RNA degradation analysis method

The combination of a single-strand specific exoribonuclease with a probe in the RNA analysis method addresses the sensitivity issues of existing techniques, enabling precise RNA degradation detection by minimizing background noise and improving sensitivity.

JP2025520907APending Publication Date: 2025-07-03SINTEF TTO AS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024577388
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-01
Filing Date
2023-06-30
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Existing methods for analyzing RNA degradation, such as capillary gel electrophoresis, are not sensitive enough to accurately measure the degradation of large RNA molecules, particularly when they are hydrolyzed into small fragments, and do not account for background noise from exoribonuclease activity on intact RNA ends.

Method used

A method using a single-strand specific exoribonuclease in combination with a probe that binds to a target region of ssRNA, preventing exoribonuclease degradation of intact RNA and allowing detection of nucleotides and nucleosides generated from degraded regions, thereby enhancing sensitivity.

Benefits of technology

The method can detect low levels of RNA degradation as low as 0.1% and provides a more accurate measurement of RNA integrity by reducing background noise, making it more sensitive than traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025520907000001_ABST
    Figure 2025520907000001_ABST
Patent Text Reader

Abstract

The present invention generally relates to methods for analyzing ribonucleic acid (RNA). In particular, the present invention relates to an RNA analysis method for evaluating the degradation level of RNA molecules in an RNA sample. The method uses an exonuclease and a means for detecting nucleotides and / or nucleosides. The present invention provides a method for analyzing ssRNA in a sample, the method comprising: (a) contacting the sample with a probe, wherein the probe binds to a target region of the ssRNA in the sample; (b) incubating the sample with a single-strand specific exoribonuclease; and (c) detecting the nucleotides and / or nucleosides generated by step (b), wherein the nucleotides and / or nucleosides are derived from one or more RNA regions located outside the target region of the ssRNA in the sample. The present invention also provides a kit for carrying out the above method.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention generally relates to methods for analyzing ribonucleic acid (RNA). In particular, the present invention relates to an RNA analysis method for evaluating the degradation level of RNA molecules in an RNA sample. This method uses an exonuclease and a means for detecting nucleotides and / or nucleosides.

[0002] RNA is a macromolecular molecule essential for various biological roles, including gene expression. Therefore, it is highly desirable for biochemists to be able to analyze specific RNA molecules of interest, and for medical practitioners to be able to use RNA molecules in RNA therapy, such as microRNA (miRNA) and messenger RNA (mRNA).

[0003] However, since RNA is relatively unstable, RNA samples must be handled with care to be stored at low temperatures, avoid contamination with RNase, avoid shear stress, and minimize hydrolysis. Even with such measures taken, when the RNA sample is thawed and used, a certain level of RNA degradation occurs, so the concentration of the target RNA molecule (i.e., an intact and functional RNA molecule) is lower than the initially recorded concentration. Therefore, it is important to know the absolute and / or relative concentration of the intact RNA molecule of interest in the sample when using the sample.

[0004] To avoid overestimating the concentration of intact RNA molecules of interest in a sample, it is desirable to measure the level of RNA degradation that has occurred. In the industry, the capillary gel electrophoresis platform is sometimes used to measure the degradation level of RNA samples. However, such platforms are not designed to analyze synthetic RNA and have low sensitivity. For example, the measurement of the integrity of RNA molecules based on size differences is particularly difficult for large RNA molecules because when large RNA molecules are hydrolyzed into small RNA fragments, degradation products that are very close to the size of the parental RNA and / or the charge-to-size ratio are obtained. Therefore, a more sensitive method for quantifying RNA degradation in RNA samples is needed.

[0005] The inventors have developed a highly sensitive method for measuring RNA degradation. Specifically, the present invention provides a method for analyzing (or evaluating) single-stranded RNA (ssRNA) in a sample, the method comprising: (a) contacting the sample with a probe, wherein the probe binds to a target region of ssRNA in the sample; (b) incubating the sample with a single-strand specific exoribonuclease; and (c) detecting the nucleotides and / or nucleosides generated by step (b), wherein the nucleotides and / or nucleosides include nucleotides and / or nucleosides from one or more RNA regions located outside the target region of ssRNA in the sample.

[0006] The method of the present invention is based on the use of a single-strand specific exoribonuclease in combination with a probe, and the probe serves to block the degradation of the target site of ssRNA by the exoribonuclease.

[0007] The ssRNA in the sample is degraded over time (enzymatically, chemically, or otherwise), and the 3´ and 5´ ends continue to increase. The more 3´ and 5´ ends that can be cleaved by exoribonucleases, the more nucleotides and / or nucleosides are released by the action of exoribonucleases on the sample. Thus, the levels of nucleotides and / or nucleosides generated by incubating the ssRNA sample with exoribonucleases can be used to determine the level of degradation of ssRNA in the sample (see Figure 10).

[0008] However, it has been found that simply incubating ssRNA with exoribonucleases is insufficient to accurately determine the level of degradation. This is because incubation with exoribonucleases releases a significant amount of nucleotides and / or nucleosides regardless of the extent of degradation of ssRNA in the sample. Specifically, these cleavage products are derived from the cleavage of free ends (3´ and / or 5´ ends, depending on the directionality of the exoribonuclease used in that manner) present in the intact version of the ssRNA molecules in the sample. Thus, when exoribonucleases are used alone, a significant level of background signal (or "noise") will always occur.

[0009] The addition of a probe that binds to the ends of the ssRNA molecules in the sample (more specifically, a probe that binds to the 3´ end of the ssRNA molecule if a 3´→5´ exoribonuclease is being used, or a probe that binds to the 5´ end of the ssRNA molecule if a 5´→3´ exoribonuclease is being used) prevents exoribonucleases from cleaving regions of ssRNA that do not show degraded RNA, reducing the level of background signal and improving sensitivity.

[0010] In other words, since the probe forms a region of double-stranded nucleic acid that is not a substrate for single-stranded specific exoribonuclease (alternatively, the probe blocks the exoribonuclease by shielding the binding region of ssRNA), the single-stranded specific exoribonuclease cannot digest the free 3'- or 5'-end that is not the result of degradation.

[0011] For example, when measuring the degradation level of mRNA in a sample, the exoribonuclease can be a 3'→5' exoribonuclease, and the target region of the mRNA can be the poly(A) tail. The probe (for example, a poly(dT) oligonucleotide, also called oligo(dT)) binds to (or hybridizes with) the poly(A) tail, thereby protecting the poly(A) tail from degradation by exoribonuclease.

[0012] In the method of the present invention, it is possible to detect a low level of RNA degradation of 0.1% or less in an RNA sample. The method of the present invention is more sensitive than the method for measuring RNA degradation using capillary gel electrophoresis.

[0013] Furthermore, since the signal output (for example, light output) generated from step (c) can be detected using either single-throughput or high-throughput detection hardware, the method of the present invention is advantageous.

[0014] As will be further described below, the method of the present invention can also be applied to the measurement of the 5'-capping efficiency and poly(A) tail length of mRNA molecules.

[0015] The method of the present invention can also be used to measure the binding efficiency of a probe (which may be a candidate oligonucleotide probe or other candidate ssRNA-binding molecule or entity) to a target region. As described later, this is to what extent the probe binds to the target region within the ssRNA molecule of interest (or hybridization and complementarity), and / or is advantageous for evaluating stem-loop formation or hairpin formation (i.e., the tendency of the ssRNA of interest to form a secondary structure like a hairpin). Thus, more specifically, the method of the present invention may be for evaluating or measuring the degree of binding of a probe to a target region, or for evaluating or measuring stem-loop formation or hairpin formation in ssRNA.

[0016] The method of the present invention is a method (or a method therefor) for analyzing ssRNA in a sample. Alternatively, the method of the present invention can also be regarded as a method (or a method therefor) for evaluating, inspecting, investigating, examining, or assessing ssRNA in a sample. Preferably, the method of the present invention is a method for quantifying or qualitatively analyzing the RNA portion of interest in an ssRNA sample.

[0017] The RNA portion of interest may be an intact RNA (e.g., mRNA) molecule, and of course, in relation to that, the RNA portion of interest may be an RNA fragment generated as a result of RNA degradation. Thus, this portion may be the entire RNA molecule or a fragment. Alternatively, the portion may be a polyA tail whose length is interesting to quantify. In yet another embodiment, the RNA portion may be a 5´ cap group, and it may be interesting to know how effective a certain cap structure is in preventing digestion, or to determine the proportion of mRNA molecules in a sample incorporating the cap.

[0018] An "ssRNA sample" is a sample containing ssRNA. The term "ssRNA" refers to an ssRNA molecule, or one or more ssRNA molecules, or a plurality of ssRNA molecules, as appropriate for the context in which it is used. Generally, the term "ssRNA" means an ssRNA molecule or a type of ssRNA molecule, for example, a type of ssRNA having a specific sequence, or sharing a specific sequence or feature. For example, mRNA is a type of ssRNA molecule that can be analyzed by the method of the present invention. Different messenger RNA molecules may differ in a specific region, such as the sequence of the protein-coding region; however, since they are messenger RNA molecules, they have common features, for example, they all encode proteins and generally all have a poly(A) tail and a 5´ cap. Non-coding RNAs (such as long non-coding RNAs) can also be analyzed by the method of the present invention.

[0019] The term "ssRNA" as used herein also encompasses modified ssRNA. Modified ssRNA contains one or more modified nucleotides or regions. One or more or all of the nucleotides or regions within the molecule may be modified. Modified ssRNA may be modified in the sugar and / or nucleobase region. Thus, the nucleotides and / or nucleosides produced by step (b) of the present invention may be nucleotide analogs and / or nucleoside analogs.

[0020] Examples of sugar modifications include phosphorodiamidate morpholino oligomers (PMO); 2'-O-methoxyethyl; 2'-O-methyl (2'-OMe); 2'-fluoro (2'-F); 2'-deoxy-2'-fluoroarabinonucleic acid (FANA); locked nucleic acid (LNA); unlocked nucleic acid (UNA); threose nucleic acid (TNA); 1,5-anhydrohexitol nucleic acid (HNA); cyclohexene nucleic acid (CeNA); and glycol nucleic acid (GNA). Examples of nucleobase modifications include 5-methoxyuridine; pseudouridine; N1-methylpseudouridine; 5-methylcytosine; abasic nucleosides; and 5-fluorobenzofuran-2'-deoxyuridine.

[0021] Modified mRNAs are often used as mRNA-based therapeutics, and the ssRNAs of the present invention are preferably 5-methoxyuridine, pseudouridine or N1-methylpseudouridine modified mRNAs.

[0022] The sample may be a product for pharmaceutical, prognostic, diagnostic or research use, manufactured on a laboratory scale or an industrial scale. The sample may be isolated from humans, other animals, plants, or other organisms. The sample may be purified, partially purified, or may not be purified.

[0023] The method of the present invention is at least partially automated such that one or more steps of the method can be performed without human intervention (or do not require human intervention). The method of the present invention may be automated (or fully automated) such that, for example, all steps of the method are performed without human intervention (or do not require human intervention).

[0024] The method of the present invention is an in vitro (and / or ex vivo) method.

[0025] The sample is preferably a solution containing ssRNA and optionally a buffer.

[0026] The method of the present invention can be applied to the analysis of any ssRNA (i.e., any ssRNA molecule or type of ssRNA molecule including the modified RNAs described above). For example, the ssRNA may be synthetic ssRNA or artificial ssRNA. Alternatively, the ssRNA may be non-synthetic, such as ssRNA of eukaryotes, bacteria, archaea, or viruses. Preferably, the ssRNA is ssRNA containing a poly(A) sequence (i.e., poly(A) tail) and / or a 5′ cap at its 3′ end. More preferably, the ssRNA is mRNA, and even more preferably eukaryotic mRNA.

[0027] Step (a) The method of the present invention includes step (a) of contacting a sample with a probe, and the probe binds to a target region of ssRNA in the sample.

[0028] The probe used in the method of the present invention may be any molecule or entity that can bind to ssRNA. The binding is typically an annealing reaction or a hybridization reaction, but the probe may be, for example, an RNA-binding protein or something containing them. The RNA-binding protein needs to specifically recognize and bind to the target region. For example, when the target region is a poly(A) tail, the RNA-binding protein can be a poly(A)-binding protein (PABP).

[0029] The step of contacting the sample with the probe may include binding (or mixing or admixing) the probe and the sample. Typically, the step of contacting the sample with the probe includes adding the probe to the sample. Alternatively, the step of contacting the sample with the probe may include adding the sample to a solution containing the probe.

[0030] In order for the probe to bind (or hybridize or anneal) to the target region of ssRNA, heating and cooling steps may be employed. For example, the contacting step may include mixing the probe and the ssRNA sample, heating the mixture, and cooling the mixture. More preferably, it may include heating at about 80 °C for 2 minutes and then cooling to room temperature. Such methods for promoting such binding (or hybridization) are well known in the art, such as those used in multi-temperature polymerase chain reaction (PCR) protocols.

[0031] The probe may be an oligonucleotide, and this term includes oligonucleotides containing modified nucleic acids / nucleotides. Modified nucleic acids / nucleotides are structurally similar to naturally occurring RNA or DNA but contain one or more natural or synthetic linkages or modifications. The modifications can be located in any region of the compound, for example, the backbone region (more preferably, the sugar and / or phosphate region) and / or the nucleobase region. Thus, the oligonucleotide can have an alternative (or modified) backbone, nucleobase, or sugar-ring chemistry. Of course, in the context of the probes used in the present invention, such modifications must be such that the oligonucleotide has the ability to bind (or bind sufficiently) to the target region of ssRNA.

[0032] Examples of backbone modifications include phosphorothioate (PS); N3´→P5´ phosphoramidate (NP); 2´,5´-phosphodiester; and peptide nucleic acid (PNA). Examples of sugar modifications include phosphorodiamidate morpholino oligomers (PMO); 2´-O-methoxyethyl; 2´-O-methyl (2´-OMe); 2´-fluoro (2´-F); 2´-deoxy-2´-fluoroarabinonucleic acid (FANA); locked nucleic acid (LNA); unlocked nucleic acid (UNA); threose nucleic acid (TNA); 1,5-anhydrohexitol nucleic acid (HNA); cyclohexene nucleic acid (CeNA); and glycol nucleic acid (GNA). Examples of nucleobase modifications include 5-methoxyuridine; pseudouridine; N1-methylpseudouridine; 5-methylcytosine; non-basic nucleosides; and 5-fluorobenzofuran-2′-deoxyuridine. Such modifications are considered advantageous because they can provide probes that confer higher affinity for RNA, higher stability, higher resistance to degradation, and improved ability to block the degradation of the target region of ssRNA by exoribonucleases.

[0033] Preferably, the probe is a deoxyribonucleic acid (DNA) probe or an RNA probe, more preferably a DNA probe. That is, preferably the probe is a DNA molecule or an RNA molecule, more preferably a DNA molecule. Optionally, the 5´ or 3´ phosphorylation state of the probe can also be changed so that the probe is not recognized by exoribonucleases.

[0034] Preferably, the probe is an oligonucleotide, i.e., a single-stranded polynucleotide containing a relatively small number of nucleotides. Thus, the oligonucleotide can have a length of up to 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 25, 20, 19, 18, 17, 16, or 15 nucleotides. Alternatively, or in addition thereto, the oligonucleotide can have a length of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides. More preferably, the oligonucleotide has a length of 5 to 300, 5 to 250, 5 to 200, 5 to 150, 5 to 100, 5 to 50, or 5 to 25 nucleotides. Alternatively, the oligonucleotide can have a length of 10 to 300, 50 to 300, 100 to 300, 150 to 300, 200 to 300, or 250 to 300 nucleotides. Alternatively, the oligonucleotide can have a length of 5 to 250, 10 to 250, 50 to 250, 100 to 250, 150 to 250, or 200 to 250 nucleotides. Preferably, the oligonucleotide has a length of 15 to 100 nucleotides, more preferably 20 to 60 nucleotides, for example 25 to 45 nucleotides.

[0035] More preferably, the oligonucleotide is a DNA oligonucleotide or an RNA oligonucleotide. More preferably, it is a DNA oligonucleotide.

[0036] The probe used in the method of the present invention binds or hybridizes to (or is suitable for binding or hybridizing to, or can bind or hybridize to) a target region of ssRNA in the sample.

[0037] Alternatively, the probe used in the method of the present invention is preferably complementary to the target region of ssRNA in the sample. The term "complementary" includes not only those that are "partially complementary" but also those that are "fully complementary". In a preferred embodiment, the probe is fully complementary to the target region of ssRNA in the sample. As is understood in the art, an oligonucleotide probe that is fully (i.e., 100%) complementary to a target region is an oligonucleotide that exhibits Watson-Crick base pairs with the target region over the entire sequence of the oligonucleotide probe.

[0038] In contrast, an oligonucleotide probe that is partially complementary to a target region can be defined as an oligonucleotide having at least 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% complementarity to the target region. The percentage of complementarity means the percentage of bases (nucleic acid bases or nitrogen bases) in the probe that exhibit Watson-Crick base pairs with the bases of the target region.

[0039] In embodiments, a saturated (or excess) amount or concentration of the probe can be used. This means that the molar ratio (or stoichiometric ratio) of probe molecules to copies of the target region is at least 1:1 (i.e., the molar ratio of probe molecules to copies of intact ssRNA is 1:1). Preferably, an excess amount or concentration of the probe that is 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, 100-fold, 500-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, or 10000-fold is used. The higher the ratio of the probe to the copies of the target region, the higher the percentage of copies of the target region that are bound or hybridized (or blocked) by the probe. Therefore, it is advantageous to use a saturated or excess amount or concentration of the probe.

[0040] The "target region" is typically a subsection of ssRNA with a pre-determined sequence to which a probe can bind. Usually, the sequence of the target region is fully elucidated when implementing the method of the present invention. However, it is only necessary to elucidate the sequence of the target region to the extent that sufficient binding or hybridization to the target region is achieved, i.e., to the extent that degradation of the target region (e.g., by exoribonuclease) is sufficiently blocked or inhibited. For example, as discussed herein, it is sufficient if the probe is partially complementary to the target region. Therefore, in some embodiments, the target region may only be partially elucidated when implementing the method of the present invention.

[0041] The terms "target region of ssRNA" and "target region of the ssRNA" may be used interchangeably herein.

[0042] Step (b) The method of the present invention includes step (b) of incubating a sample with a single-strand specific exoribonuclease.

[0043] Therefore, herein, when the term "exoribonuclease" is used to describe the exoribonuclease used in the present invention, it refers to the "single-strand specific exoribonuclease" as described above.

[0044] The step of incubating the sample with the exoribonuclease includes binding (or mixing or commingling) the probe and the exoribonuclease. Typically, the step of incubating the sample with the exoribonuclease includes adding the exoribonuclease to the sample. Alternatively, the step of incubating the exoribonuclease and the sample may include adding the sample to a solution containing the exoribonuclease.

[0045] Incubation is at least (or at most) 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 60 minutes, 65 minutes, 70 minutes, 75 minutes, 80 minutes, 85 minutes, 90 minutes, 95 minutes, 100 minutes, 110 minutes, 120 minutes, 130 minutes, 140 minutes, 150 minutes, 160 minutes, 170 minutes or 180 minutes. Preferably, incubation is 5 - 180 minutes, 10 - 180 minutes, 15 - 180 minutes, 20 - 180 minutes, 25 - 180 minutes, 30 - 180 minutes, 35 - 180 minutes, 40 - 180 minutes, 45 - 180 minutes, 50 - 180 minutes, 60 - 180 minutes, 70 - 180 minutes, 80 - 180 minutes, 90 - 180 minutes, 100 - 180 minutes, 110 - 180 minutes, 120 - 180 minutes, 130 - 180 minutes, 140 - 180 minutes, 150 - 180 minutes, 160 - 180 minutes, or 170 - 180 minutes. Alternatively, incubation may be 5 - 180 minutes, 5 - 170 minutes, 5 - 160 minutes, 5 - 150 minutes, 5 - 140 minutes, 5 - 130 minutes, 5 - 120 minutes, 5 - 110 minutes, 5 - 100 minutes, 5 - 95 minutes, 5 - 90 minutes, 5 - 85 minutes, 5 - 80 minutes, 5 - 75 minutes, 5 - 70 minutes, 5 - 65 minutes, or 5 - 60 minutes. Incubation is preferably about 30 minutes to 90 minutes.

[0046] The temperature or temperature range at which the incubation step should be performed (or is most optimal) depends on the specific exoribonuclease being used. This is because exoribonucleases have different temperature dependencies. It will be understood that adjusting the temperature of the incubation step according to the specific exoribonuclease used is within the purview of one of ordinary skill in the art. For example, the incubation temperature can be 10 - 40 °C (e.g., 25 - 40 °C), preferably about 25 °C (e.g., when using exonuclease T as the exoribonuclease) or about 37 °C (e.g., when using PNPase or RNase R as the exoribonuclease).

[0047] Of course, the "sample" incubated with the exonuclease in step (b) is the sample that was contacted (or previously contacted, or has been contacted, or previously contacted, or previously contacted) with the probe in step (a) as described herein. Therefore, to avoid doubt, it should be noted that the steps of the method are performed in the order described in claim 1 (in the order of (a), (b), (c)).

[0048] An exonuclease is a protein having exonuclease activity. An exonuclease degrades RNA by removing terminal nucleotides from the 5'-end (also denoted as 5'→3' exonuclease, or 5'-3' exonuclease) or 3'-end (also denoted as 3'→5' exonuclease, or 3'-5' exonuclease) of RNA. In embodiments of the present invention, the exonuclease may be a 5'→3' exonuclease or a 3'→5' exonuclease, preferably a 3'→5' exonuclease.

[0049] The exonuclease of the present invention does not have (or does not have significant activity) endonuclease (such as endoribonuclease) activity, that is, the exonuclease of the present invention is not an endonuclease (or cannot be classified as an endonuclease). The exonuclease does not have measurable endonuclease activity, or, if it has endonuclease activity, which is not important, has an exonuclease activity that is at least 10-fold, 50-fold, 100-fold, 500-fold or 1000-fold greater than the endonuclease activity.

[0050] The exonuclease used in the present invention is a single-strand specific exonuclease. As understood in the art, the term "single-strand specific exonuclease" means that the exonuclease of the present invention specifically or preferentially cleaves (or degrades or digests) ssRNA rather than double-stranded (ds) polynucleotides, such as dsRNA or DNA-RNA hybrid polynucleotides. A single-strand specific exonuclease has no double-stranded exonuclease activity, or if it has double-stranded exonuclease activity, at any given concentration, it has a single-strand exonuclease activity that is at least 5-fold, 10-fold, 50-fold, 100-fold, 500-fold or 1000-fold greater than the double-stranded (ds) exonuclease activity.

[0051] The specificity between ss nucleic acid and ds nucleic acid may depend on the concentration, but in the method of the present invention, the concentrations of the reagents and enzymes (and reaction conditions) are selected to minimize the double-stranded exonuclease activity. As a result, in the method of the present invention, the exonuclease exhibits a single-strand exonuclease activity that is at least 5-fold, 10-fold, 50-fold, 100-fold, 500-fold or 1000-fold greater than the double-stranded (ds) exonuclease activity.

[0052] Therefore, the catalytic activity (or nucleic acid processing activity) of the single-strand specific exonuclease of the present invention consists of (or mainly consists of) single-strand specific exo(ribo)nuclease activity. Alternatively, in an embodiment of the method of the present invention, the exonuclease does not exhibit (or does not significantly exhibit or strongly exhibit) nucleic acid processing activity other than single-strand specific exonuclease activity.

[0053] The exonuclease may be a natural exonuclease or a synthetic exonuclease. The exonuclease may be a natural exonuclease or a synthetic exonuclease modified (or mutated) to enhance the specificity for ssRNA.

[0054] Exoribonucleases are classified into two subgroups according to their mechanism of action. Namely, hydrolytic exoribonucleases and phosphorolytic exoribonucleases. Hydrolytic exoribonucleases cleave by hydrolyzing (i.e., using water) the nucleotide-nucleotide bond in RNA and release nucleotide monophosphate (NMP). On the other hand, phosphorolytic exoribonucleases cleave the nucleotide-nucleotide bond of RNA by phosphorylation (i.e., using inorganic phosphate) and release nucleotide diphosphate (NDP). In some cases, nucleosides (without phosphate) may be released as a result of exoribonuclease activity. For example, after RNA is naturally hydrolyzed (degraded), the 5´ fragment usually contains 2´,3´-cyclic phosphate. As a result, the 3´ fragment has no phosphate. When an exoribonuclease acts on this last fragment, one nucleoside is released.

[0055] Therefore, in embodiments of the method of the present invention, the exoribonuclease is a hydrolytic exoribonuclease or a phosphorolytic exoribonuclease. Preferably, the hydrolytic exoribonuclease is exonuclease T or RNAseR. Preferably, the phosphorolytic exoribonuclease is polynucleotide phosphorylase (PNPase). In embodiments, the exoribonuclease is a nucleotide-producing exoribonuclease or can produce nucleotides from RNA cleavage activity.

[0056] The use of PNPase is advantageous when used in combination with the LucipacA3 assay (described elsewhere in this specification). This is because the LucipacA3 assay generates inorganic phosphate (Pi), which stimulates PNPase and enhances its degradation activity. However, ultimately, equilibrium is reached and a large amount of NDP (25% on average is ADP) is generated, which inhibits the degradation via PNPase. This feedback attenuates the effect of PNPase and prevents the system from saturating.

[0057] Because PNPase has the ability to recognize 2´,3´-cyclic phosphate, it is advantageous to use PNPase in other situations. Under specific circumstances where RNA is degraded, 2´,3´-cyclic phosphate is formed. That is, the 3´ end formed from the cleavage of RNA is a 2´,3´-cyclic phosphate end.

[0058] When PNPase acts on a 2´,3´-cyclic phosphate end, nucleoside diphosphate is released as usual (i.e., as when PNPase acts on the 3´-hydroxyl end or the 3´-phosphate end), and can then be detected by one of several known methods, for example, any one of the detection methods described elsewhere in this specification. Thus, in embodiments of the method of the invention where the exoribonuclease is a 3´→5´ exoribonuclease, it is particularly advantageous for the exoribonuclease to be one that can recognize (or cleave, or digest, or process) 2´,3´-cyclic phosphate (alternatively, also referred to as 2´,3´-cyclic phosphate, or 2´,3´-cyclic phosphate end, or 2´,3´-cyclic phosphate 3´ end, or 2´,3´-cyclic phosphate 3´ end of ssRNA).

[0059] PNPase is available from Sigma.

[0060] However, it should also be noted that when practicing the methods of the invention on an ssRNA sample that contains (or may contain or is suspected of containing) one or more ssRNA molecules with 2´,3´-cyclic phosphate ends, there is no need to limit the particular type of exoribonuclease used. Rather, the 2´,3´-cyclic phosphate ends can be addressed by "opening" the 2´,3´-cyclic phosphate ends, i.e., converting the 2´,3´-cyclic phosphate 3´ ends to 3´ ends recognizable by all (or most) exoribonucleases, such as the hydroxyl group 3´ ends or phosphate group 3´ ends as described above. This conversion can be done in several ways. In water, 2´,3´-cyclic phosphate is in equilibrium with 2´-phosphate and 3´-phosphate, and this equilibrium varies depending on the reaction conditions. The opening (or conversion) of the 2´,3´-cyclic phosphate ends can be achieved chemically, for example, by incubating the ssRNA sample with HCl. Alternatively, or in addition, the opening (or conversion) of the 2´,3´-cyclic phosphate ends can be achieved enzymatically, for example, using T4 polynucleotide kinase-phosphatase in the absence of ATP (Das and Shuman, “Mechanism of RNA 2’,3’-cyclic phosphate end healing by T4 polynucleotide kinase-phosphatase”, Nucleic Acids Research, 2013, Vol. 41, No. 1, 355-365).

[0061] Accordingly, the methods of the invention can be applied to an ssRNA sample that contains (or may contain or is suspected of containing) one or more ssRNA molecules with 2´,3´-cyclic phosphate ends. "One or more ssRNA molecules with 2´,3´-cyclic phosphate ends" (or that may contain 2´,3´-cyclic phosphate ends) means one or more ssRNA molecules in which the 2´ and 3´ positions of the ribose are bridged by a phosphate at the 3´-terminal nucleotide (or modified nucleotide) of the ssRNA molecule.

[0062] In an embodiment where the exoribonuclease is a hydrolytic exoribonuclease, the detecting step (i.e., step (c)) includes detecting nucleoside monophosphates. Thus, in the embodiment, the method of the present invention includes the following steps: (a) a step of contacting a sample with a probe, wherein the probe binds (e.g., hybridizes) to a target region of ssRNA in the sample; (b) a step of incubating the sample with a hydrolytic single-strand specific exoribonuclease; and (c) a step of detecting the nucleoside monophosphates generated by step (b), wherein the nucleoside monophosphates include nucleoside monophosphates from one or more RNA regions located outside the target region of ssRNA in the sample.

[0063] In an embodiment where the exoribonuclease is a phosphorolytic exoribonuclease, the detecting step (i.e., step (c)) includes detecting nucleoside diphosphates. Thus, in the embodiment, the method of the present invention includes the following steps: (a) a step of contacting a sample with a probe, wherein the probe binds (e.g., hybridizes) to a target region of ssRNA in the sample; (b) a step of incubating the sample with a phosphorolytic single-strand specific exoribonuclease; and (c) a step of detecting the nucleoside diphosphates generated by step (b), wherein the nucleoside diphosphates include nucleoside diphosphates from one or more RNA regions located outside the target region of ssRNA in the sample.

[0064] Optionally, both a hydrolytic exoribonuclease and a phosphorolytic exoribonuclease may be used in the method of the present invention, in which case the detecting step includes detecting both nucleoside monophosphates and nucleoside diphosphates.

[0065] In some embodiments, an exoribonuclease at a saturation concentration (or excess concentration) can be used. This refers to the amount or concentration of exoribonuclease at which the cleavage of ssRNA occurs at the maximum rate. This will generally be understood to be an amount or concentration of exoribonuclease equal to or exceeding the number of substrates in the ssRNA sample (the substrate is the 5´ end of the ssRNA in the case of a 5´→3´ exoribonuclease and the 3´ end of the ssRNA in the case of a 3´→5´ exoribonuclease). The number of substrates can be estimated based on knowledge of the RNA sample. Using an exoribonuclease at a saturation amount or concentration is advantageous as it allows for the rapid production of nucleotides and / or nucleosides (depending on the exoribonuclease used) and thus enables a rapid determination of the ssRNA degradation level. By saturating the RNA sample with exoribonuclease, the number of free RNA ends can also be quantified by measuring the rate of increase over time of the concentration of nucleotides and / or nucleosides.

[0066] Step (c) The method of the present invention includes step (c) of detecting (or measuring or observing or monitoring) the nucleotides and / or nucleosides produced by step (b), where the nucleotides and / or nucleosides include nucleotides and / or nucleosides from one or more RNA regions located outside the target region of the ssRNA in the sample.

[0067] Optionally, the detection step uses an enzyme - reagent mixture (i.e., step (c) includes using an enzyme - reagent mixture to detect (or measure or observe or monitor) the nucleotides and / or nucleosides produced by step (b)).

[0068] The nucleotides and / or nucleosides detected during the detection step may be natural (or standard) nucleotides and / or nucleosides. For example, the nucleotides and / or nucleosides detected during the detection step may be adenosine, uridine, cytidine or guanosine, or a nucleoside monophosphate of one of these nucleosides, or a nucleoside diphosphate of one of these nucleosides, or a combination thereof (i.e., adenosine, adenosine monophosphate (AMP), adenosine diphosphate (ADP), uridine, uridine monophosphate (UMP), uridine diphosphate (UDP), cytidine, cytidine monophosphate (CMP), cytidine diphosphate (CDP), guanosine, guanosine monophosphate (GMP), guanosine diphosphate (GDP), or a combination thereof).

[0069] Alternatively, or in addition thereto, the nucleotides and / or nucleosides detected during the detection step may be modified nucleotides and / or nucleosides. For example, the nucleotides and / or nucleosides detected during the detection step may be 5-methoxyuridine; pseudouridine; N1-methylpseudouridine; 5-methylcytosine; non-basic nucleosides; or 5-fluorobenzofuran-2'-deoxyuridine, or a nucleoside monophosphate of one of these nucleosides, or a nucleoside diphosphate of one of these nucleosides, or a combination thereof. Alternatively, the nucleotides and / or nucleosides may be any of the other modified nucleic acids described elsewhere in this specification, or a combination thereof (or may be derived from their degradation products).

[0070] Preferably, the nucleotides and / or nucleosides detected during the detection step are nucleosides, nucleoside monophosphates, nucleoside diphosphates, or a combination thereof; more preferably, they are adenosine, adenosine monophosphate, adenosine diphosphate, or a combination thereof.

[0071] Preferably, the nucleotides and / or nucleosides detected during the detection step are nucleoside monophosphates, nucleoside diphosphates, and combinations thereof; preferably, adenosine monophosphate and / or adenosine diphosphate.

[0072] As is clear from the above discussion, the nucleotides and / or nucleosides detected during the detection step may be a single type (or species) of molecule, or a mixture of multiple types (or species) or molecules. To detect multiple types (or molecular species) of molecules in the detection step, it may be appropriate to use multiple detection methods simultaneously or sequentially. Thus, only one type of base (in the form of a nucleoside or nucleotide, regardless) may be detected, and that is preferred, but one or more types of bases may be detected, or all four types of bases (in the form of a nucleoside or nucleotide, regardless) may be detected.

[0073] Of course, the nucleotides and / or nucleosides detected during the detection step are individual nucleotides and / or nucleosides, as per the ordinary meaning of these terms, as opposed to, for example, polynucleotides.

[0074] The output signal generated in step (c) is proportional to the amount (or level) of the nucleotides and / or nucleosides generated in step (b).

[0075] Nucleotides and / or nucleosides can be detected by any suitable detection method known in the art.

[0076] Mass spectrometry and nuclear magnetic resonance (NMR) are tools applicable to the detection and quantification of any nucleotide and / or nucleoside. However, it may also be preferable to use detection methods using enzymes or immunoassays, and numerous kits and reagents for such methods are available in the art.

[0077] For example, nucleotides and / or nucleosides can be detected using luminescence- or fluorescence-based methods. In the case of AMP and / or ADP, these molecules can be detected using the Lucipac A3 enzyme mix as described, for example, in Bakke and Suzuki 2018 (Journal of Food Protection, Vol. 81, No. 5, 2018, Pages 729-737) and Bakke et al. 2020 (Journal of AOAC INTERNATIONAL, 103(4), 2020, 1090-1104). In the Lucipac A3 protocol, AMP is converted to ATP in a reaction catalyzed by pyruvate orthophosphate dikinase (PPDK), and ADP is converted to ATP in a reaction catalyzed by pyruvate kinase. The ATP generated by these two reactions is used in a reaction catalyzed by luciferase to generate light.

[0078] The luciferase-catalyzed reaction converts ATP (i.e., the ATP generated by the PPDK- and PK-catalyzed reactions) to AMP. The AMP generated by the luciferase-catalyzed reaction is returned (or "recycled") to ATP by the PPDK-catalyzed reaction. The resulting ATP is used again in the luciferase-catalyzed reaction, leading to the generation of additional light and AMP. The resulting AMP is recycled back to ATP, and the cycle repeats.

[0079] This process of AMP recycling leads to the generation of a constant light intensity proportional to the amount of AMP and ADP in the sample. Thus, AMP and ADP in the sample can be quantified by measuring the light intensity using a luminometer, for example, by providing an output in relative light units (RLU), or by measuring the number of photons emitted per second (p / s).

[0080] Guanosine diphosphate (GDP) can also be detected, for example, by a luminescence-based method such as the Promega GDP-Glo assay (VA1090). Similarly, uridine diphosphate (UDP) can be detected by the Promega UDP-Glo assay (V6961).

[0081] Adenosine can be detected, for example, by fluorescence measurement using a CELLTECHGEN adenosine assay kit or a BIOVISION adenosine assay kit (K327-100).

[0082] Accordingly, in an embodiment, the detection step provides a light output. In a preferred embodiment, the detection step uses an enzyme-reagent mixture, preferably a mixture containing luciferase, more preferably pyruvate orthophosphate dikinase and / or pyruvate kinase.

[0083] Alternatively, AMP and / or ADP can be detected using a NAD+ / NADH binding assay or a NADP+ / NADPH binding assay. For example, a traditional method for detecting ADP is a reaction catalyzed by pyruvate kinase that converts phosphoenolpyruvate (PEP) to pyruvate using ADP, and then converts pyruvate to lactate while oxidizing NADH to NAD+. NADH absorbs light at 340 nm, while NAD+ does not. Therefore, by measuring the absorbance at 340 nm, the change in the concentration of NADH can be detected. Other methods for measuring the concentration of NAD+ or NADH are also known in the art.

[0084] Similarly, GDP can be detected by several other methods including the Profoldin micromolar GDP assay kit (MGD100K-PF) which can also be used for the detection of ADP.

[0085] Alternatively, nucleotides and / or nucleosides can also be detected using immunoassay methods.

[0086] For example, AMP and / or ADP can be detected using anti-AMP antibodies and / or anti-ADP antibodies, for example, in the Transcreener AMP 2 assay or the Transcreener ADP 2 assay (e.g., as described in Kleman-Leyer et al., Characterization and optimization of a red-shifted fluorescence polarization ADP detection assay. Assay Drug Dev Technol 2009;7(1):56-67). The Transcreener assay uses an AMP or ADP analog covalently linked to a fluorescent tracer. The nucleotide analog-tracer fusion molecule is bound to an anti-AMP antibody or an anti-ADP antibody. If there is enzyme activity that results in the formation of ADP, the fusion molecule is displaced by ADP. When the tracer is displaced from the anti-ADP antibody or anti-AMP antibody, the fluorescence characteristics of the tracer change and can be detected using standard equipment.

[0087] Similarly, GDP can be detected using the Transcreener GDP FP assay (Bellbrook labs 3009-1k).

[0088] Alternatively, nucleotides and / or nucleosides can also be detected using an enzyme-linked detection method.

[0089] For example, AMP and / or ADP can be detected using an enzyme-linked detection method such as the ADP-Quest assay (described, for example, in Charter et al., A generic, homogenous method for measuring kinase and inhibitor activity via adenosine 5′-diphosphate accumulation. J Biomol Screen 2006;11:390-399). In the ADP-Quest assay, ADP drives a cascade of detection enzymes, ultimately generating a fluorescent signal. More specifically, ADP is converted to ATP in a reaction catalyzed by pyruvate kinase, while phosphoenolpyruvate is converted to pyruvate simultaneously. Subsequently, pyruvate is converted to hydrogen peroxide by pyruvate oxidase. Then, hydrogen peroxide reacts with Amplex Red in a peroxidase-catalyzed reaction to generate the fluorescent compound resorufin. The concentration of resorufin is measured fluorometrically using standard equipment.

[0090] In some embodiments, and as previously described herein, the present invention can be used to measure or quantify ssRNA degradation in a sample. This can be achieved using either a 5´→3´ exoribonuclease or a 3´→5´ exoribonuclease, or both.

[0091] To measure the degradation of ssRNA by the method of the present invention using a 3´→5´ exoribonuclease, a probe that binds (or hybridizes) to a sequence at or near the 3´ end of the ssRNA should be used. That is, the "target region" of the ssRNA is at or near the 3´ end of the ssRNA (or is a sequence at or near the 3´ end of the ssRNA). Thus, in an embodiment, the exoribonuclease is a 3´→5´ exoribonuclease and the target region of the ssRNA is at or near the 3´ end.

[0092] Thus, when the ssRNA whose degradation is measured is an ssRNA containing a poly(A) tail, such as mRNA, the degradation can be measured by the method of the present invention by using a 3´→5´ exoribonuclease together with a probe that binds to (or hybridizes with) the poly(A) tail or a part thereof. Thus, in an embodiment, the exoribonuclease is a 3´→5´ exoribonuclease, the ssRNA contains a poly(A) tail, and the target region of the ssRNA is the poly(A) tail. Thus, the probe is one that binds to or hybridizes with (or can bind to or hybridize with) the poly(A) tail. For example, the probe may be an oligonucleotide DNA probe containing or consisting of a poly(T) sequence, preferably consisting of a poly(T) sequence. Alternatively, the probe may be an oligonucleotide RNA probe containing or consisting of a poly(U) sequence, preferably consisting of a poly(U) sequence. In this way, when the probe and the ssRNA are incubated, the probe binds to the poly(A) tail to form a double strand, and the poly(A) tail is protected from degradation by the single-strand specific exoribonuclease of the present invention.

[0093] To measure the degradation of ssRNA by the method of the present invention using a 5´→3´ exoribonuclease, a probe that binds (or hybridizes) to the sequence at or near the 5´ end of the ssRNA should be used. That is, the "target region" of the ssRNA is at or near the 5´ end of the ssRNA (or is the sequence at or near the 5´ end of the ssRNA). 5´→3´ exoribonuclease activity is generally inhibited by the presence of a 5´ cap, but not all mRNAs in a sample have a 5´ cap. Therefore, a probe should be used that protects the 5´ end of mRNA molecules that do not have a 5´ cap (i.e., uncapped mRNA) and prevents degradation at the 5´ end by the 5´→3´ exoribonuclease. Thus, in an embodiment, the exoribonuclease is a 5´→3´ exoribonuclease and the target region of the ssRNA is at or near the 5´ end of the ssRNA. Optionally, a probe can also be additionally used in which the target region of the ssRNA is immediately upstream of the poly(A) tail to prevent excessive signal generation.

[0094] The term "upstream" means the ordinary meaning in the art, i.e., "5´" or "with respect to 5´". This term is in contrast to "downstream" which has the ordinary meaning in the art, i.e., "3´" or "with respect to 3´".

[0095] As used herein, the target region of the ssRNA that is "immediately upstream" of the polynucleotide region in question, e.g., the target region of the ssRNA of the poly(A) tail, is considered to include or consist of nucleotides within 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 nucleotides, preferably within 0 nucleotides (i.e., the first nucleotide upstream of the polynucleotide region in question, e.g., the poly(A) tail) of the polynucleotide region in question.

[0096] In this specification, when the target region is considered to be "near" the polynucleotide region in question, such as the poly(A) tail or the 5' end, the target region of the ssRNA is considered to be within 50, 40, 30, 20, or 10 nucleotides, preferably within 10 or 5 nucleotides, of the polynucleotide region in question.

[0097] In some embodiments, the methods of the invention can be used to measure the binding efficiency (or binding affinity, or hybridization efficiency, or hybridization affinity) of a probe to ssRNA (the target region of the ssRNA).

[0098] Since there is not perfect complementarity between the oligonucleotide probe and the target region, the binding efficiency of the probe to the target region of the ssRNA may not be optimal. Thus, more specifically, in some embodiments, the invention can be used to determine the degree of complementarity between a probe and ssRNA (or the target region of the ssRNA) when, for example, the entire sequences of the probe (when the probe is an oligonucleotide) and / or the ssRNA (or the target region of the ssRNA) are not fully elucidated (i.e., the sequences of the probe and / or the ssRNA (or the target region of the ssRNA) are only partially elucidated).

[0099] Alternatively or additionally, the binding efficiency of a probe to a target region of ssRNA may be suboptimal due to, for example, steric hindrance to probe binding to the target region caused by secondary structure formation (e.g., hairpin or stem-loop formation) of the ssRNA in and / or around the target region of the ssRNA (e.g., in the vicinity of the target region of the ssRNA, or immediately upstream or downstream thereof). Thus, more specifically, in some embodiments, the present invention can be used to determine the degree of secondary structure formation in and / or around the target region of ssRNA, and preferably, the secondary structure formation is hairpin (or stem-loop) formation. In such embodiments, it is preferred to use an exonuclease that is not inhibited by the stem-loop, such as RNase R.

[0100] Probes that are not oligonucleotides or analogs thereof may also have variable binding affinities for target regions within ssRNA molecules, and the methods of the present invention can be developed to examine the binding affinity of candidate probe molecules and / or to screen candidate probe molecules to identify probe molecules having strong affinities.

[0101] The 5´ cap is a non-standard nucleotide found at the 5´ end of precursor mRNAs and other primary RNA transcripts. In eukaryotes, it is a methylated guanine nucleotide attached to the rest of the mRNA by an atypical 5´-5´ triphosphate linkage.

[0102] The present invention can be used to measure or quantify the mRNA capping efficiency in a sample (i.e., in an mRNA sample), that is, the proportion of mRNA molecules in the sample incorporating a 5' cap. In such embodiments, a 5'→3' exoribonuclease is used. The 5'→3' exoribonuclease digests the 5' end of uncapped mRNA. However, the 5'→3' exoribonuclease cannot digest the 5' end of capped mRNA because such 5' ends are protected from degradation by the 5' cap. Preferably, the 5'→3' exoribonuclease is Xrn-1.

[0103] Since the mRNA capping efficiency is usually higher than 95%, an efficient assay is required to detect a slight difference in capping efficiency. Therefore, in order to prevent over-signal generation, a probe is required downstream (not immediately downstream) of the 5' end of the mRNA. Thus, in embodiments of the method of the present invention, the exoribonuclease is a 5'→3' exoribonuclease and the target region of the ssRNA is downstream (or located) but not immediately downstream of the 5' end of the mRNA. Preferably, the target region of the ssRNA is at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 nucleotides downstream (or located) from the 5' end of the mRNA. Preferably, the target region is located (begins) within 50, 60, 70, 100, 150, 200 or 250 nucleotides downstream from the 5' end of the mRNA.

[0104] In some embodiments, the invention can be used for the measurement or quantification of poly(A) tail length. In such embodiments, a 3´→5´ exoribonuclease is used to digest the poly(A) tail. However, in the absence of a blocking probe, the exoribonuclease will further digest the mRNA nucleotides upstream of the poly(A) tail, which is undesirable. To prevent or minimize this undesirable digestion, a probe that binds immediately upstream of the poly(A) tail (i.e., a probe whose ssRNA target region is immediately upstream of the poly(A) tail) can be used. Thus, in an embodiment, the exoribonuclease is a 3´→5´ exoribonuclease, the ssRNA contains a poly(A) tail, and the target region of the ssRNA is immediately upstream of the poly(A) tail.

[0105] It will be appreciated that if the probe binds only in the vicinity of the last nucleotide before the start of the poly(A) tail, the readout will be distorted by the adenine nucleotides present in the RNA between the end of the probe and the start of the poly(A) tail. Such residues may contribute to the signal generated by the enzyme-reagent mixture. It is desirable that there are no nucleotides between the end of the probe and the start point of the poly(A) tail, but if there are a few nucleotides in that zone, especially if there is no adenine among them, the analysis is still useful.

[0106] Alternatively, a part of the probe may be complementary to the RNA sequence immediately upstream of the poly(A) tail, and another part of the probe may be complementary to the region of the poly(A) tail. Thus, in other words, the probe binds (or hybridizes) near the 5´ end of the poly(A) tail. Accordingly, in an embodiment, the exoribonuclease is a 3´→5´ exoribonuclease, and the target region of the ssRNA is a region spanning the nucleotide at the 5´ end of the poly(A) tail and the nucleotide immediately upstream of the poly(A) tail.

[0107] The method of the present invention may also include performing the above-described further method (or further method steps) on the same sample material. In this case, step (a) of the method of the present invention is not performed, but steps (b) and (c) of the method of the present invention are performed. The comparison of the results obtained by these two methods is performed when the second method (excluding step (a)) operates as a control step.

[0108] Thus, optionally, the method of the present invention also includes comparing the levels of nucleotides and / or nucleosides detected in step (c) of the method including step (a) with the levels of nucleotides and / or nucleosides detected in step (c) of the method not including step (a). This comparison includes providing (or calculating, determining) the ratio of the two levels. Preferably, the same nucleotide or nucleoside as in the method of the present invention is detected in the control method.

[0109] The further method (step) functions as a control or baseline that can normalize the detected levels of nucleotides and / or nucleosides (e.g., luminescence levels such as when the Lucipac A3 protocol is used) generated by step (b) from the original method steps. The use of further method steps is not essential, but has advantages such as enabling more meaningful outputs regardless of the specific apparatus or parameters used.

[0110] For example, in one embodiment of the method of the present invention for measuring or quantifying the binding (or hybridization) efficiency of a probe to a target ssRNA, the further method steps include incubating the sample (i) with an oligonucleotide and (ii) without an oligonucleotide. From the ratio of (i) / (ii), the binding efficiency of the probe to the RNA can be known. Specifically, when there is no binding or the binding is weak, the ratio is 1 (or close to it), and when the binding is strong, the ratio is 0 (or close to it).

[0111] In embodiments, it may be desirable to consider background signals in calculations. Background signals (or "noise") are generated, for example, by trace amounts of contaminating nucleotides. This signal is quantified by measuring the signal (e.g., a luminescence signal) generated by the same protocol in the absence of the mRNA sample, and the result is taken into account. Thus, in the above equations (i) / (ii), the values of (i) and (ii) can exclude the background signal.

[0112] The degradation rate can be calculated by the following formula, and this time the background signal is explicitly considered in the formula: Degradation rate = (Degradation - Background) / (Probe-free - Background) Here, "Degradation" is the signal (e.g., a luminescence signal) from the degraded sample following incubation with exoribonuclease and subsequent detection (e.g., using the Lucipac A3 assay), "Background" is the signal generated in the absence of the mRNA sample (the signal may be due to, for example, trace amounts of contaminating nucleotides), and "Probe-free" is the signal determined from the degraded sample in the absence of the probe.

[0113] As a comparison, instead of determining and using the signal generated for the ssRNA sample in the absence of the probe, one can also determine and use the signal generated for a version of the ssRNA sample that is assumed (or hypothesized) to be 100% intact (i.e., 0% degraded) in the presence of the probe (i.e., all of steps (a)-(c) of the present invention are carried out as normal, but an intact sample is used). Examples of such samples can be freshly thawed or newly generated ssRNA samples, or versions or aliquots of ssRNA samples that have not been exposed to degradation conditions.

[0114] In another aspect, the present invention provides a kit for carrying out the method of ssRNA analysis as defined herein, said kit comprising the probe of the present invention and the exonuclease of the present invention as defined herein.

[0115] Optionally, the kit includes a buffer. The buffer may be a buffer for (or suitable for) the probe and / or exonuclease. Optionally, the kit includes means for detecting nucleotides and / or nucleosides, for example, an enzyme-reagent mixture as defined herein.

[0116] Preferred embodiments and additional features of the method of the present invention are applicable mutatis mutandis to this aspect of the present invention.

[0117] Throughout this specification, when the terms "comprising", "having", or other equivalent terms are used herein, the term "consisting of" is also alternatively contemplated. A method comprising certain steps also includes, where appropriate, a method consisting of these steps.

[0118] As used throughout this application, the terms "a" and "an" are used in the sense of "at least one", "at least a first", "one or more" or "a plurality" of the components or steps being referred to, unless specifically stated otherwise hereinafter.

[0119] The present invention will be further described in the following non-limiting examples with reference to the following figures.

Brief Description of the Drawings

[0120]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figures 12 - 18

Example

[0121] Example using exonuclease T Exonuclease activity is required to release nucleosides from mRNA in Example 1 FLuc 5moU mRNA (Trilink #L-7602) was thawed at 20 ng / μl and stored on ice. Next, the mRNA was taken out of the ice and stored on the bench at room temperature for a predetermined time (0 hours to 2 hours). 50 μl of the mRNA was diluted with 50 μl of Lucipac A3 reagent (Kikkoman #60365) and measured with a Tecan Spark plate reader using a flat-bottom NUNC 96-well plate. Furthermore, a part of the mRNA that had just been thawed was diluted to 100 ng / μl, digested with 7 μl of exonuclease T (NEB #M0265) at 25°C for 30 minutes, and then Exo T was inactivated (at 65°C for 20 minutes). 50 μl of the obtained sample was diluted with 50 μl of Lucipac A3 reagent and further serially diluted (up to a dilution ratio of 1:10).

[0122] Exonuclease T releases nucleoside monophosphates from ssRNA in the 3'→5' direction (i.e., mainly the poly(A) tail is digested), and Lucipac A3 converts AMP into measurable luminescence.

[0123] The results of this example are shown in Fig. 1. The dotted line indicates the signal (expressed in p / s (photons / second)) obtained by adding 50 μl of Lucipac A3 to 50 μl of nuclease-free water. As shown by the white bars, even without incubation with exonuclease T, a slight level of luminescence can be obtained with mRNA. This is presumably due to the presence of trace amounts of AMP and / or ADP, or due to slight degradation or slight contamination of the mRNA sample. As shown by the black bars, when incubated with exonuclease T, the luminescence signal increases significantly. Therefore, this example shows that exonuclease activity is necessary to release nucleosides from mRNA.

[0124] Example 2 - Can sensitively distinguish different ratios of digested mRNA and intact mRNA FLuc 5moU mRNA was digested with exonuclease T and mixed at different ratios with intact FLuc 5moU mRNA (the total mRNA concentration was kept constant at 10 pg / μl). 50 μl of Lucipac A3 reagent was added to 50 μl of this mRNA mixture, and luminescence was measured with a Tecan plate reader.

[0125] The results of this example are shown in Fig. 2. For example, 1.0 indicates that the RNA mixture contains equal amounts (equal masses) of digested mRNA and intact mRNA, and 0.0 indicates that the RNA mixture contains only intact mRNA. The dotted line in Fig. 2 is the same as the dotted line in Example 1. That is, it indicates the signal obtained by adding 50 μl of Lucipac A3 to 50 μl of nuclease-free water.

[0126] Fig. 2 shows that when the Lucipac A3 assay is performed by changing the ratio of digested mRNA and intact mRNA, the magnitude of the luminescence signal is different. Thus, this example shows that different ratios of digested mRNA and intact mRNA can be sensitively distinguished.

[0127] Example 3 - mRNA degradation cannot be detected by exonuclease T digestion alone The FLuc 5moU mRNA (size 1929 nt) was placed on the bench at room temperature for 1 week and compared with freshly thawed (i.e., intact) mRNA regardless of the presence or absence of exonuclease T digestion. 50 μl of mRNA (100 pg / μl) was used, and 50 μl, 25 μl, or 10 μl of Lucipac A3 reagent was added to each sample.

[0128] The results of this example are shown in Figure 3. For intact mRNA incubated with exonuclease T, a significant increase in the luminescence signal was observed compared to intact mRNA not incubated with exonuclease T. This increase in the luminescence signal is mainly due to the digestion of the poly(A) tail (derived from the original intact mRNA molecule) by exonuclease T. For bench mRNA incubated with exonuclease T, a similar increase in the luminescence signal was observed compared to bench mRNA not incubated with exonuclease T. A smear on a 0.8% agarose gel (containing 1% bleach) indicates that the mRNA on the bench for 1 week was slightly degraded. However, this degradation did not lead to a significant increase in luminescence.

[0129] Therefore, in this example, the luminescence signal resulting from the digestion of the poly(A) tail terminus by exonuclease T dominated the overall luminescence signal of the bench exoT sample, and the luminescence signal resulting from the digestion of termini other than the poly(A) tail terminus (i.e., termini resulting from the degradation of the bench mRNA sample) by exonuclease T was undetectable.

[0130] Example 4 - Complementary Oligonucleotides Inhibit Exonuclease T Activity When Exo T is added to the FLuc 5moU mRNA sample and incubated at 25°C for 60 minutes, AMP is released from the ssRNA fragment. The released AMP is quantified using the Lucipac A3 assay.

[0131] The results of this example are shown in Fig. 4. When 5-fold molar excess of dT30 is added to this reaction, the number of released AMP decreases, indicating that much of the AMP is generated from the poly(A) tail.

[0132] Example using PNPase Example 5 - Polynucleotide phosphorylase (PNPase) is a 3´→5´ exonuclease that releases nucleotide diphosphates from mRNA and is inhibited by double-stranded mRNA.

[0133] FLuc 5moU mRNA was left standing at room temperature for 1 week. Next, the mRNA was incubated at 80°C for 2 minutes with or without the addition of 5-fold molar excess of oligo-deoxythymidine (dT30). After cooling to room temperature, PNPase (Sigma #N9914) was added (final concentration 5 ng / μl) and incubated at 37°C for 60 minutes. Next, 3 μl (15 ng mRNA) of this reaction solution was mixed with 25 μl of Lucipac A3 reagent, and luminescence was measured with a Tecan plate reader.

[0134] The results of this example are shown in Fig. 5. Addition of dT30 inhibits the release of ADP from the poly(A) tail.

[0135] Example 6 - Complementary oligonucleotides inhibit exonuclease-mediated degradation of mRNA in a sequence-specific manner In an in vitro transcription reaction (NEB #E2040S), linearized pET22b_NEIL2-NLuc-His was used as the template DNA, and enzymatic poly(A) tailing reaction (Cellscript #C-PAP5104H) and silica-based purification (NEB #T2040S) were performed. All were carried out according to the manufacturer's specifications to synthesize in-house poly(A) tailed mRNA. Both this unmodified FLuc mRNA and commercially available 5moU-modified FLuc mRNA were annealed at 80°C for 2 minutes and then cooled to room temperature with either a 4-fold molar excess of dT30 oligodeoxynucleotide (T) or one of three oligodeoxynucleotides with random sequences (R1-R3). (R1: TTTACCGCAACTACACCTAACTGAGATACT (SEQ ID NO: 1), R2: TTAGATAACCGGATACAGTGACTTTGATAG (SEQ ID NO: 2), R3: CTGCGTATGGAGGAAGGAACTTTTGCGTGT (SEQ ID NO: 3)). The mixture of these mRNAs and oligonucleotides was incubated with PNPase (final concentration 10 ng / μl) at 37°C for 60 minutes in PNPase buffer (final concentration 5 mM MgCl2, 10 mM KCl, 50 mM Tris HCl (pH 8.5), 10 mM inorganic phosphate). 600 ng of each reaction was electrophoresed on a 0.8% agarose TAE gel (containing 1% bleach).

[0136] The results of this example are shown in Fig. 6. For both FLuc 5moU mRNA and NEIL2-NLuc mRNA, the bands in the lanes without PNPase are at approximately the same position as the corresponding bands in the lanes containing both PNPase and dT30. This indicates that dT30 effectively inhibits PNPase activity. In contrast (and also for both FLuc 5moU mRNA and NEIL2-NLuc mRNA), the four bands in the lanes containing PNPase but lacking dT30 (either without oligonucleotides or with any of the random sequence oligonucleotides R1 to R3) are at approximately the same position and are lower (indicating higher resolution than the other two bands) than the other two bands. From the fact that the bands in these four lanes are at the same position (for both RNA types), it can be seen that oligonucleotides R1 to R3 were unable to prevent mRNA degradation by PNPase. Thus, in summary, the gel image shows that only dT30 inhibits PNPase activity against mRNA, while random oligodeoxynucleotides do not.

[0137] Example 7 - The luminescence signal due to phosphorylation of the poly(A) tail can be avoided by the addition of a large excess of oligonucleotides FLuc 5moU mRNA (124 ng) was mixed with 0 to 500-fold molar excess of dT30 in a total of 10 μl of nuclease-free water. The mixture was heated at 80 °C for 2 minutes and then cooled to room temperature. Next, the mRNA containing annealed dT30 (final concentration 2.9 ng / μl) was mixed with PNPase (final concentration 1.6 ng / μl) and PNPase buffer. After incubating all samples at 37 °C for 60 minutes, they were centrifuged at 8000 RPM for 10 seconds. Using a flat-bottom white NUNC 96-well plate, 5 μl of each sample was mixed with 26 μl of Lucipac A3 reagent and 25 μl of nuclease-free water, and immediately imaged with a Tecan plate reader (luminescence exposure time was 2 seconds per well).

[0138] The results of this example are shown in Figure 7. This graph shows that when the ratio of dT30:mRNA is between 250 - 500, almost all of the signal derived from poly(A) phosphorylation can be suppressed. The rate of degradation can be calculated using the formula: Degradation rate = (Degradation - Background) / (Poly(A) - Background).

[0139] The "Background" value reflects the stable background luminescence from a sample containing only dT30 and PNPase. The luminescence remaining when poly(A) phosphorylation is completely inhibited is derived from RNA degradation fragments ("Degradation").

[0140] The "Poly(A)" value and line represent the luminescence from a sample containing PNPase but completely lacking dT30.

[0141] When dT30:mRNA is 500, it can be seen from the formula (Degradation - Background) / (Poly(A) - Background) that 11.26% of the input mRNA has been degraded.

[0142] Example 8 - Signals obtained from non-poly(A)-derived RNA fragments correlate with RNA degradation FLuc 5moU mRNA in water was degraded by heating at 95 °C for the indicated time (0 - 60 minutes). The longer the incubation time at 95 °C, the more the mRNA was degraded. 100 nanograms of mRNA was loaded onto a TAE agarose gel (1% bleach). Next, 12.4 ng of mRNA and 500-fold molar excess of dT30 (total volume 10 μl) were denatured / annealed at 70 °C for 2 minutes in a thermocycler and cooled to room temperature. Next, mRNA only, mRNA:dT30 hybrid, and dT30 only were incubated with PNPase at 37 °C for 60 minutes in a 30 μl reaction mixture (2.49 ng sample, PNPase buffer, 1.41 ng PNPase, RNase-free water). Finally, 1 μl of this mixture was mixed with 55 μl of water and 5 μl of Lucipac A3 reagent, and luminescence measurement was performed with a Tecan plate reader using a white NUNCLON 96-well plate. The degradation rate was calculated by the formula (degradation rate - background) / (poly(A) - background).

[0143] The results of this example regarding the mRNA:dT30 hybrid are shown in Figure 8. This example demonstrates that the signal obtained from RNA fragments derived from non-poly(A) correlates with RNA degradation. Since an excess of dT30 was used, the signal from the poly(A) tail was (basically) absent.

[0144] Other examples Example 9 - Complementary oligonucleotides suppress PNPase activity The results of this example are shown in Figure 12. Intact mRNA (12.4 ng) was incubated at 70 °C for 2 minutes with three types of 500-fold molar excess of oligo(T30) or without adding oligo(T30). After cooling, these samples were incubated at 37 °C for 60 minutes in the presence or absence of PNPase and PNPase buffer. The reaction mixture (containing 6.2 ng of mRNA) was transferred to a Nunclon 96-well plate, and Lucipac A3 reagent was added. Finally, luminescence measurement was performed with a Tecan plate reader 5 minutes later.

[0145] These results indicate that intact mRNA generates luminescence only in the presence of PNPase, and the addition of oligo(T30) almost suppresses signal generation to the baseline. Furthermore, even when using three different batches of oligo(T30), the signal variation is limited. These data confirm the data in Figure 5 using a 5-fold molar excess of T30 (similarly in this example, a 500-fold molar excess of T30 was used).

[0146] Example 10 - RNase R is inhibited by annealing oligo(T30) to the mRNA to be analyzed. Either LNA or DNA chemical synthesis can be used for T30. The results of this example are shown in Figure 13. The mRNA was thermally decomposed at 95°C for 10 minutes. After cooling, this decomposed mRNA was mixed at different ratios with intact mRNA regardless of the addition of locked nucleic acid oligo(T30) (LNA, Figure 13A) or deoxyribonucleic acid oligo(T30) (DNA, Figure 13B). After annealing at 60°C for 2 minutes, it was gradually cooled to room temperature and incubated at 37°C for 60 minutes in RNase R buffer using RNase R (Abcam#ab286929, final concentration 0.023 U / μl) according to the manufacturer's instructions. 5 μl of these samples was mixed with 15 μl of Lucipac A3 reagent and 40 μl of dH2O, and then luminescence was measured with a Tecan plate reader. The relative degradation rate was calculated by dividing the luminescence of the annealed mRNA by the luminescence of the non-annealed mRNA. As a result, RNase R (Vincent and Deutscher, J Biol Chem (2006) Oct 6; 281(40):29769-75), a 3'-5' exoribonuclease, was shown to be inhibited by annealing oligo(T30) to the mRNA to be analyzed, and either LNA or DNA chemical substances can be used for T30.

[0147] Example 11 - High molar excess of oligo inhibits digestion by exonuclease T in a dose-dependent manner The results of this example are shown in Fig. 14. The mRNA was thermally decomposed at 95°C for 10 minutes. This decomposed mRNA was annealed (at 65°C for 2 minutes) to different molar amounts of oligo (T30) with both DNA chemistry (T30) and locked nucleic acid chemistry (T30LNA). These mixtures were subjected to exonuclease T digestion (at 25°C for 60 minutes, inactivating the enzyme at 65°C for 7 minutes), after which Lucipac A3 reagent was added and luminescence was read using a Tecan plate reader. As a result, it was found that the higher the molar excess of oligos with different chemical properties (i.e., T30 and T30LNA oligos), the more the digestion by exonuclease T was inhibited in a dose-dependent manner.

[0148] Example 12 - The present invention has sufficient sensitivity to detect degradation under mild conditions. The results of this example are shown in Fig. 15. The mRNA was thermally decomposed at 70°C for 10 minutes, annealed (at room temperature for 10 minutes) to a 1000-fold molar excess of oligo (T30), mixed at different ratios with intact mRNA, subjected to PNPase digestion (at 37°C for 60 minutes), after which Lucipac A3 reagent was added and luminescence was read using a Tecan plate reader. Even under such very mild thermal decomposition conditions, the result was that the luminescence signal increased as more decomposed mRNA was present in the sample. Under such conditions, such a difference could not be detected by capillary gel electrophoresis using the method of Raffaele et al. Electrophoresis 2022 May;43(9-10):1101-1106.

[0149] Example 13 - Luminescence in a PNPase-based assay using various excess amounts of T30 and mild degradation conditions The results of this example are shown in Figure 16. mRNA was thermally decomposed at 70 °C for 10 minutes and mixed at different ratios with intact mRNA (a total of 12 ng of input mRNA per sample). Next, 1000-fold, 2000-fold, and 3000-fold molar excesses of oligo(T30) were added to the mRNA samples and annealed at room temperature for 10 minutes. After a short centrifugation, PNPase was added to the PNPase buffer, incubated at 37 °C for 10 minutes, and then Lucipac A3 reagent was added, and luminescence was measured with a Tecan plate reader. These results confirmed (a) the difference in luminescence output between intact mRNA and mildly thermally decomposed mRNA at 70 °C, (b) that a difference in luminescence can be obtained by digesting the mRNA sample for only 10 minutes, and (c) that no significant signal improvement was seen even when adding more than 1000-fold T30.

[0150] Example 14 - When more non-tail mRNA fragments are present and available for digestion, the assay outputs higher luminescence. The results of this example are shown in Figure 17. Figure 17A: 12 nanograms of mRNA was mixed with 60 nt RNA oligo at different molar ratios in the presence of 1000-fold molar excess of oligo(T30) and annealed to the mRNA at room temperature for 10 minutes. Next, PNPase in PNPase buffer was added to each mRNA sample, incubated at 37 °C for 5 minutes, then Lucipac A3 reagent was added, and luminescence was measured with a Tecan plate reader. Figure 17B: Various molar excess amounts of RNA oligo were mixed with intact mRNA and treated as in the RNA in the left figure. Overall, these experiments mimic the increase in the number of RNA fragments generated by mRNA degradation. As a result, similar to thermally decomposed mRNA, this assay method was shown to output higher luminescence when more non-tail mRNA fragments are present.

[0151] Example 15 - Using 5´→3´ exoribonuclease XRN-1, AMP can be released from decapped mRNA. The results of this example are shown in Fig. 18. The mRNA was decapped using DCP-1 to generate 5'-monophosphate mRNA. This decapped mRNA was mixed with capped mRNA at different ratios (0-16%). Next, an oligonucleotide (GGGTTCTCTCTGAGTCTGT (SEQ ID NO: 4)) complementary to the 5'UTR was annealed to the mRNA of interest (at 60 °C for 2 minutes) to prevent the generation of excessive signals. This mixture was incubated with 5'-3' exoribonuclease 1 (XRN-1) at 37 °C for 10 minutes according to the manufacturer's specifications (NEB #M0338S). Finally, Lucipac A3 reagent was added, and luminescence was measured using a Tecan plate reader. These results indicate that XRN-1 can be used to release AMP from uncapped mRNA. As a result, this AMP is converted into measurable luminescence and can be correlated with the proportion of decapped mRNA in the sample.

Claims

**Claim 1** A method for analyzing ssRNA in a sample, comprising: (a) contacting the sample with a probe, wherein the probe binds to a target region of ssRNA in the sample; (b) incubating the sample with a single-strand specific exoribonuclease; and (c) detecting nucleotides and / or nucleosides generated in step (b), wherein the nucleotides and / or nucleosides are derived from one or more RNA regions located outside the target region of ssRNA in the sample. **Claim 2** The method according to claim 1, wherein the nucleotides and / or nucleosides are adenosine, adenosine monophosphate, adenosine diphosphate, or a combination thereof, preferably adenosine monophosphate, adenosine diphosphate, or a combination thereof. **Claim 3** The method according to claim 1 or 2, wherein the detection step relies on light output. **Claim 4** The method according to any one of claims 1 to 3, wherein the detection step uses an enzyme-reagent mixture, preferably the enzyme-reagent mixture comprises luciferase, more preferably pyruvate orthophosphate dikinase and / or pyruvate kinase. **Claim 5** The method according to any one of claims 1 to 4, wherein the probe is an oligonucleotide probe, preferably a DNA or RNA oligonucleotide probe, more preferably a DNA oligonucleotide probe. **Claim 6** The method according to claim 5, wherein the oligonucleotide has a length of 15 to 100 nucleotides, preferably 20 to 60 nucleotides. **Claim 7** The method according to any one of claims 1 to 4, wherein the probe is an RNA-binding protein. **Claim 8** The method according to any one of claims 1 to 7, wherein the exoribonuclease is a 3'→5' exoribonuclease. **Claim 9** The method according to claim 8, wherein the ssRNA contains a poly(A) tail and the target region of the ssRNA is the poly(A) tail. **Claim 10** The method according to claim 8, wherein the ssRNA contains a poly(A) tail and the target region of the ssRNA is immediately upstream of the poly(A) tail or spans the 5' end of the poly(A) tail. **Claim 11** The method according to any one of claims 1 to 7, wherein the exoribonuclease is a 5'→3' exoribonuclease. **Claim 12** The method according to claim 11, wherein the target region of the ssRNA is located at or near the 5'-end of the ssRNA.

13. The method according to any one of claims 1 to 12, wherein the exoribonuclease is a hydrolytic exoribonuclease or a phosphorolytic exoribonuclease.

14. The method according to any one of claims 1 to 13, comprising performing a further method on the same sample material, wherein step (a) defined in any one of claims 1 to 13 is not performed, but steps (b) and (c) defined in any one of claims 1 to 13 are performed.

15. The method according to any one of claims 1 to 14, wherein the method is for measuring the binding efficiency of a probe to the ssRNA.

16. The method according to any one of claims 1 to 15, wherein the method is for analyzing the secondary structure within the ssRNA, preferably stem-loop or hairpin formation within the ssRNA.

17. The method according to any one of claims 1 to 16, wherein the ssRNA contains one or more modified nucleotides, preferably one or more modified nucleotides contain N1-methylpseudouridine.

18. A kit for performing the ssRNA analysis method according to any one of claims 1 to 17, the kit comprising a probe defined in any one of claims 1 to 17 and an exoribonuclease defined in any one of claims 1 to 17, and optionally, an enzyme-reagent mixture for detecting nucleotides and / or nucleosides.