Oligonucleotide Composition and Method Thereof

Oligonucleotides with specific modifications targeting SARM1 transcripts provide effective knockdown of SARM1 mRNA and protein, addressing the limitations of existing treatments for SARM1-related diseases with therapeutic efficacy for neurodegenerative conditions.

JP2025523905APending Publication Date: 2025-07-25AMYLYX PHARMA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025502513
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-21
Filing Date
2023-07-21
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

Existing treatments for conditions, disorders, or diseases associated with SARM1 are inadequate, and there is a need for oligonucleotides that can effectively reduce SARM1 transcripts and polypeptides to prevent or treat these conditions.

Method used

Development of oligonucleotides with specific base sequences and modifications, such as nucleobase and sugar modifications, and internucleotide linkages, particularly phosphorothioate linkages, that can hybridize to SARM1 transcripts and reduce their levels.

Benefits of technology

The oligonucleotides effectively knockdown SARM1 mRNA and protein levels, providing therapeutic benefits for neurodegenerative conditions like ALS and other diseases associated with SARM1, with minimal cytotoxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025523905000100
    Figure 2025523905000100
  • Figure 2025523905000101
    Figure 2025523905000101
  • Figure 2025523905000102
    Figure 2025523905000102
Patent Text Reader

Abstract

In particular, the present disclosure provides oligonucleotides targeting SARM1 and compositions thereof. In some embodiments, the present disclosure provides methods for preventing or treating various conditions, disorders, or diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - reference to Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 391,161, filed on July 21, 2022, the entire disclosure of which is hereby incorporated by reference herein.

Background Art

[0002] Oligonucleotides are useful in a variety of applications, such as therapeutic, diagnostic, and / or research applications. For example, oligonucleotides that target various genes can be useful in the treatment of conditions, disorders, or diseases associated with such target genes.

Summary of the Invention

Problems to be Solved by the Invention

[0003] In particular, the present disclosure provides techniques (e.g., oligonucleotides, compositions, methods, etc.) for treating various conditions, disorders, or diseases associated with SARM1. In some embodiments, the present disclosure provides oligonucleotides that include various modifications, such as nucleobase modifications, sugar modifications, internucleotide linkage modifications, etc., and can hybridize to SARM1 transcripts. In some embodiments, the present disclosure provides oligonucleotides and compositions thereof that can reduce the level of SARM1 transcripts when administered or delivered to a system that includes or expresses SARM1 transcripts. In some embodiments, the techniques provided reduce the level of SARM1 transcripts and / or polypeptides in a system. In some embodiments, the present disclosure provides techniques for preventing and / or treating various conditions, disorders, or diseases associated with SARM1.

Means for Solving the Problems

[0004] In some embodiments, the present disclosure encompasses the recognition that oligonucleotides of certain base sequences may be more effective in reducing the levels of SARM1 transcripts (e.g., SARM1 mRNA) and / or its products (e.g., SARM1 polypeptide). In some embodiments, the base sequence of the oligonucleotide is CCACTAGCCCTGGGAGCAAA, GCCATCTCCATCCATAGAGC, AGGAGAGCTGTGGGCTTGGG, CACCCATGCCTCCCAGCAGA, GCTGGCTGTACTCACTCTCC, GTGCTCTGTCCTTGGTCCTG, CCCATTCTCATGCAGCCTAC, CTGTGACCTAGGCTCCTTGA, GGTCTGAGAGGCTGTGGGTC, GCTCCCAGTTCTTCTGTGGT, GATGTCCTCCACAGGTGACA, GCTTCCTGCCTTACTGACCT, CTCTCCTTTGTCCCTGACCA, GCCTTGCCTTTTCCTCACTC, GCCTGGTCACTAACCCTCTC, CACCCACCTTGGTCTTGCCT, CACACTGATGTCCTGTCCCA, CACACCTCTGGGTCTTGGCC, GCTGCCCATCACTCCCAGTT, CTCTCCATCTGCCCTGGCCC, CAGTCCCTCTCCTTGTCTCT, ATCCACCTGCTGCTCCTGGG, CCCTTGTGTCTTGTGGGTGC, GCCCTAGGATTTTCCTGTTG, GCCTCAACTCCTGCCTCCCA, AGACACCTGGGTATCAGCCT, TCCTTCTTCCCTATTTCCCA, GCATCACTCACTGTCAGGTA, GTCAGTGCCACAGCCTTGTC, GGCACCTACCTTATGCACCC, ACTACTGCATCCCTCAGCCC, GCTTGTCTCATCCTGTCTCT, TGTCTCTGAGCTGACTGCTT,GGGCTTGACTCCACACTCCA, GGCATGGCATCTCAGCTTCA, TTCAGGATCACCTAGCTGGT, CCTCTTTGCCATCTGCTGGG, GAGTGCAGTTCACTTGTGGT, TGCCCACACTCTGCCTGTCA, CAGAGGGAGCTGCTAGTCAG,TTGGCAAAGGTGATGCAGGC, CCTCCACCAGTTGGAAGACC, GGTTCTCAGCCACCAGGATC, GTGCTCCAAGATGCCTGCCA, CCTTGCAGGCTCTTGATGGC, GTGCCATTGGTAGAGTAGGA, GTGAGCTCCCTAAAGAACCT, GGTTTGCCACCAGTACAGGG, TCCAGCTTCTCCACATCAAT, GAACTTGCCTGCTTCCAGCT, ACACTCTGGATGAGTTTGTC, GGGCACCCATGACACTCTGG, ACTTGTCCAGTGCTCCAGGT, CCCCAATCCTTGCAGTCATGG, AGCACAGCCTGCATGTCCTC, CAAACTGGTGTCAGAGCCTG, GCAGCACCCTCCAAACTGGT, TGGTTAGGTTGGACCCATGG, GCCCAGGTTGTCTCAGCCCA, TCCCTCTCCAGATACTGAGG, ACAGACAACCCAATGGCAGG, GTCTCCAGAACTGAGCAGGG, CCTTAATTCCTGTCTGAGGC, CAGAATACAGTGCCCAGGCC, CCCAGGCCCTTGCTCAGAAT, GCACTCATCCCTGGCTGGCT, GATTACAGGGCAAGGCCACA, GCCCTGGATGTGGCAAAAGA, AAGGAAGTCAGAGGGAGGGC, CAGGCCCAAACAGGAGGCTC, ATGCCCAGACCCAGGCCCAA, CTGAGGCACAGCACCAAGGC, GCCAGACCAGGAAGGAGCCT, TCAGGACTTTGCCTCTTTCC, GCTTTAGAGATTTGCTACCC, GCCCAGCCTCAGAATGATTC, CCTCTGAACCCAGTGGAGGA, GCCTGGGTTTATTGGAGGGT, GCCAGCACAGCCAAGAGTGG, or about five or more (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) consecutive nucleobases of GGGAGTGGAAGGAAGGAGCC, wherein each T is optionally and independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide is CCACTAGCCCTGGGAGCAAA,GCCATCTCCATCCATAGAGC, AGGAGAGCTGTGGGCTTGGG, CACCCATGCCTCCCAGCAGA, GCTGGCTGTACTCACTCTCC, GTGCTCTGTCCTTGGTCCTG, CCCATTCTCATGCAGCCTAC, CTGTGACCTAGGCTCCTTGA, GGTCTGAGAGGCTGTGGGTC, GCTCCCAGTTCTTCTGTGGT, GATGTCCTCCACAGGTGACA, GCTTCCTGCCTTACTGACCT, CTCTCCTTTGTCCCTGACCA, GCCTTGCCTTTTCCTCACTC, GCCTGGTCACTAACCCTCTC, CACCCACCTTGGTCTTGCCT, CACACTGATGTCCTGTCCCA, CACACCTCTGGGTCTTGGCC, GCTGCCCATCACTCCCAGTT, CTCTCCATCTGCCCTGGCCC, CAGTCCCTCTCCTTGTCTCT, ATCCACCTGCTGCTCCTGGG, CCCTTGTGTCTTGTGGGTGC, GCCCTAGGATTTTCCTGTTG, GCCTCAACTCCTGCCTCCCA, AGACACCTGGGTATCAGCCT, TCCTTCTTCCCTATTTCCCA, GCATCACTCACTGTCAGGTA, GTCAGTGCCACAGCCTTGTC, GGCACCTACCTTATGCACCC, ACTACTGCATCCCTCAGCCC, GCTTGTCTCATCCTGTCTCT, TGTCTCTGAGCTGACTGCTT, GGGGCTTGACTCCACACTCCA, GGCATGGCATCTCAGCTTCA, TTCAGGATCACCTAGCTGGT, CCTCTTTGCCATCTGCTGGG, GAGTGCAGTTCACTTGTGGT, TGCCCACACTCTGCCTGTCA, CAGAGGGAGCTGCTAGTCAG, TTGGCAAAGGTGATGCAGGC, CCTCCACCAGTTGGAAGACC, GGTTCTCAGCCACCAGGATC, GTGCTCCAAGATGCCTGCCA, CCTTGCAGGCTCTTGATGGC, GTGCCATTGGTAGAGTAGGA, GTGAGCTCCCTAAAGAACCT, GGTTTGCCACCAGTACAGGGTCCAGCTTCTCCACATCAAT, GAACTTGCCTGCTTCCAGCT, ACACTCTGGATGAGTTTGTC, GGGCACCCATGACACTCTGG, ACTTGTCCAGTGCTCCAGGT, CCCAACTCCTTGCAGTCATGG, AGCACAGCCTGCATGTCCTC, CAAACTGGTGTCAGAGCCTG, GCAGCACCCTCCAAACTGGT, TGGTTAGGTTGGACCCATGG, GCCCAGGTTGTCTCAGCCCA, TCCCTCTCCAGATACTGAGG, ACAGACAACCCAATGGCAGG, GTCTCCAGAACTGAGCAGGG, CCTTAATTCCTGTCTGAGGC, CAGAATACAGTGCCCAGGCC, CCCAGGCCCTTGCTCAGAAT, GCACTCATCCCTGGCTGGCT, GATTACAGGGCAAGGCCACA, GCCCTGGATGTGGCAAAAGA, AAGGAAGTCAGAGGGAGGGC, CAGGCCCAAACAGGAGGCTC, ATGCCCAGACCCAGGCCCAA, CTGAGGCACAGCACCAAGGC, GCCAGACCAGGAAGGAGCCT, TCAGGACTTTGCCTCTTTCC, GCTTTAGAGATTTGCTACCC, GCCCAGCCTCAGAATGATTC, CCTCTGAACCCAGTGGAGGA, GCCTGGGTTTATTGGAGGGT, GCCAGCACAGCCAAGAGTGG, or GGGAGTGGAAGGAAGGAGCC.,

[0005] In some embodiments, oligonucleotides are provided that include various modifications such as nucleobase modifications, sugar modifications, internucleotide linkage modifications, and the like. A variety of useful modifications are available in the art and can be utilized in accordance with the present disclosure. In some embodiments, the modifications provide various advantages such as improved stability, binding affinity, pharmacokinetic profile, pharmacodynamic profile, and the like.

[0006] For example, in some embodiments, the oligonucleotides provided include various sugar modifications. In some embodiments, the modified sugar is 2'-OR sA natural RNA sugar having a modification, R s is an optionally substituted C 1-6 aliphatic, and -OR s replaces the 2'-OH group (2'-OR s "modified sugar"). In some embodiments, R s is an optionally substituted C 1-6 alkyl. In some embodiments, R s is -CH3. In some embodiments, R s is -CH2CH2OCH3.

[0007] In some embodiments, the provided oligonucleotide comprises or consists of a wing-core-wing structure, wherein in each wing, independently, there are about 1 to 10 (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleosides, in the core there are about 5 or more (e.g., about 5 - 20, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.) nucleosides, and each wing independently contains one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) modified sugars. In some embodiments, each sugar in the wing is independently a modified sugar. In some embodiments, each sugar in the wing is independently a 2'-OR s modified sugar. In some embodiments, the modified sugar is a 2'-MOE modified sugar (R s is -CH2CH2OCH3 for the 2'-OR s modified sugar). In some embodiments, each wing independently contains one or more (e.g., about 1, 2, 3, 4, 5 or more) 2'-MOE modified sugars. In some embodiments, each sugar in the wing is independently a 2'-MOE modified sugar. In some embodiments, the core region contains fewer modified sugars and / or a lower level of modified sugars compared to one or both wings. In some embodiments, there are no modified sugars in the core region. In some embodiments, each sugar in the core region is independently a natural DNA sugar.

[0008] In addition or alternatively, in some embodiments, the provided oligonucleotides include modified internucleotide linkages. In some embodiments, the modified internucleotide linkages provide improved properties and / or activities as compared to natural phosphate linkages. A variety of internucleotide linkages are available in the art and can be utilized in accordance with the present disclosure. In some embodiments, the modified internucleotide linkage is a phosphorothioate internucleotide linkage (-O-P(O)(SH)-O-), which may exist in various salt forms. In some embodiments, each linkage in the provided oligonucleotide is a phosphorothioate internucleotide linkage.

[0009] In some embodiments, the present disclosure provides techniques for preparing oligonucleotides and their compositions. In some embodiments, the provided oligonucleotides and their compositions are of high purity. In some embodiments, the oligonucleotides are provided, for example, in a phosphorothioate internucleotide linkage as a mixture of diastereomers with respect to the chiral linked phosphorus. In some embodiments, one or more diastereomers with respect to the chiral linked phosphorus are enriched in the provided composition.

[0010] As described herein, the oligonucleotides and compositions of the present disclosure can be provided / utilized in various forms. In some embodiments, the present disclosure provides one or more forms of oligonucleotides, for example, in acid form (e.g., where the natural phosphate linkage exists as -O(P(O)(OH)-O- and the phosphorothioate internucleotide linkage exists as -O(P(O)(SH)-O-), in salt form (e.g., where one or more or all of the natural phosphate linkages independently exist in salt form (e.g., sodium salt (-O(P(O)(O - Na + )-O-), where one or more or all of the phosphorothioate internucleotide linkages exist in salt form (e.g., sodium salt (-O(P(O)(S - Na +)-O-), hydrates, etc., to provide a composition containing the same. As will be understood by those skilled in the art, oligonucleotides can exist in various salt forms including pharmaceutically acceptable salts, and in solutions (e.g., various aqueous buffer systems), the cations can dissociate from the anions. In some embodiments, the present disclosure provides a pharmaceutical composition comprising the oligonucleotide provided and / or one or more of its pharmaceutically acceptable salts, and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is a buffer or includes a buffer. In some embodiments, the pharmaceutically acceptable carrier is buffered saline. In some embodiments, the pharmaceutically acceptable carrier is artificial cerebrospinal fluid (aCSF). In some embodiments, the pharmaceutically acceptable carrier is cerebrospinal fluid.

[0011] In some embodiments, the present disclosure describes useful techniques for evaluating oligonucleotides and their compositions. Certain useful techniques are described in the examples.

[0012] The provided technology can be utilized for various purposes. For example, in some embodiments, the provided technology is useful for preventing and / or treating various conditions, disorders, or diseases related to SARM1. In some embodiments, the present disclosure provides a method for preventing a condition, disorder, or disease, the method comprising administering or delivering an effective amount of the provided oligonucleotide to a subject susceptible thereto. In some embodiments, the present disclosure provides a method for treating a condition, disorder, or disease, the method comprising administering or delivering an effective amount of the provided oligonucleotide to a subject suffering therefrom. In some embodiments, the oligonucleotide is administered or delivered in a pharmaceutical composition. In some embodiments, the oligonucleotide is administered or delivered in one or more forms, for example, in the form of one or more pharmaceutically acceptable salts in some embodiments. In some embodiments, the oligonucleotide is administered or delivered in solution, for example, in an aCSF solution. Various techniques are available in the art and can be utilized to administer or deliver the provided oligonucleotide and its compositions. For example, in some embodiments, the oligonucleotide and compositions herein are administered or delivered intrathecally.

[0013] In some embodiments, the condition, disorder, or disease is a neurodegenerative condition, disorder, or disease. In some embodiments, the condition, disorder, or disease is or includes Wallerian degeneration. In some embodiments, the condition, disorder, or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder, or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder, or disease is a neuropathy. In some embodiments, the condition, disorder, or disease is a peripheral neuropathy. In some embodiments, the condition, disorder, or disease is a chemotherapy-induced peripheral neuropathy. In some embodiments, the condition, disorder, or disease is Parkinson's disease. In some embodiments, the condition, disorder, or disease is Huntington's disease. In some embodiments, the condition, disorder, or disease is Alzheimer's disease. In some embodiments, the condition, disorder, or disease is frontotemporal dementia. In some embodiments, the condition, disorder, or disease is a brain injury. In some embodiments, the condition, disorder, or disease is a traumatic brain injury. In some embodiments, the condition, disorder, or disease is progressive supranuclear palsy. In some embodiments, the condition, disorder, or disease is corticobasal degeneration. In some embodiments, the condition, disorder, or disease is Wolfram syndrome. In some embodiments, the condition, disorder, or disease is Friedreich's ataxia. In some embodiments, the condition, disorder, or disease is multiple system atrophy. In some embodiments, the condition, disorder, or disease is spinocerebellar ataxia. In some embodiments, the condition, disorder, or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder, or disease is Pick's disease. In some embodiments, the condition, disorder, or disease is progressive muscular atrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0014]

FIG. 1A - B

FIG. 2

FIG. 3A - B

FIG. 4

FIG. 5A - B

FIG. 6

Mode for Carrying Out the Invention

[0015] The technology of the present disclosure can be more easily understood by referring to the following detailed description of certain embodiments.

[0016] Definitions As used herein, unless otherwise indicated, the following definitions shall apply. For the purposes of the present disclosure, chemical elements are identified according to the Periodic Table, CAS version, Handbook of Chemistry and Physics, 75th Ed. In addition, general principles of organic chemistry are described in “Organic Chemistry”, Thomas Sorrell, University Science Books, Sausalito: 1999, and “March’s Advanced Organic Chemistry”, 5th Ed., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001.

[0017] As used herein in the present disclosure, unless clear from the context otherwise, (i) the terms “a” or “an” can be understood to mean “at least one”, (ii) the term “or” can be understood to mean “and / or”, (iii) the terms “comprising”, “comprise”, “including” (whether used with “without limitation” or not), and “include” (whether used with “without limitation” or not) can be understood to encompass item-by-item components or steps, whether presented by themselves or together with one or more additional components or steps, (iv) the term “another” can be understood to mean at least an additional / second one or more, (v) the terms “about” and “approximately” can be understood to allow for standard variations as understood by those skilled in the art, and (vi) when ranges are provided, endpoints are included.

[0018] Unless otherwise specified, descriptions of oligonucleotides and their elements (e.g., base sequences, sugar modifications, internucleotide linkages, linkage phosphorus stereochemistry, patterns thereof, etc.) are from 5' to 3'. As will be understood by those skilled in the art, in some embodiments, oligonucleotides can be provided and / or utilized in various forms, such as in the form of salts, particularly pharmaceutically acceptable salts, such as sodium salts. As will also be understood by those skilled in the art, in some embodiments, individual oligonucleotides within a composition can be in the same composition (e.g., a liquid composition) where a particular such oligonucleotide can be in different forms at a particular time, such as in the form of a salt (and may be dissolved, and the oligonucleotide chain may be present, for example, in anionic form(s) in a liquid composition), and still be considered to have the same constitution and / or structure. For example, those skilled in the art will understand that at a given pH, the internucleotide linkages between individual nucleotides along an oligonucleotide chain can be in the form of an acid (H) or one of a plurality of possible salt forms (e.g., sodium salt, or salts of different cations depending on which ions can be present in a preparation or composition), and that such individual oligonucleotides can be appropriately considered to have the same constitution and / or structure as long as those acid forms (e.g., when present, replacing all cations with H+) are of the same constitution and / or structure.

[0019] Aliphatic: As used herein, "aliphatic" means a straight-chain (i.e., unbranched) or branched-chain, substituted or unsubstituted hydrocarbon chain that is completely saturated or contains one or more unsaturated units (but is not aromatic), or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is completely saturated or contains one or more unsaturated units (but is not aromatic), or a combination thereof. In some embodiments, the aliphatic group contains from 1 to 50 aliphatic carbon atoms. In some embodiments, the aliphatic group contains from 1 to 20 aliphatic carbon atoms. In other embodiments, the aliphatic group contains from 1 to 10 aliphatic carbon atoms. In other embodiments, the aliphatic group contains from 1 to 9 aliphatic carbon atoms. In other embodiments, the aliphatic group contains from 1 to 8 aliphatic carbon atoms. In other embodiments, the aliphatic group contains from 1 to 7 aliphatic carbon atoms. In other embodiments, the aliphatic group contains from 1 to 6 aliphatic carbon atoms. In still other embodiments, the aliphatic group contains from 1 to 5 aliphatic carbon atoms, and in still other embodiments, the aliphatic group contains 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups, and their hybrids such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0020] Alkyl: As used herein, the term "alkyl" is given its ordinary meaning in the art and includes saturated aliphatic groups including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups, and cycloalkyl-substituted alkyl groups. In some embodiments, alkyl has from 1 to 100 carbon atoms. In certain embodiments, straight-chain or branched-chain alkyl has about 1 to 20 carbon atoms in its backbone (e.g., C1-C 20 , C2-C 20) and alternatively, have from about 1 to 10 carbon atoms. In some embodiments, the cycloalkyl ring has from about 3 to 10 carbon atoms in its ring structure when such a ring is monocyclic, bicyclic, or polycyclic, and alternatively, has about 5, 6, or 7 carbons in the ring structure. In some embodiments, the alkyl group can be a lower alkyl group, and a lower alkyl group contains 1 to 4 carbon atoms (e.g., C1-C4 for straight-chain lower alkyl).

[0021] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates, and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and / or parasites. In some embodiments, the animal may be a transgenic animal, a genetically engineered animal, and / or a clone.

[0022] Characteristic moiety: As used herein, the term "characteristic moiety" refers, in the broadest sense, to a part of a substance whose presence (or absence) correlates with the presence (or absence) of a particular characteristic, attribute, or activity of the substance. In some embodiments, the characteristic moiety of a substance is a part found in substances and related substances that share a particular characteristic, attribute, or activity, but not in substances that do not share that particular characteristic, attribute, or activity. In certain embodiments, the characteristic moiety shares at least one functional characteristic with the intact substance. For example, in some embodiments, the "characteristic moiety" of a nucleic acid is, in some embodiments, a part that includes the number of contiguous stretches of nucleobases that are characteristic of that nucleic acid.

[0023] Comparable: The term "comparable" is used herein to describe two (or more) sets of conditions or situations that are sufficiently similar to each other to enable comparison of the resulting outcomes or observed phenomena. In some embodiments, a comparable series of conditions or situations is characterized by a plurality of substantially identical features and one or a few varying features. One of ordinary skill in the art will understand that a series of conditions is comparable to another if the differences in the results or observed phenomena obtained under the different series of conditions or situations are caused by the variation of those varying features, or if the number and type of substantially identical features are sufficient to warrant a reasonable conclusion indicating the variation of the features.

[0024] Heteroatom: The term "heteroatom" as used herein means an atom other than carbon or hydrogen. In some embodiments, the heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including oxidized forms of nitrogen, sulfur, phosphorus, or silicon, charged forms such as nitrogen (e.g., quaternized forms, iminium groups, etc.), phosphorus, sulfur, oxygen, etc.). In some embodiments, the heteroatom is silicon, phosphorus, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is silicon, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is oxygen, sulfur, or nitrogen.

[0025] Identity: As used herein, the term "identity" refers to the overall relatedness between polymer molecules, such as between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered to be "substantially identical" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. The percent identity between two nucleic acid or polypeptide sequences can be calculated, for example, by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced into one or both of the first and second sequences for optimal alignment, and non-identical sequences can be ignored for comparison purposes). In certain embodiments, the length of the aligned sequences for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. The nucleotides at corresponding positions are then compared. If a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that needs to be introduced for optimal alignment of the two sequences. Comparison of sequences and determination of the percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the Meyers and Miller algorithm (CABIOS, 1989, 4:11-17) incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a 12 gap length penalty, and a 4 gap penalty.The percent identity between two nucleotide sequences can alternatively be determined using the GAP program in the GCG software package, using the NWSgapdna.CMP matrix.

[0026] Inter-nucleotide linkage: As used herein, the phrase "inter-nucleotide linkage" generally refers to the linkage that connects the nucleoside units of an oligonucleotide or nucleic acid. In some embodiments, the inter-nucleotide linkage is the phosphodiester linkage widely found in naturally occurring DNA and RNA molecules (the natural phosphate linkage (-OP(=O)(OH)O-), which may exist in salt form, as understood by those skilled in the art). In some embodiments, the inter-nucleotide linkage is a modified inter-nucleotide linkage (not a natural phosphate linkage). In some embodiments, the inter-nucleotide linkage is a "modified inter-nucleotide linkage" where at least one oxygen atom or -OH of the phosphodiester linkage is replaced by a different organic or inorganic moiety. In some embodiments, such organic or inorganic moieties are selected from =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R')3, -S-, -Se-, and -N(R')-, and each R' is independently -H, or a C having 1 to 5 heteroatoms 1-10 aliphatic, C 6-14 aryl, C 1-10 heteroaliphatic, an optionally substituted group selected from 5- to 10-membered heteroaryl having 1 to 5 heteroatoms, and 3- to 10-membered heterocyclyl having 1 to 4 heteroatoms, or two or more R' groups together with the intervening atoms form an optionally substituted 3- to 10-membered ring having 0 to 5 heteroatoms in addition to the intervening atoms. In some embodiments, the modified inter-nucleotide linkage is a phosphorothioate linkage. In some embodiments, the inter-nucleotide linkage is, for example, one of PNA (peptide nucleic acid) or PMO (phosphorodiamidate morpholino oligomer) linkages. Those skilled in the art will understand that the inter-nucleotide linkage may exist as an anion or cation at a given pH due to the presence of acidic or basic moieties during the linkage.

[0027] In vitro: As used herein, the term "in vitro" refers to events that occur not within a living organism (e.g., an animal, a plant, and / or a microorganism), but rather in an artificial environment, such as within a test tube or reaction vessel, within a cell culture, etc.

[0028] In vivo: As used herein, the term "in vivo" refers to events that occur within a living organism (e.g., an animal, a plant, and / or a microorganism).

[0029] Linking phosphorus: As defined herein, the phrase "linking phosphorus" refers to the phosphorus atom in which the particular phosphorus atom being referred to is present in the internucleotide linkage, and this phosphorus atom is used to indicate correspondence to the phosphorus atom of the phosphodiester internucleotide linkage present in naturally occurring DNA and RNA. In some embodiments, the linking phosphorus atom is in a modified internucleotide linkage, and each oxygen atom of the phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, the linking phosphorus atom is chiral (e.g., as in phosphorothioate internucleotide linkages). In some embodiments, the linking phosphorus atom is achiral (e.g., as in a natural phosphate linkage).

[0030] Modified nucleobase: Terms such as "modified nucleobase", "modified base", etc. refer to a chemical moiety that is chemically different from a nucleobase but can perform at least one function of a nucleobase. In some embodiments, the modified nucleobase is a nucleobase containing a modification. In some embodiments, the modified nucleobase can form a moiety in a polymer that can base pair with a nucleic acid containing at least a complementary sequence of the base, e.g., at least one function of the base. In some embodiments, the modified nucleobase is a substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobase in the context of an oligonucleotide refers to a nucleobase that is not A, T, C, G, or U.

[0031] Modified nucleoside: The term "modified nucleoside" refers to a moiety that is derived from or chemically similar to a natural nucleoside but contains a chemical modification that distinguishes it from the natural nucleoside. Non-limiting examples of modified nucleosides include nucleosides containing modifications in the base and / or sugar. Non-limiting examples of modified nucleosides include nucleosides having a 2'-modification in the sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (lacking a nucleobase). In some embodiments, a modified nucleoside can form a moiety in a polymer that can base pair with a nucleic acid containing at least a complementary sequence of the base, e.g., at least one function of the nucleoside.

[0032] Modified nucleotide: The term "modified nucleotide" includes any chemical moiety that is structurally different from a natural nucleotide but can perform at least one function of a natural nucleotide. In some embodiments, a modified nucleotide includes modifications in the sugar, base, and / or internucleotide linkage. In some embodiments, a modified nucleotide includes a modified sugar, a modified nucleobase, and / or a modified internucleotide linkage. In some embodiments, a modified nucleotide can form a subunit in a polymer that can base pair with a nucleic acid containing at least a complementary sequence of the base, e.g., at least one function of the nucleotide.

[0033] Modified sugar: The term "modified sugar" refers to a moiety that can replace a sugar. A modified sugar mimics the steric arrangement, electronic properties, or some other physicochemical properties of a sugar. In some embodiments, as described in the present disclosure, a modified sugar is a substituted ribose or deoxyribose. In some embodiments, a modified sugar includes a 2'-modification. Examples of useful 2'-modifications are widely utilized in the art and are described herein. In some embodiments, the 2'-modification is 2'-F. In some embodiments, the 2'-modification is 2'-OR, where R is optionally substituted C 1-10It is aliphatic. In some embodiments, the 2'-modification is 2'-OMe (2'-O-methyl). In some embodiments, the 2'-modification is 2'-MOE (2'-O-methoxyethyl). In some embodiments, the modified sugar is a bicyclic sugar (e.g., the sugar used in LNA, BNA, etc.). In some embodiments, in the context of an oligonucleotide, the modified sugar is a sugar other than ribose or deoxyribose as typically found in natural RNA or DNA.

[0034] Nucleic acid: As used herein, the term "nucleic acid" includes any nucleotide and polymer thereof. The term "polynucleotide" as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA), or a combination thereof. These terms refer to the primary structure of a molecule and thus include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. These terms include, as equivalents, modified nucleotides and / or modified polynucleotides, such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides, and any analogs of RNA or DNA. This term includes polynucleotides or oligoribonucleotides (RNA) and polydeoxyribonucleotides or oligodeoxyribonucleotides (DNA), nucleic acids derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases, nucleic acids derived from sugars and / or modified sugars, and nucleic acids derived from phosphate bridges and / or modified internucleotide linkages. This term includes nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified internucleotide linkages. Examples include nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing both a ribose moiety and a deoxyribose moiety, and nucleic acids containing a ribose moiety and a modified ribose moiety, among others, but not limited thereto. Unless otherwise specified, the prefix poly refers to a nucleic acid containing 2 to about 10,000 nucleotide monomer units, and the prefix oligo refers to a nucleic acid containing 2 to about 200 nucleotide monomer units.

[0035] Nucleobase: The term "nucleobase" refers to the portion of a nucleic acid that is involved in hydrogen bonding that binds one nucleic acid strand to the other complementary strand in a sequence-specific manner. The most common naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally occurring nucleobase is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally occurring nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleobase contains a heteroaryl ring, the ring atoms are nitrogen, and in a nucleoside, the nitrogen is attached to the sugar moiety. In some embodiments, the nucleobase contains a heterocyclic ring, the ring atoms are nitrogen, and in a nucleoside, the nitrogen is attached to the sugar moiety. In some embodiments, the nucleobase is a "modified nucleobase", a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobase is a substituted A, T, C, G, or U. In some embodiments, the modified nucleobase is a substituted tautomer of A, T, C, G, or U. In some embodiments, the modified nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of a nucleobase and retains the properties of hydrogen bonding that binds one nucleic acid strand to another nucleic acid strand in a sequence-specific manner. In some embodiments, the modified nucleobase can pair with all five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes, or activity of an oligonucleotide duplex. As used herein, the term "nucleobase" also encompasses structural analogs that are used in place of natural, or naturally occurring nucleotides, such as modified nucleobases and nucleobase analogs. In some embodiments, the nucleobase is optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U.In some embodiments, "nucleobase" refers to a nucleobase unit in an oligonucleotide or nucleic acid (e.g., A, T, C, G, or U in an oligonucleotide or nucleic acid).

[0036] Nucleoside: The term "nucleoside" refers to the moiety in which a nucleobase or modified nucleobase is covalently attached to a sugar or modified sugar. In some embodiments, the nucleoside is a natural nucleoside, such as adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, the nucleoside is a modified nucleoside, such as a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, the nucleoside is a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, "nucleoside" refers to a nucleoside unit in an oligonucleotide or nucleic acid.

[0037] Nucleotide: As used herein, the term "nucleotide" refers to the monomeric units of polynucleotides consisting of a nucleobase, a sugar, and one or more internucleotide linkages (e.g., the phosphate linkages in natural DNA and RNA). Naturally occurring bases [guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil, (U)] are derivatives of purines or pyrimidines, but it should be understood that natural and non-natural base analogs are also included. Naturally occurring sugars are pentose (5-carbon sugars) deoxyribose (which forms DNA), or ribose (which forms RNA), but it should be understood that natural and non-natural sugar analogs are also included. Nucleotides are linked via internucleotide linkages to form nucleic acids, or polynucleotides. Many internucleotide linkages are known in the art (including, but not limited to, phosphate, phosphorothioate, boranophosphate, etc.). Artificial nucleic acids include, among others, PNA (peptide nucleic acid), phosphotriester, phosphorothioate, H-phosphonate, phosphoramidate, boranophosphate, methylphosphonate, phosphonoacetate, thiophosphonoacetate, and other variants of the phosphate backbone of natural nucleic acids as described herein. In some embodiments, natural nucleotides include naturally occurring bases, sugars, and internucleotide linkages. As used herein, the term "nucleotide" also encompasses structural analogs used in place of natural, or naturally occurring, nucleotides such as modified nucleotides and nucleotide analogs. In some embodiments, "nucleotide" refers to the nucleotide units in oligonucleotides or nucleic acids.

[0038] Oligonucleotide: As used herein, the term "oligonucleotide" refers to a polymer or oligomer of nucleotides and may include any combination of natural and non-natural nucleobases, sugars, and internucleotide linkages.

[0039] An oligonucleotide can be either single-stranded or double-stranded. A single-stranded oligonucleotide may have a double-stranded region (formed by two portions of the single-stranded oligonucleotide), and a double-stranded oligonucleotide containing two oligonucleotide strands may have a single-stranded region, for example, in a region where the two oligonucleotide strands are not complementary to each other. Exemplary oligonucleotides include structural genes, genes containing regulatory and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded RNAi agents, and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimir, antagomir, Ul adapters, triple-stranded forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides, but are not limited thereto.

[0040] The oligonucleotides of the present disclosure can be of various lengths. In certain embodiments, the oligonucleotide can range from about 2 to about 200 nucleoside lengths. In various related embodiments, the oligonucleotide, single-stranded, double-stranded, or triple-stranded, can range in length from about 4 to about 10 nucleosides, about 10 to about 50 nucleosides, about 20 to about 50 nucleosides, about 15 to about 30 nucleosides, about 20 to about 30 nucleosides. In some embodiments, the oligonucleotide is about 9 to about 39 nucleoside lengths. In some embodiments, the oligonucleotide is about 25 to about 70 nucleoside lengths. In some embodiments, the oligonucleotide is about 26 to about 70 nucleoside lengths. In some embodiments, the oligonucleotide is about 27 to about 70 nucleoside lengths. In some embodiments, the oligonucleotide is about 28 to about 70 nucleoside lengths. In some embodiments, the oligonucleotide is about 29 to about 70 nucleoside lengths. In some embodiments, the oligonucleotide is about 30 to about 70 nucleoside lengths. In some embodiments, the oligonucleotide is about 31 to about 70 nucleoside lengths. In some embodiments, the oligonucleotide is about 32 to about 70 nucleoside lengths. In some embodiments, the oligonucleotide is about 25 to about 60 nucleoside lengths. In some embodiments, the oligonucleotide is about 25 to about 50 nucleoside lengths. In some embodiments, the oligonucleotide is about 25 to about 40 nucleoside lengths. In some embodiments, the oligonucleotide is about 30 to about 40 nucleoside lengths. In some embodiments, the oligonucleotide is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleoside lengths. In some embodiments, the oligonucleotide is at least 4 nucleoside lengths. In some embodiments, the oligonucleotide is at least 5 nucleoside lengths. In some embodiments, the oligonucleotide is at least 6 nucleoside lengths. In some embodiments, the oligonucleotide is at least 7 nucleoside lengths. In some embodiments, the oligonucleotide is at least 8 nucleoside lengths.In some embodiments, the oligonucleotide is at least 9 nucleosides in length. In some embodiments, the oligonucleotide is at least 10 nucleosides in length. In some embodiments, the oligonucleotide is at least 11 nucleosides in length. In some embodiments, the oligonucleotide is at least 12 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 16 nucleosides in length. In some embodiments, the oligonucleotide is at least 17 nucleosides in length. In some embodiments, the oligonucleotide is at least 18 nucleosides in length. In some embodiments, the oligonucleotide is at least 19 nucleosides in length. In some embodiments, the oligonucleotide is at least 20 nucleosides in length. In some embodiments, the oligonucleotide is at least 25 nucleosides in length. In some embodiments, the oligonucleotide is at least 26 nucleosides in length. In some embodiments, the oligonucleotide is at least 27 nucleosides in length. In some embodiments, the oligonucleotide is at least 28 nucleosides in length. In some embodiments, the oligonucleotide is at least 29 nucleosides in length. In some embodiments, the oligonucleotide is at least 30 nucleosides in length. In some embodiments, the oligonucleotide is at least 31 nucleosides in length. In some embodiments, the oligonucleotide is at least 32 nucleosides in length. In some embodiments, the oligonucleotide is at least 33 nucleosides in length. In some embodiments, the oligonucleotide is at least 34 nucleosides in length. In some embodiments, the oligonucleotide is at least 35 nucleosides in length. In some embodiments, the oligonucleotide is at least 36 nucleosides in length. In some embodiments, the oligonucleotide is at least 37 nucleosides in length. In some embodiments, the oligonucleotide is at least 38 nucleosides in length.In some embodiments, the oligonucleotide is at least 39 nucleosides in length. In some embodiments, the oligonucleotide is at least 40 nucleosides in length. In some embodiments, the oligonucleotide is 25 nucleosides in length. In some embodiments, the oligonucleotide is 26 nucleosides in length. In some embodiments, the oligonucleotide is 27 nucleosides in length. In some embodiments, the oligonucleotide is 28 nucleosides in length. In some embodiments, the oligonucleotide is 29 nucleosides in length. In some embodiments, the oligonucleotide is 30 nucleosides in length. In some embodiments, the oligonucleotide is 31 nucleosides in length. In some embodiments, the oligonucleotide is 32 nucleosides in length. In some embodiments, the oligonucleotide is 33 nucleosides in length. In some embodiments, the oligonucleotide is 34 nucleosides in length. In some embodiments, the oligonucleotide is 35 nucleosides in length. In some embodiments, the oligonucleotide is 36 nucleosides in length. In some embodiments, the oligonucleotide is 37 nucleosides in length. In some embodiments, the oligonucleotide is 38 nucleosides in length. In some embodiments, the oligonucleotide is 39 nucleosides in length. In some embodiments, the oligonucleotide is 40 nucleosides in length. In some embodiments, each nucleoside counted by the oligonucleotide length independently comprises a nucleobase comprising a ring having at least one nitrogen ring atom. In some embodiments, each nucleoside counted by the oligonucleotide length independently comprises A, T, C, G, or U, or optionally substituted A, T, C, G, or U, or a tautomer of optionally substituted A, T, C, G, or U.

[0041] Optionally substituted: As described herein, the compounds of the present disclosure, e.g., oligonucleotides, may contain optionally substituted and / or substituted moieties. Generally, the term "substituted" means that one or more hydrogens of the designated moiety are replaced with a suitable substituent, whether or not the term "optionally" is prefixed. Unless otherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and where two or more positions within any given structure may be substituted with two or more substituents selected from a particular group, the substituents may be the same or different at all positions. In some embodiments, an optionally substituted group is unsubstituted. Combinations of substituents contemplated by the present disclosure preferably result in the formation of stable or chemically feasible compounds. The term "stable" as used herein refers to compounds that do not substantially change when subjected to the conditions necessary for their production, detection, and in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein. Certain substituents are described below.

[0042] A substitutable atom, e.g., a suitable monovalent substituent on a suitable carbon atom, is independently halogen, -(CH2) 0-4 R°, -(CH2) 0-4 OR°, -O(CH2) 0-4 Ro, -O-(CH2) 0-4 C(O)OR°, -(CH2) 0-4 CH(OR°)2, -(CH2) that may be substituted with R° 0-4 Ph, -(CH2) that may be substituted with R° 0-4 O(CH2) 0-1 Ph, -CH=CHPh that may be substituted with R°, -(CH2) that may be substituted with R° 0-4 O(CH2) 0-1 -pyridyl, -NO2, -CN, -N3, -(CH2) 0-4 N(R°)2, -(CH2) 0-4 N(R°)C(O)R°, -N(R°)C(S)R°, -(CH2) 0-4N(R°)C(O)NR°2, -N(R°)C(S)NR°2, -(CH2) 0-4 N(R°)C(O)OR°, -N(R°)N(R°)C(O)R°, -N(R°)N(R°)C(O)NR°2, -N(R°)N(R°)C(O)OR°, -(CH2) 0-4 C(O)R°, -C(S)R°, -(CH2) 0-4 C(O)OR°, -(CH2) 0-4 C(O)SR°, -(CH2)0-4C(O)OSiR°3, -(CH2)0-4OC(O)R°, -OC(O)(CH2) 0-4 SR°, -SC(S)SR°, -(CH2) 0-4 SC(O)R°, -(CH2) 0-4 C(O)NR°2, -C(S)NR°2, -C(S)SR°, -(CH2) 0-4 OC(O)NR°2, -C(O)N(OR°)R°, -C(O)C(O)R°, -C(O)CH2C(O)R°, -C(NOR°)R°, -(CH2) 0-4 SSR°, -(CH2) 0-4 S(O)2R°, -(CH2) 0-4 S(O)2OR°, -(CH2) 0-4 OS(O)2R°, -S(O)2NR°2, -(CH2) 0-4 S(O)R°, -N(R°)S(O)2NR°2, -N(R°)S(O)2R°, -N(OR°)R°, -C(NH)NR°2, -Si(R°)3, -OSi(R°)3, -B(R°)2, -OB(R°)2, -OB(OR°)2, -P(R°)2, -P(OR°)2, -P(R°)(OR°), -OP(R°)2, -OP(OR°)2, -OP(R°)(OR°), -P(O)(R°)2, -P(O)(OR°)2, -OP(O)(R°)2, -OP(O)(OR°)2, -OP(O)(OR°)(SR°), -SP(O)(R°)2, -SP(O)(OR°)2, -N(R°)P(O)(R°)2, -N(R°)P(O)(OR°)2, -P(R°)2[B(R°)3], -P(OR°)2[B(R°)3], -OP(R°)2[B(R°)3], -OP(OR°)2[B(R°)3], -(C 1-4 linear or branched alkylene)O-N(R°)2, or -(C 1-4is a linear or branched alkylene)C(O)O-N(R°)2, each R° may be substituted as defined herein and is independently hydrogen, C 1-20 aliphatic, nitrogen, oxygen, sulfur, silicon, and phosphorus, a C having 1 to 5 heteroatoms independently selected therefrom 1-20 heteroaliphatic, -CH2-(C 6-14 aryl), -O(CH2) 0-1 (C 6-14 aryl), -CH2-(5- to 14-membered heteroaryl ring), a 5- to 20-membered monocyclic, bicyclic, or polycyclic saturated, partially unsaturated, or aryl ring having 0 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, or, regardless of the above definition, two independent occurrences of R° together with the intervening atom(s) form a 5- to 20-membered monocyclic, bicyclic, or polycyclic saturated, partially unsaturated, or aryl ring having 0 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, which may be substituted as defined below.

[0043] Suitable monovalent substituents on R° (or the ring formed by combining two independent occurrences of R° with the intervening atom(s)) are independently halogen, -(CH2) 0-2 R ● , -(haloR ● ), -(CH2) 0-2 OH, -(CH2) 0-2 OR ● , -(CH2) 0-2 CH(OR ● )2, -O(haloR ● ), -CN, -N3, -(CH2) 0-2 C(O)R ● , -(CH2) 0-2 C(O)OH, -(CH2) 0-2 C(O)OR ● , -(CH2) 0-2 SR ● , -(CH2) 0-2 SH, -(CH2) 0-2 NH2, -(CH2) 0-2 NHR ● , -(CH2)0-2 NR ● 2, -NO2, -SiR ● 3, -OSiR ● 3, -C(O)SR ● , -(C 1-4 linear or branched alkylene)C(O)OR ● , or -SSR ● and each R ● is unsubstituted or, when "halo" precedes, is substituted with only one or more halogens and is independently selected from C 1-4 aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, and a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents on the saturated carbon atoms of R° include =O and =S.

[0044] For example, suitable divalent substituents on suitable carbon atoms are independently, hereinafter, =O, =S, =NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2-3 O-, or -S(C(R * 2)) 2-3 S- and each independent occurrence of R * is hydrogen, C 1-6 aliphatic which may be substituted as defined hereinafter, and is selected from an unsubstituted 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents bonded to the substitutable carbon proximal to the "optionally substituted" group include -O(CR * 2) 2-3 O- and each independent occurrence of R * is hydrogen, C 1-6It is selected from unsubstituted 5- to 6-membered saturated, partially unsaturated, and aryl rings having 0 to 4 heteroatoms independently selected from aliphatic, nitrogen, oxygen, and sulfur.

[0045] R * Suitable substituents on the aliphatic group of are, independently, halogen, -R ● , -(haloR ● ), -OH, -OR ● , -O(haloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, and each R ● is unsubstituted or, when "halo" precedes, is substituted only with one or more halogens and is independently C 1-4 aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 3- to 6 (e.g., 3- to 5, 5- to 6, etc.) membered saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0046] In some embodiments, suitable substituents on substitutable nitrogen are, independently, -R † , -NR † 2, -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CH2C(O)R † , -S(O)2R † , -S(O)2NR † 2, -C(S)NR † 2, -C(NH)NR † 2, or -N(R † )S(O)2R † and each R † is independently hydrogen, C 1-6 aliphatic which may be substituted as defined below, unsubstituted -OPh, or an unsubstituted 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, regardless of the above definition, R† The two independent occurrences, together with intervening atom(s), form an unsubstituted 3- to 12-membered saturated, partially unsaturated, or aryl monocyclic or bicyclic ring having from 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0047] R † Suitable substituents on the aliphatic group of R are independently halogen, -R ● , -(haloR ● ), -OH, -OR ● , -O(haloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, and each R ● is unsubstituted or, when preceded by "halo", substituted only with one or more halogens and is independently C 1-4 aliphatic, -CH2Ph, -O(CH2) 0-1 Ph, or a 5- to 6-membered saturated, partially unsaturated, or aryl ring having from 0 to 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0048] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that contains at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties as defined herein.

[0049] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in an amount of a unit dose appropriate for administration in a treatment regimen that, when administered to the relevant population, exhibits a statistically significant probability of achieving a predetermined therapeutic effect. In some embodiments, the pharmaceutical composition can be specially formulated for administration in solid or liquid form, including oral administration, such as drenches (aqueous or non-aqueous solutions or suspensions), tablets, such as those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, such as subcutaneous, intramuscular, intravenous, or epidural injection, as a sterile solution or suspension, or as a sustained release formulation; topical application, such as creams, ointments, or controlled release patches, or sprays applied to the skin, lung, or oral cavity; intravaginal or rectal, such as pessaries, creams, or foams; sublingual; ocular; transdermal; or suitable for application to the nose, lung, and other mucosal surfaces.

[0050] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with human and animal tissues within the scope of sound medical judgment, without undue toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0051] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material involved in transporting or delivering the subject compound from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials that can function as pharmaceutically acceptable carriers include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as carboxymethylcellulose sodium, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffering solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations.

[0052] Pharmaceutically acceptable salts: The term "pharmaceutically acceptable salts" as used herein refers to salts of such compounds that are suitable for use in a pharmaceutical context, i.e., within the scope of sound medical judgment, without undue toxicity, irritation, allergic response, etc., and are suitable for use in contact with the tissues of humans and lower animals and have a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge, et al. detail pharmaceutically acceptable salts in J. Pharmaceutical Sciences, 66:1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, salts of amino groups formed by inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by other methods used in the art such as ion exchange, which are non-toxic acid addition salts. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like.In some embodiments, the provided compounds include one or more acidic groups, such as oligonucleotides, and the pharmaceutically acceptable salts are salts of an alkali, alkaline earth metal, or ammonium (e.g., ammonium salts of N(R)3 where each R is independently defined and described in the present disclosure). Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyls having 1 to 6 carbon atoms, sulfonates, and arylsulfonates. In some embodiments, the provided compounds include two or more acid groups, e.g., oligonucleotides may include two or more acidic groups (e.g., in natural phosphate linkages and / or modified nucleotide linkages). In some embodiments, the pharmaceutically acceptable salts of such compounds, or salts generally, may include two or more cations that may be the same or different. In some embodiments, in the pharmaceutically acceptable salt (or salt generally), all ionizable hydrogens in the acidic groups (e.g., in an aqueous solution having a pKa of about 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 or less, in some embodiments about 7 or less, in some embodiments about 6 or less, in some embodiments about 5 or less, in some embodiments about 4 or less, in some embodiments about 3 or less) are replaced by cations. In some embodiments, each phosphorothioate and phosphate group independently exists in its salt form (e.g., -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O- in the case of sodium salts, respectively). In some embodiments, each phosphorothioate and phosphate nucleotide linkage independently exists in its salt form (e.g., -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O- in the case of sodium salts, respectively).In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide. In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide, and each acidic phosphate and modified phosphate group (e.g., phosphorothioate, phosphate, etc.), if present, is present in salt form (all sodium salts).

[0053] Protecting groups: As used herein, the term "protecting group" is well known in the art and includes those detailed in Protecting Groups in Organic Synthesis, T.W. Greene and P.G.M. Wuts, 3rd edition, John Wiley & Sons, 1999, which is hereby incorporated by reference in its entirety. Also included are those protecting groups particularly adapted for nucleoside and nucleotide chemistry as described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. in 2006 / 2012, the entirety of Chapter 2 of which is hereby incorporated by reference in its entirety. Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluorenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-dicyclohexylcarboxamide)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithiocarbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitrobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(p-toluenesulfonyl)ethyl carbamate, [2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acetyloxybenzyl carbamate, p-(dihydroxyboronyl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivative, N'-p-toluenesulfonylaminocarbonyl derivative, N'-phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzylthiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decyloxybenzyl carbamate, 2,2-Dimethoxycarbonylvinyl carbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate, 1,1-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isobornyl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p'-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-methyl-1-(p-phenylazophenyl)ethyl carbamate, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyl oxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrosinamide, N-acetylmethionine derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-Tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitropyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrrolin-3-yl)amine, quaternary ammonium salt, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberlylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, N-p-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine, N-p-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivative, N-diphenylboric acid derivative, N-[phenyl(pentacarbonylchromium or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphine amide (Dpp), dimethylthiophosphine amide (Mpt), diphenylthiophosphine amide (Ppt), dialkyl phosphoramidate, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-Dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4’,8’-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide are mentioned.,

[0054] The well-protected carboxylic acids further include, but are not limited to, carboxylic acids protected with silyl, alkyl, alkenyl, aryl, and arylalkyl groups. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), as well as 2- and 4-picolyl.

[0055] Suitable hydroxyl protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyl oxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-Dinitrobenzhydryl, 5-dibenzosuberil, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromophenacyloxyphenyl)diphenylmethyl, 4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4',4''-tris(levulinoyloxyphenyl)methyl, 4,4',4''-tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethyltexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkylmethyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkylethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonio)ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate, alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, alkyl N,N,N’,N’-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts) are included. When protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylidene orthoester, 1-ethoxyethylidine orthoester, 1,2-dimethoxyethylidene orthoester, α-methoxybenzylidene orthoester, 1-(N,N-dimethylamino)ethylidene derivative, α-(N,N'-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene orthoester, di-t-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanilidene) derivative (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic carbonate, cyclic boronate, ethyl boronate, and phenyl boronate are included.,

[0056] In some embodiments, the hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl, (DMTr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl) or 9-(p-methoxyphenyl)xanthen-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl, and 4,4'-dimethoxytrityl groups.In some embodiments, the phosphorus-linked protecting group is a group attached to a phosphorus linkage (e.g., an internucleotide linkage) through oligonucleotide synthesis. In some embodiments, the protecting group is attached to the sulfur atom of a phosphorothioate group. In some embodiments, the protecting group is attached to the oxygen atom of an internucleotide phosphorothioate linkage. In some embodiments, the protecting group is attached to the oxygen atom of an internucleotide phosphate linkage. In some embodiments, the protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methylbenzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamide)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, or 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.

[0057] Subject: As used herein, the terms "subject" or "test subject" refer to any organism to which a compound (e.g., an oligonucleotide) or composition is administered according to the present disclosure, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans, insects, parasites, etc.), and plants. In some embodiments, the subject is a human. In some embodiments, the subject may have and / or be susceptible to a disease, disorder, and / or condition.

[0058] Sugar: The term "sugar" refers to monosaccharides or polysaccharides in closed and / or open forms. In some embodiments, the sugar is a monosaccharide. In some embodiments, the sugar is a polysaccharide. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term "sugar" also encompasses structural analogs used in place of conventional sugar molecules, such as glycols, glycol nucleic acids ("GNA"), which are polymers that form the backbone of nucleic acid analogs. As used herein, the term "sugar" also encompasses natural or naturally occurring structural analogs used in place of nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, the sugar is an RNA or DNA sugar (ribose or deoxyribose). In some embodiments, the sugar is a modified ribose or deoxyribose sugar, such as 2'-modified, 5'-modified, etc. As described herein, in some embodiments, when used in oligonucleotides and / or nucleic acids, modified sugars can provide one or more desired properties, activities, etc. In some embodiments, the sugar is optionally substituted ribose or deoxyribose. In some embodiments, "sugar" refers to the sugar unit in an oligonucleotide or nucleic acid.

[0059] Prone: An individual who is "prone" to a disease, disorder, and / or condition is an individual who has a higher risk of developing the disease, disorder, and / or condition than a member of the general population. In some embodiments, an individual who is prone to a disease, disorder, and / or condition is likely to have the disease, disorder, and / or condition. In some embodiments, an individual who is prone to a disease, disorder, and / or condition may not have been diagnosed as having the disease, disorder, and / or condition. In some embodiments, an individual who is prone to a disease, disorder, or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is prone to a disease, disorder, or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is prone to a disease, disorder, or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is prone to a disease, disorder, or condition will not develop the disease, disorder, and / or condition.

[0060] Therapeutic agent: As used herein, the term "therapeutic agent" generally refers to any agent that, when administered to a subject, induces a desired effect (e.g., a desired biological, clinical, or pharmacological effect). In some embodiments, an agent is considered a therapeutic agent if it demonstrates a statistically significant effect across an appropriate population. In some embodiments, the appropriate population is a population of subjects who have and / or are susceptible to a disease, disorder, or condition. In some embodiments, the appropriate population is a population of model organisms. In some embodiments, the appropriate population can be defined by one or more criteria such as age group, gender, genetic background, existing clinical condition, previous exposure to therapy, etc. In some embodiments, a therapeutic agent, when administered to a subject in an effective amount, alleviates, improves, reduces, inhibits, prevents, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms or features of a disease, disorder, and / or condition in the subject. In some embodiments, a "therapeutic agent" is an agent that has been approved or needs to be approved by a government agency before it can be marketed for administration to humans. In some embodiments, a "therapeutic agent" is an agent that requires a medical prescription for administration to humans. In some embodiments, the therapeutic agent is a provided compound, e.g., a provided oligonucleotide.

[0061] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" means the amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that, when administered as part of a treatment regimen, induces a desired biological response. In some embodiments, a therapeutically effective amount of a substance, when administered to a subject having or susceptible to a disease, disorder, and / or condition, is an amount sufficient for the treatment, diagnosis, prevention, and / or delay of the onset of the disease, disorder, and / or condition. As will be appreciated by those of skill in the art, the effective amount of a substance can vary depending on such factors as the desired biological endpoint, the substance being delivered, the target cell or tissue, etc. For example, the effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates, improves, reduces, inhibits, prevents, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms or characteristics of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered as a single dose, and in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0062] Treatment: As used herein, the terms "treat," "treatment," or "treating" refer to any method used for the partial or complete alleviation, improvement, reduction, inhibition, prevention, delay of onset, reduction of severity, and / or reduction of incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment may be administered to a subject who does not exhibit symptoms of a disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject who exhibits only early signs of a disease, disorder, and / or condition, for example, for the purpose of reducing the risk of developing a medical condition associated with the disease, disorder, and / or condition.

[0063] Wild type: As used herein, the term "wild type" has the meaning understood in the art, referring to an entity having a structure and / or activity as found in nature in a "normal" state or situation (as contrasted with, e.g., a variant, diseased, altered, etc.). One of ordinary skill in the art will understand that wild type genes and polypeptides often exist in multiple different forms (e.g., alleles).

[0064] As will be understood by one of ordinary skill in the art, the methods and compositions described herein with respect to the provided compounds (e.g., oligonucleotides) generally also apply to pharmaceutically acceptable salts of such compounds.

[0065] As used in this disclosure, in some embodiments, "one or more" is 1 to 200, 1 to 150, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60. In some embodiments, "one or more" is one. In some embodiments, "one or more" is two. In some embodiments, "one or more" is three. In some embodiments, "one or more" is four. In some embodiments, "one or more" is five. In some embodiments, "one or more" is six. In some embodiments, "one or more" is seven. In some embodiments, "one or more" is eight. In some embodiments, "one or more" is nine. In some embodiments, "one or more" is ten. In some embodiments, "one or more" is at least one. In some embodiments, "one or more" is at least two. In some embodiments, "one or more" is at least three. In some embodiments, "one or more" is at least four. In some embodiments, "one or more" is at least five. In some embodiments, "one or more" is at least six. In some embodiments, "one or more" is at least seven. In some embodiments, "one or more" is at least eight. In some embodiments, "one or more" is at least nine. In some embodiments, "one or more" is at least ten.

[0066] As used in this disclosure, in some embodiments, "at least one" is the "one or more" described herein.

[0067] Description of a particular embodiment In particular, the present disclosure provides various oligonucleotides and compositions thereof. In some embodiments, the oligonucleotides of the present disclosure target SARM1 and can hybridize with SARM1 transcripts, such as SARM1 mRNA. In some embodiments, the provided technologies, such as oligonucleotides, compositions, methods, etc., reduce the level of SARM1 transcripts and / or their products. The use of naturally occurring nucleic acids is limited, for example, by their susceptibility to endo- and exonucleases. Therefore, various synthetic counterparts have been developed to avoid these drawbacks and / or further improve various properties and activities. In some embodiments, the provided oligonucleotides include various chemical modifications, such as nucleobase modifications, sugar modifications, internucleotide linkage modifications, etc., in particular making these molecules less susceptible to degradation and improving other properties and / or activities. In some embodiments, the oligonucleotide includes one or more features described herein, such as base sequence, length, wing, core, activity, etc. In some embodiments, the oligonucleotide has the base sequence described herein and / or the wing-core-wing structure described herein.

[0068] Base sequence The base sequences of the various oligonucleotides are of sufficient length such that they can form a double strand with a complementary sequence in a target nucleic acid for one or more biological functions. In some embodiments, the oligonucleotides specifically target their target nucleic acids. In some embodiments, the provided base sequences of the oligonucleotides are sequences that are complementary to or include a portion of the target nucleic acid (the "target portion"), for example, a sequence complementary to the SARM1 gene or its transcript. In some embodiments, the target portion includes a portion of an exon and / or an intron. In some embodiments, the target portion includes a portion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, or exon 9 of SARM1. In some embodiments, the target portion includes a portion of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, or intron 8 of SARM1. In some embodiments, the target portion includes a portion of exon 1 of SARM1. In some embodiments, the target portion includes a portion of exon 2 of SARM1. In some embodiments, the target portion includes a portion of exon 3 of SARM1. In some embodiments, the target portion includes a portion of exon 4 of SARM1. In some embodiments, the target portion includes a portion of exon 5 of SARM1. In some embodiments, the target portion includes a portion of exon 7 of SARM1. In some embodiments, the target portion includes a portion of exon 8 of SARM1. In some embodiments, the target portion includes a portion of exon 9 of SARM1. In some embodiments, the target portion includes a portion of intron 1 of SARM1. In some embodiments, the target portion includes a portion of intron 2 of SARM1. In some embodiments, the target portion includes a portion of intron 3 of SARM1. In some embodiments, the target portion includes a portion of intron 4 of SARM1. In some embodiments, the target portion includes a portion of intron 5 of SARM1. In some embodiments, the target portion includes a portion of intron 6 of SARM1. In some embodiments, the target portion includes a portion of intron 7 of SARM1. In some embodiments, the target portion includes a portion of intron 8 of SARM1.Exons and introns are alternating. For example, intron 1 is between exon 1 and exon 2, intron 2 is between exon 2 and exon 3, and so on. In some embodiments, the target portion is within an exon. In some embodiments, the target portion is within an intron. In some embodiments, the target portion includes a portion of an exon and a portion of an exon. In some embodiments, such an array complementary to the target portion is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleobases in length.

[0069] In some embodiments, the target portion is or includes a characteristic portion of a nucleic acid sequence (e.g., of the SARM1 gene or its transcript), and the characteristic portion defines the nucleic acid sequence relative to other portions in the relevant organism. For example, the characteristic portion is not present in other genomic nucleic acid sequences (e.g., genes) or their transcripts in the relevant organism (e.g., in the case of human SARM1, its characteristic portion is not present in other human nucleic acid sequences or their transcripts). In some embodiments, the characteristic portion of a transcript defines that transcript relative to other transcripts in the relevant organism. For example, in some embodiments, the characteristic portion is not present in transcripts transcribed from different nucleic acid sequences (e.g., different genes). In some embodiments, transcriptional variants from a nucleic acid sequence (e.g., mRNA variants of a gene) may share a common characteristic portion that defines them from transcripts of other nucleic acids, e.g., transcripts of other genes. In some embodiments, the characteristic portion of a transcript defines the transcript from other transcript(s) of the same nucleic acid sequence (e.g., gene) and / or other alleles of the nucleic acid sequence. In some embodiments, the characteristic portion defines a particular allele (and / or its transcript) relative to other allele(s) (and / or their transcripts). In some embodiments, the characteristic portion includes a discrete sequence in the nucleic acid. In some embodiments, the characteristic portion is a continuous stretch of nucleobases in the nucleic acid (“characteristic sequence”). The characteristic portion or sequence can have various numbers of nucleobases.In some embodiments, in the characteristic portion or sequence, there are about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleobases. In some embodiments, there are about 10. In some embodiments, there are about 11. In some embodiments, there are about 12. In some embodiments, there are about 13. In some embodiments, there are about 14. In some embodiments, there are about 15. In some embodiments, there are about 16. In some embodiments, there are about 17. In some embodiments, there are about 18. In some embodiments, there are about 19. In some embodiments, there are about 20. In some embodiments, there are about 21. In some embodiments, there are about 22. In some embodiments, there are about 23. In some embodiments, there are about 24. In some embodiments, there are about 25. In some embodiments, there are about 25 or more.

[0070] In some embodiments, the oligonucleotide comprises a sequence that is identical or complementary to a characteristic portion of the nucleic acid. In some embodiments, the oligonucleotide comprises a sequence that is identical or complementary to a characteristic portion of the SARM1 transcript. In some embodiments, the oligonucleotide comprises a sequence that is complementary to a characteristic portion of the SARM1 transcript. In some embodiments, the base sequence of the oligonucleotide is identical or complementary to a characteristic portion of the nucleic acid. In some embodiments, the base sequence of the oligonucleotide is identical or complementary to a characteristic portion of the SARM1 transcript. In some embodiments, the base sequence of the oligonucleotide is complementary to a characteristic portion of the SARM1 transcript. In some embodiments, the characteristic portion is a characteristic sequence.

[0071] In some embodiments, the characteristic sequence of the SARM1 transcript is, or comprises, a sequence complementary to the sequence of the oligonucleotide of Table 1. In some embodiments, the characteristic sequence is, or comprises, UUUGCUCCCAGGGCUAGUGG, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, GCUCUAUGGAUGGAGAUGGC, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, CCCAAGCCCACAGCUCUCCU, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, UCUGCUGGGAGGCAUGGGUG, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, GGAGAGUGAGUACAGCCAGC, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, CAGGACCAAGGACAGAGCAC, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, GUAGGCUGCAUGAGAAUGGG, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, UCAAGGAGCCUAGGUCACAG, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, GACCCACAGCCUCUCAGACC, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, ACCACAGAAGAACUGGGAGC, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, UGUCACCUGUGGAGGACAUC, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, AGGUCAGUAAGGCAGGAAGC, where each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or comprises, UGGUCAGGGACAAAGGAGAG, where each U can independently be replaced by T.In some embodiments, the characteristic sequence is, or includes, GAGUGAGGAAAAGGCAAGGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, GAGAGGGUUAGUGACCAGGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, AGGCAAGACCAAGGUGGGUG, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, UGGGACAGGACAUCAGUGUG, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, GGCCAAGACCCAGAGGUGUG, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, AACUGGGAGUGAUGGGCAGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, GGGCCAGGGCAGAUGGAGAG, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, AGAGACAAGGAGAGGGACUG, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, CCCAGGAGCAGCAGGUGGAU, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, GCACCCACAAGACACAAGGG, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, CAACAGGAAAAUCCUAGGGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, UGGGAGGCAGGAGUUGAGGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, AGGCUGAUACCCAGGUGUCU, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, UGGGAAAUAGGGAAGAAGGA, and each U can independently be replaced by T.In some embodiments, the characteristic sequence is, or includes, UACCUGACAGUGAGUGAUGC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GACAAGGCUGUGGCACUGAC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GGGUGCAUAAGGUAGGUGCC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GGGCUGAGGGAUGCAGUAGU, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, AGAGACAGGAUGAGACAAGC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, AAGCAGUCAGCUCAGAGACA, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, UGGAGUGUGGAGUCAAGCCC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, UGAAGCUGAGAUGCCAUGCC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, ACCAGCUAGGUGAUCCUGAA, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, CCCAGCAGAUGGCAAAGAGG, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, ACCACAAGUGAACUGCACUC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, UGACAGGCAGAGUGUGGGCA, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, CUGACUAGCAGCUCCCUCUG, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GCCUGCAUCACCUUUGCCAA, and each U can be independently replaced by T.In some embodiments, the characteristic sequence is, or includes, GGUCUUCCAACUGGUGGAGG, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GAUCCUGGUGGCUGAGAACC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, UGGCAGGCAUCUUGGAGCAC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GCCAUCAAGAGCCUGCAAGG, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, UCCUACUCUACCAAUGGCAC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, AGGUUCUUUAGGGAGCUCAC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, CCCUGUACUGGUGGCAAACC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, AUUGAUGUGGAGAAGCUGGA, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, AGCUGGAAGCAGGCAAGUUC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GACAAACUCAUCCAGAGUGU, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, CCAGAGUGUCAUGGGUGCCC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, ACCUGGAGCACUGGACAAGU, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, CCAUGACUGCAAGGAUUGGG, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GAGGACAUGCAGGCUGUGCU, and each U can be independently replaced by T.In some embodiments, the characteristic sequence is, or includes, CAGGCUCUGACACCAGUUUG, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, ACCAGUUUGGAGGGUGCUGC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, CCAUGGGUCCAACCUAACCA, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, UGGGCUGAGACAACCUGGGC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, CCUCAGUAUCUGGAGAGGGA, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, CCUGCCAUUGGGUUGUCUGU, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, CCCUGCUCAGUUCUGGAGAC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GCCUCAGACAGGAAUUAAGG, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GGCCUGGGCACUGUAUUCUG, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, AUUCUGAGCAAGGGCCUGGG, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, AGCCAGCCAGGGAUGAGUGC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, UGUGGCCUUGCCCUGUAAUC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, UCUUUUGCCACAUCCAGGGC, and each U can be independently replaced by T. In some embodiments, the characteristic sequence is, or includes, GCCCUCCCUCUGACUUCCUU, and each U can be independently replaced by T.In some embodiments, the characteristic sequence is, or includes, GAGCCUCCUGUUUGGGCCUG, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, UUGGGCCUGGGUCUGGGCAU, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, GCCUUGGUGCUGUGCCUCAG, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is A. is, or includes, GGCUCCUUCCUGGUCUGGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, GGAAAGAGGCAAAGUCCUGA, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, GGGUAGCAAAUCUCUAAAGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, GAAUCAUUCUGAGGCUGGGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, UCCUCCACUGGGUUCAGAGG, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, ACCCUCCAAUAAACCCAGGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, CCACUCUUGGCUGUGCUGGC, and each U can independently be replaced by T. In some embodiments, the characteristic sequence is, or includes, GGCUCCUUCCUUCCACUCCC, and each U can independently be replaced by T.

[0072] In some embodiments, the oligonucleotide can hybridize to a region of a nucleic acid. In some embodiments, an oligonucleotide that can specifically hybridize to a particular region (s) of a nucleic acid (e.g., via sequence complementarity) can more effectively reduce the level of that nucleic acid than an oligonucleotide that specifically hybridizes to one or more reference regions of the nucleic acid (e.g., via sequence complementarity). In some embodiments, the region has a length of about 20 to 200 (e.g., about 20 to 150, 20 to 100, 30 to 200, 30 to 150, 40 to 200, 40 to 150, 50 to 100, or about 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200) nucleobases. In some embodiments, the region has a length of about 30 nucleobases. In some embodiments, the region has a length of about 40 nucleobases. In some embodiments, the region has a length of about 50 nucleobases. In some embodiments, the region has a length of about 60 nucleobases. In some embodiments, the region has a length of about 70 nucleobases. In some embodiments, the region has a length of about 80 nucleobases. In some embodiments, the region has a length of about 90 nucleobases. In some embodiments, the region has a length of about 100 nucleobases. In some embodiments, the region has a length of about 120 nucleobases. In some embodiments, the region has a length of about 150 nucleobases. In some embodiments, the region has a length of about 200 nucleobases. In some embodiments, the region includes the complementary sequence of the base sequence of the oligonucleotide of Table 1, which, in some embodiments, is in the middle of the region. For example, in some embodiments, the region is UUUGCUCCCAGGGCUAGUGG or includes it. In some embodiments, the region is GCUCUAUGGAUGGAGAUGGC or includes it. In some embodiments, the region is CCCAAGCCCACAGCUCUCCU or includes it. In some embodiments, the region is UCUGCUGGGAGGCAUGGGUG or includes it.In some embodiments, the region is GGAGAGUGAGUACAGCCAGC or includes it. In some embodiments, the region is CAGGACCAAGGACAGAGCAC or includes it. In some embodiments, the region is GUAGGCUGCAUGAGAAUGGG or includes it. In some embodiments, the region is UCAAGGAGCCUAGGUCACAG or includes it. In some embodiments, the region is GACCCACAGCCUCUCAGACC or includes it. In some embodiments, the region is ACCACAGAAGAACUGGGAGC or includes it. In some embodiments, the region is UGUCACCUGUGGAGGACAUC or includes it. In some embodiments, the region is AGGUCAGUAAGGCAGGAAGC or includes it. In some embodiments, the region is UGGUCAGGGACAAAGGAGAG or includes it. In some embodiments, the region is GAGUGAGGAAAAGGCAAGGC or includes it. In some embodiments, the region is GAGAGGGUUAGUGACCAGGC or includes it. In some embodiments, the region is AGGCAAGACCAAGGUGGGUG or includes it. In some embodiments, the region is UGGGACAGGACAUCAGUGUG or includes it. In some embodiments, the region is GGCCAAGACCCAGAGGUGUG or includes it. In some embodiments, the region is AACUGGGAGUGAUGGGCAGC or includes it. In some embodiments, the region is GGGCCAGGGCAGAUGGAGAG or includes it. In some embodiments, the region is AGAGACAAGGAGAGGGACUG or includes it. In some embodiments, the region is CCCAGGAGCAGCAGGUGGAU or includes it. In some embodiments, the region is GCACCCACAAGACACAAGGG or includes it. In some embodiments, the region is CAACAGGAAAAUCCUAGGGC or includes it. In some embodiments, the region is UGGGAGGCAGGAGUUGAGGC or includes it.In some embodiments, the region is, or comprises, AGGCUGAUACCCAGGUGUCU. In some embodiments, the region is, or comprises, UGGGAAAUAGGGAAGAAGGA. In some embodiments, the region is, or comprises, UACCUGACAGUGAGUGAUGC. In some embodiments, the region is, or comprises, GACAAGGCUGUGGCACUGAC. In some embodiments, the region is, or comprises, GGGUGCAUAAGGUAGGUGCC. In some embodiments, the region is, or comprises, GGGCUGAGGGAUGCAGUAGU. In some embodiments, the region is, or comprises, AGAGACAGGAUGAGACAAGC. In some embodiments, the region is, or comprises, AAGCAGUCAGCUCAGAGACA. In some embodiments, the region is, or comprises, UGGAGUGUGGAGUCAAGCCC. In some embodiments, the region is, or comprises, UGAAGCUGAGAUGCCAUGCC. In some embodiments, the region is, or comprises, ACCAGCUAGGUGAUCCUGAA. In some embodiments, the region is, or comprises, CCCAGCAGAUGGCAAAGAGG. In some embodiments, the region is, or comprises, ACCACAAGUGAACUGCACUC. In some embodiments, the region is, or comprises, UGACAGGCAGAGUGUGGGCA. In some embodiments, the region is, or comprises, CUGACUAGCAGCUCCCUCUG. In some embodiments, the region is, or comprises, GCCUGCAUCACCUUUGCCAA. In some embodiments, the region is, or comprises, GGUCUUCCAACUGGUGGAGG. In some embodiments, the region is, or comprises, GAUCCUGGUGGCUGAGAACC. In some embodiments, the region is, or comprises, UGGCAGGCAUCUUGGAGCAC. In some embodiments, the region is, or comprises, GCCAUCAAGAGCCUGCAAGG. In some embodiments, the region is, or comprises, UCCUACUCUACCAAUGGCAC.In some embodiments, the region is AGGUUCUUUAGGGAGCUCAC or includes it. In some embodiments, the region is CCCUGUACUGGUGGCAAACC or includes it. In some embodiments, the region is AUUGAUGUGGAGAAGCUGGA or includes it. In some embodiments, the region is AGCUGGAAGCAGGCAAGUUC or includes it. In some embodiments, the region is GACAAACUCAUCCAGAGUGU or includes it. In some embodiments, the region is CCAGAGUGUCAUGGGUGCCC or includes it. In some embodiments, the region is ACCUGGAGCACUGGACAAGU or includes it. In some embodiments, the region is CCAUGACUGCAAGGAUUGGG or includes it. In some embodiments, the region is GAGGACAUGCAGGCUGUGCU or includes it. In some embodiments, the region is CAGGCUCUGACACCAGUUUG or includes it. In some embodiments, the region is ACCAGUUUGGAGGGUGCUGC or includes it. In some embodiments, the region is CCAUGGGUCCAACCUAACCA or includes it. In some embodiments, the region is UGGGCUGAGACAACCUGGGC or includes it. In some embodiments, the region is CCUCAGUAUCUGGAGAGGGA or includes it. In some embodiments, the region is CCUGCCAUUGGGUUGUCUGU or includes it. In some embodiments, the region is CCCUGCUCAGUUCUGGAGAC or includes it. In some embodiments, the region is GCCUCAGACAGGAAUUAAGG or includes it. In some embodiments, the region is GGCCUGGGCACUGUAUUCUG or includes it. In some embodiments, the region is AUUCUGAGCAAGGGCCUGGG or includes it. In some embodiments, the region is AGCCAGCCAGGGAUGAGUGC or includes it. In some embodiments, the region is UGUGGCCUUGCCCUGUAAUC or includes it.In some embodiments, the region is UCUUUUGCCACAUCCAGGGC or includes it. In some embodiments, the region is GCCCUCCCUCUGACUUCCUU or includes it. In some embodiments, the region is GAGCCUCCUGUUUGGGCCUG or includes it. In some embodiments, the region is UUGGGCCUGGGUCUGGGCAU or includes it. In some embodiments, the region is GCCUUGGUGCUGUGCCUCAG or includes it. In some embodiments, the region is AGGCUCCUUCCUGGUCUGGC or includes it. In some embodiments, the region is GGAAAGAGGCAAAGUCCUGA or includes it. In some embodiments, the region is GGGUAGCAAAUCUCUAAAGC or includes it. In some embodiments, the region is GAAUCAUUCUGAGGCUGGGC or includes it. In some embodiments, the region is UCCUCCACUGGGUUCAGAGG or includes it. In some embodiments, the region is ACCCUCCAAUAAACCCAGGC or includes it. In some embodiments, the region is CCACUCUUGGCUGUGCUGGC or includes it. In some embodiments, the region is GGCUCCUUCCUUCCACUCCC or includes it.

[0073] In some embodiments, the nucleotide sequence of the oligonucleotide comprises or consists of about 10 to 50 (e.g., about 15 to 50, 16 to 50, 17 to 50, 18 to 50, 19 to 50, 20 to 50, 15 to 30, 20 to 30, 15 to 25, or 20 to 25, or at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, in some embodiments at least about 15, in some embodiments at least about 16, in some embodiments at least about 17, in some embodiments at least about 18, in some embodiments at least about 19, in some embodiments at least about 20, in some embodiments at least about 21, in some embodiments at least about 22, in some embodiments at least about 23, in some embodiments at least about 24, in some embodiments at least about 25) consecutive bases that are identical or complementary to a nucleotide sequence of the same length of the SARM1 gene or its transcript (e.g., mRNA). In some embodiments, they are complementary to a nucleotide sequence of the same length in the SARM1 transcript.

[0074] In certain embodiments, the nucleotide sequence of the oligonucleotide is at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100% complementary to a target sequence in the SARM1 transcript. In some embodiments, the nucleotide sequence of the oligonucleotide is completely complementary to a target sequence in the SARM1 transcript.

[0075] In some embodiments, the nucleotide sequence of the oligonucleotide has at least about 80% identity with the nucleotide sequence of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide has at least about 85% identity with the nucleotide sequence of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide has at least about 90% identity with the nucleotide sequence of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide has at least about 95% identity with the nucleotide sequence of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa.

[0076] In some embodiments, the nucleotide sequence of the oligonucleotide includes a continuous range of about 15 or more bases of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide includes a continuous range of about 16 or more bases of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide includes a continuous range of about 17 or more bases of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide includes a continuous range of about 18 or more bases of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide includes a continuous range of about 19 or more bases of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide includes a continuous range of about 20 or more bases of the oligonucleotide disclosed in Table 1, each T can be independently replaced by U, and vice versa.

[0077] In some embodiments, the nucleotide sequence of the oligonucleotide includes the nucleotide sequence of the oligonucleotide in Table 1, where each T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide is the nucleotide sequence of the oligonucleotide in Table 1, where each T can be independently replaced by U, and vice versa. For example, in some embodiments, the nucleotide sequence of the oligonucleotide includes CCACTAGCCCTGGGAGCAAA, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCCATCTCCATCCATAGAGC, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes AGGAGAGCTGTGGGCTTGGG, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes CACCCATGCCTCCCAGCAGA, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCTGGCTGTACTCACTCTCC, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GTGCTCTGTCCTTGGTCCTG, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes CCCATTCTCATGCAGCCTAC, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes CTGTGACCTAGGCTCCTTGA, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GGTCTGAGAGGCTGTGGGTC, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCTCCCAGTTCTTCTGTGGT, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GATGTCCTCCACAGGTGACA, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCTTCCTGCCTTACTGACCT, and each T can be independently replaced by U.In some embodiments, the nucleotide sequence of the oligonucleotide comprises CTCTCCTTTGTCCCTGACCA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCTTGCCTTTTCCTCACTC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCTGGTCACTAACCCTCTC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CACCCACCTTGGTCTTGCCT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CACACTGATGTCCTGTCCCA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CACACCTCTGGGTCTTGGCC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCTGCCCATCACTCCCAGTT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CTCTCCATCTGCCCTGGCCC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CAGTCCCTCTCCTTGTCTCT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ATCCACCTGCTGCTCCTGGG, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCCTTGTGTCTTGTGGGTGC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCCTAGGATTTTCCTGTTG, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCTCAACTCCTGCCTCCCA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises AGACACCTGGGTATCAGCCT, and each T can independently be replaced by U.In some embodiments, the nucleotide sequence of the oligonucleotide comprises TCCTTCTTCCCTATTTCCCA, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCATCACTCACTGTCAGGTA, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTCAGTGCCACAGCCTTGTC, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGCACCTACCTTATGCACCC, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ACTACTGCATCCCTCAGCCC, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCTTGTCTCATCCTGTCTCT, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TGTCTCTGAGCTGACTGCTT, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGGCTTGACTCCACACTCCA, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGCATGGCATCTCAGCTTCA, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TTCAGGATCACCTAGCTGGT, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCTCTTTGCCATCTGCTGGG, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GAGTGCAGTTCACTTGTGGT, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TGCCCACACTCTGCCTGTCA, and each T can be independently replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CAGAGGGAGCTGCTAGTCAG, and each T can be independently replaced by U.In some embodiments, the nucleotide sequence of the oligonucleotide comprises TTGGCAAAGGTGATGCAGGC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCTCCACCAGTTGGAAGACC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGTTCTCAGCCACCAGGATC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTGCTCCAAGATGCCTGCCA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCTTGCAGGCTCTTGATGGC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTGCCATTGGTAGAGTAGGA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTGAGCTCCCTAAAGAACCT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGTTTGCCACCAGTACAGGG, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TCCAGCTTCTCCACATCAAT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GAACTTGCCTGCTTCCAGCT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ACACTCTGGATGAGTTTGTC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGGCACCCATGACACTCTGG, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ACTTGTCCAGTGCTCCAGGT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCCAATCCTTGCAGTCATGG, and each T can independently be replaced by U.In some embodiments, the nucleotide sequence of the oligonucleotide comprises AGCACAGCCTGCATGTCCTC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CAAACTGGTGTCAGAGCCTG, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCAGCACCCTCCAAACTGGT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TGGTTAGGTTGGACCCATGG, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCCAGGTTGTCTCAGCCCA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TCCCTCTCCAGATACTGAGG, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ACAGACAACCCAATGGCAGG, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTCTCCAGAACTGAGCAGGG, and each T can independently be replaced by U. In some embodiments, as confirmed in the examples, such oligonucleotides, for example, oligonucleotide 62, can provide a very substantial and sustained reduction in SARM1 mRNA and polypeptide levels. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCTTAATTCCTGTCTGAGGC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CAGAATACAGTGCCCAGGCC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCCAGGCCCTTGCTCAGAAT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCACTCATCCCTGGCTGGCT, and each T can independently be replaced by U.In some embodiments, the nucleotide sequence of the oligonucleotide includes GATTACAGGGCAAGGCCACA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCCCTGGATGTGGCAAAAGA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes AAGGAAGTCAGAGGGAGGGC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide is CAGGCCCAAAC. including AGGAGGCTC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes ATGCCCAGACCCAGGCCCAA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes CTGAGGCACAGCACCAAGGC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCCAGACCAGGAAGGAGCCT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes TCAGGACTTTGCCTCTTTCC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCTTTAGAGATTTGCTACCC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCCCAGCCTCAGAATGATTC, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes CCTCTGAACCCAGTGGAGGA, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCCTGGGTTTATTGGAGGGT, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GCCAGCACAGCCAAGAGTGG, and each T can independently be replaced by U. In some embodiments, the nucleotide sequence of the oligonucleotide includes GGGAGTGGAAGGAAGGAGCC, and each T can independently be replaced by U.

[0078] In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCACTAGCCCTGGGAGCAAA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCATCTCCATCCATAGAGC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises AGGAGAGCTGTGGGCTTGGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CACCCATGCCTCCCAGCAGA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCTGGCTGTACTCACTCTCC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTGCTCTGTCCTTGGTCCTG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCCATTCTCATGCAGCCTAC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CTGTGACCTAGGCTCCTTGA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGTCTGAGAGGCTGTGGGTC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCTCCCAGTTCTTCTGTGGT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GATGTCCTCCACAGGTGACA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCTTCCTGCCTTACTGACCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CTCTCCTTTGTCCCTGACCA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCTTGCCTTTTCCTCACTC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCTGGTCACTAACCCTCTC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CACCCACCTTGGTCTTGCCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CACACTGATGTCCTGTCCCA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CACACCTCTGGGTCTTGGCC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCTGCCCATCACTCCCAGTT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CTCTCCATCTGCCCTGGCCC.In some embodiments, the nucleotide sequence of the oligonucleotide comprises CAGTCCCTCTCCTTGTCTCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ATCCACCTGCTGCTCCTGGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCCTTGTGTCTTGTGGGTGC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCCTAGGATTTTCCTGTTG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCTCAACTCCTGCCTCCCA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises AGACACCTGGGTATCAGCCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TCCTTCTTCCCTATTTCCCA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCATCACTCACTGTCAGGTA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTCAGTGCCACAGCCTTGTC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGCACCTACCTTATGCACCC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ACTACTGCATCCCTCAGCCC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCTTGTCTCATCCTGTCTCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TGTCTCTGAGCTGACTGCTT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGGCTTGACTCCACACTCCA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGCATGGCATCTCAGCTTCA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TTCAGGATCACCTAGCTGGT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCTCTTTGCCATCTGCTGGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GAGTGCAGTTCACTTGTGGT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TGCCCACACTCTGCCTGTCA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CAGAGGGAGCTGCTAGTCAG.In some embodiments, the nucleotide sequence of the oligonucleotide comprises TTGGCAAAGGTGATGCAGGC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCTCCACCAGTTGGAAGACC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGTTCTCAGCCACCAGGATC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTGCTCCAAGATGCCTGCCA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCTTGCAGGCTCTTGATGGC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTGCCATTGGTAGAGTAGGA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTGAGCTCCCTAAAGAACCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGTTTGCCACCAGTACAGGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TCCAGCTTCTCCACATCAAT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GAACTTGCCTGCTTCCAGCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ACACTCTGGATGAGTTTGTC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGGCACCCATGACACTCTGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ACTTGTCCAGTGCTCCAGGT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCCAATCCTTGCAGTCATGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises AGCACAGCCTGCATGTCCTC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CAAACTGGTGTCAGAGCCTG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCAGCACCCTCCAAACTGGT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TGGTTAGGTTGGACCCATGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCCAGGTTGTCTCAGCCCA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TCCCTCTCCAGATACTGAGG.In some embodiments, the nucleotide sequence of the oligonucleotide comprises ACAGACAACCCAATGGCAGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTCTCCAGAACTGAGCAGGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCTTAATTCCTGTCTGAGGC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CAGAATACAGTGCCCAGGCC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCCAGGCCCTTGCTCAGAAT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCACTCATCCCTGGCTGGCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GATTACAGGGCAAGGCCACA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCCTGGATGTGGCAAAAGA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises AAGGAAGTCAGAGGGAGGGC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CAGGCCCAAACAGGAGGCTC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises ATGCCCAGACCCAGGCCCAA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CTGAGGCACAGCACCAAGGC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCAGACCAGGAAGGAGCCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TCAGGACTTTGCCTCTTTCC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCTTTAGAGATTTGCTACCC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCCAGCCTCAGAATGATTC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises CCTCTGAACCCAGTGGAGGA. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCTGGGTTTATTGGAGGGT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCCAGCACAGCCAAGAGTGG. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGGAGTGGAAGGAAGGAGCC.

[0079] Length As will be understood by those skilled in the art, oligonucleotides can be of various lengths to provide desired properties and / or activities for various uses. Many techniques for evaluating, selecting, and / or optimizing oligonucleotide length are available in the art and can be utilized in accordance with the present disclosure. As demonstrated herein, in many embodiments, the oligonucleotides provided are of a length suitable for hybridizing to their targets and reducing the levels of their targets and / or their products. In some embodiments, the oligonucleotide is of a length sufficient to recognize a target nucleic acid (e.g., SARM1 mRNA). In some embodiments, the oligonucleotide is of a length sufficient to distinguish a target nucleic acid from other nucleic acids (e.g., nucleic acids having a base sequence other than the SARM1 sequence) to reduce off-target effects. In some embodiments, the oligonucleotide is short enough to reduce the complexity of manufacture or production and reduce the cost of the product.

[0080] In some embodiments, the nucleotide sequence of the oligonucleotide is about 10 to 100 nucleobases in length. In some embodiments, the nucleotide sequence is about 10 to 50 nucleobases in length. In some embodiments, the nucleotide sequence is about 15 to 50 nucleobases in length. In some embodiments, the nucleotide sequence is about 15 to 30 nucleobases in length. In some embodiments, the nucleotide sequence is about 15 to 25 nucleobases in length. In some embodiments, the nucleotide sequence is about 15 to 22 nucleobases in length. In some embodiments, the nucleotide sequence is about 18 to 22 nucleobases in length. In some embodiments, the nucleotide sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 12 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 13 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 14 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 15 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 16 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 17 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 18 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 19 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 20 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 21 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 22 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 23 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 24 nucleobases in length. In some embodiments, the nucleotide sequence is at least about 25 nucleobases in length. In some embodiments, the nucleotide sequence is about 15 nucleobases in length. In some embodiments, the nucleotide sequence is about 16 nucleobases in length. In some embodiments, the nucleotide sequence is about 17 nucleobases in length. In some embodiments, the nucleotide sequence is about 18 nucleobases in length. In some embodiments, the nucleotide sequence is about 19 nucleobases in length. In some embodiments, the nucleotide sequence is about 20 nucleobases in length. In some embodiments, the nucleotide sequence is about 21 nucleobases in length. In some embodiments, the nucleotide sequence is about 22 nucleobases in length.In some embodiments, the base sequence is about 23 nucleobases in length. In some embodiments, the base sequence is about 24 nucleobases in length. In some embodiments, the base sequence is about 25 nucleobases in length. In some other embodiments, the base sequence is at least about 30 nucleobases in length. In some embodiments, each nucleobase independently comprises a monocyclic, bicyclic, or polycyclic ring optionally substituted with at least one ring atom being nitrogen. In some embodiments, each nucleobase independently is an optionally substituted adenine, cytosine, guanosine, thymine, or uracil, or an optionally substituted tautomer of adenine, cytosine, guanosine, thymine, or uracil.

[0081] Nucleobase In accordance with the present disclosure, various nucleobases can be utilized in the provided oligonucleotides. In some embodiments, the nucleobases are natural nucleobases that are the most commonly occurring nucleobases of A, T, C, G, and U. In some embodiments, the nucleobases are modified nucleobases in that they are not A, T, C, G, or U. In some embodiments, the nucleobases are optionally substituted A, T, C, G, or U, or substituted tautomers of A, T, C, G, or U. In some embodiments, the nucleobases are optionally substituted A, T, C, G, or U, such as 5mC, 5-hydroxymethyl C, etc. In some embodiments, the nucleobases are A, T, C, G, or U substituted with alkyl. In some embodiments, the nucleobase is A. In some embodiments, the nucleobase is T. In some embodiments, the nucleobase is C. In some embodiments, the nucleobase is G. In some embodiments, the nucleobase is U. In some embodiments, the nucleobase is 5mC. In some embodiments, the nucleobases are substituted A, T, C, G, or U. In some embodiments, the nucleobases are substituted tautomers of A, T, C, G, or U. In some embodiments, the substitution protects a particular functional group in the nucleobase and minimizes unwanted reactions during oligonucleotide synthesis. Suitable techniques for nucleobase protection in oligonucleotide synthesis are widely known in the art and can be utilized in accordance with the present disclosure. In some embodiments, the modified nucleobases improve the properties and / or activities of the oligonucleotides. For example, in many cases, 5mC can be utilized instead of C to modulate certain unwanted biological effects, such as the immune response. In some embodiments, when determining sequence identity, substituted nucleobases having the same hydrogen bonding pattern are treated the same as unsubstituted nucleobases, e.g., 5mC can be treated the same as C [e.g., an oligonucleotide having 5mC instead of C (e.g., AT5mCG) is considered to have the same base sequence as an oligonucleotide having C at the corresponding position(s) (e.g., ATCG)].

[0082] In some embodiments, the oligonucleotide comprises one or more A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more optionally substituted A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more 5-methylcytosine (5mC), 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine. In some embodiments, the oligonucleotide comprises one or more 5mC. In some embodiments, each nucleobase in the oligonucleotide is independently selected from optionally substituted A, T, C, G, and U, and optionally substituted tautomers of A, T, C, G, and U. In some embodiments, each nucleobase in the oligonucleotide is independently optionally protected A, T, C, 5mC, G, and U. In some embodiments, each nucleobase in the oligonucleotide is optionally substituted A, T, C, G, or U. In some embodiments, each nucleobase in the oligonucleotide is selected from the group consisting of A, T, C, G, U, and 5mC.

[0083] In some embodiments, the nucleobase is optionally substituted 2AP or DAP. In some embodiments, the nucleobase is optionally substituted 2AP. In some embodiments, the nucleobase is optionally substituted DAP. In some embodiments, the nucleobase is 2AP. In some embodiments, the nucleobase is DAP.

[0084] In some embodiments, the nucleobases are natural nucleobases or modified nucleobases derived from natural nucleobases. Examples include uracil, thymine, adenine, cytosine, and guanine, each optionally having an amino group protected by an acyl protecting group, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pseudoisocytosine, and pyrimidine analogs such as pseudouracil, and other modified nucleobases such as 8-substituted purines, xanthine, or hypoxanthine (the latter two being natural degradation products). Certain examples of modified nucleobases are disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22, 2183-2196, and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313.

[0085] In some embodiments, the provided oligonucleotides contain one or more 5-methylcytosines. In some embodiments, the present disclosure provides oligonucleotides having a base sequence disclosed herein, for example, in Table 1, wherein each T can independently be replaced by U, and vice versa, and each cytosine can optionally and independently be replaced by 5-methylcytosine, and vice versa. As will be understood by those skilled in the art, in some embodiments, 5mC can be treated as C with respect to the base sequence of the oligonucleotide. Such oligonucleotides contain a nucleobase modification at the position of C (see, for example, the various oligonucleotides in Table 1 or A2). In the description of the oligonucleotide, unless otherwise stated, the nucleobases, sugars, and internucleotide linkages are unmodified.

[0086] In some embodiments, the modified nucleobase is a modified nucleobase known in the art, for example, as described in WO2017 / 210647. In some embodiments, the modified nucleobase is an enlarged-size nucleobase to which one or more aryl and / or heteroaryl rings, such as a phenyl ring, are added.

[0087] The nucleobase can be protected during oligonucleotide synthesis. Various protection techniques are available and can be utilized in accordance with the present disclosure.

[0088] In some embodiments, the modified nucleobase is a 5-substituted pyrimidine, 6-azapyrimidine, pyrimidine substituted with alkyl or alkynyl, purine substituted with alkyl, or N-2, N-6, and O-6 substituted purine. In certain embodiments, the modified nucleobase is 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoyl cytosine, 4-N-benzoyl uracil, 5-methyl 4-N-benzoyl cytosine, 5-methyl 4-N-benzoyl uracil, universal base, hydrophobic base, degenerate base, size-expanded base, and fluorinated base. In some embodiments, the modified nucleobase is a tricyclic pyrimidine such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, or 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). In some embodiments, the modified nucleobase is one in which the purine or pyrimidine base is replaced with another heterocycle such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, or 2-pyridone.

[0089] In some embodiments, the modified nucleobase is substituted. In some embodiments, the modified nucleobase is substituted to include, for example, a heteroatom, an alkyl group, or a fluorescent moiety, a biotin or avidin moiety, or a linking moiety attached to another protein or peptide. In some embodiments, the modified nucleobase is a "universal base" that is not a nucleobase in the most classical sense but functions similarly to a nucleobase. An example of a universal base is 3-nitropyrrole.

[0090] In some embodiments, the nucleosides that can be utilized in the provided technology are modified nucleobases and / or modified sugars, such as 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2'-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2'-O-methylpseudouridine, beta,D-galactosylqueosine, 2'-O-methylguanosine, N 6 -isopentenyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, N 7 -methylguanosine, 3-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-formylcytosine, 5-carboxylcytosine, N 6 -methyladenosine, 7-methylguanosine, 5-methylaminoethyluridine, 5-methoxyaminomethyl-2-thiouridine, beta, D-mannosylqueosine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N 6-Isopentenyl adenosine, N-((9-beta, D-ribofuranosyl-2-methylthiopurin-6-yl)carbamoyl)threonine, N-((9-beta, D-ribofuranosylpurin-6-yl)-N-methylcarbamoyl)threonine, methyl uridine-5-oxyacetate, uridine-5-oxyacetic acid (v), pseudouridine, queosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, 2'-O-methyl-5-methyluridine, and 2'-O-methyluridine.

[0091] In some embodiments, a nucleobase, e.g., a modified nucleobase, includes one or more biomolecule binding moieties such as, for example, an antibody, an antibody fragment, biotin, avidin, streptavidin, a receptor ligand, or a chelating moiety. In other embodiments, the nucleobase is 5-bromouracil, 5-iodouracil, or 2,6-diaminopurine. In some embodiments, the nucleobase includes substitution with a fluorescent or biomolecule binding moiety. In some embodiments, the substituent is a fluorescent moiety. In some embodiments, the substituent is biotin or avidin.

[0092] In some embodiments, the nucleobase is as described in US9394333, US9744183, US9605019, US9598458, US9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, and / or WO2019 / 032612, each of these nucleobases being incorporated herein by reference.

[0093] Sugar A variety of sugars, including modified sugars, can be utilized in accordance with the present disclosure. In some embodiments, the present disclosure provides sugar modifications and patterns thereof, optionally in combination with other structural elements (e.g., nucleobase modifications and their patterns, internucleotide linkage modifications and their patterns, etc.) that can provide improved properties and / or activities when incorporated into oligonucleotides.

[0094] The most common naturally occurring nucleosides contain a ribose sugar (e.g., in RNA) or a deoxyribose sugar (e.g., in DNA) linked to a nucleobase of adenosine (A), cytosine (C), guanine (G), thymine (T), or uracil (U). In some embodiments, the sugar, e.g., the various sugars in many of the oligonucleotides of Table 1 (unless otherwise noted), is the natural DNA sugar (in a DNA nucleic acid or oligonucleotide,

Chemical formula

Chemical formula

[0095] The sugar can be attached to the internucleotide linkage at various positions. By way of non-limiting example, the internucleotide linkage can be attached to the 2'-, 3'-, 4'-, or 5'-position of the sugar. As is most common in natural nucleic acids, the internucleotide linkage typically connects one sugar at the 5'-position and another sugar at the 3'-position, unless otherwise indicated.

[0096] In some embodiments, the sugar is a naturally occurring DNA or RNA sugar that is optionally substituted. In some embodiments, the sugar is an optionally substituted

Chemical formula

Chemical formula

Chemical formula

Chemical Structure

Chemical Structure

[0097] In some embodiments, the sugar is

Chemical Structure

[0098] In some embodiments, the modified sugar has one or more substituents independently selected from -F, -CF3, -CN, -N3, -NO, -NO2, -OR’, -SR’, or -N(R’)2 at the 2’ position (typically one substituent, often in the axial position or R 2s ), and each R’ is independently C as described in this disclosure and, in some embodiments, is optionally substituted 1-10 aliphatic, -O-(C1-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 alkyl), or -N(C1-C 10 alkyl)2, -O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl), or -N(C2-C 10 alkenyl)2, -O-(C2-C 10 alkynyl), -S-(C2-C 10 alkynyl), -NH-(C2-C 10 alkynyl), or -N(C2-C 10 alkynyl)2, or -O--(C1-C 10 alkylene)-O--(C1-C 10 alkyl), -O-(C1-C 10 alkylene)-NH-(C1-C 10 alkyl) or -O-(C1-C 10 alkylene)-NH(C1-C 10(alkyl)2, -NH-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), or -N(C1-C 10 alkyl)-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), wherein each of alkyl, alkylene, alkenyl, and alkynyl is independent and optionally substituted. In some embodiments, the substituent is -O(CH2) n OCH3, -O(CH2) n NH2, MOE, DMAOE, or DMAEOE, and n is from 1 to about 10.

[0099] In some embodiments, the modified sugar is a natural RNA sugar whose 2'-OH is replaced with a group selected from -F, -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2, where each R' is independently as described in the present disclosure, -O-(C1-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 alkyl), or -N(C1-C 10 alkyl)2, -O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl), or -N(C2-C 10 alkenyl)2, -O-(C2-C 10 alkynyl), -S-(C2-C 10 alkynyl), -NH-(C2-C 10 alkynyl), or -N(C2-C 10 alkynyl)2, or -O--(C1-C 10 alkylene)-O--(C1-C 10 alkyl), -O-(C1-C 10 alkylene)-NH-(C1-C 10 alkyl) or -O-(C1-C 10 alkylene)-NH(C1-C 10 alkyl)2, -NH-(C1-C 10(alkylene)-O-(C1-C 10 (alkyl), or -N(C1-C 10 (alkyl)-(C1-C 10 (alkylene)-O-(C1-C 10 (alkyl), wherein each of alkyl, alkylene, alkenyl, and alkynyl is independent and optionally substituted. In some embodiments, the 2'-OH is replaced with -H (deoxyribose). In some embodiments, the 2'-OH is replaced with -F. In some embodiments, the 2'-OH is replaced with -OR'. In some embodiments, the 2'-OH is replaced with -OMe. In some embodiments, the 2'-OH is replaced with -OCH2CH2OMe.

[0100] In some embodiments, the sugar modification is a 2'-modification. In some embodiments, the 2'-modification is a 2'-OR s modification. In some embodiments, R s is optionally substituted C 1-4 aliphatic. In some embodiments, R s is optionally substituted C 1-6 (alkyl). In some embodiments, the modification is 2'-OMe. In some embodiments, the modification is 2'-MOE. In some embodiments, the 2'-modification is S-cEt. In some embodiments, the modified sugar is an LNA sugar. In some embodiments, the 2'-modification is -F.

[0101] In some embodiments, the sugar modification replaces the sugar moiety with another cyclic or acyclic moiety. Examples of such moieties are well known in the art and can be utilized in accordance with the present disclosure, such as, for example, those of morpholino, glycol nucleic acid, PNA, and the like.

[0102] In some embodiments, one or more sugars of the oligonucleotide are independently modified. In some embodiments, each sugar of the oligonucleotide or a portion thereof (e.g., a wing) is independently modified. In some embodiments, the modified sugar comprises a 2'-modification. In some embodiments, each modified sugar independently comprises a 2'-modification. In some embodiments, the 2'-modification is 2'-OR s wherein R s is optionally substituted C 1-6 aliphatic. In some embodiments, the 2'-modification is a 2'-OMe modification. In some embodiments, the 2'-modification is a 2'-MOE modification. In some embodiments, the 2'-modification is an LNA sugar modification. In some embodiments, the 2'-modification is 2'-F. In some embodiments, each sugar modification is independently a 2'-modification. In some embodiments, each sugar modification is independently a 2'-OR s modification. In some embodiments, each sugar modification is independently a 2'-OR s wherein R s is optionally substituted C 1-6 alkyl. In some embodiments, each sugar modification is 2'-OMe. In some embodiments, each sugar modification is 2'-MOE. In some embodiments, each sugar modification is independently 2'-OMe or 2'-MOE. In some embodiments, each sugar modification is independently 2'-OMe, 2'-MOE, or an LNA sugar.

[0103] As will be appreciated by those skilled in the art, modifications such as sugars, nucleobases, internucleotide linkages, etc. can be used in combination in oligonucleotides and are often used. See, for example, the various oligonucleotides in Table 1.

[0104] In some embodiments, the sugar is as described in US9394333, US9744183, US9605019, US9598458, US9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, and / or WO2019 / 032612, each of which is incorporated herein by reference.

[0105] Various additional sugars useful for preparing oligonucleotides or analogs thereof are known in the art and can be utilized in accordance with the present disclosure.

[0106] Inter-nucleotide linkage In some embodiments, the oligonucleotide comprises base modifications, sugar modifications, and / or inter-nucleotide linkage modifications. In accordance with the present disclosure, various inter-nucleotide linkages can be utilized to link units containing nucleobases, e.g., nucleosides. In some embodiments, the oligonucleotide comprises both one or more modified inter-nucleotide linkages and one or more natural phosphate linkages. As is widely known to those skilled in the art, natural phosphate linkages are widely found in natural DNA and RNA molecules, which have the structure of -OP(O)(OH)O-, connect the sugars in nucleosides in DNA and RNA, and can be in various salt forms. For example, at physiological pH (about 7.4), natural phosphate linkages are mainly in the form where the anion is -OP(O)(O -)It exists in the form of a salt that is O-. A modified internucleotide linkage, or an unnatural phosphate linkage, is an internucleotide linkage that is not a natural phosphate linkage or its salt form. Modified internucleotide linkages can also be in the form of their salts depending on their structures. For example, as understood by those skilled in the art, a phosphorothioate internucleotide linkage having the structure of -OP(O)(SH)O- can exist in various salt forms. For example, at physiological pH (about 7.4), the anion is -OP(O)(S - )O-.

[0107] In some embodiments, the oligonucleotide comprises an internucleotide linkage that is a modified internucleotide linkage, such as a phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, thiophosphate, 3'-thiophosphate, or 5'-thiophosphate.

[0108] In some embodiments, the internucleotide linkage is described in US9394333, US9744183, US9605019, US9598458, US9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, and / or WO2019 / 032612, and each of these internucleotide linkages is incorporated herein by reference.In some embodiments, the internucleotide linkage is described in U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,177,195; 5,023,243; 5,034,506; 5,166,315; 5,185,444; 5,188,897; 5,214,134; 5,216,141; 5,235,033; 5,264,423; 5,264,564; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,938; 5,405,939; 5,434,257; 5,453,496; 5,455,233; 5,466,677; 5,466,677; 5,470,967; 5,476,925; 5,489,677; 5,519,126; 5,536,821; 5,541,307; 5,541,316; 5,550,111; 5,561,225; 5,563,253; 5,571,799; 5,587,361; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,625,050; 5,633,360; 5,645,62; 5,663,312; 5,677,437; 5,677,439; 6,160,109; 6,239,265; 6,028,188; 6,124,445; 6,169,170; 6,172,209; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; or RE39,464, and each of these internucleotide linkages is incorporated herein by reference.

[0109] In some embodiments, the oligonucleotide comprises one or more modified internucleotide linkages. In some embodiments, each modified internucleotide linkage is independently a phosphorothioate internucleotide linkage. In some embodiments, one or more of all the internucleotide linkages in the oligonucleotide, for example, about 1-20, 1-15, 1-10, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or about 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or more are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 10% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 25% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 50% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 60% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 70% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 75% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 80% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 85% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 90% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, more than about 95% of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, each internucleotide linkage attached to a natural DNA sugar is independently a phosphorothioate internucleotide linkage.In some embodiments, each internucleotide linkage in the oligonucleotide is independently a phosphorothioate internucleotide linkage.

[0110] In some embodiments, the oligonucleotide comprises one or more native phosphate linkages. In some embodiments, each native phosphate linkage independently binds to at least one modified sugar. In some embodiments, each sugar bound to a native phosphate linkage is independently a modified sugar. In some embodiments, each sugar bound to a native phosphate linkage is independently a 2'-OR s modified sugar or bicyclic sugar (e.g., LNA sugar). In some embodiments, each sugar bound to a native phosphate linkage is independently a 2'-OR s modified sugar. In some embodiments, each sugar bound to a native phosphate linkage is independently a 2'-MOE modified sugar.

[0111] Wing and core In some embodiments, the oligonucleotide comprises or consists of a 5'-wing-core-wing-3' structure.

[0112] The wings and the core can, independently, be of various suitable lengths. In some embodiments, the wing or the core independently has about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more nucleobases. In some embodiments, each nucleobase independently comprises a monocyclic, bicyclic, or polycyclic ring that is optionally substituted, the ring having at least one nitrogen ring atom. In some embodiments, each nucleobase is independently an optionally substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, the number of nucleobases in the wing is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the number is 1 for the wing. In some embodiments, the number is 2 for the wing. In some embodiments, the number is 3 for the wing. In some embodiments, the number is 4 for the wing. In some embodiments, the number is 5 for the wing. In some embodiments, the number is 6 for the wing. In some embodiments, the number is 7 for the wing. In some embodiments, the number is 8 for the wing. In some embodiments, the number is 9 for the wing. In some embodiments, the number is 10 for the wing. In some embodiments, in the wings of the wing-core-wing structure, the two wings are of the same length. In some embodiments, the two wings are of different lengths. In some embodiments, the number is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more for the core. In some embodiments, the number is 5 to 15 for the core, for example, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15. In some embodiments, the number is 1 for the core. In some embodiments, the number is 2 for the core. In some embodiments, the number is 3 for the core. In some embodiments, the number is 4 for the core. In some embodiments, the number is 5 for the core.In some embodiments, the number is 6 for the core. In some embodiments, the number is 7 for the core. In some embodiments, the number is 8 for the core. In some embodiments, the number is 9 for the core. In some embodiments, the number is 10 for the core. In some embodiments, the number is 11 for the core. In some embodiments, the number is 12 for the core. In some embodiments, the number is 13 for the core. In some embodiments, the number is 14 for the core. In some embodiments, the number is 15 for the core.

[0113] In some embodiments, the wing-core-wing is described as "X-Y-Z", where "X" represents the length of the 5' wing (as the number of nucleobases), "Y" represents the length of the core (as the number of nucleobases), and "Z" represents the length of the 3' wing (as the number of nucleobases). Exemplary embodiments of X, Y, and Z are described as numbers (e.g., as above) and include their lengths as exemplified by oligonucleotide species (e.g., Table 1). In some embodiments, the two wings are of the same or different lengths and / or have the same or different modifications or patterns of modifications. In some embodiments, Y is from 8 to 15. In some embodiments, X, Y, or Z can each independently be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, or more. In some embodiments, each of X, Y, and Z is independently from 1 to 30. In some embodiments, X-Z-Z is 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7-5, 4-7-5, 5-7-4, or 4-7-4.

[0114] In some embodiments, the wing contains one or more sugar modifications. In some embodiments, each sugar in the wing is independently modified. In some embodiments, each wing sugar in the oligonucleotide is independently modified. In some embodiments, each modified sugar independently contains a 2'-modification (e.g., 2'-OR s a modified sugar, an LNA sugar, etc.). In some embodiments, each wing sugar independently contains a 2'-OR s modified sugar. In some embodiments, each sugar modification in the wing is the same. In some embodiments, the wing contains different sugar modifications, e.g., different 2'-OR s modifications. In some embodiments, 2'-OR s is 2'-OMe. In some embodiments, 2'-OR s is 2'-MOE. In some embodiments, each sugar in the wing is a 2'-MOE modified sugar. In some embodiments, each sugar in the wing is a 2'-OMe modified sugar. In some embodiments, the wing contains one or more 2'-OMe modified sugars and one or more 2'-MOE modified sugars.

[0115] In some embodiments, the two wings of the wing-core-wing structure contain different sugar modifications or patterns thereof.

[0116] In some embodiments, a particular sugar modification, e.g., 2'-MOE, provides higher stability than other sugar modifications, e.g., 2'-OMe or natural DNA or RNA sugars, under certain conditions.

[0117] In some embodiments, the wing contains a bicyclic sugar. In some embodiments, the bicyclic sugar is an LNA, cEt, or BNA sugar.

[0118] In some embodiments, one or more internucleotide linkages attached to the 5'-wing sugar are each independently a modified internucleotide linkage. In some embodiments, they are each independently phosphorothioate internucleotide linkages. In some embodiments, each internucleotide linkage attached to the 5'-wing sugar is independently a modified internucleotide linkage. In some embodiments, such internucleotide linkages are each independently phosphorothioate internucleotide linkages.

[0119] In some embodiments, one or more internucleotide linkages attached to the 3'-wing sugar are each independently a modified internucleotide linkage. In some embodiments, they are each independently phosphorothioate internucleotide linkages. In some embodiments, each internucleotide linkage attached to the 3'-wing sugar is independently a modified internucleotide linkage. In some embodiments, such internucleotide linkages are each independently phosphorothioate internucleotide linkages.

[0120] In some embodiments, the core comprises one or more, for example, about 1 to 20, 5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20, or 5 to 15, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 natural DNA sugars. In some embodiments, the core comprises two or more natural DNA sugars. In some embodiments, the core comprises three or more natural DNA sugars. In some embodiments, the core comprises four or more natural DNA sugars. In some embodiments, the core comprises five or more natural DNA sugars. In some embodiments, the core comprises six or more natural DNA sugars. In some embodiments, the core comprises seven or more natural DNA sugars. In some embodiments, the core comprises eight or more natural DNA sugars. In some embodiments, the core comprises nine or more natural DNA sugars. In some embodiments, the core comprises ten or more natural DNA sugars. In some embodiments, the core comprises eleven or more natural DNA sugars. In some embodiments, the core comprises twelve or more natural DNA sugars. In some embodiments, the core comprises thirteen or more natural DNA sugars. In some embodiments, the core comprises fourteen or more natural DNA sugars. In some embodiments, the core comprises fifteen or more natural DNA sugars. In some embodiments, such DNA sugars are contiguous. In some embodiments, each sugar in the core is independently a natural DNA sugar.

[0121] In some embodiments, one or more internucleotide linkages attached to the core sugar are each independently a modified internucleotide linkage. In some embodiments, they are each independently phosphorothioate internucleotide linkages. In some embodiments, each internucleotide linkage attached to the core sugar is independently a modified internucleotide linkage. In some embodiments, such internucleotide linkages are each independently phosphorothioate internucleotide linkages.

[0122] In some embodiments, the core forms a double-stranded structure recognizable by RNase H such that it can hybridize to the target mRNA and RNase H can cleave the mRNA.

[0123] Oligonucleotide In particular, the present disclosure provides various oligonucleotides. As described herein, oligonucleotides can include various nucleobase modifications, sugar modifications, internucleotide linkages, and patterns thereof. In some embodiments, the present disclosure provides the oligonucleotides of Table 1 as examples. [Table 1] TIFF2025523905000010.tif254170TIFF2025523905000011.tif246170TIFF2025523905000012.tif253170TIFF2025523905000013.tif249170TIFF2025523905000014.tif244170 Note: Unless otherwise indicated, oligonucleotides are written from 5' to 3'. As will be understood by those skilled in the art, the internucleotide linkage connects the 5' and 3' positions of the sugars. Unless otherwise indicated (e.g., by "*" which is for phosphorothioate internucleotide linkages), the internucleotide linkage is a natural phosphate linkage. Unless otherwise indicated, each of A, T, C, and G is independently, (e.g., typically as found in natural DNA), deoxyadenosine, thymidine, deoxycytidine, and deoxyguanosine. "2MOEr" indicates a 2'-MOE modification to the sugar, "5" indicates that the nucleoside has a 5'-OH group (e.g., when at the 5' end of an oligonucleotide), "3" indicates that the nucleoside has a 3'-OH group (e.g., when at the 3' end of an oligonucleotide), "i" indicates that the nucleoside is in the middle of the oligonucleotide and its 5'- and 3'-positions are attached to the internucleotide linkages as shown, and "Me-dC" indicates 5-methyl-2'-deoxycytidine nucleoside. As will be understood by those skilled in the art, oligonucleotides can exist in various forms including various salt forms. / 52MOErA / is [Chemical formula] and / 52MOErT / is [Chemical formula] and / 52MOErC / is [Chemical formula] and / 52MOErG / is [Chemical formula] and * is -O-P(O)(SH)-O- / i2MOErA / is [Chemical formula] and / i2MOErT / is [Chemical formula] and / i2MOErC / is [Chemical formula] and / i2MOErG / is [Chemical formula] and / iMe-dC / is [Chemical formula] and / 32MOErA / is [Chemical formula] and / 32MOErT / is [Chemical formula] and / 32MOErC / is [Chemical formula] and / 32MOErG / is [Chem.] as follows.

[0124] In some embodiments, the provided oligonucleotide can hybridize to the SARM1 transcript. In some embodiments, the provided oligonucleotide can reduce the level of the SARM1 transcript or its product. In some embodiments, the provided oligonucleotide can reduce the level of SARM1 mRNA. In some embodiments, the provided oligonucleotide can reduce the level of the SARM1 polypeptide. In some embodiments, the provided oligonucleotide can reduce the active level of the SARM1 polypeptide observed in a system (e.g., a sample, a subject, etc.). In some embodiments, the oligonucleotide is selected from Table 1. In some embodiments, the oligonucleotide is a pharmaceutically acceptable salt of the oligonucleotide selected from Table 1.

[0125] In some embodiments, the present disclosure provides an oligonucleotide that is particularly effective in reducing the level of SARM1 transcript, polypeptide, and / or activity.

[0126] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / *A*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G*G*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErA / or a salt thereof.

[0127] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *A*T* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErC / or a salt thereof.

[0128] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *A*G* / iMe-dC / *T*G*T*G*G*G* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0129] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErA / or a salt thereof.

[0130] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / iMe-dC / *T*G*T*A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0131] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*T* / iMe-dC / * / iMe-dC / *T*T*G*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / or a salt thereof.

[0132] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / *T* / iMe-dC / *T* / iMe-dC / *A*T*G* / iMe-dC / *A*G* / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / 32MOErC / or a salt thereof.

[0133] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *T*A*G*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErA / or a salt thereof.

[0134] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*G*A*G*G* / iMe-dC / *T*G*T* / i2MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErC / or a salt thereof.

[0135] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*T*T* / iMe-dC / *T*T* / iMe-dC / *T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.

[0136] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G*G* / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0137] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / *T*T*A* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0138] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*T*T*G*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0139] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *T*T*T*T* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / 32MOErC / or a salt thereof.

[0140] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*T* / iMe-dC / *A* / iMe-dC / *T*A*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / 32MOErC / or a salt thereof.

[0141] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *T*T*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0142] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / *T*G*A*T*G*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0143] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T* / iMe-dC / *T*G*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0144] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / *A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErT / or a salt thereof.

[0145] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0146] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0147] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0148] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G*T*G*T* / iMe-dC / *T*T*G*T*G* / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErC / or a salt thereof.

[0149] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *A*G*G*A*T*T*T*T* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / 32MOErG / or a salt thereof.

[0150] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / *A*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0151] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G*G*G*T*A*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0152] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0153] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErC / *A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / *T*G*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErA / or a salt thereof.

[0154] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / or a salt thereof.

[0155] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T*A* / iMe-dC / * / iMe-dC / *T*T*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0156] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*G* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0157] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / *T* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0158] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*A*G* / iMe-dC / *T*G*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErT / or a salt thereof.

[0159] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / *T*G*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0160] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *G*G* / iMe-dC / *A*T* / iMe-dC / *T* / iMe-dC / *A*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0161] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G*A*T* / iMe-dC / *A* / iMe-dC / * / iMe-dC / *T*A*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.

[0162] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*T*G* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0163] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*T*T* / iMe-dC / *A* / iMe-dC / *T*T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.

[0164] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / *A* / iMe-dC / *T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0165] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G*G*A*G* / iMe-dC / *T*G* / iMe-dC / *T*A* / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErG / or a salt thereof.

[0166] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / *A*A*A*G*G*T*G*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.

[0167] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *A*G*T*T*G*G*A* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0168] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / *T* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErT / * / 32MOErC / or a salt thereof.

[0169] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / * / iMe-dC / *A*A*G*A*T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0170] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.

[0171] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / *A*T*T*G*G*T*A*G*A*G* / i2MOErT / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / or a salt thereof.

[0172] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*A*A*G* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0173] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A*G*T*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0174] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErT / or a salt thereof.

[0175] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0176] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*G*A*T*G*A*G*T* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / or a salt thereof.

[0177] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / * / iMe-dC / *A*T*G*A* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0178] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / * / iMe-dC / *A*G*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.

[0179] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T* / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *A*G*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0180] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / *A*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *A*T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErC / or a salt thereof.

[0181] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErC / *T*G*G*T*G*T* / iMe-dC / *A*G*A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / or a salt thereof.

[0182] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*A*A* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.

[0183] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / *A*G*G*T*T*G*G*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0184] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G*G*T*T*G*T* / iMe-dC / *T* / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0185] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*G*A*T*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0186] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / iMe-dC / *A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*A*T*G* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0187] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0188] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*T* / iMe-dC / * / iMe-dC / *T*G*T* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.

[0189] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / *T*A* / iMe-dC / *A*G*T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0190] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / 32MOErT / or a salt thereof.

[0191] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0192] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / iMe-dC / *A*G*G*G* / iMe-dC / *A*A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / 32MOErA / or a salt thereof.

[0193] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *G*G*A*T*G*T*G*G* / iMe-dC / *A* / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / 32MOErA / or a salt thereof.

[0194] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / *A*G*T* / iMe-dC / *A*G*A*G*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.

[0195] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*A*A* / iMe-dC / *A*G*G*A* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErC / or a salt thereof.

[0196] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / 32MOErA / or a salt thereof.

[0197] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / *A* / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.

[0198] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *A*G*G*A*A*G*G* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.

[0199] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / *A* / iMe-dC / *T*T*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0200] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*G*A*G*A*T*T*T*G* / iMe-dC / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0201] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / *A*G*A*A*T* / i2MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErC / or a salt thereof.

[0202] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*T*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / or a salt thereof.

[0203] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*G*T*T*T*A*T*T*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.

[0204] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A*A*G* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErG / or a salt thereof.

[0205] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *T*G*G*A*A*G*G*A*A*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErC / or a salt thereof.

[0206] In some embodiments, the present disclosure provides a composition comprising the provided oligonucleotide. In some embodiments, the oligonucleotide composition comprises the provided oligonucleotide or a salt thereof, as well as various diastereomers and salts thereof. In some embodiments, the oligonucleotide composition comprises the provided oligonucleotide or a salt thereof and various diastereomers with respect to chiral linked phosphorus and salts thereof. In some embodiments, the oligonucleotide can exist in one or more forms. In some embodiments, the oligonucleotide in the composition exists in the form of a salt. In some embodiments, the oligonucleotide in the composition exists in the form of one or more salts. In some embodiments, the form of the salt is a pharmaceutically acceptable salt form. In some embodiments, the form of the salt is a metal salt. In some embodiments, the form of the salt is an alkali metal salt. In some embodiments, the form of the salt is a sodium salt. In some embodiments, the form of the salt is a potassium salt. In some embodiments, the form of the salt is a calcium salt. In some embodiments, the form of the salt is an ammonium salt form (e.g., of N(R’)3, where R’ is as described herein, and in some embodiments, each R’ is independently -H or optionally substituted C 1-6 alkyl). In some embodiments, the oligonucleotide composition is a liquid composition and the oligonucleotide is dissolved in solution. In some embodiments, the solution is a buffer. In some embodiments, the solution is buffered saline. In some embodiments, in the composition, acidic internucleotide linkages, such as natural phosphate linkages, phosphorothioate internucleotide linkages, for example, independently exist in anionic form, and the composition comprises one or more types of cations, such as Na + , K + , etc.

[0207] Additional chemical moieties In some embodiments, the oligonucleotide comprises one or more additional chemical moieties. A variety of additional chemical moieties, such as targeting moieties, carbohydrate moieties, lipid moieties, etc., are known in the art and can be utilized in accordance with the present disclosure to modulate the properties and / or activities of the oligonucleotide, such as stability, half-life, activity, delivery, pharmacodynamic properties, pharmacokinetic properties, etc. In some embodiments, certain additional chemical moieties facilitate the delivery of the oligonucleotide to desired cells, tissues, and / or organs, including but not limited to cells of the central nervous system. In some embodiments, certain additional chemical moieties facilitate the internalization of the oligonucleotide. In some embodiments, certain additional chemical moieties increase the stability of the oligonucleotide. In some embodiments, the present disclosure provides techniques for incorporating a variety of additional chemical moieties into the oligonucleotide.

[0208] Certain useful additional chemical moieties are described in US9394333, US9744183, US9605019, US9598458, US9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607, WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, and / or WO2019 / 032612, and each of these additional chemical moieties is hereby incorporated by reference herein.

[0209] Manufacture A variety of techniques are available in the art for manufacturing the provided oligonucleotides and can be utilized in accordance with the present disclosure. For example, in some embodiments, oligonucleotides are manufactured on a solid support using phosphoramidites. In some embodiments, oligonucleotides are manufactured in solution. In some embodiments, the manufacture of oligonucleotides includes multiple cycles, each of which adds one or more nucleoside units, typically one. In some embodiments, the cycles include coupling of phosphoramidites in the newly coupled nucleoside, blocking of unreacted 5'-OH groups, modification (e.g., sulfidation), and / or deblocking of protected 5'-OH groups. In some embodiments, when a particular length of oligonucleotide is achieved, the modification can be performed at the end of the cycle.

[0210] Certain techniques for manufacturing oligonucleotides are described in US3687808, US4469863, US4476301, US5177195, US5023243, US5034506, US5166315, US5185444, US5188897, US5214134, US5216141, US5235033, US5264423, US5264564, US5276019, US5278302, US5286717, US5321131, US5399676, US5405938, US5405939, US5434257, US5453496, US5455233, US5466677, US5466677, US5470967, US5476925, US5489677, US5519126, US5536821, US5541307, US5541316, US5550111, US5561225, US5563253, US5571799, US5587361, US5596086, US5602240, US5608046, US5610289, US5618704, US5623070, US5625050, US5633360, US564562, US5663312, US5677437, US5677439, US6160109, US6239265, US6028188, US6124445, US6169170, US6172209, US6277603, US6326199, US6346614, US6444423, US6531590, US6534639, US6608035, US6683167, US6858715, US6867294, US6878805, US7015315, US7041816, US7273933, US7321029, USRE39464, US9394333, US9744183, US9605019, US9598458, US9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO2018 / 223056, WO2018 / 223073, WO2018 / 223081, WO2018 / 237194, WO2019 / 032607,It is described in WO2019 / 055951, WO2019 / 075357, WO2019 / 200185, WO2019 / 217784, or WO2019 / 032612.

[0211] In some embodiments, the oligonucleotide and / or composition is provided as a stereorandom composition with respect to chiral linked phosphorus. For example, when using conventional phosphoramidites containing N,N - diisopropylamino and 2 - cyanoethyloxy groups for oligonucleotide synthesis, the chiral linkage can be formed without stereoselectivity or with low stereoselectivity. In some embodiments, the oligonucleotide is provided as a mixture of various diastereomers and / or their salts. In some embodiments, the composition comprises an oligonucleotide and / or one or more or all of its diastereomers with respect to chiral linked phosphorus. In some embodiments, the oligonucleotide and / or its diastereomer is independently in one or more forms. In some embodiments, the oligonucleotide and / or its diastereomer is independently in the form of one or more salts, for example, in the form of one or more pharmaceutically acceptable salts. In some embodiments, for each chiral linked phosphorus, both the Rp and Sp configurations are present in the composition. In some embodiments, for each chiral linked phosphorus, both the Rp and Sp configurations have a percentage of at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45%. In some embodiments, for the chiral nucleotide internucleotide linkage, both the Rp and Sp configurations have a percentage of about 50%. In some embodiments, for each chiral nucleotide internucleotide linkage, both the Rp and Sp configurations have a percentage of about 50%. In some embodiments, for each chiral nucleotide internucleotide linkage, both the Rp and Sp configurations have a percentage of about 20 - 80%. In some embodiments, for each chiral nucleotide internucleotide linkage, both the Rp and Sp configurations have a percentage of about 30 - 70%. In some embodiments, for each chiral nucleotide internucleotide linkage, both the Rp and Sp configurations have a percentage of about 40 - 60%. In some embodiments, for each chiral nucleotide internucleotide linkage, both the Rp and Sp configurations have a percentage of about 45 - 55%.In some embodiments, for each linking phosphorus, the Rp configuration independently has a percentage of about 20 - 80%, 30 - 70%, 40 - 60%, or 45 - 55%, or about 20%, 30%, 40%, 50%, 60%, 70%, or 80%.

[0212] The amount, concentration, etc. of the oligonucleotides provided can be evaluated using various techniques in accordance with the present disclosure, such as by UV (e.g., at 260 nm), weight, etc. In some embodiments, the amount, concentration, etc. of all the oligonucleotides present in the composition are evaluated. In some embodiments, the amount, concentration, etc. include all those forms in which all the oligonucleotides share the same configuration (e.g., diastereomers with respect to chiral linking phosphorus) including the form of pharmaceutically acceptable salts.

[0213] SARM1 In some embodiments, SARM1 refers to a gene or its gene product (e.g., nucleic acid (e.g., DNA, RNA, etc.), transcript (e.g., SARM1 mRNA), protein encoded thereby (e.g., SARM1 polypeptide), etc.) from a species that may be known as SARM2, NAD(+) hydrolase SARM1, NADP(+) hydrolase SARM1, NADase SARM1, sterile alpha and armadillo repeat protein, sterile alpha and TIR motif-containing protein 1, SAMD2, MyD88-5, SAM domain-containing protein 2, sterile alpha motif domain-containing protein 2, HsTIR, etc. Various SARM1 sequences including its variants are readily available to those skilled in the art. Various techniques, such as assays, cells, animal models, etc. have also been reported and can be used for the characterization and / or evaluation of the techniques (e.g., oligonucleotides, compositions, methods, etc.) provided in accordance with the present disclosure.

[0214] The SARM1 gene has been reported to encode the SARM1 protein, which, according to various reports, contains 724 or 690 amino acids depending on the isoform and is mainly localized in the cytoplasm and mitochondria. Some studies have also shown that SARM1 may be localized in the axons, dendrites, and / or synapses of nerve cells. In some embodiments, SARM1 contains a plurality of domains from the N-terminal region to the C-terminal region, including (i) a mitochondrial targeting region, (ii) an armadillo repeat (ARM) domain, (iii) a first sterile alpha motif (SAM) domain, (iv) a second sterile alpha motif (SAM) domain, and (v) a toll / interleukin-1 (IL-1) receptor (TIR) domain. SARM1 from other species, such as monkeys, rats, and mice, has been reported to contain various conserved domains similar to human SARM1.

[0215] The SARM1 protein has been reported to function as an enzyme that cleaves nicotinamide adenine dinucleotide (NAD+) into nicotinamide (NAM), adenosine diphosphate ribose (ADPR), and cyclic adenosine diphosphate ribose (cADPR) (Essuman et al., Neuron, 2017). Furthermore, homodimerization of SARM1 has been reported to increase this enzyme activity (Gerdts et al., J Neurosci., 2013, Summer et al., Proc Natl Acad Sci USA, 2016). Certain studies have suggested that neural stress or injury can lead to upregulation of SARM1 activity by enabling this dimerization through relief of inhibition by the ARM domain (Loring and Thompson, Cell Chem Biol., 2020). SARM1 has been reported to be associated with the presence and function of nicotinamide mononucleotide adenylyltransferase 2 (NMNAT2), which has been described as neuroprotective and has been reported to function to maintain low levels of nicotinamide mononucleotide (NMN) and relatively high levels of NAD+ (Figley et al., Neuron, 2021).

[0216] The proposed NADase activity of SARM1 is suggested to contribute to cell death and / or axonal degeneration by depleting NAD+ and / or inducing signal transduction cascades by increasing ADPR and cADPR (Loring and Thompson, Cell Chem Biol., 2020). Knockdown and / or knockout of SARM1 has been reported to be potentially neuroprotective by preventing axonal degeneration induced by depletion or loss of NMNAT2 and / or by inhibiting Wallerian degeneration (Gilley et al., Cell Rep., 2015, Gilley et al., Cell Rep., 2017). Several studies have also detailed the in vivo prevention of peripheral neuropathy or retinal degeneration by SARM1 knockout, further supporting the potential neuroprotective effects of SARM1 downregulation (Geisler et al., Brain, 2016, Finnegan et al., Int J Mol Sci, 2022).

[0217] In some embodiments, the SARM1 gene, transcript (e.g., mRNA before or after splicing), or protein variant or isoform contains a mutation (in some embodiments, referred to as a SNP or reportable as a SNP). SARM1 mutations have been reported to be enriched in subjects with ALS (Bloom et al., Mol Neurodegener, 2022). Among these mutations, some mutations have been reported to result in a constitutively active SARM1 protein. In some embodiments, the mutations are rs782325355, rs71373646, rs71373646, rs11652384, rs1555585331, rs781854217, rs782421919, rs782331635, rs1032963037, rs1449836804, rs1555585243, rs376587698, rs369186722, rs373458416, rs782706244, rs1555585662, rs1555585804, rs377210302, rs1555585809, rs782228906, rs782106973, rs571724138, rs539229444, rs782196205, rs782398426, rs782321764, rs782753946, rs1451417529, rs782676389, rs782225125, rs782774927, rs782256561, rs372946020, and / or rs781850558. In some embodiments, the mutations are Δ226-232, Δ249-252, V184G, G206S, L223P, R267W, V331E, E340K, C482Y, T385A, T502P, E693D, V112I, A240E, R244S, A250T, A275V, R310H, A341V, R403P, Y429F, E431G, R465T, N478S, D483E, R484C, A488E, V518L, S558N, R569C, R570Q, I593T, E604K, M612V, R615H, D637Y, A646S, V654M, M672V, S684F, R697C, and / or R702C.In some embodiments, the SARM1 protein, e.g., a mutant SARM1 protein, is constitutively active. In some embodiments, the oligonucleotide targets both wild-type and mutant SARM1. In some embodiments, the oligonucleotide can reduce the levels of both wild-type and mutant SARM1 transcripts and / or the products (e.g., polypeptides) encoded thereby. In some embodiments, the nucleotide sequence of the oligonucleotide is complementary to a characteristic portion shared by various forms of the SARM1 transcript, e.g., in some embodiments, all forms of the SARM1 transcript in a subject. In some embodiments, the techniques provided can selectively reduce the level of SARM1 transcripts associated with a condition, disorder, or disease. In some embodiments, the techniques provided can selectively reduce the level of mutant SARM1 transcripts and / or the products (e.g., polypeptides) encoded thereby. In particular, the present disclosure encompasses the recognition that in various conditions, disorders or diseases, e.g., the overall levels of both wild-type and mutant forms of SARM1 transcripts, and / or the products (e.g., polypeptides) encoded thereby, are reduced, and provides techniques for reducing the overall levels of SARM1 transcripts and / or the products (e.g., polypeptides) encoded thereby.

[0218] SARM1-related condition, disorder, or disease Various conditions, disorders, or diseases have been reported to be associated with SARM1 and can be prevented or treated by the present disclosure. Generally, a condition, disorder, or disease is associated with SARM1 if the presence, level, activity, and / or form of SARM1 and / or its products (e.g., transcripts, encoded proteins, etc.) correlates with the incidence and / or susceptibility to the condition, disorder, or disease (e.g., across a relevant population). In some embodiments, a condition, disorder, or disease associated with SARM1 can be treated and / or prevented by reducing the expression, level, and / or activity of SARM1 transcripts and / or proteins.

[0219] In particular, the present disclosure provides techniques for preventing and / or treating various conditions, disorders, or diseases. In some embodiments, the condition, disorder, or disease is a neurodegenerative disease. In some embodiments, the condition, disorder, or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder, or disease is traumatic brain injury (TBI). In some embodiments, the condition, disorder, or disease is Alzheimer's disease (AD). In some embodiments, the condition, disorder, or disease is Parkinson's disease (PD). In some embodiments, the condition, disorder, or disease is frontotemporal dementia (FTD). In some embodiments, the condition, disorder, or disease is progressive supranuclear palsy (PSP). In some embodiments, the condition, disorder, or disease is corticobasal degeneration (CBD). In some embodiments, the condition, disorder, or disease is Wolfram syndrome (WS). In some embodiments, the condition, disorder, or disease is Friedreich's ataxia (FRDA). In some embodiments, the condition, disorder, or disease is multiple system atrophy (MSA). In some embodiments, the condition, disorder, or disease is spinocerebellar ataxia (SCA). In some embodiments, the condition, disorder, or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder, or disease is Pick's disease (PD). In some embodiments, the condition, disorder, or disease is progressive motor atrophy. In some embodiments, the condition, disorder, or disease is concussion. In some embodiments, the condition, disorder, or disease is spinal cord injury (SCI). In some embodiments, the condition, disorder, or disease is chronic traumatic encephalopathy (CTE). In some embodiments, the condition, disorder, or disease is seizure. In some embodiments, the condition, disorder, or disease is stroke. In some embodiments, the condition, disorder, or disease is intracerebral hemorrhage. In some embodiments, the condition, disorder, or disease is tauopathy. In some embodiments, the condition, disorder, or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder, or disease is acute glaucoma. In some embodiments, the condition, disorder, or disease is cancer. In some embodiments, the condition, disorder, or disease is diabetes. In some embodiments, the condition, disorder, or disease is chemotherapy-induced peripheral neuropathy.

[0220] Characteristic evaluation and assessment In some embodiments, the characteristics and / or activities of the provided oligonucleotides and their compositions can be characterized and / or evaluated using a variety of techniques available to those skilled in the art, such as biochemical assays (e.g., RNase H assays), cell-based assays, animal models, clinical trials, and the like. Certain useful techniques are described in the examples. Those skilled in the art reading the present disclosure will readily understand that other techniques, such as in vitro models (e.g., cell lines) for various conditions, disorders, or diseases, animal models for various conditions, disorders, or diseases, clinical trials, etc., can be designed and / or utilized to evaluate the techniques provided in accordance with the present disclosure (e.g., oligonucleotides, compositions, methods, etc.).

[0221] Biological uses As will be understood by those skilled in the art, oligonucleotides are useful for many purposes. In some embodiments, the techniques provided (e.g., oligonucleotides, compositions, methods, etc.) are useful for reducing the levels and / or activities of various SARM1 transcripts (e.g., RNA) and / or the products encoded thereby (e.g., proteins). In some embodiments, the techniques provided reduce the level and / or activity of SARM1 RNA transcripts. In some embodiments, the provided oligonucleotides and compositions provide knockdown of SARM1 mRNA. In some embodiments, the techniques provided reduce the level of SARM1 polypeptide. In some embodiments, the techniques provided reduce the level of SARM1 activity.

[0222] In some embodiments, the present disclosure provides a method for reducing the level of SARM1 mRNA in a system, the method comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition. In some embodiments, the present disclosure provides a method for reducing the level of SARM1 polypeptide in a system, the method comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition. In some embodiments, the present disclosure provides a method for reducing the level of SARM1 activity in a system, the method comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition.

[0223] In some embodiments, the system comprises SARM1 mRNA. In some embodiments, the system comprises wild-type SARM1 mRNA. In some embodiments, the system comprises SARM1 mRNA containing a mutation. In some embodiments, the system comprises wild-type mRNA and SARM1 mRNA containing a mutation. In some embodiments, the system expresses SARM1 mRNA. In some embodiments, the system expresses wild-type SARM1 mRNA. In some embodiments, the system expresses SARM1 mRNA containing a mutation. In some embodiments, the system expresses wild-type SARM1 and SARM1 mRNA containing a mutation. In some embodiments, the system expresses SARM1 polypeptide. In some embodiments, the system expresses wild-type SARM1 polypeptide. In some embodiments, the system expresses SARM1 polypeptide containing a mutation. In some embodiments, the system expresses wild-type SARM1 polypeptide and SARM1 polypeptide containing a mutation.

[0224] In some embodiments, the system is an in vitro system. In some embodiments, the system is an in vivo system.

[0225] In some embodiments, the system comprises cells. In some embodiments, the system is a cell. In some embodiments, the system comprises a population of cells. In some embodiments, the system is a population of cells. In some embodiments, the cells are neurons. In some embodiments, the cells are cells in the nervous system. In some embodiments, the cells are cells in the CNS. In some embodiments, the cells have one or more characteristics, properties, and / or activities of neuronal cells.

[0226] In some embodiments, the system is a tissue. In some embodiments, the system comprises a tissue. In some embodiments, the system is an organ. In some embodiments, the system comprises an organ. In some embodiments, the system is the brain or a part thereof. In some embodiments, the system comprises the brain or a part thereof. In some embodiments, the system is an organism. In some embodiments, the system comprises an organism. In some embodiments, the system is a subject. In some embodiments, the system is a mammal, such as a mouse, a rat, a monkey, etc. In some embodiments, the system is a human.

[0227] In some embodiments, the level is reduced by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% compared to the absence of the provided oligonucleotide or composition and / or the presence of a reference oligonucleotide or composition. In some embodiments, such reduction is achieved at a concentration (e.g., 1 nM, 5 nM, 10 nM, 100 nM, 500 nM, 1 μM, 5 μM, etc.) or dose of a particular oligonucleotide. In some embodiments, such reduction is achieved in a system, e.g., various suitable assays (e.g., in vitro cell-based assays, assays described in the examples, etc.). In some embodiments, the reference composition does not contain an oligonucleotide that targets SARM1. In some embodiments, the reference oligonucleotide targets a nucleic acid different from SARM1. In some embodiments, the level is the level of mRNA, e.g., SARM1 mRNA. In some embodiments, the level is the level of a polypeptide, e.g., SARM1 protein. In some embodiments, the level is reduced by at least about 10%. In some embodiments, the level is reduced by at least about 20%. In some embodiments, the level is reduced by at least about 30%. In some embodiments, the level is reduced by at least about 40%. In some embodiments, the level is reduced by at least about 50%. In some embodiments, the level is reduced by at least about 60%. In some embodiments, the level is reduced by at least about 70%. In some embodiments, the level is reduced by at least about 75%. In some embodiments, the level is reduced by at least about 80%. In some embodiments, the level is reduced by at least about 85%. In some embodiments, the level is reduced by at least about 90%. In some embodiments, the level is reduced by at least about 95%. In some embodiments, the level of SARM1 mRNA, e.g., when evaluated using the assay in the examples, is about 0.01 - 50 μM, e.g., about 0.01 - 30, 1 - 30, about 5 - 30, about 1, about 5, about 10, about 15, about 20, about 25, about 30 μM, etc. of an oligonucleotide by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%,Reduced by 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, and in some embodiments, with an oligonucleotide of about 30 uM, reduced by about or at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, and in some embodiments, with an oligonucleotide of about 20 uM, reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85%, and in some embodiments, with an oligonucleotide of about 19 uM, reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85%, and in some embodiments, with an oligonucleotide of about 16 uM, reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85%, and in some embodiments, with an oligonucleotide of about 10 uM, reduced by about or at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, and in some embodiments, with an oligonucleotide of about 3.33 uM, reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 65%, 70%, 75%, 80%, or 85%, and in some embodiments, with an oligonucleotide of about 1.11 uM, reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85%, and in some embodiments, with an oligonucleotide of about 0.37 uM, reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%, and in some embodiments, with an oligonucleotide of about 0.12 uM, reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50%, and in some embodiments, with an oligonucleotide of about 0.04 uM, reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, or 40%, and in some embodiments,With an oligonucleotide of about 0.01 uM, it is reduced by about or at least about 10%, 15%, 20%, 25% or 30%. In some embodiments, the reduction is about or at least about 50%. In some embodiments, the reduction is about or at least about 55%. In some embodiments, the reduction is about or at least about 60%. In some embodiments, the reduction is about or at least about 65%. In some embodiments, the reduction is about or at least about 70%. In some embodiments, the reduction is about or at least about 75%. In some embodiments, the reduction is about or at least about 80%. In some embodiments, the reduction is about or at least about 85%. In some embodiments, the reduction is about or at least about 90%. In some embodiments, the reduction is about or at least about 95%. In some embodiments, the reduction is evaluated about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks, after administration or delivery of the provided oligonucleotide or composition, or thereafter. In some embodiments, the reduction is evaluated about or at least about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks, or thereafter, after removal or washout of the provided oligonucleotide or composition. In some embodiments, the reduction is evaluated on day 0. In some embodiments, the reduction is evaluated on about day 3. In some embodiments, the reduction is evaluated on about day 10. In some embodiments, the reduction is evaluated on about day 14. In some embodiments, the reduction is evaluated on about day 21. In some embodiments, one or more evaluations, e.g., reduction of SARM1 mRNA levels, are independently about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, and in some embodiments, the reduction is independently about or at least about 60%, and in some embodiments, the reduction is about or at least about 65%.In some embodiments, the reduction is about or at least about 70%, in some embodiments, the reduction is about or at least about 75%, and in some embodiments, the reduction is independently about or at least about 80%. In some embodiments, the reduction is evaluated on about day 21. In some embodiments, one or more evaluations, such as a reduction in SARM1 protein level or its activity, is independently about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments, the reduction is independently about or at least about 10%, in some embodiments, the reduction is about or at least about 15%, in some embodiments, the reduction is about or at least about 20%, in some embodiments, the reduction is about or at least about 25%, in some embodiments, the reduction is independently about or at least about 30%, in some embodiments, the reduction is independently about or at least about 35%, in some embodiments, the reduction is independently about or at least about 40%, in some embodiments, the reduction is independently about or at least about 45%, in some embodiments, the reduction is independently about or at least about 50%, in some embodiments, the reduction is independently about or at least about 55%, and in some embodiments, the reduction is independently about or at least about 60%. In some embodiments, the reduction is about or at least about 40% on day 7 after removal of the provided oligonucleotide or composition. In some embodiments, the reduction is about or at least about 40% on day 10 after removal of the provided oligonucleotide or composition. In some embodiments, the reduction is about or at least about 40% on day 14 after removal of the provided oligonucleotide or composition. In some embodiments, the reduction is about or at least about 40% on day 21 after removal of the provided oligonucleotide or composition. In some embodiments, the reduction is about or at least about 40% - 50% on or after about days 7, 10, 14, and / or 21 after removal of the provided oligonucleotide or composition. Certain results are shown by way of example in the figures and examples. Those skilled in the art reading this disclosure willTo understand that various techniques can be utilized to evaluate the provided techniques including reduction of mRNA and / or polypeptide levels by the provided oligonucleotides and compositions. Certain useful techniques are described in the Examples. In some embodiments, the reduction is relative to the presence of a reference oligonucleotide or composition, e.g., a scrambled oligonucleotide as described herein. In some embodiments, the reduction is relative to the absence of the oligonucleotide or composition. In some embodiments, the evaluation is performed according to that described in the Examples, e.g., in some embodiments, using iPSC-derived motor neurons having an oligonucleotide concentration of about 16, 19, or 20 uM with gymnonic delivery.

[0228] In some embodiments, the activity of the provided oligonucleotide or oligonucleotide composition can be evaluated by, for example, an IC50 that is a concentration that reduces the level of SARM1 mRNA, polypeptide, activity by 50% under suitable conditions, such as a cell-based in vitro assay, the assays described in the examples, etc. In some embodiments, the provided oligonucleotide or composition has an IC50 of about 0.001, 0.01, 0.1, 0.5, 1, 2, 5, 10, 50, 100, 200, 500, 1000, 2000, 5000, or 10000 nM, or about 0.001, 0.01, 0.1, 0.5, 1, 2, 5, 10, 50, 100, 200, 500, 1000, 2000, 5000, or 10000 nM or less. In some embodiments, the oligonucleotide has an IC50 of about 10000 nM, or about 10000 nM or less. In some embodiments, the oligonucleotide has an IC50 of about 5000 nM, or about 5000 nM or less. In some embodiments, the oligonucleotide has an IC50 of about 2000 nM, or about 2000 nM or less. In some embodiments, the oligonucleotide has an IC50 of about 1000 nM, or about 1000 nM or less. In some embodiments, the IC50 is about 500 nM, or about 500 nM or less. In some embodiments, the IC50 is about 200 nM, or about 200 nM or less. In some embodiments, the IC50 is about 100 nM, or about 100 nM or less. In some embodiments, the IC50 is about 50 nM, or about 50 nM or less. In some embodiments, the IC50 is about 20 nM, or about 20 nM or less. In some embodiments, the IC50 is about 10 nM, or about 10 nM or less. In some embodiments, the IC50 is about 5 nM, or about 5 nM or less. In some embodiments, the IC50 is about 2 nM, or about 2 nM or less. In some embodiments, the IC50 is about 1 nM, or about 1 nM or less.

[0229] In some embodiments, the provided oligonucleotides and compositions are useful for treating various conditions, disorders, or diseases by reducing the levels and / or activities of SARM1 transcripts and / or the products encoded thereby that are associated with the condition, disorder, or disease.

[0230] In some embodiments, the present disclosure provides a method for preventing a condition, disorder, or disease, the method comprising administering or delivering to a subject susceptible thereto an effective amount of an oligonucleotide or composition of the present disclosure. In some embodiments, the present disclosure provides a method for treating a condition, disorder, or disease, the method comprising administering or delivering to a subject afflicted therewith an effective amount of an oligonucleotide or composition of the present disclosure.

[0231] A variety of conditions, disorders, or diseases associated with SARM1 can be prevented or treated with the techniques provided. In some embodiments, the subject benefits from a reduction in the levels of SARM1 transcripts, polypeptides, and / or activities in certain cells, tissues, and / or organs.

[0232] In some embodiments, the condition, disorder, or disease is a neurodegenerative condition, disorder, or disease. In some embodiments, the condition, disorder, or disease is or includes Wallerian degeneration. In some embodiments, the condition, disorder, or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder, or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder, or disease is a neuropathy. In some embodiments, the condition, disorder, or disease is a peripheral neuropathy. In some embodiments, the condition, disorder, or disease is a chemotherapy-induced peripheral neuropathy. In some embodiments, the condition, disorder, or disease is Parkinson's disease. In some embodiments, the condition, disorder, or disease is Huntington's disease. In some embodiments, the condition, disorder, or disease is Alzheimer's disease. In some embodiments, the condition, disorder, or disease is frontotemporal dementia. In some embodiments, the condition, disorder, or disease is a brain injury. In some embodiments, the condition, disorder, or disease is a traumatic brain injury. In some embodiments, the condition, disorder, or disease is progressive supranuclear palsy. In some embodiments, the condition, disorder, or disease is corticobasal degeneration. In some embodiments, the condition, disorder, or disease is Wolfram syndrome. In some embodiments, the condition, disorder, or disease is Friedreich's ataxia. In some embodiments, the condition, disorder, or disease is multiple system atrophy. In some embodiments, the condition, disorder, or disease is spinocerebellar ataxia. In some embodiments, the condition, disorder, or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder, or disease is Pick's disease. In some embodiments, the condition, disorder, or disease is progressive motor atrophy. In some embodiments, the condition, disorder, or disease is associated with neuron injury. In some embodiments, the condition, disorder, or disease is associated with neuron cell injury. In some embodiments, the condition, disorder, or disease is associated with neuron cell death.

[0233] In some embodiments, the conditions, disorders, or diseases that can be prevented and / or treated according to the present disclosure are described in WO2022 / 031736, WO2021 / 108602, or WO2022 / 125377.

[0234] Various techniques can be utilized to administer or deliver the provided oligonucleotides or compositions. In some embodiments, the oligonucleotides or compositions are administered or delivered orally. In some embodiments, the oligonucleotides or compositions are administered or delivered via a parenteral route. In some embodiments, parenteral routes include intravenous, intraarterial, intramuscular, intradermal, subcutaneous, intranasal, and intraperitoneal routes. In some embodiments, the oligonucleotides or compositions are administered or delivered via an intravitreal, intraorbital, subconjunctival, intravitreal, subretinal, transscleral, or intratympanic route. In some embodiments, the oligonucleotides or compositions are administered or delivered parenterally. In some embodiments, the oligonucleotides or compositions are administered or delivered intrathecally. In some embodiments, the oligonucleotides or compositions are administered or delivered intravenously. In some embodiments, the oligonucleotide is administered or delivered as a liquid composition. In some embodiments, the oligonucleotide is dissolved in a liquid, such as buffered saline like aCSF, for administration or delivery.

[0235] In some embodiments, the oligonucleotides or compositions can be utilized in combination with another therapy, such as another therapeutic agent.

[0236] In some embodiments, the technologies provided, such as oligonucleotides, compositions, methods, etc., delay or prevent the onset of one or more symptoms and / or characteristics of a condition, disorder, or disease. In some embodiments, the technologies provided delay, slow down, or prevent the progression of a condition, disorder, or disease. In some embodiments, the technologies provided alleviate, improve, reduce, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. In some embodiments, the technologies provided improve the performance of a subject in one or more assessments. In some embodiments, the technologies provided improve the performance of a subject in one or more clinical assessments. In some embodiments, the technologies provided independently improve one or more clinical assessment results of a subject.

[0237] Pharmaceutical composition In some embodiments, the present disclosure provides a pharmaceutical composition comprising a compound provided, such as an oligonucleotide, or a pharmaceutically acceptable salt thereof, and a pharmaceutical carrier. In some embodiments, for example, for therapeutic and clinical purposes, the oligonucleotides of the present disclosure are provided as a pharmaceutical composition.

[0238] As will be understood by those skilled in the art, oligonucleotides can be provided in various forms. In some embodiments, the oligonucleotide can be in the form of an acid, for example, in the case of natural phosphate linkages, in the form of -OP(O)(OH)O-, and in the case of phosphorothioate nucleotide linkages, in the form of -OP(O)(SH)O-. In some embodiments, the oligonucleotide provided can be in the form of a salt, for example, in the case of natural phosphate linkages, in the form of -OP(O)(ONa)O- in the sodium salt, and in the case of phosphorothioate nucleotide linkages, in the form of -OP(O)(SNa)O- in the sodium salt. Unless otherwise stated, the oligonucleotides of the present disclosure can exist in the form of acids, bases, and / or salts. In some embodiments, the composition comprises oligonucleotides in one or more forms. In some embodiments, the composition comprises oligonucleotides in one or more salt forms. In some embodiments, the composition comprises oligonucleotides in one or more pharmaceutically acceptable salt forms.

[0239] When used as a therapeutic agent, the oligonucleotide or composition provided is typically administered as a pharmaceutical composition. In some embodiments, the pharmaceutical composition is suitable for the administration or delivery of the oligonucleotide to a body region or portion affected by a condition, disorder, or disease. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of the oligonucleotide provided or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of oligonucleotides that are diastereomers of each other, and the oligonucleotides exist in one or more forms. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of oligonucleotides that are diastereomers of each other with respect to chiral-linked phosphorus, and the oligonucleotides exist in one or more forms.

[0240] In some embodiments, the pharmaceutically acceptable carrier is a buffer solution. In some embodiments, the pharmaceutically acceptable carrier is buffered saline. In some embodiments, the pharmaceutically acceptable carrier is artificial cerebrospinal fluid. In some embodiments, the composition is a liquid composition comprising dissolved oligonucleotides.

[0241] In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ocular administration, or otic administration. In some embodiments, the pharmaceutical composition is a tablet, pill, capsule, liquid, inhalant, nasal spray solution, suppository, suspension, gel, colloid, dispersion, suspension, solution, emulsion, ointment, lotion, eye drop, or ear drop. In some embodiments, the pharmaceutical composition is formulated for intrathecal administration.

[0242] As will be appreciated by those skilled in the art, oligonucleotides can exist in various salt forms. In some embodiments, the salt is a pharmaceutically acceptable salt. In some embodiments, the pharmaceutical composition optionally comprises the oligonucleotide in its salt form and a sodium salt. In some embodiments, the pharmaceutical composition optionally comprises the oligonucleotide in its salt form and sodium chloride. In some embodiments, each hydrogen ion of the oligonucleotide that can be donated to a base (e.g., under conditions such as an aqueous solution, a pharmaceutical composition) is non-H +It is replaced by a cation. For example, in some embodiments, a pharmaceutically acceptable salt of an oligonucleotide is an all-metal ion salt, and each hydrogen ion (e.g., -OH, -SH, etc.) of each internucleotide linkage (e.g., natural phosphate linkage, phosphorothioate internucleotide linkage, etc.) is replaced by a metal ion. Various suitable metal salts for pharmaceutical compositions are widely known in the art and can be utilized in accordance with the present disclosure. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a magnesium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is an ammonium salt (cation N(R’)4 + ). In some embodiments, the pharmaceutically acceptable salt contains one and no more than one type of cation. In some embodiments, the pharmaceutically acceptable salt contains two or more types of cations. In some embodiments, the cation is Li + , Na + , K + , Mg 2+ , or Ca 2+ . In some embodiments, the pharmaceutically acceptable salt is an all-sodium salt. In some embodiments, the pharmaceutically acceptable salt is an all-sodium salt, and each internucleotide linkage that is a natural phosphate linkage (acid form -O-P(O)(OH)-O-) exists, if present, in the form of its sodium salt (-O-P(O)(ONa)-O-), and each internucleotide linkage that is a phosphorothioate internucleotide linkage (acid form -O-P(O)(SH)-O-) exists, if present, in the form of its sodium salt (-O-P(O)(SNa)-O-).

[0243] In some embodiments, the oligonucleotide or composition, e.g., a pharmaceutical composition, is provided as a solid. In some embodiments, the oligonucleotide or composition, e.g., a pharmaceutical composition, is lyophilized.

[0244] In some embodiments, an oligonucleotide or composition, e.g., a pharmaceutical composition, is stored at a temperature lower than ambient temperature, e.g., about -78 °C, -20 °C, 0 °C, 4 °C, or 10 °C, or about -78 °C, -20 °C, 0 °C, 4 °C, or 10 °C or lower.

[0245] Various techniques for delivering nucleic acids and / or oligonucleotides are known in the art and can be utilized in accordance with the present disclosure. For example, various supramolecular nanocarriers can be used to deliver nucleic acids. Exemplary nanocarriers include liposomes, cationic polymer complexes, and various polymeric compounds. Complexation of nucleic acids with various polycations is another approach for intracellular delivery and includes the use of PEGylated polycations, polyethyleneamine (PEI) complexes, cationic block copolymers, and dendrimers. Some cationic nanocarriers, including PEI and polyamidoamine dendrimers, can help release the contents from endosomes. Other approaches can include the use of polymeric nanoparticles, microspheres, liposomes, dendrimers, biodegradable polymers, conjugates, prodrugs, inorganic colloids such as sulfur or iron, antibodies, implants, biodegradable implants, biodegradable microspheres, osmotic pressure-controlled implants, lipid nanoparticles, emulsions, oily solutions, aqueous solutions, biodegradable polymers, poly(lactide-co-glycolic acid), poly(lactic acid), liquid depot, polymeric micelles, quantum dots, and lipoplexes. In some embodiments, the oligonucleotide is conjugated to another molecule.

[0246] In some embodiments, the oligonucleotide is administered or delivered via geminotic uptake.

[0247] In some embodiments, an oligonucleotide or composition is formulated for various modes of administration, including systemic and topical or localized administration. Techniques and formulations can generally be found in Remington, The Science and Practice of Pharmacy (20th ed. 2000).

[0248] In certain embodiments, the oligonucleotide or composition is delivered to the CNS. In certain embodiments, the oligonucleotide and composition are delivered to the cerebrospinal fluid. In certain embodiments, the oligonucleotide and composition are administered to the brain parenchyma. In certain embodiments, the oligonucleotide and composition are delivered to the animal / subject by intrathecal or intracerebroventricular administration. The wide distribution of the oligonucleotide and composition can be achieved by the administration methods described herein and / or known in the art.

[0249] In certain embodiments, parenteral administration is by injection, for example, by syringe, pump, etc. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is directly administered to tissues or sites such as cerebrospinal fluid, striatum, caudate nucleus, cortex, hippocampus, and / or cerebellum.

[0250] The provided oligonucleotides and compositions thereof are effective over a wide dosage range. In some embodiments, the dosage is from about 0.01 to about 1000 mg, from about 0.5 to about 100 mg, from about 1 to about 50 mg, or from about 5 to about 100 mg. The exact dosage can depend on the route of administration, the form in which the oligonucleotide is administered, the subject (e.g., weight, age, body surface area, etc.), the condition, disorder, or disease, and / or the preference and experience of the physician. In some embodiments, a fixed dosage is administered. In some embodiments, the provided oligonucleotide or composition is administered or delivered, for example, by injection or infusion, once a week, every two weeks, monthly, every two months, every 90 days, every three months, every six months, every nine months, or once a year. In some embodiments, two or more dosages are about the same amount. In some embodiments, one or more dosages are independently greater than one or more other dosages. For example, in some embodiments, one or more loading dosages of a higher amount, each independently, are administered before one or more maintenance dosages of a lower amount, each independently. In some embodiments, two or more or all of the loading dosages are about the same amount. In some embodiments, a loading dosage is a higher amount than another loading dosage. In some embodiments, two or more or all of the maintenance dosages are about the same amount. In some embodiments, a maintenance dosage is a higher amount than another maintenance dosage.

[0251] Exemplary embodiments In particular, the present disclosure provides the following exemplary embodiments. 1. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GTCTCCAGAACTGAGCAGGG, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 2. The oligonucleotide according to embodiment 1, wherein the nucleotide sequence of the oligonucleotide is GTCTCCAGAACTGAGCAGGG. 3. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CCTTGCAGGCTCTTGATGGC, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 4. The oligonucleotide according to embodiment 3, wherein the nucleotide sequence of the oligonucleotide is CCTTGCAGGCTCTTGATGGC. 5. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GCTGGCTGTACTCACTCTCC, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 6. The oligonucleotide according to embodiment 5, wherein the nucleotide sequence of the oligonucleotide is GCTGGCTGTACTCACTCTCC. 7. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of TCAGGACTTTGCCTCTTTCC, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 8. The oligonucleotide according to embodiment 7, wherein the nucleotide sequence of the oligonucleotide is TCAGGACTTTGCCTCTTTCC. 9. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GGGAGTGGAAGGAAGGAGCC, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 10. The oligonucleotide according to embodiment 9, wherein the nucleotide sequence of the oligonucleotide is GGGAGTGGAAGGAAGGAGCC. 11. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleobases of GCTTTAGAGATTTGCTACCC, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 12. The oligonucleotide according to embodiment 11, wherein the nucleotide sequence of the oligonucleotide is GCTTTAGAGATTTGCTACCC. 13. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleobases of GCATCACTCACTGTCAGGTA, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 14. The oligonucleotide according to embodiment 13, wherein the nucleotide sequence of the oligonucleotide is GCATCACTCACTGTCAGGTA. 15. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleobases of GCCCTAGGATTTTCCTGTTG, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 16. The oligonucleotide according to embodiment 15, wherein the nucleotide sequence of the oligonucleotide is GCCCTAGGATTTTCCTGTTG. 17. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleobases of GTGCCATTGGTAGAGTAGGA, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 18. The oligonucleotide according to embodiment 17, wherein the nucleotide sequence of the oligonucleotide is GTGCCATTGGTAGAGTAGGA. 19. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleic acid bases of CTGTGACCTAGGCTCCTTGA, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 20. The oligonucleotide according to embodiment 19, wherein the nucleotide sequence of the oligonucleotide is CTGTGACCTAGGCTCCTTGA. 21. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleic acid bases of AGACACCTGGGTATCAGCCT, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 22. The oligonucleotide according to embodiment 21, wherein the nucleotide sequence of the oligonucleotide is AGACACCTGGGTATCAGCCT. 23. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleic acid bases of GCCCAGGTTGTCTCAGCCCA, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 24. The oligonucleotide according to embodiment 23, wherein the nucleotide sequence of the oligonucleotide is GCCCAGGTTGTCTCAGCCCA. 25. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleic acid bases of GCTTGTCTCATCCTGTCTCT, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 26. The oligonucleotide according to embodiment 25, wherein the base sequence of the oligonucleotide is GCTTGTCTCATCCTGTCTCT. 27. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGTTCTCAGCCACCAGGATC, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 28. The oligonucleotide according to embodiment 27, wherein the base sequence of the oligonucleotide is GGTTCTCAGCCACCAGGATC. 29. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CAAACTGGTGTCAGAGCCTG, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 30. The oligonucleotide according to embodiment 29, wherein the base sequence of the oligonucleotide is CAAACTGGTGTCAGAGCCTG. 31. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCAGCACCCTCCAAACTGGT, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 32. The oligonucleotide according to embodiment 31, wherein the base sequence of the oligonucleotide is GCAGCACCCTCCAAACTGGT. 33. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of TGTCTCTGAGCTGACTGCTT, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 34. The oligonucleotide according to embodiment 33, wherein the nucleotide sequence of the oligonucleotide is TGTCTCTGAGCTGACTGCTT. 35. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CCACTAGCCCTGGGAGCAAA, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 36. The oligonucleotide according to embodiment 35, wherein the nucleotide sequence of the oligonucleotide is CCACTAGCCCTGGGAGCAAA. 37. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GCCATCTCCATCCATAGAGC, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 38. The oligonucleotide according to embodiment 37, wherein the nucleotide sequence of the oligonucleotide is GCCATCTCCATCCATAGAGC. 39. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of AGGAGAGCTGTGGGCTTGGG, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 40. The oligonucleotide according to embodiment 39, wherein the nucleotide sequence of the oligonucleotide is AGGAGAGCTGTGGGCTTGGG. 41. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CACCCATGCCTCCCAGCAGA, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 42. The oligonucleotide according to embodiment 41, wherein the nucleotide sequence of the oligonucleotide is CACCCATGCCTCCCAGCAGA. 43. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GTGCTCTGTCCTTGGTCCTG, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 44. The oligonucleotide according to embodiment 43, wherein the nucleotide sequence of the oligonucleotide is GTGCTCTGTCCTTGGTCCTG. 45. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCCATTCTCATGCAGCCTAC, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 46. The oligonucleotide according to embodiment 45, wherein the nucleotide sequence of the oligonucleotide is CCCATTCTCATGCAGCCTAC. 47. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGTCTGAGAGGCTGTGGGTC, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 48. The oligonucleotide according to embodiment 47, wherein the base sequence of the oligonucleotide is GGTCTGAGAGGCTGTGGGTC. 49. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCTCCCAGTTCTTCTGTGGT, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 50. The oligonucleotide according to embodiment 49, wherein the base sequence of the oligonucleotide is GCTCCCAGTTCTTCTGTGGT. 51. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GATGTCCTCCACAGGTGACA, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 52. The oligonucleotide according to embodiment 51, wherein the base sequence of the oligonucleotide is GATGTCCTCCACAGGTGACA. 53. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCTTCCTGCCTTACTGACCT, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 54. The oligonucleotide according to embodiment 53, wherein the base sequence of the oligonucleotide is GCTTCCTGCCTTACTGACCT. 55. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CTCTCCTTTGTCCCTGACCA, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 56. The oligonucleotide according to embodiment 55, wherein the nucleotide sequence of the oligonucleotide is CTCTCCTTTGTCCCTGACCA. 57. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GCCTTGCCTTTTCCTCACTC, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 58. The oligonucleotide according to embodiment 57, wherein the nucleotide sequence of the oligonucleotide is GCCTTGCCTTTTCCTCACTC. 59. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GCCTGGTCACTAACCCTCTC, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 60. The oligonucleotide according to embodiment 59, wherein the nucleotide sequence of the oligonucleotide is GCCTGGTCACTAACCCTCTC. 61. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CACCCACCTTGGTCTTGCCT, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. The oligonucleotide according to embodiment 61, wherein the nucleotide sequence of the oligonucleotide is CACCCACCTTGGTCTTGCCT. 63. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CACACTGATGTCCTGTCCCA, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 64. The oligonucleotide according to embodiment 63, wherein the nucleotide sequence of the oligonucleotide is CACACTGATGTCCTGTCCCA. 65. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CACACCTCTGGGTCTTGGCC, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 66. The oligonucleotide according to embodiment 65, wherein the nucleotide sequence of the oligonucleotide is CACACCTCTGGGTCTTGGCC. 67. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GCTGCCCATCACTCCCAGTT, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 68. The oligonucleotide according to embodiment 67, wherein the nucleotide sequence of the oligonucleotide is GCTGCCCATCACTCCCAGTT. 69. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CTCTCCATCTGCCCTGGCCC, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 70. The oligonucleotide according to embodiment 69, wherein the base sequence of the oligonucleotide is CTCTCCATCTGCCCTGGCCC. 71. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CAGTCCCTCTCCTTGTCTCT, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 72. The oligonucleotide according to embodiment 71, wherein the base sequence of the oligonucleotide is CAGTCCCTCTCCTTGTCTCT. 73. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ATCCACCTGCTGCTCCTGGG, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 74. The oligonucleotide according to embodiment 73, wherein the base sequence of the oligonucleotide is ATCCACCTGCTGCTCCTGGG. 75. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCCTTGTGTCTTGTGGGTGC, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 76. The oligonucleotide according to embodiment 75, wherein the base sequence of the oligonucleotide is CCCTTGTGTCTTGTGGGTGC. 77. An oligonucleotide, The base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GCCTCAACTCCTGCCTCCCA, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 78. The oligonucleotide according to embodiment 77, wherein the base sequence of the oligonucleotide is GCCTCAACTCCTGCCTCCCA. 79. An oligonucleotide, The base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of TCCTTCTTCCCTATTTCCCA, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 80. The oligonucleotide according to embodiment 79, wherein the base sequence of the oligonucleotide is TCCTTCTTCCCTATTTCCCA. 81. An oligonucleotide, The base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GTCAGTGCCACAGCCTTGTC, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 82. The oligonucleotide according to embodiment 81, wherein the base sequence of the oligonucleotide is GTCAGTGCCACAGCCTTGTC. 83. An oligonucleotide, The base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GGCACCTACCTTATGCACCC, and each T is optionally and independently replaced by U. An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. The oligonucleotide according to embodiment 83, wherein the nucleotide sequence of the oligonucleotide is GGCACCTACCTTATGCACCC. 85. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleic acid bases of ACTACTGCATCCCTCAGCCC, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 86. The oligonucleotide according to embodiment 85, wherein the nucleotide sequence of the oligonucleotide is ACTACTGCATCCCTCAGCCC. 87. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleic acid bases of GGGCTTGACTCCACACTCCA, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 88. The oligonucleotide according to embodiment 87, wherein the nucleotide sequence of the oligonucleotide is GGGCTTGACTCCACACTCCA. 89. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleic acid bases of GGCATGGCATCTCAGCTTCA, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 90. The oligonucleotide according to embodiment 89, wherein the nucleotide sequence of the oligonucleotide is GGCATGGCATCTCAGCTTCA. 91. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleic acid bases of TTCAGGATCACCTAGCTGGT, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 92. The oligonucleotide according to embodiment 91, wherein the base sequence of the oligonucleotide is TTCAGGATCACCTAGCTGGT. 93. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCTCTTTGCCATCTGCTGGG, and each T is optionally and independently replaced with U, An oligonucleotide, wherein the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 94. The oligonucleotide according to embodiment 93, wherein the base sequence of the oligonucleotide is CCTCTTTGCCATCTGCTGGG. 95. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GAGTGCAGTTCACTTGTGGT, and each T is optionally and independently replaced with U, An oligonucleotide, wherein the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 96. The oligonucleotide according to embodiment 95, wherein the base sequence of the oligonucleotide is GAGTGCAGTTCACTTGTGGT. 97. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TGCCCACACTCTGCCTGTCA, and each T is optionally and independently replaced with U, An oligonucleotide, wherein the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 98. The oligonucleotide according to embodiment 97, wherein the base sequence of the oligonucleotide is TGCCCACACTCTGCCTGTCA. 99. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CAGAGGGAGCTGCTAGTCAG, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 100. The oligonucleotide according to embodiment 99, wherein the nucleotide sequence of the oligonucleotide is CAGAGGGAGCTGCTAGTCAG. 101. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of TTGGCAAAGGTGATGCAGGC, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 102. The oligonucleotide according to embodiment 101, wherein the nucleotide sequence of the oligonucleotide is TTGGCAAAGGTGATGCAGGC. 103. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CCTCCACCAGTTGGAAGACC, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 104. The oligonucleotide according to embodiment 103, wherein the nucleotide sequence of the oligonucleotide is CCTCCACCAGTTGGAAGACC. 105. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GTGCTCCAAGATGCCTGCCA, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 106. The oligonucleotide according to embodiment 105, wherein the nucleotide sequence of the oligonucleotide is GTGCTCCAAGATGCCTGCCA. 107. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GTGAGCTCCCTAAAGAACCT, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 108. The oligonucleotide according to embodiment 107, wherein the nucleotide sequence of the oligonucleotide is GTGAGCTCCCTAAAGAACCT. 109. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GGTTTGCCACCAGTACAGGG, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 110. The oligonucleotide according to embodiment 109, wherein the nucleotide sequence of the oligonucleotide is GGTTTGCCACCAGTACAGGG. 111. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of TCCAGCTTCTCCACATCAAT, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 112. The oligonucleotide according to embodiment 111, wherein the nucleotide sequence of the oligonucleotide is TCCAGCTTCTCCACATCAAT. 113. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GAACTTGCCTGCTTCCAGCT, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 114. The oligonucleotide according to embodiment 113, wherein the nucleotide sequence of the oligonucleotide is GAACTTGCCTGCTTCCAGCT. 115. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ACACTCTGGATGAGTTTGTC, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 116. The oligonucleotide according to embodiment 115, wherein the nucleotide sequence of the oligonucleotide is ACACTCTGGATGAGTTTGTC. 117. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGGCACCCATGACACTCTGG, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 118. The oligonucleotide according to embodiment 117, wherein the nucleotide sequence of the oligonucleotide is GGGCACCCATGACACTCTGG. 119. An oligonucleotide, wherein the nucleotide sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ACTTGTCCAGTGCTCCAGGT, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 120. The oligonucleotide according to embodiment 119, wherein the nucleotide sequence of the oligonucleotide is ACTTGTCCAGTGCTCCAGGT. 121. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CCCAATCCTTGCAGTCATGG, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 122. The oligonucleotide according to embodiment 121, wherein the nucleotide sequence of the oligonucleotide is CCCAATCCTTGCAGTCATGG. 123. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of AGCACAGCCTGCATGTCCTC, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 124. The oligonucleotide according to embodiment 123, wherein the nucleotide sequence of the oligonucleotide is AGCACAGCCTGCATGTCCTC. 125. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of TGGTTAGGTTGGACCCATGG, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 126. The oligonucleotide according to embodiment 125, wherein the nucleotide sequence of the oligonucleotide is TGGTTAGGTTGGACCCATGG. 127. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of TCCCTCTCCAGATACTGAGG, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. The oligonucleotide according to embodiment 127, wherein the base sequence of the oligonucleotide is TCCCTCTCCAGATACTGAGG. 129. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of ACAGACAACCCAATGGCAGG, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 130. The oligonucleotide according to embodiment 129, wherein the base sequence of the oligonucleotide is ACAGACAACCCAATGGCAGG. 131. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CCTTAATTCCTGTCTGAGGC, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 132. The oligonucleotide according to embodiment 131, wherein the base sequence of the oligonucleotide is CCTTAATTCCTGTCTGAGGC. 133. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CAGAATACAGTGCCCAGGCC, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 134. The oligonucleotide according to embodiment 133, wherein the base sequence of the oligonucleotide is CAGAATACAGTGCCCAGGCC. 135. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CCCAGGCCCTTGCTCAGAAT, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 136. The oligonucleotide according to embodiment 135, wherein the base sequence of the oligonucleotide is CCCAGGCCCTTGCTCAGAAT. 137. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCACTCATCCCTGGCTGGCT, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 138. The oligonucleotide according to embodiment 137, wherein the base sequence of the oligonucleotide is GCACTCATCCCTGGCTGGCT. 139. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GATTACAGGGCAAGGCCACA, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 140. The oligonucleotide according to embodiment 139, wherein the base sequence of the oligonucleotide is GATTACAGGGCAAGGCCACA. 141. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCCTGGATGTGGCAAAAGA, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleotide linkage. 142. The oligonucleotide according to embodiment 141, wherein the base sequence of the oligonucleotide is GCCCTGGATGTGGCAAAAGA. 143. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of AAGGAAGTCAGAGGGAGGGC, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 144. The oligonucleotide according to embodiment 143, wherein the nucleotide sequence of the oligonucleotide is AAGGAAGTCAGAGGGAGGGC. 145. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CAGGCCCAAACAGGAGGCTC, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 146. The oligonucleotide according to embodiment 145, wherein the nucleotide sequence of the oligonucleotide is CAGGCCCAAACAGGAGGCTC. 147. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of ATGCCCAGACCCAGGCCCAA, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 148. The oligonucleotide according to embodiment 147, wherein the nucleotide sequence of the oligonucleotide is ATGCCCAGACCCAGGCCCAA. 149. An oligonucleotide, The nucleotide sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CTGAGGCACAGCACCAAGGC, and each T is optionally and independently replaced by U, An oligonucleotide, wherein the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. The oligonucleotide according to embodiment 149, wherein the base sequence of the oligonucleotide is CTGAGGCACAGCACCAAGGC. 151. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GCCAGACCAGGAAGGAGCCT, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 152. The oligonucleotide according to embodiment 151, wherein the base sequence of the oligonucleotide is GCCAGACCAGGAAGGAGCCT. 153. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GCCCAGCCTCAGAATGATTC, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 154. The oligonucleotide according to embodiment 153, wherein the base sequence of the oligonucleotide is GCCCAGCCTCAGAATGATTC. 155. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CCTCTGAACCCAGTGGAGGA, and each T is optionally and independently replaced by U, and the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage. 156. The oligonucleotide according to embodiment 155, wherein the base sequence of the oligonucleotide is CCTCTGAACCCAGTGGAGGA. 157. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GCCTGGGTTTATTGGAGGGT, and each T is optionally and independently replaced by U, An oligonucleotide comprising a modified nucleobase, a modified sugar, or a modified internucleoside linkage. 158. The oligonucleotide according to embodiment 157, wherein the base sequence of the oligonucleotide is GCCTGGGTTTATTGGAGGGT. 159. An oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCAGCACAGCCAAGAGTGG, and each T is optionally and independently replaced by U, and the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleoside linkage. 160. The oligonucleotide according to embodiment 159, wherein the base sequence of the oligonucleotide is GCCAGCACAGCCAAGAGTGG. 161. The oligonucleotide according to any one of the preceding embodiments, wherein the oligonucleotide comprises a 5'-wing-core-wing-3' structure. 162. The oligonucleotide according to any one of the preceding embodiments, wherein there are about 3 to 10 nucleosides in the 5'-wing. 163. The oligonucleotide according to any one of the preceding embodiments, wherein there are 5 nucleosides in the 5'-wing. 164. The oligonucleotide according to any one of the preceding embodiments, wherein each sugar in the 5'-wing is independently a modified sugar. 165. The sugar in the 5'-wing is 2'-OR s a modified sugar, and R s is C 1-6 aliphatic. The oligonucleotide according to any one of the preceding embodiments. 166. The oligonucleotide according to any one of the preceding embodiments, wherein the sugar in the 5'-wing is a 2'-MOE modified sugar. 167. The oligonucleotide according to any one of the preceding embodiments, wherein the sugar in the 5'-wing is a 2'-OMe modified sugar. The oligonucleotide according to any one of the preceding embodiments, wherein the sugar in the 5'-wing is a bicyclic sugar. The oligonucleotide according to embodiment 168, wherein the bicyclic sugar is an LNA sugar. The oligonucleotide according to embodiment 168, wherein the bicyclic sugar is a cEt sugar. 171. Each sugar in the 5'-wing is independently a 2'-OR s modified sugar, and R s is C 1-6 aliphatic, the oligonucleotide according to any one of embodiments 1 to 165. The oligonucleotide according to any one of embodiments 1 to 165, wherein each sugar in the 5'-wing is independently a 2'-MOE modified sugar. 173. The oligonucleotide according to any one of the preceding embodiments, wherein there are about 8 to 15 nucleosides in the core. 174. The oligonucleotide according to any one of the preceding embodiments, wherein there are 10 nucleosides in the core. 175. The oligonucleotide according to any one of the preceding embodiments, wherein each sugar in the core is independently a natural DNA sugar. 176. The oligonucleotide according to any one of the preceding embodiments, wherein the core does not contain cytosine. 177. The oligonucleotide according to any one of the preceding embodiments, wherein the core contains one or more 5-methylcytosines. 178. The oligonucleotide according to any one of the preceding embodiments, wherein there are about 3 to 10 nucleosides in the 3'-wing. 179. The oligonucleotide according to any one of the preceding embodiments, wherein there are 5 nucleosides in the 3'-wing. 180. The oligonucleotide according to any one of the preceding embodiments, wherein each sugar in the 3'-wing is independently a modified sugar. 181. The sugar in the 3'-wing is a 2'-OR s modified sugar, and R s is C 1-6The oligonucleotide according to any one of the preceding embodiments, which is aliphatic. The oligonucleotide according to any one of the preceding embodiments, wherein the sugar in the 3'-wing is a 2'-MOE modified sugar. The oligonucleotide according to any one of the preceding embodiments, wherein the sugar in the 3'-wing is a 2'-OMe modified sugar. The oligonucleotide according to any one of the preceding embodiments, wherein the sugar in the 3'-wing is a bicyclic sugar. The oligonucleotide according to embodiment 184, wherein the bicyclic sugar is an LNA sugar. The oligonucleotide according to embodiment 184, wherein the bicyclic sugar is a cEt sugar. 187. Each sugar in the 3'-wing is independently a 2'-OR s modified sugar, and R s is C 1-6 The oligonucleotide according to any one of embodiments 1 to 181, which is aliphatic. The oligonucleotide according to any one of embodiments 1 to 181, wherein each sugar in the 3'-wing is independently a 2'-MOE modified sugar. The oligonucleotide according to any one of the preceding embodiments, wherein the oligonucleotide comprises a modified internucleotide linkage. The oligonucleotide according to embodiment 189, wherein the modified internucleotide linkage is a phosphorothioate internucleotide linkage. The oligonucleotide according to any one of the preceding embodiments, wherein each internucleotide linkage is independently a modified internucleotide linkage. The oligonucleotide according to any one of the preceding embodiments, wherein each internucleotide linkage is independently a phosphorothioate internucleotide linkage. 193. An oligonucleotide having a structure selected from the following: / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / *A*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G*G*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *A*T* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErC / , / 52MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *A*G* / iMe-dC / *T*G*T*G*G*G* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / iMe-dC / *T*G*T*A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*T* / iMe-dC / * / iMe-dC / *T*T*G*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / *T* / iMe-dC / *T* / iMe-dC / *A*T*G* / iMe-dC / *A*G* / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / 32MOErC / , / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *T*A*G*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*G*A*G*G* / iMe-dC / *T*G*T* / i2MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*T*T* / iMe-dC / *T*T* / iMe-dC / *T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G*G* / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / *T*T*A* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*T*T*G*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *T*T*T*T* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*T* / iMe-dC / *A* / iMe-dC / *T*A*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *T*T*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / *T*G*A*T*G*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T* / iMe-dC / *T*G*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / *A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / , / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G*T*G*T* / iMe-dC / *T*T*G*T*G* / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErC / 、 / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *A*G*G*A*T*T*T*T* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / 32MOErG / 、 / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / *A*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / 、 / 52MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G*G*G*T*A*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / 、 / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / 、 / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErC / *A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / *T*G*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErA / 、 / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / 、 / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T*A* / iMe-dC / * / iMe-dC / *T*T*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / 、 / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*G* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / 、 / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / *T* / i...

Claims

1. An oligonucleotide having the following structure: / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof, where * is -O-P(O)(SH)-O-, / 52MOErG / is 【Chemical 1】 where / i2MOErA / is 【Chemical Formula 2】 where / i2MOErT / is 【Chemical Formula 3】 where / i2MOErC / is 【Chemical Formula 4】 where / i2MOErG / is [Chemical Formula 5] where / iMe-dC / is 【Chemical Formula 6】 where / 32MOErG / is 【Chemical Formula 7】 where An oligonucleotide wherein each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively.

2. An oligonucleotide having the following structure: / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof, where * is -O-P(O)(SH)-O-, / 52MOErC / is [Chemical 8] where / i2MOErA / is 【Chemical Formula 9】 where / i2MOErT / is 【Chemical Formula 10】 where / i2MOErC / is 【Chemical 11】 where / i2MOErG / is 【Chemical 12】 where / iMe-dC / is 【Chemical 13】 where / 32MOErC / is 【Chemical 14】 where An oligonucleotide wherein each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively.

3. An oligonucleotide having a structure selected from the following: / 52MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / *A*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G*G*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *A*T* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErC / , / 52MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *A*G* / iMe-dC / *T*G*T*G*G* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / iMe-dC / *T*G*T*A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*T* / iMe-dC / * / iMe-dC / *T*T*G*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / *T* / iMe-dC / *T* / iMe-dC / *A*T*G* / iMe-dC / *A*G* / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / 32MOErC / , / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *T*A*G*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*G*A*G*G* / iMe-dC / *T*G*T* / i2MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*T*T* / iMe-dC / *T*T* / iMe-dC / *T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G*G* / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / *T*T*A* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*T*T*G*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *T*T*T*T* / * / iMe-dC / * / iMe-dC / *T* / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*T* / iMe-dC / *A* / * / iMe-dC / *T*A*A* / * / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *T*T*G*G*T* / * / iMe-dC / *T* / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / *T*G*A*T*G*T* / * / iMe-dC / * / iMe-dC / *T*G* / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / * / iMe-dC / *T* / * / iMe-dC / *T*G*G*G*T* / * / iMe-dC / *T* / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / * / iMe-dC / * / iMe-dC / *A*T* / * / iMe-dC / *A* / * / iMe-dC / *T* / * / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*T* / * / iMe-dC / *T*G* / * / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *T* / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / 、 / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / iMe-dC / * / * / iMe-dC / *T* / * / iMe-dC / *T* / * / iMe-dC / * / * / iMe-dC / *T*T*G* / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / 、 / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / * / iMe-dC / *T*G* / * / iMe-dC / *T*G* / * / iMe-dC / *T* / * / iMe-dC / * / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / 、 / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G*T*G*T* / * / iMe-dC / *T*T*G*T*G* / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErC / 、 / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *A*G*G*A*T*T*T*T* / * / iMe-dC / * / * / iMe-dC / * / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / 32MOErG / 、 / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / *A*A* / * / iMe-dC / *T* / * / iMe-dC / * / * / iMe-dC / *T*G* / * / iMe-dC / * / * / iMe-dC / * / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / 、 / 52MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G*G*G*T*A*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErC / *A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / *T*G*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErA / , / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T*A* / iMe-dC / * / iMe-dC / *T*T*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*G* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / *T* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*A*G* / iMe-dC / *T*G*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErT / , / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / *T*G*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *G*G* / iMe-dC / *A*T* / iMe-dC / *T* / iMe-dC / *A*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / , / 52MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G*A*T* / iMe-dC / *A* / iMe-dC / * / iMe-dC / *T*A*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*T*G* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*T*T* / * / iMe-dC / *A* / * / iMe-dC / *T*T* / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / 、 / 52MOErT / * / i2MOErG / * / i2MOErC / * / * / i2MOErC / * / * / i2MOErC / *A* / * / iMe-dC / *A* / * / iMe-dC / *T* / * / iMe-dC / *T*G* / * / iMe-dC / * / * / iMe-dC / * / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / * / 32MOErA / 、 / 52MOErC / * / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G*G*A*G* / * / iMe-dC / *T*G* / * / iMe-dC / *T*A* / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / * / 32MOErG / 、 / 52MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / *A*A*A*G*G*T*G*A*T*G* / * / i2MOErC / * / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / * / 32MOErC / 、 / 52MOErC / * / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A* / * / iMe-dC / * / * / iMe-dC / *A*G*T*T*G*G*A* / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / * / 32MOErC / 、 / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / *T* / * / iMe-dC / *A*G* / * / iMe-dC / * / * / iMe-dC / *A* / * / iMe-dC / * / * / iMe-dC / *A* / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErT / * / * / 32MOErC / 、 / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / * / * / iMe-dC / *A*A*G*A*T*G* / * / iMe-dC / * / * / iMe-dC / * / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / * / 32MOErA / 、 / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / * / iMe-dC / *T* / * / iMe-dC / *T*T*G* / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / *A*T*T*G*G*T*A*G*A*G* / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / * / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *T*A*A*A*G* / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErT / *G* / * / iMe-dC / * / * / iMe-dC / *A* / * / iMe-dC / * / * / iMe-dC / *A*G*T*A* / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T* / * / iMe-dC / *T* / * / iMe-dC / * / * / iMe-dC / *A* / * / iMe-dC / *A* / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*G* / * / iMe-dC / * / * / iMe-dC / *T*G* / * / iMe-dC / *T*T* / * / iMe-dC / * / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / , / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*G*A*T*G*A*G*T* / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / * / iMe-dC / *A*T*G*A* / * / iMe-dC / *A* / * / iMe-dC / * / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / * / iMe-dC / * / * / iMe-dC / *A*G*T*G* / * / iMe-dC / *T* / * / iMe-dC / * / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T* / * / iMe-dC / * / * / iMe-dC / *T*T*G* / * / iMe-dC / *A*G*T* / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / *A*G* / * / iMe-dC / * / * / iMe-dC / *T*G* / * / iMe-dC / *A*T*G* / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErC / *T*G*G*T*G*T* / * / iMe-dC / *A*G*A* / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A* / * / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *T* / * / iMe-dC / * / * / iMe-dC / *A*A*A* / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / *A*G*G*T*T*G*G*A* / *iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G*G*T*T*G*T* / *iMe-dC / *T* / *iMe-dC / *A* / *i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T* / *iMe-dC / * / *iMe-dC / *A*G*A*T*A* / *iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / iMe-dC / *A*A* / *iMe-dC / * / *iMe-dC / * / *iMe-dC / *A*A*T*G* / *i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / *iMe-dC / *T*G*A*G* / *i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*T* / *iMe-dC / * / *iMe-dC / *T*G*T* / *iMe-dC / *T* / *i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / *T*A* / *iMe-dC / *A*G*T*G* / *iMe-dC / * / *iMe-dC / * / *iMe-dC / * / *i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / 32MOErT / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / iMe-dC / *A*G*G*G* / iMe-dC / *A*A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *G*G*A*T*G*T*G*G* / iMe-dC / *A* / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / 32MOErA / , / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / *A*G*T* / iMe-dC / *A*G*A*G*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*A*A* / iMe-dC / *A*G*G*A* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / 32MOErA / , / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / *A* / iMe-dC / * / * / iMe-dC / * / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *A* / iMe-dC / * / * / iMe-dC / *A*G*G*A*A*G*G* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / *A* / iMe-dC / *T*T*T*G* / iMe-dC / * / * / iMe-dC / *T* / iMe-dC / * / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*G*A*G*A*T*T*T*G* / iMe-dC / * / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G* / iMe-dC / * / * / iMe-dC / *T* / iMe-dC / *A*G*A*A*T* / i2MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*A* / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *A*G*T*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*G*T*T*T*A*T*T*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A*A*G* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErG / , or / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *T*G*G*A*A*G*G*A*A*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErC / , or a salt thereof, having * is -O-P(O)(SH)-O- / 52MOErA / is 【Chemical Formula 15】 as follows / 52MOErT / is 【Chemical Formula 16】 as follows / 52MOErC / is 【Chemical 17】 as follows / 52MOErG / is 【Chemical Formula 18】 as follows / i2MOErA / is 【Chemical Formula 19】 as follows / i2MOErT / is 【Chemical 20】 as follows / i2MOErC / is 【Chemical 21】 as follows / i2MOErG / is 【Chemical 22】 as follows / iMe-dC / is 【Chemical 23】 as follows / 32MOErA / is 【Chemical 24】 as follows / 32MOErT / is 【Chemical Formula 25】 as follows / 32MOErC / is 【Chemical 26】 as follows / 32MOErG / is 【Chemical 27】 as follows An oligonucleotide wherein each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively.

4. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of GTCTCCAGAAC TGAGCAGGGG, and each T is optionally and independently replaced by U, the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage.

5. The oligonucleotide according to claim 4, wherein the base sequence of the oligonucleotide is GTCTCCAGAAC TGAGCAGGGG.

6. An oligonucleotide, wherein the base sequence of the oligonucleotide contains 10 or more consecutive nucleic acid bases of CCTTGCAGGC TCTTGATGGG, and each T is optionally and independently replaced by U, the oligonucleotide contains a modified nucleic acid base, a modified sugar, or a modified internucleotide linkage.

7. The oligonucleotide according to claim 6, wherein the base sequence of the oligonucleotide is CCTTG CAGGC TCTTG ATGGC.

8. An oligonucleotide, The base sequence of the oligonucleotide is CCACTAGCCCTGGGAGCAAA, GCCATCTCCATCCATAGAGC, AGGAGAGCTGTGGGCTTGGG, CACCCTATGCCTCCCCAGCAGA, GCTGGCTGTACTCTACTCTC, GTGCTCTGTCCCTTGGTCCTG, CCCATTCTCATGCAGCCTAC, CTGTGACCTAGGCTCCCTGA, GGTCCTGAGAGGCTGTGGGT, GCTCCCCAGTTCTTCTGTGGG, GATGTCCCTCCACAGGTGACA, GCTTCCCTGCCCTTACTGACC, CTCTCCCTTTGTCCCCAGCCA, GCCCTTGCCCTTTTCCCTACT, GCCCTGGTCTACAAACCTCTC, CACCCTACCCTTGGTTCTGCC, CACACTGATGTCCCTGTCCCC, CACACCTCTGGGTTCTGGCC, GCTGCCCCATCACTCCCAGTT, CTCTCCATCTGCCCCGGCCC, CAGTCCCCCTCTCCCTGTCTC, ATCCACCTGCTGCTCCCTGGG, CCCCTTGTGTCTTGTGGGTCG, GCCCTAGGATTTTTCCCTGTTG, GCCCTCAACTCCTGCCCTCCA, AGACACCTGGGATCAGCCT, TCCTTCTTCCCTATTTCCTCA, GCATCACTCTGTCCAGGTAG, GTCCAGTGCCTGCAGCCTTGT, GGCCACCTACCCTTATGCACC, ACTACTGCATCCCCAGCCCC, GCTTGTCTCATCCTGTCTCT, TGTCCTCTGAGCTGACTGCTT, GGGCTTGACTCCTACACTCCT, GGCCATGGCCATCTCCGCTTC, TTCAGGATCACCTAGCTGGG, CCTCTTTGCCATCTGCTGGG, GAGTGCAGTTTCACTTGTGGG, TGCCCCACACTCCTGCCCTCA, CAGAGGGAGCTGCTAGTCAG, TTGGCAAAGGTGATGCAGGC, CCTCCACCTAGTTGGAAGACC, GGTTCTCCAGCCACAGGATC, GTGCTCCAAGATGCCCTGCCA, CCTTGCCAGGCCTCTTGATGG, GTGCCATTGGTTAGAGTAGGAGTGAGCTCCCTAAAGAACCT, GGTTTGCACCAGTACAGGG, TCCAGCTTCTCCACATCAAT, GAACTTGCCTGCTTCCAGCT, ACACTCTGGATGAGTTTGTG, GGGACCCTATGACACTCTGG, ACTTGTCCAGTGCTCCAGGT, CCCAACCTTGCTCATGGG, AGCACAGCCTGCATGTCCCT, CAAAACTGGTGTCCAGCCTG, GCAGCACCCCTCCAAACTGGT, TGGTTAGGTTGGACCCTATG, GCCCTGGTGTCTCCAGCCC, TCCCCCTCCTAGATACTGAGG, ACAGACAAACCCAAAGGAGG, GTCTCCAGAACTGAGCAGGG, CCTTAATTCCCTGTCTGAGG, CAGAAATACAGTGCCTGGCC, CCCAGGGCCCTTGCTCAATA, GCACTCATCCCTGGCTGGG, GATTACAGGGCAAGGCCACA, GCCCTGGATGTGGCAAAAGA, AAGGAAGTCCAGGGGAGGGG, CAGGGCCAAAACAGGAGGCT, ATGCCCAGAACCAGGGCCCA, CTGAGGCACAGCACCAAAGG, GCCAGACCAGGAAGGAGCC, TCAGGAACTTTGCCTCTTTC, GCTTTAGAGATTTGCTACCC, GCCCTGCCCTCAATAATTC, CCTCTGAACCCAGTGGAGG, GCCCTGGGGTTTATTGGAGG, GCCAGCACAGCCAAAGTGGT, or contains 10 or more consecutive nucleobases of GGGA GTGGAAGGAAGGAGCC, wherein each T is optionally and independently replaced by U, wherein the oligonucleotide comprises a modified nucleobase, a modified sugar, or a modified internucleotide linkage.

9. The base sequence of the oligonucleotide is CCACTAGCCCTGGGAGCAAA, GCCATCTCCATCCATAGAGC, AGGAGAGCTGTGGGCTTGGG, CACCCATGCCCTCCAGCAGA, GCTGGCTGTACTCCACTCTC, GTGCTCTGTCCCTTGGTCCTG, CCCATTCTCATGCAGCCTAC, CTGTGACCTAGGCTCCCTGA, GGTCCTGAGAGGCTGTGGGT, GCTCCCCAGTTCTTCTGTGGG, GATGTCCCTCCACAGGTGACA, GCTTCCCTGCCCTTACTGACC, CTCTCCCTTTGTCCCCAGCCA, GCCCTTGCCCTTTTCCCTACT, GCCCTGGTCAACTACCCCTCT, CACCCACCCTTGGTTCTGCC, CACACTGATGTCCCTGTCCCC, CACACCTCTGGGTTCTGGCC, GCTGCCCATCACTCCCAGTT, CTCTCCATCTGCCCCTGGCCC, CAGTCCCCCTCCTTGTCCTC, ATCCACCTGCTGCTCCCTGG, CCCCTTGTGTCTTGTGGGTC, GCCCTAGGATTTTTCCCTGTT, GCCCTCAACTCCCTGCCCTCC, AGACACCTGGGATCAGCCT, TCCTTCTTCCCTATTTCCCA, GCATCACTCTGTCCAGGT, GTCTGTGCCACAGCCTTGTC, GGCCACCTACCTTATGCCCCC, ACTACTGCATCCCCAGCCCC, GCTTGTCTCATCCTGTCTC, TGTCTCTGAGCTGACTGCTT, GGGCTTGACTCCTACACCCA, GGCCATGGCCATCTCAGCTCA, TTCAGGATCACCTAGCTGGG, CCTCTTTGCCATCTGCTGGG, GAGTGCAGTTTCACTTGTGGG, TGCCCCACACTCTGCCCTGTC, CAGAGGGAGCTGCTAGTCAG, TTGGCAAAGGTGATGCAGGC, CCTCCACCTGTTGGAAGACC, GGTTCTCACAGCCACAGGATC, GTGCTCCAAGATGCCCTGCCA, CCTTGCCAGGCTCTTGATGGC, GTGCCATTGGTTAGAGTAGGAGTGAGCTCCCTAAAGAACCT, GGTTTGCACCAGTACAGGG, TCCAGCTTCTCCACATCAAT, GAACTTGCCCTGCTTCCAGCT, ACACTCTGGATGAGTTTGTG, GGGCACCCATGACACTCTGG, ACTTGTCCAGTGCTCCAGGT, CCCAACCTTGCTGTCATGG, AGCACAGCCTGCATGTCCCT, CAAAACTGGTGTCCAGCCTG, GCAGCACCCCTCCAAACTGGT, TGGTTAGGTTGGACCCTATG, GCCCTGGTGTCTCCAGCCCC, TCCCCCTCCTAGATACTGAGG, ACAGACAAACCCATGGAGG, GTCTCCAGAACTCAGCAGGG, CCTTAATTCCCTGTCTGAGG, CAGAAATACAGTGCCCAGGC, CCCAGGCCTTGCTCCAGAA, GCACTCATCCCTGGCTGGG, GATTACAGGGCAAGGCCACA, GCCCTGGATGTGGCAAAAGA, AAGGAAGTCCAGGGAGGGG, CAGGCCCAACACAGGAGGCT, ATGCCCAGACCCTGGC, CCCAG, CTGAGGGCACAGCACCCAAGG, GCCAGACCAGGAAGGAGCC, TCAGGACTTTGCCTCTTTCC, GCTTTAGAGATTTGCTACCC, GCCCTGCCCTCA, AGATGATTC, CCTCTGAACCCAGTGGAGG, GCCCTGGGGTTTATTGGAGGG, GCCAGCACAGCCAAAGTG, or GGGA, GGAGTGGAAGGAAGGAGCC, the oligonucleotide according to claim 8.,

10. The oligonucleotide according to any one of claims 4 to 9, wherein the oligonucleotide comprises a 5'-wing-core-wing-3' structure.

11. The oligonucleotide according to claim 10, wherein there are about 3 to 10 nucleosides in the 5'-wing, and optionally, there are 5 nucleosides in the 5'-wing.

12. The oligonucleotide according to claim 10 or 11, wherein each sugar in the 5'-wing is independently a modified sugar.

13. The sugar in the 5'-wing is a 2'-O- s modified sugar, and R s is C 1-6 is aliphatic, The sugar in the 5'-wing is a 2'-MOE-modified sugar, The sugar in the 5'-wing is a 2'-OMe-modified sugar, The oligonucleotide according to any one of claims 10 to 12, wherein the sugar in the 5'-wing is a bicyclic sugar, and optionally, the bicyclic sugar is an LNA sugar or a cEt sugar.

14. each sugar in the 5'-wing is independently a 2'-O-R s modified sugar, and R s is C 1-6 is aliphatic or The oligonucleotide according to any one of claims 10 to 13, wherein each sugar in the 5'-wing is independently a 2'-MOE-modified sugar.

15. The oligonucleotide according to any one of claims 10 to 14, wherein there are about 8 to 15 nucleosides in the core, and optionally, there are 10 nucleosides in the core.

16. The oligonucleotide according to any one of claims 10 to 15, wherein each sugar in the core is independently a natural DNA sugar.

17. The oligonucleotide according to any one of claims 10 to 16, wherein the core does not contain cytosine and / or the core contains one or more 5-methylcytosines.

18. The oligonucleotide according to any one of claims 10 to 17, wherein there are about 3 to 10 nucleosides in the 3'-wing, and optionally, there are 5 nucleosides in the 3'-wing.

19. The oligonucleotide according to any one of claims 10 to 18, wherein each sugar in the 3'-wing is independently a modified sugar.

20. The sugar in the 3'-wing is a 2'-O- s modified sugar, and R s is C 1-6 is aliphatic, The sugar in the 3'-wing is a 2'-MOE-modified sugar, The sugar in the 3'-wing is a 2'-OMe modified sugar, The sugar in the 3'-wing is a bicyclic sugar, and optionally, the bicyclic sugar is an LNA sugar or a cEt sugar, the oligonucleotide according to any one of claims 10 to 19.

21. Each sugar in the 3'-wing is independently a 2'-OR s modified sugar, and Rs is C 1-6 is aliphatic, or Each sugar in the 3'-wing is independently a 2'-MOE modified sugar, the oligonucleotide according to any one of claims 10 to 20.

22. The oligonucleotide comprises a modified internucleotide linkage, and optionally, the modified internucleotide linkage is a phosphorothioate internucleotide linkage, the oligonucleotide according to any one of claims 10 to 21.

23. Each internucleotide linkage is independently a modified internucleotide linkage, and / or Each internucleotide linkage is independently a phosphorothioate internucleotide linkage, the oligonucleotide according to any one of claims 4 to 22.

24. The oligonucleotide is a pharmaceutically acceptable salt, and optionally, the oligonucleotide is a sodium salt, the oligonucleotide according to any one of the preceding claims.

25. A composition comprising the oligonucleotide according to any one of the preceding claims and one or more diastereomers of the oligonucleotide with respect to chiral linked phosphorus.

26. A composition, An oligonucleotide or a salt thereof, and One or more diastereomers of the oligonucleotide with respect to chiral linked phosphorus, or one or more salts of the diastereomers, The oligonucleotide is / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , * is -O-P(O)(SH)-O-, / 52MOErG / is 【Chemical Formula 28】 as follows, / i2MOErA / is 【Chemical 29】 as follows, / i2MOErT / is 【Chemical Formula 30】 as follows, / i2MOErC / is 【Chemical 31】 as follows, / i2MOErG / is 【Chemical Formula 32】 as follows, / iMe-dC / is 【Chemical 33】 as follows, / 32MOErG / is 【Chemical 34】 as follows, Each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively, the composition.

27. A composition comprising: an oligonucleotide or a salt thereof; and one or more diastereomers of the oligonucleotide with respect to a chiral linked phosphorus, or one or more salts of the diastereomers, wherein the oligonucleotide is / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / , where * is -O-P(O)(SH)-O-, / 52MOErC / is 【Chemical 35】 as follows, / i2MOErA / is 【Chemical 36】 as follows, / i2MOErT / is 【Chemical 37】 as follows, / i2MOErC / is 【Chemical 38】 as follows, / i2MOErG / is 【Chemical Formula 39】 as follows, / iMe-dC / is 【Chemical 40】 as follows, / 32MOErC / is 【Chemical 41】 as follows, and each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively. **Claim 28** A composition comprising: an oligonucleotide or a salt thereof; and one or more diastereomers of the oligonucleotide with respect to a chiral linked phosphorus, or one or more salts of the diastereomers, wherein the oligonucleotide is / 52MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / *A*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G*G*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *A*T* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErC / , / 52MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *A*G* / iMe-dC / *T*G*T*G*G*G* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / iMe-dC / *T*G*T*A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*T* / iMe-dC / * / * / iMe-dC / *T*T*G*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / *T* / iMe-dC / *T* / iMe-dC / *A*T*G* / iMe-dC / *A*G* / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / 32MOErC / , / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErG / *A* / iMe-dC / * / * / iMe-dC / *T*A*G*G* / iMe-dC / *T* / iMe-dC / * / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*G*A*G*G* / iMe-dC / *T*G*T* / i2MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*T*T* / * / iMe-dC / *T*T* / * / iMe-dC / *T* / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / iMe-dC / * / * / iMe-dC / *T* / * / iMe-dC / * / * / iMe-dC / *A* / * / iMe-dC / *A*G*G* / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*G* / * / iMe-dC / * / * / iMe-dC / *T*T*A* / * / iMe-dC / *T* / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*T*T*G*T* / * / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *T* / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G* / * / iMe-dC / * / * / iMe-dC / *T*T*T*T* / * / iMe-dC / * / * / iMe-dC / *T* / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*T* / * / iMe-dC / *A* / * / iMe-dC / *T*A*A* / * / iMe-dC / * / * / iMe-dC / * / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *T*T*G*G*T* / * / iMe-dC / *T* / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / *T*G*A*T*G*T* / * / iMe-dC / * / iMe-dC / *T*G* / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / * / iMe-dC / *T* / * / iMe-dC / *T*G*G*G*T* / * / iMe-dC / *T* / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / * / iMe-dC / * / iMe-dC / *A*T* / * / iMe-dC / *A* / * / iMe-dC / *T* / * / iMe-dC / * / * / iMe-dC / * / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / * / iMe-dC / *A*T* / * / iMe-dC / *T*G* / * / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *T* / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / * / iMe-dC / * / * / iMe-dC / *T* / * / iMe-dC / *T* / * / iMe-dC / * / * / iMe-dC / *T*T*G* / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / , / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G* / * / iMe-dC / *T*G* / * / iMe-dC / *T* / * / iMe-dC / * / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / 、 / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G*T*G*T* / * / iMe-dC / *T*T*G*T*G* / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErC / 、 / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *A*G*G*A*T*T*T*T* / * / iMe-dC / * / * / iMe-dC / * / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / 32MOErG / 、 / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / *A*A* / * / iMe-dC / *T* / * / iMe-dC / * / * / iMe-dC / *T*G* / * / iMe-dC / * / * / iMe-dC / * / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / 、 / 52MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / * / iMe-dC / *T*G*G*G*T*A*T* / * / iMe-dC / * / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / 、 / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / iMe-dC / *T*T* / * / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *T*A*T*T* / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / 、 / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErC / *A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / *T*G*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErA / , / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T*A* / iMe-dC / * / iMe-dC / *T*T*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*G* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / *T* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*A*G* / iMe-dC / *T*G*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErT / , / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / *T*G*A* / / iMe-dC / *T* / / iMe-dC / * / / iMe-dC / *A* / / iMe-dC / *A* / / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *G*G* / / iMe-dC / *A*T* / / iMe-dC / *T* / / iMe-dC / *A*G* / / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / , / 52MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G*A*T* / / iMe-dC / *A* / / iMe-dC / * / / iMe-dC / *T*A*G* / / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*T*G* / / iMe-dC / * / / iMe-dC / *A*T* / / iMe-dC / *T*G* / / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*T*T* / / iMe-dC / *A* / / iMe-dC / *T*T* / / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / / iMe-dC / *A* / / iMe-dC / *T* / / iMe-dC / *T*G* / / iMe-dC / * / / iMe-dC / * / / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G*G*A*G* / iMe-dC / *T*G* / iMe-dC / *T*A* / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErG / , / 52MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / *A*A*A*G*G*T*G*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *A*G*T*T*G*G*A* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / *T* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / * / iMe-dC / *A*A*G*A*T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / *A*T*T*G*G*T*A*G*A*G* / i2MOErT / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *T*A*A*A*G* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / * / iMe-dC / *A* / iMe-dC / * / * / iMe-dC / *A*G*T*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T* / iMe-dC / *T* / iMe-dC / * / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*G* / iMe-dC / * / * / iMe-dC / *T*G* / iMe-dC / *T*T* / iMe-dC / * / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / , / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*G*A*T*G*A*G*T* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *A*T*G*A* / iMe-dC / *A* / iMe-dC / * / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / * / iMe-dC / *A*G*T*G* / iMe-dC / *T* / iMe-dC / * / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / * / 32MOErT / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T* / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *A*G*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / *A*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *A*T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErC / *T*G*G*T*G*T* / iMe-dC / *A*G*A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / * / * / iMe-dC / *T* / iMe-dC / * / * / iMe-dC / *A*A*A* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / *A*G*G*T*T*G*G*A* / iMe-dC / * / iMe-dC / * / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G*G*T*T*G*T* / iMe-dC / *T* / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*G*A*T*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / iMe-dC / *A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*A*T*G* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*T* / iMe-dC / * / iMe-dC / *T*G*T* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / *T*A* / iMe-dC / *A*G*T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / 32MOErT / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *A*T* / * / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *T*G*G* / * / iMe-dC / * / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / iMe-dC / *A*G*G*G* / * / iMe-dC / *A*A*G*G* / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *G*G*A*T*G*T*G*G* / * / iMe-dC / *A* / * / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / 32MOErA / , / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / *A*G*T* / * / iMe-dC / *A*G*A*G*G*G* / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / * / iMe-dC / *A*A*A* / * / iMe-dC / *A*G*G*A* / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*A* / * / iMe-dC / * / * / iMe-dC / * / * / iMe-dC / *A*G*G* / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / 32MOErA / , / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G* / * / iMe-dC / *A* / * / iMe-dC / *A*G* / * / iMe-dC / *A* / * / iMe-dC / * / * / iMe-dC / * / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *A*G*G*A*A*G*G* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / *A* / iMe-dC / *T*T*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*G*A*G*A*T*T*T*G* / iMe-dC / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / *A*G*A*A*T* / i2MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*T*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*G*T*T*T*A*T*T*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A*A*G* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErG / , or / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *T*G*G*A*A*G*G*A*A*G / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErC / , and * is -O-P(O)(SH)-O- / 52MOErA / is 【Chemical 42】 and / 52MOErT / is 【Chemical 43】 and / 52MOErC / is 【Chemical Formula 44】 and / 52MOErG / is 【Chemical 45】 and / i2MOErA / is 【Chemical Formula 46】 and / i2MOErT / is 【Chemical 47】 and / i2MOErC / is 【Chemical 48】 and / i2MOErG / is 【Chemical 49】 and / iMe-dC / is 【Chemical Formula 50】 and / 32MOErA / is 【Chemical Formula 51】 and / 32MOErT / is 【Chemical 52】 and / 32MOErC / is 【Chemical Formula 53】 and / 32MOErG / is 【Chemical Formula 54】 and A composition wherein each of A, T, and G is independently deoxyadenosine, thymidine, and deoxyguanosine, respectively.

29. For each chiral linking phosphorus, the percentage of the Rp configuration is independently about 20% to 80%, about 30% to 70%, about 40% to 60%, about 45% to 55%, or about 50%, according to any one of Claims 25 to 28. The composition described.

30. The composition according to any one of Claims 25 to 29, wherein the composition comprises a salt of the oligonucleotide and one or more salts of one or more diastereomers.

31. The composition according to any one of Claims 25 to 30, wherein the composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier.

32. The composition according to any one of Claims 25 to 31, wherein the composition comprises a pharmaceutically acceptable salt of the oligonucleotide, one or more pharmaceutically acceptable salts of one or more diastereomers, and a pharmaceutically acceptable carrier.

33. A pharmaceutical composition comprising the oligonucleotide or composition according to any one of the preceding claims and a pharmaceutically acceptable carrier.

34. The composition according to Claim 33, wherein the composition comprises one or more pharmaceutically acceptable salts of the oligonucleotide.

35. The composition according to any one of Claims 25 to 34, wherein the composition is a liquid composition.

36. The composition according to any one of Claims 31 to 35, wherein the pharmaceutically acceptable carrier is a buffer solution, buffered physiological saline, or artificial cerebrospinal fluid.

37. A method for reducing the level of SARM1 mRNA in a system, comprising administering or delivering to the system an effective amount of the oligonucleotide or composition according to any one of the preceding claims.

38. A method for reducing the level of SARM1 polypeptide in a system, comprising administering or delivering to the system an effective amount of the oligonucleotide or composition according to any one of claims 1 to 36.

39. A method for reducing the level of SARM1 activity in a system, comprising administering or delivering to the system an effective amount of the oligonucleotide or composition according to any one of claims 1 to 36.

40. The method according to any one of claims 37 to 39, wherein the system expresses SARM1 mRNA.

41. The method according to any one of claims 37 to 40, wherein the system is a cell, a neuronal cell population, a tissue, an organ, the brain or a part thereof, an organism, a subject, or a human, or comprises them.

42. The level of SARM1 mRNA in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% compared to the absence of the oligonucleotide or composition. The method according to any one of claims 37 to 41.

43. The level of SARM1 polypeptide in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60% compared to the absence of the oligonucleotide or composition. The method according to any one of claims 37 to 42.

44. The level of SARM1 activity in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% compared to the absence of the oligonucleotide or composition. The method according to any one of claims 37 to 43.

45. The method according to any one of claims 37 to 44, wherein the level of SARM1 mRNA in said system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% as compared to administering or delivering a reference oligonucleotide or composition.

46. The method according to any one of claims 37 to 45, wherein the level of SARM1 polypeptide in said system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or 60% as compared to administering or delivering a reference oligonucleotide or composition.

47. The method according to any one of claims 37 to 46, wherein the level of SARM1 activity in said system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% as compared to administering or delivering a reference oligonucleotide or composition.

48. The method according to any one of claims 45 to 47, wherein the reference oligonucleotide does not target SARM1, or the reference composition does not contain an oligonucleotide that targets SARM1.

49. The method according to any one of claims 45 to 48, wherein the reference oligonucleotide is a scrambled oligonucleotide, or contains a scrambled oligonucleotide, or the reference composition contains a scrambled oligonucleotide.

50. The method according to any one of claims 37 to 49, wherein the reduction is evaluated about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks, after administering or delivering the oligonucleotide or composition, or thereafter.

51. The method according to any one of claims 37 to 49, wherein the reduction is evaluated about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks, after removal or washout of the oligonucleotide or composition.

52. The method according to any one of claims 37 to 51, wherein the reduction is evaluated in iPSC-derived motor neurons having an oligonucleotide concentration of about 20 uM in gymnothic delivery or as described in Example 5.

53. A method for preventing or treating a condition, disorder, or disease, comprising administering or delivering to a subject susceptible thereto an effective amount of the oligonucleotide or composition according to any one of claims 1 to 36.

54. The method according to claim 53, wherein the onset of the condition, disorder, or disease is delayed or prevented.

55. A method for treating a condition, disorder, or disease, comprising administering or delivering to a subject suffering therefrom an effective amount of the oligonucleotide or composition according to any one of claims 1 to 36.

56. The method according to claim 55, wherein the severity of the symptoms of the condition, disorder, or disease is reduced.

57. The method according to any one of claims 55 to 56, wherein one or more clinical evaluation results of the subject are independently improved.

58. The method according to any one of claims 53 to 57, wherein the condition, disorder, or disease is a neurodegenerative condition, disorder, or disease, Wallerian degeneration, amyotrophic lateral sclerosis, peripheral neuropathy, chemotherapy-induced peripheral neuropathy, Parkinson's disease, Huntington's disease, Alzheimer's disease, frontotemporal dementia, traumatic brain injury, progressive supranuclear palsy, corticobasal degeneration, Wolfram syndrome, Friedreich's ataxia, multiple system atrophy, spinocerebellar ataxia, spinal muscular atrophy, Pick's disease, progressive motor atrophy, stroke, concussion, intracerebral hemorrhage, acute glaucoma, seizure, and / or spinal cord injury.

59. The method according to any one of claims 53 to 58, wherein the oligonucleotide or composition is administered or delivered intrathecally or intravenously.

60. An oligonucleotide or composition according to any one of claims 1 to 36 for use in the method according to any one of claims 37 to 59 or for the manufacture of a medicament for use in the method according to any one of claims 37 to 59.

61. An oligonucleotide, composition, or method according to any one of exemplary embodiments 1 to 517.