Tuberculosis mRNA vaccine as well as preparation method and application thereof

By preparing an mRNA vaccine with multiple combinations of Mycobacterium tuberculosis antigens, the problem of insufficient protective efficacy of existing vaccines has been solved, achieving effective prevention and treatment of tuberculosis and significantly inhibiting the proliferation of Mycobacterium tuberculosis.

CN121591855APending Publication Date: 2026-03-03BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV +3

Patent Information

Application Number
CN202411119114.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-08-14
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

Existing tuberculosis vaccines, such as BCG, offer limited protection for children and adults and are ineffective in preventing primary infection and the spread of tuberculosis. The protective effect of existing vaccines declines over time, and there is a lack of more effective alternatives.

Method used

A combination of multiple Mycobacterium tuberculosis antigens, including early secretory antigens, PE/PPE family antigens, and latent-associated antigens, was used to prepare an mRNA vaccine, which was delivered via a lipid nanoparticle carrier for the prevention and treatment of tuberculosis.

Benefits of technology

This vaccine can be used both as a preventative vaccine against latent tuberculosis and as a treatment for active tuberculosis, significantly inhibiting Mycobacterium tuberculosis and providing long-lasting protection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004994618270000061
    Figure BDA0004994618270000061
  • Figure BDA0004994618270000062
    Figure BDA0004994618270000062
  • Figure BDA0004994618270000081
    Figure BDA0004994618270000081
Patent Text Reader

Abstract

The invention provides a tuberculosis mRNA vaccine as well as a preparation method and application thereof. The invention firstly provides an antigen, which comprises the following antigen components: at least one fusion protein or chimeric protein formed by mycobacterium tuberculosis early secretion antigens Ag85A and Ag85B and / or immunocompetence fragments thereof, at least one mycobacterium tuberculosis PE / PPE family antigen Rv1759c (PE-PGRS family protein WAG22) or immunocompetence fragments thereof, and at least one immunocompetence fragment thereof, and at least one mycobacterium tuberculosis latent associated antigen Rv1813c or an immunocompetence fragment thereof; selectively, two or more of these antigens or immunocompetent fragments thereof may form a fusion protein and / or chimeric protein as an antigen component. The mRNA vaccine with multiple antigen components has a more effective effect on prevention of tuberculosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a tuberculosis mRNA vaccine, its preparation method and application, and belongs to the field of biopharmaceutical technology. Background Technology

[0002] Tuberculosis (TB) is a chronic infectious disease caused by the Mycobacterium tuberculosis (MTB) complex. It can cause pulmonary tuberculosis or invade other organs such as the liver, kidneys, brain, and lymph nodes, forming extrapulmonary tuberculosis. The main clinical symptoms of pulmonary tuberculosis include cough and sputum production, possibly accompanied by low-grade fever, night sweats, weight loss, and weakness; while the symptoms of extrapulmonary tuberculosis depend on the organ involved.

[0003] Treatment for tuberculosis typically includes symptomatic and specific therapies, primarily anti-tuberculosis drug therapy. For prevention, the mycobacterium tuberculin skin test is an important means of screening for tuberculosis infection, while vaccination is an effective preventative measure.

[0004] To date, Bacillus Calmette-Guerin (BCG) is the only globally approved vaccine for the prevention of tuberculosis. BCG is a live vaccine made from attenuated bovine MTB. It is effective in preventing tuberculous meningitis and miliary tuberculosis in infants and young children, but offers limited protection in children and adults, and its effectiveness decreases over time. Furthermore, BCG is generally considered not to prevent primary infection and has limited effectiveness in preventing the spread of tuberculosis. Other vaccines developed using existing technologies, such as auxotrophic tuberculosis live attenuated vaccines, BCG recombinant vaccines, tuberculosis subunit vaccines, and DNA vaccines, also offer unsatisfactory protective effects. Currently, no new vaccine can completely replace BCG.

[0005] Therefore, it is essential to develop new anti-TB vaccines. Summary of the Invention

[0006] One object of the present invention is to provide a new vaccine for the prevention and treatment of tuberculosis.

[0007] In this invention, multiple antigens are combined to prepare a tuberculosis vaccine.

[0008] On one hand, the present invention provides an antigen (a single antigen molecule, or a composition) comprising the following antigen components:

[0009] At least one early secreted antigen of Mycobacterium tuberculosis or a fragment thereof with immunological activity;

[0010] At least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0011] At least one Mycobacterium tuberculosis latent-associated antigen or its immunologically active fragment;

[0012] Selectively, two or more of the following antigens or their immunoactive fragments may be selected as antigen components: early secreted antigens of Mycobacterium nucleatum or their immunoactive fragments, Mycobacterium tuberculosis PE / PPE family antigens or their immunoactive fragments, and latent-associated antigens of Mycobacterium tuberculosis or their immunoactive fragments.

[0013] According to specific embodiments of the present invention, the antigen of the present invention can be a composition of multiple antigen molecules, or a single molecular form of antigen molecule formed by the fusion and / or chimerism of the multiple antigen components.

[0014] According to a specific embodiment of the present invention, the early secretory antigen of Mycobacterium tuberculosis may be selected from antigens such as Ag85A, Ag85B, ESAT6, EspC (Rv3615c), EsxH (TB10.4), CFP10, or their immunogenic fragments, as well as one or more fusion proteins or chimeric proteins formed by two or more of these antigens or their immunogenic fragments.

[0015] According to a specific embodiment of the present invention, the Mycobacterium tuberculosis PE / PPE family antigen can be selected from antigens such as PPE18, Rv2770c (PPE44), Rv1806 (PE20), Rv3812 (PE_PGRS62), PE63, Rv1759c (PE-PGRS familyprotein WAG22), PPE14, Rv1818c (PE-PGRS33), Rv2608 (PPE42), Rv3872 (PE35), Rv1196 (PPE18) or their immunogenic fragments, as well as one or more of the fusion proteins or chimeric proteins formed by two or more of these antigens or their immunogenic fragments.

[0016] According to a specific embodiment of the present invention, the latent-associated antigen of Mycobacterium tuberculosis may be selected from antigens such as Rv1285(cysD), Rv1813c, Rv2029c, Rv2031c, Rv2624c, Rv2628, Rv2660c, or immunogenic fragments thereof, as well as one or more fusion proteins or chimeric proteins formed by two or more of these antigens or their immunogenic fragments.

[0017] In this invention, a tuberculosis vaccine is prepared by combining multiple antigens. The resulting tuberculosis vaccine can be used both as a preventative vaccine against latent tuberculosis reactivation and as a therapeutic agent for active tuberculosis. In a specific embodiment of this invention, its inhibitory effect on Mycobacterium tuberculosis has been experimentally demonstrated.

[0018] According to a specific embodiment of the present invention, the antigen of the present invention, the early secreted antigen of Mycobacterium tuberculosis includes one or more of the following antigen components: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, and a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof.

[0019] Ag85A and Ag85B: A major component of the secreted proteins in the culture filtrate of Mycobacterium tuberculosis is the Ag85 complex (antigen 85 complex), a protein family with a relative molecular mass of 38,000 composed of Ag85A, Ag85B, and Ag85C. Ag85A, with a full length of 295 amino acids, is a key enzyme in the synthesis of the Mycobacterium tuberculosis cell wall. It is responsible for catalyzing the acyl transfer reaction in the antigen 85 complex, transferring long-chain fatty acid ester groups to the citrus fatty acids in the cell wall. Ag85A can stimulate humoral immunity and also trigger Th1-type cellular immunity, inducing CD8+ T cell proliferation and increases in IL-2 and IFN-γ. Ag85B, a protein with a full length of 285 amino acids and a molecular weight of 34.6 kDa, also known as MPT59 or Rv1886, is a mycobacterial transferase involved in bacterial cell wall synthesis. It has multiple T cell epitopes and can induce Th1 responses and IFN-γ production.

[0020] In some specific embodiments of the present invention, the antigen described in the present invention includes the early secretory antigen of Mycobacterium tuberculosis, which comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B.

[0021] In some specific embodiments of the present invention, the antigen described in the present invention, wherein the early secreted antigen of Mycobacterium tuberculosis has the amino acid sequence shown in SEQ ID NO: 5.

[0022] According to a specific embodiment of the present invention, the antigens described herein include Mycobacterium tuberculosis PE / PPE family antigens, including Rv1759c (PE-PGRS family protein WAG22).

[0023] Rv1759c (PE-PGRS family protein Wag22): In order to design a new vaccine to prevent the reactivation of Mycobacterium tuberculosis, Campuzano J et al. used a B6D2F1 mouse chronic tuberculosis experimental model and observed the continuous expression of Rv1759c on the cell wall of mycobacteria phagocytosed by activated macrophages in pulmonary granulomas. This antigen induced the production of IFN-γ after stimulation, indicating that this antigen may play an important role in maintaining the immune response to latent infection.

[0024] According to a specific embodiment of the present invention, the latent mycobacterium tuberculosis-associated antigens in the antigens described herein include Rv1813c.

[0025] Rv1813c: A protein expressed by MTB under hypoxic conditions and associated with latent bacterial growth. Although Rv1813c is not essential for the survival of Mycobacterium tuberculosis in vitro, the ΔRv1813c mutant of Mycobacterium tuberculosis was attenuated in a low-dose aerosol model of tuberculosis in mice, exhibiting lower bacterial burden, delayed death time, and reduced ability to stimulate the pro-inflammatory cytokines interleukin-1β (IL-1β) and IL-12.

[0026] According to a specific embodiment of the present invention, an antigen (a single antigen molecule or a composition) is provided, comprising the following antigen components:

[0027] At least one early secreted antigen of Mycobacterium tuberculosis or an immunologically active fragment thereof; the early secreted antigen of Mycobacterium tuberculosis includes one or more of the following antigens: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, and a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof.

[0028] At least one Mycobacterium tuberculosis PE / PPE family antigen Rv1759c (PE-PGRS family protein WAG22) or an immunologically active fragment thereof; and

[0029] At least one Mycobacterium tuberculosis latent-associated antigen Rv1813c or an immunologically active fragment thereof;

[0030] Selectively, two or more of the following antigens or their immunoactive fragments may be selected as antigenic components: early secreted antigen of Mycobacterium tuberculosis or its immunoactive fragments, Mycobacterium tuberculosis PE / PPE family antigen or its immunoactive fragments, and latent related antigen of Mycobacterium tuberculosis or its immunoactive fragments.

[0031] Preferably, the early secretory antigen of Mycobacterium tuberculosis comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B. More preferably, the early secretory antigen of Mycobacterium tuberculosis has the amino acid sequence shown in SEQ ID NO: 5.

[0032] On the other hand, the present invention also provides a nucleic acid molecule that can encode the antigen described in the present invention.

[0033] According to specific embodiments of the present invention, the nucleic acid molecule of the present invention can be a composition of multiple nucleic acid molecules, or it can be a single molecular form of a nucleic acid molecule that can encode the multiple antigen components.

[0034] According to a specific embodiment of the present invention, the nucleic acid molecule of the present invention comprises:

[0035] A nucleic acid molecule encoding at least one early secreted antigen of Mycobacterium tuberculosis or a fragment of its immunologically active form;

[0036] A nucleic acid molecule encoding at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0037] A nucleic acid molecule that encodes at least one latent-associated antigen of Mycobacterium tuberculosis or a fragment thereof that has immunological activity.

[0038] According to a specific embodiment of the present invention, when the antigen of the present invention includes fusion protein and / or chimeric protein antigen components, the nucleic acid molecule of the present invention includes a nucleic acid molecule encoding these fusion protein and / or chimeric protein antigen components.

[0039] According to a specific embodiment of the present invention, the nucleic acid molecule of the present invention can be DNA or RNA.

[0040] On the other hand, the present invention also provides an mRNA comprising an mRNA molecule encoding the antigen described herein. The mRNA of the present invention can be used to prepare a Mycobacterium tuberculosis mRNA vaccine.

[0041] According to a specific embodiment of the present invention, the mRNA of the present invention can be a composition of multiple mRNA molecules, or it can be a single molecular form of mRNA molecule that can encode the multiple antigen components.

[0042] According to a specific embodiment of the present invention, the mRNA of the present invention comprises:

[0043] mRNA molecules encoding at least one early secreted antigen of Mycobacterium tuberculosis or a fragment of its immunologically active form;

[0044] mRNA molecules encoding at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0045] mRNA molecules encoding at least one Mycobacterium tuberculosis latent-associated antigen or its immunologically active fragment.

[0046] According to a specific embodiment of the present invention, when the antigen of the present invention comprises fusion protein and / or chimeric protein antigen components, the mRNA of the present invention comprises mRNA encoding these fusion protein and / or chimeric protein antigen components.

[0047] In some specific embodiments of the present invention, the antigen described herein includes a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B, and the mRNA of the present invention includes mRNA encoding this chimeric protein. In some more specific embodiments, the chimeric protein formed by the fragment of Ag85A and the fragment of Ag85B has the amino acid sequence shown in SEQ ID NO: 5, and the mRNA of the present invention includes an mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 5. In some specific embodiments of the present invention, the coding region sequence of the mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 5 is shown in SEQ ID NO: 6, that is, the coding region sequence of the mRNA molecule encoding the early secretory antigen of Mycobacterium tuberculosis is shown in SEQ ID NO: 6.

[0048] In some specific embodiments of the present invention, the antigen described herein includes Mycobacterium tuberculosis PE / PPE family antigen Rv1759c, and the mRNA of the present invention includes mRNA encoding Rv1759c. In some more specific embodiments, Rv1759c has the amino acid sequence shown in SEQ ID NO: 15, and the mRNA of the present invention includes an mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 15. In some specific embodiments of the present invention, the coding region sequence of the mRNA molecule encoding Rv1759c is shown in SEQ ID NO: 16.

[0049] In some specific embodiments of the present invention, the antigen described herein includes Mycobacterium tuberculosis latent-associated antigen Rv1813c, and the mRNA of the present invention includes mRNA encoding Rv1813c. In some more specific embodiments, Rv1813c has the amino acid sequence shown in SEQ ID NO: 7, and the mRNA of the present invention includes an mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 7. In some specific embodiments of the present invention, the coding region sequence of the mRNA molecule encoding Rv1813c is shown in SEQ ID NO: 8.

[0050] According to a specific embodiment of the present invention, the mRNA molecule of the present invention has any one or more of the following modifications:

[0051] Modified with 1-methylpseuuridine;

[0052] Modified by adding a 3' tail (e.g., a PloyA tail sequence);

[0053] It is modified with at least one 5' cap;

[0054] Includes at least one 5'UTR sequence;

[0055] It includes at least one 3'UTR sequence.

[0056] In some specific embodiments of the present invention, the 5' cap modification in the mRNA of the present invention is selected from one of m7G, Cap0, Cap1, Cap2, modified Cap0, modified Cap1, and modified Cap2 structures. More specifically, it can be any of Cap0, Cap1, Cap2, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-denitro-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, or any of the 5' cap structures mentioned in patent applications CN202310091020.3 and CN202310391954.9. The entire contents of CN202310091020.3 and CN202310391954.9 are incorporated herein by reference.

[0057] In some specific embodiments of the present invention, the PolyA tail sequence can be any of the PolyA tails mentioned in patent applications WO2024041641A1 and CN202311309226.5. The entire contents of WO2024041641A1 and CN202311309226.5 are incorporated herein by reference.

[0058] The mRNA of the present invention can be used to prepare vaccines in lipid nanoparticle formulations. Therefore, in another aspect, the present invention also provides lipid nanoparticles loaded with the mRNA described herein.

[0059] On the other hand, the present invention also provides a pharmaceutical composition comprising: the mRNA described in the present invention, and a pharmaceutically acceptable excipient.

[0060] On the other hand, the present invention also provides the use of the mRNA, the lipid nanoparticles, or the pharmaceutical composition in the preparation of a tuberculosis mRNA vaccine.

[0061] On the other hand, the present invention also provides a tuberculosis mRNA vaccine comprising the mRNA described in the present invention.

[0062] In some specific embodiments of the present invention, the vaccine of the present invention is a lipid nanoparticle formulation.

[0063] In some more specific embodiments of the present invention, the lipid nanoparticles include mRNA and lipid LNPs, wherein the lipid LNPs include one or more of cationic lipids, supporting lipids, sterols, and polymer-conjugated lipids.

[0064] According to a specific embodiment of the present invention, the cationic lipid includes one or more of the following: methyl 4-(N,N-dimethylamino)butyrate (DLin-MC3-DMA), ((4-hydroxybutyl)azadiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decoxy)hexyl)amino)octanoate (SM-102), 8-((7-((3-(hexylthio)-2-methylpropionyl)oxo)n-heptyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanoate (T19), and 8-((5-(((3-(octylthio)-2-methylpropionyl)oxo)n-pentyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanoate (T13).

[0065] According to a specific embodiment of the present invention, the structural formula of T19 is:

[0066]

[0067] According to a specific embodiment of the present invention, the structural formula of T13 is:

[0068]

[0069] According to a specific embodiment of the present invention, the polymer-conjugated lipid includes one or more of PEG-DMG, ALC0159, PEG-DSPE, and PEG-DSG.

[0070] According to a specific embodiment of the present invention, the supporting phospholipid includes one or more of DSPC, DOPE, DOPC, and DOPS.

[0071] According to a specific embodiment of the present invention, the sterols include one or more of cholesterol and β-sitosterol.

[0072] According to a specific embodiment of the present invention, in the lipid LNP, based on the total molar amount of lipids as 100%, the molar ratio of each lipid component is as follows: cationic lipids 35%-57.5%, supported lipids 0%-16% or 5%-16%, sterols 27.5%-55%, and polymer-conjugated lipids 0-3%, preferably 0.5%-2.5%.

[0073] According to a specific embodiment of the present invention, the mRNA vaccine further includes excipients. The excipients used may be, for example, an aqueous solution of salt and sugar. Preferably, the salt is selected from one or more of citrate, acetate, phosphate, or Tris salt; and the sugar is selected from one or more of sucrose and trehalose.

[0074] On the other hand, the present invention also provides a method for preparing the tuberculosis mRNA vaccine, comprising:

[0075] Each mRNA molecule described in this invention is separately formulated into lipid nanoparticles, and then multiple lipid nanoparticles are mixed together; or

[0076] Multiple mRNA molecules in the mRNA described in this invention are mixed into a mixture, and then the mRNA mixture is made into lipid nanoparticles.

[0077] The method for preparing the tuberculosis mRNA vaccine may further include: mixing the lipid nanoparticles with excipients to prepare the vaccine product.

[0078] In some specific embodiments of the present invention, the vaccine dosage form of the present invention is a freeze-dried dosage form or a frozen dosage form.

[0079] In some specific embodiments of the present invention, the vaccine of the present invention is an intramuscular injection vaccine.

[0080] In some specific embodiments of the present invention, the vaccine described herein is a preventive and / or therapeutic tuberculosis vaccine targeting the spleen and / or lungs.

[0081] The tuberculosis vaccine of the present invention can be used as a preventive vaccine against latent activation, and also as a therapeutic drug for treating active tuberculosis. It has a significant inhibitory effect on Mycobacterium tuberculosis. Attached Figure Description

[0082] Figure 1 This is an electrophoretic detection image of partially synthesized antigen mRNA in an embodiment of the present invention.

[0083] Figure 2 This is an electrophoretic detection image of partially synthesized antigen mRNA in an embodiment of the present invention.

[0084] Figure 3This is an electrophoretic detection image of partially synthesized antigen mRNA in an embodiment of the present invention.

[0085] Figure 4 This shows the results of qualitative detection of relevant antigen expression using Western blotting.

[0086] Figure 5 This shows the results of indirect method for detecting the expression of related antigens.

[0087] Figure 6 This shows the results of an in vitro inhibition test of the vaccine against Mycobacterium tuberculosis according to a specific embodiment of the present invention.

[0088] Figure 7 This shows the challenge test results of the vaccine according to a specific embodiment of the present invention. Detailed Implementation

[0089] To provide a clearer understanding of the technical features, objectives, and beneficial effects of this invention, the technical solution of this invention is described in detail below, but this should not be construed as limiting the scope of implementation of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention. Experimental methods in each embodiment that do not specify specific conditions are operated according to conventional conditions in the relevant field. All starting reagents and materials used in the embodiments are commercially available or prepared with reference to existing techniques in the art.

[0090] Example 1

[0091] In this embodiment, a variety of antigen combinations were designed, as shown in Table 1.

[0092] Table 1: Antigen Combinations

[0093] Antigen combination 1 Ag85ab+Rv1813c+Rv1759c Antigen combination 2 Ag85ab+Rv2029c+Rv3872 Antigen combination 3 Ag85ab+Rv2029c+Rv1759c Antigen combination 4 Ag85ab+Rv2031c+Rv3872 Antigen combination 5 Ag85ab+Rv2031c+Rv1759c Antigen combination 6 Ag85ab+Rv2031c+Rv2770c

[0094] The amino acid sequences and corresponding mRNA sequences of the antigens used in this embodiment are shown in Table 2.

[0095] Table 2: Amino acid sequence and mRNA sequence of the antigen

[0096]

[0097]

[0098] Rv2029c: Responding to hypoxia, low NO and CO levels, it was found to possess a phosphofructokinase-like domain, which may play a role in Mtb's utilization of fructose.

[0099] Rv3872(PE35): The PE35(Rv3872) gene of Mycobacterium tuberculosis is located in the differential region (RD), which is absent in all Mycobacterium bovis vaccine strains. Hanif SN et al. cloned the PE35 antigen encoded by the gene using the pUMCV6 DNA vaccine vector, which induced antigen-specific Th-1 responses (antigen-induced cell proliferation and IFN-γ secretion), but lacked Th-2 responses (IL-5 secretion) and anti-inflammatory responses (IL-10 secretion). Furthermore, multiple epitopes of PE35 induced cellular responses.

[0100] Rv2770c (PPE44) is a predicted virulence factor upregulated in the lungs of infected guinea pigs. Yu Z et al. heterologously expressed PPE44 in a non-pathogenic, rapidly growing strain of *Mycobacterium smegmatis*. Subcellular localization analysis indicated that Rv2770c is a cell wall-associated protein, suggesting it may be a candidate protein involved in host-pathogen interactions. Rv2770c also enhanced the survival rate of *Mycobacterium smegmatis* within macrophages. Romano M et al. immunized mice with a plasmid DNA vaccine encoding PPE44 or a recombinant PPE44 protein formulated with adjuvants, generating strong cellular and humoral immune responses. PPE44-based subunit vaccines provide protection against intracellular challenge by highly virulent *Mycobacterium tuberculosis*, with efficacy comparable to BCG.

[0101] Rv2031c is a dormant regulatory gene of Mycobacterium tuberculosis (MTB), which primarily expresses α-crystallin (HspX) during the latent phase and participates in general cellular stress responses. It can regulate the metabolism of Mycobacterium tuberculosis within host cells and is important for its survival during the latent phase. Depletion of this protein worsens the tolerance of Mycobacterium tuberculosis to anaerobic bacteria. Therefore, it is considered a potential candidate drug to promote the survival of pathogens during hypoxia, a condition similar to the latent phase. Furthermore, its role in impairing the immune response by blocking the differentiation of monocytes into dendritic cells has recently been demonstrated.

[0102] Sequence optimization

[0103] In this invention, a highly stable and highly expressed mRNA sequence is designed based on the amino acid sequence of the above antigen through sequence optimization.

[0104] All mRNA sequence design metrics were within acceptable limits, with a low number of unpaired bases and a high CAI value, meeting the design principles of high stability and high expression.

[0105] mRNA synthesis

[0106] The sequence-optimized gene was constructed into a universal mRNA vector. Template DNA was prepared by PCR for mRNA transcription. mRNA was synthesized using a Cap1 cap analog, N1-methylpseudouracil, and a 120nt Poly A tail (each mRNA was 100% m1ψ modified, the 5' cap structure was m7G(5')ppp(5')(2'OMeA)pG, the 5' UTR sequence was GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC (SEQ ID NO: 47), the 3' UTR sequence was GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATG CCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGG AAG (SEQ ID NO: 48), and the Poly A tail sequence was a 120nt A) to verify the expression of the relevant antigen.

[0107] The purified mRNAs were then analyzed by electrophoresis, such as... Figures 1-3 As shown. Among them. Figure 1 Lanes 1-11 of the middle swimming pool contain Rv2031c, Rv2029c, Rv2628, Rv2660c, Rv1813c, Rv2624c, Rv1285, M72, Ag85A, Ag85B, and IFN-γ, respectively. Their sizes are close to the theoretical values, and the bands are single. Figure 2 The bands in lanes 1-6 of the middle swimming pool are Ag85A, Ag85B, Rv1196, ESAT6, Rv2660c, and CFP10, respectively. Their sizes are close to the theoretical values, and the bands are single. Figure 3 The middle lanes 1-9 are Rv0915c, Rv0934, Rv1759c, Rv1806, Rv2351c, Rv2770c, Rv2941, Rv3812, and Rv3872, respectively. Their sizes are close to the theoretical values, and the bands are single.

[0108] Expression Validation

[0109] mRNA was transfected into 293T / 17 cells with a confluence of over 70%, and Western blot analysis was performed 48 hours after transfection. The antigen expression was qualitatively detected using Western blot (e.g., in antigen expression experiments). Figure 4Some small proteins (<20kDa) were not detected by Western blot. Rv2624c, Ag85A, Rv1285, Rv1196, Rv2029c, Rv2031c, and Rv1813c were all detected by antigen expression, and their protein sizes were consistent with theoretical values. However, Rv2628 and Rv2660c were not detected by Western blot.

[0110] Because Western blotting (WB) is challenging for detecting low molecular weight proteins, an indirect ELISA method was used for qualitative protein detection. Intracellular proteins (undiluted, 2-fold dilution, and 4-fold dilution) were collected 48 hours after cell transfection for ELISA analysis. The sample coating order was Rv2628, Rv2660c, ESAT6, TB10.4, and Control. Based on the OD values ​​measured by the microplate reader in the table above, a bar chart was plotted using the OD values ​​at undiluted (e.g., ...). Figure 5 The OD values ​​were all higher than those of the blank control, indicating that each mRNA was expressed at different levels.

[0111] vaccine preparation

[0112] Since TB vaccines primarily rely on CD4+ cell-mediated immunity, this project utilizes the LNP vector T19-5, which exhibits strong spleen-targeting and cellular immune response, to prepare lipid nanoparticles containing mRNA (mRNA-LNP). The main quality control parameters are encapsulation efficiency >90% and particle size 100-120 nm. The LNP vector T19-5 has a composition of T19:DSPC:PEG-DMG:CHOL in a mass ratio of 48:16:1.5:34.5. T19, DSPC, PEG-DMG, and CHOL are dissolved in anhydrous ethanol to prepare organic phase A (average lipid concentration 10 mg / ml). The mRNA to be carried is dissolved in citrate / sodium citrate buffer at pH 4.0 to prepare aqueous phase B (mRNA concentration 0.54 mg / ml). The solutions are then mixed using a microfluidic apparatus at a volume ratio of 1:3 (solution A:solution B) to form the mRNA-LNP. After preparation, the solution was dialyzed in 20 mM Tris buffer for 24 h, with the buffer changed every 8 h. After 24 h, the solution was sterilized by passing it through a 0.22 μm filter membrane to obtain the mRNA-LNP vaccine product.

[0113] In this embodiment, the parameters of the mRNA-LNPs carrying mRNAs encoding each antigen are shown in Table 3. Each mRNA-LNP encodes a single-component antigen.

[0114] Table 3

[0115]

[0116] The particle size, PDI, and site encapsulation efficiency of each mRNA-LNP were all within the quality standard range.

[0117] BCG suspension preparation: Scrape the BCG colonies from the upper layer of Roche medium and add them to a sterile flask containing 1 mL of sterile 1×PBS. Shake thoroughly and let stand for 15 minutes. Aspirate the upper bacterial suspension into a 15 mL sterile centrifuge tube and measure the OD. 600 (0.3 = 10) 7 CFU), dilute the bacterial solution to 10 6 CFU / 100μL / mice, awaiting subcutaneous immunization.

[0118] Animal Immunization

[0119] The mRNA vaccines corresponding to the antigens / antigen combinations (i.e., antigens with multiple components) in each experiment were administered to animals in batches. Each group consisted of 5 C57 mice. Each mouse required a vaccine dose of 5 μg for each antigen for each immunization. Except for the BCG group, which received 100 μL of subcutaneous immunization, the other 9 groups received 50 μL of intramuscular injection per mouse, with two immunizations administered 14 days apart.

[0120] After blood collection, the spleen of the mice was isolated by soaking in 75% alcohol and placed in a 2mL EP tube (pre-cooled on ice with 1500μL of 1640 medium containing penicillin and antibiotics added).

[0121] Spleens were immersed in mouse lymphocyte separation medium (Dacowed). Splenic lymphocytes were isolated by grinding the spleen using a 75μm filter (Falcon) and syringe core, following the manufacturer's instructions. The isolated splenic lymphocyte clusters were resuspended in 1 mL of erythrocyte lysis buffer, lysed for 2-3 min, and then centrifuged at 1000×g for 5 min after adding 2 mL of 1×PBS to stop lysing. The cells were then rinsed with RPMI 1640 complete medium (antibiotic-free, 1× non-essential amino acids, 10 mM Hepes, 1 mM sodium pyruvate, 5×10⁻⁶ ppm) -5 Resuspend and count the M 2-mercaptoethanol, adjusting the result to 1×10⁻⁶. 7 Cells / mL, keep at 4℃ (add 100μL / well to BMDM after Mtb infection and incubate with supplemental medium to 1mL), and freeze the remaining spleen cells.

[0122] MGIA Experiment

[0123] Immortal BMDM paving:

[0124] The immortal BMDM system is divided into 2×10 6Cells / Wells were seeded into 24-well plates one day in advance, and RPMI 1640 complete medium (without antibiotics) was added. Each sample was set up in duplicate. A total of 50 mice were euthanized, resulting in 50 samples and 100-well cells per group, which were seeded into two different 24-well plates.

[0125] Evaluation of protective effect (MGIA experiment - co-culture):

[0126] Pre-spread BMDM cells were infected with Mtb at an MOI of 5 (simultaneously with the necropsy of mice). Four hours later, the cells were washed twice with 1× sterile PBS (to remove adhering cell surfaces and extracellular bacteria). 10 6 Cells / 100μL / Wells immunized mouse SMCs (antibiotic-free, 1× non-essential amino acids, 10mM Hepes, 1mM sodium pyruvate, 5×10 -5 M 2-mercaptoethanol) was added to 1 mL, and the mixture was incubated for 96 hours. 500 μL of culture medium was added after 48 hours. 2 mg / mL 2-thiophenecarboxylicacid hydride was added to the BCG group (inhibiting the proliferation of BCG in spleen cells, with no effect on Mtb).

[0127] Evaluation of protective effect (MGIA test - coated CFU):

[0128] Observe the wells and duplicate wells for contamination, and select an uncontaminated well for lysis. Transfer the cell culture to an EP tube (freeze for future cytokine detection), wash with 500 μL sterile 1×PBS, add 500 μL sterile 0.05% SDS for lysis for 2-3 min, and serially dilute with sterile 1×PBS to a final volume of 10. -2 Sterile spread beads were evenly spread onto 7H10 (containing OADC), with 3 replicates for each concentration (6 × 48 Samples = 288 plates per day), and incubated at 37°C for 4 weeks (during which contamination and CFU growth were observed).

[0129] In this embodiment, after co-incubating spleen cell lysate with MTB-infected immortalized line BMDM for 4 days, the solution was diluted 100-fold and evenly spread on 7H10 (containing OADC), and cultured at 37°C for 4 weeks. CFU growth was then recorded as follows: Figure 6 As shown in the figure. The results indicate that Ag85a+Ag85b, Rv3615c, Rv2031c, Rv2029c, Rv1813c, Rv3872, Rv1759c, and Rv2770c in the experimental group have good immunogenicity when used as antigens, and can effectively inhibit the proliferation of Mycobacterium tuberculosis after immunization of mice.

[0130] Virus challenge experiment

[0131] Mice were immunized twice via intramuscular injection, two weeks apart, with doses of 5 μg (mRNA) and 100 μg (protein). BCG vaccine (1 dose, 10...) 3 CFU was administered intradermally as a positive control. The negative control group received an equal volume of physiological saline. Two weeks after the second immunization, the H37Rv strain was introduced via aerosol, delivering 20-50 bacteria into the lungs. All surviving animals were euthanized four weeks later. During necropsy, all lung lobes were removed from the thoracic cavity for individual manipulation. The right lung homogenate, serially diluted 10-fold, was then serially diluted to 10-fold with sterile 1×PBS. -2 -10 -3 Sterile spreaders were evenly applied to 7H10 (containing OADC) plates, with three replicates for each concentration. After incubation at 37°C in 5% CO2 for 21 days, colony formation was counted. Colony counts were statistically calculated, and data are expressed as log10 of the average recovered bacterial count.

[0132] See the results of the challenge experiment. Figure 7 The results showed that Ag85ab+Rv1813c+Rv1759c exhibited a significant protective effect, significantly reducing the Mycobacterium tuberculosis load in the lungs and spleen of mice to below the detection limit, which was significantly better than BCG vaccine.

[0133] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. An antigen comprising the following antigenic components: At least one early secreted antigen of Mycobacterium tuberculosis or an immunologically active fragment thereof; the early secreted antigen of Mycobacterium tuberculosis includes one or more of the following antigens: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, and a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof. At least one Mycobacterium tuberculosis PE / PPE family antigen Rv1759c (PE-PGRS family protein WAG22) or an immunologically active fragment thereof; and At least one Mycobacterium tuberculosis latent-associated antigen Rv1813c or an immunologically active fragment thereof; in, Selectively, two or more of the following antigens, namely Mycobacterium tuberculosis early secretory antigen or its immunoactive fragments, Mycobacterium tuberculosis PE / PPE family antigen or its immunoactive fragments, and Mycobacterium tuberculosis latent related antigen or its immunoactive fragments, may form fusion proteins and / or chimeric proteins as antigen components.

2. The antigen according to claim 1, wherein: The early secreted antigen of Mycobacterium tuberculosis comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B; preferably, the early secreted antigen of Mycobacterium tuberculosis has an amino acid sequence as shown in SEQ ID NO:

5.

3. A nucleic acid molecule that encodes the antigen as described in claim 1 or 2.

4. An mRNA comprising an mRNA molecule encoding the antigen of claim 1 or 2.

5. The mRNA according to claim 4, wherein: The coding region sequence of the mRNA molecule encoding the early secretory antigen of Mycobacterium tuberculosis is shown in SEQ ID NO: 6; The coding region sequence of the mRNA molecule encoding Rv1759c is shown in SEQ ID NO: 16; The coding region sequence of the mRNA molecule encoding Rv1813c is shown in SEQ ID NO:

8.

6. The mRNA according to claim 4 or 5, wherein, The mRNA molecule has one or more of the following modifications: Modified with 1-methylpseuuridine; Modified by adding a 3' tail (e.g., a PloyA tail sequence); It is modified with at least one 5' cap; Includes at least one 5'UTR sequence; It includes at least one 3'UTR sequence.

7. A lipid nanoparticle loaded with the mRNA according to any one of claims 4 to 6.

8. A pharmaceutical composition comprising: mRNA as described in any one of claims 4 to 6, and a pharmaceutically acceptable excipient.

9. The use of the mRNA of any one of claims 4 to 6, the lipid nanoparticles of claim 7, or the pharmaceutical composition of claim 8 in the preparation of a tuberculosis mRNA vaccine.

10. A tuberculosis mRNA vaccine comprising the mRNA according to any one of claims 4 to 6; Preferably, the vaccine is a lipid nanoparticle formulation; Preferably, the vaccine formulation is a freeze-dried formulation or a frozen formulation; Preferably, the vaccine is an intramuscular injection vaccine.

11. The mRNA vaccine according to claim 10, wherein, The lipid nanoparticles comprise mRNA and lipid LNPs, wherein: The lipid LNP includes one or more of cationic lipids, supported lipids, sterols, and polymer-conjugated lipids; Preferably, the cationic lipid comprises one or more of the following: 4-(N,N-dimethylamino)butyrate (dilinyl)methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl)azadiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decoxy)hexyl)amino)octanoate (SM-102), 8-((7-((3-(hexylthio)-2-methylpropionyl)oxo)n-heptyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanoate (T19), and 8-((5-((3-(octylthio)-2-methylpropionyl)oxo)n-pentyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanoate (T13); Preferably, the polymer-conjugated lipid comprises one or more of PEG-DMG, ALC0159, PEG-DSPE, and PEG-DSG; Preferably, the supporting phospholipids include one or more of DSPC, DOPE, DOPC, and DOPS; Preferably, the sterols include one or more of cholesterol and β-sitosterol; Preferably, based on the total molar amount of lipids as 100%, the molar ratio of each lipid component is as follows: cationic lipids 35%-57.5%, supported lipids 0%-16%, sterols 27.5%-55%, and polymer-conjugated lipids 0-3%, preferably 0.5%-2.5%. Preferably, the mRNA vaccine further includes excipients; the excipients may be, for example, an aqueous solution of salt and sugar; more preferably, the salt is selected from one or more of citrate, acetate, phosphate or Tris salt; and the sugar is selected from one or more of sucrose and trehalose. Preferably, the vaccine is a preventive and / or therapeutic tuberculosis vaccine targeting the spleen and / or lungs.

Citation Information

Patent Citations

  • Compound for capping 5'end of nucleic acid and application of compound

    CN118373866A

  • A halogenated compound for 5' end capping of nucleic acids and its applications

    CN118772219B

  • Polyelement polyA polynucleotide for improving mRNA stability and protein expression and application thereof

    CN119799695A

  • Multi-fragmented polya polynucleotide stably existing in host cell and use thereof

    WO2024041641A1

Cited By

  • MRNA (messenger ribonucleic acid) pharmaceutical composition for preventing and treating tuberculosis and application thereof

    CN121513181A