Streptococcus suis polysaccharide protein conjugate vaccine as well as preparation method and application thereof

Abstract

The invention provides a streptococcus suis polysaccharide protein conjugate vaccine as well as a preparation method and application thereof, and belongs to the technical field of vaccine preparation. The vaccine comprises a polysaccharide-protein conjugate formed by coupling streptococcus suis type 2 capsular polysaccharide and streptococcus suis type 2 recombinant protein. The preparation method comprises the following steps: S1, preparing streptococcus suis type 2 capsular polysaccharide; s2, preparing streptococcus suis type 2 recombinant protein; s3, activating polysaccharide; s4, combining the biotinylated polysaccharide with the recombinant protein containing the avidin structural domain to form a stable polysaccharide-protein conjugate; s5, removing unbound proteins; and S6, mixing the polysaccharide-protein conjugate with the oil-water emulsion in proportion. By optimizing a coupling technology and a vaccine preparation formula, the immunogenicity and the protection effect of the vaccine are improved, the safety and the broad-spectrum cross protection capability of the vaccine are remarkably enhanced, the complexity and the cost of a vaccine production process are reduced, and the vaccine has a good industrial application prospect and a good popularization value.

Description

Technical Field

[0001] The present invention relates to a polysaccharide protein conjugate vaccine for swine streptococcal disease and a preparation method and application thereof, belonging to the technical field of vaccine preparation. Background Art

[0002] Streptococcus suis (SS), belonging to the Streptococcus family and the genus Streptococcus, is a Gram-positive bacterium with a spherical or oval shape, no flagella, no spores, and a capsule. It is aerobic or facultative anaerobic organism and requires blood or serum for growth. Hemolytic rings are produced on 5% sheep blood agar plates. The most common clinical symptoms of S. suis in pigs are meningitis and septicemia. Pigs with this infection exhibit elevated body temperature and bleeding from the tips of the ears, neck, and back. In more severe cases, pigs experience respiratory distress and systemic congestion. Meningitis in pigs typically affects piglets and lactating sows. After the onset of meningitis, piglets develop increasingly elevated body temperatures. As the disease progresses, clinical signs include agitation, paralysis of the limbs, heart failure, and neurological symptoms such as circling and convulsions. If left untreated, death can occur within a short period of time. In addition, severe lameness, difficulty standing, and swollen lymph nodes can also be seen in affected pigs.

[0003] According to the specific differences of their capsular antigens, Streptococcus can be divided into 35 serotypes, including types 1 to 34 and 1 / 2.

[0004] Currently, finding alternatives to antibiotics is crucial for controlling Streptococcus suis infections. Selecting safe and reliable vaccines to vaccinate animals can help them produce high levels of antibodies to resist bacterial infection. Currently, inactivated or live attenuated vaccines are commonly used in the domestic market to prevent Streptococcus suis. However, inactivated vaccines have low immunogenicity, require large doses, and only offer protection against infections with homologous strains. Live attenuated vaccines offer some cross-protection against infections with both homologous and heterologous strains, but carry a significant risk of virulence reversion or even re-infection during in vivo reproduction. While traditional subunit vaccines are highly safe, they have a single antigenic component and offer limited protection against Streptococcus suis type 2 infections.

[0005] Capsular polysaccharide (CPS) is the most widely studied and recognized virulence factor of Streptococcus suis, playing a crucial role in the survival, pathogenicity, and immune protection of SS2. Capsular polysaccharide is a colloidal or mucous substance produced by bacteria in certain environments. It is typically composed of long chains of 2-5 repeating monosaccharide units, which accumulate on the cell wall to form a stable, thick, and dense protective layer. Research has shown that polysaccharides are important protective antigens of bacteria, rarely causing adverse reactions after immunization in animals, and can be developed as target antigens for safe and effective vaccines. However, CPS is a weak immunogenic molecule that interferes with activation of the host's innate immune system. Furthermore, capsular polysaccharide is a T-cell-independent (TI) antigen, resulting in a very low antibody response and no memory cell production upon entry. However, covalent binding of the polysaccharide to a carrier protein converts this T-cell-independent antigen into a T-cell-dependent (TD) antigen. The polysaccharide component of the conjugate binds to B cells and activates helper T cells. These helper T cells specifically recognize the polypeptide portion of the conjugate carrier protein and, in response to the carrier protein, amplify the production of polysaccharide antibodies. Furthermore, polysaccharide-protein conjugate vaccines not only enhance immune responses but also provide broader cross-protection, making them particularly suitable for the prevention and control of multiple serotypes of pathogens. With advances in genetic engineering and molecular biology, polysaccharide conjugate vaccines have shown great potential in the research of Streptococcus suis type 2 vaccines, becoming an important direction in vaccine development. Summary of the Invention

[0006] In response to the above technical problems, the present invention aims to provide a polysaccharide-protein conjugate vaccine for Streptococcus suis, as well as its preparation method and application. Based on the strong non-covalent interaction between biotin and avidin, a candidate protein from Streptococcus suis is used as a carrier to link to the capsular polysaccharide, which is then used as an antigen to prepare the vaccine. The vaccine's immune efficacy was evaluated in a mouse immune protection assay, providing new insights into the development of novel polysaccharide-protein conjugate vaccines for Streptococcus suis.

[0007] A polysaccharide-protein conjugate vaccine for swine streptococcal disease, comprising an effective amount of a polysaccharide-protein conjugate formed by coupling a capsular polysaccharide of Streptococcus suis with a recombinant protein and a pharmaceutically acceptable adjuvant; The recombinant protein is obtained by synthesizing a target gene, transforming a plasmid, expressing the protein and purifying the protein through one selected from MRP, SAO, EF, SLY protein and commercial carrier protein CRM197.

[0008] Furthermore, the Streptococcus suis capsular polysaccharide was obtained by fermentation and extraction and purification of a strain classified as Streptococcus suis type 2, which was deposited in the China Center for Type Culture Collection on December 6, 2024, with the deposit number CCTCC NO: M20242747.

[0009] Furthermore, the molecular weight of the Streptococcus suis capsular polysaccharide is 300-400 KDa.

[0010] Furthermore, the recombinant protein is MRP protein.

[0011] Furthermore, the dosage of the polysaccharide-protein conjugate in the vaccine is 20-250 μg / mL.

[0012] Furthermore, the adjuvant is in the form of one or more of an oil-water emulsion, an aqueous adjuvant, and an aluminum salt adjuvant.

[0013] A method for preparing a polysaccharide-protein conjugate vaccine for swine streptococcal disease comprises the following steps: S1: Preparation of Streptococcus suis type 2 capsular polysaccharide; S2: Preparation of recombinant protein; S3: Activate the polysaccharide by CDAP method and connect biotin-PEG3-NH2 to obtain biotinylated polysaccharide; S4: The biotinylated polysaccharide is combined with the recombinant protein of Streptococcus suis type 2 to obtain a polysaccharide-protein conjugate; S5: Remove unbound proteins by gel filtration chromatography to obtain purified polysaccharide-protein conjugates; S6: The aqueous phase and the oil phase containing the purified polysaccharide-protein conjugate are mixed in proportion to form an emulsion, and the emulsion is allowed to stand at a low temperature of <15°C to stabilize, thereby obtaining a vaccine.

[0014] Furthermore, the recombinant protein is MRP protein, and is obtained by connecting the nucleotide sequence shown in SEQ ID NO.2 to the 3' end of the nucleotide sequence shown in SEQ ID NO.1 with a linker and the nucleotide sequence shown in SEQ ID NO.3 to obtain the target gene, followed by plasmid transformation, protein expression and protein purification.

[0015] Furthermore, after the capsular polysaccharide in the vaccine is activated by the CDAP method, the biotin modification ratio of the polysaccharide is controlled between 15% and 25% by controlling the amount of the biotin modifier Biotin-PEG3-NH2 added.

[0016] Furthermore, in the step S4, the mass ratio of Streptococcus suis type 2 capsular polysaccharide to Streptococcus suis type 2 recombinant protein is 1:1, and the reaction is carried out at 4°C.

[0017] Furthermore, in the S3 step, after the polysaccharide is linked to biotin-PEG3-NH2, it is dialyzed twice in a 100KD dialysis bag in a 1M NaCl solution for 4 hours each time; then it is dialyzed twice in a 150mM NaCl solution for 12 hours each time; and finally, it is dialyzed twice in pure water for 12 hours each time.

[0018] The invention relates to an application of the vaccine in preparing medicines for treating, diagnosing and preventing swine streptococcal disease.

[0019] The beneficial effects of the present invention are: By covalently binding the capsular polysaccharide of Streptococcus suis type 2 to a recombinant protein, the present invention significantly enhances the immunogenicity of the capsular polysaccharide, overcoming the drawbacks of the polysaccharide as a T-cell-independent antigen, which has limited efficacy and inability to activate immune memory. The vaccine can induce the production of high levels of IgG and IgM antibodies in animals, enhancing the immune response and providing long-lasting and effective immune protection. After immunization of mice and piglets, challenge experiments demonstrated protection rates as high as 90%-100%, surpassing existing inactivated vaccines and traditional subunit vaccines.

[0020] The present invention constructs a variety of polysaccharide-protein conjugate vaccines by screening and optimizing different carrier proteins, including MRP, SAO, EF, SLY, and CRM197. Experimental results show that polysaccharide conjugate vaccines using MRP and SAO as carriers achieve a 100% protection rate in a mouse challenge experiment, achieving stronger broad-spectrum cross-protection, particularly effective against different serotypes of Streptococcus suis. The optimized application of different carrier proteins provides more options for vaccine design and expands the scope of vaccine application.

[0021] The introduction of a biotin-avidin system enables efficient conjugation of polysaccharides and recombinant proteins, significantly improving binding efficiency and structural stability. The conjugate is stable, achieving a coupling rate exceeding 80%, ensuring vaccine consistency and effectiveness. The use of CDAP activation and Biotin-PEG3-NH2 conjugation technology makes the polysaccharide conjugation process gentler and more efficient, avoiding the side reactions and degradation issues associated with traditional methods and improving vaccine production efficiency and product quality.

[0022] This invention optimizes the extraction and purification process for Streptococcus suis type 2 capsular polysaccharide. Branched polyethyleneimine (PEI) and phenol treatment are used to efficiently remove nucleic acids and proteins, and ultrafiltration technology is combined to significantly improve polysaccharide purity and yield. Multiple batches of purification experiments have shown that the polysaccharide purity remains stable at 78%-84%, with extremely low residual nucleic acids and proteins, ensuring the high purity and quality of the vaccine raw material. This environmentally friendly process reduces the use of hazardous reagents, improves production safety and environmental friendliness, and facilitates industrialization and promotion.

[0023] The vaccine formulation of the present invention is rationally designed, utilizing an M903 water-in-oil emulsion, effectively enhancing the immune effect of the antigen and prolonging the duration of immunity. The optimized oil-to-water ratio of 55:45 ensures vaccine stability and adjuvant efficacy, prevents emulsion stratification, and improves storage stability and injection safety. The vaccine preparation process is simple to operate, and the product performance is stable, making it suitable for large-scale production and widespread application.

[0024] Animal trials have demonstrated the vaccine's safety, with no significant adverse reactions observed. Immunized mice and piglets were in good spirits, ate and drank well, and showed no local reactions such as redness or swelling at the injection site. Challenge protection trials showed protection rates of 75%-100% for piglets in the high- and medium-dose vaccine groups, respectively, and 90%-100% for mice, demonstrating the vaccine's safety and effectiveness. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The protein standard curve.

[0026] Figure 2 The polysaccharide standard curve.

[0027] Figure 3 This is a linear curve of the logarithm of the relative molecular mass of standard dextran and retention time.

[0028] Figure 4 These are H NMR spectra of Streptococcus suis type 2 polysaccharide. A: Spectrum of Streptococcus suis type 2 polysaccharide reported in the literature; B: Spectrum of Streptococcus suis type 2 polysaccharide purified in our laboratory. HOD: deuterium signal in water; Neu5Ac3e: equatorial proton signal at the third carbon position in the N-acetylneuraminic acid structure; Neu5AcMe: methyl proton signal on the acetyl group in the N-acetylneuraminic acid structure; Neu5Ac3a: axial proton signal at the third carbon position in the N-acetylneuraminic acid structure.

[0029] Figure 5 This is the construction map of the pET-28a-Avidin-MRP plasmid.

[0030] Figure 6 The expression of Avidin-MRP fusion protein (SDS-PAGE). M: protein molecular weight standard; W: whole cells; S: supernate; P: precipitate.

[0031] Figure 7 Western Blot analysis of the Avidin-MRP fusion protein. M: protein molecular weight standard; 1: sample before induction; 2: whole cells after induction; 3: supernatant after induction; 4: precipitate after induction.

[0032] Figure 8 Purification of Avidin-MRP fusion protein (SDS-PAGE). M: protein molecular weight marker; 1: nickel column flow-through; 2: eluate from Wash Buffer I; 3: eluate from Wash Buffer II; 4: eluate from Wash Buffer III; 5: eluate from Eluate I; 6: eluate from Eluate II.

[0033] Figure 9 Comparison of one-dimensional proton spectra of Streptococcus suis type 2 capsular polysaccharide before and after activation. A: Spectrum of Streptococcus suis type 2 polysaccharide before activation; B: Spectrum of biotin (biotin-PEG3-NH2); C: Spectrum of biotinylated Streptococcus suis type 2 polysaccharide.

[0034] Figure 10 This image shows the HPLC characterization of the biotinylated polysaccharide-fusion protein conjugate. RI: Conjugation refers to the peak detected by the refractive index detector, which represents the conjugate formed by the binding of the polysaccharide and the fusion protein. UV-260: Conjugation refers to the peak detected at a UV wavelength of 260 nm, indicating that the conjugate contains a component that absorbs at 260 nm. UV-280: Conjugation refers to the peak detected at a UV wavelength of 280 nm, which corresponds to a protein component, representing the fusion protein.

[0035] Figure 11 The figure shows the characterization of the conjugate of biotinylated polysaccharide and fusion protein by high performance liquid chromatography.

[0036] Figure 12 The graph shows the level of mouse polysaccharide IgG antibodies measured by indirect ELISA.

[0037] Figure 13 The graph shows the level of mouse polysaccharide IgM antibodies measured by indirect ELISA.

[0038] Figure 14 The graph shows the level of mouse polysaccharide IgG antibodies measured by indirect ELISA.

[0039] Figure 15 The graph shows the level of mouse polysaccharide IgM antibodies measured by indirect ELISA.

[0040] Figure 16 Survival curves of mice challenged with polysaccharide conjugate vaccines prepared with antigens containing different polysaccharide to protein ratios.

[0041] Figure 17 Survival curves of mice challenged with polysaccharide vaccines prepared using other carrier proteins. DETAILED DESCRIPTION

[0042] The present invention is described in detail below with reference to the embodiments and accompanying drawings.

[0043] Example 1

[0044] This embodiment discloses a polysaccharide protein conjugate vaccine for swine streptococcal disease and its preparation method. The specific method is as follows S1. Preparation of Streptococcus suis type 2 capsular polysaccharide 1.1 Preparation of master seeds and working seeds The capsular polysaccharide high-producing strain S031 (CCTCC NO: M20242085), which was screened out from 46 clinical isolates of Streptococcus suis type 2 in our laboratory, was taken out from the -80℃ freezer and inoculated into 5 mL of TSB medium containing 5% newborn calf serum. It was cultured at 37℃±1℃ for 16 hours. The bacterial liquid was transferred to 150 mL of fresh TSB medium containing 5% newborn calf serum and cultured at 37℃±1℃ for 8 hours until the exponential growth phase. The culture was stopped, the cells were packaged and freeze-dried, and stored at 4℃ as the main seeds.

[0045] Inoculate the bacteria in the main seed freeze-dried tube into 5 mL of TSB medium containing 5% newborn calf serum, and culture it at 37℃±1℃ for 16 hours. Transfer the bacterial liquid to 150 mL of fresh TSB medium containing 5% newborn calf serum, and culture it at 37℃±1℃ for 8 hours until the exponential growth phase. Stop the culture, package and freeze-dry, and store at 4℃ as working seeds.

[0046] 1.2 Bacterial fermentation Remove a seed tube from the working seed bank and inoculate it into 5 mL of TSB medium containing 5% newborn calf serum. Incubate at 37°C ± 1°C until the mid-logarithmic growth phase. Transfer the bacterial liquid to 400 mL of fresh TSB medium containing 5% newborn calf serum and incubate at 37°C ± 1°C for 8 hours until the exponential growth phase. Inoculate 200 mL of fermentation seed liquid into 4 L of liquid culture medium at a 5% inoculum size for fermentation. After 10 hours of incubation, when the bacteria enter the mid-to-late logarithmic growth phase, terminate the fermentation and harvest the bacterial liquid.

[0047] 1.3 Extraction and purification of capsular polysaccharides (1) Harvest the bacteria by centrifugation: Centrifuge the fermented bacteria at 4000 rpm for 30 min, wash three times with 10 mM PBS, and concentrate the solution to 1 / 10 of its volume using 10 mM PBS.

[0048] (2) Bacterial cell lysis and polysaccharide crude extraction: add lysozyme to a final concentration of 1 mg / mL, react at 37°C, 180 rpm for 12 hours, then centrifuge at 10,000 rpm for 20 minutes, and collect the supernatant; (3) Removal of nucleic acids: Add a branched polyethyleneimine (PEI) aqueous solution with a final concentration of 350 mg / L to the supernatant, adjust the pH to 8.0 ± 0.2, shake at 25°C for 30 min, centrifuge at 10,000 rpm for 20 min, remove the precipitate, and collect the supernatant; (4) Protein removal: Add phenol to a final concentration of 5% to the supernatant, shake at room temperature for 4 hours, centrifuge at 10,000 rpm for 30 minutes, and collect the supernatant; (5) Ultrafiltration and concentration: The supernatant was ultrafiltered eight times with an equal volume of pure water to remove impurities. The obtained pure polysaccharide solution was freeze-dried and stored.

[0049] 1.4 Polysaccharide characterization and analysis 1.4.1 Nucleic acid content determination method The nucleic acid content in polysaccharides was determined by ultraviolet absorption. First, the sample to be tested was diluted so that its absorbance value was between 0.3 and 0.7. Then, according to the Lambert-Beer law: A=kbc, k is the absorption coefficient, b is the thickness of the absorption layer (unit: cm), and c is the solution concentration (unit: mol / L). When the absorbance value is detected with a 1 cm cuvette, the absorption coefficient of nucleic acid at a wavelength of 260 nm is 200. Therefore, the nucleic acid content is estimated based on the absorbance.

[0050] 1.4.2 Protein content determination method The protein content in capsular polysaccharide was determined by Folin-phenol method.

[0051] Preparation of test solution: (1) 0.2 mol / L NaOH solution, (2) 4% Na2CO3 solution, (3) 2% potassium sodium tartrate solution, (4) 1% CuSO4 solution. The NaOH-Na2CO3 solution was prepared by mixing equal volumes of (1) and (2), and the potassium sodium tartrate-copper sulfate solution was prepared by mixing (3) and (4). Solution A was prepared by mixing these two solutions in a ratio of 50:1. Solution B was prepared by diluting the Folin-phenol reagent by half before use.

[0052] Reference solution: Accurately weigh 25.0 mg of standard bovine serum albumin, dry to constant weight, dissolve with a small amount of water, and then add water to a 50 mL volumetric flask to obtain a 0.5 mg / mL standard bovine serum albumin solution.

[0053] Draw a standard curve: Take 0, 50, 100, 150, 200, 250, and 300 μL of 0.5 mg / mL standard bovine serum albumin solution, add water to 500 μL, add 2.5 mL of reagent A, vortex and let it stand at room temperature for 10 minutes, then add 250 μL of reagent B, vortex again and let it stand for 1 hour, and measure its optical density at 750 nm. With the optical density of bovine serum albumin as the vertical axis and the concentration as the horizontal axis, the protein content standard curve equation is obtained (such as Figure 1 shown).

[0054] Quantitative determination: Accurately pipette an appropriate amount of the sample solution to be prepared into 5 mg / mL, operate in parallel with the bovine serum albumin standard, measure its optical density at 750 nm, and use the standard curve equation to obtain the protein content in the capsular polysaccharide.

[0055] 1.4.3 Polysaccharide content determination method The phenol-sulfuric acid method was used to determine the polysaccharide content in the samples.

[0056] Preparation of reference solution: Accurately weigh standard dextran and use a volumetric flask to make a 0.1 mg / mL standard solution.

[0057] To draw a standard curve: Take 0, 50, 100, 150, 200, 250, and 300 μL of a 0.1 mg / mL standard dextran solution, dilute to 500 μL, add 200 μL of 6% phenol and 1.0 mL of concentrated sulfuric acid, shake, and react in a boiling water bath for 10 minutes. Cool to room temperature and measure the optical density at 490 nm. Using the optical density of dextran as the ordinate and the concentration as the abscissa, the equation for the standard curve for sugar content is obtained. Figure 2 shown.

[0058] Quantitative determination: Accurately pipette an appropriate amount of sample solution to be prepared into 5 mg / mL, operate in parallel with the standard, measure its optical density at 490 nm, and use the standard curve equation to obtain the sugar content of capsular polysaccharide.

[0059] The freeze-dried capsular polysaccharide was tested for nucleic acid, protein, and polysaccharide content using the methods described in 1.4.1 to 1.4.3 above to assess its purity and yield. The results of three batches of polysaccharide fermented and purified using steps 1.2 and 1.3 above are shown in Table 1.

[0060] Table 1: Characterization data of three batches of freeze-dried polysaccharide from Streptococcus suis type 2 Batch number Polysaccharide content Nucleic acid content Protein content Batch 1 82% 0.10% 0.62% Batch 2 78% 0.08% 0.51% Batch 3 84% 0.15% 0.68% 1.4.4 Polysaccharide molecular weight determination The molecular weight of polysaccharides was determined by CL-4B gel chromatography. The external water volume V0 and internal water volume Vt of the chromatography column (1.6× 90 cm) were calibrated with blue dextran (Blue dextran 2000kd) and vitamin B12, and the polysaccharide was dissolved to 5 mg / mL and loaded. The loading conditions were 0.9% NaCl (pH 7.0) as eluent, a flow rate of 0.8 mL / min, and a fraction collection of 3 mL / tube. The detection signal was a differential refractometer, 254 nm, and 280 nm wavelength signals. The volume Ve of the highest peak of the polysaccharide on the chromatography column was recorded, and the Kd value was calculated according to the formula Kd = (Ve -V0) / (Vt -V0). Alternatively, dextran of different molecular weights was used as a standard to draw a standard curve of molecular weight and retention time, and the molecular weight of the target polysaccharide was calculated according to its retention time. Figure 3 As shown in Figure 2, the molecular weight of Streptococcus suis type 2 capsular polysaccharide should be 300-400 KDa.

[0061] 1.4.5 Polysaccharide Chemical Structure The polysaccharide was fully dissolved in heavy water and its nuclear magnetic resonance (H) 1 The spectrum was compared with the Streptococcus suisserotype 2 capsular polysaccharide reported in the literature Van Calsteren MR, Gagnon F, Lacouture S, et al. Structure determination of Streptococcus suisserotype 2 capsular polysaccharide.[J]. Biochemistry and Cell Biology, 2010. (Chinese translation: Van Calsteren MR, Gagnon F., Lacouture S. et al. Structural analysis of Streptococcus suisserotype 2 capsular polysaccharide[J]. Biochemistry and Cell Biology, 2010.), such as Figure 4 As shown in the figure, the capsular polysaccharide extracted by our laboratory is consistent with the spectrum reported in the literature. Figure 1 The points are normal.

[0062] S2, preparation of recombinant protein of Streptococcus suis type 2 2.1 Construction of protein expression vector 2.1.1 Target gene synthesis and recombinant plasmid construction The amino acid sequence at positions 45-179 of rhizavidin was selected as the optimized core avidin Avidin. The nucleotide sequence encoding the Avidin protein was optimized according to the Escherichia coli preferred codon table (SEQ ID NO.1), and a flexible linker (SEQ ID NO.2) was added to the 3' end. The amino acid sequence at positions 408-588 of the Streptococcus suis type 2 MRP protein was selected as the protein antigen. The nucleotide sequence encoding the protein antigen was also optimized according to the Escherichia coli preferred codon table (SEQ ID NO.3) and connected to the linker. At the same time, in order to facilitate the construction of the plasmid in the later stage, a BamH I restriction site was added to its N-terminus, and an XhoI restriction site was added to the C-terminus. The optimized nucleotide sequence was commissioned to Suzhou Jinweizhi Biological Co., Ltd. for synthesis, and the synthesized recombinant gene fragment was inserted into the pET-28a plasmid to construct a recombinant vector. The schematic diagram of the recombinant vector construction is shown in the figure. Figure 5 shown.

[0063] SEQ ID NO.1: TTTGATGCGAGTAACTTTAAAGATTTCAGCTCTATTGCGAGCGCCAGTAGCTCTTGGCAGAATCAGAGTGGCAGCACCATGATTATCCAGGTGGATTCTTTCGGCAACGTTAGTGGCCAGTATGTTAATCGTGCGCAGGGCACGGGTTGCCAGAACTCTCCGTACCCGCTGACCGGCCGCGTGAATGGCACGTTTATCGCCT TCAGCGTTGGCTGGAACAATTCTACCGAAAACTGTAATAGTGCAACCGGCTGGACGGGTTATGCGCAGGTGAACGGTAACAATACCGAAATTGTTACGAGCTGGAATCTGGCCTATGAAGGCGGTTCTGGCCCGGCAATCGAACAGGGTCAGGATACCTTTCAGTACGTTCCGACCACGGAAAACAAAAGCCTGCTGAAAGAT SEQ ID NO.2: GGAGGCGGAGGTTCGAGCTCC SEQ ID NO.3: AAGGTCCATATCCAAAGGGAACGGTATAACCTTGCTGGTACGGTTCAAAAGGATACAGTACAATATAAAGTTATTCGTGAAATTGTGGAGAACGACCAAGCAGTTTCTTAAATTCTATTATTTAGATCCTACCTATA AGGGTGAAGTAGATTGGAGAGGAACTGATACGACTGGGTTTATTGAGTTGCTTACAACTTCCCCAACAACCTATAAAGTTGGTACTATATACGATTACAATATTAATTCAAAAATTACAGCTCCATTTACTATTGA TCCTACCAAGAATGTTATGGTTTTCAAGGAAAGTGAACAGAACGAGCAAGGTAGCAAATATCGCGTCATTGCTCAATGGTCAGGAGATGAAACCACTAAAGGTATATATGGAAAAATCTATATCGCTACTCAGGT TTGGACGACTAAATTGGGAACAAACGAGTGGGGATGGTTTGACTATTCTGATGACCAAGCTGGTATAAAATTTAATAACAAAGGTTTTTGGCCGGCAGGTGTTCAAAATACACTTCGAAATGCTACTCCAGCTACA 2.1.2 Plasmid transformation The recombinant plasmid was transferred into competent cells BL21 (DE3) by heat stress method, and single clones that could grow on kanamycin-resistant plates were picked out. The results of PCR and double enzyme digestion were positive, indicating that the construction of the prokaryotic expression vector was completed.

[0064] 2.2 Protein expression (1) Take the preserved prokaryotic expression strain and shake culture overnight to revive it.

[0065] (2) Transfer the cells to a conical flask containing kanamycin-resistant LB medium at a ratio of 1:100 and culture at 37°C with shaking at 220 rpm.

[0066] (3) When the bacteria reached the logarithmic growth phase, 0.1 mM, 0.5 mM, and 1.0 mM IPTG inducer were added, respectively, and induced at 220 rpm at 16 °C for 16 h to explore the expression of different inducer concentrations.

[0067] (4) Collect the induced bacterial solution, centrifuge it at 6000 rpm for 15 minutes, and collect the bacterial precipitate.

[0068] (5) Resuspend the bacterial pellet with PBS at 1 / 10 the volume of the original bacterial solution, place it in an ice-water bath and crush it in an ultrasonic crusher. When the transparency of the bacterial solution changes significantly, stop ultrasonication.

[0069] (6) Place the broken bacterial solution in a centrifuge tube and centrifuge at 12000 rpm for 30 minutes. A clear precipitate will be visible at the bottom. Take the supernatant and precipitate samples to detect the expression of the target protein. Figure 6 and Figure 7 As shown in the figure, different induction conditions will affect the soluble expression of protein. When the rotation speed is controlled at 220 rpm, the induction temperature is 16 °C, and the inducer IPTG concentration is 0.1 mM, the protein expression level in the supernatant is the highest.

[0070] 2.3 Protein purification In order to facilitate the purification of the target protein, we retained the histidine tag on the N-terminus of the plasmid during the design, so that the plasmid expresses a continuous histidine sequence. The imidazole ring in the histidine can bind to the nickel ions in the purification column. Since different proteins carry different numbers of imidazole rings and have different affinities with the nickel column, when the concentration of imidazole in the mobile phase is increased, the protein will be gradually eluted, thereby achieving the purpose of separating different proteins. Finally, the target protein is eluted from the nickel column with a high concentration of imidazole buffer, such as Figure 8 The specific steps are as follows: (1) Nickel column binding: Take a well-preserved nickel column, drain the liquid from the column, rinse thoroughly with deionized water, then add his buffer A containing 25 mM imidazole to equilibrate and drain the liquid. Add the filtered ultrasonic supernatant (E2 protein is the supernatant after renaturation), shake on ice for more than 2 hours, and drain the flow-through from the column.

[0071] (2) Washing: Wash three times with his buffer A containing 25 mM imidazole (5-10 column volumes each time), each time for 5-10 min, and place in an ice bath on a shaker to remove impurities.

[0072] (3) Elution: Elute twice with his buffer B containing 250 mM imidazole, 10 minutes each time, and place in a shaker ice bath to elute the target protein.

[0073] (5) SDS-PAGE detection: Take 40 μL of sample, add 10 μL of 5× Loading Buffer, and boil in a boiling water bath for 10 minutes to complete the sample preparation. SDS-PAGE run was used to identify the protein purification status.

[0074] (6) Dialysis: According to the SDS-PAGE results (such as Figure 8 The eluate containing the target protein was placed in a 3.5 kDa dialysis bag and dialyzed in 1× PBS overnight.

[0075] (7) BCA quantitative storage: Concentrate to a concentration of about 1 mg / mL using an ultrafiltration tube, and store in aliquots at -80°C.

[0076] S3, Activation of Streptococcus suis type 2 capsular polysaccharide CDAP is used to activate polysaccharides with hydroxyl groups to form cyanate, which reacts with the amino groups carried by biotin (Biotin-PEG3-NH2) to generate biotinylated polysaccharides. Figure 9 As shown in the figure, a series of new peaks appeared in the polysaccharide after activation. For example, the peak at 2.19 ppm corresponds to the C H 2 NMR signals prove that CDAP is activated and modified successfully.

[0077] The experimental steps are as follows: Reagent preparation (1) Prepare SS2 polysaccharide into a 5 mg / mL solution using 0.15 M sodium chloride.

[0078] (2) Dissolve Amine-PEG3-Biotin in 0.1M HEPES (pH 8) to prepare a solution with a pH of 8.0 and a concentration of 0.1M.

[0079] (3) Prepare a DMAP solution with a pH of 8.0 and a concentration of 2.5 M.

[0080] (4) Prepare a 100 mg / mL acetonitrile solution of CDAP.

[0081] 2. Activation reaction (1) Take 2000 μL of the prepared SS2 polysaccharide solution, add 200 μL of DMAP solution, and adjust the reaction pH to 9.0 ± 0.2 with 0.1 M NaOH. The reaction should be carried out on ice throughout.

[0082] (2) Add 100 μL of CDAP solution to the above reaction solution, adjust the reaction pH to 9.0 ± 0.2 with 0.1 M NaOH, and react on ice for 10-15 minutes.

[0083] (3) Add 19.5 μL of 0.1 M Amine-PEG3-Biotin and check the reaction pH at 8.0-9.0. Stir the reaction at room temperature for 1 hour and then incubate at 4°C overnight.

[0084] (4) Dialysis: Place the reaction solution after overnight reaction in a 100KD dialysis bag and dialyze it twice in 1M NaCl solution for 4 hours each time. Then transfer it to 150mM NaCl solution for dialyze twice for 12 hours each time and dialyze it into pure water twice for 12 hours each time.

[0085] (5) After dialysis, the solution is evaporated to dryness in a rotary evaporator to obtain 15%-25% biotin-modified polysaccharides.

[0086] S4. Preparation of polysaccharide-protein conjugates The freeze-dried activated polysaccharide was dissolved in physiological saline, and the MRP recombinant protein was added multiple times until the polysaccharide and protein were completely bound. After mixing, the mixture was placed on a rotary shaker and reacted at 4°C overnight to complete the preparation of the polysaccharide-protein conjugate.

[0087] S5. Removal of free protein Gel filtration chromatography columns were used to remove unbound free protein from the polysaccharide-protein conjugate CPS2-MRP. The principle is that the protein bound to the polysaccharide is eluted first due to its increased molecular weight, while the free protein enters the gel particles and is eluted later. Samples were collected in Eppendorf tubes, with 500 μL collected per tube. These tubes were labeled and analyzed by SDS-PAGE.

[0088] 5. Determination of free polysaccharide and total sugar content After removing the free protein from the conjugate CPS2-MRP, the protein and total sugar contents in each conjugate were detected by BCA method and phenol-sulfuric acid method, respectively.

[0089] 5.1 Determination of total polysaccharide content The total polysaccharide content in the sample was determined by the phenol-sulfuric acid method.

[0090] 5.2 Determination of free polysaccharide content Add 5% (V / V) 1M HCL solution to the test solution, mix while adding, and let it stand for 15 minutes to precipitate the free carrier protein and bound carrier protein in the solution to obtain free sugars. Then use the phenol-sulfuric acid method to detect the free polysaccharide content. The free polysaccharide content should not be higher than 20% of the total polysaccharide content, that is, the coupling rate of the polysaccharide should be greater than 80%.

[0091] 5.3 Determination of total protein content Detect the total protein content of the sample according to the BCA method 5.4 Determination of free protein content The free protein content was determined by high performance liquid chromatography, and the free protein content should not be higher than 20% of the total protein content.

[0092] S6. Vaccine Preparation Dilute the following antigens in pre-chilled PBS according to the desired ratio. Weigh the aqueous and oily biphasic adjuvant M903 (aqueous phase: oily phase = 45:55 volume ratio) separately and place them in a 250mL glass beaker. Slowly add the aqueous phase to the adjuvant (3 seconds, 5-10 L / min) while stirring at 500-700 rpm and maintaining a temperature of 32-33°C. Stir for 5-10 minutes. After stirring, store the prepared emulsion at a low temperature (<15°C) for 24 hours, avoiding movement and agitation. Vaccine preparation is complete.

[0093] Example 2: Preparation of a conjugate of Streptococcus suis type 2 capsular polysaccharide and CRM197 CRM197 is a non-toxic diphtheria toxin mutant with a molecular weight of 58.4 kDa. In the 20th century, researchers screened numerous diphtheria toxin mutants and found that CRM197, compared to native diphtheria toxin, had a 52nd amino acid substitution from glycine to glutamic acid, losing toxicity while retaining good immunogenicity. It is often used as a carrier protein containing Th epitopes to conjugate with polysaccharide antigens to enhance vaccine immunogenicity. The conjugate was prepared directly using the CDAP activation method. S1. Preparation of Streptococcus suis type 2 capsular polysaccharide, same as step S1 in Example 1 S2, select CRM197; S3. Polysaccharide activation (1) Prepare a 5 mg / mL solution of Streptococcus suis type 2 capsular polysaccharide in 0.15 M sodium chloride.

[0094] (2) Prepare a DMAP solution with a pH of 8.0 and a concentration of 2.5 M.

[0095] (3) Prepare a 100 mg / mL acetonitrile solution of CDAP.

[0096] S4. Coupling reaction (1) Take 2000 μL of the prepared SS2 polysaccharide solution, add 200 μL of DMAP solution, and adjust the reaction pH to 9.0 ± 0.2 with 0.1 M NaOH. The reaction should be carried out on ice throughout.

[0097] (2) Add 100 μL of CDAP solution to the above reaction solution, adjust the reaction pH to 9.0 ± 0.2 with 0.1 M NaOH, and react on ice for 10-15 minutes.

[0098] (3) Add an equal amount of CRM197 protein and adjust the reaction pH to 8.0-9.0. Stir the reaction at room temperature for 1 hour and then place the reaction at 4°C for 30 hours.

[0099] (4) Dialysis: Place the reaction solution after overnight reaction in a 100KD dialysis bag and dialyze it twice in 1M NaCl solution for 4 hours each time. Then transfer it to 150mM NaCl solution for dialyze twice for 12 hours each time and dialyze it into pure water twice for 12 hours each time.

[0100] (5) After dialysis, the solution is evaporated to dryness in a rotary evaporator to obtain the polysaccharide-protein conjugate CPS2-CRM197.

[0101] S5. Removal of free protein and determination of free polysaccharide and total sugar content are the same as step S5 in Example 1 S6. Vaccine preparation is the same as step S6 in Example 1.

[0102] The components and concentrations of the vaccine are shown in Table 2.

[0103] Table 2: Vaccine preparation record Group Polysaccharide content in vaccines Target protein content in the vaccine Total preparation volume CPS2-MRP group 50 μg / mL 47 μg / mL 100mL CPS2-CRM197 group 50 μg / mL 45 μg / mL 100mL CPS2 group 50 μg / mL 0 μg / mL 100mL MRP Group 0 μg / mL 47 μg / mL 100mL Example 3: Protection test of mice against polysaccharide conjugate vaccines prepared with antigens containing different polysaccharide to protein ratios To compare the protective effects of polysaccharide conjugate vaccines prepared with antigens containing different polysaccharide to protein ratios against challenge in mice, we adjusted the amount of Biotin added during the polysaccharide activation phase, controlling the polysaccharide modification ratio between 10% and 30%, and added MRP carrier protein multiple times to maximize protein binding. At this point, the polysaccharide to protein binding ratio was between 1:0.3 and 1:1.2, as shown in Table 3. Each group of antigens was formulated into a polysaccharide conjugate vaccine and mice were immunized. After immunization, mice in each vaccine group and control group were intraperitoneally injected with a minimum lethal dose (MLD) of 6×10 8 The mice in each group were observed for 72 hours after infection with Streptococcus suis serotype 2 strain ZJS02, and the clinical symptoms and deaths of the mice in each group were recorded to draw a survival curve.

[0104] The test results showed that all mice in the PBS control group died during the observation period, and the challenge test was established. Among the several vaccine groups prepared in this laboratory, one group of mice developed clinical symptoms such as depression and erect hair during the observation period, and four mice died, with a survival rate of 60%. The protective effect of one group of vaccines after immunization was poor, while the survival rate of mice in the other vaccine groups was 100%. However, when the Biotin modification ratio was 30%, the protein binding success rate was greatly reduced, the protein feed amount was large, and the free protein content was high, resulting in a large protein loss. Therefore, we controlled the Biotin modification ratio to 15% to 25%. Correspondingly, the optimal binding ratio of polysaccharide to protein was 1:0.5 to 1:1.

[0105] Table 3: Antigen preparation with different polysaccharide to protein binding ratios Group Biotin Modification Ratio Polysaccharide content Protein content Polysaccharide-protein ratio 1 group 10% 1mg / mL 0.31 mg / mL 1:0.3 2 groups 15% 1mg / mL 0.48 mg / mL 1:0.5 3 groups 20% 1mg / mL 0.82 mg / mL 1:0.8 4 groups 25% 1mg / mL 1.11 mg / mL 1:1 5 groups 30% 1mg / mL 1.23 mg / mL 1:1.2 Other tests: 1. Vaccine preparations for immunization of mice and protection against virus infection 1. Experimental Grouping and Immunization Sixty 5-6-week-old female BALB / c mice were randomly divided into six groups, with 10 mice per group. Each group was immunized with the vaccines prepared in the above groups and a commercial vaccine (inactivated suis streptococcal disease vaccine (Streptococcus equi subsp. Zooepidemicus + Streptococcus suis type 2 + Streptococcus suis type 7)). As shown in Table 4, mice in each experimental group were injected with 0.1 mL of the corresponding vaccine via multiple subcutaneous injections at the back. Two weeks after the initial immunization, a second booster immunization was administered using the same route and dose. Following immunization, mice were maintained normally, and the mental state, food and water intake, and changes in the injection site of each group were observed and recorded daily.

[0106] Table 4: Grouping of mouse immunization test

[0107] 2. Elisa to detect the level of polysaccharide antibodies in serum Blood was collected from mice in each group 2, 4, and 6 weeks after the first immunization. After standing at room temperature for 2 hours, the blood was centrifuged at 3000 rpm for 10 minutes to separate the serum, and the levels of polysaccharide IgG and IgM antibodies in the serum were measured.

[0108] The steps of Elisa test are as follows: (1) Coating: Lyophilized CPS2 was diluted to 0.01 mg / mL with 1× PBS, coated with 50 μL per well of the ELISA plate, and incubated in a 4°C refrigerator overnight.

[0109] (2) After washing, wash the membrane three times with 1×PBST at 250 μL / well.

[0110] (3) After the blocking and washing process is complete, add 200 μL of protein blocking solution to each well and incubate at room temperature for 2 hours. Then discard the protein blocking solution to complete the blocking process.

[0111] (4) Sample addition: 100 μL of the mouse serum sample to be tested and the positive and negative controls diluted 1:40 were added to the prepared ELISA plate and incubated at 37°C for 30 min.

[0112] (5) Wash and discard the solution in the ELISA plate, add 300 μL of washing solution to each well and wash repeatedly 5 times.

[0113] (6) After the secondary antibody incubation and washing is completed, add 100 μL of HRP-labeled goat anti-mouse IgG enzyme-labeled secondary antibody diluted at 1:10000 to each well to detect the IgG antibody level; add 100 μL of HRP-labeled goat anti-mouse IgM enzyme-labeled secondary antibody diluted at 1:1000 to each well to detect the IgM antibody level. Incubate at 37°C for 30 minutes.

[0114] (7) Washing: The washing method is the same as (5).

[0115] (8) Color development: Add 100 μL of color development solution to each well and incubate at room temperature in the dark for 10 minutes.

[0116] (9) Stop the color reaction by adding 50 μL of stop solution.

[0117] (10) Set the wavelength of the microplate reader to 450 nm and measure the OD450 nm value of each well within 10 minutes.

[0118] The test results show that ( Figure 12 and Figure 13 The difference between the two polysaccharide conjugate vaccines lies in the carrier protein. Immunization of mice with Streptococcus suis type 2 polysaccharide conjugated to Streptococcus suis MRP protein expressed in our laboratory produced high levels of IgG and IgM antibodies 14 days after vaccination, significantly higher than those produced with the CRM197 protein-conjugated polysaccharide. Immunization with Streptococcus suis type 2 polysaccharide alone, however, showed an increase in IgM antibody levels 21 days after vaccination, but this was significantly different from that seen with the protein-conjugated vaccine. Immunization with the whole-bacterial inactivated vaccine did not produce significant levels of IgG and IgM antibodies against the polysaccharide.

[0119] 3. Elisa to detect the level of MRP protein antibodies in serum The purified MRP recombinant protein was diluted to 0.01 mg / mL with 1× PBS and coated in an ELISA plate at a volume of 50 μL per well. The plate was incubated overnight at 4°C to prepare an MRP protein-coated plate. The Elisa assay procedure was the same as in 5.2. The test results showed ( Figure 14 and Figure 15 : Immunization of mice with Streptococcus suis MRP protein expressed in our laboratory coupled to Streptococcus suis type 2 polysaccharide produced high levels of IgG and IgM antibodies against MRP protein 14 days after immunization, but these levels declined after 28 days. Immunization with the whole-bacterial inactivated vaccine produced lower levels of both antibodies against MRP protein than the coupled protein group. Detection of IgM antibodies showed poor specificity, and the other two groups without MRP protein also showed varying degrees of elevated antibody levels, but the results for the PBS group were consistent.

[0120] 4. Attack protection test Fourteen days after the second immunization, mice in each vaccine group and control group were intraperitoneally injected with a minimum lethal dose (mLD) of 6×108 CFU / mouse Streptococcus suis serotype 2 strain S068 (deposited in China Center for Type Culture Collection on December 6, 2024, with the deposit number CCTCC NO: M20242747 and the classification name Streptococcus suis type 2). After the infection, the mice were observed for 72 hours, the clinical symptoms and deaths of each group of mice were recorded, and the survival curve was drawn.

[0121] The results showed that all mice in the PBS control group died during the observation period, indicating that the challenge test was successful. After simple immunization with Streptococcus suis type 2 polysaccharide CPS2 and Streptococcus suis protein MRP, the survival rates of mice were 30% and 20%, respectively. The survival rate of mice in the CPS2-MRP polysaccharide conjugate vaccine prepared in our laboratory was 100%, the protection rate of mice in the CPS2-CRM197 polysaccharide conjugate vaccine group was 90%, and the survival rate of mice in the commercial inactivated vaccine group was 80% (see Figure 16 The results showed that the polysaccharide conjugate vaccine had a good immune protection effect on mice. The difference between the two vaccines lies in the different carrier proteins, and the mouse survival rate was at least 90%. This shows that the vaccine preparation prepared using Streptococcus suis protein MRP as a carrier protein and the vaccine preparation prepared using the commercial carrier protein CRM197 both have good protection and are superior to the commercial inactivated whole-cell vaccine. Immunization with Streptococcus suis type 2 polysaccharide CPS2 and Streptococcus suis protein MRP alone has some protective effect, but it cannot be used as a vaccine.

[0122] 2. Vaccine preparations for immunization of piglets and protection against virus infection 1. Experimental Grouping and Immunization To verify the protective effect of the prepared Streptococcus suis type 2 polysaccharide conjugate vaccine CPS2-MRP on piglets, we prepared 250 μg / head, 125 μg / head, and 62.5 μg / head vaccines for piglet challenge protection trials. Each group consisted of 4 piglets, and the results were 4 / 4 protection. To explore the minimum immunization dose of the vaccine, we further selected 20 healthy susceptible piglets aged 3 to 4 weeks with negative Streptococcus suis antigen and antibody tests, and randomly divided them into 5 groups of 4 piglets each. They were immunized with different doses of Streptococcus suis type 2 polysaccharide conjugate vaccine and commercial vaccine (inactivated swine streptococcal disease vaccine (Streptococcus equi subsp. zooepidemicus + Streptococcus suis type 2 + Streptococcus suis type 7)). The challenge control group was not immunized, as shown in Table 5.

[0123] Piglets in each experimental group were vaccinated with the corresponding vaccine via intramuscular injection in the neck. Three weeks after the initial vaccination, a second booster vaccination was administered using the same route and dosage. Following vaccination, the piglets were reared normally, and their mental state, food and water intake, and injection site changes were observed and recorded daily.

[0124] Table 5: Grouping of piglet immunization test

[0125] 2. Challenge and Observation: 14 days after the second vaccination, all test pigs were injected with a pathogenic dose of Streptococcus suis type 2 S068 strain via the ear vein. After challenge, they were observed for 14 consecutive days. The body temperature was measured daily. The incidence and mortality of each group within 14 days were recorded. The pigs were autopsied to observe whether there were typical pathological changes such as joint effusion, pericardial effusion, and cerebral congestion. The criteria for judging the protection of piglets from challenge are (1) no symptoms; (2) no clinical symptoms such as joint swelling, lameness, and ataxia, and no post-mortem lesions such as suppurative arthritis and meningitis (brain edema, congestion). If the body temperature rises, it should not exceed 1.5℃ of the basal body temperature. If it exceeds 1.5℃, it should be kept below 2 days. If any of the above two items are met, it will be judged as protected.

[0126] 3. Challenge Test Results: All piglets in the challenge control group developed disease during the observation period, confirming the validity of the challenge test. After immunization with high- and medium-dose Streptococcus suis type 2 polysaccharide conjugate vaccine, the piglets' protection rate against the challenge was at least 75%, compared to 50% for the commercial inactivated vaccine group (see Table 6). These results demonstrate that this polysaccharide conjugate vaccine provides excellent immune protection in piglets, with the minimum immunization dose being 20 μg / pig.

[0127] Table 6: Results of piglet immune challenge experimental group immunity Increased body temperature Clinical symptoms Necropsy lesions determination 1 High-dose polysaccharide conjugate vaccine 0 / 4 1 / 4 0 / 4 3 / 4 protection 2 Medium-dose polysaccharide conjugate vaccine 0 / 4 0 / 4 0 / 4 4 / 4 protection 3 Low-dose polysaccharide conjugate vaccine 1 / 4 2 / 4 0 / 4 2 / 4 protection 4 Blank control group 4 / 4 4 / 4 4 / 4 4 / 4 onset 5 Commercial vaccines 1 / 4 2 / 4 1 / 4 0 / 4 protection 3. Protection test of mice against polysaccharide vaccines prepared with other carrier proteins In order to further expand and screen the carrier protein, we conducted further research on other candidate proteins of Streptococcus suis based on the research on lysozyme-releasing protein (MRP). We prepared the extracellular protein factor EF, hemolysin SLY and surface protein SAO respectively according to the methods of Example 2 and Example 3. The above-mentioned expressed proteins were coupled with Streptococcus suis type 2 polysaccharide (CPS2) using the same method to prepare various polysaccharide conjugate vaccines (the polysaccharide in the vaccine was 50 μg / mL and the target protein was 25-50 μg / mL), and mice were immunized. After immunization, the mice in each vaccine group and the control group were intraperitoneally injected with a minimum lethal dose (MLD) of 6×10 8 The mice in each group were observed for 72 hours after infection with Streptococcus suis serotype 2 strain ZJS02, and the clinical symptoms and deaths of the mice in each group were recorded to draw a survival curve.

[0128] The test results showed that all mice in the PBS control group died during the observation period, indicating that the challenge test was successful. The two polysaccharide conjugate vaccines CPS2-MRP and CPS2-SAO prepared in our laboratory had a 100% protection rate for mice, while the protection rates of CPS2-CRM197 and CPS2-SLY were 90%, and the protection rate of CPS2-EF was 80% (see Figure 17 The results showed that the polysaccharide conjugate vaccine prepared using the above-mentioned Streptococcus suis protein as a carrier protein had a good immune protection effect on mice.

[0129] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A polysaccharide-protein conjugate vaccine for swine streptococcal disease, characterized in that: The vaccine comprises an effective amount of a polysaccharide-protein conjugate formed by coupling a capsular polysaccharide of Streptococcus suis with a recombinant protein and a pharmaceutically acceptable adjuvant; The recombinant protein is obtained by synthesizing a target gene, transforming a plasmid, expressing the protein and purifying the protein through one selected from MRP, SAO, EF, SLY protein and commercial carrier protein CRM197.

2. The polysaccharide-protein conjugate vaccine for swine streptococcal disease according to claim 1, characterized in that: The Streptococcus suis capsular polysaccharide was deposited in the China Center for Type Culture Collection on December 6, 2024, with the collection number CCTCC NO: M20242747. It was obtained by fermentation of a strain classified as Streptococcus suis type 2 and then extraction and purification.

3. The polysaccharide-protein conjugate vaccine for swine streptococcal disease according to claim 2, characterized in that: The molecular weight of the Streptococcus suis capsular polysaccharide is 300-400 KDa.

4. The polysaccharide-protein conjugate vaccine for swine streptococcal disease according to claim 1 or 2, characterized in that: The recombinant protein is selected from the amino acid sequence segment at positions 408-588 of the Streptococcus suis type 2 MRP protein.

5. The polysaccharide-protein conjugate vaccine for swine streptococcal disease according to claim 4, characterized in that: The dosage of the polysaccharide-protein conjugate in the vaccine is 20-250 μg / mL.

6. The polysaccharide-protein conjugate vaccine for swine streptococcal disease according to claim 1, characterized in that: The adjuvant is one or more of an oil-water emulsion, an aqueous adjuvant, and an aluminum salt adjuvant.

7. A method for preparing the polysaccharide-protein conjugate vaccine for swine streptococcal disease according to any one of claims 1 to 6, characterized in that: The following steps are involved: S1: Preparation of Streptococcus suis type 2 capsular polysaccharide; S2: Preparation of recombinant protein; S3: Activate the polysaccharide by CDAP method and connect biotin-PEG3-NH2 to obtain biotinylated polysaccharide; S4: The biotinylated polysaccharide is combined with the recombinant protein of Streptococcus suis type 2 to obtain a polysaccharide-protein conjugate; S5: Remove unbound proteins by gel filtration chromatography to obtain purified polysaccharide-protein conjugates; S6: The aqueous phase and the oil phase containing the purified polysaccharide-protein conjugate are mixed in proportion to form an emulsion, and the emulsion is allowed to stand at a temperature below 15°C to stabilize to obtain a vaccine.

8. The method for preparing the polysaccharide-protein conjugate vaccine for swine streptococcal disease according to claim 7, characterized in that: The recombinant protein is MRP protein, and is obtained by connecting the nucleotide sequence shown in SEQ ID NO.2 to the 3' end of the nucleotide sequence shown in SEQ ID NO.1 with a linker and the nucleotide sequence shown in SEQ ID NO.3 to obtain the target gene, followed by plasmid transformation, protein expression and protein purification.

9. The method for preparing the polysaccharide-protein conjugate vaccine for swine streptococcal disease according to claim 7, characterized in that: After the capsular polysaccharide in the vaccine is activated by the CDAP method, the biotin modification ratio of the polysaccharide is controlled between 15% and 25% by controlling the amount of the biotin modifier Biotin-PEG3-NH2 added.

10. The method for preparing the polysaccharide-protein conjugate vaccine for swine streptococcal disease according to claim 7, characterized in that: In the step S4, the mass ratio of Streptococcus suis type 2 capsular polysaccharide to Streptococcus suis type 2 recombinant protein is 1:1, and the reaction is carried out at 4°C.

11. The method for preparing the polysaccharide-protein conjugate vaccine against swine streptococcal disease according to claim 7, characterized in that: In the S3 step, after the polysaccharide is linked to biotin-PEG3-NH2, it is dialyzed twice in a 100KDa dialysis bag in a 1M NaCl solution for 4 hours each time; then it is dialyzed twice in a 150mM NaCl solution for 12 hours each time; and finally, it is dialyzed twice in pure water for 12 hours each time.

12. Use of the vaccine according to any one of claims 1 to 11 in the treatment, diagnosis and prevention of swine streptococcal disease.

Images