Humanized antibody against tumor antigen or its functional fragment
Humanized antibodies with modified CDRs address the limitations of existing STn-targeting antibodies by enhancing binding affinity and specificity, improving therapeutic efficacy and safety for cancer treatment.
Patent Information
- Application Number
- JP2024573925
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-24
- Filing Date
- 2023-06-26
- Publication Date
- 2025-07-23
AI Technical Summary
Existing antibodies targeting sialyl Tn (STn) antigens in cancer cells have limitations in binding affinity, specificity, and immunogenicity, which affect their therapeutic efficacy and safety in human patients.
Development of humanized antibodies with modified complementarity determining regions (CDRs) through affinity maturation, resulting in high-affinity and specific binding to STn antigens, reducing immunogenicity and improving therapeutic window.
The humanized antibodies exhibit enhanced binding affinity and specificity to STn antigens, potentially increasing tumor uptake and anti-tumor response, and reducing the risk of human anti-drug antibody responses.
Smart Images

Figure 2025523455000002 
Figure 2025523455000003 
Figure 2025523455000004
Abstract
Description
Technical Field
[0001] The present invention relates to a humanized antibody or a functional antibody fragment thereof, or a probe thereof, against a group of antigens identified in cancer.
Background Art
[0002] Sialyl Tn (STn) is a short O-glycan antigen, which is a disaccharide consisting of sialic acid linked to N-acetylgalactosamine, i.e., Neu5Acα-2,6GalNAc, and is O-linked to the amino acid residues of serine or threonine in the α-configuration via a GalNAc residue in the polypeptide chain. This shortened glycan has been detected at different frequencies in different types of carcinomas (Julian, Videira, & Delannoy 2012), but is not present in normal healthy tissues. In addition, STn serves as a target for metastatic, drug-resistant, and highly malignant tumors. In this type of tumor, these characteristics are as follows. 1) Association of STn expression with primary and metastatic cancer cells (Okasaki et al., 2012) 2) Correlation between increased STn expression in patients and poor prognosis, shortened overall survival, and lack of response to chemotherapy (Choi et al., 2000) 3) Avoidance of immune cell surveillance (Carrascal et al., 2014)
[0003] α-2,6 Sialic acid is typically a truncated cancer biomarker. Short α2,6-sialylated O-glycans are overexpressed in several types of cancer. They are generally involved in cancer progression and metastasis. In addition, shortened glycans have been reported to contribute to immune evasion by being recognized by several immune receptors such as sialic acid-binding proteins (Siglecs) (Crocke, Paulson, & Varkl, 2007; Micoll et al., 2003).
[0004] The present invention further provides an antibody, a functional antibody fragment thereof, or a probe thereof that specifically binds to these cancer biomarkers. In addition to the specific identification of tumor cells, these antibodies also have the potential to block the recognition of such ligands by host cell receptors involved in the mechanisms underlying tumor progression, including immune tolerance.
[0005] Several antibodies have been approved for treating cancer patients (see, for example, https: / / www.cancer.org), and further details of these and additional background to the present invention can be found in WO 2019 / 147152.
[0006] WO 2019 / 147152 describes nucleotide sequences encoding monoclonal antibodies (mAbs) against STn and the group of glycans terminally linked with α-2,6-linked sialic acid. These antigens are short-chain glycans that are overexpressed in cancer but not expressed by normal cells.
Prior Art Documents
Patent Documents
[0007]
Patent Document 1
Non-Patent Documents
[0008]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
Non-Patent Document 4
Non-Patent Document 5
Non-Patent Document 6
Non-Patent Document 7
Summary of the Invention
Means for Solving the Problems
[0009] In a broad aspect, according to the present invention, there is provided an antibody or a fragment thereof or a probe thereof, wherein the antibody or fragment or probe is (a) a heavy chain variable region (VH), wherein (i) H-CDR1, H-CDR2, and H-CDR3 respectively shown in any one of SEQ ID NOs: 1 to 24 or 49 to 88 the VH comprising a complementarity determining region (CDR) selected from the group consisting of and / or (b) a light chain variable region (VL), wherein (i) L-CDR1, L-CDR2, and L-CDR3 respectively shown in any one of SEQ ID NOs: 25 to 48 or 89 to 128 the VL comprising a complementarity determining region (CDR) selected from the group consisting of An antibody or a fragment thereof or a probe thereof is provided.
[0010] The fragment can be a functional antibody fragment of the disclosed antibody, i.e., it can retain the ability to bind to an antigen. The antibodies, fragments or probes described herein can specifically bind to the sialyl Tn (STn) antigen. Suitably, the antibody, fragment or probe is a humanized antibody, fragment or probe and is thus suitable for application in human patients. The antibody, fragment or probe can be, for example, an affinity matured humanized antibody, fragment or probe.
[0011] In one aspect, the antibody or fragment thereof may include a heavy chain variable region (VH) and a light chain variable region (VL). A constant region may also be provided, as will be appreciated.
[0012] Accordingly, in one aspect, the present invention provides, essentially, a modified antibody having amino acid changes in the chimeric L2A5 framework region described in WO 2019 / 147152 for humanizing it. The main scope of humanization is to modify antibodies derived from non-human species, the protein sequences of which are modified to increase their similarity to antibodies normally produced in humans. The inventors have discovered and generated humanized L2A5 variants that show a decrease in immunogenicity and, moreover, maintain binding and specificity to STn, as disclosed in the present application.
[0013] In a further aspect, the present invention also describes additional modified antibodies based on the humanized variant, designated V1 in the present application. Through the process of affinity maturation, different point mutations were introduced into the CDRs, which enabled the inventors to create variants with a higher binding affinity to STn. As disclosed in the present application, some antibody variants showed an increase in binding to STn+ cell lines and BSM mucin without any associated binding to other glycans.
[0014] The present application generally describes the generation of humanized antibodies that recognize STn with moderate to high affinity and high specificity, which are features that are not generally predictable in advance. The humanized clones may also potentially have reduced immunogenicity, which reduces the chance of a human anti-drug antibody (HAMA) response, increases the therapeutic window, and improves the PK profile of the antibody.
[0015] Furthermore, the present application describes the development of high-affinity humanized anti-STn antibodies by the process of affinity maturation. For certain therapeutic applications, it is desired to have antibodies with high affinity for the target antigen, and thus improve the anti-tumor response.
[0016] The inventors have herein found a method for improving the affinity and binding of antibodies to the target sialyl Tn (STn) by creating new antibodies. These relate to the clones described in the patent of WO 2019147152A1 pamphlet. In particular, the inventors have provided several different humanized antibody clones, including the humanized clones referred to herein using the acronym V1. In particular, using this humanized V1 clone, the inventors have also provided herein a series of new and different antibodies resulting from the affinity maturation process. These new clones or variants have differences in amino acid sequences as well as increased affinity and binding to the target sialyl Tn (STn), and thus are substantially improved over known antibodies.
[0017] Accordingly, the present application describes high-affinity humanized anti-STn antibodies obtained by the process of affinity maturation. For certain applications, it is highly desired to have antibodies with high affinity for the target antigen and improve the anti-tumor response. For example, this may enable: - Antibody-drug conjugates or radioimmunoconjugates with increased tumor uptake and anti-tumor function - Fine-tuning of bispecific T cell engagers and CAR receptors to induce desired levels of T cell activation - Improvement of in vivo STn blockade to bring about an anti-tumor response by restoring the function of immune cells. BRIEF DESCRIPTION OF THE DRAWINGS
[0018]
Figure 1-1
Figure 1-3
Figure 2
Figure 3a
Figure 3b
Figure 4
Figure 5
Figure 6a-1
Figure 6a-2
Figure 6b-1
Figure 6b-2
Figure 7-1
Figure 7-5
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12A
Figure 12B
Figure 13A
Figure 13D
Figure 14
Figure 15
Figure 16
Figure 17
Figure 18
Figure 19
Figure 20a
Figure 20b
BEST MODE FOR CARRYING OUT THE INVENTION
[0019] It will be understood that a monoclonal antibody (mAb) refers to an antibody produced by a single B cell clone. mAbs can also be produced by hybridomas, which are hybrids between B cells and myeloma cells, or cell lines that express recombinant DNA encoding the immunoglobulin heavy and light chains, and thus produce a single specific antibody.
[0020] Antibodies can be expressed in the extracellular environment and then purified from them.
[0021] The specificity of an antibody is its ability to react with one antigen or a group of antigens sharing a particular epitope. An epitope, also known as an antigenic determinant, is the part of the antigen recognized by the antibody.
[0022] Antibodies belong to the protein immunoglobulin class, which typically consists of a collection of two identical heavy chains (approximately 50 - 70 kDa) and two identical light chains (approximately 25 kDa). At the amino terminus of each heavy or light chain, there is a sequence of 100 - 130 amino acids encoding the variable region. At the carboxyl terminus of each heavy or light chain, there is a sequence encoding the constant region. Typically, each antibody is bivalent, i.e., it binds to the same antigen.
[0023] An antigen-binding fragment (Fab) is an antibody fragment that binds to an antigen. Each Fab is composed of one constant domain and one variable domain derived from each of the heavy and light chains of the antibody. The fragment crystallizable (Fc) region is composed of the two or three carboxy-terminal domains of the two heavy chains. Fab ensures binding to the antigen, while the Fc region ensures that each antibody elicits an effector immune response. The Fc region binds to various cell receptors such as Fc receptors and other molecules such as complement proteins, and mediates different physiological effects including opsonization that facilitates phagocytosis by phagocytes, cell lysis by natural killer cells, and degranulation of mast cells, basophils, and eosinophils.
[0024] The term "variable domain" or "variable region" refers to the amino-terminal portion of the light or heavy chain of an antibody that interacts with an antigen. This typically has a length of about 120-130 amino acids in the heavy chain and about 100-110 amino acids in the light chain. The sequence of each variable region is substantially altered particularly in the complementarity-determining regions (CDRs) that are responsible for the interaction with a specific antigen. The CDRs are adjacent to the relatively unaltered framework regions (FRs). Typically, there are three CDRs in each of the light and heavy chains. Thus, for example, CDR L1, L2, and L3 are within the light chain and CDR H1, H2, and H3 are within the heavy chain.
[0025] The expression "functional antibody fragment or probe" appropriately refers to a portion of an antibody that contains the variable regions of the heavy and light chains of the antibody, or either the variable region of the heavy chain or the variable region of the light chain of the antibody. For example, a functional antibody fragment or probe retains most or all of the binding activity of the original antibody from which the fragment or probe is derived. Such functional antibody fragments or probes can include, for example, single-chain Fv (scFv), diabody, triabody, tetrabody, and minibody.
[0026] As used herein, the term "fragment" specifically relates to fragments of the described specific antibodies, and it will be recognized that these form important aspects of the present disclosure. In this way, the monoclonal or recombinant antibodies provided by the present disclosure can be, for example, the following fragments: (i) a Fab fragment consisting of VL, VH, CL, and CH1 domains; (ii) an Fd fragment consisting of VH and CH1 domains; (iii) an Fv fragment consisting of VL and VH domains; (iv) a dAb fragment consisting of a VH domain; (v) an isolated CDR region; (vi) an F(ab')2 fragment, which is a bivalent fragment containing two linked Fab fragments; and (vii) a single-chain Fv molecule (scFv), where the VH domain and the VL domain are linked by a peptide linker that allows the two domains to associate to form an antigen-binding site.
[0027] Alternatively, as understood, the antibodies according to the present disclosure may include whole IgG antibodies, whereby the antibodies include a variable region and a constant region.
[0028] The term "nucleotide sequence" refers to a sequence of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
[0029] As understood, the nucleotide sequence can be transcribed to produce mRNA, which is then translated into a polypeptide and / or a fragment thereof.
[0030] Further aspects of the invention are described herein. In a preferred aspect, the antibody or fragment or probe has the following pairs of heavy-chain CDRs and light-chain CDRs: The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 1 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 25; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 2 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 26; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 3 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 27; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 4 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 28; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 5 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 29; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 6 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 30; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 7 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 31; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 8 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 32; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 9 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 33; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 10 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 34; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 11 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 35; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 12 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 36; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 13 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 37; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in Sequence No. 14 and L-CDR1, L-CDR2, and L-CDR3 shown in Sequence No. 38; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 15 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 39; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 16 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 40; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 17 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 41; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 18 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 42; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 19 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 43; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 20 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 44; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 21 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 45; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 22 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 46; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 23 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 47; or Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 24 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 48 An antibody or a functional antibody fragment or probe thereof containing one of the above is provided.
[0031] Sequence identity information identifying the humanized and affinity matured variants provided by the present invention, including the complete VH and VL sequences and the CDR regions for each variant, is provided in Figures 1-6, and in the Sequence Listing attached to the present application.
[0032] The present invention provides humanized and affinity matured antibody variants that exhibit excellent binding affinity and specificity to the antigen STn while also showing a reduction in immunogenicity. The humanized variants are disclosed herein by SEQ ID NOs: 1-24 (variable VH region) and SEQ ID NOs: 25-48 (variable VL region), and the affinity matured antibody variants are disclosed herein by SEQ ID NOs: 49-88 (variable VH region) and SEQ ID NOs: 89-128 (variable VL region).
[0033] In a preferred embodiment, an antibody or fragment or probe has the following pairs of heavy chain CDRs and light chain CDRs: The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 17 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 41; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 20 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 44; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 21 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 45 An antibody or a functional antibody fragment or probe thereof is provided that includes one of the above.
[0034] In a further embodiment, an antibody or fragment or probe has the following pairs of light chain CDRs and heavy chain CDRs: The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 49 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 89; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 50 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 90; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 51 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 91; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 52 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 92; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 53 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 93; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 54 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 94; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 55 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 95; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 56 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 96; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 57 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 97; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 58 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 98; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 59 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 99; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 60 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 100; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 61 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 101; The pairing of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 62 with L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 102; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 63 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 103; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 64 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 104; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 65 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 105; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 66 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 106; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 67 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 107; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 68 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 108; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 69 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 109; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 70 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 110; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 71 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 111; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 72 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 112; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 73 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 113; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 74 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 114; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 75 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 115; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 76 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 116; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 77 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 117; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 78 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 118; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 79 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 119; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 80 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 120; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 81 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 121; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 82 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 122; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 83 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 123; Pairs of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 84 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 124; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 85 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 125; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 86 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 126; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 87 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 127; or The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 88 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 128 An antibody or a functional fragment or probe thereof comprising one of the above is provided.
[0035] In a preferred embodiment, the antibody or fragment or probe is the following pair of heavy chain CDR and light chain CDR: The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 49 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 89; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 70 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 110; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 81 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 121; or The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 88 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 128 An antibody or a fragment or probe thereof comprising one of the above is provided.
[0036] In a further embodiment of the present invention, in addition to the CDR regions described herein, the antibody or fragment or probe (a) a heavy chain variable region (VH) comprising a humanized heavy chain framework region, said VH, and / or, (b) The variable light chain region (VL) comprising a humanized light chain framework region, said VL An antibody, or a functional antibody fragment or probe thereof, comprising the same is provided.
[0037] The humanized framework region can be further described, for example, as follows. It will be understood that the variable framework region refers to the sequences around the CDR regions. Thus, different combinations of the CDR regions and variable framework regions described herein may be made, if desired.
[0038] Thus, in one aspect of the present invention, an antibody or fragment comprises (a) A variable heavy chain region (VH) comprising (i) A variable heavy chain region (VH) sequence selected from the group consisting of any one of SEQ ID NOs: 1 to 24 or 49 to 88 respectively, said VH comprising a humanized heavy chain framework region shown by the sequence, and / or and (b) A variable light chain region (VL) comprising (ii) A variable light chain region (VL) sequence selected from the group consisting of any one of SEQ ID NOs: 25 to 48 or 89 to 128 respectively, said VL comprising a humanized light chain framework region shown by the sequence, An antibody or a fragment thereof comprising the same is provided.
[0039] One of the humanized heavy chain framework regions described above can be paired with any one of the humanized light chain framework regions, if desired.
[0040] Specific pairing of framework regions is preferred. In one aspect of the present invention, an antibody or fragment comprises one of the following pairs of a light chain framework region and a heavy chain framework region, the heavy chain framework region being as shown by the variable heavy chain region (VH) sequence shown below, and the light chain framework region being as shown by the variable light chain region (VL) sequence shown below: An antibody or a fragment thereof is provided: Pair of the heavy chain framework region of SEQ ID NO:1 and the light chain framework region of SEQ ID NO:25; Pair of the heavy chain framework region of SEQ ID NO:2 and the light chain framework region of SEQ ID NO:26; Pair of the heavy chain framework region of SEQ ID NO:3 and the light chain framework region of SEQ ID NO:27; Pair of the heavy chain framework region of SEQ ID NO:4 and the light chain framework region of SEQ ID NO:28; Pair of the heavy chain framework region of SEQ ID NO:5 and the light chain framework region of SEQ ID NO:29; Pair of the heavy chain framework region of SEQ ID NO:6 and the light chain framework region of SEQ ID NO:30; Pair of the heavy chain framework region of SEQ ID NO:7 and the light chain framework region of SEQ ID NO:31; Pair of the heavy chain framework region of SEQ ID NO:8 and the light chain framework region of SEQ ID NO:32; Pair of the heavy chain framework region of SEQ ID NO:9 and the light chain framework region of SEQ ID NO:33; Pair of the heavy chain framework region of SEQ ID NO:10 and the light chain framework region of SEQ ID NO:34; Pair of the heavy chain framework region of SEQ ID NO:11 and the light chain framework region of SEQ ID NO:35; Pair of the heavy chain framework region of SEQ ID NO:12 and the light chain framework region of SEQ ID NO:36; Pair of the heavy chain framework region of SEQ ID NO:13 and the light chain framework region of SEQ ID NO:37; Pair of the heavy chain framework region of SEQ ID NO:14 and the light chain framework region of SEQ ID NO:38; Pair of the heavy chain framework region of SEQ ID NO:15 and the light chain framework region of SEQ ID NO:39; Pair of the heavy chain framework region of SEQ ID NO:16 and the light chain framework region of SEQ ID NO:40; Pair of the heavy chain framework region of SEQ ID NO:17 and the light chain framework region of SEQ ID NO:41; Pair of the heavy chain framework region of SEQ ID NO:18 and the light chain framework region of SEQ ID NO:42; Pair of the heavy chain framework region of SEQ ID NO: 19 and the light chain framework region of SEQ ID NO: 43; Pair of the heavy chain framework region of SEQ ID NO: 20 and the light chain framework region of SEQ ID NO: 44; Pair of the heavy chain framework region of SEQ ID NO: 21 and the light chain framework region of SEQ ID NO: 45; Pair of the heavy chain framework region of SEQ ID NO: 22 and the light chain framework region of SEQ ID NO: 46; Pair of the heavy chain framework region of SEQ ID NO: 23 and the light chain framework region of SEQ ID NO: 47; or Pair of the heavy chain framework region of SEQ ID NO: 24 and the light chain framework region of SEQ ID NO: 48.
[0041] In a further aspect of the present invention, there is provided an antibody or fragment or probe that comprises one of the following pairs of a light chain framework region and a heavy chain framework region, wherein the heavy chain framework region is as shown in the heavy chain variable region (VH) sequence shown below, and the light chain framework region is as shown in the light chain variable region (VL) sequence shown below: Pair of the heavy chain framework region of SEQ ID NO: 49 and the light chain framework region of SEQ ID NO: 89; Pair of the heavy chain framework region of SEQ ID NO: 50 and the light chain framework region of SEQ ID NO: 90; Pair of the heavy chain framework region of SEQ ID NO: 51 and the light chain framework region of SEQ ID NO: 91; Pair of the heavy chain framework region of SEQ ID NO: 52 and the light chain framework region of SEQ ID NO: 92; Pair of the heavy chain framework region of SEQ ID NO: 53 and the light chain framework region of SEQ ID NO: 93; Pair of the heavy chain framework region of SEQ ID NO: 54 and the light chain framework region of SEQ ID NO: 94; Pair of the heavy chain framework region of SEQ ID NO: 55 and the light chain framework region of SEQ ID NO: 95; Pair of the heavy chain framework region of SEQ ID NO: 56 and the light chain framework region of SEQ ID NO: 96; Pair of the heavy chain framework region of SEQ ID NO: 57 and the light chain framework region of SEQ ID NO: 97; Pair of the heavy chain framework region of SEQ ID NO: 58 and the light chain framework region of SEQ ID NO: 98; Pair of the heavy chain framework region of SEQ ID NO: 59 and the light chain framework region of SEQ ID NO: 99; Pair of the heavy chain framework region of SEQ ID NO: 60 and the light chain framework region of SEQ ID NO: 100; Pair of the heavy chain framework region of SEQ ID NO: 61 and the light chain framework region of SEQ ID NO: 101; Pair of the heavy chain framework region of SEQ ID NO: 62 and the light chain framework region of SEQ ID NO: 102; Pair of the heavy chain framework region of SEQ ID NO: 63 and the light chain framework region of SEQ ID NO: 103; Pair of the heavy chain framework region of SEQ ID NO: 64 and the light chain framework region of SEQ ID NO: 104; Pair of the heavy chain framework region of SEQ ID NO: 65 and the light chain framework region of SEQ ID NO: 105; Pair of the heavy chain framework region of SEQ ID NO: 66 and the light chain framework region of SEQ ID NO: 106; Pair of the heavy chain framework region of SEQ ID NO: 67 and the light chain framework region of SEQ ID NO: 107; Pair of the heavy chain framework region of SEQ ID NO: 68 and the light chain framework region of SEQ ID NO: 108; Pair of the heavy chain framework region of SEQ ID NO: 69 and the light chain framework region of SEQ ID NO: 109; Pair of the heavy chain framework region of SEQ ID NO: 70 and the light chain framework region of SEQ ID NO: 110; Pair of the heavy chain framework region of SEQ ID NO: 71 and the light chain framework region of SEQ ID NO: 111; Pair of the heavy chain framework region of SEQ ID NO: 72 and the light chain framework region of SEQ ID NO: 112; Pair of the heavy chain framework region of SEQ ID NO: 73 and the light chain framework region of SEQ ID NO: 113; Pair of the heavy chain framework region of SEQ ID NO: 74 and the light chain framework region of SEQ ID NO: 114; Pair of the heavy chain framework region of SEQ ID NO: 75 and the light chain framework region of SEQ ID NO: 115; Pair of the heavy chain framework region of SEQ ID NO: 76 and the light chain framework region of SEQ ID NO: 116; Pair of the heavy chain framework region of SEQ ID NO: 77 and the light chain framework region of SEQ ID NO: 117; Pair of the heavy chain framework region of SEQ ID NO: 78 and the light chain framework region of SEQ ID NO: 118; Pair of the heavy chain framework region of SEQ ID NO: 79 and the light chain framework region of SEQ ID NO: 119; Pair of the heavy chain framework region of SEQ ID NO: 80 and the light chain framework region of SEQ ID NO: 120; Pair of the heavy chain framework region of SEQ ID NO: 81 and the light chain framework region of SEQ ID NO: 121; Pair of the heavy chain framework region of SEQ ID NO: 82 and the light chain framework region of SEQ ID NO: 122; Pair of the heavy chain framework region of SEQ ID NO: 83 and the light chain framework region of SEQ ID NO: 123; Pair of the heavy chain framework region of SEQ ID NO: 84 and the light chain framework region of SEQ ID NO: 124; Pair of the heavy chain framework region of SEQ ID NO: 85 and the light chain framework region of SEQ ID NO: 125; Pair of the heavy chain framework region of SEQ ID NO: 86 and the light chain framework region of SEQ ID NO: 126; Pair of the heavy chain framework region of SEQ ID NO: 87 and the light chain framework region of SEQ ID NO: 127; or Pair of the heavy chain framework region of SEQ ID NO: 88 and the light chain framework region of SEQ ID NO: 128.
[0042] This is an example where the framework region allows a certain degree of variability in the exact sequence while still enabling the maintenance of function, including binding affinity and specificity. Accordingly, the present invention also provides an antibody or a fragment or a probe thereof as described, wherein the heavy chain framework region and / or the light chain framework region may have a sequence identity of 80% or more, preferably 85% or more, with respect to the specific sequences listed herein. For example, this may be due to substitution, addition, or deletion of amino acid residues, and in many cases, substitution is preferred. The substitution may be, for example, a conservative amino acid substitution.
[0043] In a preferred embodiment of the present invention, the antibody or a fragment or a probe thereof as described herein is such that the heavy chain framework region and / or the light chain framework region has a sequence identity of 90% or more, preferably 95% or more, with respect to the specific sequences listed herein. For example, this may be due to substitution, addition, or deletion of amino acid residues, and in many cases, substitution is preferred. The substitution may be, for example, a conservative amino acid substitution.
[0044] In a further embodiment of the present invention, the antibody or fragment or probe (a) is a heavy chain variable region (VH) comprising (i) the VH selected from the group consisting of any one of SEQ ID NOs: 1 to 24 or 49 to 88 respectively, and / or (a) is a light chain variable region (VL) comprising (ii) the VL selected from the group consisting of any one of SEQ ID NOs: 25 to 48 or 89 to 128 respectively, An antibody or a fragment or a probe thereof is provided.
[0045] Any one of the VH regions may be paired with any one of the VL regions, but specific pairing is preferred.
[0046] Accordingly, in a further aspect, the present invention provides an antibody or fragment or probe as described herein, which comprises one of the following pairs of a heavy chain variable region (VH) and a light chain variable region (VL): The pair of SEQ ID NO: 1 and SEQ ID NO: 25; The pair of SEQ ID NO: 2 and SEQ ID NO: 26; The pair of SEQ ID NO: 3 and SEQ ID NO: 27; The pair of SEQ ID NO: 4 and SEQ ID NO: 28; The pair of SEQ ID NO: 5 and SEQ ID NO: 29; The pair of SEQ ID NO: 6 and SEQ ID NO: 30; The pair of SEQ ID NO: 7 and SEQ ID NO: 31; The pair of SEQ ID NO: 8 and SEQ ID NO: 32; The pair of SEQ ID NO: 9 and SEQ ID NO: 33; The pair of SEQ ID NO: 10 and SEQ ID NO: 34; The pair of SEQ ID NO: 11 and SEQ ID NO: 35; The pair of SEQ ID NO: 12 and SEQ ID NO: 36; The pair of SEQ ID NO: 13 and SEQ ID NO: 37; The pair of SEQ ID NO: 14 and SEQ ID NO: 38; The pair of SEQ ID NO: 15 and SEQ ID NO: 39; The pair of SEQ ID NO: 16 and SEQ ID NO: 40; The pair of SEQ ID NO: 17 and SEQ ID NO: 41; The pair of SEQ ID NO: 18 and SEQ ID NO: 42; The pair of SEQ ID NO: 19 and SEQ ID NO: 43; The pair of SEQ ID NO: 20 and SEQ ID NO: 44; The pair of SEQ ID NO: 21 and SEQ ID NO: 45; The pair of SEQ ID NO: 22 and SEQ ID NO: 46; The pair of SEQ ID NO: 23 and SEQ ID NO: 47; or The pair of SEQ ID NO: 24 and SEQ ID NO: 48 is provided.
[0047] In a further aspect of the present invention, an antibody or fragment or probe comprises one of the following pairs of a heavy chain variable region (VH) and a light chain variable region (VL): The pair of SEQ ID NO: 49 and SEQ ID NO: 89; The pair of SEQ ID NO: 50 and SEQ ID NO: 90; Pair of Sequence Number 51 and Sequence Number 91; Pair of Sequence Number 52 and Sequence Number 92; Pair of Sequence Number 53 and Sequence Number 93; Pair of Sequence Number 54 and Sequence Number 94; Pair of Sequence Number 55 and Sequence Number 95; Pair of Sequence Number 56 and Sequence Number 96; Pair of Sequence Number 57 and Sequence Number 97; Pair of Sequence Number 58 and Sequence Number 98; Pair of Sequence Number 59 and Sequence Number 99; Pair of Sequence Number 60 and Sequence Number 100; Pair of Sequence Number 61 and Sequence Number 101; Pair of Sequence Number 62 and Sequence Number 102; Pair of Sequence Number 63 and Sequence Number 103; Pair of Sequence Number 64 and Sequence Number 104; Pair of Sequence Number 65 and Sequence Number 105; Pair of Sequence Number 66 and Sequence Number 106; Pair of Sequence Number 67 and Sequence Number 107; Pair of Sequence Number 68 and Sequence Number 108; Pair of Sequence Number 69 and Sequence Number 109; Pair of Sequence Number 70 and Sequence Number 110; Pair of Sequence Number 71 and Sequence Number 111; Pair of Sequence Number 72 and Sequence Number 112; Pair of Sequence Number 73 and Sequence Number 113; Pair of Sequence Number 74 and Sequence Number 114; Pair of Sequence Number 75 and Sequence Number 115; Pair of Sequence Number 76 and Sequence Number 116; Pair of Sequence Number 77 and Sequence Number 117; Pair of Sequence Number 78 and Sequence Number 118; Pair of Sequence Number 79 and Sequence Number 119; Pair of Sequence Number 80 and Sequence Number 120; Pair of Sequence Number 81 and Sequence Number 121; Pair of Sequence Number 82 and Sequence Number 122; Pair of Sequence Number 83 and Sequence Number 123; Pair of SEQ ID NO:84 and SEQ ID NO:124; Pair of SEQ ID NO:85 and SEQ ID NO:125; Pair of SEQ ID NO:86 and SEQ ID NO:126; Pair of SEQ ID NO:87 and SEQ ID NO:127; or Pair of SEQ ID NO:88 and SEQ ID NO:128 An antibody or a fragment thereof or a probe thereof is provided, which comprises one of the above.
[0048] In the same manner as described above, the present invention also provides an antibody or a fragment thereof or a probe thereof, wherein the heavy chain variable region (VH) and / or the light chain variable region (VL) can have a sequence identity of 80% or more, preferably 85% or more, with respect to the specific VH and VL sequences listed herein. For example, this may be due to substitution, addition, or deletion of amino acid residues, and in many cases, substitution is preferred. The substitution may be, for example, a conservative amino acid substitution.
[0049] In a preferred embodiment of the present invention, the antibody or a fragment thereof or a probe described herein is such that the heavy chain variable region (VH) and / or the light chain variable region has a sequence identity of 90% or more, preferably 95% or more, with respect to the specific sequences listed herein. For example, this may be due to substitution, addition, or deletion of amino acid residues, and in many cases, substitution is preferred. The substitution may be, for example, a conservative amino acid substitution.
[0050] From a functional perspective, the present invention provides an antibody or a fragment thereof or a probe thereof described herein, which binds to STn and a group of glycans having α2,6-linked sialic acid at the terminus. The glycans having α2,6-linked sialic acid at the terminus may include, for example, STn, 2,6-sialyl-T, di-sialyl-T, or 2,6-sialyllactosamine.
[0051] The overall group of glycans recognized by the antibody or a fragment thereof or a probe described herein includes the following. 1. Sialyl Tn: NeuAcα--6GaINAcα / β1- 2. 2,6-Sialyl T: Gal β1-3GalNAcα1-NeuAcα2-6 3. Disialyl T: NeuAcα2-3Galβ1-3GalNAcα1---NeuAcα2-6 4. 2,6-Sialo-N-acetyl lactosamine: NeuAcα2-6Galβ1-4Glcβ1-
[0052] Also known as STn, sialosyl Tn, sialylated Tn, Neu5Ac-α2,6GalNAcα-O-Ser / Thr, or CD175 by the "surface antigen classification" nomenclature, sialyl Tn is the simplest sialylated mucin-type O-glycan. STn is a truncated O-glycan containing sialic acid (Neu5Ac) α-2,6-linked (via carbon 6) to N-acetyl-galactosamine (GalNAc) α-O-linked to serine / threonine (Ser / Thr) (Neu5Ac-α2,6GalNAcα-O-Ser / Thr). Sialylation prevents the formation of various core structures that would otherwise be found in mucin-type O-glycans.
[0053] STn is expressed in over 80% of human carcinomas and is associated with poor prognosis and decreased overall survival in different cancer patients. The biosynthesis of the STn antigen is associated with the expression of the sialyltransferase ST6GalNAc1 and the mutation or loss of heterozygosity of the COSMC gene.
[0054] Antibodies that bind to STn with such specificity are of particular interest because, in contrast to many current antibody therapies, they have high tumor specificity and low or no reactivity to normal cells.
[0055] The antibodies or fragments thereof or probes described herein can specifically bind to STn or the group of α-2,6 sialylated glycans as described herein.
[0056] The antibodies or fragments thereof described herein can undergo glycan changes at glycosylation sites.
[0057] In one aspect of the invention, the antibodies or fragments thereof or probes described herein can be provided in any suitable form. For example, the antibody or fragment or probe can be provided as a ScFv, monoclonal antibody, chimeric antibody, humanized antibody, bispecific antibody, antibody drug conjugate (ADC), or CAR-T cell, or in other formats, as understood by those skilled in the art.
[0058] Thus, for example, the antibodies or fragments thereof or probes of the invention can be provided as single-chain fragment variable antibodies (scFv). This refers to a functional antibody fragment that contains only the VL and VH regions, which are joined by a linker to form a monovalent antigen-binding site. Diabodies, tribodies, and tetrabodies are antibodies that include dimers, trimers, or tetramers of scFv, i.e., they contain two, three, and four polypeptide chains, respectively, and form two, three, and four antigen-binding sites, respectively, which can be the same or different.
[0059] The antibodies, functional antibody fragments, or probes in the present invention can have one or more binding sites. When containing two or more binding sites, these sites can be identical to each other or different. In the case of two different binding sites, the antibody, functional antibody fragment, or probe is named a "bispecific" antibody.
[0060] In a further aspect, the invention thus also provides an antibody drug conjugate (ADC) comprising an antibody or fragment thereof or probe, a linker, and a cytotoxic drug, as described herein.
[0061] The present invention also provides a pharmaceutical composition comprising an antibody or a functional antibody fragment or probe thereof, or an antibody-drug conjugate (ADC), as described herein, and a pharmaceutically acceptable carrier.
[0062] In another aspect, a method for detecting a tumor biomarker in a patient sample using an antibody or a functional antibody fragment or probe thereof, or an antibody-drug conjugate (ADC), or a pharmaceutical composition, as described herein, is provided. The methodology includes staining a biological sample obtained from a subject with a nucleotide sequence encoding an antibody or a functional antibody fragment or probe thereof, or an antibody-drug conjugate (ADC), as described herein, under conditions appropriate for specific binding to the antibody. The presence or absence of binding of the antibody indicates tumor cells expressing STn, 2,6-sialyl T, di-sialyl T, or 2,6-sialolactosamine on the cell surface. For example, the biological sample to be analyzed may contain isolated cells, or tissue, or tumor-derived proteins.
[0063] The present invention also provides all of those described herein for medical use, an antibody or a functional antibody fragment or probe thereof, or an antibody-drug conjugate (ADC), or a pharmaceutical composition. In particular, the antibody as a pharmaceutical composition for medical use is intended to be used for treating cancer patients. It is contemplated that various types of tumors can be treated with the variants disclosed herein.
[0064] Accordingly, in some aspects, the antibody, functional antibody fragment or probe of the present invention can be conjugated or fused to one or more diagnostic or therapeutic agents, or any other desired molecule. The resulting conjugated antibody, functional antibody fragment or probe can be useful for monitoring or diagnosing the onset, prognosis and / or severity of diseases associated with the expression of STn or α-2,6-sialylated glycans.
[0065] The antibody, functional fragment, or probe of the present invention can also be used to detect the expression of STn or α-2,6-sialylated glycans in any biological sample using classical immunohistological methods (IHC or immunoassay, e.g., enzyme linked immunosorbent assay (ELISA) and radioimmunoassay (RIA)), flow cytometry, and immunoblotting.
[0066] The antibody, functional antibody fragment, or probe of the present invention can be included alone, conjugated, or in combination with a pharmaceutical composition, provided that it is provided at an effective concentration to exert a therapeutically useful effect with minimal side effects.
[0067] In a further aspect, the present invention includes an isolated polynucleotide comprising a nucleic acid sequence, wherein the nucleic acid sequence encodes an antibody, functional antibody fragment, or probe described herein, particularly the variable heavy chain region of an antibody, the variable light chain region domain of an antibody, or a functional antibody fragment or probe thereof.
[0068] In a further aspect, the present invention provides an expression vector comprising a polynucleotide encoding an antibody, fragment, or probe described herein. As will be understood, appropriate host cells comprising such expression vectors can be provided.
[0069] The present invention further provides a pharmaceutical composition comprising a monoclonal antibody or a functional antibody fragment thereof, preferably a nucleotide sequence encoding an antibody or fragment as described herein and claimed, wherein the nucleotide sequence is encapsulated using an mRNA delivery system. Such systems are known in the art. The mRNA delivery system enables transient expression of the antibody or antibody fragment in target cells and promotes the production of therapeutic proteins intracellularly.
[0070] An mRNA delivery system comprising a monoclonal antibody or a functional antibody fragment, preferably a nucleotide sequence encoding an antibody or fragment as described herein and claimed, includes various approaches including lipid-based nanoparticles (LNP), polymeric nanoparticles, and viral vectors that enable efficient delivery to target cells.
[0071] For example, in the case of LNP, the formulation typically consists of lipid-based nanoparticles composed of lipids such as phospholipids and cholesterol together with a nucleotide sequence encoding an antibody or antibody fragment. The formulation enables encapsulation of the nucleotide sequence within a lipid bilayer structure, protects it from degradation, and facilitates its delivery to target cells.
[0072] In one embodiment, LNP can be prepared by mixing lipids and the nucleotide sequence in a suitable solvent and then controlling a mixing process such as microfluidics or sonication to form small and stable nanoparticles. The resulting LNP can be further optimized by adjusting lipid composition, nucleotide sequence concentration, and other formulation parameters to achieve desired characteristics such as size, stability, and cellular uptake efficiency.
[0073] To achieve efficient delivery, LNP can be administered to a subject via various routes including intravenous, intramuscular, or subcutaneous injection. Upon administration, LNP enters the target cells by endocytosis, and the encapsulated nucleotide sequence is released into the cytoplasm. The nucleotide sequence is then translated into the desired antibody or antibody fragment, resulting in transient expression within the target cells.
[0074] The use of LNP as an mRNA delivery system enables the controlled transient production of therapeutic antibodies or antibody fragments in a targeted manner. This technology offers advantages such as ease of formulation, high encapsulation efficiency, and calibrated delivery characteristics, making it an effective approach for delivering nucleotide sequences encoding antibodies or antibody fragments for therapeutic use.
[0075] Accordingly, the present invention provides a composition comprising a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof, wherein the antibody or fragment is as described herein and as claimed, the nucleotide sequence is encapsulated within an mRNA delivery system, and the mRNA delivery system is capable of promoting transient expression of the sTn antibody or antibody fragment in target cells.
[0076] The mRNA delivery system can be any suitable system, but in a preferred embodiment, the mRNA delivery system comprises lipid-based nanoparticles, polymer-based nanoparticles, or viral vectors. Lipid-based nanoparticles (LNP) are particularly suitable as described above.
[0077] In a further aspect, there is provided a method for delivering a monoclonal antibody or a functional antibody fragment thereof, preferably the antibody or fragment as described herein and as claimed, to a target cell, the method comprising: a) encapsulating a nucleotide sequence encoding the antibody or antibody fragment within an mRNA delivery system; b) administering the mRNA delivery system to the target cell; c) enabling the mRNA to be taken up and expressed by the target cell, thereby producing the antibody or antibody fragment within the target cell.
[0078] In one aspect, the mRNA delivery system may be further modified with a targeting moiety so as to enhance specific uptake by target cells expressing the sialyl Tn (STn) antigen.
[0079] In a further aspect, there is provided a therapeutic composition comprising the mRNA delivery system described herein and a monoclonal antibody or a functional antibody fragment thereof that specifically binds to the sialyl Tn (STn) antigen, preferably a nucleotide sequence encoding an antibody or fragment as described herein and claimed, wherein the composition is formulated for administration to a human or animal subject. The therapeutic composition may further comprise, for example, as will be appreciated, a carrier or excipient suitable for systemic or topical administration to the subject.
[0080] In a further aspect, the invention provides a method for treating cancer characterized by overexpression of the sialyl Tn (STn) antigen, comprising: a) incorporating a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof that binds to the STn antigen into an mRNA delivery system; b) administering the mRNA delivery system to a subject in need thereof, thereby enabling expression of the antibody or antibody fragment in the cells of the subject and selectively targeting STn-expressing cancer cells. The monoclonal antibody or functional antibody fragment that binds to the STn antigen is preferably an antibody or fragment as described herein and claimed.
[0081] The invention also provides a theranostic composition comprising an mRNA delivery system comprising a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof that specifically binds to the sialyl Tn (STn) antigen, preferably an antibody or fragment as described herein and claimed, and a detectable label, enabling both therapeutic delivery to STn-expressing cancer cells and imaging of STn-expressing cancer cells.
[0082] In a further aspect, there is provided a method for treating cancer in an animal or human characterized by overexpression of the sialyl Tn (STn) antigen, the method comprising administering to a subject in need thereof a therapeutic composition comprising an antibody or a fragment thereof, preferably an antibody or fragment as described herein and claimed, whereby the STn-expressing cancer cells in the animal or human are selectively targeted and treated.
[0083] In a further aspect, the present invention provides a cell therapy composition for engaging and directing effector cells to a target, the cell therapy composition comprising an sTn antibody, preferably an antibody or fragment as described herein and claimed, wherein the cell therapy comprises techniques such as chimeric antigen receptor (CAR) therapy, natural killer (NK) cell therapy, and cell-specific engagers, whereby target recognition and cytotoxicity against sTn-expressing cells are promoted.
[0084] The present invention also provides the use of an sTn antibody, preferably an antibody or fragment as described herein and claimed, in cell therapy applications, wherein the sTn antibody sequence is incorporated into effector cells by genetic modification and combined with various techniques including CAR-T, NK CAR, and cell-specific engagers to enable specific recognition and enhanced cytotoxicity against target cells expressing the sTn antigen.
[0085] A further aspect of the present invention provides the use of an sTn antibody, preferably an antibody or fragment as described herein and claimed, in cell therapy applications for directing effector cells to sTn-expressing target cells, wherein the cell therapy comprises a wide range of techniques including, but not limited to, CAR-T, NK CAR, and cell-specific engagers, whereby target cell cytotoxicity and immune-mediated responses against sTn-expressing cells are promoted.
[0086] In a further aspect, there is provided the use of an sTn antibody, preferably an antibody or fragment thereof described herein and claimed, in cell therapy applications, wherein the sTn antibody is used for the induction and trafficking of effector cells by various techniques including CAR-T, NK CAR, and cell-specific engagers, enabling target recognition, activation, and cytotoxicity against cells expressing the sTn antigen.
[0087] In yet a further aspect, there is provided the use of an sTn antibody, preferably an antibody or fragment thereof described herein and claimed, in cell therapy applications for enabling target recognition and cytotoxicity by effector cells, wherein the cell therapy includes a wide range of techniques such as CAR-T, NK CAR, and cell-specific engagers, promoting the induction of effector cells to sTn-expressing cells and promoting an immune-mediated response.
[0088] According to the present invention, a method for producing an antibody or a functional antibody fragment or probe described herein may include the step of using such a suitable host cell.
[0089] The present invention also provides an mRNA sequence encoding an antibody targeting the sTn antigen, for example, an antibody described herein and claimed. The present invention makes good use of the degeneracy of the genetic code, which enables the design of multiple mRNA sequences that encode the same antibody but are optimized for expression in human cells.
[0090] For example, the present invention provides mRNA sequences encoding the variable heavy chain (VH) and light chain (VL) of an anti-sTn antibody, and some specific examples are shown below. Using the standard genetic code, it is possible to create mRNA sequences optimized for each chain considering factors such as codon usage bias, mRNA stability, and immunogenicity.
[0091] As exemplary embodiments of the present invention, the following mAb clones: ·mAb_v1 ·mAb_v64 ·mAb_v46 ·mAb_v48 The amino acid sequences of the VH and VL chains of the anti-sTn antibody, compared with, for example, are shown in FIGS. 4 to 6.
[0092] The corresponding optimized nucleotide sequences created using the standard genetic code and taking into account factors such as codon usage bias, mRNA stability, and immunogenicity in humans are as follows. VH sequence: For mAb_v1 and mAb_v48 (and designated nucleotide sequence number 174): CAGGUGCAGCUGCAGGAGAGCGGCCCCGGCCUGGUGAAGCCCAGCCAGACCCUGAGCCUGACCUGCACCGUGAUCGGCUACAGCAUCACCAGCGGCUACUACUGGAACUGGAUCAGGCAGCCCCCCGGCAAGGGCCUGGAGUGGAUCGGCAGCAUCAACUACGACGGCAGCAACAUCUACAACCCCAGCCUGAAGAGCAGGGUGACCAUCAGCAGGGACACCAGCAAGAACCAGUUCAGCCUGAAGCUGAGCAGCGUGACCGCCGCCGACACCGCCGUGUACUACUGCGCCAGGGGCGGCGACUACUGGGGCCAGGGCACCACCGUGACCGUGAGCAGC For mAb_v64 (and designated nucleotide sequence number 175): CAGGUGCAGCUGCAGGAGAGCGGCCCCGGCCUGGUGAAGCCCAGCCAGACCCUGAGCCUGACCUGCACCGUGAUCGGCCAGAGCAUCACCAGCGGCUACUACUGGAACUGGAUCAGGCAGCCCCCCGGCAAGGGCCUGGAGUGGAUCGGCAGCAUCAACUACGACGGCAGCAACAUCUACAACCCCAGCCUGAAGAGCAGGGUGACCAUCAGCAGGGACACCAGCAAGAACCAGUUCAGCCUGAAGCUGAGCAGCGUGACCGCCGCCGACACCGCCGUGUACUACUGCGCCAGGGGCGGCCACCCCUGGGGCCAGGGCACCACCGUGACCGUGAGCAGC For mAb_v46 (and the specified nucleotide sequence number 176): CAGGUGCAGCUGCAGGAGAGCGGCCCCGGCCUGGUGAAGCCCAGCCAGACCCUGAGCCUGACCUGCACCGUGAUCGGCUACAGCAUCACCAGCGGCUACAACUGGAACUGGAUCAGGCAGCCCCCCGGCAAGGGCCUGGAGUGGAUCGGCAGCAUCAACCCCGACGGCAGCAACUUCUACAACCCCAGCCUGAAGAGCAGGGUGACCAUCAGCAGGGACACCAGCAAGAACCAGUUCAGCCUGAAGCUGAGCAGCGUGACCGCCGCCGACACCGCCGUGUACUACUGCGCCAGGGGCGGCGACUACUGGGGCCAGGGCACCACCGUGACCGUGAGCAGC VL sequence: For mAb_v1 and mAb_v64; mAb_v46 (and the specified nucleotide sequence number 177): GAGAUCGUGCUGACCCAGAGCCCCGCCACCCUGAGCCUGAGCCCCGGCGAGAGGGCCACCCUGAGCUGCAGCGCCAGCAGCAGCGUGAGCUACAUGCACUGGUUCCAGCAGAAGCCCGGCCAGGCCCCCAGGAGGUGGAUCUACGACACCAGCAAGAGGGCCACCGGCGUGCCCGCCAGGUUCAGCGGCAGCGGCAGCGGCACCGACUACACCCUGACCAUCAGCAGCCUGGAGCCCGAGGACUUCGCCGCCUACUACUGCCAGCAGUGGAGCAGCGACCCCCCCAUGCUGACCUUCGGCGGCGGCACCAAGCUGGAGAUCAAG For mAb_v48 (and the specified nucleotide sequence number 178): GAGAUCGUGCUGACCCAGAGCCCCGCCACCCUGAGCCUGAGCCCCGGCGAGAGGGCCACCCUGAGCUGCAGCGCCAGCAGCACCGUGAGCUACAUGCACUGGUUCCAGCAGAAGCCCGGCCAGGCCCCCAGGAGGUGGAUCUACGACACCAGCAAGAGGGCCACCGGCGUGCCCGCCAGGUUCAGCGGCAGCGGCAGCGGCACCGACUACACCCUGACCAUCAGCAGCCUGGAGCCCGAGGACUUCGCCGCCUACUACUGCCAGCAGUGGACCGCCGACCCCCCCAUGCUGACCUUCGGCGGCGGCACCAAGCUGGAGAUCAAG
[0093] The mRNA sequences listed above were created using the first codon for each corresponding amino acid according to the standard genetic code. However, it should be noted that there is a significant degree of degeneracy in the genetic code, meaning that most amino acids (except methionine and tryptophan) can be encoded by more than one codon. This feature opens the way to create multiple mRNA sequences for any given amino acid sequence, such as the amino acid sequences of the VH and VL chains of an antibody.
[0094] Therefore, as can be understood, alternative mRNA sequences encoding the same antibody could be created using the selection of different codons. In practice, the creation of these alternative sequences can be guided by considerations such as codon usage bias in the target organism (in this case, humans), the stability of the resulting mRNA, the degree of immunogenicity, and the impact of translation speed on protein product folding and post-translational modification.
[0095] Also, other methods such as machine learning algorithms could be utilized to optimize nucleotide sequences based on these factors. These optimized sequences can offer advantages from the perspectives of protein production efficiency, mRNA stability, and immunogenicity of the final product. Therefore, this degeneracy property of the genetic code clearly shows the possibilities for a large number of sequences within the scope of the present invention, enabling the creation of various mRNA sequences that encode the same therapeutic antibody but are optimized according to different parameters.
[0096] Due to the ability to direct the in situ production of the desired antibody, the use of these mRNA sequences for antibody production can present numerous advantages in biomedical applications such as targeted cancer therapy and may lead to more effective and individualized treatments.
[0097] Sequence Liabilities As part of the present invention, the inventors also considered the identification of sequence liabilities (i.e., post-translational modification - PTM - sites) in the CDRs of the humanized V1 and affinity matured clones described herein. The inventors identified at least one PTM site in the heavy chain and another site in the light chain. To remove this liability, it is proposed to introduce single amino acid changes in each PTM, thus changing the CDRs.
[0098] The most risky positions were evaluated as follows. In VL: · "DP" aspartic acid fragmentation site at positions 93 / 94 of CDR3. In VH: · "NS" deamidation site at positions 53 / 54 of CDR2. This risk seems to be specific to the affinity matured variant mAb-v53. · "DG" aspartic acid isomerization site at positions 55 / 56 of CDR2.
[0099] Thus, in one aspect of the present invention, any one of the L-CDR3 sequences or VL variable light chain sequences (either humanized or affinity matured) disclosed herein has the "D" (aspartic acid / aspartate) at position 93 replaced with any one of the following amino acid residues: A, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W, or Y and may be further mutated.
[0100] In a further aspect, any one of the L-CDR3 sequences or VL variable light chain sequences (either humanized or affinity matured) disclosed herein has the "P" (proline) at position 94 replaced with any one of the following amino acid residues: A, E, F, H, I, K, L, N, Q, R, T, V, W, or Y and may be further mutated.
[0101] One of the changes shown for position 93 may be paired with any one of the changes shown for position 94.
[0102] In a preferred aspect, any one of the L-CDR3 sequences or VL variable light chain sequences (either humanized or affinity matured) disclosed herein has the "DP" at positions 93 and 94 replaced with any one of the following pairs of amino acid residues: DA, DK, DN, EP, KP, NP, QP, RP, AA, EE, FF, GP, HH, II, KK, LL, NN, QQ, RR, SP, TT, VV, WW, or YY and may be further mutated.
[0103] Thus, the VL CDR3 sequences in any of the arrays disclosed herein may be modified by the methods described above. Mutations DA, DK, DN, EP, KP, NP, QP, or RP may preferably be possible.
[0104] Figure 20b shows certain preferred VL sequences incorporating the above-described sequence liability modifications, which disclose the variable light chains of the humanized variants (v65-v88) based on V1. These are shown as SEQ ID NOs: 150-173.
[0105] According to a further aspect of the invention, any one of the H-CDR2 sequences or VH variable heavy chain sequences (either humanized or affinity matured) disclosed herein may have the "D" (aspartic acid / aspartate) at position 55 replaced with any of the following amino acid residues: A, E, F, G, H, I, K, L, P, Q, R, V, W or Y and may be further mutated.
[0106] In a further aspect, any one of the H-CDR2 sequences or VH variable heavy chain sequences (either humanized or affinity matured) disclosed herein may have the "G" (glycine) at position 56 replaced with any of the following amino acid residues: A, E, F, H, I, K, L, N, Q, R, T, V, W or Y and may be further mutated.
[0107] One of the changes shown for position 55 may be paired with any one of the changes shown for position 56.
[0108] In a preferred embodiment, any one of the H-CDR2 sequences or VH variable heavy chain sequences (either humanized or affinity matured) disclosed herein may have the "DG" at positions 55 and 56 replaced with a pair of the following amino acid residues: DE, DK, DA, EG, QG, RG, AA, EE, FF, GG, HH, KK, LL, DN, PQ, QQ, RR, DT, VV, WW, or YY It can be further mutated to be replaced by any one of them.
[0109] Therefore, the VH CDR2 sequence in any of the sequences disclosed herein may be modified by the above method. Mutations DE, DK, DA, EG, QG, or RG may be preferred.
[0110] Figure 20a shows certain preferred VH sequences incorporating the above-described sequence liability modifications, which disclose the variable heavy chains of humanized variants (v65 - v85) based on V1. These are shown as SEQ ID NOs: 129 - 149.
[0111] In a preferred embodiment, an L - CDR3 sequence or a VL variable light chain sequence (either humanized or affinity matured) containing a mutation that replaces the "DP" at positions 93 and 94 with any one of the following pairs of amino acid residues: DA, DK, DN, EP, KP, NP, QP, RP, AA, EE, FF, GP, HH, II, KK, LL, NN, QQ, RR, SP, TT, VV, WW, or YY can be paired with any one of an H - CDR2 sequence or a VH variable heavy chain sequence (either humanized or affinity matured) containing a mutation that replaces the "DG" at positions 55 and 56 with any one of the following pairs of amino acid residues: DE, DK, DA, EG, QG, RG, AA, EE, FF, GG, HH, KK, LL, DN, PQ, QQ, RR, DT, VV, WW, or YY
[0112] In a further aspect of the invention, in the affinity matured variant mAb-v53, it may be advantageous to further mutate this variant to substitute the "NS" (asparagine / serine) at positions 53 and 54 of CDR2 in the variable heavy chain with alternative amino acids. For example, N can be replaced with one of A, E, F, G, H, I, K, L, P, Q, R, V, W or Y while maintaining S at position 54. Alternatively, S can be replaced with A, E, F, G, H, I, K, L, P, Q, R, V, W or Y while maintaining N at position 54. Alternatively, both N and S can be altered such that combinations of the above-described variant forms can be used.
[0113] Detailed Description Materials and Methods Generally, where applicable, methods for the production of the antibodies of the invention may include the fusion between two cells to produce a hybridoma, introduction of the nucleotide sequences of the invention into a host cell, culturing the host cell under conditions appropriate for the production of the heavy and / or light chains encoded by the antibody or functional fragment or probe of the invention for a sufficient time, followed by purification of the heavy and light chains of the antibody or its functional fragment or probe.
[0114] The recombinant expression of an antibody or a functional antibody fragment or probe of the invention that binds to the group of STn or α-2,6 sialylated antigens may include the construction of an expression vector containing a nucleotide sequence encoding the heavy and / or light chains of the antibody or its functional antibody fragment or probe of the invention.
[0115] Vectors can be generated by recombinant DNA techniques. Such vectors can also include other coding nucleotide sequences from which the chimeric antibody sequences are derived. For example, they can include nucleotide sequences encoding the constant regions of antibody molecules that enable the expression of chimeric proteins containing the amino acid sequences of the antibodies, functional antibody fragments or probes of the invention, followed by the entire heavy or light chain of the antibody, or the entire heavy and light chains (see WO 86 / 05807 and WO 89 / 01036).
[0116] The expression vector can be introduced into host cells by transfection / transduction techniques, and the resulting cells produce the antibody of the present invention or a functional antibody fragment thereof. Accordingly, the present invention includes host cells containing a nucleotide sequence encoding the antibody of the present invention or a functional antibody fragment or probe thereof.
[0117] Host cells can be selected to modify the characteristics of the product derived from the inserted nucleotide sequence.
[0118] In one aspect, these host cells can add glycosylation or phosphorylation sites, or other modifications, to the encoded protein. For example, the host cells can provide accurate processing of the protein and cell transport / secretion.
[0119] Finally, for attempts to increase the similarity to antibodies normally produced in humans and reduce the immunogenic effect, the inventors have provided a new and improved useful antibody variant, including humanization of the parental L2A5 antibody, throughout the antibody affinity maturation of selected humanized variants named using the initials of V1, which results in the creation of antibody variants with increased binding and affinity for the target STn.
[0120] The obtained antibody clones / variants are characterized by specificity for the target and immunogenicity, as further described below, from the perspective of binding to different cancer cell lines.
[0121] In general terms, the methods used by the inventors and the specific processes described will be well understood by those skilled in the art from the perspective of their technical details.
[0122] Humanization Variable domain analysis and CDR identification The IMGT Domain Gap Align tool was used: http: / / www.imgt.org / 3Dstructure-DB / cgi / DomainGapAlign.cgi for the purpose of identifying complementarity-determining regions (CDRs) and analyzing the most matching germline sequences.
[0123] Molecular modeling Molecular models were constructed for the VH and VL domains based on homology to previously published antibody crystal structures using in-house software. The PDB files enable viewing in any molecular visualization software. Images were created using PyMol.
[0124] Sequence vulnerability analysis Antibody sequences were analyzed for specific vulnerabilities based on published protein motifs. The analysis was performed using an in-house system constructed in Microsoft Excel. The software used the following motif representing any amino acid where X is not proline. [Table 1]
[0125] Gene synthesis and cloning The variable heavy and variable light domains were designed with appropriate restriction sites at the 5' and 3' ends to enable cloning into Absolute Antibody cloning and expression vectors. The variable domain sequences were codon-optimized for expression in human cells. After gene synthesis, the variable domains were cloned into the appropriate species and types of Absolute Antibody vectors. The correct sequences were verified by Sanger sequencing using raw data analyzed with DNASTAR Lasergene software. Once the plasmid DNA was confirmed, an appropriate size preparation was performed to generate a sufficient amount of high-quality DNA for transfection.
[0126] Expression and purification HEK 293 (human embryonic kidney 293) mammalian cells were grown to an optimal stage for transient transfection. The cells were transiently transfected with heavy and light chain expression vectors and further cultured for 6 days. The culture was harvested by centrifugation at 4000 rpm and filtered through a 0.22 M filter. The first step of purification was performed using protein A affinity chromatography with elution using citrate buffer pH 3.0, followed by neutralization with 0.5 M Tris, pH 9.0. The resulting eluted protein was then buffer exchanged into PBS using a desalting column. The antibody concentration was determined by UV spectrophotometry and the antibody was concentrated if necessary.
[0127] Antibody analysis The purity of the antibody was determined by SDS-PAGE (sodium dodecyl sulphate polyacrylamide gel electrophoresis) and HPLC (high performance liquid chromatography). SEC-HPLC was performed on an Agilent 1100 series instrument using a suitable size exclusion column (SEC). The antibody expression titer was determined by protein A HPLC.
[0128] Characterization of humanized antibody Different assays were performed to demonstrate whether the humanized variant maintained biophysical properties (specificity, affinity, and internalization) similar to the parental clone. These assays included the following. · Evaluation of binding to BSM mucin (STn carrier) by ELISA · Evaluation of binding to different STn+ cell lines (flow cytometry) · NMR studies to understand the antibody interaction with STn-serine glycan · In silico immunogenicity analysis · Glycan array to determine antibody specificity ·Affinity measurement by SPR ·TMA for evaluating mAb binding to patient-derived cancer tissues
[0129] Affinity maturation Library construction Bioinformatics analysis of the parental antibody was performed to create a site-specific CDR mutant library. After homology modeling of the antibody Fv region and CDR grafting in the template, CDR residues potentially involved in antigen binding were identified. Sixteen positions for the heavy chain and fourteen positions for the light chain were identified. By analyzing the NGS database, the amino acids commonly used for specific germline sequences were identified. Based on this, degenerate codons were designed and mutations were introduced at the identified positions potentially involved in antigen binding. Amino acids with unfavorable characteristics were generally avoided. The introduction of mutations was on average four mutations for each antibody chain and could be described by a Gaussian distribution. Primers were designed based on the degenerate codons and used for introducing mutations into the antibody sequences. The mutated antibody genes were cloned into Yumab's scFv phage display vector, three libraries were created, and packaged into antibody-phage particles. 5×10 8 A library with a total functional diversity greater than cfu was created. Antibody clones with functional open reading frames were determined by DNA sequence analysis. Packaging and purification of the antibody-phage particles resulted in at least 3×10 11 cfu / ml for each library.
[0130] Affinity maturation by in vivo selection The created antibody-phage library was used for affinity maturation by in vitro selection. The same overall excess of antibody-phage particles for the functional size was used for each individual library. A specific amount was pooled into one library for in vitro selection.
[0131] For the initial panning round, biotinylated BSM was used. The antibody phage output of panning round 1 created in biotinylated proteins was used for the second round in a reduced number of STn+ cells to increase stringency and drive the output to antibodies with increased affinity. In both panning rounds, negative selection against several negative antigens was performed. Four different strategies were used for affinity maturation by in vitro selection. By increasing stringency from strategy 1 to 4, it is expected that the amount of eluted antibody-phage particles will decrease.
[0132] Antibody screening The eluted antibody-phage particles after panning round 2 were used for infection of 384 clones of Escherichia coli (E. Coli) from each randomly selected strategy for antibody screening. In total, 1536 antibody clones were used for the production of monoclonal scFv antibodies in the bacterial system. The produced antibody clones were tested for binding activity against positive and negative cell lines. The provided control antibody (IgG) and the parental scFv antibody were used as positive controls. The parental scFv antibody was identified with a signal-noise ratio of 20, and thus, clones with a signal-noise ratio greater than 20 were identified as hits.
[0133] Antibody sequencing Two hundred and ten clones were identified as hits and selected for DNA sequence analysis. Sequence analysis revealed 40 uniquely mutated antibodies. These antibodies showed 1 to 6 mutations in the CDRs. Several hotspot mutations showing preferred mutations at different positions were identified.
[0134] In addition, a total of 40 uniquely mutated antibodies were selected and soluble scFvs were generated. The generation was used for ELISA screening in two positive antigens (biotinylated BSM and non-biotinylated BSM) and two negative antigens (streptavidin and BSA). The signal-to-noise ratio between the positive and negative antigens was calculated for analysis. Most antibodies showed strong binding to both positive antigens and no binding to the negative antigens. Based on the results obtained, antibodies were selected for conversion to the final format and production in mammalian cell culture.
[0135] Conversion to the final format (human IgG1): Based on the results obtained, 20 antibodies were selected for conversion to human IgG1. The antibodies were cloned into Yumab's mammalian expression vector and produced in mammalian cell culture. The antibodies were purified using protein A affinity chromatography and buffer-exchanged into phosphate-buffered saline. Quality control was performed by UV / VIS spectroscopy and reducing SDS-PAGE. 18 antibodies were successfully produced and showed high purity and integrity. In parallel, the parental antibodies were cloned into the same format and produced simultaneously.
[0136] Affinity ranking For verification of antibody binding, titrations were performed in the provided positive cell line (MDA-MB-231 STn) and negative cell line (MDA-MB-231 WT), and also in bovine submaxillary mucin (BSM). Additional titration experiments were performed using cell lines that naturally express STn (COLO205, SNU16, OV90). All antibodies showed strong and specific binding to the target cells. EC50 values were calculated. The best antibody showed an EC50 value of approximately 0.6 nM, while the parental antibody was calculated to have an EC50 value of 2 nM. The specificity of the affinity matured antibody clones was evaluated by glycan array.
[0137] Results Humanized variant EC50 ELISA - BSM To evaluate antibody binding to the target antigen STn, the inventors used an in vitro assay using mucin that naturally expresses STn: bovine submaxillary mucin (BSM). Humanized variants (V1, V2, and V3) were incubated using BSM-coated wells, and binding was evaluated using an ELISA assay. Absorbance was detected at 450 nm, and then, as shown in Figure 8, the normalized EC50 was calculated.
[0138] Figure 8 shows the normalized EC50 using humanized clones V1, V2, and V3. The ELISA assay was performed using bovine submaxillary mucin (BSM). A 96-well plate was coated using BSM [3 μg / mL] dissolved in 1×PBS. Absorbance was detected at 450 nm using a microplate reader. The absorbance values were normalized against the background and plotted as the percentage of the dose-response effect against the antibody dose (log scale) as shown in the graph. The EC50 (μg / mL) was calculated for each condition. Thus, in one aspect, the present invention provides humanized antibody clones that bind to the antigen STn, where the EC50 by the test described above is less than 0.5, for example, in the range of 0.05 to 0.5. For example, this can be in the range of 0.3238 to 0.4573 for the V1 clone; 0.06649 to 0.1365 for the V2 clone, and 0.3440 to 0.4490 for the V3 clone.
[0139] The antibody clone V2 disclosed herein has a percentage of dose-response effect three times higher in binding affinity measured by the BSM ELISA described herein compared to the other mAb clones V1 and V3, thus suggesting better binding activity at lower concentrations. The relative EC50 values are included in the legend of Figure 8, showing a three-fold decrease in EC50 in V2 compared to the V1 and V3 clones. At the same time, these results indicate that these humanized variants have good binding properties to the target antigen STn.
[0140] Binding to STn+ cell lines Figure 9 shows the results of the binding of humanized clones to several STn+ cell lines. Within these cell lines, four showed different levels of native STn expression, including low (LS174T, OVCAR8), medium (SNU16), and high (OV90), while two cell lines showed genetic overexpression of STn (PANC1-STn and MDA-MB-231-STn). As a result of the different STn expression levels in these cell lines, lower EC50s (higher binding at lower doses) were shown in the highly expressing cell lines compared to these cell lines with low STn expression. Nevertheless, the results showed that the three mAb variants (V1, V2, and V3) shown maintained high binding to different cell lines expressing STn, indicating clustering to the STn antigen binding profile.
[0141] NMR Figure 10 illustrates how NMR studies can identify the points of contact / interaction between an antibody and a glycan molecule. The data were obtained as saturation transfer difference (STD) using nuclear magnetic resonance (NMR) to study the interaction between the ligand STn and the mAb in solution. In this experiment, according to the legend on the right side of the scheme, using the humanized variant 6 (V6), it was observed that the antibody binds mostly to the sialic acid portion of STn (larger circles of 100 - 76% STD), but also interacts with the GalNac portion.
[0142] SPR Figure 11 summarizes the surface plasmon resonance (SPR) data used to measure the affinity and kinetic parameters of different anti-STn antibodies. BSA-STn was immobilized on the chip, and the antibody was injected onto the surface as the association step. The humanized clones (V1, V2, and V3) tested showed high affinity for BSA-STn with KD values in the range of 29 nM to 39 nM. No interaction was detected between the CBS-PC clone (human positive STn control) and BSA-STn.
[0143] Glycan array Figures 12 and 19 illustrate that this assay can evaluate the binding specificity and binding strength of antibodies to a panel of α2-6 sialylated glycans by using chips with different immobilized glycan probes. Figure 12A shows a two-fold increase in the binding to STn via serine when using V1 and V3 clones as compared to the "positive control" mAb. Figure 12B shows how the humanized mAb maintained its specificity for STn-Ser as compared to the parental L2A5 mAb, and that the humanization process did not alter the mAb properties but showed an increase in binding to the STn-Thr probe as compared to parental L2A5, confirming that it clearly shows an improvement in binding to the target. Additionally, Figure 19 shows how the affinity matured clones and the first-generation humanized clone V1 showed an approximately 30-fold increase in the binding of STn-Ser as compared to the CBS-PC control antibody. Finally, a 30-fold increase in the binding to STn-Thr was shown in V64 and V25, while a 10-fold increase was shown in V1, V46, and V53 as compared to the CBS-PC control antibody. At the same time, this data clearly shows that the increase in the binding affinity of this antibody is through not only STn-Ser but also STn-Thr.
[0144] In-silico immunogenicity analysis Depending on the HLA status and other factors, therapeutic antibodies can be immunogenic and induce an immune response that can lead to premature elimination or neutralization of the molecule (human anti-mouse monoclonal antibody response, or HAMA). To analyze the humanized CBS variants and predict their overall immunogenicity as compared to the chimeric CBS version (as previously disclosed in WO 2019147152A1 pamphlet), in-silico tools were used to analyze the antibody sequences. As shown in Figures 13A - D, the results from this analysis are useful for predicting the overall immunogenicity, and the inventors have found that this can be used, if necessary, as a guide for further sequence optimization.
[0145] Figures 13(A - D) illustrate the VH and VL affinity predictions in V1 and V2 compared to the chimeric / parental L2A5 Ab. Using the NetMHCIIPan 4.0 tool, the parameters were set using the position in the protein sequence, Rank EL% (percentile rank of the predicted score of the eluted ligand), BA (Binding Affinity), SB (Strong Binder), and WB (Weak Binder). The antibody sequences were uploaded in FASTA format. The affinity values were calculated based on the binding affinity (BA) provided by the tool (1 / EC50 × 100).
[0146] Results obtained from the analysis of the variable heavy chain (VH) showed that both CBS - V1 and CBS - V2 had a decrease in the number of immunogenic peptides compared to the chimeric CBS (chimeric L2A5) antibody (Figures A - B). Finally, the prediction results of the variable light chain (VL) showed that CBS - V1 had a decrease in the number of immunogenic peptides compared to the chimeric CBS (chimeric L2A5) antibody, while CBS - V2 showed an increase in the number of immunogenic peptides compared to the chimeric CBS (Figures C - D).
[0147] Using these in - silico predictions, the overall decrease in immunogenic peptides in the humanized clones V1 and V2 as seen compared to the chimeric L2A5 Ab provides evidence that these variants are less immunogenic compared to the chimeric CBS and are thus more suitable for further development.
[0148] Internalization assay The purpose of this study was to evaluate the internalization kinetics of the CBS anti - STn antibody in breast cancer cell lines (MDA - MB231 - STn) overexpressing STn. To evaluate this feature, the inventors used humanized Ab clones (V1 and V2) along with negative (IgG) and positive (3F1) antibody controls to evaluate the internalization assay as shown in Figure 14.
[0149] Figure 14 shows the results from an antibody internalization assay using humanized Ab variants (V1, V2) in the breast cancer cell line MDA-MB231 overexpressing STn. 1×10 5 target cells (MDA-MB-231 STn+) per well were seeded in a 96-well plate. Antibodies (10 ug / mL) were incubated with the target cells for 2 hours, 6 hours, or 16 hours (triplicates for each condition), pHrodo fluorescence was measured by flow cytometry, and human IgG1 [2.59 mg / mL] (Abcam, lot GR3218380-20) was used as a negative control. The commercially available anti-STn antibody 3F1 [2.57 mg / mL] was used as a positive control, and humanized variants V1 and V2 [1 mg / mL] were tested in the assay. In this assay, the antibodies were labeled with the Zenon pHrodo fluorophore (Invitrogen, catalog Z25611), which is activated only under the low pH conditions found in early endosomes. Antibody internalization was indirectly evaluated by measuring pHrodo fluorescence by flow cytometry. The signal-to-background ratio (S / B) was calculated by dividing the MFI data from each antibody by the background (target cells only) MFI. The S / B data were plotted as mean + / - SD for each time point.
[0150] In conclusion, CBS-V1 and CBS-V2 showed a higher internalization profile in MDA-MB-231 STn+ cells compared to the 3F1 mAb. Internalization was time-dependent and showed a medium to fast internalization kinetics with a signal close to the peak at 6 hours.
[0151] TMA (tissue microarray) To quantitatively evaluate the Ab-binding ability of the newly created humanized Ab-clones, the inventors performed immunohistochemical examination (IHC) using anti-human STn V1, V2, and V3 Abs on TMA slides. In this analysis, the following Abs were tested using different TMA panels as cancer-tumors (40 types, 95 cases) and cancer metastases (48 cases). Representative IHC images using V1, V2, and V3, along with controls (primary and isotype-free), are shown in FIG. 15.
[0152] FIG. 15 shows representative IHC staining using humanized V1, V2, and V3 antibody clones in colon cancer and different metastatic tissues. Immunohistochemical examination (IHC) was performed on formalin-fixed paraffin-embedded (FFPE) human colon cancer tissues using citrate buffer pH 6.0, a Leica Bond automated immunostainer, and three anti-STn antibodies V1, V2, and V3 (1:5000) with negative (no primary antibody control) and human IgG isotype controls. Staining was visualized in DAB (brown), and hematoxylin was used as nuclear counterstaining (blue). Whole-slide images were created using Panoramic SCAN (manufactured by 3D Histech). The scale bar in the figure represents 50 μm.
[0153] Results were obtained using IHC together with humanized Abs (V1, V2, and V3), and strong affinity for the target antigen STn was shown in both colorectal cancer and metastatic tissues compared to controls (primary and human isotype-free). Interestingly, all three human variants of anti-STn showed very similar binding patterns.
[0154] Conclusion - Humanized Findings and conclusions that can be derived from the results obtained are as follows. · Humanized clones derived from parental L2A5 were found to be successfully created · Variants V1, V2, and V3 were shown to maintain high binding and specificity for STn ·V1 and V2 are predicted to have lower immunogenicity compared to the parental clone. ·The inventors used V1 as a starting point for the affinity maturation process and further results therefrom are described below.
[0155] Affinity matured clone Results EC50 ELISA-BSM This was performed for the affinity matured clones as described above.
[0156] Figure 16 shows the results of EC50 ELISA for specific clones (selected after the affinity maturation process) having point mutations in the CDR regions, which were screened against BSM mucin by ELISA. The results show that the affinity matured variants have lower EC50 and an increase in binding efficiency of 0.5 - 1 fold at lower concentrations compared to the parental V1 clone.
[0157] EC50 cell lines - COLO205, SNU16, OV90, MDA-MB-231-STn This was performed for the affinity matured clones as described above.
[0158] Figure 17 shows the results of the binding profiles of new affinity matured antibody variants in cell lines having different STn expression levels. Each antibody was titrated using a 7-point concentration curve and the binding strength was measured by flow cytometry using a secondary antibody conjugated to a fluorophore.
[0159] Based on the binding results obtained in MDA-MB-231 STn cells, the EC50 for each antibody was calculated and these are shown in Figure 18. The table summarizes the EC50 and the detected maximum MFI obtained for each clone.
[0160] Accordingly, in one aspect, the present invention provides an affinity matured humanized antibody clone described herein that binds to antigen STn, wherein the EC50 by the test described above is at least 145 ng / mL or less, preferably at least 110 ng / mL or less, more preferably at least 100 ng / mL or less, or at least 80 ng / mL or less.
[0161] Glycan array - affinity matured clone This was performed for the affinity matured clone as described above.
[0162] The affinity matured clone was evaluated on a glycan array using different sialylated probes, and the results are shown in Figure 19. It was found that the affinity matured clone maintained specificity for STn - serine and STn - threonine (probes 3 and 4), but showed only residual binding to other probes.
[0163] Conclusion - Affinity maturation Findings and conclusions that can be derived from the results obtained are as follows. · Introduction of point mutations in specific regions of the V1 CDR created clones with higher binding affinity. · Despite the higher binding affinity, the affinity matured clone remains specific for STn. This is a surprising result.
Claims
**Claim 1** An antibody or a fragment thereof that binds to a sialyl Tn (STn) antigen, wherein the antibody (a) is a heavy chain variable region (VH) that (i) contains complementarity-determining regions (CDRs) selected from the group consisting of H-CDR1, H-CDR2, and H-CDR3, each shown in any one of SEQ ID NOs: 1-24 or 49-88, and the VH and / or (b) is a light chain variable region (VL) that (i) contains complementarity-determining regions (CDRs) selected from the group consisting of L-CDR1, L-CDR2, and L-CDR3, each shown in any one of SEQ ID NOs: 25-48 or 89-128, and the VL An antibody or a fragment thereof comprising the above. **Claim 2** The antibody or a fragment thereof according to claim 1, wherein the antibody comprises a heavy chain variable region (VH) and a light chain variable region (VL). **Claim 3** The antibody has the following pairs of heavy chain CDRs and light chain CDRs: The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 1 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 25; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 2 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 26; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 3 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 27; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 4 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 28; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 5 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 29; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 6 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 30; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 7 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 31; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 8 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 32; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 9 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 33; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 10 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 34; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 11 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 35; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 12 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 36; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 13 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 37; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 14 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 38; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 15 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 39; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 16 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 40; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 17 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 41; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 18 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 42; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 19 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 43; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 20 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 44; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 21 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 45; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 22 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 46; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 23 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 47; or The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 24 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 48 The antibody or fragment thereof according to claim 1 or 2, comprising one of the pairs.
4. The antibody has the following pairs of heavy chain CDRs and light chain CDRs: The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 1 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 25; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 3 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 27; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 2 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 26 The antibody or fragment thereof according to claim 3, comprising one of the pairs.
5. The antibody has the following pairs of light chain CDRs and heavy chain CDRs: The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 49 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 89; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 50 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 90; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 51 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 91; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 52 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 92; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 53 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 93; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 54 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 94; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 55 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 95; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 56 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 96; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 57 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 97; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 58 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 98; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 59 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 99; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 60 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 100; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 61 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 101; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 62 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 102; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 63 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 103; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 64 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 104; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 65 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 105; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 66 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 106; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 67 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 107; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 68 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 108; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 69 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 109; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 70 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 110; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 71 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 111; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 72 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 112; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 73 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 113; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 74 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 114; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 75 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 115; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 76 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 116; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 77 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 117; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 78 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 118; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 79 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 119; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 80 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 120; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 81 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 121; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 82 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 122; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 83 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 123; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 84 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 124; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 85 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 125; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 86 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 126; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 87 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 127; or The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 88 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 128 The antibody or fragment thereof according to claim 1 or 2, comprising one of the above.
6. The antibody has the following pairs of heavy chain CDRs and light chain CDRs: The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 49 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 89; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 70 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 110; The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 81 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 121; or The pair of H-CDR1, H-CDR2, and H-CDR3 shown in SEQ ID NO: 88 and L-CDR1, L-CDR2, and L-CDR3 shown in SEQ ID NO: 128 The antibody or fragment thereof according to claim 5, comprising one of the above.
7. The antibody is (a) a heavy chain variable region (VH) comprising a humanized heavy chain framework region, said VH, and / or (b) a light chain variable region (VL) comprising a humanized light chain framework region, said VL The antibody or fragment thereof according to any one of claims 1 to 6, comprising the above.
8. The antibody is (a) a heavy chain variable region (VH) (i) each of SEQ ID NOs: 1 to 24 or 49 to 88 A humanized heavy chain framework region shown by a heavy chain variable region (VH) sequence selected from the group consisting of and / or (b) a light chain variable region (VL), wherein (ii) each is any one of SEQ ID NOs: 25 to 48 or 89 to 128 A VL containing a humanized light chain framework region shown by a light chain variable region (VL) sequence selected from the group consisting of The antibody or fragment thereof according to any one of claims 1 to 7, comprising
9. The antibody or fragment thereof according to claim 7, wherein the antibody comprises one of the following pairs of a light chain framework region and a heavy chain framework region, the heavy chain framework region is as shown by a heavy chain variable region (VH) sequence shown below, and the light chain framework region is as shown by a light chain variable region (VL) sequence shown below: A pair of the heavy chain framework region of SEQ ID NO: 1 and the light chain framework region of SEQ ID NO: 25; A pair of the heavy chain framework region of SEQ ID NO: 2 and the light chain framework region of SEQ ID NO: 26; A pair of the heavy chain framework region of SEQ ID NO: 3 and the light chain framework region of SEQ ID NO: 27; A pair of the heavy chain framework region of SEQ ID NO: 4 and the light chain framework region of SEQ ID NO: 28; A pair of the heavy chain framework region of SEQ ID NO: 5 and the light chain framework region of SEQ ID NO: 29; A pair of the heavy chain framework region of SEQ ID NO: 6 and the light chain framework region of SEQ ID NO: 30; A pair of the heavy chain framework region of SEQ ID NO: 7 and the light chain framework region of SEQ ID NO: 31; A pair of the heavy chain framework region of SEQ ID NO: 8 and the light chain framework region of SEQ ID NO: 32; A pair of the heavy chain framework region of SEQ ID NO: 9 and the light chain framework region of SEQ ID NO: 33; A pair of the heavy chain framework region of SEQ ID NO: 10 and the light chain framework region of SEQ ID NO: 34; A pair of the heavy chain framework region of SEQ ID NO: 11 and the light chain framework region of SEQ ID NO: 35; A pair of the heavy chain framework region of SEQ ID NO: 12 and the light chain framework region of SEQ ID NO: 36; A pair of the heavy chain framework region of SEQ ID NO: 13 and the light chain framework region of SEQ ID NO: 37; A pair of the heavy chain framework region of SEQ ID NO: 14 and the light chain framework region of SEQ ID NO: 38; A pair of the heavy chain framework region of SEQ ID NO: 15 and the light chain framework region of SEQ ID NO: 39; A pair of the heavy chain framework region of SEQ ID NO: 16 and the light chain framework region of SEQ ID NO: 40; Pair of the heavy chain framework region of SEQ ID NO: 17 and the light chain framework region of SEQ ID NO: 41; Pair of the heavy chain framework region of SEQ ID NO: 18 and the light chain framework region of SEQ ID NO: 42; Pair of the heavy chain framework region of SEQ ID NO: 19 and the light chain framework region of SEQ ID NO: 43; Pair of the heavy chain framework region of SEQ ID NO: 20 and the light chain framework region of SEQ ID NO: 44; Pair of the heavy chain framework region of SEQ ID NO: 21 and the light chain framework region of SEQ ID NO: 45; Pair of the heavy chain framework region of SEQ ID NO: 22 and the light chain framework region of SEQ ID NO: 46; Pair of the heavy chain framework region of SEQ ID NO: 23 and the light chain framework region of SEQ ID NO: 47; or Pair of the heavy chain framework region of SEQ ID NO: 24 and the light chain framework region of SEQ ID NO:
48. [
10. ] The antibody according to claim 7 or a fragment thereof, wherein the antibody comprises one of the following pairs of a light chain framework region and a heavy chain framework region, the heavy chain framework region is as shown in the heavy chain variable region (VH) sequence shown below, and the light chain framework region is as shown in the light chain variable region (VL) sequence shown below: Pair of the heavy chain framework region of SEQ ID NO: 49 and the light chain framework region of SEQ ID NO: 89; Pair of the heavy chain framework region of SEQ ID NO: 50 and the light chain framework region of SEQ ID NO: 90; Pair of the heavy chain framework region of SEQ ID NO: 51 and the light chain framework region of SEQ ID NO: 91; Pair of the heavy chain framework region of SEQ ID NO: 52 and the light chain framework region of SEQ ID NO: 92; Pair of the heavy chain framework region of SEQ ID NO: 53 and the light chain framework region of SEQ ID NO: 93; Pair of the heavy chain framework region of SEQ ID NO: 54 and the light chain framework region of SEQ ID NO: 94; Pair of the heavy chain framework region of SEQ ID NO: 55 and the light chain framework region of SEQ ID NO: 95; Pair of the heavy chain framework region of SEQ ID NO: 56 and the light chain framework region of SEQ ID NO: 96; Pair of the heavy chain framework region of SEQ ID NO: 57 and the light chain framework region of SEQ ID NO: 97; Pair of the heavy chain framework region of SEQ ID NO: 58 and the light chain framework region of SEQ ID NO: 98; Pair of the heavy chain framework region of SEQ ID NO: 59 and the light chain framework region of SEQ ID NO: 99; Pair of the heavy chain framework region of SEQ ID NO: 60 and the light chain framework region of SEQ ID NO: 100; Pair of the heavy-chain framework region of SEQ ID NO: 61 and the light-chain framework region of SEQ ID NO: 101; Pair of the heavy-chain framework region of SEQ ID NO: 62 and the light-chain framework region of SEQ ID NO: 102; Pair of the heavy-chain framework region of SEQ ID NO: 63 and the light-chain framework region of SEQ ID NO: 103; Pair of the heavy-chain framework region of SEQ ID NO: 64 and the light-chain framework region of SEQ ID NO: 104; Pair of the heavy-chain framework region of SEQ ID NO: 65 and the light-chain framework region of SEQ ID NO: 105; Pair of the heavy-chain framework region of SEQ ID NO: 66 and the light-chain framework region of SEQ ID NO: 106; Pair of the heavy-chain framework region of SEQ ID NO: 67 and the light-chain framework region of SEQ ID NO: 107; Pair of the heavy-chain framework region of SEQ ID NO: 68 and the light-chain framework region of SEQ ID NO: 108; Pair of the heavy-chain framework region of SEQ ID NO: 69 and the light-chain framework region of SEQ ID NO: 109; Pair of the heavy-chain framework region of SEQ ID NO: 70 and the light-chain framework region of SEQ ID NO: 110; Pair of the heavy-chain framework region of SEQ ID NO: 71 and the light-chain framework region of SEQ ID NO: 111; Pair of the heavy-chain framework region of SEQ ID NO: 72 and the light-chain framework region of SEQ ID NO: 112; Pair of the heavy-chain framework region of SEQ ID NO: 73 and the light-chain framework region of SEQ ID NO: 113; Pair of the heavy-chain framework region of SEQ ID NO: 74 and the light-chain framework region of SEQ ID NO: 114; Pair of the heavy-chain framework region of SEQ ID NO: 75 and the light-chain framework region of SEQ ID NO: 115; Pair of the heavy-chain framework region of SEQ ID NO: 76 and the light-chain framework region of SEQ ID NO: 116; Pair of the heavy-chain framework region of SEQ ID NO: 77 and the light-chain framework region of SEQ ID NO: 117; Pair of the heavy-chain framework region of SEQ ID NO: 78 and the light-chain framework region of SEQ ID NO: 118; Pair of the heavy-chain framework region of SEQ ID NO: 79 and the light-chain framework region of SEQ ID NO: 119; Pair of the heavy-chain framework region of SEQ ID NO: 80 and the light-chain framework region of SEQ ID NO: 120; Pair of the heavy-chain framework region of SEQ ID NO: 81 and the light-chain framework region of SEQ ID NO: 121; Pair of the heavy-chain framework region of SEQ ID NO: 82 and the light-chain framework region of SEQ ID NO: 122; Pair of the heavy-chain framework region of SEQ ID NO: 83 and the light-chain framework region of SEQ ID NO: 123; Pair of the heavy chain framework region of SEQ ID NO: 84 and the light chain framework region of SEQ ID NO: 124; Pair of the heavy chain framework region of SEQ ID NO: 85 and the light chain framework region of SEQ ID NO: 125; Pair of the heavy chain framework region of SEQ ID NO: 86 and the light chain framework region of SEQ ID NO: 126; Pair of the heavy chain framework region of SEQ ID NO: 87 and the light chain framework region of SEQ ID NO: 127; or Pair of the heavy chain framework region of SEQ ID NO: 88 and the light chain framework region of SEQ ID NO:
128. **Claim 11** The antibody or fragment thereof according to any one of claims 7 to 10, wherein the heavy chain framework region and / or the light chain framework region has 80% sequence identity to the listed sequences. **Claim 12** The antibody or fragment thereof according to any one of claims 7 to 11, wherein the heavy chain framework region and / or the light chain framework region has 90% sequence identity to the listed sequences. **Claim 13** The antibody is (a) a heavy chain variable region (VH) that (i) is selected from the group consisting of any one of SEQ ID NOs: 1 to 24 or 49 to 88 for said VH, and / or (a) a light chain variable region (VL) that (ii) is selected from the group consisting of any one of SEQ ID NOs: 25 to 48 or 89 to 128 for said VL and includes the antibody or fragment thereof according to any one of claims 1 to 12. **Claim 14** The antibody has the following pairs of a heavy chain variable region (VH) and a light chain variable region (VL): Pair of SEQ ID NO: 1 and SEQ ID NO: 25; Pair of SEQ ID NO: 2 and SEQ ID NO: 26; Pair of SEQ ID NO: 3 and SEQ ID NO: 27; Pair of SEQ ID NO: 4 and SEQ ID NO: 28; Pair of SEQ ID NO: 5 and SEQ ID NO: 29; Pair of SEQ ID NO: 6 and SEQ ID NO: 30; Pair of SEQ ID NO: 7 and SEQ ID NO: 31; Pair of SEQ ID NO: 8 and SEQ ID NO: 32; Pair of SEQ ID NO: 9 and SEQ ID NO: 33; Pair of SEQ ID NO: 10 and SEQ ID NO: 34; Pair of SEQ ID NO: 11 and SEQ ID NO: 35; Pair of SEQ ID NO: 12 and SEQ ID NO: 36; Pair of SEQ ID NO: 13 and SEQ ID NO: 37; Pair of SEQ ID NO: 14 and SEQ ID NO: 38; Pair of SEQ ID NO: 15 and SEQ ID NO: 39; Pair of SEQ ID NO: 16 and SEQ ID NO: 40; Pair of SEQ ID NO: 17 and SEQ ID NO: 41; Pair of SEQ ID NO: 18 and SEQ ID NO: 42; Pair of SEQ ID NO: 19 and SEQ ID NO: 43; Pair of SEQ ID NO: 20 and SEQ ID NO: 44; Pair of SEQ ID NO: 21 and SEQ ID NO: 45; Pair of SEQ ID NO: 22 and SEQ ID NO: 46; Pair of SEQ ID NO: 23 and SEQ ID NO: 47; or The pair of SEQ ID NO: 24 and SEQ ID NO: 48 The antibody or fragment thereof according to claim 13, comprising one of the above.
15. The antibody has the following pairs of a heavy chain variable region (VH) and a light chain variable region (VL): The pair of SEQ ID NO: 49 and SEQ ID NO: 89; The pair of SEQ ID NO: 50 and SEQ ID NO: 90; The pair of SEQ ID NO: 51 and SEQ ID NO: 91; The pair of SEQ ID NO: 52 and SEQ ID NO: 92; The pair of SEQ ID NO: 53 and SEQ ID NO: 93; The pair of SEQ ID NO: 54 and SEQ ID NO: 94; The pair of SEQ ID NO: 55 and SEQ ID NO: 95; The pair of SEQ ID NO: 56 and SEQ ID NO: 96; The pair of SEQ ID NO: 57 and SEQ ID NO: 97; The pair of SEQ ID NO: 58 and SEQ ID NO: 98; The pair of SEQ ID NO: 59 and SEQ ID NO: 99; The pair of SEQ ID NO: 60 and SEQ ID NO: 100; The pair of SEQ ID NO: 61 and SEQ ID NO: 101; The pair of SEQ ID NO: 62 and SEQ ID NO: 102; The pair of SEQ ID NO: 63 and SEQ ID NO: 103; The pair of SEQ ID NO: 64 and SEQ ID NO: 104; The pair of SEQ ID NO: 65 and SEQ ID NO: 105; The pair of SEQ ID NO: 66 and SEQ ID NO: 106; The pair of SEQ ID NO: 67 and SEQ ID NO: 107; The pair of SEQ ID NO: 68 and SEQ ID NO: 108; The pair of SEQ ID NO: 69 and SEQ ID NO: 109; The pair of SEQ ID NO: 70 and SEQ ID NO: 110; The pair of SEQ ID NO: 71 and SEQ ID NO: 111; The pair of SEQ ID NO: 72 and SEQ ID NO: 112; The pair of SEQ ID NO: 73 and SEQ ID NO: 113; The pair of SEQ ID NO: 74 and SEQ ID NO: 114; The pair of SEQ ID NO: 75 and SEQ ID NO: 115; The pair of SEQ ID NO: 76 and SEQ ID NO: 116; The pair of SEQ ID NO: 77 and SEQ ID NO: 117; The pair of SEQ ID NO: 78 and SEQ ID NO: 118; The pair of SEQ ID NO: 79 and SEQ ID NO: 119; The pair of SEQ ID NO: 80 and SEQ ID NO: 120; The pair of SEQ ID NO: 81 and SEQ ID NO: 121; The pair of SEQ ID NO: 82 and SEQ ID NO: 122; The pair of SEQ ID NO: 83 and SEQ ID NO: 123; The pair of SEQ ID NO: 84 and SEQ ID NO: 124; The pair of SEQ ID NO: 85 and SEQ ID NO: 125; The pair of SEQ ID NO: 86 and SEQ ID NO: 126 The pair of SEQ ID NO: 87 and SEQ ID NO: 127; or The pair of SEQ ID NO: 88 and SEQ ID NO: 128 The antibody or fragment thereof according to claim 13, comprising one of the above.
16. L - CDR3 is further mutated such that the D (aspartic acid / aspartate) at position 93 is substituted with any one of the following amino acid residues: A, E, F, G, H, I, K, L, N, P, Q, R, S, T, V, W, or Y The antibody or fragment thereof according to any one of claims 1 to 15, wherein the substitution is made.
17. L - CDR3 is further mutated such that the P (proline) at position 94 is substituted with any one of the following amino acid residues: Substituted with any one of A, E, F, H, I, K, L, N, Q, R, T, V, W, or Y The antibody or fragment thereof according to any one of claims 1 to 16, further mutated so as to be substituted with any one of them.
18. The antibody or fragment thereof according to claim 16, wherein any one of the mutations shown for position 93 is paired with any one of the mutations shown for position 94 in claim 17.
19. L - CDR3 has the DP at positions 93 and 94 as a pair of the following amino acid residues: DA, DK, DN, EP, KP, NP, QP, RP, AA, EE, FF, GP, HH, II, KK, LL, NN, QQ, RR, SP, TT, VV, WW, or YY The antibody or fragment thereof according to claim 16, 17 or 18, further mutated so as to be substituted with any one of them.
20. The antibody or fragment thereof according to any one of claims 16 to 19, wherein the light chain variable sequence VL is as shown in any one of SEQ ID NOs: 150 to 173.
21. H - CDR2 has the D (aspartic acid / aspartate) at position 55 as the following amino acid residue: A, E, F, G, H, I, K, L, P, Q, R, V, W or Y The antibody or fragment thereof according to any one of claims 1 to 20, further mutated so as to be substituted with any one of them.
22. H - CDR2 has the G (glycine) at position 56 as the following amino acid residue: A, E, F, H, I, K, L, N, Q, R, T, V, W or Y The antibody or fragment thereof according to any one of claims 1 to 21, further mutated so as to be substituted with any one of them.
23. The antibody or fragment thereof according to claim 21, wherein any one of the mutations shown for position 55 is paired with any one of the mutations shown for position 56 in claim 22.
24. H - CDR2 has the DG at positions 55 and 56 as a pair of the following amino acid residues: DE, DK, DA, EG, QG, RG, AA, EE, FF, GG, HH, KK, LL, DN, PQ, QQ, RR, DT, VV, WW, or YY The antibody or fragment thereof according to claim 21, 22 or 23, further mutated so as to be substituted with any one of them.
25. The antibody or fragment thereof according to any one of claims 21 to 24, wherein the heavy chain variable sequence VH is as shown in any one of SEQ ID NOs: 129 to 149.
26. L - CDR3 has the "DP" at positions 93 and 94 as a pair of the following amino acid residues: further mutated so as to be substituted with any one of DA, DK, DN, EP, KP, NP, QP, RP, AA, EE, FF, GP, HH, II, KK, LL, NN, QQ, RR, SP, TT, VV, WW, or YY; H - CDR2 has DG at positions 55 and 56 replaced with a pair of the following amino acid residues: DE, DK, DA, EG, QG, RG, AA, EE, FF, GG, HH, KK, LL, DN, PQ, QQ, RR, DT, VV, WW, or YY and is further mutated so as to be substituted with any one of them; An antibody or a fragment thereof according to any one of claims 16 to 25.
27. L - CDR3 has "DP" at positions 93 and 94 replaced with a pair of the following amino acid residues: DA, DK, DN, EP, KP, NP, QP, or RP and is further mutated so as to be substituted with any one of them; H - CDR2 has DG at positions 55 and 56 replaced with a pair of the following amino acid residues: DE, DK, DA, EG, QG, or RG and is further mutated so as to be substituted with any one of them; An antibody or a fragment thereof according to any one of claims 16 to 26.
28. An antibody or a fragment thereof according to any one of claims 13 to 27, wherein the heavy - chain variable region (VH) and / or the light - chain variable region (VL) has 80% sequence identity to the recited sequences.
29. An antibody or a fragment thereof according to claim 28, wherein the heavy - chain variable region (VH) and / or the light - chain variable region (VL) has 90% sequence identity to the recited sequences.
30. An antibody or a fragment thereof according to any one of claims 1 to 29, which binds to STn and a group of glycans having α2,6 - linked sialic acid at the terminus.
31. An antibody or a fragment thereof according to claim 30, wherein the glycan having α2,6 - linked sialic acid at the terminus contains STn, 2,6 - sialyl T, di - sialyl T, or 2,6 - sialyl lactosamine.
32. An antibody or a fragment thereof according to any one of claims 1 to 31, which undergoes glycan modification at the glycosylation site.
33. An antibody or a fragment thereof according to any one of claims 1 to 32, which is in the form of a ScFv (single - chain variable fragment), monoclonal antibody, chimeric antibody, humanized antibody, bispecific antibody or multispecific antibody, antibody - drug conjugate (ADC), or cell therapy.
34. The antibody or fragment thereof according to any one of claims 1 to 33, which is a functional antibody fragment or probe thereof that binds to STn and a group of glycans having α2,6-linked sialic acid at the terminus.
35. A cell therapy composition comprising the antibody according to any one of claims 1 to 34 for inducing and migrating effector cells to a target, wherein the cell therapy includes techniques such as chimeric antigen receptor (CAR) therapy, natural killer (NK) cell therapy, and cell-specific engagers, thereby promoting target recognition and cytotoxicity against sTn-expressing cells, said cell therapy composition.
36. Use in the cell therapy application of the antibody according to any one of claims 1 to 34, wherein the antibody is an sTn antibody, and the sTn antibody sequence is incorporated into effector cells by genetic recombination and combined with various techniques including CAR-T, NK CAR, and cell-specific engagers to enable specific recognition and enhanced cytotoxicity against target cells expressing the sTn antigen, said use.
37. Use in the cell therapy application of the antibody according to any one of claims 1 to 34 for migrating effector cells to sTn-expressing target cells, wherein the antibody is an sTn antibody, and the cell therapy includes a wide range of techniques including, but not limited to, CAR-T, NK CAR, and cell-specific engagers, thereby promoting target cell cytotoxicity and immune-mediated responses against sTn-expressing cells, said use.
38. Use in the cell therapy application of the antibody according to any one of claims 1 to 34, wherein the antibody is an sTn antibody, and the sTn antibody is used for the induction and migration of effector cells by various techniques including CAR-T, NK CAR, and cell-specific engagers, enabling target recognition, activation, and cytotoxicity against cells expressing the sTn antigen, said use.
39. Use in the cell therapy application of the antibody according to any one of claims 1 to 34 for enabling target recognition and cytotoxicity by effector cells, wherein the antibody is an sTn antibody, and the cell therapy includes a wide range of techniques such as CAR-T, NK CAR, and cell-specific engagers, promoting the induction of effector cells to sTn-expressing cells and promoting immune-mediated responses, said use.
40. An antibody-drug conjugate (ADC) comprising an antibody, a linker, and a cytotoxic drug according to any one of claims 1 to 34.
41. A pharmaceutical composition comprising an antibody or a fragment thereof according to any one of claims 1 to 34, or an antibody-drug conjugate (ADC) according to claim 40, and a pharmaceutically acceptable carrier.
42. A method for detecting a tumor in a subject using an antibody or a fragment thereof according to any one of claims 1 to 34, or an antibody-drug conjugate (ADC) according to claim 40, or a pharmaceutical composition according to claim 41, the method comprising staining a biological sample obtained from the subject with a nucleotide sequence encoding an antibody according to any one of claims 1 to 34, or an antibody-drug conjugate (ADC) according to claim 40, under conditions suitable for specific binding of the antibody, wherein the presence or absence of binding of the sequence indicates the presence or absence of tumor cells expressing STn, 2,6-sialyl T, di-sialyl T, or 2,6-sialolactosamine on the cell surface, and optionally, the biological sample comprises isolated cells, or tissue, or tumor-derived protein, said method.
43. An antibody or a fragment thereof according to any one of claims 1 to 34, or an antibody-drug conjugate (ADC) according to claim 40, or a pharmaceutical composition according to claim 41, for use in medicine.
44. An antibody or a fragment thereof according to any one of claims 1 to 34, or an antibody-drug conjugate (ADC) according to claim 40, or a pharmaceutical composition according to claim 41, for use in the treatment of cancer.
45. A composition comprising a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof, wherein the antibody or fragment is as described in any one of claims 1 to 34, and the nucleotide sequence is encapsulated within an mRNA delivery system, and the mRNA delivery system is capable of promoting transient expression of the sTn antibody or antibody fragment in target cells, said composition.
46. The composition according to claim 45, wherein the mRNA delivery system comprises lipid-based nanoparticles, polymer-based nanoparticles, or viral vectors.
47. A method for delivering a monoclonal antibody or a functional antibody fragment thereof to a target cell, wherein the antibody or fragment is as described in any of claims 1 to 34, comprising: a) encapsulating a nucleotide sequence encoding the antibody or antibody fragment within an mRNA delivery system; b) administering the mRNA delivery system to the target cell; c) enabling the mRNA to be taken up and expressed by the target cell, thereby producing the antibody or antibody fragment within the target cell.
48. The method according to claim 47, wherein the mRNA delivery system is further modified with a targeting moiety so as to enhance specific uptake by target cells expressing sialyl Tn (STn) antigen.
49. A therapeutic composition comprising the mRNA delivery system according to claim 46 and a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof that specifically binds to sialyl Tn (STn) antigen, formulated for administration to a subject.
50. The therapeutic composition according to claim 49, further comprising a carrier or excipient suitable for systemic or local administration to a subject.
51. A method for treating cancer characterized by overexpression of sialyl Tn (STn) antigen, comprising: a) incorporating a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof that binds to STn antigen into an mRNA delivery system; b) administering the mRNA delivery system to a subject in need thereof, thereby enabling expression of the antibody or antibody fragment within the cells of the subject and selectively targeting STn-expressing cancer cells.
52. The therapeutic composition according to claim 49 or 50, or the method according to claim 51, wherein the monoclonal antibody or the functional antibody fragment thereof comprises the antibody or the fragment as described in any of claims 1 to 34.
53. A theranostic composition comprising an mRNA delivery system comprising a nucleotide sequence encoding a monoclonal antibody or a functional antibody fragment thereof as described in any of claims 1 to 34 that specifically binds to sialyl Tn (STn) antigen and a detectable label, enabling both therapeutic delivery to and imaging of STn-expressing cancer cells.
54. A method for treating cancer in an animal or human characterized by overexpression of the sialyl Tn (STn) antigen, the method comprising administering to a subject in need thereof a therapeutic composition comprising an antibody or a fragment thereof according to any of claims 1 to 34, whereby selectively targeting and treating STn-expressing cancer cells in the animal or human.
55. An expression vector comprising a polynucleotide encoding an antibody according to any of claims 1 to 34.
56. A host cell comprising the expression vector according to claim 55.
57. A method for producing an antibody or a fragment thereof according to any of claims 1 to 34, the method comprising using the host cell according to claim 56.
58. A polynucleotide sequence encoding an antibody or a functional antibody fragment thereof, wherein the antibody or the fragment thereof is as described in any of claims 1 to 34.
59. The polynucleotide sequence according to claim 58, comprising mRNA.
60. An mRNA delivery system comprising the polynucleotide according to claim 58 or 59.
Citation Information
Patent Citations
L2a5 antibody or functional fragment thereof against tumour antigens
WO2019147152A1