro immunological activity of the domain of Rv2299c protein, ESAT6, and the fusion protein of the RpfE active domain in Example 2>
[0475] Based on the results of Example 1, the immunological activities of each domain or fusion domain of Rv2299c and the fusion protein of ESAT6 were examined.
[0476] As shown in Figure 9, in order to produce Rv2299cD2D3-ESAT6, Rv2299cD3-ESAT6 in which ESAT6 was fused to D2 and D3 excluding D1 of Rv2299c, and Rv2299cD2D3-ESAT6-RpfE1D1 in which the D1 site, which is the active region of RpfE1, was fused, the gene was cloned into an expression vector, the plasmid was transformed into Escherichia coli, and the recombinant protein was produced and purified.
[0477] In the present invention, the Rv2299cD2D3-ESAT6 fusion protein means a polypeptide composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 5 and SEQ ID NO: 6 are sequentially linked and fused, and refers to a polypeptide in which the end of Rv2299cD2D3 and the other end of ESAT6 are linked. The production of the Rv2299cD2D3-ESAT6 fusion protein was carried out by the recombinant protein production method using pET-22b(+)_Rv2299cD2D3-ESAT6 in Example 1.2.
[0478] Hereinafter, in the present invention, a fusion protein containing two or more Mycobacterium tuberculosis-derived antigens or their immunologically active sites means a polypeptide composed of an amino acid sequence in which each amino acid sequence of the Mycobacterium tuberculosis-derived antigen or its immunologically active site sequence is sequentially linked and fused.
[0479] Since the recombinant protein was purified in E. coli, it was confirmed that there was no contamination of the protein by LPS, which is a component of E. coli cells, and the results are shown in Fig. 10. As can be seen in Fig. 10, even in the treatment with 100 ng / ml of LPS, the concentrations of TNF-α and IL-1β were not significantly different from those of the control group, and it was confirmed that the concentrations of TNF-α and IL-1β increased by the treatment with Rv2299cD3-ESAT6 (D3-E6), Rv2299cD2D3-ESAT6 (D2D3-E6), and Rv2299cD2D3-ESAT6-RpfE1D1 (D2D3-E6-RpfED1), and it was confirmed that there was no contamination by LPS.
[0480] Therefore, Fig. 11 shows the results of measuring the anti-tuberculosis activities against three types of fusion proteins, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD3-ESAT6. First, Fig. 11A shows the results of measuring the number of Mycobacterium tuberculosis after adding T cells activated by BMDCs matured with each protein to BMDMs infected with Mycobacterium tuberculosis and co-culturing for 72 hours. As can be seen in Fig. 11A, the three types of fusion proteins, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD3-ESAT6, all showed similar anti-tuberculosis activities. Also, the IL-2, IL-17, and IFN-γ produced at this time were measured and shown in Fig. 11B. As can be seen in Fig. 11B, IL-2 and IL-17 increased similarly by the three types of fusion proteins, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD3-ESAT6. In the case of IFN-γ, the production increased most significantly by Rv2299c-ESAT6. Although Rv2299cD2D3-ESAT6 and Rv2299cD3-ESAT6 were less than Rv2299c-ESAT6, it was confirmed that they effectively increased the production of IFN-γ.
[0481] Subsequently, the anti-tuberculosis activity of a protein in which the active site of D1 of RpfE protein, which is related to inducing the reactivation of Mycobacterium tuberculosis, was fused to Rv2299cD2D3-ESAT6 was measured. Dendritic cells were stimulated for 24 hours using three types of fusion proteins, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1, and the production of IL-1β, TNF-α, IL-12, and IL-23 in mouse dendritic cells (BMDCs) was measured using ELISA, as shown in Figure 12. As shown in Figure 12, it was found that all three fusion proteins significantly induced the production of IL-1β, TNF-α, and IL-12, and the production of IL-23 was most highly induced in the Rv2299cD2D3-ESAT6-RpfED1 treatment group.
[0482] In addition, the T cell activation response by BMDCs matured by each fusion protein was measured using ovalbumin (OVA) peptide-specific transgenic T cells as shown in Fig. 13A. Fig. 13B shows the results of analysis by fluorescence-activated cell sorting (FACS) after co-culturing activated dendritic cells pretreated with CFSE (5,6-carboxyfluorescein diacetate succinimidyl ester) with OVA peptide-specific T cells for 24 hours after treating dendritic cells with each of the fusion proteins Rv2299c-ESAT6, Rv2299D3-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1 and OVA peptide for 24 hours. As seen in Fig. 13B, BMDCs matured by each of the four fusion proteins, Rv2299c-ESAT6, Rv2299D3-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1, induced T cell proliferation and Th1 response. Also, the cytokines produced at this time were measured and shown in Fig. 13C. As seen in Fig. 13C, all four proteins promoted the production of IFN-γ, IL-17, IL-2, and TNF-α. In particular, the treatment with Rv2299cD2D3-ESAT6-RpfED1 tended to increase the production of IFN-γ, IL-17, and TNF-α more significantly.
[0483] To confirm the inhibitory effect of intracellular bacterial growth of Rv2299c-ESAT6, Rv2299D3-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1, T cells activated by BMDCs matured by each of the four types of fusion proteins were added to BMDMs infected with Mycobacterium tuberculosis. As a result, as shown in Figure 14A, an inhibitory effect on Mycobacterium tuberculosis growth was confirmed in all four types, and among them, Rv2299cD2D3-ESAT6 and Rv2299cD2D3-ESAT6-RpfED1 proteins showed the most significant inhibitory effect on intracellular bacterial growth. In particular, in the case of the Rv2299cD2D3-ESAT6-RpfED1 protein, it was confirmed that almost all Mycobacterium tuberculosis was removed from BMDMs infected with Mycobacterium tuberculosis. At this time, the concentration of cytokines produced was confirmed and shown in Figure 14B. As shown in Figure 14B, the production of IFN-γ, IL-17, and IL-2 cytokines increased in all four fusion protein treatment groups. In particular, in the case of the Rv2299cD2D3-ESAT6-RpfED1 protein, the production of cytokines IFN-γ, IL-17, and IL-2 was the highest, which was consistent with the result of the Mycobacterium tuberculosis removal ability.
[0484] <Example 3. Evaluation of vaccine efficacy of Rv2299c protein domain, ESAT6, RpfE, and cell wall skeleton (BCG-CWS) binding antigen of BCG>
[0485] BCG cell wall skeleton (BCG-CWS) has been reported as a mediator capable of inducing Th1 response in experiments using OVA (Ref Vaccine, 2010, PMID: 20937311). The inventor of the present invention has reported that when Ag85B, a mycobacterium protein, was bound to BCG-CWS and used to immunize mice and then challenge them with mycobacterium, a protective effect similar to that of BCG was shown at 6 weeks, and a sustained protective efficacy was maintained at 32 weeks (the number of bacteria measured was 3.2 log in the lungs and spleen). However, it has been reported that the protective effect of BCG alone disappears at 32 weeks (Ref PLOS One, 2019, PMID 30849108). Therefore, the efficacy of the tuberculosis vaccine in which BCG-CWS was bound to the fusion protein confirmed in the above examples was confirmed.
[0486] 3.1. Vaccine efficacy of Rv2299c-ESAT6 and BCG-CWS binding antigen
[0487] A vaccine obtained by covalently binding a vaccine in which the aforementioned immunologically active protein or active domain is fused to BCG-CWS was used to evaluate the efficacy of a tuberculosis vaccine. Rv2299c-ESAT6 (Ref, Oncotarget 2017, PMID: 28193909), which has been reported to have a BCG booster effect, was used. Figure 15A shows a schematic diagram of the preventive effect evaluation experiment of the aforementioned vaccine. C57BL / 6 mice were divided into seven groups as follows (G1: Mycobacterium tuberculosis infection control group, G2: antigen control group BCG-CWS (10 μg), G3: antigen control group BCG-CWS / DDA (dimethyldioctadecylammonium) (10 μg / 250 μg), G4: Rv2299c-ESAT6-BCG-CWS (7.5 μg / 10 μg), G5: Rv2299c-ESAT6-BCG-CWS / DDA (7.5 μg / 10 μg / 250 μg), G6: immunopotentiator control group DDA / MPL (Monophosphoryl lipid A) (250 μg / 25 μg), G7: Rv2299c-ESAT6 / DDA / MPL (5 μg / 250 μg / 25 μg)), and the mice in groups G2 to G7 were immunized subcutaneously three times (8, 6, and 4 weeks before) before Mycobacterium tuberculosis inoculation. Four weeks after the last immunization, 1×10 6 CFU of the non-pathogenic Mycobacterium tuberculosis strain H37Ra was inoculated into the airways of all groups. The mice were sacrificed 6 and 18 weeks after Mycobacterium tuberculosis inoculation, and the number of bacteria in the lungs was measured and shown in Figure 15B. As seen in Figure 15B, when DDA was mixed with BCG-CWS, the protective effect appeared later at 18 weeks than at 6 weeks. In addition, Rv2299c-ESAT6 antigen (G5) mixed with DDA / MPL, which is often used when immunizing animals with a subunit vaccine that is a protein antigen, had no vaccine efficacy. The most interesting fact is that Rv2299c-ESAT6-CWS (G4) showed the highest vaccine efficacy 6 weeks later compared to other conditions and induced a reaction in which the bacteria were completely removed from the lungs 18 weeks later. This demonstrated that in the field of tuberculosis vaccines, using BCG-CWS covalently bound to an antigen showed a superior protective effect compared to using DDA / MPL, an immunopotentiator whose efficacy has been proven.
[0488] 3.2 Vaccine Efficacy of the Segmental Domains of Rv2299c and RpfE, ESAT6 Fusion Protein, and BCG-CWS Conjugated Antigen
[0489] Based on the above results in Figure 15, as shown in Figure 16A, the vaccine efficacy of the conjugated antigen obtained by covalently conjugating BCG-CWS to the segmental domains of Rv2299c and RpfE, and the ESAT6 fusion protein, was confirmed in the state of infection with the pathogenic strain H37Rv. C57BL / 6 mice were divided into six groups as follows (G1: Infection control group for Mycobacterium tuberculosis infection, G2: Antigen control group (BCG 1×10 5 CFU), G3: Antigen control group BCG-CWS (10 μg / μg), G4: Rv2299c-ESAT6-BCG-CWS (5 μg / 10 μg), G5: Rv2299cD2D3-ESAT6-BCG-CWS (5 μg / 10 μg), G6: Rv2299cD2D3-ESAT6-RpfED1-BCG-CWS (5 μg / 10 μg)), and the mice in groups G2 to G6 were immunized subcutaneously three times (10, 8, and 6 weeks before) prior to Mycobacterium tuberculosis inoculation. Six weeks after the last immunization, 1×10 3CFU was inoculated into the airways of all groups. Mice were sacrificed 6 and 28 weeks after Mycobacterium tuberculosis inoculation, and the bacterial counts were measured from the lungs and shown in Fig. 16B. As seen in Fig. 16B, at 6 weeks after Mycobacterium tuberculosis inoculation, both Rv2299c-ESAT6-CWS (G4), Rv2299cD2D3-ESAT6-CWS (G5) and Rv2299cD2D3-ESAT6-RpfED1-CWS (G6) significantly inhibited bacterial growth in the lungs. In particular, Rv2299cD2D3-ESAT6-RpfED1-CWS most strongly inhibited growth, and in 5 out of 6 mice, no bacteria grew. At 28 weeks, in both the mice immunized with Rv2299cD2D3-ESAT6-CWS (G5) and Rv2299cD2D3-ESAT6-RpfED1-CWS (G6), no bacteria grew in the lungs. Also, from the gross pathology findings by macroscopic observation of the lungs, the number of granulomas was significantly less observed in the groups inoculated with those vaccines (Fig. 16C). When the D1 portion of Rv2299c was removed from Rv2299c-ESAT6, rather the protective effect increased. The live BCG (G2) had some effect at 6 weeks, but had no protective effect at 28 weeks. In general, it has been reported that the protective effect of BCG rapidly decreases after 10 weeks of immunization. In contrast, Rv2299c-ESAT6-CWS (G5), Rv2299cD2D3-ESAT6-CWS (G5) and Rv2299cD2D3-ESAT6-RpfED1-CWS (G6) of the present invention induced an almost complete bacteria-removing reaction. This has a vaccine effect that is significantly superior to the subunit vaccines or live bacterial vaccines reported to date.
[0490] Six weeks after inoculation with Mycobacterium tuberculosis, each mouse was sacrificed, and lung and spleen cells were isolated. After stimulation with purified protein derivatives (PPD), ESAT6, Rv2299c-ESAT6, Rv2299cD2D3-ESAT6, and Rv2299cD2D3-ESAT6-RpfED1 antigens, cytokines in the cell culture supernatant were measured and shown in Figures 17 and 18. As seen in Figures 17 and 18, in the group inoculated with three types of vaccines that had excellent effects on removing Mycobacterium tuberculosis in the lungs, cytokines such as IFN-γ were not produced in the lung cells stimulated with the antigen. However, in the spleen cells, IFN-γ, IL-2, and IL-17 increased more in the group inoculated with the antigen. In particular, in the group (G6) immunized with Rv2299cD2D3-ESAT6-RpfED1-CWS, which had the best protective effect, other cytokines except IFN-γ were not produced in the spleen cells. It is considered that, like the mice in groups 5 (G5) and 6 (G6), the immune response returned to normal in the lungs where the bacteria were removed, and the immune response was significantly reduced.
[0491] According to what is known so far, no vaccine that mixes a protein subunit vaccine / immunopotentiator shows vaccine efficacy comparable to that of BCG alone. Therefore, protein-based subunit vaccines have been developed for BCG-prime-booster vaccines. However, summarizing the results in Figures 16 to 19, it was confirmed that the antigen obtained by binding the fusion protein according to the present invention and CWS surprisingly completely removed the bacteria after three vaccinations with the vaccine and induced an immune response significantly superior to that of BCG efficacy. Therefore, since the fusion protein vaccine composition of the present invention induces an immune response that completely removes the bacteria, it can replace BCG and is expected to be very effective as a BCG booster and a therapeutic vaccine.
[0492] <Example 4. Evaluation of the therapeutic vaccine efficacy of the Rv2299c protein domain, ESAT6, RpfE, and BCG cell wall skeleton (BCG-CWS) conjugate antigen>
[0493] Therapeutic vaccines for improving tuberculosis treatment outcomes have been developed for purposes such as (1) suppressing recurrence after completion of combination therapy, (2) enhancing the tuberculosis defense effect in cured patients, (3) reducing the treatment period after infection or the number of drugs used in treatment, and (4) suppressing the reactivation of latent tuberculosis. Therefore, the therapeutic vaccine efficacy of the fusion protein antigen according to the present invention was evaluated.
[0494] 4.1. Evaluation of the potential of the Rv2299c-ESAT6 fusion protein as a therapeutic vaccine
[0495] In order to select a therapeutic vaccine composed of highly active fusion proteins, the present inventors constructed an experiment as shown in Fig. 19A to primarily measure the therapeutic vaccine efficacy of the Rv2299c-ESAT6 fusion protein, which is a previously developed vaccine candidate fusion protein, using a latent infection model. First, C57BL / 6 mice were infected with Mycobacterium tuberculosis via the trachea, and from 3 weeks to 4 weeks after the bacteria had maximally proliferated in the lungs, they were treated with isoniazid and rifampin (Chemotherapy, C) and then the treatment was interrupted. When the treatment was interrupted, bacteria were not initially detected in the lungs, but the bacteria would regrow over time. At this time, a vaccine candidate substance in which the fusion protein was mixed with the immunopotentiator DDA / MPL (Adjuvant) was subcutaneously inoculated at 4 weeks, 7 weeks, and 10 weeks, which was 1 week after the treatment, and the effect of suppressing the regrowth of the bacteria was confirmed and shown in Fig. 19B. As can be seen in Fig. 19B, in the control group of mice administered only the immunopotentiator (DDA / MPL), bacteria were not detected in the lungs at 7 weeks after infection, which was the time when the treatment was interrupted, but at 16 weeks after infection, the number of bacteria was the same as that of the infection control group of mice that were only infected without treatment. However, in the group immunized with Rv2299c-ESAT6 / DDA / MPL, bacteria were not detected in the lungs at 7 weeks after infection, and at 16 weeks after infection, the number of bacteria in the lungs was significantly less than that of the control group.
[0496] 4.2. Evaluation of the vaccine efficacy of the Rv2299c-ESAT6-Rv3463 fusion protein
[0497] Based on the results of Figure 19B, the vaccine efficacy of Rv2299c-Rv3463 and Rv2299c-Rv3463-ESAT6 fusion proteins was analyzed. While conducting the experiment in the same method as Figure 19A, as shown in Figure 20A, the bacterial counts in the lungs were measured at 12 weeks and 20 weeks post-infection and shown in Figure 20B. As seen in Figure 20B, at 20 weeks post-infection, the regrowth of bacteria was more effectively suppressed in the mice immunized with Rv2299c-Rv3463-ESAT6 than with Rv2299c-Rv3463. Subsequently, the vaccine composition order was changed to prepare fusion proteins of Rv2299c-ESAT6 and Rv2299c-ESAT6-Rv3463, and after conducting the experiment in the same method as above, the results were shown in Figure 20C. As seen in Figure 20C, at 12 weeks post-infection, the regrowth of bacteria was completely suppressed in the mice immunized with Rv2299c-ESAT6-Rv3463, but at 20 weeks, the difference between the two groups vaccinated with Rv2299c-ESAT6 and Rv2299c-ESAT6-Rv3463 disappeared. However, it was confirmed that the vaccines in both groups significantly suppressed the regrowth of bacteria compared to the control group. Summarizing the above results, the fusion proteins of Rv2299c-ESAT6, Rv2299c-ESAT6-Rv3463, and Rv2299c-Rv3463-ESAT6 showed excellent therapeutic vaccine effects. In particular, when evaluated based on 12 weeks post-infection, the Rv2299c-ESAT6-Rv3463 fusion protein showed the most excellent therapeutic vaccine efficacy.
[0498] 4.3. Evaluation of the vaccine efficacy of proteins with multiple active proteins or domains fused to the D2D3 region of Rv2299c
[0499] The Rv2299cD2D3-ESAT6 fusion protein, which removes the D1 portion of Rv2299c from Rv2299c-ESAT6 with excellent existing vaccine efficacy, has a reduced molecular weight, so multiple active domains can be fused. Therefore, based on the Rv2299cD2D3-ESAT6 fusion protein, a multi-fusion protein was constructed and cloned as shown in Figure 21A, and produced as a recombinant protein in Escherichia coli. As shown in Figure 21B, C57BL / 6 mice infected with Mycobacterium tuberculosis were treated and sacrificed, and the number of bacteria in the lungs was measured at 20 weeks after infection and shown in Figure 21C. As shown in Figure 20, since the Rv2299c-ESAT6-Rv3463 fusion protein showed excellent therapeutic vaccine efficacy, based on the mice immunized with Rv2299cD2D3-ESAT6-Rv3463 from which the D1 site of Rv2299c was removed from this fusion protein, vaccine candidates with more excellent efficacy were attempted to be selected. As a result, as seen in Figure 21C, Rv2299cD2D3-ESAT6-Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2 (G7), Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3 (G8), and Rv2299cD2D3-ESAT6-Rv3463D2-Rv2005cD3-RpfED1 (G9) showed very excellent vaccine efficacy.
[0500] Also, additional recombinant proteins were constructed with Rv2299cD2D3-ESAT6 as the backbone as shown in Figure 22A, and the vaccine efficacy was evaluated in the same manner as above as shown in Figure 22B, and the results are shown in Figure 22C. As shown in Figure 22C, multiple fusion proteins were found to suppress bacterial growth by about 0.5 log 10 level. Interestingly, the most basic backbone fusion protein, Rv2299cD2D3-ESAT6, showed the most excellent vaccine efficacy and significantly suppressed bacterial regrowth compared to the protein with additional active sites fused to the backbone fusion protein.
[0501] 4.4. Evaluation of Vaccine Efficacy of Proteins with Multiple Active Proteins or Domains Fused
[0502] Various proteins were constructed and produced as shown in Fig. 23A, and the therapeutic vaccine efficacy was analyzed by the method shown in Fig. 23B and is shown in Fig. 23C. At this time, a fusion protein showing better efficacy than Rv2299cD2D3-ESAT6-Rv3463 (G11) was searched for. As a result of evaluating the vaccine efficacy of the fusion proteins composed of Rv2882c-Rv2005c-Rv3463, Rv2882c-Rv2005cD3-ESAT6-Rv3463, Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv2220-ESAT6-Rv3463, Rv0869c-ESAT6-Rv2005cD3-Rv3463 and Rv1605-ESAT6-Rv2005cD3-Rv3463, as seen in Fig. 23C, Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2 (G6) showed the best vaccine efficacy.
Claims
1. A composition for a tuberculosis vaccine, comprising an immunologically active site of Rv2299c and a fusion protein of ESAT6 characterized thereby.
2. The fusion protein is a fusion protein of an immunologically active site of Rv2299c composed of one amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 5 and ESAT6 composed of the amino acid sequence of SEQ ID NO: 6 The composition for a tuberculosis vaccine according to Claim 1.
3. The fusion protein is a fusion protein of an immunologically active site of Rv2299c composed of one amino acid sequence selected from the group consisting of SEQ ID NOs: 3 to 5 and ESAT6 composed of the amino acid sequence of SEQ ID NO: 6 The composition for a tuberculosis vaccine according to Claim 1.
4. A BCG cell wall skeleton (BCG-Cell Wall Skeleton, BCG-CWS) is bound to the end of the fusion protein The composition for a tuberculosis vaccine according to any one of Claims 1 to 3.
5. A vaccine for preventing tuberculosis or a vaccine for treating tuberculosis The composition for a tuberculosis vaccine according to any one of Claims 1 to 3.
6. A vaccine for preventing tuberculosis or a vaccine for treating tuberculosis The composition for a tuberculosis vaccine according to Claim 4.
7. The end of the fusion protein further comprises one or more tuberculosis bacillus-derived antigens or immunologically active sites thereof selected from the group consisting of RpfE, Rv3463, Rv2005c, Rv2882c, Rv2145c, Rv1605, Rv2220, and Rv0869c The composition for a tuberculosis vaccine according to any one of Claims 1 to 3.
8. At the end of the fusion protein, any one mycobacterium tuberculosis-derived antigen or its immunologically active site selected from the group consisting of RpfED1 composed of the amino acid sequence of SEQ ID NO: 8, Rv3463 composed of the amino acid sequence of SEQ ID NO: 19, Rv2005cD3-Rv3463 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 18 and SEQ ID NO: 19 are sequentially linked and fused, Rv2882cD2-Rv2005cD3-Rv3463D2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 12, SEQ ID NO: 18 and SEQ ID NO: 21 are sequentially linked and fused, Rv2005cD3-Rv1605-Rv3463D2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 18, SEQ ID NO: 22 and SEQ ID NO: 21 are sequentially linked and fused, Rv3463D2-Rv2882cD2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21 and SEQ ID NO: 12 are sequentially linked and fused, Rv3463D2-Rv2882cD2-Rv2145cD2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 12 and SEQ ID NO: 15 are sequentially linked and fused, Rv3463D2-Rv2882cD2-RpfED1 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 12 and SEQ ID NO: 8 are sequentially linked and fused, Rv3463D2-Rv2882cD2-RpfED1-Rv2145cD2 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 12, SEQ ID NO: 8 and SEQ ID NO: 15 are sequentially linked and fused, Rv3463D2-Rv2005cD3 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21 and SEQ ID NO: 18 are sequentially linked and fused, and Rv3463D2-Rv2005cD3-RpfED1 composed of an amino acid sequence in which the amino acid sequences of SEQ ID NO: 21, SEQ ID NO: 18 and SEQ ID NO: 8 are sequentially linked and fused is further included The composition for a tuberculosis vaccine according to any one of claims 1 to 3.
9. At the end of the fusion protein, BCG cell wall skeleton (BCG-Cell Wall Skeleton, BCG-CWS) is bound The composition for a tuberculosis vaccine according to claim 7.
10. At the end of the fusion protein, BCG cell wall skeleton (BCG-Cell Wall Skeleton, BCG-CWS) is bound The composition for a tuberculosis vaccine according to claim 8.
11. A tuberculosis preventive vaccine or a tuberculosis treatment vaccine The tuberculosis vaccine composition according to claim 9
12. A tuberculosis preventive vaccine or a tuberculosis treatment vaccine The tuberculosis vaccine composition according to claim 10
13. As a Mycobacterium tuberculosis-derived antigen or its immunologically active site, an amino acid sequence in which the amino acid sequences of SEQ ID NO: 10, SEQ ID NO: 16, and SEQ ID NO: 19 are sequentially linked and fused, Rv2882c-Rv2005c-Rv3463, SEQ ID NO: 10, SEQ ID NO: 16, SEQ ID NO: 6, and SEQ ID NO: 19 An amino acid sequence in which the amino acid sequences are sequentially linked and fused, Rv2882c-Rv2005cD3-ESAT6-Rv3463, SEQ ID NO: 23, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 6, and SEQ ID NO: 21 An amino acid sequence in which the amino acid sequences are sequentially linked and fused, Rv2220-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, Rv0869c-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, SEQ ID NO: 22, SEQ ID NO: 12, SEQ ID NO: 18, SEQ ID NO: 6, and SEQ ID NO: 21 An amino acid sequence in which the amino acid sequences are sequentially linked and fused, Rv1605-Rv2882cD2-Rv2005cD3-ESAT6-Rv3463D2, SEQ ID NO: 23, SEQ ID NO: 6, SEQ ID NO: 19, SEQ ID NO: 6, and SEQ ID NO: 21 An amino acid sequence in which the amino acid sequences are sequentially linked and fused, Rv2220-ESAT6-Rv3463, SEQ ID NO: 24, SEQ ID NO: 6, SEQ ID NO: 18, and SEQ ID NO: 19 An amino acid sequence in which the amino acid sequences are sequentially linked and fused, Rv0869c-ESAT6-Rv2005cD3-Rv3463, and SEQ ID NO: 22, SEQ ID NO: 6, SEQ ID NO: 18, and SEQ ID NO: 19 An amino acid sequence in which the amino acid sequences are sequentially linked and fused, Rv1605-ESAT6-Rv2005cD3-Rv3463, comprising any one fusion protein selected from the group A tuberculosis vaccine composition characterized by this
14. BCG cell wall skeleton (BCG-Cell Wall Skeleton, BCG-CWS) is bound to the end of the fusion protein The tuberculosis vaccine composition according to claim 13
15. A tuberculosis preventive vaccine or a tuberculosis treatment vaccine The tuberculosis vaccine composition according to claim 13 or 14
Citation Information
Patent Citations
Tag-free tubercle bacillus fusion protein ESAT6-RpfE and preparation method and application thereof
CN102190733A
Identification of specific differentially expressed mycobacterial antigens
JP2002534994A
Mycobacterial Antigen Vaccine
JP2015524794A
Composition for promoting the maturation of dendritic cells, comprising a fusion protein of Rv2299c and ESAT-6
JP2019521183A
Boosting composition for BCG vaccine comprising Rv2299c-ESAT6-HspX-RipA fusion protein
KR102193304B1