A plant having a modified deoxyhypusine synthase gene

Genome editing of the DHS gene in plants using techniques like CRISPR reduces DHS activity, addressing the limitations of current senescence regulation methods and enhancing stress tolerance and yield by delaying senescence and improving shelf life.

JP2025522915APending Publication Date: 2025-07-17AGRIBODY TECHNOLOGIES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025500298
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-06
Filing Date
2023-07-06
Publication Date
2025-07-17

AI Technical Summary

Technical Problem

Current methods for regulating programmed cell death and senescence in plants, including those induced by environmental stress, are not widely applicable and often require the introduction of foreign DNA, leading to potential loss of antisense expression in subsequent generations.

Method used

Genome editing techniques such as RTDS, TALEN, ARCUS, or CRISPR are used to introduce deletions, insertions, or substitutions in the hypervariable region of the deoxyhypusine synthase (DHS) gene, reducing DHS protein activity and thereby delaying senescence and enhancing stress tolerance and yield.

Benefits of technology

The method results in plants with extended lifespan, increased resistance to abiotic stress, and improved yield by reducing the activity of DHS, which is essential for eIF-5A activation and downstream aging-related gene expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025522915000001_ABST
    Figure 2025522915000001_ABST
Patent Text Reader

Abstract

The present disclosure relates to a method for producing a plant body with delayed senescence, which comprises at least one nucleotide deletion, insertion, or substitution in at least one copy of a gene encoding deoxyhypusine synthase (DHS) in the plant body, wherein this nucleotide deletion, insertion, or substitution reduces the activity of DHS encoded by this gene in the plant body. The present disclosure also relates to a plant body produced by the method described herein and its progeny.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority to U.S. Provisional Patent Application No. 63 / 367,759, filed on July 6, 2022, the content of which is hereby incorporated by reference in its entirety for all purposes.

[0002] Reference to Electronically Submitted Sequence Listing

[0001] This application includes an XML - formatted sequence listing electronically submitted from EFS - Web together with this specification. The content of this XML copy created on July 6, 2023, is named "SequenceListing" and is 374,680 bytes in size. This sequence listing is hereby incorporated by reference in its entirety.

Background Art

[0003] Background Senescence is the final stage of biological development in the life of a plant. It is a precursor to death and occurs at various biological tissue levels, including the whole plant, organs, flowers and fruits, tissues, and individual cells.

[0004] The occurrence of senescence can be induced by various factors, both internal and external. Senescence is a complex and highly regulated developmental stage in the life of a plant or plant tissues such as fruits, flowers, and leaves. When senescence occurs, cell membranes and macromolecules disintegrate in a coordinated manner, and subsequently, metabolites are mobilized to other parts of the plant.

[0005] In addition to programmed senescence that occurs during normal plant development, cell and tissue death, and subsequent mobilization of metabolites occur as a coordinated response to external environmental factors. External factors that induce premature senescence, also known as necrosis or apoptosis, include environmental stresses such as temperature, drought, insufficient sunlight, or insufficient nutrient supply, as well as attacks by pathogens. Plant tissues exposed to environmental stress also generally produce ethylene, known as stress ethylene (Buchanan-Wollaston (1997) J. Exp. Botany 48:181-199; Wright, M. (1974) Plant 120:63-69). Ethylene is known to cause senescence in some plants.

[0006] Senescence is not a passive process but rather an actively regulated process involving the coordinated expression of specific genes. Total RNA levels decline during senescence, and the expression of many genes switches off (Bate et al. (1991) J. Exper. Botany 42:801-11; Hensel et al. (1993) The Plant Cell 5:553-64). However, there is increasing evidence that the senescence process depends on de novo transcription of nuclear genes. For example, senescence is blocked by inhibitors of mRNA and protein synthesis and by enucleation. Molecular studies using cDNA from senescing and green leaves in in vitro translation experiments have revealed changes in the pattern of leaf protein products in senescing leaves (Thomas et al. (1992) J. Plant Physiol. 139:403-12). By using differential screening and subtractive hybridization methods, many cDNA clones corresponding to senescence-induced genes have been identified from various different plants, including both monocots and dicots such as Arabidopsis, maize, cucumber, asparagus, tomato, rice, and potato. The identification of genes specifically expressed during senescence is conclusive evidence that de novo transcription is required for the progression of senescence.

[0007] Events that occur through aging appear to be highly coordinated to maximize the use of cellular components before necrosis and death occur. To control this process, complex interactions involving the sensing of specific signals and the induction of gene expression cascades should occur. The expression of genes encoding aging-related proteins is probably controlled by common activator proteins, which are in turn activated directly or indirectly by hormonal signals. Little is known about the mechanisms involved in the initial signaling or subsequent coordination of this process.

[0008] Coordinated gene expression requires factors involved in transcription and translation, including initiation factors. Translation initiation factor genes have been isolated and characterized in various organisms, including plants. Translation initiation factors can regulate the rate at which an mRNA population moves out of the nucleus and its rate of association with ribosomes, and to some extent can affect the stability of specific mRNAs. (Zuk et al. (1998) EMBO J. 17:2914-2925). Indeed, one such translation initiation factor, which is not required for global translation activity, is thought to shuttle a specific subset of mRNAs from the nucleus to the cytoplasm for translation (Jao et al. (2002) J. Cell. Biochem. 86:590-600; Wang et al. (2001) J. Biol. Chem. 276:17541-17549; Rosorius et al. (1999) J. Cell Sci. 112:2369-2380). This translation factor is known as eukaryotic initiation factor 5A (eIF-5A) and is the only known protein that contains the amino acid hypusine. (Park et al. (1988) J. Biol. Chem. 263:15264-15269).

[0009] Eukaryotic translation initiation factor 5A (eIF-5A) is an essential protein factor with a size of approximately 17 kDa, which is involved in the initiation of eukaryotic protein synthesis. It is characterized by the presence of hypusine [N-(4-amino-2-hydroxybutyl)lysine], a unique modified amino acid known to exist only in eIF-5A. Hypusine is formed post-translationally in eIF-5A through the transfer and hydroxylation of a butylamine group from the polyamine spermidine to the side-chain amino group of a specific lysine residue. The activation of eIF-5A involves the transfer of the butylamine residue of spermidine to lysine, the formation of hypusine, and the activation of eIF-5A. In eukaryotes, deoxyhypusine synthase (DHS) mediates the post-translational synthesis of hypusine in eIF-5A. The hypusine modification has been shown to be essential for eIF-5A activity in vitro using the methionyl-puromycin assay.

[0010] Hypusine is formed post-translationally in eIF-5A through the conversion of a conserved lysine residue by the actions of deoxyhypusine synthase (DHS; EC 1.1.1.249) and deoxyhypusine hydroxylase (DOHH; EC 1.14.99.29). DHS cDNA has been directly sequenced or predicted from genomic sequences in many other plant species, including Arabidopsis thaliana (GenBank accession number NM_120674), alfalfa (U.S. Patent No. 8,563,285), banana (GenBank accession number XM_009405857), Amaranthus hypochondriacus (GenBank accession number XP_010452500), canola (GenBank accession number XM_013859772), carnation (GenBank accession number AF296080), cocoa (GenBank accession number CGD0006914), coffee (GenBank accession number GR986281), soybean (GenBank accession number BM092515), tobacco (GenBank accession number NM_001325620), tomato (GenBank accession number NM_001247566), wheat (GenBank accession number FJ376389), and dozens more. DOHH cDNA sequences have been identified in some plants, including Medicago truncatula (GenBank accession number XM_013594404).

[0011] DHS converts the conserved lysine residue of eIF-5A to deoxyhypusine through the addition of a butylamine group derived from spermidine. When this intermediate form of eIF-5A is then hydroxylated by DHH, it becomes hypusine (Park et al. (1997) Biol. Signals 6:115-123). Both the deoxyhypusine form and the hypusine form of eIF-5A are capable of binding to cDNA in vitro (Liu et al. (1997) Biol. Signals 6:166-174). Although the function of eIF-5A is not fully understood, there is some evidence that it may regulate cell division (Park et al. (1998) J. Biol. Chem. 263:15264-15269; Tome et al. (1997) Biol. Signals 6:150-156) and aging (Wang et al. (2001) J. Biol. Chem. 276:17541-17549). Some organisms appear to have more than one isoform of eIF-5A, and if so, this would fit the premise that each isoform is a specific shuttle for a particular set of mRNAs involved in processes such as cell division and aging.

[0012] Wang et al. demonstrated that increased levels of DHS cDNA correlate with tomato fruit softening and both natural and stress-induced leaf senescence (Wang et al. (2001) J. Biol. Chem. 276:17541-17549; (2003) Plant Molecular Biology 52: 1223-1235; and (2005) Plant Physiology 138:1372-1382). Furthermore, when the expression of DHS was suppressed by introducing an antisense cDNA fragment of DHS under the control of a constitutive promoter in transgenic tomato plants, tomato fruits from these transgenic plants exhibited a dramatic delay in senescence, as evident from the delay in fruit softening and decay. See U.S. Patent Nos. 6,878,860, 6,900,368, 7,070,997, and 7,226,784. Since DHS is known to activate eIF-5A, these data suggest that hypusine-modified eIF-5A (active eIF-5A) may control senescence through the selective translation of mRNA species required for senescence. This was further demonstrated through the downregulation of DHS by antisense of full-length or 3'UTR cDNA under the regulation of a constitutive promoter in Arabidopsis thaliana ("AT"). By downregulating Arabidopsis thaliana DHS ("AT-DHS") expression and reducing the amount available for eIF-5A activation, senescence was delayed by approximately two weeks (see Duguay et al. (2007) Journal of Plant Physiology 164:408-420 and U.S. Patent No. 7,226,784]. Not only was senescence delayed, but an increase in seed yield, an increase in stress tolerance, and an increase in biomass were also observed in the transgenic plants, where the degree of each phenotype was determined by the degree of downregulation of DHS.

[0013] It is expected that the downregulation of DHS in plants using antisense transgenic plants will produce plants with advantageous agricultural scientific characteristics such as stress resistance, delayed aging, and increased yield. However, in general, transgenic plants have several disadvantages. The creation of transgenic DHS plants requires the introduction of foreign DNA, including the antisense gene. In many cases, a viral promoter is used for strong expression, and a selectable gene is also used. Furthermore, since viral promoters are often recognized and turned off by plants, antisense expression is lost in the next generation of transgenic plants. A better strategy for downregulating DHS in plants, such as alfalfa, is to modify the gene using genome editing so that the activity of the translated DHS protein is reduced or eliminated. Arabidopsis thaliana and many other plants have only one copy of the DHS gene per haploid genome, as shown by Southern blot (Wang et al. (2001) J. Biol. Chem. 276:17541-17549) and complete genome sequencing. Since alfalfa is a tetraploid plant, using genome editing techniques, in separate progeny from the same experiment, one of the four DHS copies found in its genome can be disrupted, thereby reducing the DHS activity in plant tissues by approximately 25%, or two of the four DHS copies found in its genome can be disrupted, thereby reducing the activity by approximately 50%, or three of the four DHS copies found in its genome can be disrupted, thereby reducing the activity by approximately 75%. Selecting independent progeny expressing each of these residual activity levels could lead to the identification of clones demonstrating the maximum degree of improvement in stress resistance and delayed aging due to incomplete hypusination of the eIF-5A isoform involved in stress and aging pathways.Given that homozygous knockout of DHS has been demonstrated to be lethal in mice and yeast, the likelihood of finding progeny in which all four DHS copies are disrupted would seem impossible, since it should be a lethal event (Templin et al. (2011) Cell Cycle 10:1043-9; Sasaki et al. (1996) FEBS Lett. 384:151-4).

[0014] In genome editing, the genome of either a plant or an animal is manipulated using a variety of techniques that insert, delete, or substitute specific gene sequences in a highly specific manner. There are many genome editing methods, including, but not limited to, the use of transgenic DNA sequences homologous to the intended modification site (homologous recombination), or methods that use engineered nucleases, including the use of a transgenic DNA sequence adjacent to the site of the intended modification (homologous recombination), or methods that use engineered nucleases, such as meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALENs), ARC nucleases (ARCUS), and CRISPR-based systems using Cas9, CRISPR-Cpf1, CRISPR-Cms1, etc. In any of these systems, the nuclease creates a site-specific double-stranded DNA break, and then, when this is repaired by homologous recombination or non-homologous end joining, a targeted mutation is created.

[0015] An example of homologous recombination is the rapid trait development system (RTDS) (Beetham et al. (1999) Proc. Natl. Acad. Sci. USA 96:8774-8778; Kochevenko and Willmitzer (2003) Plant Physiol. 132:174-184). In the RTDS, a gene repair oligonucleotide (GRON) is used to introduce a mismatch error into the sequence of a target gene in a highly specific manner. The mismatch is then repaired by the plant's natural DNA repair system using the GRON as a template, creating the desired modification.

[0016] The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 genome editing system has been used in a wide variety of organisms, including monocotyledonous and dicotyledonous plants. One or more single-guide RNAs (sgRNAs) are introduced together with a target sequence homologous to the desired gene to be edited in addition to the Cas9 nuclease, and it is used to direct the Cas9 protein to specific genomic sites (reviewed by Ma and Liu (2016) Curr. Protoc. Mol. Biol, DOI: 10.1002 / cpmb.10). Similar experiments can be designed using other double-stranded nucleases such as Cms1 (Begemann and Gray and U.S. Patent No. 9,896,696, the contents of which are hereby incorporated by reference in their entirety).

[0017] Transcription activator-like effectors (TALEs) are naturally occurring transcription effectors that allow the creation of TALEs that recognize DNA sequences with high specificity in a customizable form through the use of simple tandem repeat codes. When combined with a functional domain such as the FokI nuclease (TALEN), targeted gene disruption is possible. When the TALEN nuclease binds to its engineered recognition sequence, double-stranded DNA cleavage and subsequent recruitment of the non-homologous end-joining repair mechanism occur, resulting in either small deletions or insertions, which lead to disruption of gene function. TALENs have been used in the modification of economically important food crops and biofuels and are also under investigation for the correction of genetic errors underlying certain human diseases. TALENs can also specifically introduce the targeted sequence into its locus using homologous recombination by combining with the simultaneous introduction of a targeting segment of DNA containing homology to the cleavage site.

[0018] Meganucleases (also called homing endonucleases) are nucleases that recognize very large sequences (12 - 40 base pairs) that occur very rarely, ideally only once, in the genome [Porteus et al. (2005) Nat. Biotechnol. 23:967 - 73]. Meganucleases usually recognize palindromic sequences, but by creating a pair of monomers that recognize two different halves of the site that form the meganuclease as a heterodimer, this can cleave non - palindromic sites. ARCUS is a genome - editing technology based on the ARC nuclease, which is a fully synthetic homing endonuclease - like enzyme derived from naturally occurring homing endonucleases. The ARC nuclease can be customized to recognize specific DNA sequences and, in many cases, enables precise DNA cleavage at a site that is unique in the genome. This DNA cleavage allows genome modification, including insertions, deletions, or substitutions, to be possible by homologous recombination.

[0019] The function of DHS enzymes has been well elucidated. The deoxyhypusine synthase reaction catalyzed by DHS involves three different substrates, namely, spermidine, NAD +involves the interaction with eIF-5A precursor protein (eIF-5A(Lys)). The first step of this reaction is the NAD-dependent dehydrogenation of spermidine, the second step involves the formation of a DHS-imine intermediate by transimination, the third step involves transimination for the eIF-5A-imine intermediate, and the fourth step involves the enzyme-coupled reduction of the eIF-5A-imine intermediate (Joe et al. (1997) J. Biol. Chem. 272:32679-685). This enzyme-imine intermediate binding is formed between the 4-amino-butyl moiety of spermidine and the ε-amino group of K329 in the human enzyme [Joe et al. J. Biol. Chem. (1997) 272:32679-685]. When adding eIF-5A(Lys) precursor, the butylamine group is transferred to K50 of human eIF-5A and then reduced to form deoxyhypusine. Therefore, K329 of human DHS is extremely important for DHS enzyme activity because it is absolutely necessary for the transfer of the butylamine group from spermidine to eIF-5A.

[0020] A number of amino acid residues that have been shown to be critically important for DHS function are disclosed in US Patent Application Publication No. 2019 / 0203220A1 (the entire content of which is incorporated herein by reference). This application focuses on a previously unknown hypervariable small region of this protein, which can be deleted while maintaining viability in the homozygous state. In fact, this invention is based, in whole or in part, on the homozygous in-frame deletion of this small region, and this deletion results in a decrease in the activity of the DHS protein, thus producing extremely desirable traits in plants.

[0021] According to the amino acid sequence alignment of many plant DHS proteins, many long regions of almost complete homology are revealed. However, for the 6-amino acid region described herein as the "hypervariable region", as shown by the sequence region within the box in Figure 1C, there is almost no identity among plant species; it is a small "disordered residue" region that cannot be crystallized as shown in Figure 2B.

[0022] Scientific research examining the potential functions of "intrinsically disordered protein regions" has been mass-produced and continues to increase, including those related to the specificity of transcription factors, proteins involved in the formation of intracellular condensates, and human diseases such as cancer, cardiovascular diseases, and many neurodegenerative disorders (Brodsky, S., et al. (2021) Curr Opin Struct Biol 71:110-115; Borcherds, W., et al. (2021) Curr. Opin. Struct. Biol. 67:41-50; Garaizar, A., et al. (2020) Molecules 25:4705; Santofimia-Castango, et al. (2020) Cell Mol. Life Sci. 77:1695-1707; Kulkarni, P & V. Uversky (2019) Biomolecules 9:147; Uversky, V. (2015) Front. Aging Neurosci. 7:1-6 (the contents of which are hereby incorporated by reference in their entirety).

[0023] This hypervariable region of the DHS protein is likely involved in the formation of intracellular protein complexes, including its direct substrate eIF-5A. In fact, one proposed mechanism of action for the hypusination of eIF-5A is the selective transport of RNA involved in aging / apoptosis from the nucleus to the cytoplasm. Therefore, small deletions in the residues of the hypervariable region of DHS may result in reduced effectiveness of protein complex formation and, consequently, a potential reduction in aging. Associated phenotypic traits may include extended lifespan, improved tolerance to abiotic stress, some tolerance to necrotrophic pathogens, and increased yield.

[0024] The ability to construct homozygous mutations that reduce but do not abolish the catalytic function of the DHS protein is particularly important in crops grown from hybrid seeds. Examples include maize, wheat, sorghum for grain use, cotton, peanuts, and many other crops. In such cases, elite inbred lines that are homozygous at most loci are used as parents. If the activity of one or both parental lines is reduced due to a targeted mutation in the DHS gene, the resulting hybrid seeds will be particularly advantageous when sold to farmers. SUMMARY OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION

[0025] Currently, there is no widely applicable method for regulating the occurrence of programmed cell death (including senescence) caused by either internal or external factors, such as environmental stress. Therefore, it would be beneficial to develop senescence-regulating technologies that are applicable to all types of plants and are effective at the earliest stages in the cascade of events leading to senescence. Genome editing of DHS is a possible solution for reducing losses in plant yields due to environmental stress and improving the shelf life of perishable agricultural products such as fruits, vegetables, and flowers. MEANS FOR SOLVING THE PROBLEMS

[0026] SUMMARY In some aspects and embodiments, the present disclosure provides polynucleotides encoding such proteins, including the protein sequence of deoxyhypusine synthase (DHS) from plant species, particularly tomato, as well as mRNA and genomic sequences.

[0027] In some embodiments, the present disclosure also relates to methods involving genome editing involving any of deletions, insertions, or substitutions to disrupt the activity of such DHS proteins by targeting amino acid residues in the hypervariable region.

[0028] In some embodiments, the present disclosure provides a method for genome editing of a plant body to regulate the occurrence of aging, whether it is aging associated with aging or environmentally stress-induced aging. Without limitation, using one of several genome editing techniques including RTDS, TALEN, ARCUS or CRISPR, deletions, insertions, or substitutions are introduced into a region of certain amino acid residues in the hypervariable region, which leads to a decrease in DHS protein activity, and thus the functionally active endogenous aging-inducing DHS protein level decreases, and the activation of eIF-5A and the subsequent downstream expression of aging-related genes are reduced and / or prevented.

[0029] In some embodiments, the method of the present disclosure provides a genome-edited plant body, which is created and monitored for growth, development, and either natural aging or aging delay. Due to the decrease in aging-inducing DHS levels, an extension of lifespan or shelf life (e.g., extension of flower lifespan, reduction of fruit or vegetable spoilage), improvement of biomass, increase in seed yield, increase in resistance to physiological diseases (e.g., bottom rot, reduction of seed aging, and / or reduction of leaf yellowing) are exhibited. A plant body or a detached part of a plant body (e.g., cutting, flower, vegetable, fruit, seed, or leaf) that includes a reduction in leaf yellowing, a reduction in petal abscission, and a reduction in spoilage of fruits and vegetables during shipping and storage is selected as a desired agricultural product with improved characteristics. These excellent plant bodies are propagated. Similarly, a plant body that exhibits an increase in resistance to environmental stresses (e.g., high or low temperature, drought, low nutrient levels, high salt concentration, crowding, pathogen infection, and / or physiological diseases) is selected as an excellent agricultural product.

[0030] In some embodiments, the plant species that can be used in the method of the present invention include, without limitation, for example, ethylene-sensitive and ethylene-insensitive plants; fruiting plants such as anthurium, apple, orange, banana, grapefruit, pear, tomato, strawberry, avocado, grape. In some embodiments, the plant body is a vegetable such as carrot, pea, lettuce, cabbage, turnip, potato, broccoli, asparagus, pepper, zucchini, bean.

[0031] In some embodiments, the plant body is a flower such as rose, carnation, chrysanthemum, orchid, etc.

[0032] In some embodiments, the plant body includes agricultural scientific crop plant species such as corn, rice, soybean, alfalfa, wheat, cotton, sugar beet, canola, Camelina, sorghum, sunflower, cassava, peanut, etc., and forest plants such as poplar and other trees. Generally, in the method of the present invention, any plant body that can incorporate a DNA molecule for genome editing can be used, and plant bodies of various ploidy levels can be included, including haploid, diploid, tetraploid, and polyploid. The plant body can be either a monocotyledon or a dicotyledon and can use C3 or C4 photosynthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Brief Description of the Drawings

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Figure 1E

Figure 1F

Figure 1G

Figure 1H

Figure 1I

Figure 2

Figure 3

Figure 4A

Figure 4B

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Modes for Carrying Out the Invention

[0034] Detailed Description Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. All patents and publications mentioned in this specification are incorporated by reference in their entirety.

[0035] As used herein, "corresponding residue" refers to any amino acid of a DHS protein that is at a different position when aligned with a second DHS protein amino acid sequence (e.g., human DHS) based on N-terminal to C-terminal numbering, and even when at the same position, has a different numbering due to gaps introduced by any sequence alignment. Examples of corresponding residues are described herein, for example, in FIG. 1. Examples of plant DHS amino acid sequences and corresponding nucleotide sequences include, but are not limited to, the sequences in Table 1.

[0036] [Table 1]

[0037] [Table 2]

[0038] [Table 3]

[0039] [Table 4]

[0040] For the sake of clarity, the cultivated peanut species (Arachis hypogaea) is derived from a cross between two wild peanut species, namely, A. duranensis and A. ipaensis (Seijo et al. (2007) Am. J. Bot. 94 (12) 1963-71; Kochert et al. (1996) Am. J. Bot. 83:1282-91; Moretzsohn et al. (2013) Ann. Bot. 111:113-126). The amino acid sequences of the DHS proteins are identical between these parental diploids, A. duranensis and A. ipaensis (SEQ ID NO: 3 and SEQ ID NO: 6, respectively). Thus, the amino acid sequence of the DHS protein of cultivated peanut (Arachis hypogaea) is expected to be identical in both parents.

[0041] Genome editing of the endogenous DHS gene by deleting or modifying functionally essential defined residues results in plants that do not have, or have substantially reduced, the DHS protein that activates eIF-5A. As discussed herein, for eIF-5A to be biologically useful, it must be activated by DHS. Thus, in genome-edited plants, the inhibition or reduction of DHS activity will result in a decrease in active eIF-5A. Genome-edited plants exhibit an increase in biomass, an increase in seed yield and / or an increase in seed size, and in the case of plants that are highly perishable fruits or vegetables, an extension of post-harvest shelf life, a significantly higher tolerance to abiotic stress.

[0042] Further evidence supporting the claim that DHS and eIF-5A play a role in controlling aging was provided by treating carnation flowers with an inhibitor specific to DHS. Spermidine and eIF-5A are substrates of the DHS reaction ((Park et al. (1993) Biofactors 4:95-104; Park et al. (1997) Biol. Signals. 6:115-123). Several monoamines, diamines, and polyamines with structural features similar to spermidine inhibit DHS activity in vitro (Jakus et al. (1993) J. Biol. Chem. 268:13151-13159). Some polyamines, such as spermidine, putrescine, and spermine, are generally used to extend the vase life of carnations (Wang and Baker (1980) Hort. Sci. 15:805-806). In carnations infiltrated under vacuum with a transient infection system expressing antisense DHS, petal senescence was delayed 6 days after harvest compared to untreated flowers (Hopkins et al. (2007) New Phytol. 175:201-214).

[0043] Postharvest stress-induced senescence is another cause of reduced agricultural yields (McCabe et al. (2001) Plant Physiol. 127:505-516). This applies to plants that are partially processed, such as cut lettuce. The symptom caused by cutting lettuce is browning, which is the result of the production of phenols (Matile et al. (1999) Annu. Rev. Plant Physiol. Mol. Biol. 50:67-95). In field trials of lettuce with antisense polynucleotides of lettuce eIF-5A (LeIF-5A) or antisense full-length DHS, it was demonstrated that the browning resistance of transgenic lettuce after cutting was significantly higher than that of control lettuce. Even for stress-induced senescence caused by harvesting, which is a completely separate circuit, translational regulation upstream of browning and potentially other senescence symptoms appears to be at least partially controlled by DHS and eIF-5A (Page et al. (2001) Plant Physiol. 125:718-727). Downstream of senescence control are effector genes. These genes are the effectors of senescence and cause metabolic changes that result in the senescence syndrome. Downregulating or reducing the activity of eIF-5A will weaken all types of symptoms caused by senescence.

Example

[0044] Example Example 1: Genomic DNA sequence Genomic DNA sequences were identified for 34 plant species and 35 DHS genes from humans, and exons and introns were delineated. For Zea mays (maize), two DHS genes or alternative splice variants are shown. Other species (e.g., Solanum lycopersicum (tomato)) may have two or more DHS genes, even if only one is provided. Guide RNAs for editing DHS genes can target exons or introns within the genomic DNA. The 35 exon-intron boundaries of these genomic DNAs are illustrated in FIGS. 4A-4B. The genomic sequences of examples of plant species are provided in Table 1.

[0045] Example 2: ARCUS: Engineered Homing Endonuclease Engineered homing endonucleases known as ARCUS are engineered to produce nucleases that can create double-strand breaks in regions of tomato (S. lycopersicum) DHS that are not required for full deoxyhypusine synthase activity. This region that is the specific target of the cleavage may contain nucleic acids that surround this region and that, when translated, will contain H76 - E81 (HELPTE motif; SEQ ID NO: 106). Creation of DNA cleavage by the engineered ARC nuclease may make it possible to create small in-frame deletions in this target region of the plant DHS, which is known to be hypervariable among plant species. In tomato (S. lycopersicum), the activity of this enzyme can be reduced by deleting one or more of the following residues: H76 (no corresponding residue in human DHS - see Figure 1), E77 (corresponds to E105 in human DHS), L78 (corresponds to P106 in human DHS), P79 (corresponds to L107 in human DHS), T80 (corresponds to S108 in human DHS), or E81 (corresponds to D110 in human DHS). DNA cleavage by the ARCUS nuclease makes it possible to create small deletions in this target region of the plant DHS that reduce, but do not eliminate, deoxyhypusine synthase (DHS) activity. The amino acid sequences flanking this hypervariable 6 - amino acid region are highly conserved.

[0046] Example 3: Engineered Transcription Activator - like Effector Nuclease (TALEN) Engineered transcription activator-like effectors (TALEs) are engineered to produce nucleases that can create double-strand breaks in regions of tomato (S. lycopersicum) DHS that are not required for full deoxyhypusine synthase activity, for example, in combination with the FokI nuclease (TALEN). Similarly, a pair of TALENs fused to Clo51, a nuclease that functions only when the distance between DNA binding sites is appropriate, is designed adjacent to the target site. This region that is the specific target of cleavage may contain nucleic acids that surround this region and that, when translated, will contain H76 - E81 (HELPTE motif; SEQ ID NO: 106). Creation of DNA cleavage by engineered TALEs may make it possible to create small in-frame deletions in this target region of plant DHS, which is known to be hypervariable between plant species. In tomato (S. lycopersicum), the activity of this enzyme can be reduced by deleting one or more of the following residues: H76 (no corresponding residue in human DHS - see Figure 1), E77 (corresponds to E105 in human DHS), L78 (corresponds to P106 in human DHS), P79 (corresponds to L107 in human DHS), T80 (corresponds to S108 in human DHS), or E77 (corresponds to D110 in human DHS). DNA cleavage by engineered TALENs makes it possible to create small deletions in this target region of plant DHS that reduce, but do not abolish, deoxyhypusine synthase activity. The amino acid sequences on either side of this hypervariable 6-amino acid region are highly conserved.

[0047] Example 4: sgRNA with double-strand cleavage ability When the sgRNA is introduced into a plant together with Cas9 or another nuclease (CRISPR-Cas9 system), it is engineered to produce a guide RNA having the ability to create double-strand breaks in a region of tomato (S. lycopersicum) DHS that is not required for full deoxyhypusine synthase activity. This region that is the specific target of cleavage may contain nucleic acids that surround this region and that, when translated, will contain H76 - E81 (HELPTE motif; SEQ ID NO: 106). If DNA cleavage is created by the gRNA and the CRISPR nuclease, it may be possible to create small in-frame deletions in this target region of plant DHS, which is known to be hypervariable among plant species. In tomato (S. lycopersicum), the activity of this enzyme can be reduced by deleting one or more of the following residues: H76 (no corresponding residue in human DHS - see Figure 1c), E77 (corresponding to E105 in human DHS), L78 (corresponding to P106 in human DHS), P79 (corresponding to L107 in human DHS), T80 (corresponding to S108 in human DHS), or E81 (corresponding to D110 in human DHS). The nucleic acid sequence of this 6 - amino acid hypervariable region within the range of the tomato (Solanum lycopersicum) DHS1 gene sequence is CATGAGCTGCCCACGGAG (SEQ ID NO: 107). DNA cleavage by the sgRNA and the CRISPR nuclease makes it possible to create small deletions in this target region of plant DHS that reduce, but do not abolish, deoxyhypusine synthase activity. The amino acid sequences flanking this hypervariable 6 - amino acid region are highly conserved.

[0048] Example 5: Editing of a Predetermined Genomic Locus in Tomato (Solanum lycopersicum) Design one or more gRNAs to anneal to a desired site in the tomato genome and enable interaction with one or more Cas9 or other CRISPR double-stranded nuclease proteins. Clone these gRNAs into a vector such that they are operably linked to a promoter operable in plant cells (gRNA cassette). Clone one or more genes encoding Cas9 or other CRISPR double-stranded nuclease proteins into a vector such that they are operably linked to a promoter operable in plant cells (CRISPR nuclease cassette). Clone the gRNA cassette and the CRISPR nuclease cassette, respectively, into vectors suitable for plant transformation, and subsequently transform this vector into Agrobacterium cells. Contact these cells with tomato tissue suitable for transformation. After this incubation with Agrobacterium cells, culture the tomato cells in a tissue culture medium suitable for the regeneration of intact plants, and simultaneously select against Agrobacterium cells. Regenerate tomato plants from the cells that have been contacted with Agrobacterium cells containing the vector encapsulating the CRISPR nuclease cassette and the gRNA cassette. After regeneration of the tomato plants, recover the plant tissue and extract DNA from the tissue. Optionally perform a DNA sequencing assay to determine whether a change in the DNA sequence has occurred at the desired genomic location.

[0049] Construction of plasmids. Using CRISPOR, a program that helps in the design, evaluation, and cloning of guide sequences for the CRISPR / Cas9 system, two gRNAs for the DHS1 gene of tomato (Solanum lycopersicum) were designed. The selected targets were 20 bp located at positions 1027 - 1046 (designated as TCACATGAGCTGCCCACGG - DHS1_G1 (SEQ ID NO: 108)) and 4527 - 4546 (designated as GTATCATGGGGAAAGATACG - DHS1_G3 (SEQ ID NO: 109)). Cloning into pEn_Chimera was performed [Fauser et al. (2014) The Plant Cell 29: 843 - 853]. Both CRISPR / Cas9 - based nucleases and nickases can be efficiently used for genome engineering in Arabidopsis thaliana. Briefly, for each gRNA, two 23 - bp overlapping oligos were designed, where the first 2 bp of the target were changed to GG (see Table 2). These oligos were annealed and cloned into Bpil - digested pEn_Chimera. The resulting plasmids were used with LR recombination (Thermo Fisher Scientific, Waltham, MA, USA) to transfer the AtU6 - 26p - DHS1_G1_sgRNA or AtU6 - 26p - DHS1_G3_sgRNA cassette into the pMR575 binary vector. The vector pMR575 contains AtUBQ10p_TRP15’UTR (Cor15a11L) [Gallegos & Rose (2017) The Plant Cell 29: 843 - 853]. In the determination of the transcription start site driving SpCas9, the visible marker AtOLEp - AtOLE1 - Citrine (expressed in mature embryos), and the kanamycin resistance marker, the intron DNA sequence may be more important than the proximal promoter (Fauser et al. (2014) The Plant Cell 29:843 - 853). These final vectors are designated as pMR618 (carrying G3) and pMR619 (carrying G1 - see Figure 6).To create the edited tomato plants, pMR618 and pMR619 were introduced into Agrobacterium tumefaciens strain EHA105 and used for the stable transformation of tomato cotyledons of varieties TF2465 and TF4415 using the method essentially described (Bari et al. (2019) Scientific Reports 9:11438) that utilized the kanamycin marker for selection.

[0050]

Table 5

[0051] Genotyping. For the mutations in DHL1, genotyping of transgenic T0 plants and their progeny was performed by Sanger sequencing of the PCR-amplified target regions using the primers listed below. The Sanger sequencing chromatograms were deconvolution-processed by web tools from TIDE or ICE.

[0052]

Table 6

[0053] The presence or absence of the transgene was confirmed by assaying the presence or absence of the predicted PCR bands by PCR using the following primers.

[0054]

Table 7

[0055] Plant propagation and phenotypic typing. The plants were grown with natural lighting in a greenhouse at 15 °C - 26 °C. In winter, the plants were supplemented with lighting from 5 am to 10 am and from 5 pm to 10 pm. No obvious developmental phenotypes were observed before fruiting.

[0056] Homozygous or biallelic (= two mutant alleles) T1 or T2 plants were used in comparison with their wild-type precursors. In two different tomato germplasm sources, namely TF2465 (plum type) and TF4415 (round type), a series of four small in-frame biallelic deletion mutations in the hypervariable region of the DHS1 gene were isolated. These mutations are described in Table 5.

[0057]

Table 8

[0058] Tomatoes of DHS1_135-3 were harvested at various different stages (green mature stage / color-breaking stage / coloring stage / peach ripe stage / red ripe stage), placed in trays on the laboratory bench, and left at room temperature. Photos of the tomatoes were taken every week. Wild-type and mutant tomatoes of the same variety, harvested at the same stage of fruit development, were compared over time (see Figure 12). It is clear that the activity of the DHS1 gene in tomatoes was reduced sufficiently by this small 3-base pair homozygous deletion mutation, which resulted in the removal of a single amino acid in the hypervariable region, to extend the shelf life of this mutant fruit 4 to 5 times longer than the wild-type control without any other obvious phenotypic effects on the plants. Similar results were observed for the other three mutations.

[0059] Example 6: Introduction of Cassettes by Particle Bombardment Alternatively, particle bombardment is used to introduce the CRISPR nuclease cassette and the gRNA cassette into tomato cells. A vector containing the CRISPR nuclease cassette and the gRNA cassette is coated onto gold beads or titanium beads, and then used to bombard tomato tissue suitable for regeneration. After bombardment, the tomato tissue is transferred to a tissue culture medium for regeneration of tomato plants. After regeneration of the tomato plants, the plant tissue is harvested and DNA is extracted from the tissue. The T7EI assay and / or the sequencing assay are appropriately performed to determine whether a change in the DNA sequence has occurred at the desired genomic location.

[0060] Example 7: Deleting DNA from a predetermined genomic locus using non-homologous end joining The first gRNA is designed to anneal to a first desired site in the genome of the target plant and to be capable of interacting with one or more Cas9 or other CRISPR double-strand nuclease proteins. The second gRNA is designed to anneal to a second desired site in the genome of the target plant and to be capable of interacting with one or more CRISPR nuclease proteins. Each of these gRNAs is operably linked to a promoter operable in plant cells and subsequently cloned into a vector suitable for plant transformation. One or more genes encoding Cas9 or other CRISPR double-strand nuclease proteins are cloned into the vector such that it is operably linked to a promoter operable in plant cells ("CRISPR nuclease cassette"). The CRISPR nuclease cassette and the gRNA cassette are cloned into a single plant transformation vector and subsequently transformed into Agrobacterium cells. These cells are contacted with plant tissue suitable for transformation. After this incubation with Agrobacterium cells, the plant cells are cultured in a tissue culture medium suitable for the regeneration of intact plants while simultaneously selecting against Agrobacterium cells. Alternatively, the vector containing the CRISPR nuclease cassette and the gRNA cassette is coated onto gold or titanium beads suitable for bombardment of plant cells. The cells are bombarded and then transferred to a tissue culture medium suitable for the regeneration of intact plants. The gRNA-CRISPR nuclease complex causes a double-strand break at the desired genomic locus, and in some cases, DNA repair occurs such that some native DNA sequences located near or within the gRNA sequence are deleted. A plant is regenerated from the cells contacted with Agrobacterium cells containing the vector encapsulating the CRISPR nuclease cassette and the gRNA cassette, or from the cells bombarded with beads coated with this vector. After regeneration of the plant, plant tissue is recovered and DNA is extracted from the tissue.Perform a sequencing assay as appropriate to determine whether DNA has been deleted from one or more desired genomic positions.

[0061] Example 8: Genome Editing of the DHS1 Locus in Soybean (Glycine max) Design guide RNAs (gRNAs) to anneal to the selected sites in the soybean genome, enabling interaction with one or more Cas9 or other CRISPR double-strand nuclease proteins. These gRNAs are cloned into a vector and, for example, operably linked to a promoter in plant cells for this gRNA cassette. One or more genes encoding Cas9 or other CRISPR double-strand nuclease proteins are cloned into a vector and, for example, operably linked to a promoter in plant cells for this CRISPR nuclease cassette (CRISPR nuclease cassette). The gRNA and CRISPR nuclease cassettes are cloned into a vector suitable for plant transformation, and subsequently this vector is transformed into Agrobacterium cells. These cells are contacted with soybean tissue suitable for transformation. After incubation with Agrobacterium cells, the soybean cells are cultured in a tissue culture medium suitable for the regeneration of intact plants, with selection against Agrobacterium cells. Soybean plants are regenerated from the cells contacted with Agrobacterium cells containing the vector encapsulating the gRNA and CRISPR nuclease cassettes. After regeneration of the soybean plants, DNA is extracted from the recovered plant tissue. A DNA sequencing assay is performed to determine whether a change has occurred in the DNA sequence at the targeted genomic position.

[0062] Construction of plasmids, gene typing, and plant propagation. As described in Example 5, at least one gRNA will be designed to be internal or proximal to the soybean genomic sequence: DEPVAE (SEQ ID NO: 123) encoding the corresponding 6 - amino - acid hypervariable region of the DHS1 gene in this species. The first step will be to sequence the relevant region of the DHS1 gene in the actual soybean cultivar used for genome editing to confirm the absence of single - nucleotide polymorphism (SNP) that could affect the annealing efficiency of the gRNA. The nucleic acid sequence of the 6 - amino - acid hypervariable region within the soybean (Glycine max) DHS1 gene sequence is GATGAACCCGTAGCTGAG (SEQ ID NO: 124), which, together with the adjacent genomic sequence, will be used to create gRNA sequence candidates. An example of one alternative nucleic acid sequence for creating the gRNA is the non - coding strand gRNA sequence (underlined is the PAM sequence)

Chemical formula

[0063] After plasmid construction, sequence confirmation, and transfer into Agrobacterium vectors and hosts, stable transformation of soybean tissues will be carried out with appropriate selection markers and / or scoring markers. Appropriate hormone - fortified solid media will be used to induce shoot formation and root formation from healthy callus tissue, regenerating T0 soybean plants, and for their progeny, gene typing for target mutations in the DHS1 gene will be performed by next - generation sequencing (NGS) or Sanger sequencing of the PCR - amplified target region using flanking primers.

[0064] In one embodiment, T1 plants in which a soybean DHS1 array deletion has been confirmed will be self-propagated, and for T2 plants, selection will be made as to whether they are, for example, null segregants in which a homozygous DHS1 mutation is present and no transgene is present. The selected T2 plants will be self-propagated, and T3 seeds will be propagated and tested for increased shelf life, increased yield, and / or increased abiotic / biotic stress tolerance compared to wild-type controls.

[0065] Example 9: Genome Editing of the DHS1 Locus in Common Bean (Phaseolus vulgaris) Design guide RNAs (gRNAs) to anneal to the sites of selection in the common bean genome, enabling interaction with one or more Cas9 or other CRISPR double-stranded nuclease proteins. These gRNAs will be cloned into a vector and, for example, operably linked to a promoter in plant cells for this gRNA cassette. One or more genes encoding Cas9 or other CRISPR double-stranded nuclease proteins will be cloned into a vector and, for example, operably linked to a promoter in plant cells for this CRISPR nuclease cassette (CRISPR nuclease cassette). The gRNA and CRISPR nuclease cassette will be cloned into a vector suitable for plant transformation, and subsequently this vector will be transformed into Agrobacterium cells. These cells will be contacted with common bean tissue suitable for transformation. After incubation with Agrobacterium cells, the common bean cells will be cultured in a tissue culture medium suitable for the regeneration of intact plants with selection against Agrobacterium cells. Common bean plants will be regenerated from the cells contacted with Agrobacterium cells containing the vector encapsulating the gRNA and CRISPR nuclease cassette. After the regeneration of common bean plants, DNA will be extracted from the recovered plant tissue. A DNA sequencing assay will be performed to determine whether a change has occurred in the DNA sequence at the targeted genomic location.

[0066] Plasmid construction, genotyping, and plant propagation. As described in Example 5, at least one gRNA will be designed to be internal or proximal to the common bean genomic sequence: DEAVTE (SEQ ID NO: 126) encoding the corresponding 6 amino acid hypervariable region of the DHS1 gene in this species.

[0067] The first step is to sequence the regions associated with the DHS1 gene in the actual adzuki bean cultivar used for genome editing to confirm that there are no single nucleotide polymorphisms (SNPs) that could affect the annealing efficiency of the gRNA. The nucleic acid sequence of the more than 6 - amino - acid variable region within the adzuki bean (Phaseolus vulgaris) DHS1 gene sequence is GATGAAGCCGTGACTGAG (SEQ ID NO: 127), which, together with the adjacent genomic sequence, will be used to create gRNA sequence candidates. An example of an alternative nucleic acid sequence for creating the gRNA is the non - coding strand gRNA sequence (the underlined part is the PAM sequence)

Chemical formula

Chemical formula

[0068] After plasmid construction, sequence confirmation, and transfer into Agrobacterium vectors and hosts, stable transformation of adzuki bean tissue will be carried out with appropriate selection markers and / or scoring markers. Appropriate hormone - fortified solid media will be used to induce shoot formation and root formation from healthy callus tissue, regenerating T0 adzuki bean plants, and for their progeny, genotyping for target mutations in the DHS1 gene will be performed by next - generation sequencing (NGS) or Sanger sequencing of the PCR - amplified target region using flanking primers.

[0069] In one embodiment, T1 plants in which an ingbean DHS1 sequence deletion has been confirmed will be self-pollinated, and for T2 plants, selection will be made as to whether they are, for example, null segregants in which a homozygous DHS1 mutation is present and the transgene is absent. The selected T2 plants will be self-pollinated, and T3 seeds will be propagated and tested for increased shelf life, increased yield, and / or increased abiotic / biotic stress tolerance compared to wild-type controls.

[0070] Example 10: Genome Editing of the DHS1 Locus in Strawberry (Fragaria ananassa) Design guide RNAs (gRNAs) to anneal to the selected sites in the strawberry genome, enabling interaction with one or more Cas9 or other CRISPR double-stranded nuclease proteins. These gRNAs will be cloned into a vector and, for example, operably linked to a promoter in plant cells for this gRNA cassette. One or more genes encoding Cas9 or other CRISPR double-stranded nuclease proteins will be cloned into a vector and, for example, operably linked to a promoter in plant cells for this CRISPR nuclease cassette (CRISPR nuclease cassette). The gRNA and the CRISPR nuclease cassette will be cloned into a vector suitable for plant transformation, and subsequently this vector will be transformed into Agrobacterium cells. These cells will be contacted with strawberry tissue suitable for transformation. After incubation with Agrobacterium cells, the strawberry cells will be cultured in a tissue culture medium suitable for the regeneration of intact plants, with selection against Agrobacterium cells. Strawberry plants will be regenerated from the cells contacted with Agrobacterium cells containing the vector encapsulating the gRNA and the CRISPR nuclease cassette. After the regeneration of strawberry plants, DNA will be extracted from the recovered plant tissue. A DNA sequencing assay will be performed to determine whether a change has occurred in the DNA sequence at the targeted genomic location.

[0071] Plasmid construction, genotyping, and plant propagation. As described in Example 5, at least one gRNA will be designed to be internal or proximal to the strawberry genomic sequence: DEAVAD (SEQ ID NO: 130) encoding the corresponding 6 amino acid hypervariable region of the DHS1 gene in this species.

[0072] The first step would be to sequence the regions associated with the DHS1 gene in the actual strawberry cultivar used for genome editing to confirm the absence of single nucleotide polymorphisms (SNPs) that could affect the annealing efficiency of the gRNA. The nucleic acid sequence of the more than 6 - amino - acid variable region within the Fragaria ananassa DHS1 gene sequence is GATGAGGCTGTAGCTGAC (SEQ ID NO: 131), which, together with the adjacent genomic sequence, will be used to create candidate gRNA sequences. An example of an alternative nucleic acid sequence for creating the gRNA is the coding - strand gRNA sequence (the underlined part is the PAM sequence)

Chemical formula

[0073] After plasmid construction, sequence confirmation, and transfer into Agrobacterium vectors and hosts, stable transformation of strawberry tissue will be carried out with appropriate selection markers and / or scoring markers. Appropriate hormone - fortified solid media will be used to induce shoot formation and root formation from healthy callus tissue, regenerating T0 strawberry plants, and for their progeny, genotyping for target mutations in the DHS1 gene will be performed by next - generation sequencing (NGS) or Sanger sequencing of the PCR - amplified target region using flanking primers.

[0074] In one embodiment, T1 plants in which strawberry DHS1 sequence deletions have been confirmed will be self - pollinated, and for T2 plants, selection will be made as to whether they are, for example, null segregants that have homozygous DHS1 mutations and no transgenes. The selected T2 plants will be self - pollinated, and T3 seeds will be propagated and tested for increased shelf - life, increased yield, and / or increased abiotic / biotic stress tolerance compared to wild - type controls.

[0075] Example 11: Genome Editing of the DHS1 Locus in Bell Pepper (Capsicum annuum) A guide RNA (gRNA) is designed to anneal to the site of selection in the bell pepper genome, enabling interaction with one or more Cas9 or other CRISPR double-stranded nuclease proteins. These gRNAs are cloned into a vector and, for example, operably linked to a promoter in plant cells for this gRNA cassette. One or more genes encoding Cas9 or other CRISPR double-stranded nuclease proteins are cloned into a vector and, for example, operably linked to a promoter in plant cells for this CRISPR nuclease cassette (CRISPR nuclease cassette). The gRNA and CRISPR nuclease cassette are cloned into a vector suitable for plant transformation, and subsequently this vector is transformed into Agrobacterium cells. These cells are contacted with bell pepper tissue suitable for transformation. After incubation with Agrobacterium cells, the bell pepper cells are cultured in a tissue culture medium suitable for the regeneration of intact plants, with selection against Agrobacterium cells. Bell pepper plants are regenerated from the cells contacted with Agrobacterium cells containing the vector encapsulating the gRNA and CRISPR nuclease cassette. After the regeneration of bell pepper plants, DNA is extracted from the recovered plant tissue. A DNA sequencing assay is performed to determine whether a change has occurred in the DNA sequence at the targeted genomic location.

[0076] Construction of plasmids, genotyping, and propagation of plants. As described in Example 5, at least one gRNA is designed to be internal or proximal to the bell pepper genomic sequence: HEVPTE (SEQ ID NO: 133) encoding the corresponding 6 amino acid hypervariable region of the DHS1 gene in this species.

[0077] The first step is to sequence the relevant region of the DHS1 gene in the actual cultivated pepper varieties used for genome editing to confirm that there are no single nucleotide polymorphisms (SNPs) that could affect the annealing efficiency of the gRNA. The nucleic acid sequence of the more than 6 - amino - acid variable region within the Capsicum annuum DHS1 gene sequence is CATGAGGTTCCTACTGAG (SEQ ID NO: 134), which, together with the adjacent genomic sequence, will be used to create candidate gRNA sequences. An example of an alternative nucleic acid sequence for creating the gRNA is the coding - strand gRNA sequence (underlined is the PAM sequence) TTCACATGAGGTTCCTACTGAGG (SEQ ID NO: 135). Another example of an alternative nucleic acid sequence for creating the gRNA is the non - coding - strand gRNA sequence (underlined is the PAM sequence)

Chemical formula

[0078] After plasmid construction, sequence confirmation, and transfer into Agrobacterium vectors and hosts, stable transformation of pepper tissue will be carried out with appropriate selection markers and / or scoring markers. Appropriate hormone - fortified solid media will be used to induce shoot formation and root formation from healthy callus tissue, regenerate T0 pepper plants, and for their progeny, genotyping for target mutations in the DHS1 gene will be performed by next - generation sequencing (NGS) or Sanger sequencing of the PCR - amplified target region using adjacent primers.

[0079] In one embodiment, T1 plants in which a capsicum DHS1 sequence deletion has been confirmed will be self-propagated, and for T2 plants, selection will be made as to whether they are, for example, null segregant individuals in which a homozygous DHS1 mutation is present and no transgene is present. The selected T2 plants will be self-propagated, and T3 seeds will be propagated and tested as to whether they have increased shelf life, increased yield, and / or increased abiotic / biotic stress tolerance compared to wild-type controls.

[0080] Example 12: Genome Editing of the DHS1 Locus in Zucchini (Cucurbita pepo) Design guide RNAs (gRNAs) to anneal to the selected sites in the zucchini genome, enabling interaction with one or more Cas9 or other CRISPR double-stranded nuclease proteins. These gRNAs will be cloned into vectors and, for example, operably linked to a promoter in plant cells for this gRNA cassette. One or more genes encoding Cas9 or other CRISPR double-stranded nuclease proteins will be cloned into a vector and, for example, operably linked to a promoter in plant cells for this CRISPR nuclease cassette (CRISPR nuclease cassette). The gRNA and the CRISPR nuclease cassette will be cloned into a vector suitable for plant transformation, and subsequently this vector will be transformed into Agrobacterium cells. These cells will be contacted with zucchini tissue suitable for transformation. After incubation with Agrobacterium cells, the zucchini cells will be cultured in a tissue culture medium suitable for the regeneration of intact plants with selection against Agrobacterium cells. Zucchini plants will be regenerated from the cells contacted with Agrobacterium cells containing the vector encapsulating the gRNA and the CRISPR nuclease cassette. After the regeneration of zucchini plants, DNA will be extracted from the recovered plant tissue. A DNA sequencing assay will be performed to determine whether a change has occurred in the DNA sequence at the targeted genomic location.

[0081] Plasmid construction, genotyping, and plant propagation. As described in Example 5, at least one gRNA will be designed to be internal or proximal to the zucchini genomic sequence: DENITE (SEQ ID NO: 137) encoding the corresponding 6 amino acid hypervariable region of the DHS1 gene in this species.

[0082] The first step would be to sequence the relevant regions of the DHS1 gene in the actual zucchini cultivar used for genome editing to confirm the absence of single nucleotide polymorphisms (SNPs) that could affect the annealing efficiency of the gRNA. The nucleic acid sequence of the more than 6 amino acid variable region within the Cucurbita pepo DHS1 gene sequence is [Chemical Formula] and, together with the adjacent genomic sequence, will be used to create gRNA sequence candidates. An example of an alternative nucleic acid sequence for creating the gRNA is the coding strand gRNA sequence (the underline is the PAM sequence) [Chemical Formula] is.

[0083] After plasmid construction, sequence confirmation, and transfer into Agrobacterium vectors and hosts, stable transformation of zucchini tissue will be carried out with appropriate selection markers and / or scoring markers. Appropriate hormone-enhanced solid media will be used to induce shoot formation and root formation from healthy callus tissue, regenerating T0 zucchini plants, and for their progeny, genotyping will be performed for target mutations in the DHS1 gene by next-generation sequencing (NGS) or Sanger sequencing of the PCR-amplified target region using adjacent primers.

[0084] In one embodiment, T1 plants in which zucchini DHS1 sequence deletions have been confirmed will be self-pollinated, and for T2 plants, selection will be carried out regarding whether there are homozygous DHS1 mutations and no transgenes, for example, null segregants. The selected T2 plants will be self-pollinated, and T3 seeds will be propagated and tested regarding whether they have increased shelf life, increased yield, and / or increased abiotic / biotic stress tolerance compared to wild-type controls.

[0085] Example 13: Genome Editing of the DHS1 Locus in Potato (Solanum tuberosum) Guide RNAs (gRNAs) are designed to anneal to the site of selection in the potato genome and will enable interaction with one or more Cas9 or other CRISPR double-stranded nuclease proteins. These gRNAs are cloned into vectors and, for example, will be operably linked to a promoter in plant cells of this gRNA cassette. One or more genes encoding Cas9 or other CRISPR double-stranded nuclease proteins are cloned into vectors and, for example, will be operably linked to a promoter in plant cells of this CRISPR nuclease cassette (CRISPR nuclease cassette). The gRNA and CRISPR nuclease cassettes will be cloned into a vector suitable for plant transformation, and subsequently this vector will be transformed into Agrobacterium cells. These cells will be contacted with potato tissue suitable for transformation. After incubation with Agrobacterium cells, the potato cells will be cultured in a tissue culture medium suitable for the regeneration of intact plants, with selection against Agrobacterium cells. Potato plants will be regenerated from cells that have been contacted with Agrobacterium cells containing the vector encapsulating the gRNA and CRISPR nuclease cassettes. After the regeneration of potato plants, DNA will be extracted from the recovered plant tissue. A DNA sequencing assay will be performed to determine whether a change has occurred in the DNA sequence at the targeted genomic location.

[0086] Construction of plasmids, genotyping, and propagation of plants. As described in Example 5, at least one gRNA will be designed to be internal or proximal to the potato genomic sequence: HELLME (SEQ ID NO: 140) encoding the corresponding 6 amino acid hypervariable region of the DHS1 gene in this species.

[0087] The first step is to sequence the region associated with the DHS1 gene in the actual potato cultivar used for genome editing to confirm that there are no single nucleotide polymorphism (SNP) that can affect the annealing efficiency of the gRNA. The nucleic acid sequence of the more than 6 amino acid variable region within the Solanum tuberosum DHS1 gene sequence is

Chemical formula

Chemical formula

Chemical formula

[0088] After plasmid construction, sequence confirmation, and transfer into Agrobacterium vectors and hosts, stable transformation of potato tissue will be carried out with appropriate selection markers and / or scoring markers. Appropriate hormone-enriched solid media will be used to induce shoot formation and root formation from healthy callus tissue, regenerating T0 potato plants, and for their progeny, genotyping for target mutations in the DHS1 gene will be performed by next-generation sequencing (NGS) or Sanger sequencing of the PCR-amplified target region using flanking primers.

[0089] In one embodiment, T1 plants in which the potato DHS1 array deletion has been confirmed will be self-propagated, and for T2 plants, selection will be made as to whether they are, for example, null segregants that have a homozygous DHS1 mutation and no transgene. The selected T2 plants will be self-propagated, and the T3 seeds will be propagated and tested for increased shelf life, increased yield, and / or increased abiotic / biotic stress tolerance compared to wild-type controls.

[0090] Example 14: Genome Editing of the DHS1 Locus in Rice (Oryza sativa japonica) Design guide RNAs (gRNAs) to anneal to the selected sites in the rice genome, enabling interaction with one or more Cas9 or other CRISPR double-stranded nuclease proteins. These gRNAs will be cloned into a vector and, for example, operably linked to a promoter in plant cells for this gRNA cassette. One or more genes encoding Cas9 or other CRISPR double-stranded nuclease proteins will be cloned into a vector and, for example, operably linked to a promoter in plant cells for this CRISPR nuclease cassette (CRISPR nuclease cassette). The gRNA and the CRISPR nuclease cassette will be cloned into a vector suitable for plant transformation, and subsequently this vector will be transformed into Agrobacterium cells. These cells will be brought into contact with rice tissue suitable for transformation. After incubation with Agrobacterium cells, the rice cells will be cultured in a tissue culture medium suitable for the regeneration of intact plants, with selection against Agrobacterium cells. Rice plants will be regenerated from the cells that have been in contact with Agrobacterium cells containing the vector encompassing the gRNA and the CRISPR nuclease cassette. After the regeneration of rice plants, DNA will be extracted from the recovered plant tissue. A DNA sequencing assay will be performed to determine whether a change has occurred in the DNA sequence at the targeted genomic location.

[0091] Plasmid construction, gene typing, and plant propagation. As described in Example 5, at least one gRNA will be designed to be internal or proximal to the rice genomic sequence: HEKPRE (SEQ ID NO: 144) encoding the corresponding 6 amino acid hypervariable region of the DHS1 gene in this species.

[0092] The first step is to sequence the relevant regions of the DHS1 gene in the actual rice cultivar used for genome editing to confirm that there are no single nucleotide polymorphisms (SNPs) that can affect the annealing efficiency of the gRNA. The nucleic acid sequence of the more than 6 amino acid variable region within the Oryza sativa japonica DHS1 gene sequence is CACGAGAAGCCACGTGAG (SEQ ID NO: 145), which, together with the adjacent genomic sequence, will be used to create gRNA sequence candidates. An example of the nucleic acid sequence for creating a gRNA on the coding strand (the underline is the PAM sequence) is

Chemical formula

Chemical formula

[0093] After plasmid construction, sequence confirmation, and transfer into Agrobacterium vectors and hosts, stable transformation of rice tissues will be carried out with appropriate selection markers and / or scoring markers. Appropriate hormone-enriched solid media will be used to induce shoot formation and root formation from healthy callus tissues, regenerating T0 rice plants, and for their progeny, genotyping will be performed for target mutations in the DHS1 gene by next-generation sequencing (NGS) or Sanger sequencing of the PCR-amplified target region using adjacent primers.

[0094] In one embodiment, the T1 plants in which the DHS1 array deletion was confirmed will be self-propagated, and for the T2 plants, selection will be made as to whether they are, for example, null segregants in which a homozygous DHS1 mutation is present and the transgene is absent. The selected T2 plants will be self-propagated, and the T3 seeds will be propagated and tested as to whether they have increased shelf life, increased yield, and / or increased abiotic / biotic stress tolerance compared to the wild-type control.

[0095] Example 15: Genome Editing of the DHS1 Locus in Sorghum (Sorghum bicolor) Design guide RNAs (gRNAs) to anneal to the selected sites in the sorghum genome, enabling interaction with one or more Cas9 or other CRISPR double-stranded nuclease proteins. These gRNAs will be cloned into a vector and, for example, operably linked to a promoter in plant cells for this gRNA cassette. One or more genes encoding Cas9 or other CRISPR double-stranded nuclease proteins will be cloned into a vector and, for example, operably linked to a promoter in plant cells for this CRISPR nuclease cassette (CRISPR nuclease cassette). The gRNA and CRISPR nuclease cassette will be cloned into a vector suitable for plant transformation, and subsequently this vector will be transformed into Agrobacterium cells. These cells will be contacted with sorghum tissue suitable for transformation. After incubation with Agrobacterium cells, the sorghum cells will be cultured in a tissue culture medium suitable for the regeneration of intact plants, with selection against Agrobacterium cells. Sorghum plants will be regenerated from the cells contacted with Agrobacterium cells containing the vector encapsulating the gRNA and CRISPR nuclease cassette. After regeneration of the sorghum plants, DNA will be extracted from the recovered plant tissue. A DNA sequencing assay will be performed to determine whether a change has occurred in the DNA sequence at the targeted genomic location.

[0096] Plasmid construction, genotyping, and plant propagation. As described in Example 5, at least one gRNA will be designed to be internal or proximal to the sorghum genomic sequence: HEKPSE (SEQ ID NO: 148) encoding the corresponding 6 amino acid hypervariable region of the DHS1 gene in this species.

[0097] The first step would be to sequence the regions associated with the DHS1 gene in the actual sorghum cultivars used for genome editing to confirm that there are no single nucleotide polymorphisms (SNPs) that could affect the annealing efficiency of the gRNA. The nucleic acid sequence of the more than 6 amino acid hypervariable region within the sorghum (Sorghum bicolor) DHS1 gene sequence is CATGAGAAGCCCAGTGAG (SEQ ID NO: 149), which, together with the adjacent genomic sequence, will be used to generate gRNA sequence candidates. Examples of two alternative nucleic acid sequences for generating the gRNA are the coding strand gRNA sequence (underlined is the PAM sequence)

Chem.

Chem.

[0098] After plasmid construction, sequence confirmation, and transfer into Agrobacterium vectors and hosts, stable transformation of sorghum tissue will be carried out with appropriate selection markers and / or scoring markers. Appropriate hormone-enriched solid media will be used to induce shoot formation and root formation from healthy callus tissue, regenerating T0 sorghum plants, and for their progeny, genotyping for target mutations in the DHS1 gene will be performed by next-generation sequencing (NGS) or Sanger sequencing of the PCR-amplified target region using flanking primers.

[0099] In one embodiment, T1 plants in which a sorghum DHS1 sequence deletion has been confirmed will be self-pollinated, and for T2 plants, selection will be carried out as to whether they are, for example, null segregants with a homozygous DHS1 mutation and no transgene. The selected T2 plants will be self-pollinated, and the T3 seeds will be propagated and tested for increased shelf life, increased yield, and / or increased abiotic / biotic stress tolerance compared to wild-type controls.

[0100] Example 16: Genome Editing of the DHS1 Locus in Rosa chinensis A guide RNA (gRNA) is designed to anneal to the selected site in the rose genome, enabling interaction with one or more Cas9 or other CRISPR double-stranded nuclease proteins. These gRNAs are cloned into a vector and, for example, operably linked to a promoter in plant cells for this gRNA cassette. One or more genes encoding Cas9 or other CRISPR double-stranded nuclease proteins are cloned into a vector and, for example, operably linked to a promoter in plant cells for this CRISPR nuclease cassette (CRISPR nuclease cassette). The gRNA and CRISPR nuclease cassette are cloned into a vector suitable for plant transformation, and subsequently this vector is transformed into Agrobacterium cells. These cells are contacted with rose tissue suitable for transformation. After incubation with Agrobacterium cells, the rose cells are cultured in a tissue culture medium suitable for the regeneration of intact plants, with selection against Agrobacterium cells. Rose plants are regenerated from the cells contacted with Agrobacterium cells containing the vector encapsulating the gRNA and CRISPR nuclease cassette. After regeneration of the rose plants, DNA is extracted from the recovered plant tissue. A DNA sequencing assay is performed to determine whether a change has occurred in the DNA sequence at the targeted genomic position.

[0101] Construction of plasmids, genotyping, and propagation of plants. As described in Example 5, at least one gRNA is designed to be internal or proximal to the rose genome sequence: DEAVAE (SEQ ID NO: 152) encoding the corresponding 6 amino acid hypervariable region of the DHS1 gene in this species.

[0102] The first step is to sequence the regions associated with the DHS1 gene in the actual rose cultivars used for genome editing to confirm that there are no single nucleotide polymorphism (SNP) that can affect the annealing efficiency of the gRNA. The nucleic acid sequence of the more than 6 amino acid variable region within the Rosa chinensis DHS1 gene sequence is GATGAGGCTGTAGCTGAG (SEQ ID NO: 153), which, together with the adjacent genomic sequence, will be used to create candidate gRNA sequences. Two examples of nucleic acid sequences for creating gRNA on the coding strand (the underlined part is the PAM sequence) are

Chemical formula

Chemical formula

[0103] After plasmid construction, sequence confirmation, and transfer into Agrobacterium vectors and hosts, stable transgenic tissues of roses will be carried out with appropriate selection markers and / or scoring markers. Appropriate hormone-enriched solid media will be used to induce shoot formation and root formation from healthy callus tissues, regenerate T0 rose plants, and for their progeny, genotype for target mutations in the DHS1 gene by next-generation sequencing (NGS) or Sanger sequencing of the PCR-amplified target regions using adjacent primers.

[0104] In one embodiment, T1 plants in which the DHS1 array deletion has been confirmed will be self-propagated, and for T2 plants, selection will be made as to whether they are, for example, null segregants in which a homozygous DHS1 mutation is present and the transgene is absent. The selected T2 plants will be self-propagated, and the T3 seeds will be propagated and tested as to whether they have an increased shelf life, increased yield, and / or increased abiotic / biotic stress tolerance compared to the wild-type control.

Claims

1. A method for producing a plant body with delayed aging compared to a wild-type control plant body, including inducing at least one nucleotide substitution in at least one copy of the gene encoding deoxyhypusine synthase (DHS) in the plant body, for at least one amino acid selected from the group consisting of H76, E77, L78, P79, T80, E81 of SEQ ID NO: 106 or the codon of the corresponding amino acid in another plant species, and due to the nucleotide substitution, the activity of DHS encoded by the gene in the plant body is reduced compared to the activity of DHS in the wild-type control plant body, so that aging is delayed.

2. Due to the delay of the aging, a) the seed yield in the plant body increases compared to the wild-type control plant body, b) the leaf and root biomass increases compared to the wild-type control plant body, c) the survival of the plant body when under drought or nutritional stress is improved compared to the wild-type control plant body, d) the disease resistance of the plant body increases compared to the wild-type control plant body; and / or e) the period during which the leaves, stems, seeds and fruits of the plant body can be stored and remain suitable for use increases compared to the wild-type control plant body, The method according to claim 1.

3. The method according to claim 1 or 2, wherein the plant body is a haploid, diploid or polyploid.

4. The method according to any one of claims 1 to 3, including inducing at least one nucleotide substitution in at least two copies of the gene encoding DHS in the plant body.

5. The method according to any one of claims 1 to 4, wherein the aging is age-related aging.

6. The method according to any one of claims 1 to 5, wherein the aging is environmental stress-induced aging.

7. The method according to any one of claims 1 to 6, wherein the aging is plant pathogen-induced aging.

8. A plant body produced by the method according to any one of claims 1 to 7.

9. A progeny of the plant body according to any one of claims 1 to 8, including the nucleotide substitution.

10. The method according to any one of claims 1 to 9, wherein the plant body is selected from the group consisting of peanut (Arachis hypogaea), sugar beet (Beta vulgaris), rapeseed (Brassica napus), Brassica rapa, camelina (Camelina sativa), tea plant (Camellia sinensis), hemp (Cannabis sativa), chili pepper (Capsicum anuum), chickpea (Cicer arietinum), robusta coffee tree (Coffea canephora), zucchini (Cucurbita pepo), strawberry (Fragaria ananassa), soybean (Glycine max), cotton (Gossypium hirsutum), lettuce (Lactuca sativa), cassava (Manihot esculenta), alfalfa (Medicago sativa), long-leaved mint (Mentha longifolia), banana (Musa acuminate), rice (Oryza sativa), Phalaenopsis equestris, common bean (Phaseolus vulgaris), American poplar (Populus deltoides), Chinese rose (Rosa chinensis), tomato (Solanum lycopersicum), potato (Solanum tuberosum), sorghum (Sorghum bicolor), cocoa (Theobroma cacao), wheat (Triticum aestivum), fox grape (Vitis labrusca), European grape (Vitis vinifera), corn (Zea mays).

11. A method for producing a plant body with delayed aging compared to a wild-type control plant body, comprising inducing at least one nucleotide deletion or insertion in at least one copy of the gene encoding deoxyhypusine synthase (DHS) in the plant body, at least one amino acid selected from the group consisting of H76, E77, L78, P79, T80, E81 of SEQ ID NO: 106, or the codon of the corresponding amino acid in another plant species, wherein the nucleotide deletion or insertion reduces the activity of DHS encoded by the gene in the plant body compared to the activity of DHS in the wild-type control plant body, thereby delaying aging, and the plant body contains at least one copy of the gene encoding DHS without the deletion or insertion.

12. Due to the delay of the aging, a) the seed yield in the plant body increases compared to the wild-type control plant body, b) the leaf and root biomass increases compared to the wild-type control plant body, c) the survival of the plant body when under drought or nutrient stress is improved compared to the wild-type control plant body, d) the disease resistance of the plant body increases compared to the wild-type control plant body, and / or e) the period during which the leaves, stems, seeds and fruits of the plant body can be stored and remain suitable for use increases compared to the wild-type control plant body. The method according to claim 11.

13. The method according to claim 11 or 12, wherein the plant body is haploid, diploid, or polyploid.

14. The method according to any one of claims 11 to 13, wherein the aging is age-related aging.

15. The method according to any one of claims 11 to 14, wherein the aging is environmentally stress-induced aging.

16. The method according to any one of claims 11 to 15, wherein the aging is plant pathogen-induced aging.

17. A plant body produced by the method according to any one of claims 11 to 16.

18. A progeny of the plant body according to any one of claims 11 to 17, which progeny contains the nucleotide deletion or insertion.

19. The method according to any one of claims 11 to 18, wherein the plant body is selected from the group consisting of peanut (Arachis hypogaea), sugar beet (Beta vulgaris), rapeseed (Brassica napus), Brassica rapa, camelina (Camelina sativa), tea plant (Camellia sinensis), hemp (Cannabis sativa), chili pepper (Capsicum anuum), chickpea (Cicer arietinum), robusta coffee tree (Coffea canephora), zucchini (Cucurbita pepo), strawberry (Fragaria ananassa), soybean (Glycine max), cotton (Gossypium hirsutum), lettuce (Lactuca sativa), cassava (Manihot esculenta), alfalfa (Medicago sativa), long-leaved mint (Mentha longifolia), banana (Musa acuminate), rice (Oryza sativa), phalaenopsis (Phalaenopsis equestris), common bean (Phaseolus vulgaris), eastern cottonwood (Populus deltoides), Chinese rose (Rosa chinensis), tomato (Solanum lycopersicum), potato (Solanum tuberosum), sorghum (Sorghum bicolor), cocoa (Theobroma cacao), wheat (Triticum aestivum), fox grape (Vitis labrusca), European grape (Vitis vinifera), corn (Zea mays).