Method for Discovering Cell Surface Antigens against Novel Antibodies

Abstract

Regarding a method for discovering cell surface antigens against novel antibodies, according to a screening method according to one aspect, it is possible to accurately screen for cell surface antigens that bind to novel antibodies, and there is an effect that the cell surface antigens against the antibodies can be efficiently screened through cells that bind well to the novel antibodies.

Description

Technical Field

[0001] The present invention relates to a method for discovering cell surface antigens against novel antibodies.

Background Art

[0002] Cell therapy through chimeric antigen receptors (CARs) has emerged as a promising anti-cancer treatment method, and research on patient-tailored anti-cancer vaccines that can enhance the effect of immune anti-cancer therapy by inducing the immune action in patients to concentrate on neoantigens specific to cancer cells is being actively conducted. In such anti-cancer treatments, technology for screening effective antigens plays a central role.

[0003] Generally, for the investigation of neoantigens, a method using cDNA library screening has been utilized. This method was carried out through a T cell co-culture step for identifying antigens that induce the activation of T cells by overexpressing a cDNA library and MHC molecules in a cell line. However, this has the disadvantages of being labor-intensive, costly, and difficult to identify all tumor antigens.

[0004] In addition, Immunoprecipitation-LC-MS / MS, which is a commonly used method for antigen discovery, is also inefficient, and currently, there is no technology for effectively discovering cell surface antigens against novel antibodies.

[0005] Therefore, in antigen-based anti-cancer treatments and the like, the current inefficient antigen discovery technology acts as a technical hurdle, and there is a current need for technology that can effectively discover antigens.

[0006] Therefore, as a result of repeated research based on this, the present inventors have found that a guide RNA library against cell surface proteins can be constructed and introduced into cancer cells together with Cas9, thereby effectively discovering cell surface antigens, and have completed the present invention.

Summary of the Invention

Problems to be Solved by the Invention

[0007] The present invention has been made in view of the above circumstances, and an object thereof is to provide a method for screening cell surface antigens, comprising the steps of treating isolated cells with a vector into which a guide RNA (gRNA) library against the cell-surface protein of the cells has been introduced, treating the cells treated with the vector with a protein capable of binding to the isolated cells, and obtaining, from the cells treated with the protein, cells that have lost the ability to bind to the treated protein.

Means for Solving the Problems

[0008] One aspect provides a method for screening cell surface antigens, comprising the steps of treating isolated cells with a vector into which a guide RNA (gRNA) library against the cell-surface protein of the cells has been introduced, treating the cells treated with the vector with a protein capable of binding to the isolated cells, and obtaining, from the cells treated with the protein, cells that have lost the ability to bind to the treated protein.

[0009] The isolated cells may be cancer cells.

[0010] As used herein, the term "cancer" refers to a physiological state in an animal that is typically characterized by abnormal or uncontrolled cell growth. Cancer may be associated with, for example, metastasis, interference with normally functioning neighboring cells, release of cytokines or other secreted products at abnormal levels, suppression or augmentation of inflammatory or immunological responses, neoplasia, premalignant, malignancy, invasion of surrounding or distant tissues or organs, such as lymph nodes. The cancer tissue may be tissue separated from the cancer. The step of obtaining cancer tissue from the cancer can be obtained by ordinary anatomical methods, for example, by cutting the tissue present in the cancer with sterile scissors at multiple sites. The obtained cancer tissue can be washed with a serum-free medium or phosphate buffered saline (PBS) containing an antibiotic, such as penicillin, streptomycin, or gentamicin, to remove contaminants such as blood present in the tissue. Enzymatic treatment can be performed directly on the cancer tissue separated as described above, or after cutting it more finely using sterile scissors or the like.

[0011] In one specific example, the cancer can be a blood cancer or a solid cancer, and the solid cancer can be any one or more selected from the group consisting of lung cancer, skin cancer, stomach cancer, intestinal cancer, colon cancer, pancreatic cancer, liver cancer, thyroid cancer, uterine cancer, cervical cancer, ovarian cancer, testicular cancer, prostate cancer, breast cancer, and oral cancer, but is not limited thereto.

[0012] In one specific example, the cell can contain a Cas9 polypeptide. The Cas polypeptide is one of the protein components of the CRISPR / Cas system and can be an activated endonuclease or a nick-forming enzyme. The Cas polypeptide can form a complex with crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) to exhibit its activity. The cell can further contain a Cas polynucleotide which is a nucleic acid sequence encoding the Cas polypeptide.

[0013] The Cas polynucleotide can be a polynucleotide derived from bacteria of the genus Streptococcus (e.g., Streptococcus pyogens), Neisseria (e.g., Neisseria meningitidis), Pasteurella (e.g., Pasteurella multocida), Francisella (e.g., Francisella novicida) or Campylobacter (e.g., Campylobacter jejuni).

[0014] The Cas polypeptide can be a wild-type Cas polypeptide or a mutant Cas polypeptide. The mutant Cas polypeptide can be, for example, a polypeptide in which a catalytic aspartate residue is changed to another amino acid (e.g., alanine). The Cas polypeptide can be a recombinant protein.

[0015] As used herein, the term "guide RNA (gRNA)" refers to a polynucleotide that cleaves, inserts, or ligates target DNA in a cell through RNA editing. The guide RNA may be a single-chain guide RNA (sgRNA). The guide RNA may be a crRNA (CRISPR RNA) specific to a target nucleic acid sequence. The guide RNA may further include a tracrRNA (trans-activating crRNA) that interacts with Cas9 nuclease. The tracrRNA may include a polynucleotide that forms a loop structure. The guide RNA may be 10 to 30 nucleotides in length. The guide RNA may be, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0016] The guide RNA may include RNA, DNA, PNA, or a combination thereof. The guide RNA may be chemically modified.

[0017] The guide RNA can be a component of a programmable nuclease. The programmable nuclease refers to all forms of nucleases that can recognize and cleave specific positions on a genetic material. The programmable nuclease is, for example, TALEN (transcription activator-like effector nuclease), zinc-finger nuclease, meganuclease, RGEN (RNA-guided engineered nuclease), Cpf1, and Ago homolog (DNA-guided endonuclease). The RGEN refers to a nuclease that includes a guide RNA specific to a target DNA and a Cas protein as components. The polynucleotide can be, for example, a component of RGEN.

[0018] The guide RNA can remove the nucleic acid sequence encoding the KRAS polypeptide by non-homologous end-joining (NHEJ) in the genetic material of a cell.

[0019] As used herein, the term "library" means a pool or population containing two or more substances of the same kind with different characteristics. Therefore, an oligonucleotide library can be a population containing two or more oligonucleotides with different base sequences, such as guide RNAs, and / or two oligonucleotides with different target sequences.

[0020] The guide RNA library can be a population of guide RNAs targeting the genes of cell-surface proteins. The guide RNA library can be a population of guide RNAs targeting 2,000 to 6,000 genes of cell-surface proteins. The guide RNA Library can include 1 to 10 guide RNAs per gene of a cell-surface protein.

[0021] The term "vector" as used in this specification means a mediator that enables the transfer of the guide RNA into a cell, such as a genetically engineered product, and the vector can contain each guide RNA coding base sequence. The vector can be a viral vector or a plasmid vector.

[0022] In one specific example, the vector can be a viral vector. The viral vector can be a retroviral vector, an adenoviral vector, a lentiviral vector, a herpes viral vector, a varicella viral vector, a rhabdoviral vector, an alphaviral vector, a proviral vector, or an adeno-associated viral vector. The vector can be an expression vector. The vector can be a constitutive or inducible expression vector. The vector can contain a packaging signal, an RRV (rev response element), a WPRE (woodchuck hepatitis virus posttranscriptional regulatory element), a cPPT (central polypurine tract), a promoter, an antibiotic resistance gene, an operator, a suppressor, a T2A peptide, a reporter gene, or a combination thereof. The promoter can contain a U6 polymerase III promoter, an elongation factor 1α promoter, an H1 promoter, a cytomegalovirus promoter, or a combination thereof. The antibiotic resistance gene can contain a puromycin resistance gene, a blasticidin resistance gene, or a combination thereof. The suppressor can be a tetracycline operator. The reporter gene can contain a nucleic acid sequence encoding an Enhanced green fluorescent protein. When present in a cell of an individual, the vector can contain an insert, i.e., an essential regulatory element operably linked to the insert so that the insert can be expressed.

[0023] The method of transmitting the vector to cells for manufacturing a library can be achieved using various methods that have become known in the art. For example, it can be accomplished by various methods known in the art such as the calcium phosphate-DNA coprecipitation method, the DEAE-dextran-mediated transfection method, the polybrene-mediated transduction method, the electroporation method, the microinjection method, the liposome fusion method, the lipofectamine and protoplast fusion method, etc. Also, when using a viral vector, the target, i.e., the vector, can be transmitted into cells using virus particles by means of infection. In addition, the vector can be introduced into cells by gene bombardment or the like.

[0024] In one specific example, the cells into which the vector has been processed may be those into which one vector has been introduced per cell. By adjusting the MOI (Multiplicity of infection) to 0.2 to 0.4, for example 0.3, one vector can be introduced per cell.

[0025] In one specific example, the method may include the step of removing cells into which the vector has not been introduced.

[0026] The term "protein capable of binding to cells" in this specification may mean a protein that specifically recognizes the surface protein of cells or specifically binds to the surface protein of cells. Therefore, the protein capable of binding to the cells may be a protein that specifically binds to the cell-surface-protein.

[0027] In one specific example, the protein that specifically binds to the cell-surface-protein may be any one selected from the group consisting of an antibody, an affibody, and a diabody.

[0028] The term in this specification "Antibody"means any antigen-binding molecule or molecular complex that contains at least one complementarity-determining region (CDR) that specifically binds to or interacts with a specific antigen. The antibody includes not only immunoglobulin molecules comprising four polypeptide chains, two heavy chains (H) and two light chains (L) that are interconnected by disulfide bonds, but also multimers thereof (e.g., IgM). Further, the antibody includes immunoglobulin molecules composed of four polypeptide chains, two heavy chains (H) and two light chains (L) that are interconnected by disulfide bonds. Each heavy chain includes a heavy-chain variable region (abbreviated herein as HCVR or VH) and a heavy-chain constant region. The heavy-chain constant region includes three domains, CH1, CH2, and CH3. Each light chain includes a light-chain variable region (abbreviated herein as LCVR or VL) and a light-chain constant region. The light-chain constant region includes one domain (CL1). The VH and VL regions can be further subdivided into hypervariable regions called complementarity-determining regions (CDRs) interspersed with more conserved regions called framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, which are arranged in the following order, from amino-terminus to carboxy-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0029] Furthermore, the antibody includes an antigen-binding fragment of a complete antibody molecule. Terms such as "antigen-binding portion" of an antibody, "antigen-binding fragment" of an antibody, etc. include any naturally occurring, enzymatically obtainable, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. An antigen-binding fragment of an antibody can be derived from a complete antibody molecule using any suitable standard technique such as proteolytic digestion, or recombinant genetic engineering techniques involving manipulation and expression of DNA encoding antibody variable and selected constant domains. Such DNA is known or can be readily available, for example, from DNA libraries that are commercial sources (including, for example, phage-antibody libraries), or can be synthesized. The DNA can be sequenced and manipulated chemically or using molecular biological techniques, for example, to arrange one or more variable domains and / or constant domains in a suitable configuration, or to introduce codons, or to generate cysteine residues, or to modify, add, or ligate amino acids.

[0030] The term "affibody" as used herein can mean a copy of an antibody that can bind to a specific target protein (receptor). Generally, an affibody molecule can be composed of 20 to 150 amino acid residues and can be composed of 2 to 10 alpha helices.

[0031] In one specific example, the cell-surface protein that provides a site to which a protein capable of binding to the isolated cell binds can be one that binds to an antibody or an antibody-like Fc site.

[0032] In one specific example, the protein capable of binding to the isolated cell and the cell-surface protein can be non-covalently linked.

[0033] The term "cell-surface-protein" in this specification may mean a protein present on the surface of a cell. In one specific example, the cell-surface-protein may be an antigen that binds to a processed protein. Therefore, through the screening method, cell surface antigens that bind well to novel antibodies can be discovered.

[0034] In one specific example, the step of obtaining cells that have lost the ability to bind to the processed protein may include the step of treating cells to which the protein has been processed with beads having a surface that binds to the processed protein, and the step of obtaining cells that do not bind to the beads. The beads may have a surface modified so as to be able to bind to the processed protein.

[0035] In one specific example, the method may include the step of analyzing the gRNA contained in cells that have lost the ability to bind to the processed protein, and the step of identifying the gene targeted by the analyzed guide RNA.

[0036] In one specific example, the method may include the step of preparing control group cells in which the gene targeted by the analyzed guide RNA has been knocked down or knocked out, and the step of treating the control group cells with an antibody to measure the presence or absence of an antigen-antibody reaction. Control group cells in which the gene targeted by the analyzed guide RNA has been knocked down can be produced by introducing siRNA of the targeted gene.

[0037] In one specific example, the antigen-antibody reaction can be measured using any one selected from the group consisting of enzyme immunoassay, radioimmunoassay, sandwich assay, Western blotting, immunoprecipitation, immunohistochemical staining, fluorescence immunoassay, enzyme substrate chromogenic method, and antigen-antibody agglutination method.

[0038] In one specific example, the cell-surface protein can be a tumor-associated antigen (TAA).

[0039] As used herein, the term "tumor-associated antigen (TAA)" means any antigen that includes, but is not limited to, proteins associated with cancer. Such antigens can be expressed on malignant cells or in the tumor microenvironment such as tumor-associated blood vessels, extracellular matrix, mesenchymal stroma, or immune infiltrates.

[0040] The tumor-associated antigen can be, for example, AFP, ALK, BAGE protein, BIRC5 (survivin), BIRC7, β-catenin, brc-abl, BRCA1, BORIS, CA9, carbonic anhydrase IX, caspase-8, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD40, CD70, CDK4, CEA, cyclin-B1, CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE protein (e.g., GAGE-1, -2), GD2, GD3, GloboH, glypican-3, GM3, gp100, Her2, HLA / B-raf, HLA / k-ras, HLA / MAGE-A3, hTERT, IL-10, LMP2, MAGE protein (e.g., MAGE-1, -2, -3, -4, -6 and -12), MART-1, mesothelin, ML-IAP, Muc1, Muc2, Muc3, Muc4, Muc5, Muc16 (CA-125), MUM1, NA17, NY-BR1, NY-BR62, NY-BR85, NY-ESO1, p15, p53, PAP, PAX3, PAX5, PCTA-1, PLAC1, PRLR, PRAME, PSMA (FOLH1), RAGE protein, Ras, RGS5, Rho, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF-β, TMPRSS2, Thompson-nouvelle antigen (Tn), TRP-1, TRP-2, tyrosinase or uroplakin-3.

Advantages of the Invention

[0041] According to the screening method of one aspect, a cell surface antigen that binds to a novel antibody can be accurately screened, and the cell surface antigen for the antibody can be efficiently screened through cells that bind well to the novel antibody. This can discover a new major antigen through the discovery of novel antibodies present in a patient's serum, and the discovery of a novel antigen can become a new treatment strategy for overcoming resistance during anticancer treatment. Therefore, it has important significance in the fields of anticancer treatment and immunotherapy, and can contribute to the development of a treatment strategy tailored to an individual patient.

Brief Description of the Drawings

[0042]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Modes for Carrying Out the Invention

[0043] Hereinafter, it will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

[0044] Example 1. Construction of cells stably expressing Cas9

[0045] To construct cells that stably express Cas9, HEK293T cells were seeded one day before transduction so that the confluency reached 70%. The HEK293T cells were co-transfected with the packaging plasmid pMD2.G (1.5 μg), psPAX2 (1.5 μg), and lentiCas9-Blast (4.5 μg) using the packaging Lipofectamine 3000. After 6 hours had passed since transduction, the medium was replaced with DMEM medium containing 10% FBS and 1% Penicillin / Streptomycin (P / S). Thereafter, the culture supernatant containing virus particles was collected every 24 hours and centrifuged at 1200 rpm for 5 minutes to remove the remaining HEK293T cells. The collected virus supernatant was filtered using a 0.45 μm filter.

[0046] To generate breast cancer cells (MDA-MB-468) that stably express Cas9, the culture medium containing the virus was repeatedly supplemented with polybrene (10 μg / ml) twice. After 24 hours of incubation, breast cancer cells (MDA-MB-468-cas9) that stably express Cas9 were constructed through 6 - 8 μg / ml of Blasticidine S hydrochloride (Sigma). To confirm whether Cas9 is well-expressed in the constructed breast cancer cells, Western blot was performed, and this is shown in Figure 1.

[0047] Figure 1 is an image confirming the presence or absence of Cas9 expression in breast cancer cells. MDA-MB-468 is a breast cancer cell not transfected with Cas9, and MDA-MB-468-cas9 is a breast cancer cell transfected with Cas9.

[0048] As shown in Figure 1, it was confirmed that MDA-MB-468-cas9 transfected with Cas9 stably expresses Cas9.

[0049] Example 2. Construction of a guide RNA library for cell-surface proteins

[0050] A guide RNA library for cell-surface proteins was constructed by designing five guide RNAs targeting each gene for approximately 5,000 cell-surface proteins, synthesizing them, and then cloning them into a lentiviral vector. completed.

[0051] more Specifically, among the proteins known to be present on the surface of cells, 2,692 cell-surface proteins were selected by analyzing genes with well-verified genetic information, as shown in Table 1: see Proc Natl Acad Sci USA. 2018 Nov 13;115(46):E10988-E10997 and the HGNC database.

[0052] [Table 1] JPEG2025522881000029.jpg 217170 JPEG2025522881000030.jpg 216170 JPEG2025522881000031.jpg 216170 JPEG2025522881000032.jpg 217170 JPEG2025522881000033.jpg 218170 JPEG2025522881000034.jpg 218170 JPEG2025522881000035.jpg 216170 JPEG2025522881000036.jpg 217170 JPEG2025522881000037.jpg 215170 JPEG2025522881000038.jpg 216170 JPEG2025522881000039.jpg 217170 JPEG2025522881000040.jpg 217170 JPEG2025522881000041.jpg 216170 JPEG2025522881000042.jpg 216170 JPEG2025522881000043.jpg 216170 JPEG2025522881000044.jpg 195170

[0053] Among the genes shown in Table 1 above, 2,653 genes that are easy to design guide RNAs were selected, and a guide RNA library containing a maximum of 6 guide RNAs per gene and control group guide RNAs was designed, resulting in a total of 15,678 guide RNAs. Then, the synthesized guide RNA library was cloned with a lentiviral vector to construct a lentiviral vector expressing the guide RNA. The lentiviral vector was subjected to next-generation sequencing (NGS) to confirm that the guide RNA was well expressed.

[0054] Example 3. Construction of Cas9 / guide RNA library cells (Cas9 / gRNA library cell)

[0055] The lentiviral vector introduced with the guide RNA library of Example 2 was introduced into the breast cancer cells (MDA-MB-468-cas9) of Example 1. The MOI (Multiplicity of Infection) was adjusted to the 0.3 level to introduce one lentiviral vector per breast cancer cell. Then, breast cancer cells without the inserted guide RNA were removed through puromycin selection to construct Cas9 / guide RNA library cells. The total D of the constructed Cas9 / guide RNA library cells N A (genomic DNA) was isolated and NGS was performed to confirm the insertion of the guide RNA library.

[0056] Experimental Example 1. Classification of cells that lost the ability to bind to an antibody using magnetic activated cell sorting (MACS)

[0057] The Cas9 / guide RNA library cells of Example 3 were treated with trypsin and resuspended in 150 μl of MACS buffer at a final concentration of 2×106 cells. Then, the Cas9 / guide RNA library cells were incubated with 5 μg of the antibody at room temperature for 2 hours. After binding the Cas9 / guide RNA library cells and MACS Protein G Microbeads (130-071-101) at 4°C for 30 minutes, MACS buffer (100 μl) was added to the Cas9 / guide RNA library cells, and the cells were classified using an LD column (130-042-901). Cells not labeled with the antibody and cells labeled with the antibody were collected and the cell count was performed.

[0058] Experimental Example 2. Confirmation of loss of antibody binding ability due to gene deficiency

[0059] To confirm the gRNAs inserted in each isolated cell population, the guide RNA regions in the total cellular DNA were PCR amplified and the distribution of 15,678 guide RNAs was confirmed by analyzing the nucleotide sequences through NGS. For each of the 15,678 guide RNAs, the ratios in the control group and the experimental group were calculated, and the guide RNAs with increased levels in the experimental group compared to the control group were selected. The genes targeted by the selected guide RNAs were identified, and the loss of antibody binding upon the deletion of each gene was tracked.

[0060] 2.1 Results of MACS using Cetuximab, a binding antibody for the EGFR surface protein, confirmed the screening of cells lacking EGFR

[0061] Screening using Cetuximab, a well-known binding antibody for the epidermal growth factor receptor (EGFR), a cell surface protein, confirmed that guide RNAs for guide sequences (SEQ ID NO: 1: TGTCACCACATAATTACCTG, SEQ ID NO: 2: GTGGAGCCTCTTACACCCAG, SEQ ID NO: 3: GTCTGCGTACTTCCAGACCA, SEQ ID NO: 4: TCTTGCCGGAATGTCAGCCG, SEQ ID NO: 5: CCTCATTGCCCTCAACACAG, SEQ ID NO: 6: CTCTTCTTAGACCATCCAGG) targeting EGFR were amplified more than 22,000-fold in cells not labeled with Cetuximab, as shown in Figure 2.

[0062] Figure 2 is a graph showing the confirmation of guide RNAs that are more highly expressed in cells not labeled with Cetuximab compared to cells labeled with Cetuximab, following MACS using Cetuximab as an antibody against Cas9 / guide RNA library cells.

[0063] As shown in Fig. 2, it was confirmed that guide RNAs targeting EGFR, which is an antigen for cetuximab, were highly expressed in cells not labeled with cetuximab.

[0064] This means that by confirming the guide RNAs amplified from cells not labeled with the antibody and identifying the genes targeted by the amplified guide RNAs, the antigen to which the antibody binds can be investigated.

[0065] 2.2 As a result of performing MACS using a CD44 antibody, which is a binding antibody against CD44, it was confirmed that cells lacking CD44 were screened.

[0066] As a result of screening using a CD44 antibody, which is a binding antibody against the CD44 surface protein, it was confirmed that guide RNAs for guide sequences targeting CD44 (SEQ ID NO: 7: CATCACGGTTAACAATAGCT, SEQ ID NO: 8: AAGACTCCCATTCGACAACA, SEQ ID NO: 9: TGCTACTTCAGACAACCACA, SEQ ID NO: 10: TCGCTACAGCATCTCTCGGA, SEQ ID NO: 11: CGTGGAATACACCTGCAAAG, SEQ ID NO: 12: CTACAGCATCTCTCGGACGG) were amplified in cells not labeled with the CD44 antibody in all of two different cell lines (HeLa and A549), and this is shown in Fig. 3.

[0067] Fig. 3 is a graph showing the confirmation of guide RNAs highly expressed in cells not labeled with the CD44 antibody in different cell lines by performing MACS using the CD44 antibody.

[0068] Fig. 3a is a graph showing the confirmation of guide RNAs highly expressed in cells not labeled with the CD44 antibody in the HeLa cell line, and Fig. 3b is a graph showing the confirmation of guide RNAs highly expressed in cells not labeled with the CD44 antibody in the A549 cell line.

[0069] As shown in Fig. 3, it was confirmed that guide RNAs targeting CD44 were highly expressed in cells not labeled with the CD44 antibody.

[0070] This means that by identifying the guide RNAs amplified from cells not labeled with the antibody and identifying the genes targeted by the amplified guide RNAs, the antigen to which the antibody binds can be investigated.

[0071] Experimental Example 3. Identification of Antigens for Anti-Cancer Antibodies

[0072] 3.1 Discovery of Novel Antibodies Derived from Patients

[0073] Novel antibodies S4-2 and S3-5 were discovered through the screening process of an antibody library derived from patients. Specifically, PBMCs were obtained from blood secured with the consent of patients selected based on clinical information. After purifying RNA here, a cDNA library for generating antibodies was secured in single-chain form through PCR, and then this was cloned into a phagemid. The thus-secured antibody library was bound to cancer cells by the phage display method to discover novel antibodies that specifically bind.

[0074] 3.2 Identification of Antigens for Anti-Cancer Antibodies

[0075] The same experiment as in Experimental Example 2 was conducted on the anti-cancer antibodies S4-2 and S3-5 discovered from the antibody library derived from patients. As a result, ICAM-11 (Intercellular Adhesion Molecule 1) was identified as the antigen for the novel anti-cancer antibody. This is shown in Fig. 4.

[0076] Fig. 4 is a graph showing the confirmation of guide RNAs that are more highly expressed in cells not labeled with the anti-cancer antibody S4-2 or S3-5 compared to cells labeled with the anti-cancer antibody S4-2 or S3-5, using the anti-cancer antibodies S4-2 and S3-5 discovered from the antibody library derived from patients as antibodies for MACS on Cas9 / guide RNA library cells.

[0077] Figure 4a is a graph showing the confirmation of guide RNAs that are highly expressed in cells not labeled with the anti-cancer antibody S4-2 discovered from a patient-derived antibody library, and Figure 4b is a graph showing the confirmation of guide RNAs that are highly expressed in cells not labeled with the anti-cancer antibody S3-5 discovered from a patient-derived antibody library.

[0078] As shown in Figure 4, it was confirmed that guide RNAs for guide sequences (SEQ ID NO: 13: TGACGTGTGCAGTAATACTG, SEQ ID NO: 14: GCCCGCTGAGGTCACGACCA, SEQ ID NO: 15: CGGGCTGTTCCCAGTCTCGG, SEQ ID NO: 16: TGCAGGGACTCCAGAACGGG, SEQ ID NO: 17: ACCAGCACGGAGCCTCCCCG, SEQ ID NO: 18: GCTCAGTTACTCACAGTACA) targeting ICAM-1 were highly expressed in cells not labeled with the anti-cancer antibodies S4-2 and S3-5 discovered from a patient-derived antibody library.

[0079] This means that the ICAM-1 is an antigen for the anti-cancer antibodies S4-2 and S3-5.

[0080] 3.3 Confirmation of the binding of anti-cancer antibodies S4-2 and S3-5 to cell lines expressing ICAM1

[0081] To confirm whether the ICAM1 directly binds to the anti-cancer antibodies S4-2 and S3-5, specific siRNAs of the ICAM1 were treated to confirm the loss of binding ability to the antibodies through fluorescence-activated cell sorting (FACS). Also, immunoprecipitation-western blot was used to verify whether ICAM1 directly binds to the anti-cancer antibodies S4-2 and S3-5. And the results are shown in Figures 5 and 6.

[0082] [Table 2]

[0083] Figure 5 is a graph obtained by treating the MDA-MB-468 cell line with specific siRNA of ICAM1 and performing fluorescence-activated cell sorting (FACS).

[0084] Figure 6 is an image obtained by performing immunoprecipitation-western blot on the HS578T breast cancer cell line expressing ICAM1.

[0085] As shown in Figures 5 and 6, it was confirmed that the cell lines not expressing ICAM1 lost the ability to bind to the anti-cancer antibodies S4-2 and S3-5, and the cell lines expressing ICAM1 were confirmed to bind to the anti-cancer antibodies S4-2 and S3-5.

[0086] 3.4 Confirmation of the direct binding between anti-cancer antibodies 4-2 and 3-5 and ICAM1

[0087] To confirm whether the anti-cancer antibodies S4-2 and S3-5 directly bind to ICAM1, purified ICAM1 was mixed with antibodies (IgG, 3-5, and 4-2) in vitro and immunoprecipitation-western blot was performed. The results are shown in Figure 7.

[0088] Figure 7 is an image showing the results of performing immunoprecipitation-western blot to confirm whether the anti-cancer antibodies S4-2 and S3-5 directly bind to ICAM1.

[0089] Figure 8 is a schematic diagram of a method for screening cell surface antigens.

[0090] As shown in Figure 7, it was confirmed that both of the anti-cancer antibodies S4-2 and S3-5 directly bind to ICAM1.

Claims

1. Treating a vector introduced with a guide RNA (gRNA) library against a cell-surface protein of the cell in isolated cells; Treating the cells treated with the vector with a protein capable of binding to the isolated cells; Obtaining, from the cells treated with the protein, cells that have lost the ability to bind to the treated protein; A method for screening cell surface antigens, comprising:

2. The method for screening cell surface antigens according to claim 1, wherein the protein capable of binding to the cell is a protein that specifically binds to the cell-surface protein.

3. The method for screening cell surface antigens according to claim 2, wherein the protein that specifically binds to the cell-surface protein is any one selected from the group consisting of an antibody, an affibody, and a diabody.

4. The method for screening cell surface antigens according to claim 3, wherein the antibody is one discovered through the process of screening an antibody library derived from a patient.

5. The method for screening cell surface antigens according to claim 1, wherein the cell is a cancer cell.

6. The method for screening cell surface antigens according to claim 1, wherein the cell contains Cas9 nuclease.

7. The method for screening cell surface antigens according to claim 1, wherein the vector is a viral vector.

8. The method for screening cell surface antigens according to claim 1, wherein the cells treated with the vector have one vector introduced per cell.

9. The method for screening cell surface antigens according to claim 1, wherein the guide RNA library contains 1 to 10 guide RNAs per gene of the cell-surface protein.

10. The method further comprises analyzing the guide RNA contained in the cells that have lost the ability to bind to the treated protein; Confirming the gene targeted by the analyzed guide RNA; The method for screening cell surface antigens according to claim 1, characterized by further comprising:

11. The step of obtaining cells that have lost the ability to bind to the processed protein includes a step of treating cells in which the protein has been processed with beads having a surface to which the processed protein binds, a step of obtaining cells that do not bind to the beads, and a method for screening a cell surface antigen according to claim 1, characterized by including these steps.

12. The method includes a step of preparing control group cells in which the gene targeted by the analyzed guide RNA has been knocked down or knocked out, a step of treating the control group cells with an antibody to measure the presence or absence of an antigen-antibody reaction, and a method for screening a cell surface antigen according to claim 10, characterized by including these steps.

13. The antigen-antibody reaction is measured using any one selected from the group consisting of enzyme immunoassay, radioimmunoassay, sandwich assay, Western blotting, immunoprecipitation, immunohistochemical staining, fluorescence immunoassay, enzyme substrate chromogenic method, and antigen-antibody agglutination method. A method for screening a cell surface antigen according to claim 12, characterized by this.

14. The cell-surface-protein is a tumor-associated antigen (TAA), and a method for screening a cell surface antigen according to claim 1, characterized by this.

Images