Adapter Trimming and Determination in Next-Generation Sequencing Data Analysis

Abstract

Embodiments of a system, apparatus, method, and / or computer program product, and / or combinations and sub - combinations thereof are provided herein, which enable adapter trimming and / or adapter determination during sequencing data analysis. Based on a plurality of match scores, one or more sequence alignments are selected. Each of the plurality of match scores may be based on the number of first matched bases and the number of second total bases. First and second consensus positions are generated from one or more sequence alignments. The trimming position is determined based on the first and second consensus positions and the first and second consensus match scores.

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 350,290, filed on June 8, 2022, the entire content of which is incorporated herein by reference.

[0002] The present disclosure relates to adapter trimming in DNA sequencing reads, specifically, to adapter trimming / determination in paired - end DNA sequencing reads.

Background Art

[0003] In next - generation sequencing (NGS) or NGS - like applications such as sequencing - by - synthesis, sequencing - by - ligation, or sequencing - by - ligation activity, trimming of adapters (or equivalent adapters, primers, or linkers) from read data is a pre - processing step during sequencing data analysis. An adapter is a short, chemically synthesized, single - stranded or double - stranded oligonucleotide that is added to one or both ends of a sequencing read. Adapters can perform various functions including identifying the end(s) of a sequencing read and tethering DNA fragments to a flow cell. Untrimmed adapters within read data can appear as errors in downstream data analysis. Whether a read is sequenced into an adapter and, if so, how many bases of the adapter are included in the read are unknown beforehand. There is a need for an adapter trimming method that can accurately and efficiently determine the trimming position so that all bases from the adapter(s) are trimmed without accidentally trimming any bases from the actual sequencing data.

Summary of the Invention

[0004] Embodiments of a system, apparatus, method, and / or computer program product, and / or combinations and sub - combinations thereof are provided herein that enable adapter trimming and / or adapter determination during sequencing data analysis. Sequencing reads can be derived from different sequencing techniques.

[0005] As a specific application of such, embodiments of a method, system, and medium for adapter trimming and / or determination from sequencing reads are provided herein so that sequencing results can be accurately and reliably generated.

[0006] Other embodiments of these aspects include corresponding computer systems, apparatuses, and computer program products recorded on a computer storage device(s) configured to execute method actions or operations, alone or in combination. For a computer system configured to execute an operation or action, the computer system has software, firmware, hardware, or a combination thereof installed thereon that causes the computer system to execute the operation or action during operation. For a computer program product configured to execute an operation or action, the computer program product includes instructions that, when executed by a hardware processor, cause the hardware processor to execute the operation or action.

[0007] Further embodiments, features, and advantages of the present disclosure, and the structure and operation of the various embodiments of the present disclosure, are described in detail below with reference to the accompanying drawings.

[0008] The accompanying drawings, which are incorporated herein and form a part of this specification, illustrate embodiments of the present disclosure and, together with the description, further serve to explain the principles of the present disclosure and to enable one of ordinary skill in the art(s) to make and use the embodiments.

Brief Description of the Drawings

[0009]

Figure 1

Figure 2

Figure 3A

Figure 3B

Figure 4

Figure 5A

Figure 5B

Figure 6A

Figure 6B

Figure 6C

Figure 6D

Figure 6E

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

[0010] In the drawings, like reference numerals generally indicate the same or similar elements. Additionally, generally, the leftmost digit(s) of a reference numeral identify the drawing in which the reference numeral first appears.

Embodiments for Carrying Out the Invention

[0011] Embodiments of systems, devices, methods, and / or computer program products, and / or combinations and sub-combinations thereof are provided herein, which enable adapter trimming and / or adapter determination of sequencing reads to generate accurate sequencing results. The techniques disclosed herein can be used for sequencing reads obtained from various imaging techniques and / or sequencing techniques. The techniques can be used for sequencing reads obtained from various sequencing samples including two-dimensional (2D) and / or three-dimensional (3D) samples. The techniques disclosed herein are useful for excluding adapter(s) in sequencing read results in next-generation sequencing (NGS), and NGS sequencing reads are used as the main examples in this specification to illustrate the application of these techniques. However, such adapter trimming techniques may also be useful in other applications.

[0012] In DNA sequencing, identifying the centers of clusters or colonies (often formed on beads) is sometimes referred to as primary analysis. Primary analysis can include base calling in which bases in a sequencing read are identified such that they form an ordered sequence of different bases such as adenine (A), cytosine (C), guanine (G), and thymine (T). After primary analysis, and more specifically after base calling, embodiments of the techniques disclosed herein can be used for adapter trimming of the sequencing reads. There are various algorithms for adapter trimming. These existing algorithms have various drawbacks. For example, existing algorithms are not adapted to directly manipulate the sequencing read output from a sequencer, and it can take a long time, on the scale of at least several hours, to trim an adapter. As another example, adapter trimming that uses alignment accuracy as a threshold may not provide reliable results as a 0.8 accuracy threshold can be met by 4 matches out of 5 bases, but may not be met by 32 matches out of 64 bases. However, the probability that 32 out of 64 bases match randomly is lower than 4 out of 5 bases. Additionally, when sequencing data includes indels, existing methods rely on complex indel handling and additional trimming operations that impose additional computational cost and time consumption to trim an adapter when indels are present.

[0013] Embodiments of the techniques disclosed herein advantageously utilize random matching and probability distributions, such as binomial distributions, to replace accuracy thresholds in existing methods and determine the likelihood that a matched base did not occur by random chance. Embodiments of the techniques disclosed herein, after being output from a sequencer, advantageously work to sequence reads directly in binary format so as to eliminate the need to process the output from the sequencer to other formats and save computational time when performing binary operations in an adapter trimming operation. Embodiments of the adapter trimming techniques disclosed herein utilize two, three, or four alignments obtained from forward and reverse reads in paired-end sequencing and eliminate the need for additional indel processing since indel handling is specific to the trimming method, such that indels in the insert or adapter only affect a portion rather than all of the alignments being used and the trimming positions can still be accurately identified. Thus, the techniques enable a significant reduction in computational complexity and computational time, e.g., from several hours to less than 10 minutes and even down to seconds, and improved accuracy over existing methods.

[0014] Embodiments of the techniques disclosed herein also advantageously determine adapter sequences based on the determination of possible adapter positions and the similarity of candidate adapter sequences. The determination of adapter sequences using embodiments of the methods disclosed herein can be used to facilitate sequencing applications that use different sequencing kits or chemistries that rely on different adapters. The determination of adapter sequences using embodiments of the methods disclosed herein can be utilized to check the accuracy and reliability of the adapter sequences (e.g., manually entered into sequencing parameters) before any subsequent analysis is performed. Embodiments of the adapter determination methods disclosed herein also advantageously facilitate accurate adapter trimming and, as a result, can improve adapter-induced errors (s) in secondary analysis.

[0015] Sequencing System FIG. 1 shows a block diagram of a system 100 implemented on a computer for generating sequencing reads and performing adapter trimming and / or adapter determination according to one or more embodiments disclosed herein. System 100 has a sequencing system 110 that includes a flow cell 112, a sequencer 114, an imager 116, a data storage 122, and a user interface 124. The sequencing system 110 can be connected to a cloud 130. The sequencing system 110 can include one or more of a dedicated processor 118, one or more field programmable gate arrays (FPGAs) 120, and a computer system 126.

[0016] In some embodiments, the flow cell 112 is configured to capture DNA fragments and form a DNA sequence for base calling on the flow cell. The flow cell 112 can include a support disclosed herein. The support can be a solid support. The support can include a surface coating thereon as disclosed herein. The surface coating can be a polymer coating disclosed herein.

[0017] The flow cell 112 can include a plurality of tiles or image regions thereon, and each tile can be divided into a grid of sub-tiles. Each sub-tile can include a plurality of clusters or colonies thereon. As a non-limiting example, the flow cell can have 424 tiles, and each tile can be divided into a 6×9 grid, thus 54 sub-tiles. A flow cell image disclosed herein can be an image that includes signals of a plurality of clusters or colonies. The flow cell image can include one or more tiles of signals, or one or more sub-tiles of signals. In some embodiments, the flow cell image can be an image that includes all tiles and substantially all signals thereon. The flow cell image can be obtained from a channel during an imaging cycle or a sequencing cycle using imager 116. In some embodiments, each tile can include millions of colonies or clusters. As a non-limiting example, a tile can include from about 1,000 to 10 million clusters or colonies. Each colony can be a collection of many copies of a DNA fragment. In some embodiments, each tile or sub-tile can include millions of colonies or clusters. As a non-limiting example, a tile can include from 1,000 to 10 million clusters or colonies. Each colony can be a collection of many copies of a DNA fragment. In some embodiments, the flow cell image may be an image that includes all tiles and substantially all signals thereon. The flow cell image can be obtained from a channel during an imaging cycle or a sequencing cycle using imager 116.

[0018] When an in-situ sample, e.g., a cell or tissue, is immobilized on a support or a flow cell, the flow cell images can be at multiple z-levels orthogonal to the image plane of the flow cell image. Specifically, for a three-dimensional (3D) sample, e.g., a cell, a tissue, or other in-situ sample, the flow cell image can include multiple z-levels to cover the entire sample(s) in 3D. The z-axis can extend from the objective lens of the optical system disclosed herein to the support, e.g., the flow cell. The axial axis can be orthogonal to the image plane of the flow cell image. Each z-level (s) of the flow cell image can be separated from an adjacent z-level (s) by a predetermined distance, e.g., from about 0.1 um to about 15 um. Each z-level of the flow cell image can be separated from an adjacent level (s) by 1 um to 10 um. At each z-level, the flow cell image can be acquired from one or more sequencing cycles and / or one or more channels. Each flow cell image can include at least a portion of one or more tiles or sub-tiles of the flow cell within its field of view. FIG. 3 shows a portion of a flow cell 112 having a plurality of tiles 290. The image plane is defined by the x-axis and the y-axis. And the z-axis is orthogonal to the x-y plane. The flow cell image, the sample, and the axial axis are described in a Cartesian coordinate system as shown in FIG. 3, but any other coordinate system can be used herein to define spatial positions and relationships. Other coordinate systems can include, but are not limited to, a polar coordinate system, a cylindrical coordinate system, or a spherical coordinate system.

[0019] Sequencer 114 can be configured to flow a nucleotide mixture onto flow cell 112, cleave a blocker from the nucleotide during the flowing step, and perform other steps for forming a DNA sequence on flow cell 112. The nucleotide can have a fluorescent element that emits light or energy at a wavelength indicating the type of nucleotide. Each type of fluorescent element can correspond to a specific nucleotide base (e.g., A, G, C, T). The fluorescent element can emit light in the visible wavelength range. In some embodiments, sequencer 114 and flow cell 112 can be configured to perform various sequencing methods disclosed herein, such as sequencing by avidity.

[0020] For example, a color may be assigned to each nucleotide base. Different types of nucleotides can have different colors. For example, adenine (A) may be red, cytosine (C) may be blue, guanine (G) may be green, and thymine (T) may be yellow. The color or wavelength of the fluorescent element of each nucleotide can be selected based on the wavelength of the light emitted by the fluorescent element such that the nucleotides are distinguishable from each other.

[0021] Imager 116 can be configured to capture an image of flow cell 112 after each flowing step. In one embodiment, imager 116 is a camera configured to capture a digital image, such as an active pixel sensor (CMOS) or a charge-coupled device (CCD) camera. The camera can be configured to capture an image at the wavelength of the fluorescent element bound to the nucleotide. The image can be referred to as a flow cell image.

[0022] In some embodiments, imager 116 can include one or more optical systems disclosed herein. The optical system(s) can be configured to capture an optical signal from the flow cell and generate a corresponding digital image. The digital image can then be used for base calling.

[0023] In one embodiment, images of the flow cell can be captured in groups, and each image in the group is captured at a wavelength or spectrum that matches or includes only one of the fluorescent elements. In another embodiment, the images can be captured as a single image that captures all wavelengths of the fluorescent elements.

[0024] The resolution of imager 116 controls the level of detail in the flow cell image, including the pixel size. In existing systems, this resolution is very important because it controls the accuracy with which the spot search algorithm identifies the polony centers. In some embodiments, the image resolution of the flow cell images disclosed herein can be from about 10 nanometers (nm) to several hundred nm or more. One way to increase the accuracy of spot search is to improve the resolution of imager 116 (e.g., by incorporating a higher resolution camera), or to improve the processing performed on the images captured by imager 116. It is possible to perform the detection of polony centers within pixels other than those detected by the spot search algorithm. These methods can enable an improvement in the detection accuracy of polony centers without increasing the resolution of imager 116. The resolution of the imager may be smaller than existing systems with equivalent performance, which can reduce the cost of sequencing system 110. In some aspects, the resolution of the imager can be the same as existing systems, but through image processing, performance superior to those existing systems can be achieved.

[0025] The image quality of the flow cell image controls the base calling quality. One way to increase the accuracy of base calling is to improve the resolution of imager 116 or to improve the processing performed on the images captured by imager 116 to result in better image quality.

[0026] After base calling is performed, sequencing reads can be output from the system to cloud 130 or computer system 400 using options for specific processing on the base calling results. The sequencing read(s) herein can be forward reads (R1), reverse reads (R2), or both. The sequencing read herein can be an arbitrarily ordered sequence of bases A, T, C, and G.

[0027] In some embodiments, the sequencing reads can be directly transmitted to computer system 126 for adapter trimming.

[0028] These adapter trimming methods can be advantageously executed in parallel within computer system 400 without interference or delay with the existing sequencing workflow of system 100. The results of adapter trimming can be made available for use in generating the user's sequencing results. Some or all of the operations disclosed herein can be advantageously executed by FPGA(s), and data can be communicated between CPU(s) and FPGA(s) to reduce the total operation time from methods that operate without FPGA(s). Further, instead of processing alignments in a standard format such as A, T, C, G, the methods disclosed herein operate advantageously on sequencing data in a binary format where each base is represented by two binary bits, significantly speeding up the adapter trimming process, and trimming can be completed in the range of seconds to minutes depending on the size of the data.

[0029] The operations or actions disclosed herein may be performed by a dedicated processor 118, one or more FPGAs 120, a computing system 126, or a combination thereof. One or more operations or actions in the methods 500, 600 disclosed herein may be performed by a dedicated processor 118, one or more FPGAs 120, a computing system 126, or a combination thereof. In some embodiments, which operations or actions should be performed by a dedicated processor 118, one or more FPGAs 120, a computing system 126, or a combination thereof may be determined based on the computation time for a particular operation(s), the complexity of the computation in a particular operation(s), the need for data transmission between hardware devices, or one or more of their combinations.

[0030] The computing system 126 can include one or more general-purpose processor computers that provide an interface for executing various programs within an operating system such as Windows™ or Linux™. Such operating systems typically provide great flexibility to the user.

[0031] In some embodiments, the dedicated processor 118 may be configured to perform operations in an adapter trimming method. These can be custom processors with specific hardware or instructions for performing their steps, rather than general-purpose processors. The dedicated processor directly executes specific software without an operating system. The lack of an operating system reduces overhead at the expense of the flexibility of what the processor can execute. The dedicated processor may utilize a custom programming language that can be designed to operate more efficiently than software executed on a general-purpose computer. This can increase the speed at which steps are performed and enable real-time processing.

[0032] In some embodiments, the FPGA(s) 120 may be configured to perform the operations of the adapter trimming method herein. The FPGA is programmed as hardware to perform only specific tasks. Software steps may be converted to hardware components using a special programming language. Once the FPGA is programmed, the hardware directly processes the provided digital data without executing software. Instead, the FPGA uses logic gates and registers to process digital data. Since there is no overhead required by an operating system, the FPGA generally processes data faster than a general-purpose computer. Similar to a dedicated processor, this comes at the expense of flexibility.

[0033] Also, without software overhead, the FPGA can operate faster than a dedicated processor, but this depends on the exact processing being performed and on the particular FPGA and dedicated processor.

[0034] A group of FPGA(s) 120 may be configured to execute steps in parallel. For example, some FPGA(s) 120 may be configured to perform processing steps on an image, a set of images, sub-tiles, or selected regions within one or more images. Each FPGA(s) 120 may execute a unique portion of the processing steps simultaneously, reducing the time required to process the data. Thereby, the processing steps can be completed in real time. Further considerations of the use of FPGAs are provided below.

[0035] Since data can be processed as it is received, executing the processing steps in real time can reduce the memory used by the system. This improves over conventional systems that may need to store data before it can be processed, which may require more memory or access to a computer system located within the cloud 130.

[0036] In some embodiments, data storage 122 is used to store information used in the adapter trimming method. This information may include sequencing reads and the adapter itself, or information that may be used during the adapter trimming operation (e.g., pixel intensity, color, etc.). For example, a probability lookup table as disclosed herein may be stored within data storage 122. The DNA sequence determined after adapter trimming may be stored within data storage 122. Compressed and / or uncompressed sequencing data may be stored within the data storage. A FASTQ file may also be stored within data storage 122.

[0037] User interface 124 may be used by a user to operate the sequencing system or to access data stored in data storage 122 or computer system 126.

[0038] Computer system 126 may control the general operation of the sequencing system and may be coupled to user interface 124. It may also perform steps of adapter trimming and its precursor operations, and / or subsequent operations such as base calling, demultiplexing, etc. In some embodiments, computer system 126 is computer system 400 as described in more detail in FIG. 4. Computer system 126 may store information regarding the operation of sequencing system 110, such as configuration information, instructions for operating sequencing system 110, or user information. Computer system 126 may be configured to pass information between sequencing system 110 and cloud 130.

[0039] As discussed above, the sequencing system 110 may have a dedicated processor 118, one or more FPGAs 120, or a computer system 126. The sequencing system may use one, two, or all of these elements to achieve the necessary processing described above. In some embodiments, when these elements are present together, the processing tasks are divided among them. For example, one or more FPGAs 120 may be used to perform adapter trimming, adapter trimming, and some or all of the operations preceding subsequent operations, while the computer system 126 may perform other processing functions for the sequencing system 110. Those skilled in the art will understand that various combinations of these elements enable various system embodiments that balance processing efficiency and speed with the cost of the processing elements.

[0040] The cloud 130 can be a network, remote storage, or some other remote computing system separated from the sequencing system 110. The connection to the cloud 130 can enable access to data stored external to the sequencing system 110 or enable software updates within the sequencing system 110.

[0041] Adapter trimming FIG. 5A shows a flowchart of an exemplary embodiment of a computer-implemented method 500 for adapter trimming of sequencing reads. The method 500 can include some or all of the operations disclosed herein. The operations can be performed in the order described herein, but are not limited thereto.

[0042] Method 500 can be executed by one or more processors disclosed herein. In some embodiments, the processor can include one or more of a processing unit, an integrated circuit, or a combination thereof. For example, the processing unit can include a central processing unit (CPU) and / or a graphics processing unit (GPU). The integrated circuit can include a chip such as a field programmable gate array (FPGA). In some embodiments, the processor can include computing system 400.

[0043] In some embodiments, some or all of the operations in method 500 can be executed by an FPGA(s). In embodiments where some operations are executed by an FPGA(s), the data after the operations executed by the FPGA(s) can be communicated by the FPGA(s) to the CPU(s), such that the CPU(s) can use such data to execute subsequent operation(s) in method 500. Similarly, data can also be transmitted from the CPU(s) to the FPGA(s) for processing by the FPGA(s). In some embodiments, all of the operations in method 500 can be executed by the CPU(s). Alternatively, the operations executed by the CPU(s) can be executed by a dedicated processor or other processors such as a GPU(s). In some embodiments, all of the operations in method 500 can be executed by an FPGA(s).

[0044] In some embodiments, method 500 is configured to trim, clip, or otherwise remove adapters from sequencing reads. The sequencing reads can be determined by analysis of the flow cell images generated by system 100. In some embodiments, method 500 is performed after a primary analysis is performed and after the sequencing reads are generated from system 100. In some embodiments, method 500 is performed after multiplex separation. In some embodiments, method 500 is performed before multiplex separation.

[0045] In some embodiments, method 500 is performed after cycle N is completed, but the sequencing and image acquisition of cycle N+1 have not yet been performed. In some embodiments, method 500 is performed after the entire array run is completed. In some embodiments, cycle N is the current cycle. N can be any non-zero integer. In some embodiments, cycle N is the cycle after the cycle corresponding to the adapter(s). In some embodiments, cycle N can be determined based on the length of the adapter and / or the length of the array insert. The array insert is the portion containing the DNA fragment of interest from the sequencing sample(s). In some embodiments, cycle N can determine whether the length of the insert is, for example, in the range of 100 to 150. For example, N can be any integer from 30 to 300 or 20 to 400. In some embodiments, N is not the last cycle in the sequencing run. In some embodiments, N is in the first half or the first third of the total number of sequencing cycles in the sequencing run. In some embodiments, method 500 is performed while the sequencing run is being performed. In some embodiments, if method 500 is performed and the length of the adapter and / or the length of the array insert are known in advance before cycle N, the result of adapter trimming or adapter determination can be used to determine whether to stop the ongoing sequencing run.

[0046] The flow cell image can be obtained from one of one, two, three, or four or more channels of imager 116 using the optical system disclosed herein. Each flow cell image can include one or more tiles (imaging regions), and each tile can be divided into a plurality of sub-tiles. Each sub-tile can include a plurality of polonies. Each sub-tile can include a plurality of regions, and each region can include a large number of polonies. The flow cell image disclosed herein can be an image obtained using flow cell 112 as shown in FIG. 1.

[0047] Flow cell 112 can include a sample(s) immobilized thereon. The sample(s) can include a plurality of nucleic acid template molecules. The sample(s) can include a 2D or 3D volume sample. The nucleic acid template molecules can be distributed randomly or in various patterns on flow cell 112. In some embodiments, the plurality of polonies or clusters herein may be extracted from a particular region of a tile, e.g., from each sub-tile. In each sub-tile, the polonies can be extracted in a predetermined pattern or randomly.

[0048] In some embodiments, the polynomials or clusters sequenced in a flow cycle can have a particular nucleotide diversity. The nucleotide diversity of a population of nucleic acid molecules, e.g., polynomials or clusters, can refer to the relative proportions of nucleotides A, G, C, and T / U present in each flow cycle. Optimally high or balanced diversity data can generally have approximately equal proportions of all four nucleotides represented in each flow cycle of a sequencing run. Low or unbalanced diversity data generally has a high proportion of a particular nucleotide and a low proportion of other nucleotides in some flow cycles of a sequencing run, e.g., less than 10% of the total number of all four nucleotides. As a result, an image corresponding to a high portion of a particular nucleotide can have more signal spots (polynomials or clusters) than an image corresponding to a low portion of the particular nucleotide. Examples of low or unbalanced diversity data in a flow cycle are that bases A, T, C, G can be approximately 1%, approximately 2%, approximately 1%, and approximately 95% of the total number of polynomials in a flow cycle, respectively. Another example of low or unbalanced diversity data is that bases A, T, C, G of polynomials in a plurality of flow cycles can be approximately 2%, approximately 5%, approximately 10%, and approximately 83%, respectively. In embodiments where low or unbalanced diversity data is present in a particular cycle and imaged for sequencing analysis, base calling is prone to errors, and existing techniques for adapter trimming or determination can fail because errors in base calling can cause insertions or deletions of nucleotide bases in sequence reads.

[0049] In addition to the bias of bases that affect diversity, complexity can also be a factor that affects image alignment. Generally, complexity can indicate the source(s) of the sample(s). A single-stranded sample can include DNA fragments or molecules derived from the same sample region or the same sample source within the genome. A multiplex sample can include DNA fragments or molecules from different sample sources, such as liver, kidney, heart, cancer tissue, etc., or from one or more sample regions within the genome. When the complexity is lower than a numerical value, such as 8 or 16, the signal can be of low diversity. For example, in a 2-cycle sequence, all the colonies are AT or TG or GC or CA. All the bases are 25% of the total number of bases in that cycle, but the complexity is less than 8 and the sequences are not all random. Method 500 can accurately trim and / or determine the adapters even when the sequencing reads are generated from low-diversity data.

[0050] In some embodiments, method 500 (a) a first alignment from aligning the tail 212 of the first sequencing read to the head 221 of the second sequencing read at one or more first positions, (b) a second alignment from aligning the tail 222 of the second sequencing read to the head 211 of the first sequencing read at one or more second positions, (c) a third alignment from aligning the first adapter 213 to the tail 212 of the first sequencing read at one or more third positions, and (d) a fourth alignment from aligning the second adapter 223 to the tail 222 of the second sequencing read at one or more fourth positions, and can include an operation 510 of selecting one or more alignments from the above.

[0051] Figure 2 shows a schematic diagram of an exemplary sequencing read disclosed herein according to some embodiments. The sequencing read 200 can be generated by the system 100 and communicated to a processor within the system 100. Alternatively, the sequencing read can be output by the system 100 to a cloud or processor external to the system 100, such as the computer system 400.

[0052] In some embodiments, each of the first sequencing read 210, the second sequencing read 220, the head 211 of the first sequencing read, the head 221 of the second sequencing read, the tail 212 of the first sequencing read, the tail 222 of the second sequencing read, the first adapter 213, and the second adapter 223 includes a sequence of nucleotide bases. The sequence of nucleotide bases may be an ordered sequence, and each base may be one of four different bases, such as A, G, C, T / U. The sequence of bases may be of low diversity such that one or more bases appear only less than 10% as disclosed herein.

[0053] The sequencing read can be generated, for example, by primary analysis from a paired-end sequencing run. The sequencing read may not yet be demultiplexed. In some embodiments, the sequencing read may be demultiplexed. Each run may include a plurality of paired sequencing reads 200. For example, a single run may include various numbers of sequencing reads, such as 100 to 10 8can include individual sequencing reads. The amount of sequencing data, e.g., 100,000 pairs of end sequencing reads per read, has a length in the range of about 30 bases to about 300 bases, and its processing, handling, and recording require methods, such as those disclosed herein, that are computationally efficient and time-effective to facilitate sequencing analysis, e.g., secondary analysis. In some embodiments, some or all of the sequencing reads 200 in the array run can be processed here using the method 500 for adapter trimming.

[0054] The sequencing reads 200 can include a forward read (R1) 210 and a reverse read (R2) 220. Both the forward read 210 and the reverse read 220 can include an insert having head portions 211, 221 and tail portions 212, 222. The reads 210, 220 can have adapters 213, 223 that are ligated or otherwise attached to the tails 212, 222. The insert is the sequence of bases of interest. In some embodiments, the reads 210, 220 can have adapters that are ligated or otherwise attached to the heads 212, 222 (not shown). In some embodiments, the reads 210, 220 can have adapters that are ligated or otherwise attached to both the heads 211, 221 and the tails 212, 222 (not shown). The first adapter 213 can be a 3' adapter, and the second adapter 223 can be a 5' adapter.

[0055] In some embodiments, the inserts in leads 210, 220 can have various numbers of A, G, C, T / U bases in the range of about 8 bases to about 500 bases. In some embodiments, the inserts in leads 210, 220 can have any number of bases in the range of about 16 bases to about 500 bases. In some embodiments, the inserts in leads 210, 220 can have any number of bases in the range of about 16 bases to about 500 bases. In some embodiments, the inserts in leads 210, 220 can have any number of bases in the range of about 32 bases to about 400 bases. In some embodiments, the inserts in leads 210, 220 can have any number of bases in the range of about 64 bases to about 250 bases. In some embodiments, the insert in the forward lead 210 and the insert in the reverse lead 220 can be of the same length. In some embodiments, the insert in the forward lead 210 and the insert in the reverse lead 220 can be of different lengths.

[0056] In some embodiments, the head 211, 221 and / or the tail 212, 222 can have a number of bases within the range of about 8 bases to about 200 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 can have a number of bases within the range of about 16 bases to about 150 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 can have a number of bases within the range of about 16 bases to about 80 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 can have a number of bases within the range of about 16 bases to about 64 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 have a number of bases within the range of about 16 bases to about 32 bases. In some embodiments, the head 211, 221, and / or the tail 212, 222 have at least 16 bases. In some embodiments, each of the head 211, 221 and the tail 212, 222 can be a different number of bases. In some embodiments, two or more of the head 211, 221 and the tail 212, 222 can have the same number of bases.

[0057] In some embodiments, the first adapter 213 and / or the second adapter 223 have from about 4 bases to about 100 bases. In some embodiments, the first adapter 213 and / or the second adapter 223 have from about 4 bases to about 64 bases. The first adapter or the second adapter can have from about 16 bases to about 64 bases. The first adapter or the second adapter can have from about 16 bases to about 40 bases. In some embodiments, the first adapter 213 and / or the second adapter 223 have about 30, about 31, about 32, about 33, or about 34 bases. In some embodiments, the first adapter 213 and / or the second adapter 223 have 30, 31, 32, 33, or 34 bases. The first adapter 213 and / or the second adapter 223 can have at least 16 bases. The first adapter 213 and the second adapter 223 can have the same number of bases. In some embodiments, the first adapter 213 and the second adapter 223 can have different numbers of bases. For example, the first adapter can have more bases than the second adapter 223.

[0058] In some embodiments, operation 510 can include selecting all four alignments as disclosed herein, namely, a first alignment from (a), a second alignment from (b), a third alignment from (c), and a fourth alignment from (d).

[0059] In some embodiments, selecting a first alignment from aligning the tail 212 of a first sequencing read to the head 221 of a second sequencing read at one or more first positions includes obtaining the reverse complementary bases of the head of the second sequencing read. Subsequently, method 500 can include aligning the reverse complementary bases of the head of the second sequencing read to the tail of the first sequencing read at a position, calculating a match score at that position, and then moving the reverse complementary bases of the head of the second sequencing read relative to the tail of the first sequencing read by one base position and repeating the calculation of the match score at the next position. Repeating such movement and match score calculation relative to each other can cover all positions from aligning one base to aligning all possible bases of the tail of the first sequencing read to the head of the second sequencing read. Thereafter, the first alignment can be selected based on the match scores at the one or more first alignment positions.

[0060] For example, in a sequencing read having 2×20 bases, R1 is CCTCGATCCCAGATCGGAGA, and R2 is CCGATCTGTGATCGAGGAGA, which is the reverse complement of R1 with one sequencing error. The last three bases are bases from the adapter(s). In this embodiment, the head of the R2 read is the reverse complement of the first 10 bases of R2. Thus, the R2 head is CACAGATCGG. The R2 head aligns with the tail of R1 and moves base by base towards the head of R1 (from right to left) at different alignment positions with 1 base aligned and 2 bases aligned. When 10 bases are aligned, since the R2 head can continue to move left, there are multiple alignment positions to align with all different options of the 10 bases of R1. Since the R2 head continues to move base by base, the match score is calculated at each different alignment position. As the R2 head moves base by base towards the head of R1, the total number of match scores of 20 or more can be calculated. The first alignment is determined when the R2 head aligns from the 8th base to the 17th base of R1:

Chemical formula

[0061] The match score is based on the number of first matched bases in the first alignment and the total number of second aligned bases. In this example, there are 9 matched bases out of a total of 10 aligned bases. In some embodiments, the match score is based on the probability that the number of first matched bases does not occur randomly. In some embodiments, the match score is based on the probability that the number of first matched bases over the total number of aligned bases does not occur randomly.

[0062] In some embodiments, the match score includes a probability as a constant subtracted from the cumulative distribution function (CDF) of a variable m. The variable m can have different distributions such as a binomial distribution. The binomial distribution can be determined by the total number n of aligned bases and the probability p of randomly matching bases in the alignment. In this particular example, since p randomly matches bases to 4 different bases, p is 0.25 and the distribution is binomial(n, 0.25). The CDF of the variable m is P(m≥M), where M is the number of matched bases. In some embodiments, the match score is C - P(m≥M), where C is a constant, M is the number of first matched bases, m is a variable having a binomial distribution, binomial(n, p), n is the total number of aligned bases, and p is the probability of randomly matching bases to the number of different bases. When the constant is set to 1 and the match score is greater than about 0.99000, about 0.99900, about 0.99990, or about 0.99999. In some embodiments, the match score is greater than 0.99000, 0.99900, 0.99990, or 0.99999.

[0063] In some embodiments, the variable m can have a binomial distribution. In some embodiments, the base composition can be estimated and a multinomial distribution can be used. In some embodiments, different binomial distributions can be used in each cycle, such that the binomial distribution is scaled by the expected or learned error rate per cycle. If m has a distribution different from the binomial distribution disclosed herein, the match scores and consensus match scores disclosed herein can be determined similarly by replacing the binomial distribution with another distribution.

[0064] In some embodiments, the match score can be selected as the highest among all match scores at possible alignment positions. In some embodiments, the match score can be selected as a score higher than a predetermined threshold. In some embodiments, the match score can be the highest among all match scores and can also satisfy a predetermined threshold. In this specific example, the match score for the first alignment is the highest among all match scores at the possible alignment positions of the tail of the R1 read and the head of the R2 read. The match score is calculated as 1 - P(m≥9), where m has a binomial(10, 0.25) distribution, and the score has a value of 0.999970436.

[0065] Similarly, a second alignment can be determined as the first alignment. The R1 head can be defined similarly as the reverse complement of the first 10 bases of R1. In this specific example, the R1 head is GGGATCGAGG. The second alignment with the highest match score is to align the R1 head from the 8th base to the 17th base of the R2 read as follows:

Chemical formula

[0066] Similarly, the third alignment can be selected from (c) aligning the first adapter 213 to the tail 212 of the first sequencing read at one or more third positions. In this particular example, the third alignment with the highest match score is to align the first adapter from the 10th base to the 20th base of R1 as read below.

Chemical formula

[0067] A fourth alignment from (d) aligning the second adapter 223 to the tail of the second sequencing read 222. In this particular example, the fourth alignment with the highest match score is to align the second adapter from the 17th base to the 20th base of the R2 read as follows.

Chemical formula

[0068] In some embodiments, method 500 can include the acts of obtaining a first sequencing read using a first adapter and obtaining a second sequencing read using a second adapter. The reads can be obtained from the sequencing system 110. More specifically, it can be directly from any processor such as the sequencer 114, the data storage 122, or 120, 118, and / or 126. Alternatively, the reads can be obtained from a cloud 130 external to the sequencing system 110.

[0069] In some embodiments, the sequencing reads are obtained directly such that the format of the bases in the reads does not require additional formatting or preprocessing. For example, the reads can be obtained directly in binary format. Each base in one or more of the head of the first sequencing read, the head of the second sequencing read, the tail of the first sequencing read, the tail of the second sequencing read, the first adapter, and the second adapter can be represented as an integer. Such an integer can be a bitwise integer having a number of binary bits. For example, each base can be represented as a binary number having 4 bits.

[0070] In some embodiments, using bases as binary numbers having multiple bits, reverse complement, base alignment, and determination of matched bases in the operations disclosed herein can be advantageously performed using bitwise arithmetic. Bitwise arithmetic can significantly speed up the operations disclosed herein using different formats of bases compared to the same operations. Bitwise arithmetic can also significantly reduce the computation time compared to existing methods of adapter trimming. For example, the operations here take seconds to minutes to perform adapter trimming, while existing methods may take hours to trim the adapter with lower accuracy than the methods disclosed herein. In some embodiments, method 500 can include operation 520 of generating a first consensus position using the first alignment and the third alignment, and a second consensus position using the second alignment and the fourth alignment.

[0071] In some embodiments, operation 520 includes determining a first adapter position from a first alignment and a second adapter position from a third alignment. The first or second adapter position can indicate where the insertion of the lead end and adapter bases begins. For example, the first adapter position can be that the adapter starts at the 17th base of the R1 lead.

[0072] In response to the determination that the first adapter position matches the second adapter position, operation 520 includes determining the first consensus position as the first adapter position.

[0073] In response to the determination that the first adapter position does not match the second adapter position, either the first adapter position or the second adapter position can be the first consensus position. In this particular example, the first adapter position indicates that the last three bases of the R1 lead are from the adapter. The second adapter position indicates that the last ten bases of the R1 lead are from the adapter. The two adapter positions from the first alignment and the third alignment do not match each other. The first consensus position can be either the first adapter position or the second adapter position. Further steps described herein can be taken to determine which of the first adapter position or the second adapter position can be the first consensus position.

[0074] Method 500 can include an operation of determining a first consensus match score based on the first alignment and the third alignment.

[0075] In response to a determination that the first alignment and the third alignment coincide at the adapter position, the method of determining the first consensus match score may include determining the first consensus match score as 1 - P(m≥M1 + M3) based on the sum of the first matched bases and the sum of the second total bases from the first alignment and the third alignment, where m has a binomial distribution (n1 + n3, p). For example, the match score can be considered as the sum of the number of matched bases and the total number of alignment bases. As a result, in the first alignment, if there are 3 matched bases out of 3 bases and 9 matched bases out of 10 bases respectively, the match score can be 1 - P(m≥12), where m~binomial(13, p) is the sum of 12 matches out of a total of 13 alignment bases.

[0076] In response to a determination that the first alignment and the third alignment do not match at the adapter position, the operation of determining the first consensus match score can include: (1) from the first adapter position obtained from the first alignment, and (2) assuming that the first adapter position is valid, aligning the first adapter to the tail of the first sequencing read at the first adapter position indicated by the first alignment. Based on the sum of the first matched bases and the sum of the second total bases, the first candidate match score can be determined. Continuing to refer to the above example, (1) from the first adapter position, there are 9 matched bases out of 10. From (2), the first adapter is aligned to the tail of the first sequencing read as follows:

Chemical Formula

[0077] The operation of determining the first consensus match score can include determining a second candidate match score based on the total of the first matched bases and the total of the second total bases, from (1) the second adapter position obtained from the third alignment, and (2) assuming the third alignment is valid, aligning the tail of the first sequencing read with the head of the second sequencing read at the second adapter position. Continuing to refer to the above example, (1) from the second adapter position, there are 8 matched bases out of 10. From (2), the tail of the first sequencing read is aligned with the head of the second sequencing read at the second adapter position as follows:

Chemical formula

[0078] The operation of determining the first consensus match score can include selecting a score as the first consensus score from the first and second candidate match scores. The selected score can be the higher score. The selected score can be higher and also satisfy a predetermined threshold. Continuing to refer to the above example, since the first candidate score is higher than the second candidate score, the first consensus score is the first candidate score.

[0079] In some embodiments, operation 520 includes generating a second consensus position using the second alignment and the fourth alignment. In some embodiments, operation 520 includes generating a third adapter position based on the second alignment and generating a fourth adapter position based on the fourth alignment. The third or fourth adapter position can indicate where the insertion of the lead end and adapter base begins. For example, the third adapter position can be that the adapter starts at the 15th base of the R1 read.

[0080] In response to a determination that the third adapter position matches the fourth adapter position, operation 520 includes determining the second consensus position as the third adapter position.

[0081] In response to a determination that the second alignment and the fourth alignment match at the adapter's position, operation 520 includes determining a second consensus match score based on the sum of the third matched bases from the second alignment and the fourth alignment and the sum of the fourth total bases. Continuing to refer to the above example, since the sum of the third matched bases from the second alignment and the fourth alignment is 3 + 9, and the total number of bases is 10 + 30, the second consensus match score is 0.9999994039535522.

[0082] In response to determining that the second alignment and the fourth alignment coincide at the adapter position, operation 520 includes (1) assuming that the second alignment and the (optional) third adapter position are valid, and calculating the total number of third matched bases and the total number of fourth total bases from the third adapter position obtained by aligning the second adapter with the tail of the second sequencing read at the third adapter position. Based on this, a third candidate match score is determined. Operation 520 may further include (1) assuming that the fourth alignment and (2) the fourth adapter position are valid, and calculating the total number of third matched bases and the total number of fourth total bases from the fourth adapter position obtained by aligning the tail of the second sequencing read with the head of the first sequencing read at the fourth adapter position. Based on this, a fourth candidate match score is determined. In some embodiments, operation 520 may further include selecting a score as the second consensus score from the third and fourth candidate match scores. The selected score may be the higher score from the third and fourth candidate match scores. The selected score may also satisfy a predetermined threshold.

[0083] In some embodiments, method 500 includes an operation of determining a trimming position based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score. If the first consensus position and the second consensus position coincide with each other, the trimming position may be determined as the coincident position. In response to determining that the first and second consensus positions are different, then, the position with the higher consensus score can be selected as the trimming position. In the above example, since the first consensus position and the second consensus position indicate that the last three bases from the R1 read and the R2 read are from the adapter and the consensus match scores are the same, the trimming position is shown to be the last three bases. Therefore, the sequenced read after trimming is as follows: R1 read: CCTCGATCCCAGATCGG R2 read: CCGATCTGTGATCGAGG

[0084] In some embodiments, the probability of P(m > M) can be pre - calculated, where m has a binomial distribution (binom(n, p)). For all M in the range [0, n] For m within the range [0, M], P(m > M) or P(m >= M), it can be pre - calculated and stored, for example, in a table. The table can be used as a lookup table such that for each pair of M and n, there is a unique table element corresponding to the pair of values of P(m > M). For example, the lookup table can have a column number corresponding to the value of M and a row number corresponding to the value of n. The pre - calculation of the lookup table can save the calculation time during adapter trimming and can be conveniently reused during execution or across different executions of adapter trimming. In some embodiments, P(m >= M) is the probability of observing at least M matches by random chance out of the total number of n bases (the maximum possible number of matches). P(m > M) is the probability of observing more than M matches by random chance out of the total number of n bases (the maximum possible number of matches).

[0085] In some embodiments, the computer - implemented method 500 can include an operation of performing one or more pre - processing steps before operation 510.

[0086] In some embodiments, this operation of performing one or more pre - processing steps can be performed by an FPGA(s). In some embodiments, the data after the operation can be communicated by the FPGA(s) to the CPU(s), such that the CPU(s) can use such data to perform subsequent operation(s) in method 500.

[0087] One or more preprocessing steps may include background subtraction. Background subtraction is configured to remove at least some background signals that may interfere with the signal of interest, i.e., the image intensity of the polony. The background signal can be noise caused by a plurality of sources including the flow cell 112, the imager 115, the sequencer 114, and other sources. The background subtraction can be adjusted to avoid excessive subtraction.

[0088] One or more preprocessing steps can include image sharpening so that the image intensity of the polony can be optimized considering their surroundings within the flow cell image. For example, a Laplacian of Gaussian (LoG) filter can be used for sharpening.

[0089] One or more preprocessing steps can include image alignment so that the image intensities of the polonies can be aligned relative to each other. For example, the image intensities can be registered to a template as disclosed herein.

[0090] One or more preprocessing steps can include intensity offset adjustment that can remove intensity offsets not removed during background subtraction.

[0091] One or more preprocessing steps may include color correction to remove interference from one channel to another or from other colors.

[0092] One or more preprocessing steps can include phase adjustment and pre-phase adjustment configured to correct the image intensity within a particular cycle by removing intensity biases caused by sequencing of out-of-sync DNA fragments from other fragments either by backward or forward.

[0093] One or more preprocessing steps can include intensity normalization such that the image intensity of the polonies from different channels can be normalized to be within a predetermined range.

[0094] One or more preprocessing steps can include quality score estimation such that the quality of base calling using the flow cell image acquired by imager 116 can be estimated before the actual base calling is performed.

[0095] One or more preprocessing steps can include base calling using various base calling algorithms. After base calling, each polony can have multiple DNA fragments as multiple arrays of bases.

[0096] One or more preprocessing steps can include storing the sequencing reads in an external data storage such as a sequencing system or the cloud. In some embodiments, the sequencing reads can be stored directly in a binary format. In some embodiments, after base calling, the sequencing reads are generated in a binary format and stored directly in the same binary format. Method 500 disclosed herein advantageously can directly perform the adapter trimming operations disclosed herein in binary format without additional processing to hide the binary format from existing adapter trimmers as they typically do.

[0097] In some embodiments, prior to operation 510, method 500 includes an operation of acquiring a plurality of sequencing reads by a processor herein. Such an acquisition operation can include actively acquiring or passively receiving a plurality of sequencing reads after the base calls are generated and recorded. The sequencing reads can be from a completed or ongoing sequencing run. Each sequencing read can be a paired-end sequencing read.

[0098] In some embodiments, method 500 includes the operation of trimming the first sequencing read, the second sequencing read, or both at the trimming position.

[0099] In some embodiments, method 500 includes the operation of converting the trimmed first sequencing read, the trimmed second sequencing read, or both to a predetermined format that is not a binary format.

[0100] In some embodiments, method 500 includes the operation of recording the trimmed first sequencing read, the trimmed second sequencing read, or both in a predetermined format in a data storage that is part of the sequencing system 100 or external to the sequencing system 100. For example, the trimmed sequencing read can be stored in a data storage device on the user's computer system 400 that is external to the sequencing system 100.

[0101] In some embodiments, method 500 includes transmitting the trimmed first sequencing read, the trimmed second sequencing read, or both to a processing unit in a predetermined format. In some embodiments, the trimmed sequencing reads can be transmitted to the user's computer system 400. In some embodiments, the processing unit is a central processing unit (CPU). In some embodiments, the processing unit, e.g., the user's computer 400, is configured to generate a sequencing result for display to the user in a predetermined format based on the trimmed first sequencing read, the trimmed second sequencing read, or both. In some embodiments, method 500 includes generating or outputting a sequencing result that includes a plurality of sequencing reads that the user can rely on to make a genetic determination without errors caused by the adapter(s). The predetermined format is not binary and is a format that is more displayable and more easily perceivable by the user than the binary format.

[0102] Figures 3A - 3B show a simulation of adapter trimming results using an existing adapter trimmer in the methods and simulated sequencing runs disclosed herein. "b2f(PE)" represents the method disclosed herein using four alignments selected from (a) - (d) in operation 510. "b2f(naive)" represents the "naive" method using four alignments selected from (a) - (d) in operation 510, having a precision threshold such that, for example, bases with 90% match are higher than bases with 70% match without using random matching and binomial distribution. "cutadapt" and "fastp" are two existing adapter trimming methods. Table 1 shows that the method disclosed herein has the highest sensitivity and highest phi coefficient among all four methods being compared in a simulated sequencing run having approximately 20k paired - end reads. The phi coefficient is a parameter that can indicate the quality of trimming calculated based on a confusion matrix including true positives, true negatives, false positives, and false negatives. The specificity of the method disclosed herein is the second highest. However, the calculation time or execution time of this method is only in the range of a few seconds to less than 10 minutes, while "cutadapt" and "fastp" can take at least several hours.

[0103] The method disclosed herein advantageously eliminates the need for additional indel processing for adapter trimming. The indel processing can be specific to the method disclosed herein. For example, if an indel is present within the adapter, the third and fourth alignments from (c) and (d) can be affected, thereby compromising the corresponding match scores. However, the first and second alignments (a) and (b) are not affected and can thus generate high match scores for accurate estimates of the adapter position. If there is an indel in the insert but not in the adapter, the first and second alignments (a) and (b) can be affected by the indel, but the other alignments can still generate accurate estimates of the adapter position. Table 2 (Figure 3A) shows the quality of adapter trimming in a simulated sequencing run with approximately 100k paired-end reads in the presence of indels, i.e., insertions and / or deletions in the adapter and insert. The method disclosed herein has the highest sensitivity and highest phi coefficient among all four methods compared. The computational or execution time of this method is only in the range of seconds to less than 10 minutes, while "cutadapt" and "fastp" can take at least several hours.

[0104] The method disclosed herein functions advantageously with asymmetric read lengths when indels can occur anywhere within the read(s). In a simulated sequencing run with approximately 100k paired-end reads, the length of the reads (or number of sequencing cycles) can vary from approximately 70 bases to approximately 180 bases. Table 3 (Figure 3B) shows that the method disclosed herein has the highest sensitivity and highest phi coefficient among all four methods compared, and the specificity is the second highest among the four different methods.

[0105] Figure 6A shows the receiver operating characteristic (ROC) curve of the method disclosed herein compared to other existing methods when analyzing the same adapter trimming dataset. The ROC curve is generated by plotting the true positive rate against the false positive rate at various threshold settings. The ROC curve can show sensitivity or recall as a function of fall-out(s). Different simulation runs are executed at different match score thresholds. The "b2f-PE" precision thresholds are as follows: 0.995, 0.999, 0.9995, 0.9999, 0.99995, 0.99999, 0.999999, 0.9999999, and 0.99999999, for each separate simulation sequencing run. The "b2f-naieve precision thresholds are as follows: 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, and 0.95. The maximum error for "cutadapt" is set as follows: 0.5, 0.45, 0.4, 0.35, 0.3, 0.25, 0.2, 0.15, 0.1, and 0.05. There is no precision threshold for "fastp". The method disclosed herein, labeled as "bases2fastq-PE", has the best ROC curve among all four methods, showing better performance than the existing methods in terms of its precision and sensitivity.

[0106] Figures 6B - 6E show a comparison of the sensitivity among four different methods in the case of indel scenarios that include deletions within the adapter (Figure 6B), inserts within the adapter (Figure 6C), deletions within the insert (Figure 6D), and inserts within the insert across different insert sizes in simulated runs (Figure 6E). The method disclosed herein, namely "b2f_PE", has the highest sensitivity among all methods across different insert sizes in different indel scenarios.

[0107] The embodiments disclosed herein focus on the adapter attached to the tail or 3' end of the sequencing read. However, in embodiments where the adapter is attached to the head or 5' end of the sequencing read, the third alignment is selected from (c) aligning the first adapter to the head of the first sequencing read at one or more third positions, and the fourth alignment is selected from (d) aligning the second adapter to the head of the second sequencing read at one or more fourth positions in operation 510. It should be noted that the operations can be performed similarly by changing the third alignment and the fourth alignment correspondingly by aligning the adapter to the head of the sequencing read.

[0108] In some embodiments, operation 510 can include selecting all four alignments as disclosed herein, namely, the first alignment from (a), the second alignment from (b), the third alignment from (c), and the fourth alignment from (d).

[0109] In some embodiments, operation 510 may be simplified to include selecting less than four alignments, for example, three alignments. In some embodiments, the three alignments can be as follows: the first alignment from (a), the second alignment from (b), and the third alignment from (c), the first alignment from (a), the third alignment from (c), and the fourth alignment from (d), the first alignment from (a), the second alignment from (b), and the fourth alignment from (d), or the second alignment from (b), the third alignment from (c), and the fourth alignment from (d). In embodiments using three alignments, if only one alignment is available instead of two alignments, the operation 520 of generating the first consensus position or the second consensus position can be simplified, and the sum of the matched bases and the sum of the total bases are replaced by the matched bases and the total bases from the single available alignment. For example, if the first consensus position is calculated based on the first and third alignments and the third alignment is not used, it is determined from the first alignment instead of the summed bases. Similarly, the operation of determining the first consensus match score and / or the second consensus match score is equivalent to determining the match score of a single available alignment instead of using both alignments. Other operations with three alignments may remain the same as the method using four alignments.

[0110] Using two or three alignments instead of four alignments can simplify the method and reduce the computational burden and time for performing the adapter trimming operation. However, errors are more likely to occur, and the results may not be as accurate as when using four alignments.

[0111] Determination of Adapter FIG. 5B shows a flowchart of a computer-executed method 600 for adapter determination after base calls are generated during sequencing analysis, according to some embodiments. Method 600 can include some or all of the operations disclosed herein. The operations can be executed in the order described herein, but are not limited thereto.

[0112] Method 600 can be executed by one or more processors disclosed herein. In some embodiments, the processor can include one or more of a processing unit, an integrated circuit, or a combination thereof. For example, the processing unit can include a central processing unit (CPU) and / or a graphics processing unit (GPU). The integrated circuit can include a chip such as a field programmable gate array (FPGA). In some embodiments, the processor can include computing system 400.

[0113] In some embodiments, some or all of the operations in method 600 can be executed by an FPGA(s). In embodiments where some operations are executed by an FPGA(s), the data after the operations executed by the FPGA(s) can be communicated by the FPGA(s) to the CPU(s), such that the CPU(s) can use such data to execute subsequent operation(s) in method 600. Similarly, data can also be transmitted from the CPU(s) to the FPGA(s) for processing by the FPGA(s). In some embodiments, all of the operations in method 600 can be executed by the CPU(s). Alternatively, the operations executed by the CPU(s) can be executed by a dedicated processor, or another processor such as a GPU(s). In some embodiments, all of the operations in method 600 can be executed by an FPGA(s).

[0114] In some embodiments, method 600 is executed after cycle N is completed, but the sequencing and image acquisition of cycle N+1 have not yet been executed. Method 600 is executed after the entire array execution is completed. In some embodiments, cycle N is the current cycle. N can be any non-zero integer. In some embodiments, cycle N can be determined based on the length of the adapter and / or the length of the array insert. In some embodiments, cycle N is the cycle after the cycle corresponding to the adapter(s). In some embodiments, cycle N can determine whether the length of the insert is, for example, within the range of 100 to 150. For example, N can be any integer from 30 to 300 or from 20 to 400. In some embodiments, N is not the last cycle in the sequencing run. In some embodiments, N is in the first half or the first third of the total number of sequencing cycles in the sequencing run. In some embodiments, method 600 is executed while the sequencing execution is being performed. In some embodiments, if method 600 is executed and the length of the adapter or the insert is known in advance before cycle N, then to determine whether it is during the sequencing execution, it is determined whether the result of adapter trimming or adapter determination should be stopped.

[0115] Method 600 can include, by a processor herein, an operation 610 of obtaining a plurality of sequencing reads. The sequencing reads can be from a completed or ongoing sequencing execution. Each sequencing read can be a paired-end sequencing read. Each paired-end sequencing read can include a first and a second sequencing read, and each of the first and second sequencing reads includes a sequence of nucleotide bases. FIG. 2 shows an exemplary paired-end sequencing read, namely, read 1 (R1) and read 2 (R2).

[0116] Sequencing reads can be generated by system 100 and communicated to a processor within system 100. Alternatively, sequencing reads can be output by system 100 to a cloud or processor external to system 100, such as computer system 400.

[0117] Sequencing reads can be generated, for example, by single-pass analysis from a paired-end sequencing run. The sequencing reads may not yet be demultiplexed. In some embodiments, the sequencing reads may not be multiplexed. Each array run can include a plurality of paired sequencing reads. For example, a single run can include various numbers of sequencing reads, such as 100 to 10 8 thousand sequencing reads. The amount of sequencing data, such as 100,000 pairs of end sequencing reads per read, has a length in the range of about 30 bases to about 300 bases, and its processing, handling, and recording require methods such as those disclosed herein that are computationally efficient and time-effective to facilitate sequencing analysis, such as secondary analysis.

[0118] FIG. 2 shows a schematic diagram of paired-end sequencing reads according to embodiments disclosed herein. In some embodiments, each of the first sequencing read 210, the second sequencing read 220, the head of the first sequencing read 211, the head of the second sequencing read 221, the tail of the first sequencing read 212, the tail of the second sequencing read 222, the first adapter 213, and the second adapter 223 includes a sequence of nucleotide bases. The sequence of bases can be an ordered sequence, and each base can be one of four different bases, namely, A, G, C, T / U. Each read of the sequence can include bases per cycle per polony or cluster. The sequence of bases can have low or unbalanced diversity in one or more cycles such that one or more types of bases are less than 10%, 8%, 5%, or 2% of the total number of bases in that cycle.

[0119] The sequencing read 200 can be from a paired-end sequencing run. Each run can include a plurality of paired sequencing reads 200. For example, a single run can include about 100k paired-end sequencing reads. The sequencing data with each read, e.g., the amount of 100k paired-end sequencing reads, has a length in the range of about 50 bases to about 400 bases, and its processing, handling, and recording require computationally efficient and time-effective methods such as the methods disclosed herein. The sequencing read 200 can include a forward read (R1) 210 and a reverse read (R2) 220. Both the forward read 210 and the reverse read 220 can include an insert having head portions 211, 221 and tail portions 212, 222. The reads 210, 220 can have adapters 213, 223 that are ligated or otherwise attached to the tails 212, 222. The insert is the sequence of bases of interest. In some embodiments, the reads 210, 220 can have adapters that are ligated or otherwise attached to the heads 212, 222 (not shown). In some embodiments, the reads 210, 220 can have adapters that are ligated or otherwise attached to both the heads 211, 221 and the tails 212, 222 (not shown). The first adapter 213 can be a 3' adapter and the second adapter 223 can be a 5' adapter.

[0120] In some embodiments, the inserts in leads 210, 220 can have any number of bases in the range of about 8 bases to about 400 bases. In some embodiments, the inserts in leads 210, 220 can have any number of bases in the range of about 16 bases to about 400 bases. In some embodiments, the inserts in leads 210, 220 can have any number of bases in the range of about 16 bases to about 300 bases. In some embodiments, the inserts in leads 210, 220 can have any number of bases in the range of about 32 bases to about 200 bases. In some embodiments, the inserts in leads 210, 220 can have any number of bases in the range of about 64 bases to about 150 bases. In some embodiments, the insert in the forward lead 210 and the insert in the reverse lead 220 can be of the same length. In some embodiments, the insert in the forward lead 210 and the insert in the reverse lead 220 can be of different lengths.

[0121] In some embodiments, the head 211, 221 and / or the tail 212, 222 can have a number of bases within the range of about 8 bases to about 200 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 can have a number of bases within the range of about 16 bases to about 150 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 can have a number of bases within the range of about 16 bases to about 80 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 can have a number of bases within the range of about 16 bases to about 64 bases. In some embodiments, the head 211, 221 and / or the tail 212, 222 have a number of bases within the range of about 16 bases to about 32 bases. In some embodiments, the head 211, 221, and / or the tail 212, 222 have at least 16 bases. In some embodiments, each of the head 211, 221 and the tail 212, 222 can be a different number of bases. In some embodiments, two or more of the head 211, 221 and the tail 212, 222 can have the same number of bases.

[0122] In some embodiments, the first adapter 213 and / or the second adapter 223 have from about 4 bases to about 100 bases. In some embodiments, the first adapter 213 and / or the second adapter 223 have from about 4 bases to about 64 bases. The first adapter or the second adapter can have from about 16 bases to about 64 bases. The first adapter or the second adapter can have from about 16 bases to about 40 bases. In some embodiments, the first adapter 213 and / or the second adapter 223 have about 30, about 31, about 32, about 33, or about 34 bases. In some embodiments, the first adapter 213 and / or the second adapter 223 have 30, 31, 32, 33, or 34 bases. The first adapter 213 and / or the second adapter 223 can have at least 16 bases. The first adapter 213 and the second adapter 223 can have the same number of bases. In some embodiments, the first adapter 213 and the second adapter 223 can have different numbers of bases. For example, the first adapter can have more bases than the second adapter 223.

[0123] Exemplary first and second sequencing reads are shown as R1 read and R2 read with respect to method 500 herein.

[0124] In some embodiments, method 600 can include (a) a first alignment from aligning the tail 212 of the first sequencing read to the head 221 of the second sequencing read at one or more first positions, and (b) an operation 620 of selecting one or more alignments from a second alignment from aligning the tail 222 of the second sequencing read to the head 211 of the first sequencing read at one or more second positions.

[0125] In some embodiments, operation 620 can include selecting both alignments, i.e., a first alignment from (a) and a second alignment from (b).

[0126] In some embodiments, selecting a first alignment from (a) of aligning the tail 212 of a first sequencing read to the head 221 of a second sequencing read at one or more first positions includes the operation of obtaining the reverse complement bases of the head of the second sequencing read. Thereafter, selecting the first alignment from (a) can include aligning the reverse complement bases of the head of the second sequencing read to the tail of the first sequencing read at a position, calculating a match score at that position, and then moving the reverse complement bases of the head of the second sequencing read relative to the tail of the first sequencing read by one base position and repeating the calculation of the match score at the next position. Repeating such movement and calculation of the match score for the two arrays to align a single base on one end can cover all possible different positions from aligning all possible bases of the tail of the first sequencing read to the head of the second sequencing read, and then realigning a single base on the other end of the sequence of nucleotide bases. Thereafter, the first alignment can be selected based on the match scores at one or more first alignment positions.

[0127] In some embodiments, operation 620 is for the processor to determine the adapter position based on a plurality of match scores, each match score being calculated based on the number of first-matched bases and the number of second total bases at one or more first positions and one or more second positions. The adapter position can be the position of the nucleotide base where the adapter starts and the insert portion of the sequence read ends. The adapter position is estimated using operation 620. In some embodiments, operation 620 includes the processor determining the adapter position based on the maximum match score among the plurality of match scores. In some embodiments, operation 620 includes the processor determining the adapter position based on one or more match scores that meet a predetermined threshold among the plurality of match scores.

[0128] For example, in a sequencing read having 2×20 bases, R1 is CCTCGATCCCAGATCGGAGA and R2 is CCGATCTGTGATCGAGGAGA, which is the reverse complement of R1 with one sequencing error. The last three bases of R1 and R2 as bases from the adapter(s). In this embodiment, the head of the R2 read is the reverse complement of the first 10 bases of R2. Thus, the R2 head is CACAGATCGG. The determined R2 head is then aligned with the tail of R1 and moves (from right to left) towards the head of R1 at different alignment positions, with 1 base aligned and then 2 bases aligned. When 10 bases are aligned, since the R2 head can continue to move left, there are multiple alignment positions to align with all different options of the 10 bases of R1. Since the R2 head continues to move base by base, the match score is calculated at each different alignment position. The first alignment is determined when the R2 head aligns from the 8th base to the 17th base of R1:

Chemical formula

[0129] The match score is based on the number of the first matching bases in the first alignment and the total number of the second aligned bases. In this example, there are 9 matching bases out of the total 10 aligned bases. In some embodiments, the match score is based on the probability that the number of the first matching bases does not occur randomly. In some embodiments, the match score is based on the probability that the number of the first matching bases does not occur randomly over the total number of aligned bases.

[0130] In some embodiments, the match score herein is similarly calculated using the method disclosed with respect to method 500.

[0131] Similarly, as the first alignment, a second alignment can be determined. The R1 head can be similarly defined as the reverse complement of the first 10 bases of R1. In this particular example, the R1 head is GGGATCGAGG. The second alignment with the highest match score is to align the R1 head from the 8th base to the 17th base of the R2 read as follows:

Chemical formula

[0132] Based on the first alignment with the highest score and the second alignment with the highest match score, the adapter position is the 18th to 20th bases of the R1 read and the R2 read. Therefore, the length of the insert determined from both the first and second alignments is the same, which is 17 bases.

[0133] Method 600 may include an operation 630 in which a processor obtains a plurality of adapter arrays from a plurality of paired-end sequencing reads based on the determined adapter positions in operation 620. The adapter array starts with three bases of AGA for both the 3' and 5' adapter arrays at the 18th base of the R1 and R2 reads. The adapter array can be any sequence of bases that is trimmed at the adapter position determined in operation 620.

[0134] In some embodiments, the first and second sequence reads include only one adapter, e.g., either the 3' or 5' adapter. In some embodiments, the first and second sequence reads include two or more different adapters. In some embodiments, the first and second sequence reads include two or more identical adapters. In some embodiments, the adapters herein include 4 to 96 bases. In some embodiments, the adapter includes 6 to 48 bases.

[0135] In some embodiments, method 600 includes an operation 640 in which a processor repeatedly executes one or more operations to determine what the adapter array obtained from operation 630 is until a stop criterion is met. Operation 640 may include an operation 641 of selecting a seed adapter array from a plurality of adapter arrays, an operation 642 of determining one or more adapter arrays among the plurality of adapter arrays that meet a similarity threshold compared to the seed adapter array, an operation 643 of determining a base of A, G, C, or T / U for each base position based on the corresponding base positions of the one or more determined adapter arrays and the corresponding number of different bases at a predetermined threshold, thereby generating individual candidate adapters, and an operation 644 of removing the seed adapter array and the one or more determined adapter arrays from the plurality of adapter arrays.

[0136] In some embodiments, method 600 may further include an operation in which a processor transfers the individual candidate adapters to a memory device, a display, or both.

[0137] The stop criterion can be customized by the user. For example, the stop criterion can be that all adapter arrays have passed operations 641-644 at least once and no other arrays remain from the pool of adapter arrays obtained in operation 630.

[0138] The similarity between two arrays can be determined using various methods. For example, a similar threshold is determined by one or more of the Hamming distance, Smith-Waterman algorithm, and Needleman-Wunsch algorithm. In embodiments where the similarity is determined by the Hamming distance, a Hamming distance of 3 or 4 can be the similarity threshold for an adapter array of 30-40 bases.

[0139] Method 600 may further include an operation 643 of determining a base of A, G, C, or T / U based on the corresponding number of different bases at the corresponding base positions of one or more determined adapter arrays and a predetermined threshold for one or more base positions.

[0140] In response to a determination that n base positions out of the total number of positions do not meet a predetermined threshold, remove the seed adapter array and one or more determined adapter arrays from the plurality of adapter arrays without generating a candidate adapter.

[0141] In some embodiments, the predetermined threshold includes a concordance of 50%, 55%, 60%, or more of the total number of bases at the corresponding base position. In some embodiments, the predetermined threshold further includes that one or more adapter sequences include at least 30, 40, 50, 60, 80, 100, or more sequences. In some embodiments, the predetermined threshold further includes that one or more adapter sequences include at least 30, 40, 50, 60, 80, 100, or more of the same base at a specific base position. For example, at the first base position, there are 55 observations of A out of a total of 60 or more observations, 5 observations of the other 3 types of bases, the predetermined threshold is met with 50 counts of the same base, and the first base position is A. As another example, out of 300 total observations, there are 100 observations of G at the first base position, and since the concordance exceeding 50% is not met, method 600 cannot determine the first base as G. If there are more than a predetermined number of base positions, such as 5, 6, or a plurality of base positions of the adapter that cannot be determined, the seed adapter sequence and one or more determined adapter sequences can be removed from the plurality of adapter sequences without generating candidate adapters. If there are less than a predetermined number of base positions, such as only 1 or 2 base positions of the adapter that cannot be determined, the seed adapter sequence and one or more determined adapter sequences can be removed from the plurality of adapter sequences, and candidate adapter sequences can still be generated at the 1 or 2 undetermined base positions. The predetermined number of undetermined bases can be 1, 2, 3, 4, 5, or more. The predetermined number of undetermined bases can be a percentage of the undetermined bases. For example, the percentage of undetermined bases is less than 20%, 15%, 10%, 5%, 2%, or 1% of the total number of bases. For example, 2 undetermined bases out of 20 total bases are an undetermined percentage of 10% of the bases.

[0142] In some embodiments, method 600 further includes selecting a second seed adapter array from a plurality of adapter arrays, determining one or more second adapter arrays among the plurality of adapter arrays that meet a similarity threshold when compared to the second seed adapter array, and then repeating operations 643-644 for the second seed adapter array.

[0143] In some embodiments, method 600 includes, in response to a determination that there are no adapter arrays among the plurality of adapter arrays that meet a similarity threshold when compared to a second seed adapter array selected from the plurality of adapter arrays, removing the second seed adapter array from the plurality of adapter arrays without generating a candidate adapter.

[0144] Exemplary adapter determination repeat operations 641-644 In this particular embodiment, consider sequencing runs using the following two adapter arrays: AAAA and TTTT.

[0145] Using operations 610 - 630, find the following adapter arrays: 1) AAAG, 2) AATA, 3) AAAA, 4) TGCT, 5) TTTT, 6) TATT, 7) TTTT, 8) AAAA, 9) AAAA, 10) AAAA, 11) TTTT, 12) CTTT, 13) ACAG, and 14) TGTA. In the first iteration of operations 641 - 644, the first array, AAAG, is processed as the seed sequence. The first seed sequence can be randomly selected from the pool of adapter arrays. Using a similarity metric, e.g., Hamming distance, to pass through all other arrays in the pool, the following six arrays match the seed sequence that meets the similarity threshold: AAAG, AATA, AAAA, AAAA, AAAA, and AAAA. For each base that meets the similarity threshold compared to the seed sequence (e.g., within Hamming distance 1 of the seed sequence), determine the number of bases at each base position for each of the four different types of bases. The base counts are determined using a base frequency matrix in this embodiment, which is [the number of base positions by different bases] (4×4 in this case), and the bases are ordered as C, A, G, T. For the six arrays similar to the seed, the matrix is [0,6,0,0, 0,6,0,0, 0,5,0,1, 0,5,1,0]. The first row “0,6,0,0” means that for the first base position, there are 0 C’s, 6 A’s, 0 G’s, and 0 T’s. For each base position or row, when there are at least four observations and at least 75% agreement, determine the base. Thus, the detected adapter is AAAA.

[0146] After determining the first adapter array, remove the seed AAAG and all the arrays that match the seed sequence from the array pool. After removal, the arrays now include: TTCT, TTTT, TATT, TTTT, TTTT, CTTT, ACAG, and TGTA.

[0147] Repeating operations 641 - 644, TTCT is the next seed sequence. The arrays that meet the similarity threshold include: TTCT, TTTT, TATT, TTTT, TTTT, and CTTT.

[0148] The number of bases at each base position is [1,0,0,5,0,1,0,5,1,0,0,5,0,0,0,6]. Using the same predetermined threshold of at least 4 occurrences and 75% match, the detected adapter is TTTT.

[0149] After removing all sequences that match the previous seed, the list of observations becomes two: ACAG and TGTA. Set ACAG as the next seed sequence. Since other sequences that meet the similarity threshold do not match ACAG, ACAG is excluded from the list. And a new iteration begins. Currently, TGTA is set as the seed sequence. However, since there are no more sequences in the pool, TGTA can also be excluded from the pool. And operation 640 completes with a stop criterion that there are no more sequences left in the pool that have not passed through 641 - 644. There are two different detected sequences: AAAA and TTTT. The two different sequences can be transferred to the user and / or used for adapter trimming of the sequence reads.

[0150] In some embodiments, method 600 further includes an operation by a processor to trim individual candidate adapters from a plurality of paired - end sequencing reads, thereby generating a plurality of trimmed sequencing reads. In some embodiments, the trimming operation can be accurate and reliable since the candidate adapter sequence has been determined, and the trimming can be performed only when it is found to exactly match one of the candidate adapter sequences determined in operation 640 at the trimming position. In some embodiments, the trimming operation can be performed with an optional error tolerance. The optional error rate can be customized based on the adapter sequence length, the sequencing kit, or various other factors. For example, the optional error rate can be 1 mismatched base, 1 deletion, 1 insertion, or a combination thereof.

[0151] In some embodiments, method 600 further includes performing a secondary analysis on the plurality of trimmed sequencing reads by a processor. In some embodiments, method 600 further includes transferring the plurality of trimmed sequencing reads to a remote processor for secondary analysis by a processor. In some embodiments, method 600 further includes transferring the plurality of trimmed sequencing reads to a local FPGA within system 100 for secondary analysis by a processor.

[0152] In some embodiments, method 600 further includes trimming the first sequencing read, the second sequencing read, or both at the trimming position, converting the trimmed first sequencing read, the trimmed second sequencing read, or both to a predetermined format by a processor, and recording the trimmed first sequencing read, the trimmed second sequencing read, or both in the predetermined format by a processor. In some embodiments, method 600 further includes transmitting the trimmed first sequencing read, the trimmed second sequencing read, or both to a processing unit in a predetermined format by a processor. The processing unit may be within system 100 or remote from the system.

[0153] In some embodiments, method 600 further includes generating the first sequencing read, the second sequencing read, or both by performing one or more primary analysis steps on the flow cell image by a processor prior to operation 610. The one or more primary analysis steps on the flow cell image include background subtraction, image sharpening, intensity offset adjustment, color correction, intensity normalization, phase and pre-phase correction, image alignment, intensity normalization, quality score estimation, or combinations thereof.

[0154] In some embodiments, in order to reduce the computational complexity and / or improve the computational speed, each base in one or more of the head of the first sequencing read, the head of the second sequencing read, the tail of the first sequencing read, the tail of the second sequencing read, the first adapter, and the second adapter is represented as an integer, an integer in bit units, a fixed number of bits, for example, a binary number having 4 or 8 bits.

[0155] In some embodiments, the methods 500, 600 herein may include providing a plurality of nucleic acid template molecules immobilized on a support, such as a flow cell. Each nucleic acid template molecule may include an insert sequence of interest. The insert sequences can be different in different template molecules. Each template molecule may correspond to a polony of an optical signal within a flow cell image.

[0156] In some embodiments, the methods 500, 600 herein may include generating a flow cell image by performing one or more sequencing reaction cycles on a plurality of nucleic acid template molecules immobilized on a support. The flow cell image can be generated or obtained by the sequencing system disclosed herein. Performing one or more cycles of the sequencing reaction may include contacting a plurality of nucleotide acid template molecules with a plurality of nucleotide reagents including a mixture of different types of nucleotide bases A, G, C, and T / U. Each individual nucleotide reagent may include a different detectable color label corresponding to each different type of nucleotide base.

[0157] In some embodiments, performing one or more cycles of the sequencing reaction can include contacting a plurality of nucleic acid template molecules with a mixture of a plurality of sequencing primers, a plurality of polymerases, and different types of avidityts. Each individual avidityt in the mixture includes a core to which a plurality of nucleotide arms are attached, and each arm of each individual avidityt can include the same type of nucleotide base. In some embodiments, performing one or more cycles of the sequencing reaction includes imaging an optical color signal released from nucleotide reagents bound to a plurality of template molecules in each of the one or more cycles. Imaging of the optical signal can be performed by an optical system disclosed herein, such as imager 116. In some embodiments, performing one or more cycles of the sequencing reaction can include obtaining a flow cell image including an optical color signal released from nucleotide reagents bound to a plurality of template molecules in each cycle of the one or more cycles.

[0158] In some embodiments, the flow cell image includes an optical signal released from nucleotide reagents that bind to the unbalanced diversity of A, G, C, and T / U nucleotide bases among a plurality of nucleic acid template molecules immobilized on a support in one or more cycles. In some embodiments, the plurality of polonies includes an unbalanced diversity of A, G, C, and T / U nucleotide bases, and the unbalanced diversity includes: (1) the number of one or more types of nucleotide bases and (2) the percentage relative to the total number of nucleotide bases, which percentage is less than 20%, less than 15%, less than 10%, or less than 5% in cycle N.

[0159] In some embodiments, methods 500, 600 can include providing a cell sample having a plurality of concatemer molecules immobilized on a support, where each concatemer molecule corresponds to a target RNA of the cell sample.

[0160] In some embodiments, methods 500, 600 may include generating a flow cell image by performing one or more sequencing reaction cycles on a plurality of concatemer molecules immobilized on a support by a sequencing system. Performing one or more cycles of the sequencing reaction may include contacting the plurality of concatemer molecules with a plurality of nucleotide reagents comprising a mixture of different types of nucleotide bases A, G, C, and T / U. Performing one or more cycles of the sequencing reaction may include contacting the plurality of concatemer molecules with a mixture of a plurality of sequencing primers, a plurality of polymerases, and different types of avidites. Each individual avidite in the mixture includes a core to which a plurality of nucleotide arms are attached, and each arm of each individual avidite includes the same type of nucleotide base. Performing one or more cycles of the sequencing reaction may include, in each of the one or more cycles, imaging an optical color signal emitted from a nucleotide reagent bound to a plurality of concatemer molecules by an optical system. In some embodiments, performing one or more cycles of the sequencing reaction may include, in each of the one or more cycles, obtaining a flow cell image including an optical color signal emitted from a nucleotide reagent bound to a plurality of concatemer molecules by an optical system.

[0161] Computer system Various embodiments of the method may be implemented using one or more computer systems, such as computer system 400 shown in FIG. 4, for example. One or more computer systems 400 may be used to implement any of the embodiments discussed herein, as well as combinations and sub-combinations thereof.

[0162] Computer system 400 may include one or more hardware processors 404. The hardware processor 404 can be a central processing unit (CPU), a graphics processing unit (GPU), or a combination thereof. The processor 404 can be connected to a bus or communication infrastructure 406.

[0163] Computer system 400 may also include user input / output device(s) 403 such as a monitor, keyboard, pointing device, etc., which can communicate with the communication infrastructure 406 via a user input / output interface(s) 402. The user input / output device 403 can be coupled to the user interface 124 of FIG. 1.

[0164] One or more of the processors 404 can be a graphics processing unit (GPU). In one embodiment, the GPU can be a processor that is a dedicated electronic circuit designed to process applications with high mathematical loads. The GPU can have a parallel structure that is efficient for parallel processing of large data blocks, for example, for common mathematically intensive data in computer graphics applications, images, videos, vector processing, array processing, etc., as well as for encryption (including brute force cracking), generation of cryptographic hashes or hash arrays, solving partial hash inversion problems, and / or generation of results of other proof-of-work calculations for some blockchain-based applications. Due to the general-purpose computing capabilities on a graphics processing unit (GPGPU), the GPU can be particularly useful, at least in the image recognition and machine learning embodiments described herein.

[0165] Additionally, one or more of the processors 404 may include a hardware-accelerated encryption coprocessor, a coprocessor or other implementation of logic for accelerating encryption calculations, or other special mathematical functions. Such an accelerated processor may further include an instruction set(s) for using the coprocessor and / or other logic to accelerate such acceleration.

[0166] The computer system 400 may also include main memory or primary memory 408, such as random access memory (RAM). The main memory 408 may include one or more levels of cache. The main memory 408 may store control logic (i.e., computer software) and / or data therein.

[0167] The computer system 400 may also include one or more secondary data storage devices or secondary memory 410. The secondary memory 410 may include, for example, a main storage drive 412 and / or a removable storage device or drive 414. The main storage drive 412 may be, for example, a hard disk drive or a solid state drive. The removable storage drive 414 may be a floppy disk drive, a magnetic tape drive, a compact disk drive, an optical storage device, a tape backup device, and / or any other storage device / drive.

[0168] The removable storage drive 414 may interact with a removable storage unit 418.

[0169] The removable memory unit 418 may include a computer-usable or readable storage device storing computer software and / or data. The software can include control logic. The software may include instructions executable by the hardware processor(s) 404. When executed by the hardware processor(s) 404, these instructions may cause the hardware processor(s) 404 to perform operations according to the instructions. The removable storage unit 418 may be a floppy disk, magnetic tape, compact disk, DVD, optical storage disk, and / or any other computer data storage device. The removable storage drive 414 can read from and / or write to the removable storage unit 418.

[0170] The secondary memory 410 may include other means, devices, components, mechanisms, or other approaches to enable the computer system 400 to access computer programs and / or other instructions and / or data. Such means, devices, components, mechanisms, or other approaches may include, for example, the removable storage unit 422 and the interface 420. Examples of the removable storage unit 422 and the interface 420 may include a program cartridge and a cartridge interface (such as those found in video game devices), a removable memory chip (such as an EPROM or PROM) and associated socket, a memory stick and a USB port, a memory card and associated memory card slot, and / or any other removable storage unit and associated interface.

[0171] Computer system 400 may further include a communication or network interface 424. The communication interface 424 may enable the computer system 400 to communicate and interact with any combination of external devices, external networks, external entities, etc. (collectively and individually referred to by reference numeral 428). For example, the communication interface 424 may enable the computer system 400 to communicate with an external or remote device 428 via a communication path 426 that may be wired and / or wireless (or a combination thereof) and may include any combination such as a LAN, WAN, the Internet, etc. Control logic and / or data may be transmitted and received between the computer system 400 via the communication path 426. In some embodiments, the communication path 426 is a connection to the cloud 130 as shown in FIG. 1. External devices, etc. referred to by reference numeral 428 may be devices, networks, entities, etc. within the cloud 130.

[0172] The computer system 400 may also be any of, by way of some non-limiting examples, or any combination thereof, a personal digital assistant (PDA), a desktop workstation, a laptop or notebook computer, a netbook, a tablet, a smartphone, a smartwatch, or other wearable, an appliance, part of the Internet of Things (IoT), and / or an embedded system.

[0173] It should be understood that the framework described herein may be implemented as a method, process, device, system, or product, such as a non-transitory computer-readable medium or device. For purposes of illustration, this framework may be described in the context where a distributed ledger is publicly available or at least accessible by untrusted third parties. An example of a current use case is a blockchain-based system. However, it should be understood that this framework may also apply to other settings where sensitive or confidential information may need to pass through the hands of untrusted third parties, and this technology is in no way limited to the use of distributed ledgers or blockchains.

[0174] Computer system 400 can be a client or server that accesses or hosts any application and / or data through any delivery paradigm, including but not limited to a remote or distributed cloud computing solution, local or on-premises software (e.g., an "on-premises" cloud-based solution), a "service as" model (e.g., content as a service (CaaS), digital content as a service (DCaaS), software as a service (SaaS), managed software as a service (MSaaS), platform as a service (PaaS), desktop as a service (DaaS), framework as a service (FaaS), backend as a service (BaaS), mobile backend as a service (MBaaS), infrastructure as a service (IaaS), database as a service (DBaaS), etc.), and / or a hybrid model that includes any combination of the above examples or other services or delivery paradigms.

[0175] Any applicable data structure, file format, and schema may be derived from standards including, but not limited to, JavaScript Object Notation (JSON), Extensible Markup Language (XML), yet another markup language (YAML), Extensible Hypertext Markup Language (XHTML), Wireless Markup Language (WML), MessagePack, XML User Interface Language (XUL), or other functionally similar representations, alone or in combination. Alternatively, proprietary data structures, formats, or schemas may be used exclusively or in combination with known or open standards.

[0176] Any associated data, files, and / or databases may be stored, retrieved, accessed, and / or transmitted in a human-readable format such as numerical, text, graphic, or multimedia formats, including various types of markup languages among other possible formats. Alternatively, or in combination with the above formats, data, files, and / or databases may be stored, retrieved, accessed, and / or transmitted in binary, encoded, compressed, and / or encrypted formats, or any other machine-readable format.

[0177] Various systems and interfaces or interconnections between layers may use any number of mechanisms such as any number of protocols, programming frameworks, floor plans, or application programming interfaces (APIs), including, but not limited to, the Document Object Model (DOM), Discovery Service (DS), NSUserDefaults, Web Services Description Language (WSDL), Message Exchange Pattern (MEP), Web Distributed Data Exchange (WDDX), Web Hypertext Application Technology Working Group (WHATWG), HTML5 Web Messaging, Representational State Transfer (REST or RESTful web services), eXtensible User Interface Protocol (XUP), Simple Object Access Protocol (SOAP), XML Schema Definition (XSD), XML Remote Procedure Call (XML-RPC), or any other mechanism that can achieve similar functions and results.

[0178] Such an interface or interconnection may also utilize a Uniform Resource Identifier (URI), which may further include a Uniform Resource Locator (URL) or a Uniform Resource Name (URN). Other forms of uniform and / or unique identifiers, locators, or names may be used exclusively or in combination with forms such as those described above.

[0179] Any of the above protocols or APIs may interface with or be implemented in, and may be compiled or interpreted in, any programming language, procedural language, functional language, or object-oriented language. Non-limiting examples include C, C++, C#, Objective-C, Java, Scala, Clojure, Elixir, Swift, Go, Perl, PHP, Python, Ruby, JavaScript, WebAssembly, or substantially any other language in any kind of framework, runtime environment, virtual machine, interpreter, stack, engine, or similar mechanism in any other library or schema (including, but not limited to, many other non-limiting examples such as Node.js, V8, Knockout, jQuery, Dojo, Dijit, OpenUI5, AngularJS, Expressjs, Backbone.js, Ember.js, DHTMLX, Vue, React, Electron, etc.).

[0180] In some embodiments, a tangible non-transitory device or product that includes a tangible non-transitory computer-usable or readable medium storing control logic (software) may sometimes be referred to herein as a computer program product or program storage device. This includes, but is not limited to, tangible products embodying the computer system 400, main memory 408, secondary memory 410, and removable storage units 418 and 422, and any combination of the foregoing. Such control logic, when executed by one or more data processing devices (such as computer system 400), may cause such data processing devices to operate as described herein.

[0181] Based on the teachings contained in this disclosure, methods of creating and using embodiments of this disclosure using data processing devices, computer systems, and / or computer architectures other than those shown in FIG. 4 will be apparent to those of ordinary skill in the relevant art(s). Specifically, embodiments may operate in implementations of software, hardware, and / or operating systems other than those described herein.

[0182] Optical system The imager 116 of FIG. 1 can include one or more optical systems. Further disclosed herein are optical system design guidelines and high-performance fluorescence imaging methods and systems that provide improved optical resolution and image quality for fluorescence imaging-based genomics applications. The disclosed optical imaging system designs provide a larger field of view, increased spatial resolution, improved modulation transfer, contrast-to-noise ratio, and image quality, a higher spatial sampling frequency, faster transitions between image captures when repositioning the sample surface to capture a series of images (e.g., of different fields of view), and an improved imaging system duty cycle, thus enabling the acquisition and analysis of higher throughput images.

[0183] In some cases, for example, improvements in imaging performance for dual-side (flow cell) imaging applications can be achieved by using an electro-optic phase plate in combination with an objective lens to compensate for optical aberrations caused by the fluid layer separating the inner surfaces of the upper (near) and lower (far) parts of the flow cell. In some cases, this design approach can also compensate for vibrations introduced by a motion-actuated compensator that moves within or outside the optical path, depending on which surface of the flow cell is being imaged.

[0184] In some cases, for example, improvement of imaging performance for dual-side (flow cell) imaging applications including the use of a thick flow cell wall (e.g., the thickness of the wall (or cover slip) exceeds 700 μm) and a fluid channel (e.g., the height or thickness of the fluid channel is 50-200 μm) can be achieved even when using a commercially available off-the-shelf objective lens by using a tube lens design that corrects for optical aberrations caused by the thick flow cell wall and / or the intermediate fluid layer in combination with the objective lens.

[0185] In some cases, for example, improvement of imaging performance for multi-channel (e.g., two-color or four-color) imaging applications can be achieved by using multiple tube lenses (one for each imaging channel), and each tube lens design is optimized for the specific wavelength range used in that imaging channel.

[0186] Exemplary embodiments disclosed herein may include a fluorescence imaging system, the system comprising: a) at least one light source configured to provide excitation light within one or more specified wavelength ranges; b) an objective lens configured to collect fluorescence generated from within a specified field of view of a sample surface when the sample surface is exposed to the excitation light, the numerical aperture of the objective lens being at least 0.1, at least 0.2, at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.9, or within a range defined by any two of the foregoing, the working distance of the objective lens being at least 400 μm, at least 500 μm, at least 600 μm, at least 700 μm, at least 800 μm, at least 900 μm, at least 1000 μm, or within a range defined by any 0.2 of the foregoing, and the field of view being at least 0.1 mm 2 , at least 0.2 mm 2 , at least 0.5 mm 2 , at least 0.7 mm 2 , at least 1 mm 2, at least 2 mm 2 , at least 3 mm 2 , at least 5 mm 2 , or at least 10 mm 2 , or a field of view within the range defined by any two of the foregoing, an objective lens, and c) at least one image sensor, wherein the fluorescence collected by the objective lens is imaged on the image sensor, and the pixel dimension of the image sensor is selected such that the spatial sampling frequency of the fluorescence imaging system is at least twice the optical resolution of the fluorescence imaging system. The fluorescence imaging system may include at least one image sensor.

[0187] In some embodiments, the numerical aperture can be at least 0.75. In some embodiments, the numerical aperture is at least 1.0. In some embodiments, the working distance is at least 850 μm. In some embodiments, the working distance is at least 1,000 μm. In some embodiments, the field of view can have an area of at least 2.5 mm2. In some embodiments, the field of view can have an area of at least 3 mm2. In some embodiments, the spatial sampling frequency can be at least 2.5 times the optical resolution of the fluorescence imaging system. In some embodiments, the spatial sampling frequency can be at least 3 times the optical resolution of the fluorescence imaging system. In some embodiments, the system can further comprise an X-Y-Z translation stage such that the system is configured to acquire a series of two or more fluorescence images in an automated manner, and each image of the series of images is or can be acquired for a different field of view. In some embodiments, the position of the sample surface may be adjusted simultaneously in the X, Y, and Z directions to match the position of the objective lens focal plane during acquisition of images of different fields of view. In some embodiments, the time required for simultaneous adjustment in the X, Y, and Z directions is less than 0.3 seconds, less than 0.4 seconds, less than 0.5 seconds, less than 0.7 seconds, or less than 1 second, or a time within a range defined by any two of the foregoing. In some embodiments, the system further comprises an autofocus mechanism configured to adjust the position of the focal plane before acquiring images of different fields of view if an error signal indicates that the difference in position between the focal plane and the sample surface in the Z direction is greater than a specified error threshold. In some embodiments, the specified error threshold is 100 nm or more. In some embodiments, the specified error threshold is 50 nm or less. In some embodiments, the system comprises three or more image sensors, and the system is configured to image fluorescence in each of three or more wavelength ranges on different image sensors. In some embodiments, the difference in the position of the focal plane between each of the three or more image sensors and the sample surface is less than 100 nm.In some embodiments, the difference in the position of the focal plane between each of three or more image sensors and the sample surface is less than 50 nm. In some embodiments, the total time required to reposition the sample surface, adjust the focus as necessary, and acquire an image is less than 0.4 seconds per field of view. In some embodiments, the total time required to reposition the sample surface, adjust the focus as necessary, and acquire an image is less than 0.3 seconds per field of view.

[0188] Also, as used herein, a) an objective lens configured to collect fluorescence originating from within a specified field of view of a sample plane within a flow cell; b) at least one tube lens disposed between the objective lens and at least one imaging element, the at least one tube lens being configured to correct an imaging performance metric of a combination of the objective lens and the at least one tube lens; at least one image sensor when imaging the inner surface of the flow cell, wherein when imaging the inner surface of the flow cell, the flow cell has a wall thickness of at least 700 μm and a gap between an upper inner surface and a lower inner surface of at least 50 μm; and an imaging performance metric that is substantially the same when imaging the upper inner surface or the lower inner surface of the flow cell, without moving one or more optical elements of the tube lens along the optical path and without moving one or more optical elements of the tube lens into or out of the optical path, and without moving an optical compensator into or out of the optical path between the flow cell and the at least one image sensor. A fluorescence imaging system for dual-side imaging of a flow cell, comprising at least one image sensor.

[0189] In some embodiments, the objective lens can be a commercially available microscope objective lens. In some embodiments, the commercially available microscope objective lens can have a numerical aperture of at least 0.3. In some embodiments, the objective lens can have a working distance of at least 700 μm. In some embodiments, the objective lens can be corrected to compensate for a cover slip thickness (or flow cell wall thickness) of 0.17 mm, or a cover slip thickness (or flow cell wall thickness) of a thickness greater than or less than 0.17 mm. In some embodiments, the optical system can be corrected to compensate for the cover slip thickness, flow cell thickness, or distance between desired focal planes. In some embodiments, the correction can be performed by inserting a corrective optical device, such as a lens or optical assembly, into the optical path of the optical system. In some embodiments, the correction can be performed without inserting a corrective optical device, such as a lens or optical assembly, into the optical path of the optical system. In some embodiments, the fluorescence imaging system can further include an electro-optic phase plate disposed adjacent to the objective lens and between the objective lens and the tube lens, the electro-optic phase plate being capable of providing correction of optical aberrations caused by a fluid filling a gap between an upper inner surface and a lower inner surface of the flow cell. In some embodiments, at least one tube lens can be a compound lens including three or more optical components. In some embodiments, at least one tube lens can include one or more of a first asymmetric convex-convex lens, a second convex-planar lens, a third asymmetric concave-concave lens, and a fourth asymmetric convex-concave lens, and can be a compound lens including four optical components present in the above order or in any alternative order. In some embodiments, at least one tube lens is configured to correct an imaging performance metric for a combination of an objective lens, at least one tube lens, and at least one imaging element when imaging an inner surface of a flow cell having a wall thickness of at least 1 mm.In some embodiments, at least one tube lens is configured to correct an imaging performance metric for a combination of an objective lens, at least one tube lens, and at least one imaging element when imaging an inner surface of a flow cell having a gap of at least 100 μm. In some embodiments, at least one tube lens is configured to correct an imaging performance metric for a combination of an objective lens, at least one tube lens, and at least one imaging element when imaging an inner surface of a flow cell having a gap of at least 200 μm. In some embodiments, the system includes a single objective lens, two tube lenses, and two image sensors, and each of the two tube lenses is designed to provide optimal imaging performance at different fluorescence wavelengths. In some embodiments, the system includes a single objective lens, three tube lenses, and three image sensors, and each of the three tube lenses is designed to provide optimal imaging performance at different fluorescence wavelengths. In some embodiments, the system includes a single objective lens, four tube lenses, and four image sensors, and each of the four tube lenses is designed to provide optimal imaging performance at different fluorescence wavelengths. In some embodiments, the design of the objective lens or at least one tube lens is configured to optimize the modulation transfer function in the mid- to high-spatial frequency range. In some embodiments, the imaging performance metric includes measurements of the modulation transfer function (MTF) at one or more specified spatial frequencies, defocus, spherical aberration, chromatic aberration, coma, astigmatism, field curvature, image distortion, contrast-to-noise ratio (CNR), or any combination thereof. In some embodiments, the difference in the imaging performance metric for imaging the upper inner surface and the lower inner surface of the flow cell is less than 10%. In some embodiments, the difference in the imaging performance metric for imaging the upper inner surface and the lower inner surface of the flow cell is less than 5%.In some embodiments, by using at least one tube lens, the imaging performance metrics for dual - side imaging are improved to be at least equivalent or better compared to those of a conventional system comprising an objective lens, a motion - actuated compensator, and an image sensor. In some embodiments, by using at least one tube lens, the imaging performance metrics for dual - side imaging are improved by at least 10% compared to those of a conventional system comprising an objective lens, a motion - actuated compensator, and an image sensor.

[0190] Disclosed herein is an illumination system for use in imaging - based solid - phase genotyping and sequencing applications, the illumination system comprising: a) a light source; and b) a liquid light guide configured to collect light emitted by the light source and deliver it to a designated illumination field on a support surface containing tethered macromolecules.

[0191] In some embodiments, the illumination system further comprises a condenser lens. In some embodiments, the designated illumination field has an area of at least 2 mm2. In some embodiments, the light delivered to the designated illumination field has a uniform intensity across a designated field of view for an imaging system used to acquire an image of the support surface. In some embodiments, the designated field of view has an area of at least 2 mm2. In some embodiments, the light delivered to the designated illumination field has a uniform intensity across the designated field of view when the coefficient of variation (CV) of the light intensity is less than 10%. In some embodiments, the light delivered to the designated illumination field has a uniform intensity across the designated field of view when the coefficient of variation (CV) of the light intensity is less than 5%. In some embodiments, the light delivered to the designated illumination field has a speckle contrast value of less than 0.1. In some embodiments, the light delivered to the designated illumination field has a speckle contrast value of less than 0.05.

[0192] Imaging Module and System: Those skilled in the art will understand that in some cases, the disclosed optical system, imaging system, or module can be a stand-alone optical system designed to image a sample or a substrate surface. In some cases, they can include one or more processors or computers. In some cases, they can include one or more software packages that provide instrument control functions and / or image processing functions. In some cases, in addition to optical components such as a light source (e.g., solid-state laser, dye laser, diode laser, arc lamp, tungsten halogen lamp, etc.), lenses, prisms, mirrors, dichroic reflectors, optical filters, optical bandpass filters, apertures, and image sensors (e.g., complementary metal-oxide semiconductor (CMOS) image sensors and cameras, charge-coupled device (CCD) image sensors and cameras, etc.), they can also include mechanical and / or optomechanical components such as an X-Y translation stage, an X-Y-Z translation stage, a piezoelectric focusing mechanism, etc. In some cases, they can function as a module, component, subassembly, or subsystem of a larger system designed for genomics applications (e.g., gene testing and / or nucleic acid sequencing applications). For example, in some cases, they can further include a light-shielding and / or other environmental control housing, a temperature control module, a fluid control module, fluid dispensing robotics, pick-and-place robotics, one or more processors or computers, one or more local and / or cloud-based software packages (e.g., instrument / system control software package, image processing software package, data analysis software package), a data storage module, a data communication module (e.g., Bluetooth, WiFi, intranet, or Internet communication hardware and related software), a display module, or any combination thereof, and can function as a module, component, subassembly, or subsystem of a larger system.

[0193] Methods for Sequencing Embodiments of the present disclosure provide methods for sequencing immobilized or non-immobilized template molecules. The methods can operate, for example, in the system 100, such as in the sequencer 114. In some embodiments, the immobilized template molecules include a plurality of nucleic acid template molecules each having one copy of a target sequence of interest. In some embodiments, the nucleic acid template molecules having one copy of the target sequence of interest can be generated by performing bridge amplification using linear library molecules. In some embodiments, the immobilized template molecules include a plurality of nucleic acid template molecules (e.g., concatemers) each having two or more tandem copies of the target sequence of interest. In some embodiments, the nucleic acid template molecules containing concatemer molecules can be generated by performing rolling circle amplification of circularized linear library molecules. In some embodiments, the non-immobilized template molecules include circular molecules. In some embodiments, the methods for sequencing use a soluble (e.g., non-immobilized) sequencing polymerase or a sequencing polymerase immobilized on a support.

[0194] In some embodiments, the sequencing reaction uses detectably labeled nucleotide analogs. In some embodiments, the sequencing reaction uses a two-step sequencing reaction, and the two-step sequencing reaction includes binding to a detectably labeled multivalent molecule and incorporating a nucleotide analog. In some embodiments, the sequencing reaction uses unlabeled nucleotide analogs. In some embodiments, the sequencing reaction uses phosphate chain-labeled nucleotides.

[0195] Library Molecules In some embodiments, the immobilized concatemer comprises, respectively, tandem repeat units of the sequence of interest (e.g., the insert region) and any adapter sequences. For example, the tandem repeat unit may include (i) a left universal adapter sequence (e.g., a surface pinning primer) having a binding sequence for a first surface primer (720), (ii) a left universal adapter sequence (e.g., a forward sequencing primer) having a binding sequence for a first sequencing primer (740), (iii) the sequence of interest (710), (iv) a right universal adapter sequence (e.g., a reverse sequencing primer) having a binding sequence for a second sequencing primer (750), (v) a right universal adapter sequence having a binding sequence for a second surface primer (730) (e.g., a surface capture primer), and (vii) a left sample index sequence (760) and / or a right sample index sequence (770). In some embodiments, the tandem repeat unit further comprises a left unique identification sequence (780) and / or a right unique identification sequence (790). In some embodiments, the tandem repeat unit further comprises at least one binding sequence for a compaction oligonucleotide. In some embodiments, FIGS. 7 and 8 show units of linear library molecules or concatemer molecules.

[0196] FIG. 7 shows an exemplary linear single-stranded library molecule (700) comprising a surface pinning primer binding site (720), an optional left unique identification sequence (780), a left index sequence (760), a forward sequencing primer binding site (740), an insert region (710) having the sequence of interest, a reverse sequencing primer binding site (750), a right index sequence (770), and a surface capture primer binding site (730).

[0197] FIG. 8 shows an exemplary linear single-stranded library molecule (700) including a surface pinning primer binding site (720), a left index array (760), a forward sequencing primer binding site (740), an insert region (710) having a sequence of interest, a reverse sequencing primer binding site (750), a right index array (770), an optional right unique identification sequence (790), and a surface capture primer binding site (730).

[0198] The immobilized concatemer can self-destruct into compact nucleic acid nanoballs. Inclusion of one or more compaction oligonucleotides during the RCA reaction can further compact the size and / or shape of the nanoballs. An increase in the number of tandem repeat units in a given concatemer increases the number of sites along the concatemer for hybridizing to multiple sequencing primers (e.g., sequencing primers having a universal sequence) that function as multiple initiation sites for a polymerase-catalyzed sequencing reaction. When the sequencing reaction uses detectably labeled nucleotides and / or detectably labeled multivalent molecules (e.g., having nucleotide units), the signals released by the nucleotides or nucleotide units involved in the parallel sequencing reaction along the concatemer result in increased signal intensity for each concatemer. Multiple portions of a given concatemer can be sequenced simultaneously. Further, multiple binding complexes can form along a particular concatemer molecule, each binding complex including a sequencing polymerase bound to a template / primer duplex and bound to a multivalent molecule, and the multiple binding complexes remain stable without dissociating, resulting in an increased duration that increases the signal intensity and reduces the imaging time.

[0199] Methods for Sequencing Using Nucleotide Analogs Embodiments of the present disclosure are methods for sequencing any of the immobilized template molecules described herein, comprising the step of contacting a sequencing polymerase with (i) a nucleic acid template molecule and (ii) a nucleic acid sequencing primer, wherein the contacting is performed under conditions suitable for the sequencing polymerase to bind to the nucleic acid template molecule hybridized to the nucleic acid primer, and the nucleic acid template molecule hybridized to the nucleic acid primer forms a nucleic acid duplex. In some embodiments, the sequencing polymerase comprises a recombinant mutant sequencing polymerase capable of binding to and incorporating nucleotide analogs.

[0200] In some embodiments, in a method for sequencing a template molecule, the sequencing primer comprises a 3'-extensible end or a 3'-nonextensible end. In some embodiments, the plurality of nucleic acid template molecules comprise amplified template molecules (e.g., clonally amplified template molecules). In some embodiments, the plurality of nucleic acid template molecules comprise one copy of a target sequence of interest. In some embodiments, the plurality of nucleic acid molecules comprise two or more tandem copies (e.g., concatemers) of a target sequence of interest. In some embodiments, the plurality of nucleic acid template molecules comprise the same target sequence of interest or different target sequences of interest. In some embodiments, the plurality of nucleic acid primers are in solution or immobilized on a support. In some embodiments, when the plurality of nucleic acid template molecules and / or the plurality of nucleic acid primers are immobilized on a support, the binding to the first sequencing polymerase generates a plurality of immobilized first complex polymerases. In some embodiments, the plurality of nucleic acid template molecules and / or nucleic acid primers are immobilized at 10 2 ~10 15 different sites on the support. In some embodiments, the binding of the plurality of template molecules and nucleic acid primers to the plurality of first sequencing polymerases is from 10 2 ~10 15Generate a plurality of first composite polymerases immobilized on different sites. In some embodiments, the plurality of immobilized first composite polymerases on the support are immobilized at predetermined or random sites on the support. In some embodiments, the plurality of immobilized first composite polymerases are in fluid communication with each other, allowing a solution of reagents (e.g., enzymes including sequencing polymerases, multivalent molecules, nucleotides, and / or divalent cations) to flow over the support, whereby the plurality of immobilized composite polymerases on the support react with the solution of reagents in a super-parallel manner.

[0201] In some embodiments, the method for sequencing further comprises step (b): contacting a sequencing polymerase with a plurality of nucleotides and at least one nucleotide suitable for binding to a sequencing polymerase bound to a nucleic acid duplex under conditions suitable for polymerase-catalyzed nucleotide incorporation to extend a sequencing primer by one nucleotide. In some embodiments, the sequencing polymerase is contacted in the presence of a plurality of nucleotides and at least one catalytic cation comprising magnesium and / or manganese. In some embodiments, the plurality of nucleotides comprises at least one nucleotide analog having a chain terminating moiety at the 2' or 3' position of the sugar. In some embodiments, the chain terminating moiety is removable from the 2' or 3' position of the sugar to convert the chain terminating moiety to an OH or H group. In some embodiments, the plurality of nucleotides comprises at least one nucleotide lacking a chain terminating moiety. In some embodiments, at least the nucleotide is labeled with a detectable reporter moiety (e.g., a fluorophore) that emits a detectable signal. The detectable reporter moiety comprises a fluorophore. In some embodiments, the fluorophore is attached to the nucleotide base. In some embodiments, the fluorophore is attached to the nucleobase by a linker that is cleavable / removable from the base. In some embodiments, at least one of the nucleotides in the plurality of nucleotides is not labeled with a detectable reporter moiety. In some embodiments, a particular detectable reporter moiety (e.g., a fluorophore) attached to a nucleotide can correspond to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) to enable detection and discrimination of the nucleotide base. When the incorporated chain-terminating nucleotide is detectably labeled, step (b) further comprises detecting a signal emitted from the incorporated chain-terminating nucleotide. In some embodiments, step (b) further comprises discriminating the nucleobase of the incorporated chain-terminating nucleotide.

[0202] In some embodiments, the method for sequencing further includes step (c): removing the chain termination moiety from the incorporated chain-terminating nucleotide to generate an extendable 3′ OH group. In some embodiments, step (c) further includes removing a detectable label from the incorporated chain-terminating nucleotide. In some embodiments, the sequencing polymerase remains bound to the template molecule hybridized to a sequencing primer that is extended by one nucleotide.

[0203] In some embodiments, the method for sequencing further includes step (d): repeating steps (b) to (c) at least once.

[0204] Two-step method for nucleic acid sequencing Some embodiments of the present disclosure provide a two-step method for sequencing any of the immobilized template molecules described herein. In some embodiments, the first step generally includes binding a multivalent molecule to a complex polymerase to form a multivalent complex polymerase and detecting the multivalent complex polymerase.

[0205] In some embodiments, the first step includes (a) contacting a plurality of first sequencing polymerases with (i) a plurality of nucleic acid template molecules and (ii) a plurality of nucleic acid sequencing primers, the contacting being performed under conditions suitable for binding the plurality of first sequencing polymerases to the plurality of nucleic acid template molecules and the plurality of nucleic acid primers, thereby forming a plurality of first complex polymerases, each of which includes a first sequencing polymerase that binds to a nucleic acid duplex, the nucleic acid duplex including a nucleic acid template molecule that hybridizes to a nucleic acid primer. In some embodiments, the first polymerase includes a recombinant mutant sequencing polymerase.

[0206] In some embodiments, in a method for sequencing a template molecule, the sequencing primer comprises an oligonucleotide having a 3'-extendable end or a 3'-non-extendable end. In some embodiments, the plurality of nucleic acid template molecules comprises amplified template molecules (e.g., clonally amplified template molecules). In some embodiments, the plurality of nucleic acid template molecules comprises one copy of a target sequence of interest. In some embodiments, the plurality of nucleic acid molecules comprises two or more tandem copies (e.g., concatemers) of a target sequence of interest. In some embodiments, the nucleic acid template molecules in the plurality of nucleic acid template molecules comprise the same target sequence of interest or different target sequences of interest. In some embodiments, the plurality of nucleic acid template molecules and / or the plurality of nucleic acid primers are in solution or immobilized on a support. In some embodiments, when the plurality of nucleic acid template molecules and / or the plurality of nucleic acid primers are immobilized on a support, the binding to the first sequencing polymerase generates a plurality of immobilized first complex polymerases. In some embodiments, the plurality of nucleic acid template molecules and / or nucleic acid primers are immobilized at 10 2 ~10 15 different sites on the support. In some embodiments, the binding of the plurality of template molecules and nucleic acid primers to the plurality of first sequencing polymerases generates a plurality of first complex polymerases immobilized at 10 2 ~10 15 different sites on the support. In some embodiments, the plurality of immobilized first complex polymerases on the support are immobilized at predetermined or random sites on the support. In some embodiments, the plurality of immobilized first complex polymerases are in fluid communication with each other, allowing a solution of reagents (e.g., enzymes including a sequencing polymerase, multivalent molecules, nucleotides, and / or divalent cations) to flow over the support, whereby the plurality of immobilized complex polymerases on the support react with the solution of reagents in a super-parallel manner.

[0207] In some embodiments, the method for sequencing further includes step (b): contacting a plurality of first composite polymerases with a plurality of multivalent molecules to form a plurality of multivalent composite polymerases (e.g., binding complexes). In some embodiments, individual multivalent molecules in the plurality of multivalent molecules include a core attached to a plurality of nucleotide arms, and each nucleotide arm is attached to a nucleotide (e.g., nucleotide unit) (e.g., FIGS. 9-13). In some embodiments, the contacting in step (b) is performed under conditions suitable for binding complementary nucleotide units of the multivalent molecules to at least two of the plurality of first composite polymerases, thereby forming a plurality of multivalent composite polymerases. In some embodiments, the conditions are suitable for inhibiting polymerase-catalyzed incorporation of complementary nucleotide units into the primers of the plurality of multivalent composite polymerases. In some embodiments, the plurality of multivalent molecules includes at least one multivalent molecule having a plurality of nucleotide arms (e.g., FIGS. 9-12), and the plurality of nucleotide arms are each attached to a nucleotide analog (e.g., nucleotide analog unit), and the nucleotide analog includes a chain-terminating moiety at the 2' and / or 3' position of the sugar. In some embodiments, the plurality of multivalent molecules includes at least one multivalent molecule including a plurality of nucleotide arms, and the plurality of nucleotide arms are each attached to a nucleotide unit lacking a chain-terminating moiety. In some embodiments, at least one of the multivalent molecules in the plurality of multivalent molecules is labeled with a detectable reporter moiety that emits a signal. In some embodiments, the detectable reporter moiety includes a fluorophore. In some embodiments, the contacting in step (b) is performed in the presence of at least one non-catalytic cation including strontium, barium, and / or calcium.

[0208] In some embodiments, the method for sequencing further includes step (c): detecting a plurality of multivalent composite polymerases. In some embodiments, detecting includes detecting a signal released by a multivalent molecule that binds to the composite polymerase, wherein the complementary nucleotide units of the multivalent molecule bind to the primer, but the incorporation of the complementary nucleotide units is inhibited. In some embodiments, the multivalent molecule is labeled with a detectable reporter moiety to enable detection. In some embodiments, the labeled multivalent molecule includes a fluorophore attached to the core, linker, and / or nucleotide units of the multivalent molecule.

[0209] In some embodiments, the method for sequencing further includes step (d): identifying the nucleobases of the complementary nucleotide units bound to the plurality of first composite polymerases, thereby determining the sequence of the template molecule. In some embodiments, the multivalent molecule is labeled with a detectable reporter moiety corresponding to a specific nucleotide unit attached to a nucleotide arm to enable identification of the complementary nucleotide units (e.g., the nucleobases adenine, guanine, cytosine, thymine, or uracil) bound to the plurality of first composite polymerases.

[0210] In some embodiments, the method for sequencing further includes step (e): dissociating the plurality of multivalent composite polymerases, removing the plurality of first sequencing polymerases and their bound multivalent molecules, and retaining the plurality of nucleic acid duplexes.

[0211] In some embodiments, the second stage of the two-stage sequencing method generally includes nucleotide incorporation. In some embodiments, the method for sequencing comprises step (f): contacting the plurality of retained nucleic acid duplexes of step (e) with a plurality of second sequencing polymerases, the contacting being performed under conditions suitable for binding the plurality of second sequencing polymerases to the plurality of retained nucleic acid duplexes, thereby forming a plurality of second composite polymerases, each of the plurality of second composite polymerases comprising a second sequencing polymerase bound to a nucleic acid duplex, further comprising contacting. In some embodiments, the second sequencing polymerase comprises a recombinant mutant sequencing polymerase.

[0212] In some embodiments, the plurality of first sequencing polymerases of step (a) have an amino acid sequence that is 100% identical to the amino acid sequence as the plurality of second sequencing polymerases of step (f). In some embodiments, the plurality of first sequencing polymerases of step (a) have an amino acid sequence that is different from the amino acid sequence of the plurality of second sequencing polymerases of step (f).

[0213] In some embodiments, a method for sequencing comprises step (g): contacting a plurality of second composite polymerases with a plurality of nucleotides, the contacting being performed under conditions suitable for binding complementary nucleotides from the plurality of nucleotides to at least two of the second composite polymerases, thereby forming a plurality of nucleotide composite polymerases. In some embodiments, the contacting of step (g) is performed under conditions suitable for promoting polymerase-catalyzed incorporation of the nucleotide composite polymerases of the bound complementary nucleotides into a primer, thereby extending the sequencing primer by only one nucleotide. In some embodiments, incorporating the nucleotides in step (g) into the 3'-end of the sequencing primer comprises a primer extension reaction. In some embodiments, the contacting of step (g) is performed in the presence of at least one catalytic cation comprising magnesium and / or manganese. In some embodiments, the plurality of nucleotides comprises natural nucleotides (e.g., non-analog nucleotides) or nucleotide analogs. In some embodiments, the plurality of nucleotides comprises 2' and / or 3' chain terminating moieties that are removable or non-removable. In some embodiments, at least one of the nucleotides in the plurality of nucleotides is not labeled with a detectable reporter moiety. In some embodiments, the plurality of nucleotides is unlabeled. In some embodiments, the plurality of nucleotides comprises a plurality of nucleotides labeled with a detectable reporter moiety. The detectable reporter moiety comprises a fluorophore. In some embodiments, the fluorophore is attached to a nucleotide base. In some embodiments, the fluorophore is attached to the nucleotide base by a linker, and the linker is cleavable / removable from the base or non-removable from the base.In some embodiments, a particular detectable reporter moiety (e.g., a fluorophore) attached to a nucleotide can correspond to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) so as to enable detection and identification of the nucleotide base.

[0214] In some embodiments, when the plurality of nucleotides in step (g) are detectably labeled, the method for sequencing further includes step (h): detecting complementary nucleotides incorporated into the primer of the nucleotide complex polymerase. In some embodiments, the plurality of nucleotides are labeled with a detectable reporter moiety so as to enable detection. In some embodiments, when the plurality of nucleotides in step (g) are unlabeled, the detecting in step (h) is omitted.

[0215] In some embodiments, when the plurality of nucleotides in step (g) are detectably labeled, the method for sequencing further includes step (i): identifying the base of the complementary nucleotides incorporated into the primer of the nucleotide complex polymerase. In some embodiments, the identification of the incorporated complementary nucleotides in step (i) can be used to confirm the identity of the complementary nucleotides of the multivalent molecule bound to the plurality of first complex polymerases in step (d). In some embodiments, the identifying in step (i) can be used to determine the sequence of the nucleic acid template molecule. In some embodiments, when the plurality of nucleotides in step (g) are unlabeled, the identifying in step (i) is omitted.

[0216] In some embodiments, the method for sequencing further includes step (j): removing the chain termination moiety from the incorporated nucleotide when step (g) is performed by contacting a plurality of second complex polymerases with a plurality of nucleotides including at least one nucleotide having a 2’ and / or 3’ chain termination moiety.

[0217] In some embodiments, the method for sequencing further includes step (k): repeating steps (a)-(j) at least once. In some embodiments, the sequence of the nucleic acid template molecule can be determined by detecting and identifying a multivalent molecule that binds to the sequencing polymerase but is not incorporated within the 3’ end of the primer in steps (c) and (d). In some embodiments, the sequence of the nucleic acid template molecule can be determined (or confirmed) by detecting and discriminating the nucleotides incorporated within the 3’ end of the primer in steps (h) and (i).

[0218] In some embodiments, in any of the methods for sequencing nucleic acid molecules, the binding of a plurality of first complex polymerases and a plurality of multivalent molecules forms at least one binding active complex, and the method comprises: (a) binding a first nucleic acid primer, a first sequencing polymerase, and a first multivalent molecule to a first portion of a concatemer template molecule, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule binds to the first sequencing polymerase; and (b) binding a second nucleic acid primer, a second sequencing polymerase, and the first multivalent molecule to a second portion of the same concatemer template molecule, thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule binds to the second sequencing polymerase, and the first and second binding complexes comprising the same multivalent molecule form a binding active complex. In some embodiments, the first sequencing polymerase comprises any wild-type or mutant polymerase described herein. In some embodiments, the second sequencing polymerase comprises any wild-type or mutant polymerase described herein. The concatemer template molecule comprises a tandem repeat sequence of a target sequence and at least one universal sequencing primer binding site. The first and second nucleic acid primers can bind to the sequencing primer binding site along the concatemer template molecule. Exemplary multivalent molecules are shown in FIGS. 9-12.

[0219] In some embodiments, in any of the methods for sequencing nucleic acid molecules, the method includes binding a plurality of first complex polymerases to a plurality of multivalent molecules to form at least one binding active complex, and the method includes: (a) contacting a plurality of sequencing polymerases and a plurality of nucleic acid primers with different portions of a concatemer nucleic acid template molecule to form at least first and second complex polymerases on the same concatemer template molecule; and (b) contacting a plurality of multivalent molecules with at least first and second complex polymerases on the same concatemer template molecule under conditions suitable for binding a single multivalent molecule from the plurality of multivalent molecules to the first and second complex polymerases, wherein at least a first nucleotide unit of the single multivalent molecule binds to a first complex polymerase comprising a first primer hybridized to a first portion of the concatemer template molecule, thereby forming a first binding complex (e.g., a first ternary complex), and at least a second nucleotide unit of the single multivalent molecule binds to a second complex polymerase comprising a second primer hybridized to a second portion of the concatemer template molecule, thereby forming a second binding complex (e.g., a second ternary complex), and the contacting is performed under conditions suitable for inhibiting the polymerase-catalyzed incorporation of the bound first and second nucleotide units in the first and second binding complexes, and the first and second binding complexes that bind to the same multivalent molecule form a binding active complex; (c) detecting the first and second binding complexes on the same concatemer template molecule; and (d) identifying the first nucleotide unit in the first binding complex, thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide unit in the second binding complex, thereby determining the sequence of the second portion of the concatemer template molecule. In some embodiments, the plurality of sequencing polymerases include any wild-type or mutant sequencing polymerase described herein. The concatemer template molecule includes a tandem repeat sequence of a target sequence and at least one universal sequencing primer binding site.Multiple nucleic acid primers can bind to the sequencing primer binding sites along the concatemer template molecule. Exemplary multivalent molecules are shown in FIGS. 9-12.

[0220] In FIG. 9, the left (Class I) is a schematic diagram of a multivalent molecule having a "starburst" or "helical" configuration. Center (Class II): Schematic diagram of a multivalent molecule having a dendrimer configuration. Right (Class III): Schematic diagram of multiple multivalent molecules formed by reacting streptavidin with a 4-arm or 8-arm type PEG-NHS having biotin and dNTP. The nucleotide unit is represented by "N", biotin is represented by "B", and streptavidin is represented by "SA".

[0221] Sequencing by Binding Some embodiments of the present disclosure provide a method for sequencing any of the immobilized template molecules described herein, the sequencing method including a sequencing-by-binding (SBB) procedure using unlabeled chain-terminating nucleotides. In some embodiments, the sequencing-by-binding (SBB) method comprises: (a) sequentially contacting a primed template nucleic acid with at least two separate mixtures under ternary complex stabilization conditions, wherein the at least two separate mixtures each comprise a polymerase and a nucleotide, whereby sequential contact results in contacting the nucleotide cognates of the first, second, and third base types in the template under ternary complex stabilization conditions; (b) examining the at least two separate mixtures to determine whether a ternary complex has formed; (c) identifying the next correct nucleotide for the primed template nucleic acid molecule, wherein the next correct nucleotide is identified as a homolog of the first, second, or third base type if a ternary complex is detected in step (b), and the next correct nucleotide is presumed to be a nucleotide homolog of the fourth base type based on the absence of a ternary complex in step (b); adding the next correct nucleotide to the primer of the primed template nucleic acid after (b), thereby producing an extended primer; and (e) repeating steps (a)-(d) at least once on the primed template nucleic acid comprising the extended primer. Exemplary sequencing-by-binding methods are described in U.S. Patent Nos. 10,246,744 and 10,731,141, the entire contents of both patents being incorporated herein by reference.

[0222] Method for Sequencing Using Phosphate Chain Labeled Nucleotides Embodiments of the present disclosure provide a method for sequencing using an immobilized sequencing polymerase that binds to a non-immobilized template molecule, wherein the sequencing reaction is performed with phosphate chain-labeled nucleotides. In some embodiments, the sequencing method includes step (a): providing a support on which a plurality of sequencing polymerases are immobilized. In some embodiments, the sequencing polymerase includes a processive DNA polymerase. In some embodiments, the sequencing polymerase includes a wild-type or mutant DNA polymerase, including, for example, Phi29 DNA polymerase. In some embodiments, the support includes a plurality of separate compartments, and the sequencing polymerase is immobilized at the bottom of the compartment. In some embodiments, the separate compartment includes a silica bottom through which light can pass. In some embodiments, the separate compartment includes a silica bottom configured with a nanofabricated confinement structure including holes in a metal cladding film (e.g., an aluminum cladding film). In some embodiments, the holes in the metal cladding have a small opening of approximately 70 nm, for example. In some embodiments, the height of the nanofabricated confinement structure is approximately 100 nm. In some embodiments, the nanofabricated confinement structure comprises a zero-mode waveguide (ZMW). In some embodiments, the nanofabricated confinement structure contains a liquid.

[0223] In some embodiments, the sequencing method further includes step (b): contacting a plurality of immobilized sequencing polymerases with a plurality of single-stranded circular nucleic acid template molecules and a plurality of oligonucleotide sequencing primers under conditions suitable for each immobilized sequencing polymerase to bind to a single-stranded circular template molecule and for each sequencing primer to hybridize to an individual single-stranded circular template molecule, thereby generating a plurality of polymerase / template / primer complexes. In some embodiments, each sequencing primer hybridizes to a universal sequencing primer binding site on the single-stranded circular template molecule.

[0224] In some aspects, the sequencing method further includes step (c): contacting the plurality of polymerase / template / primer complexes with a plurality of phosphate chain-labeled nucleotides, each comprising a phosphate chain comprising an aromatic base, a 5-carbon sugar (e.g., ribose or deoxyribose), and 3 to 20 phosphate groups, wherein the terminal phosphate group is attached to a detectable reporter moiety (e.g., a fluorophore). The first, second, and third phosphate groups may be referred to as alpha, beta, and gamma phosphate groups. In some embodiments, the particular detectable reporter moiety attached to the terminal phosphate group corresponds to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) such that detection and discrimination of the nucleobase is enabled. In some embodiments, the plurality of polymerase / template / primer complexes are contacted with the plurality of phosphate chain-labeled nucleotides under conditions suitable for polymerase-catalyzed nucleotide incorporation. In some embodiments, the sequencing polymerase is capable of binding a complementary phosphate chain-labeled nucleotide and incorporating the complementary nucleotide opposite the nucleotide in the template molecule. In some embodiments, the polymerase-catalyzed nucleotide incorporation reaction cleaves between the alpha phosphate group and the beta phosphate group, thereby releasing the polyphosphate chain linked to the fluorophore.

[0225] In some embodiments, the sequencing method further comprises step (d): detecting a fluorescence signal emitted by a phosphate chain-labeled nucleotide that is bound by a sequencing polymerase and incorporated at the end of a sequencing primer. In some embodiments, step (d) further comprises identifying a phosphate chain-labeled nucleotide that is bound by a sequencing polymerase and incorporated at the end of a sequencing primer.

[0226] In some embodiments, the sequencing method further comprises step (d): repeating steps (c) to (d) at least once. In some embodiments, the sequencing method using a phosphate chain-labeled nucleotide can be performed according to the methods described in U.S. Patent Nos. 7,170,050, 7,302,146, and / or 7,405,281.

[0227] Sequencing polymerase Embodiments of the present disclosure provide a method for sequencing a nucleic acid molecule, wherein any of the sequencing methods described herein uses at least one type of sequencing polymerase and a plurality of nucleotides, or at least one type of sequencing polymerase, a plurality of nucleotides, and a plurality of multivalent molecules. In some embodiments, the sequencing polymerase(s) can incorporate complementary nucleotides opposite the nucleotides in the template molecule. In some embodiments, the sequencing polymerase(s) can bind to the complementary nucleotide units of the multivalent molecule opposite the nucleotides in the template molecule. In some embodiments, the plurality of sequencing polymerases includes recombinant mutant polymerases.

[0228] Examples of polymerases suitable for use in sequencing with nucleotides and / or multivalent molecules include, as examples of polymerases suitable for use in sequencing with nucleotides and / or multivalent molecules, Klenow DNA polymerase, Thermus aquaticus DNA polymerase I (Taq polymerase), KlenTaq polymerase, Candidatus altiarchaeales archaea, Candidatus Hadarchaeum Yellowstonense, Hadesarchaea archaea, Euryarchaeota archaea, Thermoplasmata archaea, Thermococcus polymerase, e.g., Thermococcus litoralis, bacteriophage T7 DNA polymerase, human alpha, delta, and epsilon DNA polymerases, bacteriophage polymerases, e.g., T4, RB69, and phi29 bacteriophage DNA polymerases, Pyrococcus furiosus DNA polymerase (Pfu polymerase), Bacillus subtilis DNA polymerase III, E. coli DNA polymerase III alpha and epsilon, 9 degree N polymerase, reverse transcriptases, e.g., HIV type M or O reverse transcriptase, avian myeloblastosis virus reverse transcriptase, Moloney murine leukemia virus (MMLV) reverse transcriptase, or telomerase, but are not limited thereto. Further non-limiting examples of DNA polymerases include those from various archaeal families, e.g., Aeropyrum, Archaeglobus, Desulfurococcus, Pyrobaculum, Pyrococcus, Pyrolobus, Pyrodictium, Staphylothermus, Stetteria, Sulfolobus, Thermococcus, and Vulcanisaeta, etc., or variants thereof, which include such polymerases known in the art, e.g., 9 degrees N, VENT, DEEP VENT, THERMINATOR, Pfu, KOD, Pfx, Tgo, and RB69 polymerases.

[0229] Nucleotide Embodiments of the present disclosure provide a method for sequencing a nucleic acid molecule, wherein any of the sequencing methods described herein uses at least one nucleotide. A nucleotide comprises a base, a sugar, and at least one phosphate group. In some embodiments, at least one nucleotide in a plurality of nucleotides comprises an aromatic base, a five-carbon sugar (e.g., ribose or deoxyribose), and one or more phosphate groups (e.g., 1 to 10 phosphate groups). The plurality of nucleotides can comprise at least one type of nucleotide selected from the group consisting of dATP, dGTP, dCTP, dTTP, and dUTP. The plurality of nucleotides can be included in a mixture of any combination of two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP, and / or dUTP. In some embodiments, at least one nucleotide in a plurality of nucleotides is not a nucleotide analog. In some embodiments, at least one nucleotide in a plurality of nucleotides comprises a nucleotide analog.

[0230] In some embodiments, in any of the methods for sequencing a nucleic acid molecule described herein, at least one nucleotide in a plurality of nucleotides comprises a chain of 1, 2, or 3 phosphorus atoms, the chain typically attached to the 5'-carbon of the sugar moiety via an ester or phosphoramidate bond. In some embodiments, at least one nucleotide in a plurality of nucleotides is an analog having a phosphorus chain, in which the phosphorus atoms are bonded together with intervening O, S, NH, methylene, or ethylene. In some embodiments, the phosphorus atoms in the chain comprise a substituted side chain group containing O, S, or BH3. In some embodiments, the chain comprises a phosphate group substituted with an analog containing phosphoramidate, phosphorothioate, phosphorodithioate, and O-methylphosphoramidite groups.

[0231] In some embodiments, in any of the methods for sequencing nucleic acids described herein, at least one nucleotide in a plurality of nucleotides comprises a terminator nucleotide analog, and the terminator nucleotide analog has a chain-terminating moiety (e.g., a blocking moiety) at the sugar 2′ position, sugar 3′ position, or sugar 2′ and 3′ positions. In some embodiments, the chain-terminating moiety can inhibit the polymerase-catalyzed incorporation of subsequent nucleotide units or free nucleotides in the nascent strand during the primer extension reaction. In some embodiments, the chain-terminating moiety is attached to the 3′ sugar position, and at the 3′ sugar position, the sugar comprises a ribose or deoxyribose sugar moiety. In some embodiments, the chain-terminating moiety is removable / cleavable from the 3′ sugar position to produce a nucleotide having a 3′ OH sugar group that is extendable with a subsequent nucleotide in the polymerase-catalyzed nucleotide incorporation reaction. In some embodiments, the chain-terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, silyl group, or acetal group. In some embodiments, the chain-terminating moiety is cleavable / removable from the nucleotide, for example, by reacting the chain-terminating moiety with a chemical agent, pH change, light, or heat. In some embodiments, the chain-terminating moieties alkyl, alkenyl, alkynyl, and allyl are cleavable using tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4) having piperidine, or 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ). In some embodiments, the chain-terminating moieties aryl and benzyl are cleavable using H2 Pd / C. In some embodiments, the chain-terminating moieties amine, amide, keto, isocyanate, phosphate, thio, disulfide are cleavable using phosphine, or a thiol group comprising β-mercaptoethanol or dithiothreitol (DTT).In some embodiments, the chain-terminating moiety carbonate can be cleaved using potassium carbonate (K2CO3) in MeOH, triethylamine in pyridine, or Zn in acetic acid (AcOH). In some embodiments, the urea and silyl, which are chain-terminating moieties, can be cleaved with tetrabutylammonium fluoride, pyridine-HF, ammonium fluoride, or triethylamine trihydrofluoride. In some embodiments, the chain-terminating moiety can be cleavable / removable using nitrous acid. In some embodiments, the chain-terminating moiety can be cleavable / removable using a solution containing nitrite, for example, a combination of nitrite and an acid such as acetic acid, sulfuric acid, or nitric acid. In some further embodiments, the solution can contain an organic acid.

[0232] In some embodiments, in any of the methods for sequencing nucleic acids described herein, at least one nucleotide in a plurality of nucleotides comprises a terminator nucleotide analog, and the terminator nucleotide analog has a chain-terminating moiety (e.g., a blocking moiety) at the 2'-position, 3'-position, or both 2'- and 3'-positions of the sugar. In some embodiments, the chain-terminating moiety comprises an azide, azido, and azidomethyl group. In some embodiments, the chain-terminating moiety comprises a 3'-O-azide or 3'-O-azidomethyl group. In some embodiments, the azide, azido, and azidomethyl groups that are chain-terminating moieties are cleavable / removable with a phosphine compound. In some embodiments, the phosphine compound comprises a derivatized trialkylphosphine moiety or a derivatized triarylphosphine moiety. In some embodiments, the phosphine compound comprises tris(2-carboxyethyl)phosphine (TCEP), or bis-sulfotriphenylphosphine (BS-TPP), or tris(hydroxypropyl)phosphine (THPP). In some embodiments, the cleaving agent comprises 4-dimethylaminopyridine (4-DMAP). In some embodiments, a chain-terminating moiety comprising one or more of a 3'-O-amino group, 3'-O-aminomethyl group, 3'-O-methylamino group, or derivatives thereof can be cleaved with nitrous acid via a mechanism utilizing nitrous acid or using a solution containing nitrous acid. In some embodiments, a chain-terminating moiety comprising one or more of a 3'-O-amino group, 3'-O-aminomethyl group, 3'-O-methylamino group, or derivatives thereof can be cleaved using a solution containing nitrite. In some embodiments, for example, the nitrite can be combined with or contacted with an acid such as acetic acid, sulfuric acid, or nitric acid. In some further embodiments, for example, the nitrite can be combined with or contacted with an organic acid such as formic acid, acetic acid, propionic acid, butyric acid, isobutyric acid, etc.In some embodiments, the chain-terminating moiety comprises a 3'-acetal moiety that can be cleaved with a palladium deblocking reagent (e.g., Pd(0)).

[0233] In some embodiments, in any of the methods for sequencing a nucleic acid molecule described herein, the nucleotide analog comprises a chain-terminating moiety selected from the group consisting of 3'-deoxynucleotide, 2',3'-dideoxynucleotide, 3'-methyl, 3'-azide, 3'-azidomethyl, 3'-O-azidoalkyl, 3'-O-ethynyl, 3'-O-aminoalkyl, 3'-O-fluoroalkyl, 3'-fluoromethyl, 3'-difluoromethyl, 3'-trifluoromethyl, 3'-sulfonyl, 3'-malonyl, 3'-amino, 3'-O-amino, 3'-sulfhydryl, 3'-aminomethyl, 3'-ethyl, 3'-butyl, 3'-tert-butyl, 3'-fluorenylmethyloxycarbonyl, 3'-tert-butyloxycarbonyl, 3'-O-alkylhydroxylamino group, 3'-phosphorothioate, 3-O-benzyl, and 3'-O-benzyl, 3-acetal moiety, or derivatives thereof.

[0234] In some embodiments, in any of the methods for sequencing a nucleic acid molecule described herein, the plurality of nucleotides comprises a plurality of nucleotides labeled with a detectable reporter moiety. The detectable reporter moiety comprises a fluorophore. In some embodiments, the fluorophore is attached to the nucleotide base. In some embodiments, the fluorophore is attached to the nucleotide base with a linker, and the linker is cleavable / removable from the base. In some embodiments, at least one of the nucleotides in the plurality of nucleotides is not labeled with a detectable reporter moiety. In some embodiments, a particular detectable reporter moiety (e.g., a fluorophore) attached to a nucleotide can correspond to a nucleotide base (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) so as to enable detection and identification of the nucleotide base.

[0235] In some embodiments, in any of the methods for sequencing nucleic acids described herein, the cleavable linker on the nucleotide base comprises a cleavable moiety comprising an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azide group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, or a silyl group. In some embodiments, the cleavable linker on the base is cleavable / removable from the base by reacting the cleavable moiety with a chemical agent, a pH change, light, or heat. In some embodiments, the cleavable sites alkyl, alkenyl, alkynyl, and allyl are cleavable using tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4) having piperidine, or 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ). In some embodiments, the cleavable moieties aryl and benzyl are cleavable using H2 Pd / C. In some embodiments, the cleavable moieties amine, amide, keto, isocyanate, phosphate, thio, disulfide are cleavable using a phosphine, or a thiol group comprising β-mercaptoethanol or dithiothreitol (DTT). In some embodiments, the carbonate which is a cleavable moiety is cleavable with potassium carbonate (K2CO3) in MeOH, triethylamine in pyridine, or Zn(AcOH) in acetic acid. In some embodiments, the urea and silyl which are cleavable moieties are cleavable with tetrabutylammonium fluoride, pyridine-HF, ammonium fluoride, or triethylamine trihydrofluoride.

[0236] In some embodiments, in any of the methods for sequencing a nucleic acid molecule described herein, the cleavable linker on the nucleotide base comprises a cleavable moiety that includes an azide, azido, or azidomethyl group. In some embodiments, the azide, azido, and azidomethyl groups, which are cleavable moieties, are cleavable / removable with a phosphine compound. In some embodiments, the phosphine compound comprises a derivatized trialkylphosphine moiety or a derivatized triarylphosphine moiety. In some embodiments, the phosphine compound comprises tris(2-carboxyethyl)phosphine (TCEP), or bis-sulfotriphenylphosphine (BS-TPP), or tris(hydroxypropyl)phosphine (THPP). In some embodiments, the cleavage agent comprises 4-dimethylaminopyridine (4-DMAP).

[0237] In some embodiments, in any of the methods for sequencing a nucleic acid molecule described herein, the chain terminating moiety (e.g., at the sugar 2' and / or sugar 3' positions), and the cleavable linker on the nucleotide base have the same or different cleavable moieties. In some embodiments, the chain terminating moiety (e.g., at the sugar 2' and / or sugar 3' positions), and the detectable reporter moiety attached to the base are chemically cleavable / removable with the same chemical agent. In some embodiments, the chain terminating moiety (e.g., at the sugar 2' and / or sugar 3' positions), and the detectable reporter moiety attached to the base are chemically cleavable / removable with different chemical agents.

[0238] Multivalent molecule Embodiments of the present disclosure provide a method for sequencing nucleic acids, wherein any of the sequencing methods described herein uses at least one multivalent molecule. In some embodiments, the multivalent molecule includes a plurality of nucleotide arms, the plurality of nucleotide arms are attached to a core, and have any configuration including a starburst, a helter-skelter, or a bottlebrush configuration (e.g., FIG. 9). The multivalent molecule includes (1) a core and (2) a plurality of nucleotide arms, the plurality of nucleotide arms including (i) a core attachment portion, (ii) a spacer including a PEG portion, (iii) a linker, and (iv) a nucleotide unit, the core being attached to the plurality of nucleotide arms, the spacer being attached to the linker, and the linker being attached to the nucleotide unit. In some embodiments, the nucleotide unit includes a base, a sugar, and at least one phosphate group, and the linker is attached to the nucleotide unit via the base. In some embodiments, the linker includes an aliphatic chain or an oligoethylene glycol chain, and both linker chains have 2 to 6 subunits. In some embodiments, the linker also includes an aromatic moiety. Exemplary nucleotide arms are shown in FIG. 13. Exemplary multivalent molecules are shown in FIGS. 9-12. An exemplary spacer is shown in FIG. 14 (top), and exemplary linkers are shown in FIGS. (bottom) and 15. Exemplary nucleotides attached to the linker are shown in FIGS. 16-19. An exemplary biotinylated nucleotide arm is shown in FIG. 20.

[0239] In some embodiments, the multivalent molecule includes a core attached to a plurality of nucleotide arms, the plurality of nucleotide arms having the same type of nucleotide unit selected from the group consisting of dATP, dGTP, dCTP, dTTP, and dUTP.

[0240] In some embodiments, the multivalent molecule comprises a core attached to a plurality of nucleotide arms, each arm comprising a nucleotide unit. In some aspects, the nucleotide unit comprises an aromatic base, a five-carbon sugar (e.g., ribose or deoxyribose), and one or more phosphate groups (e.g., from 1 to 10 phosphate groups). The plurality of multivalent molecules can comprise one type of multivalent molecule having one type of nucleotide unit selected from the group consisting of dATP, dGTP, dCTP, dTTP, and dUTP. The plurality of multivalent molecules can be included in a mixture of any combination of two or more types of multivalent molecules, and the individual multivalent molecules in the mixture comprise nucleotide units selected from the group consisting of dATP, dGTP, dCTP, dTTP, and / or dUTP.

[0241] In some embodiments, the nucleotide unit comprises a chain of 1, 2, or 3 phosphorus atoms, which chain is typically attached to the 5'-carbon of the sugar moiety via an ester or phosphoramidate bond. In some embodiments, at least one nucleotide unit is a nucleotide analog having a phosphorus chain in which the phosphorus atoms are joined together with intervening O, S, NH, methylene, or ethylene. In some embodiments, the phosphorus atoms in the chain comprise substituted side-chain groups containing O, S, or BH3. In some embodiments, the chain comprises a phosphate group substituted with analogs including phosphoramidate, phosphorothioate, phosphorodithioate, and O-methylphosphoramidite groups.

[0242] In some embodiments, the multivalent molecule comprises a core attached to a plurality of nucleotide arms, each nucleotide arm comprising nucleotide units, the nucleotide units being nucleotide analogs having a chain terminating moiety (e.g., a blocking moiety) at the 2'-position, 3'-position, or both 2'- and 3'-positions of the sugar. In some embodiments, the nucleotide unit comprises a chain terminating moiety (e.g., a blocking moiety) at the 2'-position, 3'-position, or both 2'- and 3'-positions of the sugar. In some embodiments, the chain terminating moiety can inhibit the polymerase-catalyzed incorporation of subsequent nucleotide units or free nucleotides in the nascent strand during a primer extension reaction. In some embodiments, the chain terminating moiety is attached to the 3'-sugar position, where at the 3'-sugar position, the sugar comprises a ribose or deoxyribose sugar moiety. In some embodiments, the chain terminating moiety is removable / cleavable from the 3'-sugar position to produce a nucleotide having a 3'-OH sugar group that is extendable with a subsequent nucleotide in a polymerase-catalyzed nucleotide incorporation reaction. In some embodiments, the chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, or silyl group. In some embodiments, the chain terminating moiety is cleavable / removable from the nucleotide unit, for example, by reacting the chain terminating moiety with a chemical agent, pH change, light, or heat. In some embodiments, the chain terminating moieties alkyl, alkenyl, alkynyl, and allyl are cleavable using tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4) having piperidine, or 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ). In some embodiments, the chain terminating moieties aryl and benzyl are cleavable using H2 Pd / C. In some embodiments, the chain terminating moieties amine, amide, keto, isocyanate, phosphate, thio, disulfide are cleavable using phosphine, or a thiol group comprising β-mercaptoethanol or dithiothreitol (DTT).In some embodiments, the chain-terminating moiety carbonate can be cleaved using potassium carbonate (K2CO3) in MeOH, triethylamine in pyridine, or Zn in acetic acid (AcOH). In some embodiments, the urea and silyl chain-terminating moieties can be cleaved with tetrabutylammonium fluoride, pyridine-HF, ammonium fluoride, or triethylamine trihydrofluoride.

[0243] In some embodiments, the nucleotide unit contains a chain-terminating moiety (e.g., a blocking moiety) at the sugar 2'-position, the sugar 3'-position, or both the sugar 2'- and 3'-positions. In some embodiments, the chain-terminating moiety contains an azide, an azido, and an azidomethyl group. In some embodiments, the chain-terminating moiety contains a 3'-O-azide or 3'-O-azidomethyl group. In some embodiments, the azide, azido, and azidomethyl group chain-terminating moieties are cleavable / removable with a phosphine compound. In some embodiments, the phosphine compound contains a derivatized trialkylphosphine moiety or a derivatized triarylphosphine moiety. In some embodiments, the phosphine compound contains tris(2-carboxyethyl)phosphine (TCEP), or bis-sulfotriphenylphosphine (BS-TPP), or tris(hydroxyproyl)phosphine (THPP). In some embodiments, the cleavage agent contains 4-dimethylaminopyridine (4-DMAP).

[0244] In some embodiments, a nucleotide unit comprising a chain-terminating moiety selected from the group consisting of 3'-deoxynucleotide, 2',3'-dideoxynucleotide, 3'-methyl, 3'-azide, 3'-azidomethyl, 3'-O-azidoalkyl, 3'-O-ethynyl, 3'-O-aminoalkyl, 3'-O-fluoroalkyl, 3'-fluoromethyl, 3'-difluoromethyl, 3'-trifluoromethyl, 3'-sulfonyl, 3'-malonyl, 3'-amino, 3'-O-amino, 3'-sulfhydryl, 3'-aminomethyl, 3'-ethyl, 3'-butyl, 3'-tert-butyl, 3'-fluorenylmethyloxycarbonyl, 3'-tert-butyloxycarbonyl, 3'-O-alkylhydroxylamino group, 3'-phosphorothioate, and 3-O-benzyl, or derivatives thereof.

[0245] In some embodiments, the multivalent molecule comprises a core attached to a plurality of nucleotide arms, the nucleotide arms comprising a spacer, a linker, and a nucleotide unit, and the core, linker, and / or nucleotide unit are labeled with a detectable reporter moiety. In some embodiments, the detectable reporter moiety comprises a fluorophore. In some embodiments, a particular detectable reporter moiety (e.g., a fluorophore) attached to the multivalent molecule can correspond to the base (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) of the nucleotide unit so as to enable detection and identification of the nucleotide base.

[0246] In some embodiments, at least one nucleotide arm of the multivalent molecule has nucleotide units attached to a detectable reporter moiety. In some embodiments, the detectable reporter moiety is attached to a nucleotide base. In some embodiments, the detectable reporter moiety includes a fluorophore. In some embodiments, a particular detectable reporter moiety (e.g., a fluorophore) attached to the multivalent molecule can correspond to a base of the nucleotide unit (e.g., dATP, dGTP, dCTP, dTTP, or dUTP) to enable detection and identification of the nucleotide base.

[0247] In some embodiments, the core of the multivalent molecule includes an avidin-like or streptavidin-like moiety and the core attachment moiety includes biotin. In some embodiments, the core includes an avidin protein and a streptavidin-type or avidin-type moiety that includes any derivative, analog, and other non-natural forms of avidin that can bind to at least one biotin moiety. Other forms of the avidin moiety include native and recombinant avidin and streptavidin, and derivatized molecules such as non-glycosylated avidin and cleaved streptavidin. For example, the avidin moiety can be a deglycosylated form of avidin, bacterial streptavidin produced by Streptomyces (e.g., Streptomyces avidinii), and derivatized forms such as N-acyl avidin, e.g., N-acetyl, N-phthalyl, and N-succinyl avidin, and commercially available products including EXTRAVIDIN, CAPTAVIDIN, NEUTRAVIDIN, and NEUTRALITE AVIDIN.

[0248] In some embodiments, any of the methods for sequencing the nucleic acid molecules described herein may include forming a binding complex, the binding complex comprising (i) a polymerase, a nucleic acid template molecule having a duplex with a primer, and nucleotides, or the binding complex comprising (ii) a polymerase, a nucleic acid template molecule having a duplex with a primer, and nucleotide units of a multivalent molecule. In some embodiments, the binding complex has a duration of greater than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1 second. The binding complex has a duration of greater than about 0.1-0.25 seconds, or greater than about 0.25-0.5 seconds, or greater than about 0.5-0.75 seconds, or greater than about 0.75-1 second, or greater than about 1-2 seconds, or greater than about 2-3 seconds, or greater than about 3-4 seconds, or greater than about 4-5 seconds, and / or the method is performed or can be performed at 15°C or higher, 20°C or higher, 25°C or higher, 35°C or higher, 37°C or higher, 42°C or higher, 55°C or higher, 60°C or higher, or 72°C or higher, or within a range defined by any of the foregoing. The binding complex (e.g., ternary complex) remains stable until subjected to conditions that cause dissociation of the interaction between the polymerase, the template molecule, the primer, and / or any of the nucleotide units or nucleotides. For example, the dissociation conditions include contacting the binding complex with any one of a detergent, EDTA, and / or water, or a combination of any of them. In some embodiments, the present disclosure provides the method wherein the binding complex is deposited on, attached to, or hybridized to a surface that exhibits a contrast-to-noise ratio of greater than 20 in the detection step. In some embodiments, the present disclosure provides the method wherein the contacting is performed under conditions that stabilize the binding complex when the nucleotide or nucleotide unit is complementary to the next base of the template nucleic acid and destabilize the binding complex when the nucleotide or nucleotide unit is not complementary to the next base of the template nucleic acid.

[0249] Compaction oligonucleotide The compaction oligonucleotide includes a single-stranded linear oligonucleotide having a 5' region capable of hybridizing to a first portion of a concatemer molecule, and a compaction oligonucleotide having a 3' region capable of hybridizing to a second portion of a concatemer molecule (e.g., the same concatemer molecule). In some embodiments, the hybridization of the compaction oligonucleotide to an individual concatemer molecule causes the concatemer molecule to collapse or fold into a DNA nanoball that is more compact in shape and size compared to a non-collapsed DNA molecule. The spot image of the DNA nanoball can be represented as a Gaussian spot, and the size can be measured as the full width at half maximum (FWHM). A smaller spot size indicated by a smaller FWHM typically correlates with an improved image of the spot. In some embodiments, the FWHM of the DNA nanoball spot can be about 10 μm or less. The DNA nanoball can be a compact nucleic acid structure having a small full width at half maximum (FWHM) compared to a concatemer that has not been collapsed / folded into a DNA nanoball.

[0250] In some embodiments, the compaction oligonucleotide includes a single-stranded oligonucleotide comprising DNA, RNA, or a combination of DNA and RNA. The compaction oligonucleotide can be any length including 20 to 150 nucleotides, or 30 to 100 nucleotides, or 40 to 80 nucleotides.

[0251] In some embodiments, the compaction oligonucleotide includes a 5' region and a 3' region, and optionally, an intervening region between the 5' region and the 3' region. The intervening region can be any length, for example, 2 to 20 nucleotides. The intervening region includes a homopolymer having consecutive identical bases (e.g., AAA, GGG, CCC, TTT, or UUU). The intervening region includes a non-homopolymer sequence.

[0252] The 5' region of the compaction oligonucleotide may be fully complementary or partially complementary to the first part of the concatemer molecule along its length. The 3' region of the compaction oligonucleotide may be fully complementary or partially complementary to the second part of the concatemer molecule along its length. The 5' region of the compaction oligonucleotide can hybridize to the first universal sequence portion of the concatemer molecule. The 3' region of the compaction oligonucleotide can hybridize to the second universal sequence portion of the concatemer molecule. The 5' and 3' regions of the compaction oligonucleotide can hybridize to the concatemer, bringing together the distal portions of the concatemer and causing compaction of the concatemer to form a DNA nanoball.

[0253] The 5' region of the compaction oligonucleotide can have the same sequence as the 3' region. The 5' region of the compaction oligonucleotide can have a sequence different from the 3' region. The 3' region of the compaction oligonucleotide can have a sequence that is the reverse complement of the 5' region.

[0254] In some embodiments, sequence data can be derived via nanopore sequencing, which includes sequencing a nucleic acid by translocating the nucleic acid across a membrane, e.g., through a pore, and wherein sequence reads or basecalls are made by measuring one or more signals such as impedance, current, voltage, or capacitance during the translocation event. In some embodiments, the identity of a nucleotide can be determined by a unique electrical signature such as the timing, duration, extent, or shape of a current block, impedance change, voltage change, or capacitance change. Sequencing of nucleic acids by translocation across a membrane and / or through a pore does not exclude alternative detection methods such as optical, chemical, biochemical, fluorescent, luminescent, magnetic, electromagnetic, acoustic, or electroacoustic detection.

[0255] Support and Low-Nonspecific Coating In some embodiments, the flow cell 112 of FIG. 1 can include a support disclosed herein, such as a solid support. The present disclosure provides paired sequencing compositions and methods that use a support having a plurality of oligonucleotide surface primers immobilized thereon. In some embodiments, the support is passivated with a low-nonspecific binding coating. The surface coatings described herein exhibit very low nonspecific binding to reagents typically used for nucleic acid capture, amplification, and sequencing workflows, such as dyes, nucleotides, enzymes, and nucleic acid primers. The surface coating exhibits a low background fluorescence signal or a high contrast-to-noise (CNR) ratio compared to conventional surface coatings.

[0256] The low-nonspecific binding coating includes one or more layers (FIG. 21). As shown in FIG. 21, in some embodiments, the support includes alternating layers of a glass substrate and a hydrophilic coating, the alternating layers of the hydrophilic coating are covalently or non-covalently adhered to the glass, further include chemically reactive functional groups, and the chemically reactive functional groups function as attachment sites for oligonucleotide primers.

[0257] In some embodiments, multiple surface primers are immobilized on a low non-specific binding coating. In some embodiments, at least one surface primer is embedded within a low non-specific binding coating. The low non-specific binding coating enables improved nucleic acid hybridization and amplification performance. Generally, a support includes a substrate (or support structure), one or more layers of a low-binding chemical modification layer, such as a silane layer, a polymer film, attached covalently or non-covalently, and one or more surface primers attached covalently or non-covalently that can be used to design single-stranded nucleic acid library molecules on the support. In some embodiments, the formulation of the coating, such as the chemical composition of one or more layers, the coupling chemistry used to crosslink one or more layers to the support and / or to each other, and the total number of layers, can vary such that non-specific binding of proteins, nucleic acid molecules, and other hybridization and amplification reaction components to the coating is minimized or reduced relative to an equivalent single layer. The coating formulations described herein can vary such that non-specific hybridization on the coating is minimized or reduced relative to an equivalent single layer. The coating formulations can vary such that non-specific amplification on the coating is minimized or reduced relative to an equivalent single layer. The coating formulations can vary such that the specific amplification rate and / or yield on the coating is maximized. The amplification levels suitable for detection are achieved in some cases disclosed herein in 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or fewer, or more than 30 amplification cycles.

[0258] A support structure comprising one or more chemically modified layers, such as a layer of a low non-specific binding polymer, may be standalone or integrated within another structure or assembly. For example, in some embodiments, the support structure may include one or more surfaces within an integrated or assembled microfluidic flow cell. The support structure may include one or more surfaces within a microplate format, such as the bottom surface of a well in a microplate. In some embodiments, the support structure includes the inner surface (e.g., lumen surface) of a capillary. In some embodiments, the support structure includes the inner surface (e.g., lumen surface) of a capillary etched within a planar chip.

[0259] The binding chemistry used to graft the first chemically modified layer to the surface of the support generally depends on both the material from which the surface is fabricated and the chemical nature of the layer. In some embodiments, the first layer may adhere covalently to the surface. In some embodiments, the first layer may bind non-covalently, e.g., adsorb, to the support via non-covalent interaction between the support and the molecular components of the first layer, such as electrostatic interaction, hydrogen bonding, or van der Waals interaction. In either case, the support may be treated prior to the binding or deposition of the first layer. Any of a variety of surface preparation techniques known to those skilled in the art may be used to clean or treat the surface. For example, a glass surface or a silicon surface may be acid washed using a piranha solution (a mixture of sulfuric acid (H2SO4) and hydrogen peroxide (H2O2)), a base treatment in KOH and NaOH, and / or may be cleaned using an oxygen plasma treatment method.

[0260] Silane chemistry constructs a non-limiting approach for covalently modifying silanol groups on a glass or silicon surface to attach more reactive functional groups (e.g., amine or carboxyl groups), which can then be used in the coupling of linker molecules (e.g., linear hydrocarbon molecules of various lengths such as C6, C12, C18 hydrocarbons, or linear polyethylene glycol (PEG) molecules) or layer molecules (e.g., branched PEG molecules or other polymers) to the surface. Examples of suitable silanes that can be used in the preparation of any of the disclosed low adhesion coatings include, but are not limited to, (3-aminopropyl)trimethoxysilane (APTMS), (3-aminopropyl)triethoxysilane (APTES), any of various PEG silanes (e.g., those containing molecular weights such as 1K, 2K, 5K, 10K, 20K, etc.), amino-PEG silanes (i.e., those containing a free amino functional group), maleimide-PEG silanes, and biotin-PEG silanes.

[0261] Any of a variety of molecules known to those of skill in the art, including, but not limited to, amino acids, peptides, nucleotides, oligonucleotides, other monomers, or polymers, or combinations thereof, can be used in the preparation of one or more chemically modified layers on a support, and the choice of components used can vary to modify one or more properties of the layer, such as the functional groups and / or the surface density of tethered oligonucleotide primers, the hydrophilicity / hydrophobicity of the layer, or the three-dimensional properties (i.e., "thickness") of the layer. Examples of polymers that can be used to create one or more layers of low non-specific binding material in any of the disclosed coatings include polyethylene glycol (PEG) of various molecular weights and branched structures, streptavidin, polyacrylamide, polyester, dextran, poly-lysine, and poly-lysine copolymers, or any combination thereof, but are not limited thereto. Examples of conjugation chemistries that can be used to graft one or more layers of material (e.g., polymer layers) onto a surface and / or to crosslink layers to each other include biotin-streptavidin interactions (or variants thereof), his tag-Ni / NTA conjugation chemistry, methoxy ether conjugation chemistry, carboxylate conjugation chemistry, amine conjugation chemistry, NHS ester, maleimide, thiol, epoxy, azide, hydrazide, alkyne, isocyanate, and silane, but are not limited thereto.

[0262] A low non-specific binding surface coating can be applied uniformly across the entire support. Alternatively, the surface coating can be patterned such that the chemically modified layer is restricted to one or more individual regions of the support. For example, the coating can be patterned using photolithography techniques to create an array of aligned or random patterns of chemically modified regions on the support. Alternatively or in combination, the coating can be patterned using, for example, contact printing and / or inkjet printing techniques. In some embodiments, an array of aligned or random patterns of chemically modified regions can include at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or more than 10,000 individual regions.

[0263] In some embodiments, the low non-specific binding coating comprises a hydrophilic polymer that is non-specifically adsorbed or covalently grafted to the support. Typically, passivation is performed using poly(ethylene glycol) (PEG, which is also known as polyethylene oxide (PEO) or polyoxyethylene), or other hydrophilic polymers having different molecular weights and end groups attached to the support, for example, using silane chemistry. The distal end groups from the surface can include, but are not limited to, biotin, methoxy ether, carboxylate, amine, NHS ester, maleimide, and bis-silane. In some embodiments, two or more layers of hydrophilic polymers, such as linear polymers, branched polymers, or dendrimers, can be deposited on the surface. In some embodiments, the two or more layers may be covalently coupled to each other or internally cross-linked to improve the stability of the resulting coating. In some embodiments, surface primers having different nucleotide sequences and / or base modifications (or other biomolecules, such as enzymes or antibodies) can be tethered to the resulting layer at various surface densities. In some embodiments, for example, both the surface functional group density and the surface primer concentration can vary to achieve the desired surface primer density range. Additionally, the surface primer density can be controlled by diluting the surface primer with other molecules having the same functional groups. For example, to reduce the final primer density, an amine-labeled surface primer can be diluted with amine-labeled polyethylene glycol in the reaction with an NHS ester-coated surface. Also, surface primers having different lengths of linkers between the hybridization region and the surface-binding functional groups can be applied to control the surface density. Examples of suitable linkers include poly T and poly A chains (e.g., 0 to 20 bases) at the 5' end of the primer, PEG linkers (e.g., 3 to 20 monomer units), and carbon chains (e.g., C6, C12, C18, etc.). To measure the primer density, a fluorescently labeled primer can be tethered to the surface, and then the fluorescent readout can be compared to that for a dye solution of known concentration.

[0264] In some embodiments, the low non-specific binding coating comprises, on at least a portion of the support, a functionalized polymer coating layer covalently bonded via a chemical group on the support, a primer grafted to the functionalized polymer coating, and a water-soluble protective coating on the primer and the functionalized polymer coating. In some embodiments, the functionalized polymer coating comprises poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM).

[0265] Supports have been developed that include multilayer coatings of PEG and other hydrophilic polymers to adjust primer surface density and add additional dimensionality to hydrophilic or amphoteric coatings. By using hydrophilic and amphoteric surface layering techniques, including but not limited to the polymer / copolymer materials described below, it is possible to significantly increase the primer loading density on the support. Conventional PEG coating techniques use monolayer primer deposition, which has generally been reported for single molecule applications but does not result in high copy numbers for nucleic acid amplification applications. As described herein, "layering" can be achieved with any compatible polymer or monomer subunit such that a surface comprising two or more highly cross-linked layers can be sequentially constructed using conventional cross-linking techniques. Examples of suitable polymers include, but are not limited to, streptavidin, polyacrylamide, polyester, dextran, polylysine, and copolymers of polylysine and PEG. In some embodiments, the different layers can adhere to each other via any of a variety of conjugation reactions, which include, but are not limited to, biotin-streptavidin binding, azide-alkyne click reaction, amine-NHS ester reaction, thiol-maleimide reaction, and ionic interactions between a positively charged polymer and a negatively charged polymer. In some embodiments, the high primer density material can be constructed in solution and then layered onto the surface in multiple steps.

[0266] Examples of materials from which the support structure can be manufactured include, but are not limited to, glass, fused silica, silicon, polymers (e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethyl methacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high-density polyethylene (HDPE), cyclic olefin polymer (COP), cyclic olefin copolymer (COC), polyethylene terephthalate (PET)), or any combination thereof. A variety of compositions for both glass support structures and plastic support structures are contemplated.

[0267] The support structure can be of any of a variety of geometries and dimensions known to those skilled in the art and can include any of a variety of materials known to those skilled in the art. For example, the support structure can be locally planar (e.g., including the surface of a microscope slide or a microscope slide). Generally, the support structure can be cylindrical (e.g., including the inner surface of a capillary or a capillary), spherical (e.g., including the outer surface of a non-porous bead), or irregular (e.g., including the outer surface of an irregularly shaped non-porous bead or particle). In some embodiments, the surface of the support structure used for nucleic acid hybridization and amplification can be a solid non-porous surface. In some embodiments, the surface of the support structure used for nucleic acid hybridization and amplification can be porous, whereby the coatings described herein can penetrate the porous surface and the nucleic acid hybridization and amplification reactions performed thereon can occur within the pores.

[0268] A support structure comprising one or more chemically modified layers, such as a layer of a low non-specific binding polymer, may be standalone or integrated within another structure or assembly. For example, the support structure may include one or more surfaces within an integrated or assembled microfluidic flow cell. The support structure may include one or more surfaces within a microplate format, such as the bottom surface of a well in a microplate. In some embodiments, the support structure includes the inner surface of a capillary (e.g., the lumen surface). In some embodiments, the support structure includes the inner surface of a capillary (e.g., the lumen surface) etched within a planar chip.

[0269] As described above, the low non-specific binding support of the present disclosure exhibits reduced non-specific binding of proteins, nucleic acids, and other components of hybridization and / or amplification formulations used for solid-phase nucleic acid amplification. The degree of non-specific binding exhibited by a given support surface can be evaluated either qualitatively or quantitatively. Exposing the surface to a set of standardized conditions, for example, a fluorescent dye (e.g., cyanine, e.g., Cy3 or Cy5, fluorescein, coumarin, rhodamine, or other dyes disclosed herein), a fluorescently labeled nucleotide, a fluorescently labeled oligonucleotide, and / or a fluorescently labeled protein (e.g., polymerase), followed by a specific rinse protocol and fluorescence imaging, can be used as a qualitative tool for comparing non-specific binding on supports containing different surface formulations. In some embodiments, exposing the surface to a set of standardized conditions, for example, a fluorescent dye, a fluorescently labeled nucleotide, a fluorescently labeled oligonucleotide, and / or a fluorescently labeled protein (e.g., polymerase), followed by a specific rinse protocol and fluorescence imaging, can be used as a quantitative tool for comparing non-specific binding on supports containing different surface formulations, provided that the fluorescence imaging is performed under conditions where the fluorescence signal is linearly related (or related in a predictable manner) to the number of fluorophores on the support (e.g., under conditions where signal saturation and / or self-quenching of the fluorophores is not a problem) and suitable calibration standards are used. In some embodiments, other techniques known to those of skill in the art, such as radioisotope labeling and counting methods, can be used for the quantitative evaluation of the degree to which non-specific binding is exhibited by different support surface formulations of the present disclosure.

[0270] Some of the surfaces disclosed herein exhibit a ratio of specific to non-specific binding of a fluorophore such as Cy3 of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 75, 100, or more than 100, or any intermediate value encompassed by the ranges described herein. Some of the surfaces disclosed herein exhibit a ratio of specific to non-specific fluorescence of a fluorophore such as Cy3 of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 75, 100, or more than 100, or any intermediate value encompassed by the ranges described herein.

[0271] The degree of non-specific binding exhibited by the disclosed low-binding supports can be evaluated under a set of standardized incubation and rinse conditions using a standardized protocol for contacting the surface with a labeled protein (e.g., bovine serum albumin (BSA), streptavidin, DNA polymerase, reverse transcriptase, helicase, single-stranded binding protein (SSB), etc., or any combination thereof), labeled nucleotide, labeled oligonucleotide, etc., followed by detection of the amount of label remaining on the surface and comparison of the signal obtained therefrom to an appropriate calibration standard. In some embodiments, the label can include a fluorescent label. In some embodiments, the label can include a radioisotope. In some embodiments, the label can include any other detectable label known to those skilled in the art. Thus, in some embodiments, the degree of non-specific binding exhibited by a given support surface formulation can be evaluated in terms of the number of non-specifically bound protein molecules (or nucleic acid molecules, or other molecules) per unit area. In some embodiments, the low-binding support of the present disclosure has less than 0.001 molecules per 1 μm 2 per 1 μm 2 per 1 μm 2 per 1 μm 2 per 1 μm 2Less than 0.5 molecules per hit, 1 μm 2 Less than 1 molecule per hit, 1 μm 2 Less than 10 molecules per hit, 1 μm 2 Less than 100 molecules per hit, or 1 μm 2 May exhibit non-specific protein binding (or non-specific binding of other specific molecules (e.g., cyanine, e.g., Cy3 or Cy5, fluorescein, coumarin, rhodamine, etc., or other dyes disclosed herein)) of less than 1,000 molecules per hit. A given support surface of the present disclosure has non-specific binding at any value within this range, e.g., 1 μm 2 It will be recognized by those skilled in the art that it may exhibit non-specific binding of less than 86 molecules per hit. For example, some of the modified surfaces disclosed herein were contacted with a 1 μM solution of Cy3-labeled streptavidin (GE Amersham) in phosphate-buffered saline (PBS) buffer for 15 minutes, followed by rinsing three times with deionized water and then 0.5 molecules / μm 2Exhibit low non-specific protein binding. Some of the modified surfaces disclosed herein exhibit non-specific binding of less than 0.25 molecules of Cy3 dye molecules per 1 μm2. In an independent non-specific binding assay, 1 μM of labeled Cy3 SA (ThermoFisher), 1 μM of Cy5 SA dye (ThermoFisher), 10 μM of aminoallyl-dUTP-ATTO-647N (Jena Biosciences), 10 μM of aminoallyl-dUTP-ATTO-Rhol 1 (Jena Biosciences), 10 μM of aminoallyl-dUTP-ATTO-Rhol 1 (Jena Biosciences), 10 μM of 7-propylamino-7-deaza-dGTP-Cy5 (Jena Biosciences), and 10 μM of 7-propylamino-7-deaza-dGTP-Cy3 (Jena Biosciences) were incubated in a 384-well plate format at 37 °C for 15 minutes on a low-binding coated support. Each well was rinsed 2 - 3 times with 50 μl of deionized RNase / DNase-free water and rinsed 2 - 3 times with 25 mM ACES buffer at pH 7.4. The 384-well plate was imaged on a GE Typhoon instrument using a Cy3, AF555, or Cy5 filter set as specified by the manufacturer (according to the dye test performed) at 800 PMT gain settings and a resolution of 50 - 100 μm. For higher resolution imaging, the images were collected on an Olympus IX83 microscope (e.g., an inverted fluorescence microscope) (Olympus Corp., Center Valley, Pa.) with a total internal reflection illumination fluorescence (TIRF) objective lens (100×, 1.5 NA, Olympus), a CCD camera (e.g., an Olympus EM-CCD monochrome camera, an Olympus XM-10 monochrome camera, or an Olympus DP80 color and monochrome camera), an illumination source (e.g., an Olympus 100W Hg lamp, an Olympus 75W Xe lamp, or an Olympus U-HGLGPS fluorescence light source), and an excitation wavelength of 532 nm or 635 nm.The dichroic mirror was purchased from Semrock (IDEX Health & Science, LLC, Rochester, N.Y.) and is, for example, a 405, 488, 532, or 633 nm dichroic reflector / beam splitter, and the bandpass filter was selected as 532LP or 645LP to match the appropriate excitation wavelength. Some of the modified surfaces disclosed herein are 1 μm. 2 Show non-specific binding of less than 0.25 molecules of dye per hit. In some embodiments, the coated support was immersed in a buffer (e.g., 25 mM ACES, pH 7.4) while the image was being acquired.

[0272] In some embodiments, the surfaces disclosed herein exhibit a ratio of specific to non-specific binding of fluorophores such as Cy3 of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 75, 100, or more than 100, or any intermediate value encompassed by the ranges described herein. In some embodiments, the surfaces disclosed herein exhibit a ratio of specific to non-specific fluorescence signals for fluorophores such as Cy3 of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 75, 100, or more than 100, or any intermediate value encompassed by the ranges described herein.

[0273] A low-background surface consistent with the disclosure herein can exhibit a specific dye attachment (e.g., Cy3 attachment) to non-specific dye adsorption (e.g., Cy3 dye adsorption) ratio of at least 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 30:1, 40:1, 50:1, or can show more than 50 attached specific dye molecules per molecule adsorbed non-specifically. Similarly, a low-background surface consistent with the disclosure herein to which a fluorophore, e.g., Cy3, is attached, when subjected to excitation energy, can exhibit a specific fluorescence signal (e.g., arising from Cy3-labeled oligonucleotides attached to the surface) to non-specifically adsorbed dye fluorescence signal ratio of at least 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 30:1, 40:1, 50:1, or more than 50:1.

[0274] In some embodiments, the degree of hydrophilicity (or "wettability" with an aqueous solution) of the disclosed support surface can be evaluated, for example, via measurement of the water contact angle, in which a small water droplet is placed on the surface and its contact angle with the surface is measured, for example, using an optical tensiometer. In some embodiments, the static contact angle can be determined. In some embodiments, the advancing or receding contact angle can be determined. In some embodiments, the water contact angle for the surface-treated hydrophilic low-binding support disclosed herein can range from about 0 degrees to about 30 degrees. In some embodiments, the water contact angle for the surface-treated hydrophilic low-binding support disclosed herein can be 50 degrees, 40 degrees, 30 degrees, 25 degrees, 20 degrees, 18 degrees, 16 degrees, 14 degrees, 12 degrees, 10 degrees, 8 degrees, 6 degrees, 4 degrees, 2 degrees, or 1 degree or less. In many cases, the contact angle is 40 degrees or less. It will be appreciated by those skilled in the art that a given hydrophilic low-binding support surface of the present disclosure can exhibit a water contact angle having a value within any of these ranges.

[0275] In some embodiments, the hydrophilic surfaces disclosed herein often facilitate reduced wash times for bioassays due to reduced non-specific binding of biomolecules to low-fouling surfaces. In some embodiments, a suitable wash step can be performed in less than 60, 50, 40, 30, 20, 15, 10 seconds, or less than 10 seconds. For example, a suitable wash step can be performed in less than 30 seconds.

[0276] Some of the low-binding surfaces of the present disclosure exhibit a significant improvement in stability or durability against long-term exposure to solvents and high temperatures, or against repeated cycles of solvent exposure or changes in temperature. For example, the stability of the disclosed surfaces can be tested by fluorescently labeling functional groups on the surface, or tethered biomolecules (e.g., oligonucleotide primers) on the surface, and monitoring the fluorescence signal therein before, during, and after long-term exposure to solvents and high temperatures, or repeated cycles of solvent exposure or changes in temperature. In some embodiments, the degree of change in fluorescence used to evaluate the quality of the surface is less than 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, or 25% (or any combination of these percentages as measured over these periods) over a period of 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 10 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 15 hours, 20 hours, 25 hours, 30 hours, 35 hours, 40 hours, 45 hours, 50 hours, or 100 hours of exposure to solvents and / or high temperatures. In some embodiments, the degree of change in fluorescence used to evaluate the quality of the surface is less than 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, or 25% (or any combination of these percentages as measured over this range of cycles) over repeated exposure to solvent changes and / or changes in temperature of 5 cycles, 10 cycles, 20 cycles, 30 cycles, 40 cycles, 50 cycles, 60 cycles, 70 cycles, 80 cycles, 90 cycles, 100 cycles, 200 cycles, 300 cycles, 400 cycles, 500 cycles, 600 cycles, 700 cycles, 800 cycles, 900 cycles, or 1,000 cycles.

[0277] In some embodiments, the surfaces disclosed herein may exhibit a high ratio of specific signal to non-specific signal or other background. For example, when used for nucleic acid amplification, some surfaces may exhibit an amplification signal that is at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 75, 100, or 100-fold greater than the signal in adjacent non-aggregated regions of the surface. Similarly, some surfaces may exhibit an amplification signal that is at least 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 75, 100, or 100-fold greater than the signal in adjacent amplified nucleic acid aggregated regions of the surface.

[0278] In some embodiments, in nucleic acid hybridization or amplification applications, the fluorescence images of the disclosed low-background surfaces when used to create colonies of hybridized or clonally amplified nucleic acid molecules (e.g., labeled directly or indirectly with a fluorophore) exhibit a contrast-to-noise ratio (CNR) of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 210, 220, 230, 240, 250, or greater than 250.

[0279] One or more types of primers may be bound or tethered to the support surface. In some embodiments, one or more types of adapters or primers may include a spacer sequence, an adapter sequence for hybridization to an adapter-ligated target library nucleic acid sequence, a forward amplification primer, a reverse amplification primer, a sequencing primer, and / or a molecular barcode sequence, or any combination thereof. In some embodiments, one primer or adapter sequence may be tethered to at least one layer of the surface. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 different primer or adapter sequences may be tethered to at least one layer of the surface.

[0280] In some embodiments, the tethered adapter and / or primer sequence can be in the range of about 10 nucleotides to about 100 nucleotides in length. In some embodiments, the tethered adapter and / or primer sequence can be at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides in length. In some embodiments, the tethered adapter and / or primer sequence can be at most 100, at most 90, at most 80, at most 70, at most 60, at most 50, at most 40, at most 30, at most 20, or at most 10 nucleotides in length. Any of the lower and upper values described in this paragraph can be combined to form a range included within the present disclosure. For example, in some embodiments, the length of the tethered adapter and / or primer sequence can be in the range of about 20 nucleotides to about 80 nucleotides. Those skilled in the art will recognize that the length of the tethered adapter and / or primer sequence can have any value within this range, for example, about 24 nucleotides.

[0281] In some embodiments, the resulting surface density of the primer (e.g., capture primer) on the low-binding support surface of the present disclosure is 1 μm 2 per about 100 primer molecules to 1 μm 2 per about 100,000 primer molecules. In some embodiments, the resulting surface density of the primer on the low-binding support surface of the present disclosure is 1 μm 2 per about 1,000 primer molecules to 1 μm 2 per about 1,000,000 primer molecules. In some embodiments, the surface density of the primer is 1 μm 2 per at least 1,000, at least 10,000, at least 100,000, or at least 1,000,000 molecules. In some embodiments, the surface density of the primer is 1 μm 2It can be up to 1,000,000, up to 100,000, up to 10,000, or up to 1,000 molecules per hit. Combinations of any of the lower and upper limits described in this paragraph can form the ranges included in the present disclosure. For example, in some embodiments, the surface density of the primer is 1 μm 2 from about 10,000 molecules per μm 2 to about 100,000 molecules per μm. The surface density of the primer molecules can be any value within this range. For example, 1 μm 2 can have about 455,000 molecules per hit, which will be recognized by those skilled in the art. In some embodiments, the surface density of the target library nucleic acid sequences that first hybridize to the adapter or primer sequences on the support surface can be less than that shown for the surface density of the tethered primers. In some embodiments, the surface density of the clonally amplified target library nucleic acid sequences that hybridize to the adapter or primer sequences on the support surface can encompass the same range as that shown for the surface density of the tethered primers.

[0282] The local densities listed above do not preclude the density from varying across the surface such that the surface includes regions having, for example, an oligo density of 500,000 / μm 2 and also includes at least a second region having a substantially different local density.

[0283] In some embodiments, the performance of nucleic acid hybridization and / or amplification reactions using the disclosed reaction formulations and low-binding supports can be evaluated using fluorescence imaging techniques, and the contrast-to-noise ratio (CNR) of the images provides an important metric in the evaluation of amplification specificity and non-specific binding on the support. CNR is generally defined as CNR = (signal - background) / noise. The background term is generally considered to be the signal measured for the interstitial region surrounding a particular feature (diffraction-limited spot, DLS) in a particular region of interest (ROI). The signal-to-noise ratio (SNR) is often considered a benchmark for overall signal quality, but as shown in the examples below, improved CNR can provide a significant advantage over SNR as a benchmark for signal quality in applications that require rapid image capture (e.g., sequencing applications where cycle time must be minimized). With high CNR, the imaging time required to achieve accurate discrimination (and thus accurate base calling in the case of sequencing applications) can be significantly reduced even with a moderate improvement in CNR. Improved CNR in imaging data for imaging integration time provides a method for more accurately detecting features such as clonally amplified nucleic acid colonies on the support surface.

[0284] In most ensemble-based sequencing techniques, the background term is typically measured as the signal associated with the "interstitial" region. In addition to the "interstitial" background (B inter ), an "intrastitial" background (B intra ) is present within the region occupied by the amplified DNA colonies. The combination of these two background signals determines the achievable CNR, which then directly affects optical instrument requirements, architecture cost, reagent cost, run time, cost / genome, and ultimately the accuracy and data quality for circular array-based sequencing applications. Binter Background signals arise from a variety of sources, and some examples include autofluorescence from a consumable flow cell, nonspecific adsorption of detection molecules that can obscure the signal from the ROI, resulting in spurious fluorescence signals, and the presence of nonspecific DNA amplification products (e.g., those arising from primer dimers). In typical next-generation sequencing (NGS) applications, this background signal in the current field of view (FOV) is averaged and subtracted over time. The signal arising from individual DNA colonies (i.e., (signal) - B (interstitial) in the FOV) provides distinguishable features that can be classified. In some embodiments, the interstitial background (B (interstitial)) is not specific to the target of interest but can contribute to interfering fluorescence signals present in the same ROI, thus making averaging and subtraction much more difficult.

[0285] Nucleic acid amplification on the low-binding coating supports described herein can reduce the B (interstitial) background signal by reducing nonspecific binding, can result in an improvement in specific nucleic acid amplification, and can result in a reduction in nonspecific amplification that can affect the background signal arising from both interstitial and intrastitial regions. In some embodiments, optionally, the disclosed low-binding coating supports, used in combination with the disclosed hybridization and / or amplification reaction formulations, can provide an improvement in CNR that is 2, 5, 10, 100, 250, 500, or 1000 times greater than that achieved using conventional supports and hybridization, amplification, and / or sequencing protocols. Although described herein in the context of using fluorescence imaging as a readout or detection mode, the same principles apply to the use of the disclosed low-binding coating supports, as well as nucleic acid hybridization and amplification formulations, for other detection modes, including both optical and non-optical detection modes.

[0286] The headings provided in this specification are not limitations of the various embodiments of the present disclosure, which can be understood by referring to the entire specification.

[0287] Unless otherwise defined, all technical and scientific terms used in this specification have the meaning commonly understood by one of ordinary skill in the art, unless otherwise defined. Generally, the terms related to the techniques of molecular biology, nucleic acid chemistry, protein chemistry, genetics, microbiology, gene transfer cell production, and hybridization described in this specification are well-known and commonly used in the art. The techniques and procedures described in this specification are generally performed according to conventional methods well-known in the art and are performed as described in various general and more specific references cited and discussed throughout this specification. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (Third ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 2000). Also see Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992). The nomenclature and the experimental procedures and techniques used in connection with the experimental procedures and techniques described in this specification are well-known and commonly used in the art.

[0288] Unless the context requires otherwise herein, singular terms include the plural, and plural terms include the singular. The use of the singular forms of "a," "an," and "the," and the use of the singular form of any word, unless clearly and unambiguously limited to one reference, includes plural references.

[0289] The use of alternative terms (e.g., "or") is understood to mean either one or both of the alternative forms, or any combination of them.

[0290] As used herein, the term "and / or" is to be understood to mean a specific disclosure that each of the particular features or components either has or does not have the other. For example, when used in phrases such as "A and / or B" herein, the term "and / or" is intended to include "A and B", "A or B", "A" (only A), and "B" (only B). In a similar manner, when used in phrases such as "A, B, and / or C", the term "and / or" is intended to include each of the following embodiments: "A, B, and C", "A, B, or C", "A or C", "A or B", "B or C", "A and B", "B and C", "A and C", "A" (only A), "B" (only B), and "C" (only C).

[0291] As used in this specification and the appended claims, the terms "comprising", "including", "having", and "containing", and their grammatical variations as used herein, are intended to be non-limiting such that one or more items within the listing do not exclude other items that may be substituted or added to the listed items. It is understood that in this specification, when an embodiment is described in the language of "comprising", other similar embodiments described in the terms of "consisting of" and / or "consisting essentially of" are also provided.

[0292] As used herein, the terms "about," "approximately," and "substantially" refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, and the acceptable error range depends in part on how the value or composition is measured or determined, i.e., on the limitations of the measurement system. For example, "about," "approximately," or "substantially" can mean within one or more standard deviations of the mean per implementation in the relevant art. Alternatively, "about" or "approximately" can mean a range of up to 10% (i.e., ±10%) depending on the limitations of the measurement system. For example, about 5 mg can include any number between 4.5 mg and 5.5 mg. Further, especially with respect to biological systems or processes, this term can mean up to one order of magnitude or up to five-fold the value. When a particular value or composition is provided in this disclosure, unless otherwise stated, the meaning of "about," "approximately," "substantially" should be considered to be within the acceptable error range for this particular value or composition. Also, when ranges and / or sub-ranges of values are provided, the ranges and / or sub-ranges can include the endpoints of the ranges and / or sub-ranges.

[0293] As used herein, the term "polony" refers to the ability to clonally amplify nucleic acid library molecules in solution or on a support to generate amplicons that can function as template molecules for sequencing. In some embodiments, linear library molecules can be circularized to generate circularized library molecules, and the circularized library molecules can be clonally amplified in solution or on a support to generate concatemers. In some embodiments, the concatemers can function as nucleic acid template molecules that can be sequenced. Concatemers are sometimes referred to as polonies. In some embodiments, a polony includes a nucleotide strand.

[0294] The terms "peptide", "polypeptide", and "protein" and other related terms used herein are used synonymously and refer to polymers of amino acids, not limited to any particular length. Polypeptides can include natural and non-natural amino acids. Examples of polypeptides include recombinant or chemically synthesized types. Polypeptides also include precursor molecules that have not yet undergone post-translational modifications such as proteolytic cleavage, cleavage by ribosomal skipping, hydroxylation, methylation, lipidation, acetylation, SUMOylation, ubiquitination, glycosylation, phosphorylation, and / or disulfide bond formation. These terms encompass natural and artificial proteins, protein fragments, and polypeptide analogs (such as mutant proteins, variants, chimeric proteins, and fusion proteins) of protein sequences, as well as proteins that have been modified post-translationally or otherwise covalently or non-covalently.

[0295] As used herein, the term "polymerase" and variants thereof include any enzyme capable of catalyzing the polymerization of nucleotides (including analogs thereof) onto a nucleic acid strand. Typically, although not necessarily, such nucleotide polymerization can occur in a template-dependent manner. Typically, a polymerase includes one or more active sites at which nucleotide binding and / or catalysis of nucleotide polymerization can occur. In some embodiments, a polymerase includes other enzyme activities, such as 3' to 5' exonuclease activity or 5' to 3' exonuclease activity. In some embodiments, a polymerase has strand displacement activity. Polymerases include naturally occurring polymerases and any subunits and truncations, mutant polymerases, variant polymerases, recombinant, fusion or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives, or fragments (e.g., catalytically active fragments) thereof that retain the ability to catalyze nucleotide polymerization, but are not limited thereto. In some embodiments, a polymerase may be isolated from a cell or may be produced using recombinant DNA technology or chemical synthesis methods. In some embodiments, a polymerase can be expressed in a prokaryotic, eukaryotic, viral, or phage organism. In some embodiments, a polymerase can be a post-translationally modified protein or a fragment thereof. A polymerase can be derived from a prokaryote, eukaryote, virus, or phage. Polymerases include DNA-directed DNA polymerases and RNA-directed DNA polymerases.

[0296] As used herein, the term "fidelity" refers to the accuracy of DNA polymerization by a template-dependent DNA polymerase. The fidelity of a DNA polymerase is typically measured by the error rate (the frequency of incorporating an incorrect nucleotide, i.e., a nucleotide that is not complementary to the template nucleotide). The accuracy or fidelity of DNA polymerization is maintained by both the polymerase activity and the 3'-to-5' exonuclease activity of the DNA polymerase.

[0297] As used herein, the term "binding complex" refers to a complex formed by binding together a nucleic acid duplex, a polymerase, and a free nucleotide or nucleotide unit of a multivalent molecule, wherein the nucleic acid duplex comprises a nucleic acid template molecule hybridized to a nucleic acid primer. In a binding complex, the free nucleotide or nucleotide unit may or may not bind at a position opposite the complementary nucleotide in the nucleic acid template molecule at the 3'-end of the nucleic acid primer. A "ternary complex" is an example of a binding complex formed by binding together a nucleic acid duplex, a polymerase, and a free nucleotide or nucleotide unit of a multivalent molecule, wherein the free nucleotide or nucleotide unit is bound at a position opposite the complementary nucleotide in the nucleic acid template molecule at the 3'-end of the nucleic acid primer (as part of the nucleic acid duplex).

[0298] The term "duration" and related terms refer to the length of time during which a binding complex remains stable without any of its components dissociating, where the components of the binding complex include a nucleic acid template and nucleic acid primer, polymerase, nucleotide units of a multivalent molecule, or free (e.g., non-conjugated) nucleotides. The nucleotide units or free nucleotides may be complementary or non-complementary to nucleotide residues in the template molecule. The nucleotide units or free nucleotides can bind at the 3' end of the nucleic acid primer at a position opposite to the complementary nucleotide residue in the nucleic acid template molecule. The duration indicates the stability of the binding complex and the strength of the binding interaction. The duration can be measured by observing the initiation and / or duration of the binding complex, for example, by observing the signal from a labeled component of the binding complex. For example, a labeled nucleotide or a labeled reagent containing one or more nucleotides can be present in the binding complex, thus enabling the signal from the label to be detected during the duration of the binding complex. One exemplary label is a fluorescent label. The binding complex (e.g., ternary complex) remains stable until subjected to conditions that cause dissociation of the interaction between the polymerase, template molecule, primer, and / or any of the nucleotide units or nucleotides. For example, the dissociation conditions include contacting the binding complex with any one of a detergent, EDTA, and / or water, or any combination thereof.

[0299] As used herein, the terms "nucleic acid", "polynucleotide", and "oligonucleotide", and other related terms are used interchangeably and refer to polymers of nucleotides, and are not limited to any particular length. Nucleic acids include recombinant and chemically synthesized forms. Nucleic acids include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of DNA or RNA generated using nucleotide analogs (e.g., peptide nucleic acids and non-naturally occurring nucleotide analogs), and chimeric forms containing DNA and RNA. Nucleic acids can be single-stranded or double-stranded. Nucleic acids contain polymers of nucleotides, and nucleotides contain natural or unnatural bases and / or sugars. Nucleic acids contain naturally occurring internucleoside linkages, such as phosphodiester linkages. Nucleic acids contain non-natural internucleoside linkages, and non-natural internucleoside linkages include phosphorothioate, phosphorothiolate, or peptide nucleic acid (PNA) linkages. In some embodiments, the nucleic acid comprises one type of polynucleotide, or a mixture of two or more different types of polynucleotides.

[0300] As used herein, the term "primer" and related terms refer to either natural or synthetic oligonucleotides that can hybridize to a DNA and / or RNA polynucleotide template to form a double-stranded molecule. Primers can have any length, but typically can range from 4 to 50 nucleotides. A typical primer includes a 5' end and a 3' end. The 3' end of the primer can include a 3'OH moiety that functions as a nucleotide polymerization initiation site in a polymerase-mediated primer extension reaction. Alternatively, the 3' end of the primer can lack a 3'OH moiety or can include a terminal 3' blocking group that inhibits nucleotide polymerization in a polymerase-mediated reaction. Any one nucleotide or two or more nucleotides along the length of the primer can be labeled with a detectable reporter moiety. Primers can be in solution (e.g., soluble primers) or can be immobilized on a support (e.g., capture primers).

[0301] "Template nucleic acid", "template polynucleotide", "target nucleic acid", "target polynucleotide", "template strand", and other variations refer to nucleic acid strands that function as a base nucleic acid molecule for generating complementary nucleic acid strands. The template nucleic acid may be single-stranded or double-stranded, or the template nucleic acid may have single-stranded or double-stranded portions. The sequence of the template nucleic acid can be partially or completely complementary to the sequence of the complementary strand. The template nucleic acid may be obtained from a natural source or recombinant form, or may be chemically synthesized to include any type of nucleic acid analog. The template nucleic acid can be linear, circular, or in other forms. The template nucleic acid can include an insert region having an insert sequence that is also known as the sequence of interest. The template nucleic acid can also include at least one adapter sequence. The template nucleic acid can be a concatemer having two or tandem copies of the sequence of interest and at least one adapter sequence. The insert region can be isolated in any form, and the form includes chromosomes, genomes, organelles (e.g., mitochondria, chloroplasts, or ribosomes), recombinant molecules, cloning, amplification, cDNA, RNA such as precursor mRNA or mRNA, oligonucleotides, genomic DNA obtained from fresh frozen paraffin-embedded tissues, needle biopsies, cell-free circulating DNA, or any type of nucleic acid library. The insert region can be isolated from any source, and the source includes organisms such as prokaryotes, eukaryotes (e.g., humans, plants, and animals), fungi, viral cells, tissues, normal or diseased cells or tissues, body fluids including blood, urine, serum, lymph, tumors, saliva, anal and vaginal secretions, amniotic fluid samples, sweat, semen, environmental samples, culture samples, or synthetic nucleic acid molecules prepared using recombinant molecular biology or chemical synthesis methods. The insert region can be isolated from any organ, and the organ includes the head, neck, brain, breast, ovary, cervix, colon, rectum, endometrium, gallbladder, intestine, bladder, prostate, testis, liver, lung, kidney, esophagus, pancreas, thyroid, pituitary, thymus, skin, heart, larynx, or other organs. The template nucleic acid can be subjected to nucleic acid analysis including sequencing and compositional analysis.

[0302] When used in reference to nucleic acid molecules, the terms "hybridize", "hybridizing", "hybridization", or other related terms refer to hydrogen bonding between two different nucleic acids to form a double-stranded nucleic acid. Hybridization also includes hydrogen bonding between two different regions of a single nucleic acid molecule to form a self-hybridizing molecule having a double-stranded region. Hybridization can include Watson-Crick or Hoogsteen bonds to form a double-stranded double-stranded nucleic acid, or a double-stranded region within a nucleic acid molecule. The double-stranded nucleic acid, or two different regions of a single nucleic acid, may be completely complementary or partially complementary. Complementary nucleic acid strands need not hybridize to each other over their entire length. Complementary base pairing may be standard A-T or C-G base pairing, or other forms of base pairing interactions. The double-stranded nucleic acid may contain mismatched base pairing nucleotides.

[0303] The term "nucleotide" and related terms refer to a molecule containing an aromatic base, a five-carbon sugar (e.g., ribose or deoxyribose), and at least one phosphate group. Standard or non-standard nucleotides are consistent with the use of this term. In some embodiments, the phosphate includes monophosphate, diphosphate, or triphosphate, or the corresponding phosphate analogs. In some embodiments, the nucleotide contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphate groups. The term "nucleoside" refers to a molecule containing an aromatic base and a sugar.

[0304] Nucleotides (and nucleosides) typically contain a heterocyclic base that includes a substituted or unsubstituted nitrogen-containing parent heteroaromatic ring, which are commonly found in nucleic acids and include naturally occurring, substituted, modified, or engineered variants, or analogs thereof. The bases of the nucleotides (or nucleosides) are capable of forming Watson-Crick and / or Hoogsteen hydrogen bonds with appropriate complementary bases. Exemplary bases include purines and pyrimidines, such as 2-aminopurine, 2,6-diaminopurine, adenine (A), ethenoadenine, N 6 -Δ 2 -isopentenyladenine (6iA), N 6 -Δ 2 -isopentenyl-2-methylthioadenine (2ms6iA), N 6 -methyladenine, guanine (G), isoguanine, N 2 -dimethylguanine (dmG), 7-methylguanine (7mG), 2-thiopyrimidine, 6-thioguanine (6sG), hypoxanthine, and O 6 -methylguanine, 7-deaza-purines, such as 7-deazaadenine (7-deaza-A) and 7-deazaguanine (7-deaza-G), pyrimidines, such as cytosine (C), 5-propynylcytosine, isocytosine, thymine (T), 4-thiothymine (4sT), 5,6-dihydrothymine, O 4 -methylthymine, uracil (U), 4-thiouracil (4sU), and 5,6-dihydrouracil (dihydrouracil; D), indoles, such as nitroindole and 4-methylindole, pyrroles, such as nitropyrrole, nebularine, inosine, hydroxymethylcytosine, 5-methylcytosine, base (Y), and methylated, glycosylated, and acylated base moieties, among others, but not limited thereto. Additional exemplary bases can be found in Fasman, 1989, “Practical Handbook of Biochemistry and Molecular Biology”, pp. 385-394, CRC Press, Boca Raton, Fla.

[0305] Nucleotides (and nucleosides) typically include a sugar moiety, such as a carbocyclic moiety (Ferraro and Gotor 2000 Chem. Rev. 100:4319-48), an acyclic moiety (Martinez, et al., 1999 Nucleic Acids Research 27:1271-1274, Martinez, et al., 1997 Bioorganic & Medicinal Chemistry Letters vol. 7:3013-3016), and other sugar moieties (Joeng, et al., 1993 J. Med. Chem. 36:2627-2638, Kim, et al., 1993 J. Med. Chem. 36:30-7, Eschenmosser 1999 Science 284:2118-2124 and U.S. Patent No. 5,558,991). The sugar moiety includes ribosyl, 2'-deoxyribosyl, 3'-deoxyribosyl, 2',3'-dideoxyribosyl, 2',3'-didehydrodideoxyribosyl, 2'-alkoxyribosyl, 2'-azidoribosyl, 2'-aminoribosyl, 2'-fluororibosyl, 2'-mercaptoriboxyl, 2'-alkylthioribosyl, 3'-alkoxyribosyl, 3'-azidoribosyl, 3'-aminoribosyl, 3'-fluororibosyl, 3'-mercaptoriboxyl, 3'-alkylthioribosyl carbocyclic, acyclic, or other modified sugars.

[0306] In some embodiments, the nucleotide includes a chain of 1, 2, or 3 phosphorus atoms, which chain is typically attached to the 5'-carbon of the sugar moiety via an ester or phosphoramidate bond. In some embodiments, the nucleotide is an analog having a phosphorus chain in which the phosphorus atoms are bonded together with intervening O, S, NH, methylene, or ethylene. In some embodiments, the phosphorus atoms in the chain include a substituted side chain group containing O, S, or BH3. In some embodiments, the chain includes a phosphate group substituted with analogs including phosphoramidate, phosphorothioate, phosphorodithioate, and O-methylphosphoramidite groups.

[0307] When used in reference to nucleic acids, the terms "extending," "extension," "extend," and other variations refer to the incorporation of one or more nucleotides into a nucleic acid molecule. The incorporation of nucleotides includes the polymerization of one or more nucleotides to the 3'OH terminus of the end of a nucleic acid strand, resulting in the extension of the nucleic acid strand. Nucleotide incorporation can be performed with natural nucleotides and / or nucleotide analogs. Typically, but not necessarily, nucleotide incorporation occurs in a template-dependent manner. Any suitable method for extending a nucleic acid molecule can be used, and suitable methods include primer extension catalyzed by a DNA polymerase or an RNA polymerase.

[0308] The terms "reporter moiety," "reporter moieties," or related terms refer to a compound that produces, or causes the production of, a detectable signal. Reporter moieties are often referred to as "labels." Any suitable reporter moiety can be used, including luminescence, photoluminescence, electroluminescence, bioluminescence, chemiluminescence, fluorescence, phosphorescence, chromophore, radioisotope, electrochemistry, mass spectrometry, Raman, hapten, affinity tag, atom, or enzyme. Reporter moieties produce a detectable signal resulting from a chemical or physical change (e.g., heat, light, electricity, pH, salt concentration, enzyme activity, or proximity event). Proximity events include two reporter moieties coming into proximity with each other, associating with each other, or binding to each other. It is well known to those skilled in the art to select reporter moieties such that each absorbs excitation radiation and / or emits fluorescence at a wavelength distinguishable from that of other reporter moieties, allowing the presence of different reporter moieties in the same reaction or different reactions to be monitored. Two or more different reporter moieties having spectrally distinct emission profiles or minimal overlapping spectral emission profiles can be selected. Reporter moieties can be bound (e.g., operably bound) to nucleotides, nucleosides, nucleic acids, enzymes (e.g., polymerases or reverse transcriptases), or supports (e.g., surfaces).

[0309] The reporter moiety (or label) includes a fluorescent label or fluorophore. Exemplary fluorescent moieties that can function as a fluorescent label or fluorophore include fluorescein and fluorescein derivatives such as carboxyfluorescein, tetrachlorofluorescein, hexachlorofluorescein, carboxynapthofluorescein, fluorescein isothiocyanate, NHS-fluorescein, iodoacetamide fluorescein, fluorescein maleimide, SAMSA-fluorescein, fluorescein thiosemicarbazide, carbohydrazinomethylthioacetyl-amino fluorescein, rhodamine and rhodamine derivatives such as TRITC, TMR, lysamine rhodamine, Texas Red, rhodamine B, rhodamine 6G, rhodamine 10, NHS-rhodamine, TMR-iodoacetamide, lysamine rhodamine B sulfonyl chloride, lysamine rhodamine B sulfonyl hydrazide, Texas Red sulfonyl chloride, Texas Red hydrazide, coumarin and coumarin derivatives such as AMCA, AMCA-NHS, AMCA-sulfo-NHS, AMCA-HPDP, DCIA, AMCE-hydrazide, BODIPY and derivatives such as BODIPY FL C3-SE, BODIPY 530 / 550 C3, BODIPY 530 / 550 C3-SE, BODIPY 530 / 550 C3 hydrazide, BODIPY 493 / 503 C3 hydrazide, BODIPY FL C3 hydrazide, BODIPY FL IA, BODIPY 530 / 551 IA, Br-BODIPY 493 / 503, Cascade Blue and derivatives such as Cascade Blue acetyl azide, Cascade Blue cadaverine, Cascade Blue ethylenediamine, Cascade Blue hydrazide, Lucifer Yellow and derivatives such as Lucifer Yellow iodoacetamide, Lucifer Yellow CH, cyanine and derivatives such as indolium-based cyanine dyes, benzo-indolium-based cyanine dyes, pyridinium-based cyanine dyes, thiazolium-based cyanine dyes, quinolinium-based cyanine dyes, imidazolium-based cyanine dyes, Cy 3, Cy5, lanthanide chelates and derivatives such as BCPDA, TBP, TMT,BHHCT, BCOT, europium chelates, terbium chelates, Alexa Fluor dyes, DyLight dyes, Atto dyes, LightCycler Red dyes, CAL Flour dyes, JOE, and their derivatives, Oregon Green dyes, WellRED dyes, IRD dyes, phycoerythrin and phycobilin dyes, Malachite green, stilbene, DEG dyes, NR dyes, near-infrared dyes, and others known in the art such as those described in Haugland, Molecular Probes Handbook, (Eugene, Oreg.) 6th Edition, Lakowicz, Principles of Fluorescence Spectroscopy, 2nd Ed., Plenum Press New York (1999), or Hermanson, Bioconjugate Techniques, 2nd Edition, or any derivatives thereof, or any combination thereof, but not limited thereto. Cyanine dyes can exist in either sulfonated or non-sulfonated forms and consist of two indolenine, benzoindolium, pyridinium, thiazolium, and / or quinolinium groups separated by a polymethine bridge between two nitrogen atoms. Commercially available cyanine fluorophores include, for example, Cy3 (1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-2-(3-{1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-3,3-dimethyl-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium or 1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-2-(3-{1-[6-(2,5-dioxopyrrolidin-1-yloxy)-6-oxohexyl]-3,3-dimethyl-5-sulfo-1,3-dihydro-2H-indol-2-ylidene}prop-1-en-1-yl)-3,3-dimethyl-3H-indolium-5-sulfonate).Cy5 (1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-indolin-2-ylidene)penta-1,3-dien-1-yl)-3,3-dimethyl-3H-indol-1-ium or 1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-2-((1E,3E)-5-((E)-1-(6-((2,5-dioxopyrrolidin-1-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-sulfoindolin-2-ylidene)penta-1,3-dien-1-yl)-3,3-dimethyl-3H-indol-1-ium-5-sulfonate can be included) and Cy7 (1-(5-carboxypentyl)-2-[(1E,3E,5E,7Z)-7-(1-ethyl-1,3-dihydro-2H-indol-2-ylidene)hepta-1,3,5-triene-1-yl]-3H-indolium or 1-(5-carboxypentyl)-2-[(1E,3E,5E,7Z)-7-(1-ethyl-5-sulfo-1,3-dihydro-2H-indol-2-ylidene)hepta-1,3,5-triene-1-yl]-3H-indolium-5-sulfonate can be included), where "Cy" represents "cyanine" and the first digit indicates the number of carbon atoms between the two indolenine groups. Cy2, which is an oxazole derivative rather than an indolenine, and benzoderivatized Cy3.5, Cy5.5, and Cy7.5 are exceptions to this rule.,

[0310] In some embodiments, the reporter moiety can be a FRET pair, whereby multiple classifications can be performed under a single excitation and imaging step. As used herein, FRET can include Förster (excitation transfer) or Dexter (electron transfer) transfer.,

[0311] The terms “linked,” “joined,” “attached,” and variants thereof include any kind of fusion, bonding, adhesion, or association between any combination of compounds or molecules having sufficient stability to withstand use in a particular procedure. The procedure can include, but is not limited to, nucleotide transient bonding, nucleotide incorporation, deblocking, washing, removal, flow, detection, imaging, and / or identification. Such bonding can include, for example, covalent, ionic, hydrogen, dipole-dipole, hydrophilic, hydrophobic, or affinity bonding, bonding or association including van der Waals forces, and mechanical bonding. In some embodiments, such bonding occurs within a molecule, for example, to join the ends of a single-stranded or double-stranded linear nucleic acid molecule together to form a circular molecule. In some embodiments, such linkage includes, but is not limited to, linkage between a nucleic acid molecule and a solid surface, linkage between a protein and a detectable reporter moiety, linkage between a nucleotide and a detectable reporter moiety, etc., and can occur between combinations of different molecules, or between a molecule and a non-molecule. Some examples of bonding can be found, for example, in Hermanson, G., “Bioconjugate Techniques,” Second Edition (2008), Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences,” London: Macmillan (1998), Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences,” London: Macmillan (1998).

[0312] As used herein, the terms "operably linked" and "operably connected," or related terms, refer to the juxtaposition of components. Juxtaposed components can be joined together covalently. For example, two nucleic acid components can be enzymatically ligated together, and the bond that joins the two components together includes a phosphodiester bond. A first and a second nucleic acid component can be joined together, and the first nucleic acid component can impart a function to the second nucleic acid component. For example, the bond between a primer binding sequence and a sequence of interest forms a nucleic acid library molecule having a portion that can bind to the primer. In another example, a transgene (e.g., a nucleic acid encoding a polypeptide or nucleic acid sequence of interest) can be ligated to a vector, and the bond enables the expression or function of the transgene sequence contained within the vector. In some embodiments, the transgene is operably linked to a host cell regulatory sequence (e.g., a promoter sequence) that affects the expression of the transgene. In some embodiments, the vector includes at least one host cell regulatory sequence, and the at least one host cell regulatory sequence includes, for example, a promoter sequence, an enhancer, a transcription and / or translation initiation sequence, a transcription and / or translation termination sequence, and a polypeptide secretion signal sequence. In some embodiments, the host cell regulatory sequence controls the level, timing, and / or location of expression of the transgene.

[0313] The term "adapter" and related terms refer to an oligonucleotide that can be operably linked (added) to a target polynucleotide, and the adapter confers a function on the co-ligated adapter-target molecule. The adapter includes DNA, RNA, chimeric DNA / RNA, or analogs thereof. The adapter can include at least one ribonucleoside residue. The adapter can be single-stranded or double-stranded, or can have single-stranded and / or double-stranded portions. The adapter can be configured to be in a linear, stem-loop, hairpin, or Y-shaped form. The adapter can be of any length including 4 to 100 or more nucleotides. The adapter can have blunt ends, overhang ends, or a combination of both. Overhang ends include 5' overhang and 3' overhang ends. The 5' end of a single-stranded adapter, or one strand of a double-stranded adapter, may or may not have a 5' phosphate group. The adapter can include a 5' tail that does not hybridize to the target polynucleotide (e.g., a tailed adapter), or the adapter can be tail-less. The adapter can include a sequence that is complementary to at least a portion of a primer, such as an amplification primer, a sequencing primer, or a capture primer (e.g., a soluble or immobilized capture primer). The adapter can include a random sequence or a degenerate sequence. The adapter can include at least one inosine residue. The adapter can include at least one phosphorothioate, phosphorothiolate, and / or phosphoramidate bond. The adapter can include a barcode sequence, which can be used to distinguish polynucleotides (e.g., insert sequences) from different sample sources in a multiplex assay. The adapter can include a unique identification sequence (e.g., a unique molecular index, UMI, or unique molecular tag), which can be used to uniquely identify the nucleic acid molecule to which the adapter is added.In some embodiments, the unique identification sequence can be used to increase error correction and accuracy, reduce the rate of false positive variant calls, and / or increase the sensitivity of variant detection. The adapter can include at least one restriction enzyme recognition sequence, and the at least one restriction enzyme recognition sequence includes any one selected from the group consisting of type I, type II, type III, type IV, Hs type, or type IIB, or any combination of two or more thereof.

[0314] The terms "universal sequence", "universal adapter sequence" and related terms refer to sequences in nucleic acid molecules that are common between two or more polynucleotide molecules. For example, adapters having the same universal sequence can be ligated to a plurality of polynucleotides, whereby the population of co-ligated molecules carries the same universal adapter sequence. Examples of universal adapter sequences include amplification primer sequences, sequencing primer sequences, or capture primer sequences (e.g., capture primers immobilized on a soluble or support).

[0315] In some embodiments, the support is a solid, semi-solid, or a combination of both. In some embodiments, the support is porous, semi-porous, non-porous, or any combination of porous. In some embodiments, the support can be substantially planar, concave, convex, or any combination thereof. In some embodiments, the support can be cylindrical, for example, including a capillary or the inner surface of a capillary.

[0316] In some embodiments, the surface of the support can be substantially smooth. In some embodiments, the support can have a regular or irregular texture, including ridges, etchings, pores, three-dimensional scaffolds, or any combination thereof.

[0317] In some embodiments, the support includes beads having any shape, including spherical, hemispherical, cylindrical, barrel-shaped, toroidal, disk-shaped, rod-shaped, conical, triangular, cubic, polygonal, tubular, or wire-shaped.

[0318] The support can be manufactured from any material, including, but not limited to, glass, fused silica, silicon, polymers (e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethyl methacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high-density polyethylene (HDPE), cyclic olefin polymer (COP), cyclic olefin copolymer (COC), polyethylene terephthalate (PET)), or any combination thereof. Various compositions of both glass and plastic substrates are contemplated.

[0319] In some embodiments, the surface of the support is coated with one or more compounds to create a passivation layer on the support. In some embodiments, the support includes a low non-specific binding surface that enables improved nucleic acid hybridization and amplification performance on the support. Generally, the support can include a low chemically modified layer that is covalently or non-covalently bound, such as a silane layer, a polymer film, and one or more layers of one or more covalently or non-covalently bound oligonucleotides that can be used to immobilize multiple nucleic acid template molecules to the support.

[0320] In some embodiments, the degree of hydrophilicity (or "wettability" with an aqueous solution) of the surface coating can be evaluated, for example, by placing small water droplets on the surface and measuring the contact angle with the surface, e.g., by measurement of the water contact angle measured using an optical tensiometer. In some embodiments, the static contact angle can be determined. In some embodiments, the advancing or receding contact angle can be determined. In some embodiments, the water contact angle for the surface-treated hydrophilic low-binding support disclosed herein can range from about 0 degrees to about 30 degrees. In some embodiments, the water contact angle for the surface-treated hydrophilic low-binding support disclosed herein can be 50 degrees, 40 degrees, 30 degrees, 25 degrees, 20 degrees, 18 degrees, 16 degrees, 14 degrees, 12 degrees, 10 degrees, 8 degrees, 6 degrees, 4 degrees, 2 degrees, or 1 degree or less. In many cases, the contact angle is 40 degrees or less. It will be appreciated by those skilled in the art that a given hydrophilic low-binding support surface of the present disclosure can exhibit a water contact angle having a value within any of these ranges.

[0321] Embodiments of the present disclosure provide a plurality of (e.g., two or more) nucleic acid templates immobilized on a support. In some embodiments, the plurality of immobilized nucleic acid templates have the same sequence or different sequences. In some embodiments, individual nucleic acid template molecules in the plurality of nucleic acid templates are immobilized at different sites on the support. In some embodiments, two or more individual nucleic acid template molecules in the plurality of nucleic acid templates are immobilized at a site on the support. In some embodiments, the support includes a plurality of sites arranged in an array. The term "array" refers to a support that includes a plurality of sites located at predetermined positions on the support so as to form an array of sites. The sites may be dispersed and separated by interstitial regions. In some embodiments, a predetermined site on the support may be arranged in a row or column in one dimension, or in rows and columns in two dimensions. In some embodiments, the plurality of predetermined sites are arranged on the support in an organized manner. In some embodiments, the plurality of predetermined sites are arranged in any organized pattern, and the pattern includes a straight line, a hexagonal pattern, a lattice pattern, a pattern having reflection symmetry, a pattern having rotational symmetry, and the like. The pitch between different pairs of sites may be the same or may vary. In some embodiments, the support has nucleic acid template molecules immobilized at a plurality of sites at a surface density of about 10 2 per square millimeter 2 to 10 15 . In some embodiments, the support has at least 10 2 sites, at least 10 3 sites, at least 10 4 sites, at least 10 5 sites, at least 10 6 sites, at least 10 7 sites, at least 10 8 sites, at least 10 9 sites, at least 10 10 sites, at least 10 11 sites, at least 10 12sites, at least 10 13 sites, at least 10 14 sites, or at least 10 15 sites or more, and the sites are located at predetermined positions on the support. In some embodiments, a plurality of predetermined sites (e.g., 10 2 -10 15 sites or more) on the support are immobilized with nucleic acid templates to form a nucleic acid template array. In some embodiments, the nucleic acid templates immobilized at a plurality of predetermined sites by hybridization to immobilized surface capture primers, or the nucleic acid templates are covalently bound to the surface capture primers. In some embodiments, the nucleic acid templates are immobilized at a plurality of predetermined sites, e.g., 10 2 -10 15 sites or more. In some embodiments, the nucleic acid templates immobilized at a plurality of sites on the support include linear or circular nucleic acid template molecules, or a mixture of both linear and circular molecules. In some embodiments, the immobilized nucleic acid templates are clonally amplified to generate immobilized nucleic acid colonies at a plurality of predetermined sites. In some embodiments, individual immobilized nucleic acid template molecules include one copy of a target sequence of interest or a concatemer having two or more tandem copies of the target sequence of interest.

[0322] In some embodiments, a support including a plurality of sites located at random positions on the support is referred to herein as a support having randomly located sites on top. The positions of the randomly located sites on the support are not predetermined positions. The plurality of randomly located sites are arranged on the support in a disordered and / or unpredictable manner. In some embodiments, the support has at least 10 2 sites, at least 10 3 sites, at least 10 4 sites, at least 10 5 sites, at least 10 6 sites, at least 10 7sites, at least 10 8 sites, at least 10 9 sites, at least 10 10 sites, at least 10 11 sites, at least 10 12 sites, at least 10 13 sites, at least 10 14 sites, or at least 10 15 sites or more, and the sites are randomly located on the support. In some embodiments, a plurality of randomly arranged sites on the support (e.g., 10 2 ~10 15 sites or more) are immobilized with a nucleic acid template to form a support immobilized with the nucleic acid template. In some embodiments, the nucleic acid template immobilized at a plurality of randomly located sites by hybridization to an immobilized surface capture primer, or the nucleic acid template covalently binds to the surface capture primer. In some embodiments, it is immobilized at a plurality of randomly located sites, e.g., 10 2 ~10 15 or more sites. In some embodiments, the nucleic acid templates immobilized on a plurality of sites on the support include linear or circular nucleic acid template molecules, or a mixture of both linear and circular molecules. In some embodiments, the immobilized nucleic acid template is clonally amplified to generate immobilized nucleic acid colonies at a plurality of randomly located sites. In some embodiments, each immobilized nucleic acid template molecule contains one copy of the target sequence of interest or a concatemer having two or more tandem copies of the target sequence of interest.

[0323] In some embodiments, with respect to nucleic acid template molecules immobilized at predetermined or random sites on a support, the plurality of immobilized nucleic acid template molecules on the support are in fluid communication with each other such that a solution of reagents (e.g., enzymes including polymerase, multivalent molecules, nucleotides, divalent cations, and / or buffers) can be flowed over the support so that the plurality of immobilized nucleic acid template molecules on the support can react with the reagents in a massively parallel manner. In some embodiments, the fluid communication of the plurality of immobilized nucleic acid template molecules is used to perform nucleotide binding assays and / or nucleotide polymerization reactions (e.g., primer extension or sequencing) on the plurality of immobilized nucleic acid template molecules, and detection and imaging for massively parallel sequencing can be performed. In some embodiments, the term "immobilized" and related terms refer to a nucleic acid molecule or enzyme that is directly bound to the support via covalent or non-covalent binding interactions, or a nucleic acid molecule or enzyme (e.g., polymerase) that is bound to a coating on the support and is bound to the support at a predetermined or random position.

[0324] When used with a low-binding surface coating, one or more layers of the multilayer surface coating may include a branched polymer or may be linear. Examples of suitable branched polymers include, but are not limited to, branched PEG, branched poly(vinyl alcohol) (branched PVA), branched poly(vinyl pyridine), branched poly(vinyl pyrrolidone) (branched PVP), branched), poly(acrylic acid) (branched PAA), branched polyacrylamide, branched poly(N-isopropylacrylamide) (branched PNIPAM), branched poly(methyl methacrylate) (branched PMA), branched poly(2-hydroxyethyl methacrylate) (branched PHEMA), branched poly(oligo(ethylene glycol) methyl ether methacrylate) (branched POEGMA), branched polyglutamic acid (branched PGA), branched poly-lysine, branched poly-glucoside, and dextran.

[0325] In some embodiments, the branched polymers used to make any one or more of the layers of the multilayer surfaces disclosed herein can include at least 4 branches, at least 5 branches, at least 6 branches, at least 7 branches, at least 8 branches, at least 9 branches, at least 10 branches, at least 12 branches, at least 14 branches, at least 16 branches, at least 18 branches, at least 20 branches, at least 22 branches, at least 24 branches, at least 26 branches, at least 28 branches, at least 30 branches, at least 32 branches, at least 34 branches, at least 36 branches, at least 38 branches, or at least 40 branches.

[0326] The linear, branched, or multi-branched polymers used to make any one or more of the layers of the multilayer surfaces disclosed herein can have a molecular weight of at least 500, at least 1,000, at least 2,000, at least 3,000, at least 4,000, at least 5,000, at least 10,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 35,000, at least 40,000, at least 45,000, or at least 50,000 Daltons.

[0327] In some embodiments, for example, when at least one layer of a multi-layer surface comprises a branched polymer, the number of covalent bonds between the branched polymer molecules of the layer to be deposited and the molecules of the previous layer can range from about one covalent bond per molecule to about 32 covalent bonds per molecule. In some embodiments, the number of covalent bonds between the branched polymer molecules of the new layer and the molecules of the previous layer is at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least twelve, at least fourteen, at least sixteen, at least eighteen, at least twenty, at least twenty-two, at least twenty-four, at least twenty-six, at least twenty-eight, at least thirty, or at least thirty-two covalent bonds per molecule.

[0328] Any reactive functional groups remaining after coupling of a material layer to a surface can optionally be blocked by coupling small inert molecules using high-yield coupling chemistry. For example, if amine coupling chemistry is used to attach a new material layer to a previous one, any remaining amine groups can then be acetylated or inactivated by coupling with a small amino acid such as glycine.

[0329] The number of layers of a low non-specific binding material, such as a hydrophilic polymer material, deposited on a surface can range from 1 to about 10. In some embodiments, the number of layers is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10. In some embodiments, the number of layers can be at most 10, at most 9, at most 8, at most 7, at most 6, at most 5, at most 4, at most 3, at most 2, or at most 1. Any of the lower and upper limit values described in this paragraph can be combined to form a range included within the present disclosure. For example, in some embodiments, the number of layers can range from about 2 to about 4. In some embodiments, all of the layers can comprise the same material. In some embodiments, each layer can comprise a different material. In some embodiments, a plurality of layers can comprise a plurality of materials. In some embodiments, at least one layer can comprise a branched polymer. In some embodiments, all of the layers can comprise a branched polymer.

[0330] One or more layers of the low non-specific binding material can, in some cases, be deposited on and / or conjugated to the substrate surface using a polar protic solvent, a polar or polar aprotic solvent, a nonpolar solvent, or any combination thereof. In some embodiments, the solvent used for layer deposition and / or coupling includes alcohol (e.g., methanol, ethanol, propanol, etc.), another organic solvent (e.g., acetonitrile, dimethyl sulfoxide (DMSO), dimethylformamide (DMF), etc.), water, a buffered aqueous solution (e.g., phosphate buffer, phosphate buffered saline, 3-(N-morpholino)propanesulfonic acid (MOPS), etc.), or any combination thereof. In some embodiments, the organic component of the solvent mixture used can comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the total, and the balance is made up of water or a buffered aqueous solution. In some embodiments, the aqueous component of the solvent mixture used can comprise at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% of the total, and the balance is made up of an organic solvent. The pH of the solvent mixture used can be less than 6, about 6, 6.5, 7, 7.5, 8, 8.5, 9, or greater than pH 9.

[0331] The term "branched polymer" and related terms refer to a polymer having multiple functional groups that facilitate conjugation to biologically active molecules such as nucleotides, and the functional groups may be on the side chains of the polymer or may be attached directly to the central core or central backbone of the polymer. A branched polymer can have a linear backbone having one or more functional groups that dissociate from the backbone for conjugation. A branched polymer can also be a polymer having one or more side chains, and the side chains have sites suitable for conjugation. Examples of functional groups include, but are not limited to, hydroxyl, ester, amine, carbonate, acetal, aldehyde, aldehyde hydrate, alkenyl, acrylate, methacrylate, acrylamide, active sulfone, hydrazide, thiol, alkanoic acid, acid halide, isocyanate, isothiocyanate, maleimide, vinyl sulfone, dithiopyridine, vinyl pyridine, iodoacetamide, epoxide, glyoxal, dione, mesylate, tosylate, and tresylate.

[0332] As used herein, the term "clonally amplified" and variants thereof refer to nucleic acid template molecules that have been subjected to one or more amplification reactions either in solution or on a support. In the case of template molecules amplified in solution, the resulting amplicons are distributed onto a support. Prior to amplification, the template molecules contain the sequence of interest and at least one universal adapter sequence. In some embodiments, clonal amplification includes the use of polymerase chain reaction (PCR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, bridge amplification, isothermal bridge amplification, rolling circle amplification (RCA), circle-to-circle amplification, helicase-dependent amplification, recombinase-dependent amplification, single-strand binding (SSB) protein-dependent amplification, or any combination thereof.

[0333] As used herein, the term "sequencing" and variants thereof typically involve obtaining sequence information from a nucleic acid strand by determining the identity of at least some of the nucleotides (including their nucleobase components) within a nucleic acid template molecule. In some embodiments, "sequencing" a given region of a nucleic acid molecule involves identifying each nucleotide and all nucleotides within the region being sequenced. However, in some embodiments, "sequencing" includes methods where the identity of only some of the nucleotides within the region is determined while the identity of some nucleotides remains undetermined or is incorrectly determined. Any suitable sequencing method can be used. In exemplary embodiments, sequencing can include unlabeled or ion-based sequencing methods. In some embodiments, sequencing can include labeled or dye-containing nucleotides, or fluorescence-based nucleotide sequencing methods. In some embodiments, sequencing can include polony-based sequencing or bridge sequencing methods. In some embodiments, sequencing includes a massively parallel sequencing platform that uses synthetic, hybridization-based, or ligation-based sequence procedures. Examples of massively parallel synthetic sequence procedures include polony sequencing, pyrosequencing (e.g., from 454 Life Sciences, U.S. Patent Nos. 7,211,390, 7,244,559, and 7,264,929), chain terminator sequencing (e.g., from Illumina, U.S. Patent No. 7,566,537, Bentley 2006 Current Opinion Genetics and Development 16:545-552, and Bentley, et al., 2008 Nature 456:53-59), ion-sensitive sequencing (e.g., from Ion Torrent), probe anchor ligation sequencing (e.g., Complete Genomics), DNA nanoball sequencing, nanopore DNA sequencing.Examples of single molecule sequencing include Heliscope single molecule sequencing and single molecule real time (SMRT) sequencing from Pacific Biosciences (Levene, et al., 2003 Science 299(5607):682-686, Eid, et al., 2009 Science 323(5910):133-138, U.S. Patent Nos. 7,170,050, 7,302,146, and 7,405,281). Examples of sequencing by hybridization include SOLiD sequencing (e.g., from Life Technologies, WO2006 / 084132). Examples of sequencing by binding include Omniome sequencing (e.g., U.S. Patent No. 10,246,744).

[0334] It should be understood that it is intended that the section on the mode for carrying out the invention, rather than other sections, be used to construe the claims. Other sections may describe one or more exemplary embodiments as contemplated by the inventor(s), but not all, and thus are not intended to limit the present disclosure or the appended claims in any way.

[0335] It should be understood that the present disclosure describes exemplary embodiments for exemplary fields and uses, but is not limited thereto. Other embodiments and modifications thereof are possible and are included within the scope and spirit of the present disclosure. For example, without limiting the generality of this paragraph, embodiments are not limited to the software, hardware, firmware, and / or entities shown in the drawings and / or described herein. Further, embodiments have significant utility for fields and uses beyond the examples described herein, whether or not explicitly described herein.

[0336] In this specification, embodiments are described using functional building blocks that illustrate the implementation of specific functions and their relationships. The boundaries of these functional building blocks are arbitrarily defined in this specification for the sake of convenience in explanation. Alternative boundaries may be defined as long as the specified functions and relationships (or their equivalents) are appropriately implemented. Also, alternative embodiments may execute functional blocks, steps, operations, methods, etc. using an ordering different from that described herein.

[0337] References in this specification to "one embodiment", "an embodiment", "exemplary embodiments", "some embodiments", or similar phrases indicate that the described embodiments may include a particular feature, structure, or characteristic, but not all embodiments necessarily include the particular feature, structure, or characteristic. Furthermore, such phrases do not necessarily refer to the same embodiment. Additionally, when a particular feature, structure, or characteristic is described in connection with an embodiment, incorporating such feature, structure, or characteristic into other embodiments, whether or not explicitly recited or described herein, would be within the knowledge of those of ordinary skill in the relevant art(s).

[0338] Additionally, some embodiments may be described using the expressions "coupled" and "connected" along with their derivatives. These terms are not necessarily intended to be synonyms of each other. For example, some embodiments may be described using the terms "connected" and / or "coupled" to indicate that two or more elements are in direct physical or electrical contact with each other. However, the term "coupled" may also mean that two or more elements are not in direct contact with each other but still cooperate or interact with each other.

[0339] Preferred embodiments of the present invention are shown and described herein, but it will be apparent to those skilled in the art that such embodiments are provided by way of example only. The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary embodiments. Numerous variations, modifications, and substitutions will occur to those skilled in the art here without departing from the present invention. It should be understood that various alternatives to the embodiments of the present invention described herein may be employed in practicing the present invention. The following claims define the scope of the present invention, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

1. A computer-based method for adapter trimming in sequencing data analysis, To acquire flow cell images of one or more sequencing samples using a sequencer; The processor generates a first sequencing read, a second sequencing read, or both, based on the sequencing analysis of the flow cell image; The processor, and based on multiple match scores, (a) A first alignment from aligning the tail of a first sequencing lead to the head of a second sequencing lead at one or more first positions, (b) A second alignment from aligning the tail of the second sequencing lead with the head of the first sequencing lead at one or more second positions, (c) A third alignment from aligning the first adapter to the tail of the first sequencing lead at one or more third positions, and (d) Selecting one or more of the fourth alignments from aligning the second adapter to the tail of the second sequencing lead at one or more fourth positions, Each of the aforementioned multiple match scores is based on the first number of matched bases and the second total number of bases, and the selection is as follows: The processor generates a first consensus position using the first alignment and the third alignment, and a second consensus position using the second alignment and the fourth alignment. The processor determines the trimming position based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score. At the aforementioned trimming position, the first sequencing lead, the second sequencing lead, or both are trimmed. Methods that are performed on a computer, including [specific examples].

2. The processor and the sequencer further include obtaining the first sequencing read using the first adapter and the second sequencing read using the second adapter, Each of the first sequencing lead, the second sequencing lead, the head of the first sequencing lead, the head of the second sequencing lead, the tail of the first sequencing lead, the tail of the second sequencing lead, the first adapter, and the second adapter includes a sequence of bases. The method performed on a computer according to claim 1.

3. (a) Aligning the tail of the first sequencing lead with the head of the second sequencing lead at one or more of the first positions, By shifting the head of the second sequencing read relative to the tail of the first sequencing read by the number of bases, at one or more first positions, (1) the inverse complement of the head of the second sequencing read is aligned with (2) the tail of the first sequencing read; or By shifting the tail of the first sequencing read relative to the head of the second sequencing read based on the number of bases, at one or more first positions, (1) the inverse complement of the tail of the first sequencing read and (2) the head of the second sequencing read are aligned. A computer-based method according to claim 1, comprising one of the following:

4. (b) Aligning the tail of the second sequencing lead with the head of the first sequencing lead at one or more of the second positions, By shifting the head of the first sequencing read relative to the tail of the second sequencing read by the number of bases, at one or more second positions, (1) align the inverse complement of the head of the first sequencing read with the tail of the second sequencing read; or By shifting the tail of the second sequencing read relative to the head of the first sequencing read based on the number of bases, at one or more second positions, (1) the inverse complement of the tail of the second sequencing read is aligned with the head of the first sequencing read. A computer-based method according to claim 1, comprising one of the following:

5. The method performed on a computer according to claim 1, further comprising determining the plurality of match scores by the processor, wherein each of the plurality of match scores corresponds to an alignment corresponding to one of the one or more first, second, third, and fourth positions.

6. The computer-based method according to claim 1, wherein the number of first matched bases and the total number of second bases correspond to one of the one or more first, second, third, and fourth positions.

7. The first consensus position is generated using the first alignment and the third alignment, and the second consensus position is generated using the second alignment and the fourth alignment. To generate a first adapter position based on the first alignment, To generate a second adapter position based on the third alignment, A computer-based method according to claim 1, comprising determining the first consensus position as the first adapter position in response to a determination that the first adapter position coincides with the second adapter position.

8. The method performed by a computer according to claim 1, further comprising determining a first consensus match score based on a first sum of matched bases and a second sum of total bases from the first and third alignments, in response to a determination that the first and third alignments coincide at the adapter position.

9. In response to the determination that the first alignment and the third alignment do not coincide at the first and second adapter positions, From the first adapter position obtained from the first alignment, and by aligning the first adapter to the tail of the first sequencing read at the first adapter position, a first candidate match score is determined based on the sum of the first matched bases and the sum of the second total bases, From the second adapter position obtained from the third alignment, and by aligning the tail of the first sequencing read with the head of the second sequencing read at the second adapter position, a second candidate match score is determined based on the sum of the first matched bases and the sum of the second total bases, A method performed on a computer according to claim 1, further comprising selecting a score as the first consensus score from the first and second candidate match scores.

10. The method performed on a computer according to claim 1, further comprising the processor determining a second consensus match score based on the second alignment and the fourth alignment.

11. The method performed by a computer according to claim 1, further comprising determining a second consensus match score based on the sum of a third matched base and a fourth total base from the second and fourth alignments, in response to a determination that the second and fourth alignments coincide at the adapter position.

12. In response to the determination that the second alignment and the fourth alignment do not coincide at the adapter position, From the third adapter position obtained from the second alignment, and by aligning the second adapter to the tail of the second sequencing read at the third adapter position, a third candidate match score is determined based on the sum of the third matched bases and the sum of the fourth total bases, From the fourth adapter position obtained from the fourth alignment, and by aligning the tail of the second sequencing read with the head of the first sequencing read at the fourth adapter position, a fourth candidate match score is determined based on the sum of the third matched bases and the sum of the fourth total bases, A computer-based method according to claim 1, further comprising selecting a score as the second consensus score from the third and fourth candidate match scores.

13. The trimming position is determined based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score. Selecting the higher score from the first consensus match score and the second consensus match score, The higher score selected is determined to be above a predetermined threshold, A computer-based method according to claim 1, comprising determining the trimming position based on the selected higher score.

14. The trimming position is determined based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score. Selecting the higher score from the first consensus match score and the second consensus match score, The higher score selected is determined to be below a predetermined threshold, A computer-based method according to claim 1, comprising determining that trimming is not performed on the first sequencing lead or the second sequencing lead.

15. The trimming position is determined based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score. Selecting the higher score from the first consensus match score and the second consensus match score, The higher score selected is determined to be above a predetermined threshold, A computer-based method according to claim 1, comprising determining the trimming position as the first consensus position or the second consensus position, wherein the trimming position corresponds to the higher selected score.

16. The processor converts the trimmed first sequencing read, the trimmed second sequencing read, or both into a predetermined format. The method performed on a computer according to claim 1, further comprising recording the trimmed first sequencing read, the trimmed second sequencing read, or both, in the predetermined format by the processor.

17. A computer-based system for adapter trimming in sequencing data analysis, One or more hardware processors, When executed by the one or more hardware processors, the operation includes one or more data storage devices that store instructions causing the one or more hardware processors to perform an operation, and the operation is Based on multiple match scores, (a) A first alignment from aligning the tail of a first sequencing lead to the head of a second sequencing lead at one or more first positions, (b) A second alignment from aligning the tail of the second sequencing lead with the head of the first sequencing lead at one or more second positions, (c) A third alignment from aligning the first adapter to the tail of the first sequencing lead at one or more third positions, and (d) Selecting one or more of the fourth alignments from aligning the second adapter to the tail of the second sequencing lead at one or more fourth positions, Each of the aforementioned multiple match scores is based on the first number of matched bases and the second total number of bases, and the selection is as follows: Using the first alignment and the third alignment, a first consensus position is generated, and using the second alignment and the fourth alignment, a second consensus position is generated. A computer-based system that includes determining a trimming position based on the first consensus position, the second consensus position, the first consensus match score, and the second consensus match score.

18. A computer-based method for adapter determination in sequencing data analysis, The process involves obtaining a plurality of paired-end sequencing reads using a processor, wherein each paired-end sequencing read comprises a first and a second sequencing read, and each of the first and second sequencing reads comprises a sequence of nucleotide bases. The aforementioned processor, (a) A first alignment, which involves aligning the tail of a first sequencing lead with the head of a second sequencing lead at one or more first positions, and (b) Determining the adapter position based on a second alignment, which involves aligning the tail of the second sequencing lead with the head of the first sequencing lead at one or more second positions. The processor obtains multiple adapter sequences from the multiple paired-end sequencing reads based on the determined adapter positions. This involves repeatedly performing one or more actions until the stopping criteria are met. Selecting a seed adapter array from the aforementioned multiple adapter arrays, To determine one or more adapter sequences from among the plurality of adapter sequences that satisfy the similarity threshold when compared with the seed adapter sequence, For each base position, the A, G, C, or T / U base is determined based on the corresponding number of different bases at the corresponding base position of the one or more determined adapter sequences and a predetermined threshold, thereby generating individual candidate adapters. A method performed on a computer, comprising repeatedly performing the steps of removing the seed adapter array and the one or more determined adapter arrays from the plurality of adapter arrays.

19. The processor determines the adapter position based on (a) a first alignment, which is the alignment of the tail of a first sequencing lead to the head of a second sequencing lead at one or more first positions, and (b) a second alignment, which is the alignment of the tail of the second sequencing lead to the head of the first sequencing lead at one or more second positions. The method performed by a computer according to claim 18, comprising determining the adapter position based on a plurality of match scores, wherein each match score is calculated based on the number of first matched bases and the total number of second bases at one or more first positions and one or more second positions.

20. Selecting a second seed adapter array from the aforementioned plurality of adapter arrays, To determine one or more second adapter sequences from among the plurality of adapter sequences that satisfy a similarity threshold compared with the seed adapter sequence, For one or more base positions, the A, G, C, or T / U base is determined based on the corresponding number of different bases at the corresponding base positions of the one or more determined adapter sequences and a predetermined threshold, A computer-based method according to claim 18, further comprising: removing the seed adapter sequence and the one or more determined adapter sequences from the plurality of adapter sequences without generating candidate adapters, in response to a determination that n base positions out of the total number of positions do not satisfy a predetermined threshold.

21. Selecting a second seed adapter array from the aforementioned plurality of adapter arrays, The computer-based method according to claim 18, further comprising removing the second seed adapter sequence from the plurality of adapter sequences without generating candidate adapters, in response to a determination that none of the adapter sequences among the plurality of adapter sequences satisfy a similarity threshold when compared with the second seed adapter sequence.

22. A computer-based system for adapter determination in sequencing data analysis, One or more hardware processors, When executed by the one or more hardware processors, the operation includes one or more data storage devices that store instructions causing the one or more hardware processors to perform an operation, and the operation is The process involves obtaining a plurality of paired-end sequencing reads using a processor, wherein each paired-end sequencing read comprises a first and a second sequencing read, and each of the first and second sequencing reads comprises a sequence of nucleotide bases. Based on multiple match scores, the aforementioned processor (a) A first alignment from aligning the tail of the first sequencing lead with the head of the second sequencing lead at one or more first positions, (b) Selecting one or more second alignments, from aligning the tail of the second sequencing read to the head of the first sequencing read at one or more second positions, wherein each of the plurality of match scores is based on a first number of matched bases and a second total number of bases. A computer-based system comprising the processor determining the adapter position based on one or more selected first and second alignments.

Images