Polynucleotide Detection

Abstract

Provided herein are methods for improved polynucleotide detection.

Description

[Technical Field]

[0001] The present invention relates to a simplified polynucleotide sequence detection method suitable for testing for the presence of multiple diagnostic markers, including those used to identify cancer, infectious diseases, and transplant organ rejection. The present invention is also useful for companion diagnostic tests where a panel of markers must be identified reliably and at low cost.

[0002] Polymerase chain reaction (PCR) is a well-known and powerful technique for amplifying DNA or RNA present in experimental and diagnostic samples to the point where they can be reliably detected and / or quantified. However, when applied to examine nucleic acid samples containing low levels of such molecules, this technique has several limitations. First, although this technique can detect a single target molecule, it is prone to false positives due to the unnecessary amplification of other nucleic acid sequences present in the sample. This makes the selection of oligonucleotide primers used to initiate the reaction important; second, this makes the design of primers with the required level of specificity relatively complex. As a result, many PCR-based tests currently on the market have limited specificity.

[0003] A second drawback is that multiplexing of PCR-based methods is practically limited to a maximum of 10 target sequences (often 10 or less) to avoid primer-primer interactions, resulting in the need for a relatively narrow operating window.

[0004] Another problem is that quantitation of targets is difficult due to the exponential cycles of the PCR reaction; small variations in reaction efficiency have a large effect on the amount of detectable material produced. Thus, quantitation is typically limited to an accuracy of within about three-fold, even with appropriate controls and calibrations.

[0005] Finally, mutations in the region targeted for PCR amplification can have unwanted side effects. For example, there have been cases where FDA-approved tests had to be withdrawn because the target organism had mutations in the gene region targeted by the test primers, resulting in a large number of false negatives. Conversely, when specific single nucleotide polymorphisms (SNPs) are targeted for amplification, PCR often produces false positives in the presence of wild-type variants. To avoid this, very careful primer design is required, further limiting multiplexing efficiency. This is particularly true when searching for a panel of SNPs, a common requirement in cancer testing / screening or companion diagnostics.

[0006] WO 2020 / 016590 describes a method for detecting a target nucleic acid sequence in which a sample is contacted with a single-stranded probe, the probe is digested with a pyrophosphorolysis enzyme if complementary to the target, and the digested probe is detected. The method occurs in solution and uses multiple steps of pyrophosphorolysis and ligation to detect the target sequence. The inventors have surprisingly found an improvement to the method of WO 2020 / 016590, including a combined pyrophosphorolysis and ligation step that requires less enzyme.

[0007] Ingram et al. ("PAP-LMPCR for improved, allele-specific footprinting and automated chromatin fine structure analysis," NUCLEIC ACIDS RESEARCH, vol. 36, no. 3, 21 January 2008) teaches a method in which the ligation reaction is highly ineffective in the presence of an added pyrophosphorolysis induction buffer. The disclosure of Ingram et al. teaches something different from the improvements made in the present invention.

[0008] Baner J et al. ("Signal amplification of padlock probes by rolling circle", NUCLEIC ACIDS RESEARCH, vol. 26, 1998) teaches a method for amplifying the signal of a padlock probe by using rolling circle amplification. Baner J et al. do not teach or suggest combining probe X0 disclosed herein, rolling circle amplification, probe A0 disclosed herein, and pyrophosphorolysis and ligation steps.

[0009] None of the prior art discloses or teaches the methods provided and claimed herein. Summary of the Invention

[0010] To overcome many of these limitations, the present inventors have developed an improved method that builds on the inventors' experience using the pyrophosphorolysis reaction used in their previous patents. In doing so, the method exploits the double-stranded specificity of pyrophosphorolysis, a reaction that does not proceed efficiently with single-stranded oligonucleotide substrates or double-stranded substrates containing blocking groups or nucleotide mismatches. Thus, in accordance with the present invention, there is provided a method for detecting one or more target polynucleotide sequences in a nucleic acid sample, comprising: (a) A sample is i single-stranded probe oligonucleotide A0; and ii. Pyrophosphorylase into a first reaction mixture comprising a step in which the target sequence is annealed to a single-stranded probe oligonucleotide A0 to produce a first intermediate product that is at least partially double-stranded, the 3' end of A0 forming a double-stranded complex with the target sequence, and A0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end to produce an at least partially digested strand A1; (b) introducing the first reaction mixture into a second reaction mixture containing a ligase, wherein A1 undergoes ligation using a splint to form A2, wherein the target polynucleotide sequence serves as the splint or the splint comprises oligonucleotide D and undergoes ligation; ligating the 3' end of A1 to the 5' end of A1 to form a circular construct; or Ligation of the 3' end of A1 to the 5' end of ligation probe oligonucleotide C Steps including: (c) introducing the second reaction mixture into a third reaction mixture and detecting a signal from the product of the previous step, wherein the product is A2 or a portion thereof, or multiple copies of A2, or multiple copies of a portion thereof; and inferring therefrom the presence or absence of one or more target polynucleotide sequences in the sample, wherein one or more of the first, second, and / or third reaction mixtures comprise one or more antifoaming agents. The present invention provides a method comprising:

[0011] In one embodiment, the method comprises the step of: - single-stranded probe oligonucleotide A0; - pyrophosphorolytic enzyme; and - Ligase The method is further characterized by combining the first and second reaction mixtures to comprise:

[0012] In one embodiment, the method is a method for detecting two or more target polynucleotide sequences in a nucleic acid sample, - the first or second reaction mixture further comprises a single-stranded probe oligonucleotide X0, wherein X0 comprises a first target complementarity (TC) region, a second target complementarity (TC) region, a first primer binding site, and a second primer binding site, wherein the first TC region anneals to a first region of the target sequence and the second TC region hybridizes to a second region of the target sequence, wherein the first and second TC regions anneal to the target adjacent to each other such that they are separated only by a nick, wherein X0 is not pyrophosphorolyzed, and wherein X0 circularizes to the target by ligation of the first and second TC regions to form X1; - the detection step involves detecting a signal derived from the product of the previous step, the product being i. A2 or a part thereof, or multiple copies of A2, or multiple copies of parts thereof; and / or ii. X1 or any part thereof, or multiple copies of X1, or multiple copies of any part thereof; and from which the presence or absence of two or more target polynucleotide sequences in the sample is inferred. It is further characterized by the fact that

[0013] Nucleic acids to which the methods of the present invention can be applied are nucleic acids, such as naturally occurring or synthetic DNA or RNA molecules, containing the desired target polynucleotide sequence(s). In some embodiments, the nucleic acids are typically present in an aqueous solution containing nucleic acids and other biological materials, and in some embodiments, the nucleic acids are present along with other background nucleic acid molecules that are not of interest for testing purposes. In some embodiments, the nucleic acids are present in small amounts compared to these other nucleic acid components. Preferably, for example, if the nucleic acids are derived from a biological specimen containing cellular material, some or all of these other nucleic acids and exogenous biological materials have been removed using sample preparation techniques such as filtration, centrifugation, chromatography, or electrophoresis before performing step (a) of the method. Suitably, the nucleic acids are derived from a biological sample, such as blood, plasma, sputum, urine, skin, or biopsy, collected from a mammalian subject (particularly a human patient). In some embodiments, the biological sample is subjected to lysis to release the nucleic acids by disrupting any cells present. In other embodiments, the nucleic acids may already be present in a free form within the sample itself; for example, it may be cell-free DNA circulating in the blood or plasma. [Brief explanation of the drawings]

[0014] [Figure 1]

[0023] Figure 1 is a schematic diagram of the circularization of A1 to form A2 against a nucleic acid target sequence. A0 is progressively digested against the target in the 3'-5' direction from the 3' end of A0 to form the partially digested strand A1, shown as steps (A) and (B). This progressive digestion uncovers the 5' end of A0 / A1 and a region of the target complementary to the 5' end of A1, which then hybridizes to this region, shown as step (C). A1 is then ligated together in step (D) to form the circularized strand A2. [Figure 2]

[0023] Figure 1 illustrates a single-stranded probe oligonucleotide A0 annealing to a target polynucleotide sequence to produce a first intermediate product that is at least partially double-stranded, with the 3' end of A0 forming a double-stranded complex with the target polynucleotide sequence. In this simplified embodiment of the invention, there are two molecules of A0 and one target polynucleotide sequence to illustrate how A0 that does not anneal to the target is not involved in further steps of the method. In this illustrative example, the 3' end of A0 anneals to the target polynucleotide sequence, but the 5' end of A0 does not. The 5' end of A0 contains a 5' chemical blocking group, a common priming sequence, and a barcode region. The partially double-stranded first intermediate product undergoes pyrophosphorolysis in the presence of pyrophosphorolysis enzyme in the 3'-5' direction from the 3' end of A0 to produce a partially digested strand A1, the nucleic acid, and undigested A0 molecules that did not anneal to the target. [Figure 3] FIG. 1 shows A1 annealing to single-stranded trigger oligonucleotide B and extending the A1 strand in the 5'-3' direction relative to B to generate oligonucleotide A2. In this illustrative example, trigger oligonucleotide B has a 5' chemical block. Any undigested A0 anneals to trigger oligonucleotide B, but is unable to extend in the 5'-3' direction relative to B to generate a sequence that is the target for the second part of the method. In this example, A2 is primed by at least one single-stranded primer oligonucleotide to generate multiple copies of A2 or a region of A2. [Figure 4]

[0023] Figure 1 shows A1 annealed to splint oligonucleotide D and then circularized by ligation of its 3' and 5' ends. The circularized A2 is then primed with at least one single-stranded primer oligonucleotide to generate multiple copies of A2 or a region of A2. In the illustrative example, splint oligonucleotide D cannot be extended relative to A1 due to either a 3' modification (chemical in this illustration) or a nucleotide mismatch between the 3' end of D and the corresponding region of A2. [Figure 5]The 3' region of splint oligonucleotide D anneals to the 3' region of A1, while the 5' region of splint oligonucleotide D anneals to the 5' region of ligation probe C. Thus, a second intermediate product A2 is formed, comprising A1, C, and optionally an intermediate region formed by extension of A1 in the 5'-3' direction to associate with the 5' end of C. In this illustrative example, ligation probe C has a 3' chemical blocking group so that a 3'-5' exonuclease can be used to digest any unligated A1. A2 is primed by at least one single-stranded primer oligonucleotide to generate multiple copies of A2 or a region of A2. [Figure 6] FIG. 1 shows the fluorescence results of Example 2, showing that when both oligonucleotides 3 and 4 are present, the fluorescent signal appears more rapidly in the reaction, indicating that pyrophosphorolysis and ligation of oligonucleotide 3 occurs in the first reaction mixture. [Figure 7] FIG. 1 shows detection of T790M and C797S_2389 mutations at 1% allele frequency in the same reaction. [Figure 8] FIG. 1 shows detection of three mutations simultaneously in one well at 0.5% allele frequency: G719X — 6239, G719X — 6252, G719X — 6253. [Figure 9] FIG. 10 shows the fluorescence measurements of Example 5, showing results from an embodiment in which a step of pyrophosphorolysis of A0 to form A1 occurs, followed by circularization of A1 to form A2 against a target sequence. [Figure 10a]Figure 1 shows the fluorescence measurement results of Example 6, showing the detection of methylated strands at 1.56% to 100% allele frequency. The results show the detection of a signal above background in samples with completely unmethylated DNA. The method allows the detection of 1.56% methylated strands. (A) Methylated strands chemically converted using the EpiMark Bisulfite Conversion Kit (New England Biolabs, catalog number E3318S), (B) Methylated strands enzymatically converted using the Enzymatic Methyl-Seq Conversion Module (New England Biolabs, catalog number E7125L). [Figure 10b] Figure 1 shows the fluorescence measurement results of Example 6, showing the detection of methylated strands at 1.56% to 100% allele frequency. The results show the detection of a signal above background in samples with completely unmethylated DNA. The method allows the detection of 1.56% methylated strands. (A) Methylated strands chemically converted using the EpiMark Bisulfite Conversion Kit (New England Biolabs, catalog number E3318S), (B) Methylated strands enzymatically converted using the Enzymatic Methyl-Seq Conversion Module (New England Biolabs, catalog number E7125L). [Figure 11] 1 shows the fluorescence measurement results of Example 7. (A) shows that methylated strands at 1.25% allele frequency can be detected using the MspJJ enzyme. (B) shows that methylated strands at 0.31% allele frequency can be detected using the LpnPI enzyme. [Figure 12] 1 shows detection of EGFR exon 20 insertion cosm12377 at 0.2% AF using a probe with the target acting as a splint. The results show that there is a difference between Cq values of 0% and 0.2% when using different complementary regions between the target and probe. [Figure 13]This figure shows the detection of EGFR exon 20 insertion cosm26720, EGFR exon 21 single nucleotide polymorphism L858R_12429, BRAF exon 15 single nucleotide polymorphism V600E, and EGFR exon 19 deletion Cosm6223 at 0.2% VAF. Mutations are detected in a single well with one instance of probe X0 and one instance of probe A0 present in the same reaction mixture. The results show a difference in Cq values between 0% and 0.2%. DETAILED DESCRIPTION OF THE INVENTION

[0015] 1. A method for detecting one or more target polynucleotide sequences in a nucleic acid sample, comprising: (a) A sample is i single-stranded probe oligonucleotide A0; and ii pyrophosphorolytic enzyme; into a first reaction mixture comprising annealing the target sequence to a single-stranded probe oligonucleotide A0 to generate a first intermediate product that is at least partially double-stranded, the 3' end of A0 forming a double-stranded complex with the target sequence, and pyrophosphorolysis of A0 from the 3' end in the 3'-5' direction to generate an at least partially digested strand A1; (b) introducing the first reaction mixture into a second reaction mixture containing a ligase, wherein A1 undergoes ligation using a splint to form A2, wherein the target polynucleotide sequence serves as the splint or the splint comprises oligonucleotide D and undergoes ligation; ligating the 3' end of A1 to the 5' end of A1 to form a circular construct; or Ligation of the 3' end of A1 to the 5' end of ligation probe oligonucleotide C Steps including: (c) introducing the second reaction into a third reaction mixture and detecting a signal from the product of the previous step, wherein the product is: A2 or a part thereof, or multiple copies of A2, or multiple copies of a part thereof; and inferring therefrom the presence or absence of one or more polynucleotide target sequences in the sample, wherein one or more of the first, second, and / or third reaction mixtures comprise one or more antifoaming agents. The present invention provides a method comprising:

[0016] In one embodiment, the method comprises the step of: - single-stranded probe oligonucleotide A0; - pyrophosphorolytic enzyme; and - Ligase The method is further characterized by combining the first and second reaction mixtures to comprise:

[0017] In one embodiment, the method is a method for detecting two or more target polynucleotide sequences in a nucleic acid sample, - the first or second reaction mixture further comprises a single-stranded probe oligonucleotide X0, wherein X0 comprises a first target complementarity (TC) region, a second target complementarity (TC) region, a first primer binding site, and a second primer binding site, wherein the first TC region anneals to a first region of the target sequence and the second TC region hybridizes to a second region of the target sequence, wherein the first and second TC regions anneal to the target adjacent to each other such that they are separated only by a nick, wherein X0 is not pyrophosphorolyzed, and wherein X0 circularizes to the target by ligation of the first and second TC regions to form X1; - the detection step involves detecting a signal derived from the product of the previous step, the product being i. A2 or a part thereof, or multiple copies of A2, or multiple copies of parts thereof; and / or ii. X1 or a portion thereof, or multiple copies of X1, or multiple copies of a portion thereof; and and inferring therefrom the presence or absence of two or more polynucleotide target sequences in the sample. It is further characterized by the fact that

[0018] In some embodiments, X0 comprises only the first primer binding region.

[0019] In some embodiments, X0 is resistant to pyrophosphorolysis due to a chemical modification at its 3' end. In some embodiments, the chemical modification is a phosphorothioate bond.

[0020] Antifoaming agents hinder and / or reduce and / or prevent bubble / foam formation, improving fluid handling and enhancing the accuracy of optical delivery without substantially inhibiting enzyme activity. A major problem when automating PCR data analysis is identifying baseline fluorescence. Background fluorescence varies from reaction to reaction. Furthermore, baseline drift, where fluorescence increases or decreases unrelated to amplification of nucleic acids in a sample, is common. These problems are often exacerbated by bubbles in the reaction, which interfere with optical measurements. Bubbles are likely caused by the presence of nonionic polymeric detergents, which are necessary components of amplification reactions. Therefore, it would be advantageous to have a nucleic acid detection reaction free of optical interference from bubbles. Combining one or more antifoaming agents with the detection methods disclosed herein provides such a reaction.

[0021] In some embodiments, the third reaction mixture includes one or more antifoaming agents. In some embodiments, the antifoaming agent is silicone-based. In some embodiments, the antifoaming agent is Antifoam SE-15. In some embodiments, the antifoaming agent is Antifoam B emulsion. In some embodiments, the antifoaming agent is Antifoam C emulsion.

[0022] In one embodiment, the antifoaming agent is an additive that reduces and prevents the formation of bubbles in a liquid. In one embodiment, the antifoaming agent is an insoluble oil, dimethylsiloxane, silicone, alcohol, mineral oil, organic phosphate, sulfated oil, amide wax, paraffin wax, 2-octanol, oleic acid, dimethylpolysiloxane, stearate, or glycol.

[0023] Antifoam SE-15 is a 10% emulsion of active silicone polymer and nonionic emulsifier. This antifoam agent can be diluted with water and is effective in both hot and cold systems. It can be repeatedly sterilized by autoclaving. Appearance: Milky white liquid; Density: 1.0 g / ml; Viscosity: 2000 cps. Hazardous materials.

[0024] Antifoam B Emulsion is an aqueous emulsion containing 10% active silicone. It contains a different non-ionic emulsifier than those in Antifoam Emulsions C and Y-30. Antifoam B Emulsion can be prediluted with 3 to 10 volumes of cold water to aid dispersion. Prediluted suspensions should be used immediately. Antifoam B Emulsion is typically effective at 1 to 100 ppm. Appearance: White emulsion, pH approximately 6.5; density 1.0 at 25°C. Non-hazardous material.

[0025] Antifoam C Emulsion is an aqueous emulsion containing 30% active silicone. It contains a different non-ionic emulsifier than those in Antifoam Emulsions B and Y-30. Antifoam C Emulsion can be prediluted with 3 to 10 volumes of cold water to aid dispersion. Prediluted suspensions should be used immediately. Antifoam C Emulsion is typically effective at 1 to 10 ppm. Appearance: White emulsion, pH approximately 3; density 1.0 at 25°C. Hazardous materials.

[0026] In some embodiments, the first or second reaction mixture further comprises at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0, at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of X0, and deoxyribonucleotide triphosphates (dNTPs).

[0027] In some embodiments, the third reaction mixture comprises at least one single-stranded primer oligonucleotide and dNTPs. In some embodiments, the partially digested strand A1 is circularized through ligation of its 3' and 5' ends to generate oligonucleotide A2. In some embodiments, the first or second reaction mixture further comprises a ligation probe oligonucleotide C, and the partially digested strand A1 is ligated at its 3' end to the 5' end of C to generate oligonucleotide A2.

[0028] In some embodiments, the ligation comprises: - during step (a); or - during step (b); or - Between steps (a) and (b) occurs.

[0029] One of skill in the art will recognize that in embodiments in which the first reaction mixture includes a ligase (as a result of combining the first and second reaction mixtures), ligation occurs during step (a).

[0030] In some embodiments, the first or second reaction mixture further comprises a 5'-3' exonuclease, rendering the 5' ends of A0 and X0 resistant to 5'-3' exonuclease digestion. In some embodiments, the first or second reaction mixture further comprises a phosphatase or a phosphohydrolase. In some embodiments, before or during step (b) or (c), the product of the previous step is treated with at least one of a pyrophosphatase or an exonuclease.

[0031] In some embodiments, before or during the detection step, the product of the previous step is treated with at least one of pyrophosphatase or exonuclease. In some embodiments, oligonucleotide C further comprises a 3' or internal modification that protects it from 3'-5' exonuclease digestion. In some embodiments, the first or second reaction mixture further comprises a splint oligonucleotide D that comprises an oligonucleotide region complementary to the 3' end of A1 and a region complementary to either the 5' end of oligonucleotide C or the 5' end of A1.

[0032] In some embodiments, the enzyme that pyrophosphorolyzes A0 to form the partially digested chain A1 also amplifies A2 and X1.

[0033] In some embodiments, detection is accomplished using one or more oligonucleotide fluorescent-conjugated dyes or molecular probes, and the increase in signal over time resulting from the generation of the A2 and X1 amplicons is used to infer the concentration of each target sequence. In some embodiments, multiple probes A0 and / or multiple X0 are used, each selective for a different target sequence, each containing an identifying region, and further characterized in that the A2 and X1 amplicons contain the respective identifying regions, such that the target sequences present in the sample are inferred through detection of the identifying regions.

[0034] In some embodiments, detection of the identified region is performed using a molecular probe or through sequencing.

[0035] In some embodiments, the final step of the method comprises the steps of: i. labeling the product of step (b) or step (a) when the first and second reaction mixtures are combined using one or more oligonucleotide fluorescent-conjugated dyes or molecular probes; ii. measuring the fluorescent signal of the product; iii exposing the product to a set of denaturing conditions; and Identifying the polynucleotide target sequence in the analyte by monitoring the change in the fluorescent signal of the product during exposure to denaturing conditions. Further includes:

[0036] In some embodiments, one or more nucleic acid analytes are divided into multiple reaction volumes, each volume containing one or more probe oligonucleotides A0 and one or more X0 introduced to detect different target sequences. In some embodiments, the different probes A0 and X0 contain a common priming site, allowing a single or single set of primers to be used for amplification. In some embodiments, all A0s contain a common priming site, but all X0s contain different common priming sites.

[0037] In some embodiments, (a) one or more single-stranded probes A0, the 3' end of A0 being complementary to a first target polynucleotide sequence; (b) one or more pyrophosphorolysis-resistant single-stranded probes X0, wherein X0 comprises a first target-complementary (TC) region, a second target-complementary (TC) region, a first primer binding site, and a second primer binding site, wherein the first TC region anneals to a first region of a second target sequence, the second TC region hybridizes to a second region of the second target sequence, and the first and second regions of the target sequences are adjacent to each other; (c) one or more ligases; (d) one or more pyrophosphorylating enzymes; (e) one or more sources of pyrophosphate ions; (f) one or more buffering agents; and (g) one or more antifoaming agents A kit comprising:

[0038] In some embodiments, the kit may include an oligonucleotide C where the 5' end of C is complementary to a region of the target polynucleotide sequence that is different from the region of oligonucleotide D or the region to which the 3' end of A0 is complementary.

[0039] In some embodiments, the kit may include an oligonucleotide D that includes a region that is complementary to a region of A0 located in the 5' direction from the 3' end of A0, and a region that is complementary to either the 5' end of C or the 5' end of A0.

[0040] In some embodiments, the kit may include an exonuclease. In some embodiments, the kit may include a pyrophosphatase. In some embodiments, the kit may include dNTPs and one or more primers.

[0041] In one embodiment, a reaction mixture is provided that includes A2, X1, one or more primers, dNTPs, one or more antifoaming agents, and one or more buffers. In one embodiment, the reaction mixture may include one or more additional reagents selected from any of the reagents previously disclosed or disclosed below.

[0042] In one aspect of the invention, there is provided a method for detecting two or more target polynucleotide sequences in a nucleic acid sample, comprising the steps of: (a) A sample is i. A molecular system comprising a probe molecule (A0) and a hybridized splint molecule (C), A0 has a 3' end, a loop region, and a 5' phosphate that is complementary to the target polynucleotide sequence; and C hybridizes to the 5' end of A0, providing a single-stranded 3' overhang; A molecular system in which a single-stranded 3' overhang can hybridize to a region located 1 to 50 bases in the 5' direction from the 3' end of A0; ii. pyrophosphorolytic enzyme; and iii ligase; into a first reaction mixture comprising A0 is pyrophosphorolyzed from its 3' end in the 3'-5' direction to generate at least a partially digested strand A1, C displaces the 3' end of A1 from the target, and the ends of A1 are ligated to each other to form a circular construct A2 to the pre-hybridized C; and the first reaction mixture further comprises a single-stranded probe oligonucleotide X0, wherein X0 comprises a first target complementarity (TC) region, a second target complementarity (TC) region, a first primer binding site, and a second primer binding site, wherein the first TC region anneals to a first region of the target sequence and the second TC region hybridizes to a second region of the target sequence, wherein the first and second TC regions anneal to the target adjacent to each other such that they are separated only by a nick, wherein X0 is not pyrophosphorolyzed, and wherein X0 circularizes to the target by ligation of the first and second TC regions to form X1; (b) introducing the first reaction mixture into a third reaction mixture and detecting a signal from the product of the previous step, wherein the product is: i. A2 or a part thereof, or multiple copies of A2, or multiple copies of parts thereof; and / or ii. X1 or any part thereof, or multiple copies of X1, or multiple copies of any part thereof; and inferring therefrom the presence or absence of two or more polynucleotide target sequences in the sample, wherein one or more of the first and / or third reaction mixtures comprises one or more antifoaming agents. The present invention provides a method comprising:

[0043] In some embodiments, the 5' end of A0 is resistant to exonuclease degradation. In some embodiments, A0 and C hybridize at the 5' end of A0 over a region comprising at least 5 complementary nucleotides.

[0044] In some embodiments, the single-stranded 3' overhang of C is complementary to a region located 1 to 50 bases in the 5' direction from the 3' end of A0 over a region comprising at least five complementary nucleotides. In some embodiments, the region of complementarity is at least 7 nucleotides in length. In some embodiments, A2 is between 20 and 200 nucleotides in length. In some embodiments, A2 is between 40 and 100 nucleotides in length.

[0045] In one aspect of the invention, there is provided a method for detecting two or more target polynucleotide sequences in a nucleic acid sample, comprising the steps of: (a) deriving two or more nucleic acids from a biological sample by subjecting the biological sample, comprising the analyte and optionally background genomic DNA, to PCR to produce an amplicon of the analyte, wherein one or more of the primers have a non-complementary 5' tail; (b) separating two or more nucleic acids from the sample; i. single-stranded probe oligonucleotide A0; ii. pyrophosphorolytic enzyme; and iii. Ligase into a first reaction mixture comprising: the target sequence anneals to a single-stranded probe oligonucleotide A0 to produce a first intermediate product that is at least partially double-stranded, the 3' end of A0 forming a double-stranded complex with the target sequence, A0 is pyrophosphorolyzed from the 3' end in the 3'-5' direction to produce an at least partially digested strand A1, A1 undergoes ligation using a splint to form A2, and the target polynucleotide sequence serves as the splint or the splint comprises oligonucleotide D and undergoes ligation; - ligating the 3' end of A1 to the 5' end of A1 to form a circular construct; or - Ligation of the 3' end of A1 to the 5' end of the ligation probe oligonucleotide C Includes; and wherein the first reaction mixture further comprises a single-stranded probe oligonucleotide X0, wherein X0 further comprises a first target complementarity (TC) region, a second target complementarity (TC) region, a first primer binding site, and a second primer binding site, wherein the first TC region anneals to a first region of the target sequence and the second TC region hybridizes to a second region of the target sequence, wherein the first and second TC regions anneal to the target adjacent to each other such that they are separated only by a nick, wherein X0 is not pyrophosphorolyzed, and wherein X0 circularizes to the target by ligation of the first and second TC regions to form X1; (c) introducing the first reaction into a third reaction mixture and detecting a signal from the product of the previous step, wherein the product is: i. A2 or a part thereof, or multiple copies of A2, or multiple copies of parts thereof; and / or ii. X1 or a part thereof, or multiple copies of X1, or multiple copies of a part thereof; and inferring therefrom the presence or absence of two or more polynucleotide target sequences in the sample, wherein one or more of the first and / or third reaction mixtures comprises one or more antifoaming agents. The present invention provides a method comprising:

[0046] In some embodiments, step (a) comprises deriving one or more analytes from the biological sample by subjecting the biological sample, comprising the analytes and optionally background genomic DNA, to PCR to produce amplicons of the analytes, wherein one or more of the primers have a non-complementary 5' tail.

[0047] In some embodiments, one of the primers is introduced in excess of the other. In some embodiments, one or more of the primers are 5'-protected and the product is treated with a 5'-3' exonuclease. In some embodiments, one or more primers that are not 5'-protected can have a 5' phosphate group.

[0048] In some embodiments, the one or more blocking oligonucleotides are introduced into the biological sample prior to PCR. In some embodiments, the one or more blocking oligonucleotides are present in the first reaction mixture.

[0049] In one aspect of the invention, there is provided a method for detecting two or more polynucleotide sequences in a nucleic acid sample, comprising the steps of: (a) introducing blocking oligonucleotides into a first reaction mixture comprising two or more nucleic acids, wherein the blocking oligonucleotides anneal to at least a subset of non-target polynucleotide sequences; (b) the mixture produced in (a), i. single-stranded probe oligonucleotide A0; ii. pyrophosphorolytic enzyme; and iii. Ligase into a second reaction comprising the target sequence anneals to a single-stranded probe oligonucleotide A0 to produce a first intermediate product that is at least partially double-stranded, the 3' end of A0 forming a double-stranded complex, A0 being pyrophosphorolyzed from the 3' end in the 3'-5' direction to produce an at least partially digested strand A1, A1 undergoing ligation using a splint to form A2, wherein the target polynucleotide sequence serves as the splint or the splint comprises oligonucleotide D and undergoes ligation; - ligating the 3' end of A1 to the 5' end of A1 to form a circular construct; or - Ligation of the 3' end of A1 to the 5' end of the ligation probe oligonucleotide C Includes; and wherein the first reaction mixture further comprises a single-stranded probe oligonucleotide X0, wherein X0 comprises a first target complementarity (TC) region, a second target complementarity (TC) region, a first primer binding site, and a second primer binding site, wherein the first TC region anneals to a first region of the target sequence and the second TC region hybridizes to a second region of the target sequence, wherein the first and second TC regions anneal to the target adjacent to each other such that they are separated only by a nick, wherein X0 is not pyrophosphorolyzed, and wherein X0 circularizes to the target by ligation of the first and second TC regions to form X1; (d) introducing the second reaction into a third reaction mixture and detecting a signal from the product of the previous step, wherein the product is i. A2 or a part thereof, or multiple copies of A2, or multiple copies of parts thereof; and / or ii. X1 or any part thereof, or multiple copies of X1, or multiple copies of any part thereof; and inferring therefrom the presence or absence of two or more polynucleotide target sequences in the sample, wherein one or more of the first, second, and / or third reaction mixtures comprise one or more antifoaming agents. The present invention provides a method comprising:

[0050] In some embodiments, the first reaction mixture further comprises one or more primers, deoxynucleotide triphosphates (dNTPs) and an amplification enzyme, and during step (a), nucleic acids present in the sample undergo amplification, and after amplification of the nucleic acids of interest and prior to (b), the sample is further treated with a proteinase.

[0051] In some embodiments, prior to step (a), nucleic acids present in the sample are amplified, and after amplification of the nucleic acids of interest, the sample is further treated with a proteinase.

[0052] In some embodiments, the sample is treated with a proteinase before step (a). In some embodiments, the sample is treated with a proteinase during step (a). In some embodiments, the sample is treated with a proteinase after step (a).

[0053] In some embodiments, the method comprises the following steps: (a) two or more nucleic acids, i. single-stranded probe oligonucleotide A0; ii. blocking oligonucleotides; iii. pyrophosphorolytic enzyme; and iv. Ligase into a combined reaction mixture comprising: a blocking oligonucleotide anneals to at least a subset of the non-target polynucleotide sequences, and one target sequence anneals to a single-stranded probe oligonucleotide A0 to generate a first intermediate product that is at least partially double-stranded, the 3' end of A0 forming a double-stranded complex; A0 is pyrophosphorolyzed in the 3'-5' direction from the 3' end to generate an at least partially digested strand A1; A1 undergoes ligation using a splint to form A2; and the target polynucleotide sequence serves as the splint, or the splint comprises oligonucleotide D and undergoes ligation; - ligating the 3' end of A1 to the 5' end of A1 to form a circular construct; or - comprising the ligation of the 3' end of A1 to the 5' end of the ligation probe oligonucleotide C; and wherein the first reaction mixture further comprises a single-stranded probe oligonucleotide X0, wherein X0 comprises a first target complementarity (TC) region, a second target complementarity (TC) region, a first primer binding site, and a second primer binding site, wherein the first TC region anneals to a first region of the target sequence and the second TC region hybridizes to a second region of the target sequence, wherein the first and second TC regions anneal to the target adjacent to each other such that they are separated only by a nick, wherein X0 is not pyrophosphorolyzed, and wherein X0 circularizes to the target by ligation of the first and second TC regions to form X1; (b) detecting a signal from the product of the previous step, wherein the product is: i. A2 or a part thereof, or multiple copies of A2, or multiple copies of parts thereof; and / or ii. X1 or any part thereof, or multiple copies of X1, or multiple copies of any part thereof; and inferring therefrom the presence or absence of two or more polynucleotide target sequences in the sample. The first and second reaction mixtures are combined to comprise:

[0054] In some embodiments of the method, the blocking oligonucleotide is - the non-target nucleic acid sequence anneals incompletely to the blocking oligonucleotide to form an intermediate product that cannot be digested by pyrophosphorolysis to the extent necessary to melt it from the non-target molecule; - the target nucleic acid sequence fully anneals to the blocking oligonucleotide to form an intermediate product that is at least partially double-stranded at the 3' end of the blocking oligonucleotide, and the blocking oligonucleotide is pyrophosphorolyzed in the 3'-5' direction to release the target nucleic acid; - then the target nucleic acid can anneal to the single-stranded probe oligonucleotide A0 or X0 perfectly complementary to the target nucleic acid sequence and mismatched to the non-target nucleic acid sequence; The signal from the product of the previous step is detected, and the product is i. A2 or a part thereof, or multiple copies of A2, or multiple copies of parts thereof; and / or ii. X1 or any part thereof, or multiple copies of X1, or multiple copies of any part thereof; and From there, the presence or absence of two or more polynucleotide target sequences in the sample is inferred.

[0055] In some embodiments, (a) i. one or more single-stranded probes A0, the 3' end of A0 being complementary to a first target polynucleotide sequence; ii. one or more pyrophosphorolysis-resistant single-stranded probes X0, wherein X0 comprises a first target complementarity (TC) region, a second target complementarity (TC) region, a first primer binding site, and a second primer binding site, wherein the first TC region anneals to a first region of a second target sequence and the second TC region hybridizes to a second region of the second target sequence, and wherein the first and second regions of the target sequences are adjacent to each other; iii. one or more ligases; iv. one or more pyrophosphorolytic enzymes; and v. One or more sources of pyrophosphate ions a first reaction mixture comprising: (b) i. one or more antifoaming agents; and ii. dNTPs and one or more primers a second reaction mixture comprising wherein the first and / or second reaction mixture further comprises one or more buffer solutions.

[0056] In some embodiments, the second reaction mixture further comprises oligonucleotide C. In some embodiments, the second reaction may further comprise oligonucleotide D.

[0057] In some embodiments, the first and / or second reaction mixture may further comprise one or more of any other components described herein in the context of the methods, kits, or devices of the invention.

[0058] Those skilled in the art will understand that there are multiple embodiments of the inventive method disclosed herein, and that all such methods may include the use of one or more antifoam agents in one or more of the reaction mixtures described herein.

[0059] In some embodiments, the blocking oligonucleotide comprises a modification that renders it resistant to exonucleolytic or pyrophosphorolytic digestion. In some embodiments, the blocking oligonucleotide comprises a 3' modification that renders it resistant to exonucleolytic or pyrophosphorolytic digestion. In some embodiments, the blocking oligonucleotide comprises a 5' modification that renders it resistant to exonucleolytic digestion.

[0060] In one aspect of the invention, there is provided a method for detecting two or more target polynucleotide sequences in a nucleic acid sample, comprising the steps of: a. A sample containing one or more nucleic acids i. a single-stranded probe oligonucleotide A0 comprising a region complementary to the target nucleic acid sequence; ii. a single-stranded probe oligonucleotide X0 comprising a first target complementarity (TC) region, a second target complementarity (TC) region, a first primer binding site, and a second primer binding site; iii. a complement oligonucleotide B0 comprising a capture portion and a region complementary to a region adjacent to the target nucleic acid sequence; iv.Solid phase support into a first reaction mixture comprising: b. hybridizing A0, X0 and B0 to a nucleic acid analyte; c. introducing the hybridized probe into a second reaction mixture containing a pyrophosphorolysis enzyme, wherein A is pyrophosphorolyzed from the 3' end in a 3'-5' direction to generate at least partially digested strand A, and X is not pyrophosphorolyzed; d. introducing the partially digested strands A1 and X0 annealed to the target nucleic acid sequence into a third reaction mixture containing a ligase, wherein A1 undergoes ligation to form A2, the first TC region of X0 anneals to a first region of the target sequence and the second TC region hybridizes to a second region of the target sequence, the first and second TC regions anneal to the target adjacent to each other such that they are separated only by a nick, and X0 circularizes to the target by ligation of the first and second TC regions to form X1; and e. Detecting a signal from the product of the previous step, wherein the product is i. A2 or a part thereof, or multiple copies of A2, or multiple copies of parts thereof; and / or ii. X1 or any part thereof, or multiple copies of X1, or multiple copies of any part thereof; and inferring therefrom the presence or absence of two or more polynucleotide target sequences in the sample. The present invention provides a method comprising:

[0061] In some embodiments, the second and third reaction mixtures are combined, and thus the method, from step c) onwards, comprises the following steps: c. introducing the hybridized probe into a second reaction mixture containing a pyrophosphorolysis enzyme and a ligase, wherein A0 is pyrophosphorolyzed from the 3' end in the 3'-5' direction to generate at least partially digested strand A1, X0 is not pyrophosphorolyzed, a first TC region of X0 anneals to a first region of the target sequence, a second TC region hybridizes to a second region of the target sequence, the first and second TC regions anneal to the target adjacent to each other such that they are separated only by a nick, and X0 circularizes to the target by ligation of the first and second TC regions to form X1; and d. Detecting a signal from the product of the previous step, wherein the product is: iii. A2 or any part thereof, or multiple copies of A2, or multiple copies of any part thereof; and / or iv. X1 or any part thereof, or multiple copies of X1, or multiple copies of any part thereof and inferring therefrom the presence or absence of two or more polynucleotide target sequences in the sample. Includes:

[0062] In some embodiments, B0 is bound to a solid support before step (b). In some embodiments, B0 is bound to a solid support between steps (b) and (c).

[0063] In some embodiments, after B0 is bound to the solid support and A0, X0, and B0 are hybridized to the target, the supernatant, and thus any A0 or X0 that is not hybridized to the target nucleic acid analyte, is removed from the reaction mixture. This removal can occur before (c). This removal can occur before (d).

[0064] In some embodiments, the capture oligonucleotide is complementary to a region within 10,000, 5,000, 2,500, 1,000, 500, 250, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, or 5 nucleotides of the target nucleic acid sequence. In some embodiments, the capture oligonucleotide is complementary to a region within 100 nucleotides of the target nucleic acid sequence. In some embodiments, the capture oligonucleotide is complementary to a region within 50 nucleotides of the target nucleic acid sequence. In some embodiments, the capture oligonucleotide is complementary to a region within 10 nucleotides of the target nucleic acid sequence.

[0065] In some embodiments, oligonucleotides A0 and B0 are combined to form a single oligonucleotide, hi some embodiments, oligonucleotides X0 and B0 are combined to form a single oligonucleotide, forming X1, before or during circularization, and the combined oligonucleotide is released from any solid support to which it is attached.

[0066] In some embodiments, the solid support is a polymer and / or resin coated solid surface, hi some embodiments, the solid support is a polystyrene solid support.

[0067] In some embodiments, polystyrene (C8H8) nis the number of n, where n is 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, 1 1,000, 12,000, 12,500, 15,000, 16,000, 17,000, 17,500, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000 or more, or where n is any integer between any of these points, or where n is in any range derivable between any two of these points, are utilized.

[0068] In some embodiments, the polystyrene solid support is a particle, microparticle, magnetic bead, resin, or any microparticle comprising a polystyrene polymer. In some embodiments, the polystyrene support is modified to include one or more of the following functional groups: amine, carboxylate, sulfonate, trimethylamine, and / or epoxide.

[0069] In some embodiments, the solid support is a magnetic bead. In some embodiments, the magnetic bead is shaped to maximize the surface area of the bead. In some embodiments, the magnetic bead is regularly shaped. In some embodiments, the magnetic bead is irregularly shaped. In some embodiments, the magnetic bead has a diameter of less than or equal to 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5, 2.5, 1, 0.5, 0.25, or 0.1 microns.

[0070] In some embodiments, the solid support is a magnetic polystyrene bead. In some embodiments, the magnetic polystyrene bead comprises iron oxide. In some embodiments, the magnetic polystyrene bead is conjugated to streptavidin. In some embodiments, the solid support is a Dynabead (RTM) conjugated to streptavidin. In some embodiments, the solid support is a dextran-modified surface.

[0071] In some embodiments, the dextran-modified surface is a particle, microparticle, magnetic bead, resin, or any microparticle comprising a dextran polymer. In some embodiments, the dextran polymer has an approximate molecular weight of 1,000 to 410,000. In some embodiments, the dextran polymer has an approximate molecular weight of 25,000 to 100,000. In some embodiments, the surface-modified dextran is further modified to include one or more functional groups. In some embodiments, the dextran-modified surface is modified to include one or more of the following functional groups: amine, carboxylate, sulfonate, trimethylamine, and / or epoxide.

[0072] In some embodiments, the magnetic beads are dextran magnetic beads selected from Nanomag® Dextran (ND); Nanomag® Dextran-SO3H (ND-SO3H); BioMag® Dextran Coated Activated Carbon; or BioMag® Plus Dextran.

[0073] In some embodiments, the solid support is a polyethylene glycol (PEG) or PEG-modified surface. In some embodiments, the polyethylene glycol (PEG) or PEG-modified surface is a particle, microparticle, magnetic bead, resin, or any microparticle comprising PEG.

[0074] In some embodiments of the present invention, PEG, (CHO) nis the number of n, where n is 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, 1 1,000, 12,000, 12,500, 15,000, 16,000, 17,000, 17,500, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000 or more, or where n is any integer between any of these points, or where n is within any range derivable between any two of these points, are utilized. In some embodiments, the PEG utilized is PEG-200, PEG-300, PEG-400, PEG-600, PEG-1000, PEG-1300-1600, PEG-1450, PEG-3000-3700, PEG-3500, PEG-6000, PEG-8000, or PEG-17500.

[0075] In some embodiments, where the polyethylene glycol (PEG) or PEG-modified surface is a microparticle or bead, the microparticle or bead is selected from Nanomag® PEG-300 (Plain) or Nanomag®-D. In some embodiments, the solid support is polyvinylpyrrolidone (PVP) or a PVP-modified surface.

[0076] In some embodiments, the PVP or PVP-modified surface is a particle, microparticle, magnetic bead, resin, or any microparticle that includes PVP. In some embodiments of the PVP of the present invention, the n-vinylpyrrolidone is selected from the group consisting of 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, 11,000, 12,000, 12,500, 15,000, 16,000, 17,000, 17,500, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000 or more, or where n is any integer between any of these points, or where n is in any range derivable between any two of these points, are utilized.

[0077] In some embodiments, the solid support is a polysaccharide or a polysaccharide-modified surface. In some embodiments, the polysaccharide or polysaccharide-modified surface is a particle, microparticle, magnetic bead, resin, or any microparticle comprising a polysaccharide.

[0078] In some embodiments, the polysaccharide is selected from one or more of dextran, ficoll, glycogen, gum arabic, xanthan gum, carrageenan, amylose, agar, amylopectin, xylan, and / or beta-glucan. In some embodiments, the solid support is a chemical resin or a chemical resin-modified surface.

[0079] In some embodiments, the chemical resin or chemical resin-modified surface is selected from one or more of the following resins: isocyanate, glycerol, piperidino-methyl, polyDMAP (polymer-bound dimethyl 4-aminopyridine), DIPAM (diisopropylaminomethyl, aminomethyl, polystyrene aldehyde), tris(2-aminomethyl)amine, morpholino-methyl, BOBA (3-benzyloxybenzaldehyde), triphenyl-phosphine, or benzylthio-methyl.

[0080] In some embodiments, B0 is covalently attached to the solid support via the capture moiety of B0. In some embodiments, the capture moiety of B0 is covalently attached to the solid support via a chemically cleavable linker, such as a disulfide-, allyl-, or azide-masked hemiaminal ether linker. In some embodiments, the capture moiety of B0 is covalently attached to the solid support via an amide or phosphorothioate bond. Those skilled in the art will recognize that there are numerous techniques for covalently and non-covalently immobilizing oligonucleotides to solid supports; see, for example, "Strategies for Attaching Oligonucleotides to Solid Supports" (2014), authored by Integrated DNA Technologies (IDT®). In some embodiments, B0 is non-covalently attached to the solid support via the capture moiety of B0.

[0081] Those skilled in the art will recognize that numerous techniques exist for covalently and non-covalently immobilizing oligonucleotides to solid supports; see, for example, "Strategies for Attaching Oligonucleotides to Solid Supports." (2014) prepared by Integrated DNA Technologies (IDT®).

[0082] In some embodiments, the capture portion of B0 comprises an oligonucleotide sequence and the solid support comprises an oligonucleotide having a complementary sequence. In some embodiments, the length of the complementary sequence is between 10, 20, 30, 40, 50, 100, 150, and 200 bases. In some embodiments, the length of the complementary sequence is between 10, 20, 30, 40, 50, and 100 bases. In some embodiments, the length of the complementary sequence is between 10-20, 10-30, 10-40, and 10-50 bases. In some embodiments, the length of the complementary sequence is between 10-20, 10-30, and 10-40 bases. In some embodiments, the length of the complementary sequence is between 10-20 and 10-30 bases. In some embodiments, the length of the complementary sequence is between 10-20 and 10-30 bases. In some embodiments, the length of the complementary sequence is between 10-20 bases.

[0083] In some embodiments, the capture moiety comprises a chemical modification to B0, and B0 binds to the solid support via an interaction between the chemical modification and the solid support. In some embodiments, the chemical modification is biotin, and the solid support further comprises streptavidin.

[0084] In some embodiments of the method, the first reaction mixture includes a plurality of different oligonucleotides A0, X0, and B0, and the successfully hybridized oligonucleotides are simultaneously enriched.

[0085] In some embodiments, prior to step (c), A0, X0, the target nucleic acid, and optionally B0 are released from the solid support. In some embodiments, after step (c), A1, X0, optionally B0, and optionally the target nucleic acid are released from the solid support. In some embodiments, during step (c), A1, X0, optionally B0, and optionally the target nucleic acid are released from the solid support. It should be understood that reference to releasing A0 encompasses embodiments in which A0 is converted to A1 or A2 while bound to the solid surface and then released.

[0086] In some embodiments, the oligonucleotides are released from the solid support by cleaving the chemical linker through the addition of tris(2-carboxyethyl)phosphine (TCEP) or dithiothreitol (DTT) in the case of disulfide linkers; palladium complexes in the case of allyl linkers; or TCEP in the case of azide-masked hemiaminal ether linkers.

[0087] In some embodiments, the oligonucleotide is released from the solid support by removing the non-standard base from A or B and cleaving at the resulting abasic site. In some embodiments, the non-standard base is uracil, which is removed by uracil DNA glycosylase. In alternative embodiments, the non-standard base is 8-oxyguanine, which is removed by formamidopyrimidine DNA glycosylase (Fpg).

[0088] In some embodiments, the capture moiety is an oligonucleotide region and release is achieved through heating of the reaction mixture. In some embodiments, the reaction mixture is heated to 37°C to 100°C for 1 to 20 minutes. In some embodiments, the reaction mixture is heated for 1 to 15 minutes. In some embodiments, the reaction mixture is heated for 1 to 10 minutes. In some embodiments, the reaction mixture is heated for 1 to 5 minutes. In some embodiments, the reaction mixture is heated for 5 minutes. In some embodiments, the reaction mixture is heated to 37°C to 85°C. In some embodiments, the reaction mixture is heated to 37°C to 75°C. In some embodiments, the reaction mixture is heated to 37°C to 65°C. In some embodiments, the reaction mixture is heated to 37°C to 55°C. In some embodiments, the reaction mixture is heated to 37°C to 45°C.

[0089] Those skilled in the art will recognize that the temperature to which the reaction mixture is heated to allow release of the complementary oligonucleotide region will depend on the length of said region. In some embodiments, release is achieved through cleavage of oligonucleotide B0. This cleavage can be achieved by any of the means described above or below, or by any means known to those skilled in the art.

[0090] In some embodiments, B0 is cleaved chemically. In some embodiments, B0 is cleaved enzymatically. In some embodiments, B0 is cleaved by a restriction enzyme. In some embodiments, B0 is cleaved by an epigenetic modification-sensitive or -dependent restriction enzyme. In some embodiments, B0 is cleaved by a methylation-sensitive or -dependent restriction enzyme. In some embodiments, B0 is cleaved by a hydroxymethylation-sensitive or -dependent restriction enzyme.

[0091] In some embodiments, the restriction enzyme is an endonuclease. In some embodiments, B0 is cleaved by a flap endonuclease. In some embodiments, B0 comprises a photocleavable linker, and the oligonucleotide is released from the solid support by cleavage of the linker. In some embodiments, B0 comprises a UV-cleavable linker, and the oligonucleotide is released from the solid support by cleavage of the linker.

[0092] In some embodiments, the release is achieved through cleavage of A0 and / or X0 with a methylation-sensitive or methylation-dependent restriction enzyme. In some embodiments, the release is achieved through cleavage of A0 and / or X0 and the nucleic acid analyte.

[0093] In some embodiments, A0 and B0, or X0 and B0, are regions of the same oligonucleotide C0, C0 is cleaved by a methylation-sensitive or methylation-dependent restriction enzyme, and the portion comprising A0 (or X0) and the nucleic acid analyte are released from the solid support. In some embodiments, release occurs prior to pyrophosphorolysis.

[0094] In some embodiments, release occurs simultaneously with pyrophosphorolysis. In some embodiments, the target nucleic acid sequence hybridized to A0 is prevented from undergoing pyrophosphorolysis prior to release from the solid support by the presence of a modification or mismatch at its 3' end. In some embodiments, cleavage occurs 5' from these modifications or mismatches, thus generating a free 3' end that allows the pyrophosphorolysis reaction to proceed.

[0095] In some embodiments, cleavage and release occurs only if methylation is present in the target nucleic acid sequence. In some embodiments, cleavage and release occurs only if methylation is not present in the target nucleic acid sequence. In some embodiments, cleavage and release occurs only if hydroxymethylation is present in the target nucleic acid sequence. In some embodiments, cleavage and release occurs only if hydroxymethylation is not present in the target nucleic acid sequence. In some embodiments, cleavage and release occurs only if an epigenetic modification is present in the target nucleic acid sequence. In some embodiments, cleavage and release occurs only if an epigenetic modification is not present in the target nucleic acid sequence.

[0096] In one embodiment, a methylation analysis method is provided. For example, a nucleic acid strand has three potential methylation sites. In this case, these sites are CpG sites. Each CpG can be either methylated or unmethylated. Therefore, there are 2 x 2 x 2 = 8 possible methylation combinations for the strand shown. All possible methylation combinations are shown in the following strand. 5mdCTP is highlighted. [ka]

[0097] After bisulfite conversion, the chains have the following sequences: [ka]

[0098] We can detect the presence of methylation using seven A0 probes. The probes are shown below (each probe name is prefixed with a P and corresponds to the strand it detects): No probe was designed to detect strand 1 because strand 1 is completely unmethylated. [ka]

[0099] In one example, each of the probes can have the same 5' tail sequence and the same ligator sequence (i.e., the region of the probe that is complementary to the ligation splint, in some examples oligonucleotide D). If any of the 3xCpGs are methylated, a signal is generated.

[0100] In the second example, each probe has a different 5' tail sequence and a different ligator sequence. The signal of each probe can be detected individually and used to determine the methylation combination for all three CpGs. For example, detection of P2 occurs only if the 5'-most CpGs are all methylated and the remaining CpGs are unmethylated (using a strand diagram for orientation).

[0101] In another example, the probe can be: [ka]

[0102] Any methylated CpG sites on the target strand will generate a mismatch, while any unmethylated CpGs will be subject to pyrophosphorolysis. In this example, the probe has one 5' tail sequence. Three ligators are required, one for each of the three different CpGs. This means that a single probe can detect which of the three CpGs is methylated (but possibly not identify which site).

[0103] In one embodiment, there is an increase in temperature between pyrophosphorolysis and ligation to facilitate separation of the partially digested probe from its target.

[0104] In one embodiment, there is provided a method for analyzing methylation on a nucleic acid molecule having at least two potential methylation sites, comprising the steps of: a-1. Carrying out a conversion reaction that differentially modifies methylated and unmethylated sites; a. nucleic acid, at least three different single-stranded probe oligonucleotides 1-A0, 2-A0 and 3-A0, each comprising a 3' end complementary to a different nucleic acid sequence; ligase; and pyrophosphorylase into a first reaction mixture comprising: Successful annealing of any probe with a modified target nucleic acid produces a first intermediate product that is at least partially double-stranded, with the 3' end of the probe forming a double-stranded complex with the modified target nucleic acid, the probe undergoes pyrophosphorolysis from the 3' end in the 3'-5' direction to produce at least partially digested strand A1, A1 undergoes ligation using a splint to form A2, and the modified target nucleic acid serves as the splint, or the splint comprises oligonucleotide D and undergoes ligation: ligating the 3' end of A1 to the 5' end of A1 to form a circular construct; or Ligation of the 3' end of A1 to the 5' end of ligation probe oligonucleotide C Including, A2 comprises one or more partially digested portions of 1-A0, 2-A0, or 3-A0; c. Detecting A2 or a portion thereof and inferring therefrom the methylation status in the nucleic acid sample. The present invention provides a method comprising:

[0105] In some embodiments, the potential methylation sites are CpG sites. In some embodiments, the A0 oligonucleotides all contain the same 5' tail sequence, and any signal detected indicates the presence of at least one methylated CpG site in the target nucleic acid. In some embodiments, each A0 oligonucleotide contains a different 5' tail sequence, and the method establishes whether 1-A0, 2-A0, or 3-A0 has been digested. In some embodiments, only one of 1-A0, 2-A0, or 3-A0 is digested. In some embodiments, the nucleic acid contains a number (N) of CpG sites, and the first reaction mixture is ((2 N )-1) different single-stranded probes A0. In some embodiments, the nucleic acid comprises two or three CpG sites.

[0106] In one embodiment, a kit for use in a methylation analysis method is provided.

[0107] In some embodiments, the 3' end of A0 is perfectly complementary to the target polynucleotide sequence. In some embodiments, the ligase substantially lacks single-stranded ligation activity. In some embodiments, the deoxynucleotide triphosphates (dNTPs) are hot-start dNTPs. In some embodiments, the one or more ligases are thermostable. In some embodiments, the one or more ligases are naturally occurring. In other embodiments, the one or more ligases are engineered. In some embodiments, the one or more ligases are selected from any ligase previously disclosed or disclosed below. In some embodiments, the one or more polymerases are thermostable. In some embodiments, the one or more polymerases are selected from any polymerase previously disclosed or disclosed below. In some embodiments, the one or more polymerases are naturally occurring. In other embodiments, the one or more polymerases are engineered. In some embodiments, the one or more polymerases are the same as those used for pyrophosphorolysis. In some embodiments, the one or more enzymes of the invention are hot-start enzymes. In some embodiments, the one or more enzymes of the invention are thermostable.

[0108] In some embodiments, the reaction mixture comprising the pyrophosphatase further comprises a source of pyrophosphate ions.

[0109] In some embodiments, the target region of RNA present in biological sample is reverse transcribed into DNA by reverse transcriptase before being introduced into the reaction mixture containing pyrophosphorylase.In some embodiments, this is achieved by using reverse transcriptase and appropriate nucleotides.In some embodiments, the RNA present in sample is transcribed into DNA simultaneously with any pre-amplification of nucleic acid present in sample by PCR.In some embodiments, the transcription of any RNA present in sample into DNA occurs in a separate step from any pre-amplification of nucleic acid present in sample by PCR.In some embodiments of any of the methods previously described herein or described below, the RNA present in sample is not transcribed into DNA.

[0110] In such embodiments, A0 is subjected to pyrophosphorolysis of the RNA sequence to form the partially digested strand A1, and the method proceeds as previously described or as described below.

[0111] In some embodiments, the second or combined reaction mixture further comprises at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0, at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of X0, and deoxyribonucleotide triphosphates (dNTPs). In some embodiments, the second or combined reaction mixture further comprises an amplification / polymerase enzyme.

[0112] In some embodiments, the products of the pyrophosphorolysis reaction are introduced into a third reaction mixture containing the single-stranded primer oligonucleotide and dNTPs prior to the detection step.

[0113] In some embodiments, the third reaction mixture further comprises an amplification / polymerase enzyme. In some embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, comprises: - at least two single-stranded primer oligonucleotides, deoxynucleotide triphosphates (dNTPs) and an amplification enzyme; or - Reagents suitable for hybridization chain reaction (HCR); or - Suitable reagent for ligase chain reaction (LCR) further including; The pyrophosphorolytic enzyme is the same enzyme that optionally performs the amplification.

[0114] In some embodiments, the deoxynucleotide triphosphate (dNTP) is a hot-start dNTP.

[0115] Hot-start deoxynucleotide triphosphates (dNTPs) are dNTPs modified at the 3' end with a heat-labile protecting group. The presence of this modification blocks DNA polymerase nucleotide incorporation until the nucleotide protecting group is removed using a heat activation step.

[0116] In one embodiment, the second or combined reaction mixture, or the third reaction mixture to which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises components for a hybridization chain reaction (HCR).

[0117] In some embodiments, the second or combined reaction mixture, or the third reaction mixture to which the product of the pyrophosphorolysis step is introduced before the detection step, further comprises a ligation probe oligonucleotide C having a 5' phosphate, a splint oligonucleotide D that is complementary to the 3' end of A1 and the 5' end of C, and the partially digested strand A1 is ligated at its 3' end to the 5' end of C to form oligonucleotide A2.

[0118] In this embodiment, the reaction mixture further includes hairpin oligonucleotide 1 (HO1) and hairpin oligonucleotide 2 (HO2), each of which contains a fluorophore and a quencher such that when each oligonucleotide remains in the hairpin configuration, the fluorophore and quencher contact each other. HO1 is designed so that A2 and / or X1 anneal to it, opening the "hairpin" structure and separating the fluorophore from the quencher. The now "open" HO1 can anneal to HO2, opening the "hairpin" structure and separating the fluorophore from the quencher.

[0119] In this embodiment, multiple hairpin oligonucleotides are present such that the presence of one A2 and / or X1 can trigger a chain reaction that opens the hairpin oligonucleotides, resulting in the production of a detectable fluorescent signal. This methodology is known in the literature as hybridization chain reaction (HCR).

[0120] In some embodiments, the fluorophore of the fluorophore-quencher pair is selected from, but not limited to, the fluorescein family, carboxyrhodamine family, cyanine family, and rhodamine family dyes. Other families of dyes that can be used include, for example, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine family dyes, chelating lanthanide family dyes, the dye family available under the trade name Alexa Fluor J from Molecular Probes, the dye family available under the trade name Atto from ATTO-TEC (Siegen, Germany), and the dye family available under the trade name Bodipy J from Invitrogen (Carlsbad, Calif.). Fluorescein family dyes include, for example, 6-carboxyfluorescein (FAM), 2',4',1,4-tetrachlorofluorescein (TET), 2',4',5',7',1,4-hexachlorofluorescein (HEX), 2',7'-dimethoxy-4',5'-dichloro-6-carboxyrhodamine (JOE), 2'-chloro-5'-fluoro-7',8'-fused-phenyl-1,4-dichloro-6-carboxyfluorescein (NED), 2'-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC), 6-carboxy-X-rhodamine (ROX), and 2',4',5',7'-tetrachloro-5-carboxy-fluorescein (ZOE). Dyes in the carboxyrhodamine family include tetramethyl-6-carboxyrhodamine (TAMRA), tetrapropano-6-carboxyrhodamine (ROX), Texas Red, R110, and R6G. Dyes in the cyanine family include Cy2, Cy3, Cy3.5, Cy5, Cy5.5, and Cy7. Fluorophores are commercially available from, for example, Perkin-Elmer (Foster City, Calif.), Molecular Probes, Inc. (Eugene, Oreg.), and Amersham GE Healthcare (Piscataway, NJ).

[0121] In some embodiments, the quencher of the fluorophore-quencher pair may be a fluorescent quencher or a non-fluorescent quencher, including, but not limited to, TAMRA, ROX, DABCYL, DABSYL, cyanine dyes including nitrothiazole blue (NTB), anthraquinone, malachite green, nitrothiazole, and nitroimidazole compounds. Exemplary non-fluorescent quenchers that dissipate energy absorbed from fluorophores include those available from Biosearch Technologies, Inc. (Novato, Calif.) under the trade name Black Hole™, those available from Epoch Biosciences (Bothell, Wash.) under the trade name Eclipse™ Dark, those available from Anaspec, Inc. (San Jose, Calif.) under the trade name QX1J, those available from Integrated DNA Technologies (Coralville, Iowa) under the trade names ZEN and TAO, and those available from Integrated DNA Technologies (Coralville, Iowa) under the trade name Iowa Black™.

[0122] In some embodiments, the fluorophore of the fluorophore-quencher pair may be fluorescein, Lucifer Yellow, B-phycoerythrin, 9-acridine isothiocyanate, Lucifer Yellow VS, 4-acetamido-4'-isothio-cyanatostilbene-2,2'-disulfonic acid, 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin, succinimidyl 1-pyrenebutyrate, and 4-acetamido-4'-isothiocyanatostilbene-2-,2'-disulfonic acid derivatives.

[0123] In some embodiments, the fluorophore of the fluorophore-quencher pair may be LC-Red 640, LC-Red 705, Cy5, Cy5.5, lissamine rhodamine B sulfonyl chloride, tetramethylrhodamine isothiocyanate, rhodamine x isothiocyanate, erythrosine isothiocyanate, fluorescein, diethylenetriaminepentaacetic acid, or other chelators of lanthanide ions (e.g., europium or terbium).

[0124] In some embodiments, the present invention utilizes a double-quenched fluorescently labeled oligonucleotide.The inclusion of a second internal quencher shortens the distance between the dye and the quencher, and together with the first quencher, provides greater overall dye quenching, lower background, and increased signal detection.The second and first quenchers can be any of the quenchers previously described.

[0125] In alternative embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, contains a ligation probe oligonucleotide C having a 5' phosphate, a splint oligonucleotide D that is complementary to the 3' end of A1 and the 5' end of C, and the partially digested strand A1 is ligated at its 3' end to the 5' end of C to form oligonucleotide A2. In some embodiments, the 5' and 3' ends of A1 are ligated to each other to form circularized A2. In some embodiments, A1 is circularized to form A2 to ligation probe oligonucleotide C. In some embodiments, A0 is circularized to form A2 to splint oligonucleotide D.

[0126] In some embodiments, A1 circularizes to form A2 relative to the target sequence. In this embodiment, the region of the target exposed by progressive digestion of A0 in the 3'-5' direction from the 3' end of A0 to form A1 is complementary to the 5' end of A0 / A1. In this embodiment, a ligase is used to ligate the 3' and 5' ends of A1 to form circularized oligonucleotide A2. This is shown, for example, in FIG. 1. In some embodiments, the 5' end of A0 / A1 is complementary to the target over a region that is 5-50 nucleotides in length. In some embodiments, this is 5-25 nucleotides in length. In some embodiments, this is 5-20 nucleotides in length. In some embodiments, this is 5-15 nucleotides in length. In some embodiments, this is 5-12 nucleotides in length. In some embodiments, this is 5-10 nucleotides in length.

[0127] In some embodiments, A1 is circularized to form A2, as described above or below. In some embodiments, A2 is formed from partially digested strand A1, as described above or below.

[0128] In one embodiment, the second or combined reaction mixture, or the third reaction mixture to which the product of the pyrophosphorolysis step is introduced prior to the detection step, comprises: - oligonucleotide A comprising a substrate arm, a partial catalytic core, and a sensor arm; - oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; and - Substrates containing fluorophore-quencher pairs further including; The sensor arms of oligonucleotides A and B are complementary to the flanking regions of A2 such that in the presence of A2, oligonucleotides A and B combine to form a catalytic multicomponent nucleic acid enzyme (MNAzyme). In this embodiment, the MNAzyme forms only in the presence of A2 and cleaves a substrate containing a fluorophore-quencher pair such that a detectable fluorescent signal is generated. In some embodiments, it is X1 that triggers the formation of the MNAzyme. In some embodiments, the presence of either X1 or A2 triggers the formation of the MNAzyme.

[0129] In some embodiments, the fluorophore-quencher pair can be as previously described.

[0130] In some embodiments, reaction mixtures of the invention are combined such that pyrophosphorolysis, ligation and production of a detectable fluorescent signal occur without the addition of additional reagents.

[0131] In an alternative embodiment, the second or combined reaction mixture, or the third reaction mixture to which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises partially double-stranded nucleic acid; - one strand comprises at least one RNA base, at least one fluorophore, and a region of this strand is complementary to a region of A2 and / or X1, and this strand may be called the "substrate" strand; - the other strand comprises at least one quencher, a region of this strand being complementary to a region of A2 and / or X1 adjacent to the region to which the substrate strand is complementary, such that in the presence of A2 and / or X1, the partially double-stranded nucleic acid construct becomes substantially more double-stranded; In the process of becoming substantially more double-stranded, the substrate strand of the double-stranded nucleic acid construct is cleaved at an RNA base, causing fluorescence because at least one quencher on the "other" strand is no longer in sufficient proximity to at least one fluorophore on the substrate strand.

[0132] In other words, a partially double-stranded nucleic acid construct in the presence of A2 has a double stranded portion that is larger in size.

[0133] In some embodiments, the fluorophore-quencher pair may be as previously described.

[0134] In some embodiments, additional reagents such as suitable buffers and / or ions are present in a second or combined reaction mixture, or a third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step.

[0135] In some embodiments, the reaction mixture comprises Mg 2+ In some embodiments, the reaction mixture further comprises Zn ions. 2+ In some embodiments, the reaction mixture further comprises an X ion, where X is a metal. 2+ In some embodiments, the reaction mixture further comprises one or more X ions, where X is a metal. 2+ It further contains ions.

[0136] In an alternative embodiment, the second or combined reaction mixture, or the third reaction mixture to which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises reagents for ligase chain reaction (LCR).

[0137] In some embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, comprises: a. one or more ligases; and b. Two or more LCR probe oligonucleotides in which the 5' phosphate of one LCR probe is complementary to adjacent sequences on A2 or X1 immediately adjacent to the 3' OH of the other LCR probe when the probes are successfully annealed to A2 or X1 Includes:

[0138] In some embodiments, in the presence of A2 or X2, the two LCR probes successfully anneal to A2 and ligate to each other to form one oligonucleotide molecule, which then serves as a new target for the second round of covalent ligation, resulting in the exponential amplification of the target of interest, in this case A2.The ligated product or amplicon is complementary to A2 and serves as the target for the next amplification cycle.Thus, in the presence of an excess amount of LCR probe, exponential amplification of a specific target DNA sequence is achieved through repeated cycles of denaturation, hybridization, and ligation.This allows the presence of A2, and therefore the target polynucleotide sequence, to be inferred.

[0139] In some embodiments, in the presence of A2, the two PCR probes successfully anneal to A2 and ligate to each other to form a single oligonucleotide molecule that serves as a new target for a second round of covalent ligation, resulting in exponential amplification of the target of interest, in this case A2, which is then detected. In some embodiments, it is X1 that triggers LCR. In some embodiments, the presence of either X1 or A2 triggers LCR.

[0140] In some embodiments, the ligated oligonucleotide molecules are detected in real time using an intercalating dye. In some embodiments, the ligated oligonucleotide molecules are detected using gel electrophoresis. Those skilled in the art will recognize that there are multiple techniques that allow for the detection of ligated oligonucleotide molecules.

[0141] In an alternative embodiment, the second or combined reaction mixture, or the third reaction mixture to which the product of the pyrophosphorolysis step is introduced prior to the detection step, comprises: a. a splint oligonucleotide comprising a fluorophore-quencher pair that is complementary to A2 and / or X1; b. Double-stranded specific DNA digestive enzyme Includes; In the presence of A2 and / or X1, the splint oligonucleotide is digested such that the fluorophore-quencher pair is separated and the fluorescent signal, and therefore the presence of A2 and / or X1, is detectable.

[0142] In some embodiments, the fluorophore-quencher pair can be as described above. In some embodiments, the double-strand-specific DNA digestion enzyme is an exonuclease. In another embodiment, it is a polymerase with proofreading activity. In another embodiment, the reaction mixture comprises one or more mixtures of exonucleases or polymerases with proofreading activity. In some embodiments, the double-strand-specific DNA digestion enzyme is a hot-start enzyme.

[0143] In some embodiments, the double-strand-specific DNA digestive enzyme has reduced activity at the temperature at which the pyrophosphorolysis reaction of the method occurs. In some embodiments, the double-strand-specific DNA digestive enzyme has no activity at the temperature at which the pyrophosphorolysis reaction of the method occurs. In some embodiments, the reaction mixture containing the partially digested strand A1 is introduced to inorganic pyrophosphatase before or during the detection step.

[0144] In chemical science, methylation refers to the addition of a methyl group to a substrate or the substitution of an atom or group with a methyl group. Methylation is a form of alkylation, with a methyl group specifically replacing a hydrogen atom rather than a larger carbon chain. These terms are commonly used in chemistry, biochemistry, soil science, and biological science.

[0145] In biological systems, methylation is catalyzed by enzymes; such methylation can be involved in heavy metal modification, regulation of gene expression, regulation of protein function, and RNA metabolism. Heavy metal methylation can also occur outside of biological systems. Chemical methylation of tissue samples is also a method for reducing certain histological staining artifacts.

[0146] Aberrant DNA methylation profiles are associated with many different complex disease states. In oncology, hypermethylation of tumor suppressor genes in serum DNA can be used as a diagnostic marker for small cell lung cancer. Aberrant DNA methylation in cells of the immune system has been found in patients with immune diseases, such as diabetes, rheumatoid arthritis (RA), and systemic lupus erythematosus (SLE). Differential DNA methylation in peripheral blood leukocytes (PBLs) at the repeat sequences ALU, LINE-1, and Satellite2 (or measuring global DNA methylation) has been found to be associated with ischemic heart disease.

[0147] DNA methylation in vertebrates typically occurs at CpG sites (cytosine-phosphate-guanine sites; i.e., where a guanine immediately follows a cytosine in the DNA sequence); this methylation results in the conversion of cytosine to 5-methylcytosine. The formation of Me-CpG is catalyzed by the enzyme DNA methyltransferase. While the majority of mammalian DNA has approximately 40% methylated CpG sites, there are certain regions known as CpG islands (composed of approximately 65% CG residues) that are unmethylated and GC-rich. These are associated with the promoters of 56% of mammalian genes, including all ubiquitously expressed genes. 1-2% of the human genome is CpG clusters, and there is an inverse relationship between CpG methylation and transcriptional activity.

[0148] DNA methylation involves the addition of a methyl group to the nitrogen at the 5-position of the cytosine pyrimidine ring or the 6-position of the adenine purine ring. This modification can be inherited through cell division. DNA methylation is typically removed during zygote formation and re-established through successive cell divisions during development. DNA methylation is a crucial part of normal biological development and cell differentiation in higher organisms. DNA methylation stably alters gene expression patterns in cells, allowing them to "remember their place"; in other words, cells programmed to become pancreatic islets during embryonic development remain in islets throughout the lifespan of the organism, even without constant signals telling them they need to remain in islets. In addition, DNA methylation suppresses the expression of viral genes and other harmful elements that become integrated into the host genome over time. DNA methylation also forms the basis of chromatin structure, which allows cells to form the myriad characteristics required for multicellular life from a single, unchanging sequence of DNA. DNA methylation also plays a crucial role in the development of almost all types of cancer.

[0149] Bisulfite sequencing uses bisulfite treatment of DNA to determine its methylation pattern. DNA methylation was the first epigenetic mark discovered and is the most well-studied. It is also involved in the repression of transcriptional activity.

[0150] Among multiple mRNA modifications, the N6-methyladenosine (m6A) modification is the most common type in eukaryotic cells and nuclear-replicating viruses. m6A plays a significant role in multiple cancer types, including leukemia, brain tumors, liver cancer, breast cancer, and lung cancer.

[0151] 5-Methylcytosine (5mC) is the most well-studied epigenetic modification, and 5mC is oxidized to 5-hydroxymethylcytosine (5hmC) by the enzyme TET (ten-eleven translocation). Studies have shown that the distribution of 5hmC is tissue-specific, with differences in its distribution in different organs and tissues. Reduced expression of 5hmC in malignant tissues has been consistently demonstrated in a wide range of different cancers, including melanoma. By evaluating a total of 15 pairs of normal and cancer samples in human breast tissue, studies have shown that 5hmC levels were dramatically reduced in the cancer group compared to healthy breast tissue.

[0152] Treating DNA with bisulfite converts cytosine residues to uracil, while leaving 5-methylcytosine residues unaffected. Thus, bisulfite treatment introduces specific changes into the DNA sequence that depend on the methylation status of individual cytosine residues, yielding single-base resolution information about the methylation status of a segment of DNA. Various analyses can be performed on the modified sequence to obtain this information. Objective analysis is therefore reduced to distinguishing between single-nucleotide polymorphisms (cytosine and thymine) resulting from bisulfite conversion. 5hmC is converted to 5mC by bisulfite treatment, which is then read as C during sequencing. Thus, 5hmC and 5mC cannot be distinguished. The output of bisulfite sequencing can no longer be defined as a single DNA methylation because it is a composite of 5mC and 5hmC. The development of Tet-assisted oxidative bisulfite sequencing now allows for discrimination between the two modifications at single-base resolution.

[0153] 5hmC can be detected using TET-assisted bisulfite sequencing (TAB-seq). Fragmented DNA is enzymatically modified using sequential T4 phage β-glucosyltransferase (T4-BGT) and then Ten-eleven translocation (TET) dioxygenase treatments, followed by the addition of sodium bisulfite. T4-BGT glucosylates 5hmC to form β-glucosyl-5-hydroxymethylcytosine (5ghmC), which is then oxidized to 5caC using TET. Only 5ghmC is protected from subsequent deamination by sodium bisulfite, allowing 5hmC to be distinguished from 5mC by sequencing.

[0154] Oxidative bisulfite sequencing (oxBS) provides another method to distinguish between 5mC and 5hmC. The oxidizing reagent potassium perruthenate converts 5hmC to 5-formylcytosine (5fC), and subsequent bisulfite treatment deaminates 5fC to uracil. 5mC remains unchanged and can therefore be identified using this method.

[0155] APOBEC-coupled epigenetic sequencing (ACE-seq) completely excludes bisulfite conversion and relies on enzymatic conversion to detect 5hmC. This method involves T4-BGT glucosylating 5hmC to 5ghmC, protecting it from deamination by apolipoprotein B mRNA editing enzyme subunit 3A (APOBEC3A). Cytosine and 5ghmC are deaminated by APOBEC3A and sequenced as thymine.

[0156] TET-assisted 5-methylcytosine sequencing (TAmC-seq) enriches for 5mC loci and utilizes two sequential enzymatic reactions followed by affinity pulldown. Fragmented DNA is treated with T4-BGT, which protects 5hmC by glycosylation. The enzyme mTET1 is then used to oxidize 5mC to 5hmC, and T4-BGT labels the newly formed 5hmC using a modified glucose moiety (6-N3-glucose). Click chemistry is used to introduce a biotin tag, which allows enrichment of 5mC-containing DNA fragments for detection and genome-wide profiling.

[0157] Methylome analysis methods can be broadly divided into three groups: restriction enzyme-based methods, chromatin immunoprecipitation-based methods (ChIP), and affinity-based bisulfite conversion methods (gene-based). Restriction enzyme-based methods use methylation-sensitive enzymes for small-scale / large-scale DNA sequence methylation analysis by combining methylation-sensitive restriction enzyme experimental approaches (RLGS, DMH, etc.) for global methylation analysis applicable to any genome without knowing the DNA sequence. However, they require large amounts of genomic DNA, making them unsuitable for analyzing samples with small amounts of DNA. On the other hand, ChIP-based methods are useful for identifying differentially methylated regions in tumors through the precipitation of protein antigens from solution using antibodies against the protein. These methods are protein-based and have been widely applied in cancer research.

[0158] Affinity enrichment is a technique often used to isolate methylated DNA from the rest of a DNA population. This is typically achieved by antibody immunoprecipitation or methyl-CpG binding domain (MBD) proteins.

[0159] Methylated DNA immunoprecipitation (MeDIP) is an antibody immunoprecipitation method that utilizes a 5-methylcytidine (5-mC) antibody that specifically recognizes methylated cytosine. The MeDIP kit requires that the DNA sample input is single-stranded in order for the 5-methylcytidine (5-mC) antibody to bind.

[0160] Another method for enriching methylated DNA fragments uses the recombinant methyl-binding protein MBD2b or the MBD2b / MBD3L1 complex. One advantage of the methyl-CpG binding protein enrichment strategy is that it does not require denaturing the input DNA sample; the protein can recognize methylated DNA in its natural double-stranded form. Another advantage is that MBD proteins bind only to DNA methylated in a CpG context, ensuring enrichment of methylated-CpG DNA, making this technique ideal for studying CpG islands.

[0161] In some embodiments, one or more nucleic acids are selectively modified before or during step (a) of the method of the present invention. In some embodiments, unmethylated cytosine bases in one or more nucleic acids are chemically or enzymatically converted before or during step (a). In some embodiments, unmodified cytosine bases are converted to uracil by a methyltransferase enzyme. In some embodiments, the enzyme is M.Sssl. In some embodiments, unmodified cytosine bases are converted to uracil by a deaminase enzyme.

[0162] The enzymatic methyl-seq workflow relies on the ability of APOBEC to deaminate cytosine to uracil. APOBEC also deaminates 5mC and 5hmC, making it impossible to distinguish between cytosine and its modified forms. To detect 5mC and 5hmC, this method also utilizes TET2 and an oxidation enhancer, which enzymatically modify 5mC and 5hmC to forms that are not substrates for APOBEC. The TET2 enzyme converts 5mC to 5caC, and the oxidation enhancer converts 5hmC to 5ghmC. Ultimately, cytosine is sequenced as thymine, and 5mC and 5hmC are sequenced as cytosine, thereby protecting the integrity of the original 5mC and 5hmC sequence information.

[0163] In some embodiments, before or during step (a), the one or more nucleic acids are introduced to an epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease.

[0164] In some embodiments, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is McrBC. In some embodiments, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a member of the MspJI family. In some embodiments, the endonuclease is AspBHI. In some embodiments, the endonuclease is FspEI. In some embodiments, the endonuclease is LpnPI. In some embodiments, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a member of the PvuRts1I / AbaS family. In some embodiments, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a type IIM endonuclease. In some embodiments, the endonuclease is DpnI. In some embodiments, the endonuclease is BisI. In some embodiments, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is a type IV endonuclease. In some embodiments, the endonuclease is EcoKMcrBC. In some embodiments, the endonuclease is SauUSI. In some embodiments, the endonuclease is GmrSD. In some embodiments, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is selected from the DpnII restriction endonuclease family. In some embodiments, the endonuclease is DpnII. In some embodiments, the endonuclease is DpnI. In some embodiments, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is HpaI. In some embodiments, the epigenetic modification-sensitive or epigenetic modification-dependent restriction endonuclease is HpaII.

[0165] In some embodiments, one or more nucleic acids are introduced to a methylation-sensitive or methylation-dependent restriction endonuclease before or during step (a). In some embodiments, one or more nucleic acids are introduced to a methylation-sensitive or methylation-dependent restriction endonuclease before or during step (a), followed by selective amplification of target polynucleotide sequences containing the methylation state of interest through methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) of methylated DNA.

[0166] In some embodiments, the population of methylated or unmethylated nucleic acids is reduced before or during step (a). In some embodiments, the reduction is achieved using methylated DNA immunoprecipitation (MeDIP). In some embodiments, the reduction is achieved using a methyl-binding protein, such as MBD2b or the MBD2b / MBD3L1 complex.

[0167] It will be clear to those skilled in the art that the present invention can be extended to detect any epigenetic modification and is not limited to detecting the methylation status of target polynucleotide sequence.For example, the present invention can be equally adapted to detect other epigenetic modifications, including hydroxymethylation, such as the hydroxylated form of 5mC (5-hmC).This recently recognized form of epigenetic modification is an important epigenetic marker that affects gene expression and is separate from CpG methylation.Other epigenetic modifications, such as methyl adenosine, appear on RNA and can be detected by the method of the present invention.

[0168] In some embodiments, the method according to the present invention is a method in which epigenetic modification is methylation.In further embodiments, the epigenetic modification is CpG island methylation or CpG island hydroxymethylation.In some embodiments, the epigenetic modification is adenine methylation in either RNA or DNA.

[0169] In some embodiments, one or more oligonucleotides of the invention are rendered resistant to pyrophosphorolysis and / or exonuclease digestion by the presence of one or more quenchers.

[0170] In some embodiments, after the addition of a suitable wash buffer, the resulting reaction mixture is mixed. In some embodiments, the resulting reaction mixture is mixed using a vortex mixer. In some embodiments, the resulting reaction mixture is mixed by the movement of one or more magnetic beads present in the mixture. In some embodiments, each wash step involves using a wash buffer comprising one or more of: Tris-HCl pH 7.5-8.0, 5-20 mM, NaCl 0.4-2 M, EDTA 0.1-1 mM, and / or Tween 20 0-0.1%.

[0171] In some embodiments of any of the methods previously or below described herein, one or more reaction mixtures may be combined.

[0172] In some embodiments, - circularizing A1 through ligation of the 3' and 5' ends to generate A2; or - the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a ligation probe oligonucleotide C, and the ligation that A1 undergoes to form A2 is the ligation of the 3' end of A1 with the 5' end of C.

[0173] In some embodiments, the ligation of A1 is During step (b); During step (c); or Between steps (b) and (c) occurs.

[0174] In some embodiments, oligonucleotide C further comprises a 3' or internal modification that protects it from 3'-5' exonuclease digestion. In some embodiments, oligonucleotide C further comprises a 5' modification that protects it from 5'-3' exonuclease digestion. In some embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a splint oligonucleotide D. In some embodiments, D comprises an oligonucleotide region that is complementary to the 3' end of A1 and a region that is complementary to either the 5' end of oligonucleotide C or the 5' end of A1. In some embodiments, D cannot be extended relative to A1 due to either the 3' modification or a mismatch between the 3' end of D and the corresponding region of A1.

[0175] In some embodiments, the method further comprises a two-step amplification performed between steps (b) and (c). In some embodiments, the reaction volume is divided into two or more separate volumes prior to the second amplification.

[0176] Those skilled in the art will appreciate that there are numerous 3' modifications that can be used to prevent extension.

[0177] In some embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a 5'-3' exonuclease to render the 5' end of A0 resistant to 5'-3' exonuclease digestion. In some embodiments, the product of the previous step is treated with a pyrophosphatase before or during the final step. In some embodiments, the product of the previous step is treated with an exonuclease before or during the final step.

[0178] In some embodiments, detection is achieved using one or more oligonucleotide fluorescent conjugated dyes or molecular probes.

[0179] In some embodiments, the increase in signal over time due to the production of the A2 and / or X1 amplicons is used to infer the concentration of the target sequence in the nucleic acid.

[0180] In some embodiments, a plurality of probes A0 and / or X0 are used, each of which is selective for a different target sequence, and the amplicon of A2 and / or X0 further comprises an identifying region, so that the target sequence present in the nucleic acid is inferred through the detection of the identifying region. In some embodiments, a plurality of probes A0 and / or X0 are used, and a plurality of blocking oligonucleotides are also used. In some embodiments, the detection of the identifying region is carried out using a molecular probe or through sequencing.

[0181] In some embodiments, the final step of the method comprises the steps of: i. labeling the product of the previous step using one or more oligonucleotide fluorescent-conjugated dyes or molecular probes; ii. measuring the fluorescent signal of the product; iii. exposing the product to a set of denaturing conditions; and Identifying a polynucleotide target sequence in the nucleic acid by monitoring a change in the fluorescent signal of the product during exposure to denaturing conditions. Further includes:

[0182] In some embodiments, one or more nucleic acids are divided into multiple reaction volumes, each volume containing one or more probe oligonucleotides A0 and / or X0 introduced to detect a different target sequence. In some embodiments, one or more nucleic acids are divided into multiple reaction volumes, each volume containing one or more probe oligonucleotides A0 and / or X0. In some embodiments, different probes A0 contain a common priming site, allowing a single primer or a single primer set to be used for amplification of a region of A2. In some embodiments, different probes X0 contain a common priming site, allowing a single primer or a single primer set to be used for amplification of a region of X1. In some embodiments, a portion of probe A0 shares a common priming site with a portion of probe X0, allowing a single primer or a single primer set to be used for amplification of both subsets of A2 and X1. In some embodiments, all different probes A0 and X0 share a common priming site.

[0183] In alternative embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced before the detection step, further comprises one or more partially double-stranded DNA constructs, each construct containing one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and one or more quenchers are positioned sufficiently close to each other so that sufficient quenching of the one or more fluorophores occurs. In some embodiments, the construct is one strand of DNA with a self-complementary region that loops back on itself. In some embodiments, the construct comprises one primer of a primer pair. In some embodiments, the fourth reaction mixture further comprises the other primer of the primer pair.

[0184] In some embodiments, a portion of the single-stranded segment of the construct hybridizes to A2 or X1 and is extended by DNA polymerase. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. The primer then extends to the construct, replacing the self-complementary region. In this way, the one or more fluorophores and the one or more dyes are sufficiently separated so that a fluorescent signal indicating the presence of A2 or X1 in the reaction mixture can be detected. In such embodiments, the construct may be known as a sunrise primer. In some embodiments, the construct comprises two separate DNA strands.

[0185] In some embodiments, a portion of the single-stranded segment of the construct hybridizes to A2 or X1 and is extended thereto by DNA polymerase. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. This primer is then extended toward the construct in the direction of the double-stranded segment, displacing the shorter DNA strand, such that the one or more fluorophores and one or more dyes are sufficiently separated so that a fluorescent signal indicating the presence of A2 or X1 in the reaction mixture can be detected. In such embodiments, the construct may be known as a molecular zipper.

[0186] Those skilled in the art will recognize that for both the sunrise primer and the molecular zipper, the fluorophore(s) and quencher(s) pairs can be located at various positions within each respective construct, the important feature being that each pair be located sufficiently close to each other that no fluorescent signal is emitted in the absence of A2 or X1, i.e., when no extension or strand displacement has occurred.

[0187] In some embodiments according to any of the methods previously described or described below, the RNA present in the sample is not transcribed to DNA. In such embodiments, A0 undergoes pyrophosphorolysis of the RNA sequence to form a partially digested strand A1, and the method proceeds as previously described or described below.

[0188] In some embodiments, according to any of the methods described above or below, one or more reaction mixtures may be combined.The present invention further provides a method for detecting a target polynucleotide sequence in a predetermined nucleic acid.Nucleic acids to which various methods of the present invention can be applied can be prepared from the above-mentioned biological sample by a series of preliminary steps designed to amplify the nucleic acid and separate it from background genomic DNA, which is typically present in significant excess.

[0189] In some embodiments, the target polynucleotide sequence in the nucleic acid is a gene or chromosomal region within the DNA or RNA of a cancerous tumor cell, characterized by the presence of one or more mutations, e.g., mutations in the form of one or more single nucleotide polymorphisms (SNPs). Thus, the present invention is useful for monitoring and / or treating disease recurrence. Patients who are declared disease-free after treatment may be monitored over time to detect disease recurrence. This must be done non-invasively, requiring sensitive detection of the target sequence from a blood sample. Similarly, in some cancer patients, residual cancer cells remain in the patient after treatment. Monitoring the levels of these cells (or cell-free DNA) present in the patient's blood using the present invention allows for detection of disease recurrence or failure of current treatment, and the need to switch to an alternative treatment.

[0190] In some embodiments, detection of target polynucleotide sequences allows repeated testing of patient samples during disease treatment, allowing early detection of the development of resistance to treatment.For example, epidermal growth factor receptor (EGFR) inhibitors, such as gefitinib and erlotinib, are commonly used as first-line treatments for non-small cell lung cancer (NSCLC).During treatment, tumors often develop mutations in the EGFR gene (e.g., T790M, C797S) that confer resistance to treatment.Early detection of these mutations allows patients to switch to alternative treatments.

[0191] In some embodiments, the target polynucleotide sequence in the nucleic acid is a gene or chromosomal region within DNA or RNA of fetal origin, characterized by the presence of one or more mutations, e.g., mutations in the form of one or more single nucleotide polymorphisms (SNPs). Thus, the present invention can be used to detect mutations at much lower allele frequencies, at earlier stages of pregnancy than other available testing techniques.

[0192] In another embodiment, the target polynucleotide sequence may be a gene or genomic region derived from an otherwise healthy individual, but the genetic information obtained may help generate valuable companion diagnostic information and enable medical or therapeutic conclusions to be drawn for one or more defined groups within the human population.

[0193] In yet another embodiment, the target polynucleotide sequence may be characteristic of an infectious disease, or the resistance of an infectious disease to treatment with a particular therapy; for example, a polynucleotide sequence that is characteristic of a bacterial or viral gene or chromosomal region, or a mutation therein that confers resistance to a therapy.

[0194] In some embodiments, the target polynucleotide sequence can be characteristic of donor DNA. When a transplanted organ is rejected by a patient, DNA from the organ is shed into the patient's bloodstream. Early detection of this DNA will allow early detection of rejection. This can be achieved by using a custom panel of donor-specific markers or a panel of known common variants in the population, some of which are present in the donor and some of which are present in the recipient. In this way, the claimed method allows for routine monitoring of organ recipients over time.

[0195] The success of organ transplantation may depend on the overall level of cumulative organ damage caused by several events in the donor. This includes the recipient's age, lifestyle, ischemia / reperfusion injury (IRI), and immune response. Studies have shown that IRI induces epigenetic changes in donor organs. The promoter region of the C3 gene becomes demethylated in the kidney, which is associated with chronic nephropathy after transplantation. DNA methylation regulates the function of immune system cells and is therefore a major contributor to a balanced immune response to the graft. Thus, detecting the methylation status of specific DNA sequences can enable the identification of patients at risk for post-transplant complications.

[0196] In yet another embodiment, various versions of the method (see below) using different combinations of probes are used in parallel to allow nucleic acids to be simultaneously screened for multiple target sequences; for example, cancer origin, cancer indicator, or multiple infectious sources. In this approach, the amplification products obtained by applying the method in parallel are contacted with a detection panel comprising one or more oligonucleotide-binding dyes, or sequence-specific molecular probes such as molecular beacons, hairpin probes, or other. Thus, another aspect of the present invention provides for the use of at least one probe and optionally one ligation oligonucleotide in combination with one or more chemical and biological probes selective for target polynucleotide sequences, or the use of sequencing to identify the amplified probe region.

[0197] In some embodiments, the single-stranded probe oligonucleotide A0 comprises a priming region and a 3'-end that is complementary to the target polynucleotide sequence to be detected. This produces a first intermediate product that is at least partially double-stranded. In some embodiments, this step is carried out in the presence of an excess amount of A0 and in an aqueous medium containing nucleic acid and any other nucleic acid molecules.

[0198] During step (b), the double-stranded region of the first intermediate product is pyrophosphorolyzed in the 3'-5' direction from the 3' end of its A0 strand. As a result, the A0 strand is progressively digested to produce a partially digested strand, hereafter referred to as A1. If the probe oligonucleotide mishybridizes to a non-target sequence, the pyrophosphorolysis reaction will terminate at any mismatch, preventing subsequent steps of the method from proceeding. In another embodiment, this digestion continues until A1 lacks sufficient complementarity with the nucleic acid or target region therein to form a stable duplex. At this point, the various strands then separate by melting, thereby producing the single-stranded form of A1. Under typical pyrophosphorolysis conditions, this separation occurs when there are 6-20 complementary nucleotides between the nucleic acid and A0.

[0199] In another embodiment, digestion continues until there is insufficient complementarity with the nucleic acid or target region therein for the pyrophosphorylase enzyme to bind or for the pyrophosphorolysis reaction to continue. This typically occurs when 6-20 complementary nucleotides remain between the nucleic acid and the probe. In some embodiments, this occurs when 6-40 complementary nucleotides remain.

[0200] In another embodiment using a splint oligonucleotide D having complementarity to the 5' and 3' ends of A1 (see below), digestion continues until the length of complementarity between A1 and the target is reduced to a length at which it becomes energetically favorable for oligo D to displace the nucleic acid molecule from A1. This typically occurs when the region of complementarity between A1 and the nucleic acid molecule is similar in length to or shorter than the region of complementarity between oligo D and the 3' end of A1, but can also occur when the complementarity between A1 and the nucleic acid molecule is longer than this due to favoring intramolecular hybridization of oligo D, which may already hybridize to the 5' end of A1.

[0201] In another embodiment where ligation of A1 is performed using a nucleic acid molecule as a splint (see Figure 1), digestion continues until the 5' end of A1 can hybridize to the nucleic acid molecule such that the 3' and 5' ends of A1 are adjacent but separated only by a nick, which is the point at which digestion can no longer proceed, as they are ligated to each other by a ligase.

[0202] Without being bound by theory, in addition to the methods described above or elsewhere, there are several different ways that the pyrophosphorolysis reaction can be terminated. If the pyrophosphorolysis enzyme has a "read-ahead" ability, digestion can terminate 3' of the mismatch or base modification. Such activity has been observed in archaeal DNA polymerases.

[0203] In some embodiments, when a splint is present in the same reaction mixture as A0 and pyrophosphorylase, at some point during digestion of A0 in the 3'-5' direction, it may become thermokinetically favorable to form an A1-splint duplex relative to the A1-target duplex, which then frees the target to anneal to another A0 and repeat the process.

[0204] In some embodiments, the pyrophosphorolysis reaction can be terminated by ligation of A1 to form A2, which either circularizes and does not have a free 3' end to be digested in this way, or binds to another oligonucleotide which may be 3' protected or 3' mismatched and cannot be digested in this way.

[0205] In some embodiments, the pyrophosphorolysis reaction may be arrested by the presence of a backbone modification of A0.

[0206] The modification may be a modified base. The base may be resistant to pyrophosphorolysis. The modification may be a modification of the chemical backbone. In some embodiments, the pyrophosphorolysis reaction may be stopped by the presence of a mismatch at A. The location of this mismatch may be intentionally designed so that digestion stops at this defined point. In some embodiments, the temperature of the reaction mixture may be increased to heat inactivate the pyrophosphoroase. In some embodiments, the temperature is increased to melt and separate the probe-target duplex. In some embodiments, any reagent that may cause the inactivation of the pyrophosphoroase may be added to the reaction mixture. In some embodiments, the pH concentration may be adjusted to inactivate the pyrophosphoroase. In some embodiments, the salt concentration may be adjusted to inactivate the pyrophosphoroase. In some embodiments, the detergent concentration may be adjusted to inactivate the pyrophosphoroase. In some embodiments, the ion concentration may be adjusted to inactivate the pyrophosphoroase.

[0207] Those skilled in the art will recognize that there are multiple additional ways in which enzyme-catalyzed reactions can be stopped, and that the above disclosure is not intended to limit the scope of the present invention.

[0208] Preferably, pyrophosphorolysis is carried out in a reaction medium at a temperature ranging from 20 to 90°C in the presence of at least one polymerase exhibiting pyrophosphorolytic activity and a source of pyrophosphate ions. Further information regarding pyrophosphorolysis as applied to polynucleotide digestion can be found, for example, in J. Biol. Chem. 244 (1969) pp. 3019-3028 or in our earlier patent applications. In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess amount of a source of polypyrophosphate, with preferred sources including those compounds containing three or more phosphorus atoms. In some embodiments, the second reaction mixture contains an excess amount of a source of polypyrophosphate.

[0209] In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess source of modified pyrophosphate. Suitable modified pyrophosphates include pyrophosphates whose atoms or groups are substituted in place of the bridging oxygen, or pyrophosphates (or poly-pyrophosphates) with substitutions or modified groups on other oxygens. Those skilled in the art will appreciate that there are many such examples of modified pyrophosphates suitable for use in the present invention, a non-limiting selection of which is as follows:

[0210] [ka]

[0211] In some embodiments, the second reaction mixture contains an excess of a source of modified polypyrophosphate. In a preferred embodiment, the source of polypyrophosphate ions is PNP, PCP, or tripolyphosphate (PPPi). Further, but not limited to, examples of sources of pyrophosphate ions for use in the pyrophosphorolysis step (c) can be found in WO2014 / 165210 and WO00 / 49180.

[0212] In some embodiments, the source of excess modified pyrophosphate is a compound having the general formula (XO)P(=B)-(ZP(=B)(OX)) n -, where n is an integer from 1 to 4; each Z- is independently selected from -O-, -NH-, or -CH-; each B is independently O or S; and each X group is independently selected from -H, -Na, -K, an alkyl, an alkenyl, or a heterocyclic group, with the proviso that when both Z and B correspond to -O- and n is 1, at least one X group is not H. In some embodiments, Y corresponds to the general formula (XO)P(=B)-(ZP(=B)(OX)). n-, where n is 1, 2, 3, or 4. In another embodiment, the Y group corresponds to the general formula (XO)2P(=O)-ZP(=O)(OH)-, where one of the X groups is -H. In yet another preferred embodiment, Y corresponds to the general formula (XO)2P(=O)-ZP(=O)(OX)-, where at least one of the X groups is selected from methyl, ethyl, allyl, or dimethylallyl. In an alternative embodiment, Y corresponds to either the general formula (HO)2P(=O)-ZP(=O)(OH)-, where Z is either -NH- or -CH2-, or (XO)2P(=O)-ZP(=O)(OX)-, where all X are -Na or -K, and Z is either -NH- or -CH2-. In another embodiment, Y corresponds to the general formula (HO)2P(=B)-OP(=B)(OH)-, where each B group is independently either O or S, with at least one being S. Specific examples of preferred embodiments of Y include those of the formula (X1-O)(HO)P(=O)-ZP(=O)(O-X2), where Z is O, NH, or CH2, and (a) X1 is γ,γ-dimethylallyl and X2 is -H; or (b) X1 and X2 are both methyl; or (c) X1 and X2 are both ethyl; or (d) X1 is methyl and X2 is ethyl, or vice versa.

[0213] In some embodiments, when molecular probes are used for detection, the probe oligonucleotides A0 and / or X0 are configured to include an oligonucleotide identifying region 5' to the region complementary to the target sequence, and the molecular probe used is designed to anneal to this identifying region. In some embodiments, only the 3' region of A0 is capable of annealing to the target; i.e., any other region lacks sufficient complementarity with the nucleic acid to form a stable duplex at the temperature at which the pyrophosphorolysis step is performed. Throughout this specification, the term "sufficient complementarity" means that the region of complementarity is greater than 10 nucleotides in length, such that the given region has complementarity with a given region on the nucleic acid.

[0214] A further aspect of the method of the present invention provides an alternative embodiment in which the phosphorolysis step of any previous embodiment is replaced with an exonuclease digestion step using a double-strand-specific exonuclease. Those skilled in the art will appreciate that double-strand-specific exonucleases include enzymes that read in the 3'-5' direction, such as ExoIII, and enzymes that read in the 5'-3' direction, such as lambda Exo, among many others.

[0215] In some embodiments of the invention in which the exonuclease digestion step utilizes a double-strand-specific 5'-3' exonuclease, it is the 5' end of A0 that is complementary to the target nucleic acid, and the common priming sequence and blocking group are located 3' to the region complementary to the target. In further embodiments in which molecular probes are used for detection, the probe oligonucleotides A0 and / or X0 are configured to include an oligonucleotide identification region 3' to the region complementary to the target sequence, and the molecular probe used is designed to anneal to this identification region.

[0216] In embodiments of the invention in which the exonuclease digestion step utilizes a double-strand-specific 5'-3' exonuclease, an exonuclease with 3'-5' exonuclease activity can optionally be added to the second or combined reaction mixture, or to the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, in order to digest any other nucleic acid molecules present but leave any material comprising A0 and partially digested strand A1 intact. Preferably, this resistance to exonuclease degradation is achieved as described elsewhere in this application.

[0217] In a preferred embodiment of the present invention, the 5' ends of A0 and X0 or an internal site 5' to the priming region are rendered resistant to exonucleolytic degradation. By this means, and after or simultaneously with the pyrophosphorolysis step, an exonuclease with 5'-3' exonuclease activity can optionally be added to the reaction medium to digest any other nucleic acid molecules present, while leaving intact any material containing A0 and X0 and the partially digested strand A1. Preferably, resistance to exonucleolytic degradation is achieved by introducing one or more blocking groups into oligonucleotides A0 and X0 at the required points. In some embodiments, these blocking groups can be selected from phosphorothioate linkages and other backbone modifications commonly used in the art, C3 spacers, phosphate groups, modified bases, etc.

[0218] In some embodiments, the identifying region comprises or is embedded within a barcoded region that has a unique sequence and is indirectly identified using a sequence-specific molecular probe applied to the amplified components A2 and / or X1, or adapted for direct sequencing of these components. Examples of molecular probes that can be used include, but are not limited to, molecular beacons, TaqMan® probes, Scorpion® probes, and others.

[0219] In some embodiments, the A2 strand and / or X1 or a desired region thereof is amplified to generate multiple copies, typically millions of copies. This is achieved by priming the A2 and / or X1 region, and any subsequent amplicons derived therefrom, with a single-stranded primer oligonucleotide, provided in the form of a forward / reverse or sense / antisense pair that can anneal to its complementary region. The primed strand then serves as the starting point for amplification. Amplification methods include, but are not limited to, thermal cycling and isothermal methods, such as polymerase chain reaction, recombinase polymerase amplification, and rolling circle amplification; the latter of these is applicable when A2 is circularized. By any of these means, many amplicon copies of the A2 and / or X1 region, and in some cases, their sequence complements, can be rapidly generated. The exact methodology for carrying out any of these amplification methods is well known to those skilled in the art, and the exact conditions and temperature regimes used are readily available in general literature to guide the reader. Specifically, in the case of polymerase chain reaction (PCR), the methodology generally involves extending a primer oligonucleotide in the 5'-3' direction against the A2 or X1 strand using a polymerase and various sources of single nucleoside triphosphates until a complementary strand is produced; dehybridizing the double-stranded product produced to regenerate the A2 strand and the complementary strand; repriming either the A2 or X1 strand and its amplicon, and then repeating these extension / dehybridization / repriming steps multiple times to increase the concentration of the A2 and / or X1 amplicons to a level where they can be reliably detected.

[0220] In some embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a ligation probe oligonucleotide C, and the partially digested strand A1 is ligated at its 3' end to the 5' end of C, while in other embodiments, A1 is circularized through ligation of its 3' and 5' ends; In each example, oligonucleotide A2 is generated.

[0221] In some embodiments, the ligation of A1 is: During step (b); or During step (c); or Between steps (b) and (c) occurs.

[0222] In some embodiments, A1 is optionally extended in the 5'-3' direction prior to ligation.

[0223] In some embodiments, this optional extension and ligation is performed on the target oligonucleotide, while in other embodiments, they are performed through the addition of an additional splint oligonucleotide, D, to which A1 anneals prior to extension and / or ligation. In some embodiments, D comprises an oligonucleotide region complementary to the 3' end of A1 and a region complementary to either the 5' end of oligonucleotide C or the 5' end of A1. In other embodiments, D cannot be extended relative to A1 due to a modification of the 3' end or a nucleotide mismatch between the 3' end of D and the corresponding region of A1.

[0224] In some embodiments, ligation probe C has a 5' region complementary to at least a portion of the 5'-terminal region of splint oligonucleotide D or the target oligonucleotide. By such means, a second intermediate product is formed, comprising A1, C, and optionally an intermediate region formed by extension of A1 in the 5'-3' direction such that the A2 strand associates with the 5' end of C. In such embodiments, for the primers used in step (d), they are selected to amplify at least the region of A2 that includes the site where ligation of A1 with C occurs. In this embodiment, the inventors have found it advantageous to include a 3'-blocking group on C so that a 3'-5' exonuclease can be used to digest unligated A1 prior to amplification and / or detection.

[0225] In some embodiments, the second or combined reaction mixture, or the third reaction mixture into which the product of the pyrophosphorolysis step is introduced prior to the detection step, further comprises a phosphatase or phosphohydrolase to remove by hydrolysis the nucleoside triphosphates produced by the pyrophosphorolysis reaction, thereby ensuring that the pyrophosphorolysis reaction persists and is not overcome by the forward polymerization reaction.

[0226] In some embodiments, before or during step (c), the product of the previous step is treated with a pyrophosphatase to hydrolyze pyrophosphate ions, preventing further pyrophosphorolysis and favoring forward polymerization. In some embodiments, before or during step (c), the product of the previous step is treated with an exonuclease.

[0227] In some embodiments, the enzyme that performs pyrophosphorolysis of A0 to form the partially digested chain A1 also amplifies A2 and / or X1. Those skilled in the art will recognize that many such enzymes exist. Oligonucleotides A2 and X1 are detected, and the obtained information is used to infer the presence or absence of a polynucleotide target sequence in the original nucleic acid and / or its associated characteristics. For example, this means that the target sequence characteristics of cancerous tumor cells can be detected by referring to the specific SNPs being examined. As a further example, the target cell characteristics of cancerous tumor cells can be detected by referring to the specific methylation sites being examined.

[0228] In another embodiment, target sequence features of viral or bacterial genomes (including novel mutations thereof) may be detected. Many methods can be used to detect the A2 or X1 amplicon or identifying region, including, for example, oligonucleotide-binding dyes, sequence-specific molecular probes, such as fluorescently labeled molecular beacons or hairpin probes. Alternatively, direct sequencing of the A2 or X1 amplicon can be performed using one of the direct sequencing methods used or reported in the art. When using oligonucleotide-binding dyes, fluorescently labeled beacons, or probes, it is convenient to use an arrangement including a stimulating electromagnetic radiation source (laser, LED, light source, etc.) and a photodetector configured to detect the emitted fluorescence to detect the resulting signal, from which a signal comprising a data stream can be generated, which can be analyzed by a microprocessor or computer using a specifically designed algorithm.

[0229] In some embodiments, detection is achieved using one or more oligonucleotide fluorescent dyes or molecular probes. In such embodiments, the increase in signal over time resulting from the generation of A2 or X1 amplicons is used to estimate the concentration of the target sequence in the nucleic acid. In some embodiments, the final step of the method comprises the following steps: i. labeling the product of step (b) using one or more oligonucleotide fluorescent conjugated dyes or molecular probes; ii. measuring the fluorescent signal of the product; iii. exposing the product to a set of denaturing conditions; and Identifying a polynucleotide target sequence in the nucleic acid by monitoring a change in the fluorescent signal of the product during exposure to denaturing conditions. Further includes:

[0230] Another aspect of the present invention provides a method for identifying a target polynucleotide sequence in a given nucleic acid, characterized by the steps of any of the previous embodiments of the present invention, wherein multiple copies of A2 and X1 or regions of A2 or X1 are labeled with one or more oligonucleotide fluorescent-binding dyes or molecular probes. The fluorescent signals of these multiple copies are measured, and the multiple copies are exposed to a set of denaturing conditions. The target polynucleotide sequence is then identified by monitoring changes in the fluorescent signals of the multiple copies during exposure to the denaturing conditions.

[0231] In some embodiments, denaturing conditions can be provided by changing the temperature, for example, by increasing the temperature to the point where the double strands begin to dissociate. Additionally or alternatively, denaturing conditions can also be provided by changing the pH so that the conditions are acidic or alkaline, or by adding an additive or agent such as a strong acid or strong base, concentrated inorganic salt, or organic solvent, such as alcohol.

[0232] Another aspect of the invention provides the use of the above method for screening mammalian subjects, particularly human patients, for the presence of infectious diseases, cancer, or for the purpose of generating companion diagnostic information.

[0233] A further aspect of the present invention provides control probes for use in the above-described methods. This includes embodiments in which the presence of a specific target sequence or sequences is revealed by the generation of a fluorescent signal. In such embodiments, there will inevitably be a level of signal generated from non-target DNA present in the sample. For a given sample, this background signal will develop slower than the "true" signal, but this development may vary between samples. Accurate detection of low concentrations of a target sequence or sequences thus depends on knowing what signal would be expected in its absence. For planned samples, a reference is available, but this is not true for true "blind" samples from patients. A control probe (E0) is utilized to determine the expected background signal profile for each assay probe. The control probe targets a sequence not expected to be present in the sample, and the signal generated from this probe can then be used to estimate the expected signal generation rate from the sample in the absence of the target sequence.

[0234] Thus, there is provided a method for detecting a target polynucleotide sequence in a given nucleic acid according to any of the methods previously described, characterized by the following steps: a. sequentially or simultaneously repeating the steps of the method using either separate aliquots of the sample or the same aliquot, and using a second detection channel, using a second single-stranded probe oligonucleotide E0 having a 3' terminal region that is at least partially mismatched to the target sequence; b. estimating the background signal that would be generated from A0 and X0 in the absence of any target nucleic acid in the sample; and c. Inferring the presence or absence of a polynucleotide target sequence in the nucleic acid by comparing the expected background signal inferred in (a) with the actual signal observed in the presence of the target nucleic acid.

[0235] In some embodiments, control probes (E0), A0, and X0 are added to separate portions of the sample; in other embodiments, E0, A0, and X0 are added to the same portion of the sample and different detection channels (e.g., different color dyes) are used to measure their respective signals. The signal generated by E0 can then be used to estimate and correct for the background signal that would be expected to be generated by A0 and X0 in the absence of the polynucleotide target sequence in the sample. For example, correcting for the background signal can involve subtracting the signal observed from E0 from the signal observed from A0 and X0, or calibrating the signal observed from A0 and X0 using a calibration curve of the relative signals generated by A0, X0, and E0 under various conditions.

[0236] In some embodiments, a single E0 can be used to calibrate all of the assay probes that may be produced.

[0237] In some embodiments, a separate E0 may be used to calibrate each amplicon of sample DNA generated in the initial amplification step. Each amplicon may contain multiple mutations / target sequences of interest, but a single E0 is sufficient to calibrate all of the assay probes to a single amplicon.

[0238] In further embodiments, individual E0 can be used for each target sequence.For example, when targeting C>T mutation, E0 can be designed to target C>G mutation at the same site that is not known to exist in patients.The signal profile generated by E0 under various conditions can be evaluated in calibration reactions, and these data can be used to estimate the expected signal from the assay probe that targets C>T variant when this variant does not exist.

[0239] The specificity of the method of the present invention may be improved by the introduction of a blocking oligonucleotide. For example, a blocking oligonucleotide can be introduced to hybridize with at least a portion of wild-type DNA and promote annealing of A0 and X0 only to the target polyoligonucleotide sequence, but not to the wild-type. Alternatively or additionally, a blocking oligonucleotide can be used to improve the specificity of polymerase chain reaction (PCR) to prevent the amplification of any wild-type sequences present. A common technique used is to design an oligonucleotide that anneals between PCR primers but cannot be displaced or digested by PCR polymerase. The oligonucleotide is designed to anneal to a non-target (usually healthy) sequence but to be mismatched (often by a single base) to the target (mutant) sequence. This mismatch results in a difference in melting temperature for the two sequences, and the oligonucleotide is designed to remain annealed to the non-target sequence but dissociate from the target sequence at the PCR extension temperature.

[0240] Blocking oligonucleotides often may have modifications that prevent their digestion by the exonuclease activity of a PCR polymerase or that enhance the difference in melting temperature between target and non-target sequences.

[0241] Incorporation of locked nucleic acids (LNAs) or other melting temperature-altering modifications into blocking oligonucleotides can significantly increase the difference in melting temperature of the oligonucleotide for target and non-target sequences.

[0242] Thus, embodiments of the invention are provided that utilize blocking oligonucleotides. Blocking oligonucleotides, in some embodiments, must be resistant to pyrophosphorolysis (PPL) reactions to ensure they are not digested or displaced. This can be achieved in a number of different ways, for example, via mismatches at the 3' end or through modifications such as phosphorothioate linkages or spacers.

[0243] In such embodiments or aspects of the invention using a blocking oligonucleotide, a method for detecting a target polynucleotide sequence in a given nucleic acid is characterized by annealing a single-stranded blocking oligonucleotide to at least a subset of non-target polynucleotide sequences before or during the same step, wherein the nucleic acid target sequence anneals to a single-stranded probe oligonucleotide A0 to generate a first intermediate product that is at least partially double-stranded, and wherein the 3' end of A0 forms a double-stranded complex with the nucleic acid target sequence.

[0244] In some embodiments, blocking oligonucleotides are engineered to be resistant to pyrophosphorolysis via a mismatch at their 3' termini. In other embodiments, blocking oligonucleotides are engineered to be resistant via the presence of a 3'-blocking group. In other embodiments, blocking oligonucleotides are engineered to be resistant via the presence of a spacer or other internal modification. In further embodiments, blocking oligonucleotides contain both a modification that increases the melting temperature or a modified nucleotide base, making them resistant to pyrophosphorolysis.

[0245] Reference herein to a "phosphatase enzyme" refers to any enzyme, or functional fragment thereof, capable of hydrolytically removing a nucleoside triphosphate produced by the methods of the invention. This includes any enzyme, or functional fragment thereof, capable of cleaving a phosphate monoester into a phosphate ion and an alcohol.

[0246] As used herein, reference to a "pyrophosphatase enzyme" refers to any enzyme or functional fragment thereof capable of catalyzing the conversion of one ion of pyrophosphate into two phosphate ions.

[0247] This also includes inorganic pyrophosphatase and inorganic diphosphatase. A non-limiting example is thermostable inorganic pyrophosphate (TIPP). In some embodiments, a modification of any of the previously described embodiments is provided, in which the use of pyrophosphatase is optional. Some embodiments of the method of the present invention can be seen in the drawings.

[0248] In Figure 2, a single-stranded probe oligonucleotide A0 anneals to a target polynucleotide sequence to generate a first intermediate product that is at least partially double-stranded and in which the 3' end of A0 forms a double-stranded complex with the target polynucleotide sequence. In this simplified embodiment of the invention, there are two molecules of A0 and one target polynucleotide sequence to illustrate how A0 that is not annealed to the target is not involved in further steps of the method. In this illustrative example, the 3' end of A0 anneals to the target polynucleotide sequence, but the 5' end of A0 does not. The 5' end of A0 includes a 5' chemical blocking group, a common priming sequence, and a barcode region.

[0249] The partially double-stranded first intermediate product undergoes pyrophosphorolysis in the presence of pyrophosphorolytic enzyme in the 3'-5' direction from the 3' end of A0 to generate partially digested strand A1, the nucleic acid, and undigested A0 molecules that did not anneal to the target.

[0250] In Figure 3, A1 anneals to single-stranded trigger oligonucleotide B, and the A1 strand is extended in the 5'-3' direction relative to B to generate oligonucleotide A2. In this illustrative example, trigger oligonucleotide B has a 5' chemical block. Any undigested A0 anneals to trigger oligonucleotide B but is unable to extend in the 5'-3' direction relative to B to generate a sequence that is the target for the second part of the method. In this example, A2 is primed by at least one single-stranded primer oligonucleotide, resulting in the generation of multiple copies of A2 or a region of A2.

[0251] In Figure 4, A1 is annealed to splint oligonucleotide D and then circularized by ligation of its 3' and 5' ends. A2, thus circularized, is primed with at least one single-stranded primer oligonucleotide to generate multiple copies of A2 or a region of A2. In this illustrative example, splint oligonucleotide D cannot be extended relative to A1 due to either a 3' modification (chemical in this illustration) or a nucleotide mismatch between the 3' end of D and the corresponding region of A2.

[0252] 5, the 3' region of splint oligonucleotide D anneals to the 3' region of A1, while the 5' region of splint oligonucleotide D anneals to the 5' region of ligation probe C. Thus, a second intermediate region A2 is formed comprising A1, C, and optionally an intermediate region formed by extension of A1 in the 5'-3' direction to associate with the 5' end of C. In this illustrative example, ligation probe C has a 3' chemical blocking group, allowing for digestion of any unligated A1 using a 3'-5' exonuclease.

[0253] A2 is primed by at least one single-stranded primer oligonucleotide to generate multiple copies of A2 or a region of A2.

[0254] In some embodiments of the present invention, there is provided a kit for use in a method for detecting a target polynucleotide sequence in a predetermined nucleic acid present in a sample, comprising: (a) a single-stranded probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; (b) a single-stranded probe oligonucleotide X0, as previously described or as described below; (c) a ligase already described or described below; (d) a pyrophosphorolytic enzyme capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce the partially digested chain A1; (e) a suitable buffer solution A kit comprising:

[0255] In some embodiments, the kit comprises: (a) A molecular system of A0 prehybridized to C, as described previously or below; (b) a single-stranded probe oligonucleotide X0, as previously described or as described below; (c) a ligase already described or described below; (d) pyrophosphorolytic enzyme; (e) a suitable buffer Includes:

[0256] In some embodiments, the kit includes at least one blocking oligonucleotide as described above or below. In some embodiments, the kit includes at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0. In some embodiments, the kit includes at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of X0. In some embodiments, the kit includes at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0 and at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of X0. In some embodiments, the kit further includes a solid support as described above or below. In some embodiments, the kit further includes a capture oligonucleotide B0 as described above or below. In some embodiments, the kit may further include reagents suitable for cleavage of A0, B0, and / or C0, as described above or below.

[0257] In some embodiments, the kit further comprises an amplification enzyme. In some embodiments, the kit further comprises one or more primers, one or more of which have a non-complementary 5' tail. In some embodiments, one or more of the primers have a 5' phosphate. In some embodiments, one or more of the primers are 5' protected. In some embodiments, the kit comprises two or more ligation chain reaction (LCR) probe oligonucleotides, as described above or below. In some embodiments, the kit may comprise a ligation probe oligonucleotide C, as described above or below. In some embodiments, the kit may comprise a splint oligonucleotide D, as described above or below.

[0258] In some embodiments, the kit may include hairpin oligonucleotides 1 (HO1) and 2 (HO2), as described above or below. In some embodiments, the kit may further include multiple HO1s and HO2s. In some embodiments, the kit may include a substrate comprising oligonucleotide A, oligonucleotide B, and a fluorophore-quencher pair, as described above or below. In some embodiments, the kit may include a partially double-stranded nucleic acid construct, as described above or below. In some embodiments, the kit may further include an enzyme for removal of at least one RNA base. In some embodiments, the enzyme is uracil-DNA glycosylase (UDG), and the RNA base is uracil. In some embodiments, the kit may include an oligonucleotide complementary to the region of A2 or X1 containing the ligation site, comprising one or more fluorophores aligned such that their fluorescence is quenched by proximity to either each other or one or more fluorescence quenchers and a double-strand-specific DNA digestive enzyme. In some embodiments, the double-strand-specific DNA digestive enzyme is an exonuclease. In some embodiments, the double-strand-specific DNA digestive enzyme is a polymerase with proofreading activity.

[0259] In some embodiments, the fluorophore of the kit may be selected from dyes of the fluorescein family, carboxyrhodamine family, cyanine family, rhodamine family, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine family dyes, and chelating lanthanide family dyes. In some embodiments, the fluorophore of the kit may be selected from any commercially available dye. In some embodiments, the quencher of the kit may be selected from quenchers available under the trade names Black Hole™, Eclipse™, Dark, QX1J, and Iowa Black™. In some embodiments, the quencher of the kit may be selected from any commercially available quencher. In some embodiments, the kit may include one or more sunrise primers, as described above or below. In some embodiments, the kit may include one or more molecular zippers, as described above or below.

[0260] In some embodiments, the kit further comprises a source of pyrophosphate ions. Suitable sources of pyrophosphate ions are as described above or below. In some embodiments, the kit further comprises a suitable positive or negative control. In some embodiments, the kit may further comprise one or more control probes (E0) as described above. In some embodiments, the kit may further comprise one or more control probes (E0) and one or more blocking oligonucleotides.

[0261] In some embodiments, the 5' end of A0 may be rendered resistant to 5'-3' exonuclease digestion, and the kit may further comprise a 5'-3' exonuclease. In some embodiments, the kit may further comprise a splint oligonucleotide D. In some embodiments, the kit may include both C and D. In some embodiments, the kit may further comprise dNTPs, a polymerase, and a suitable buffer for initial amplification of target polynucleotide sequences present in a sample. In some embodiments, the kit may further comprise dUTP incorporating a high-fidelity polymerase, dUTP, and uracil-DNA N-glycosylase (UDG). In some embodiments, the kit may further comprise a phosphatase or phosphohydrolase. In some embodiments, the kit may further comprise a pyrophosphatase. The pyrophosphatase may be hot-start. In some embodiments, the kit may further comprise a proteinase. In some embodiments, the kit may further comprise one or more oligonucleotide-binding dyes or molecular probes. In some embodiments, the kit may further include multiple A0s, each selective for a different target sequence and each comprising an identifying region. In some embodiments, the kit may further include an enzyme for the formation of DNA from an RNA template.

[0262] In some embodiments, the enzyme is a reverse transcriptase. In some embodiments, one or more of the kits may be enzyme hot-start. In some embodiments, one or more of the enzymes of the kit may be thermostable. In some embodiments, the kit may further comprise suitable washing and buffering reagents. In some embodiments, the amplification enzyme and the pyrophosphorylation enzyme are the same. In some embodiments, the amplification enzyme and the pyrophosphorylation enzyme are the same.

[0263] The kit may further include a purification device and reagents for isolating and / or purifying a portion of the polynucleotide after the treatment described herein. Suitable reagents are well known in the art and include gel filtration columns and wash buffers. In some embodiments, the kit further includes an epigenetic-sensitive and / or epigenetic-dependent restriction enzyme, as previously described. In some embodiments, the kit further includes a methylation-sensitive and / or methylation-dependent restriction enzyme. In some embodiments, the kit further includes one or more methyl-CpG binding domain (MBD) proteins. In some embodiments, the kit further includes one or more 5-methylcytidine (5-mC) antibodies. In some embodiments, the kit further includes one or more MBD2b proteins and / or one or more MBD2b / MBD3L1 complexes.

[0264] In some embodiments, the kit further comprises reagents suitable for methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA).

[0265] In some embodiments of the present invention, at least a fluid pathway between the first region, the second region, and the third region, The first region comprises one or more wells, each well containing: dNTPs; at least one single-stranded primer oligonucleotide; Amplification enzyme for initial amplification of DNA present in the sample and The second region comprises one or more wells, each well containing a single-stranded probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded: a pyrophosphorolytic enzyme capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce the partially digested chain A1; and The third region comprises one or more wells, each well containing: dNTPs; buffering agents; Amplification enzymes; Means for detecting signals derived from A2 or a portion thereof, or multiple copies of A2, or multiple copies of a portion thereof and a fluid pathway in which the wells of the second region or the wells of the third region further comprise at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0; A device including:

[0266] In some embodiments, a probe X0, or multiple X0s, described herein are present in the same well as any probe A0.

[0267] In some embodiments, a device is provided in which at least one single-stranded primer oligonucleotide suitable for amplification of X1 is present in the same well as any primers for amplification of A2.

[0268] In some embodiments, devices are provided in which the means for detecting the presence of X1 is present in the same well or region of the device as any means for detecting the presence of A2, e.g., embodiments are provided in which a molecular probe specific for X1 is present in the same location on the device as any molecular probe specific for A2.

[0269] In some embodiments, a device is provided in which A0 is present pre-hybridized to C in the form of a molecular system, as previously described or described below. In some embodiments, one or more wells of the first region contain one or more blocking oligonucleotides, as previously described or described below. In some embodiments, one or more wells of the second region contain one or more blocking oligonucleotides, as previously described or described below.

[0270] In some embodiments, the wells in the first region comprise: - dNTPs; - one or more single-stranded primer oligonucleotides; - Amplification enzyme for the initial amplification of DNA present in the sample Including, One or more of the primers has a non-complementary 5' tail.

[0271] In some embodiments, one or more of the primers have a 5' phosphate. In some embodiments, one or more of the primers are 5' protected. In some embodiments, the means for detecting a signal is located in one or more wells of the third region. In some embodiments, the means for detecting a signal is located within the third region of the device. In some embodiments, the means for detecting a signal is located within an adjacent region of the device.

[0272] In some embodiments, the dNTPs in each well of the first region may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise dUTP incorporating a high-fidelity polymerase and uracil-DNA N-glycosylase (UDG). In some embodiments, the dNTPs in each well of the third region may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise dUTP incorporating a high-fidelity polymerase and uracil-DNA N-glycosylase (UDG). In some embodiments, each well of the second region may further comprise a source of pyrophosphate ions. In some embodiments, the 5' end of A0 may be resistant to 5'-3' exonuclease digestion, and the wells of the second region may further comprise a 5'-3' exonuclease. In some embodiments, each well of the second or third region may further comprise a ligase and a ligation probe oligonucleotide C or a splint oligonucleotide D.

[0273] Ligation probe C may contain a 3' or internal modification that protects it from 3'-5' exonuclease digestion. Splint oligonucleotide D may contain an oligonucleotide region complementary to the 3' end of A1 and a region complementary to either the 5' end of oligonucleotide C or the 5' end of A1. D may not be able to be extended relative to A1 due to either a 3' modification or a mismatch between the 3' end of D and the corresponding region of A1 or C.

[0274] In some embodiments, the dNTP may be a hot start, and each well of the second region may further comprise a phosphatase or a phosphohydrolase. In some embodiments, each well of the second region may further comprise a pyrophosphatase. In some embodiments, the pyrophosphatase may be a hot start.

[0275] In some embodiments, each well in the third region may further comprise one or more oligonucleotide-binding dyes or molecular probes. In some embodiments, each well in the second region may comprise at least one or more different A0s selective for the target sequence comprising the identification region.

[0276] In some embodiments, the amplification enzyme and the pyrophosphorolytic enzyme in the second region can be the same. In some embodiments, there can be a fourth region containing one or more wells, each of which can contain a proteinase, and the fourth region can be located between the first and second regions.

[0277] In some embodiments, the wells in the second region comprise: dNTPs; buffering agents; Amplification enzymes; and Means for detecting signals derived from A1 or a portion thereof, or multiple copies of A1, or multiple copies of a portion thereof The second and third regions of the device may be combined to further include:

[0278] The wells in the second region may further contain one or more blocking oligonucleotides as described above or below.

[0279] In some embodiments, the means for detecting a signal is located in one or more wells of the second region. In some embodiments, the means for detecting a signal is located in the second region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device.

[0280] In some embodiments, a fluid pathway between a first region and a second region, wherein the first region comprises one or more wells, and the one or more wells comprise: a single-stranded probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; a pyrophosphorolytic enzyme capable of digesting the first intermediate product in a 3'-5' direction from the end of A0 to produce a partially digested strand A1; and one or more ligases capable of ligating A1 to generate oligonucleotide A2 Includes; a fluid pathway, wherein the second region comprises one or more wells; A device including:

[0281] The wells of the first region may further comprise one or more blocking oligonucleotides as described above or below. In some embodiments, one or more wells of the first region may further comprise a source of ions to drive the pyrophosphorolysis reaction in the forward direction.

[0282] In some embodiments, the ion is a pyrophosphate ion. In some embodiments, the 5' end of A0 is resistant to 5'-3' exonuclease digestion, and the wells of the first region further comprise a 5'-3' exonuclease.

[0283] In some embodiments, the device may further include a third region including one or more wells connected to the first region by a fluid pathway, wherein the one or more wells of the third region: dNTPs; a single-stranded primer oligonucleotide; and Amplification enzyme Includes:

[0284] The wells in the third region may further comprise one or more blocking oligonucleotides, as described above or below. In some embodiments, the dNTPs in the third region may be dUTP, dGTP, dCTP, and dATP; The amplification enzyme may be a high-fidelity polymerase incorporating dUTP; and One or more wells in the third region may further contain uracil-DNA N-glycosylase.

[0285] In some embodiments, the device may further include a fourth region located between the first and third regions and including one or more wells that may contain a proteinase. In some embodiments, one or more wells in the first or second region may further include a ligase and a ligation probe oligonucleotide C that is complementary to a region of A0. In some embodiments, one or more wells in the first or second region may further include a splint oligonucleotide D that is complementary to a region of A0.

[0286] In some embodiments, one or more wells in the first or second region may further comprise a ligase, a splint oligonucleotide D, and a ligation probe oligonucleotide C. In some embodiments, the ligation probe oligonucleotide C may include a 3' or internal modification that protects it from 3'-5' exonuclease digestion.

[0287] In some embodiments, D may further comprise an oligonucleotide region that is complementary to the 3' end of A1 and a region that is complementary to the 5' end of oligonucleotide C or the 5' end of A1. In some embodiments, D may not be able to extend relative to A1 due to either a 3' modification or a mismatch between the 3' end of D and the corresponding region of A1 or C. In some embodiments, one or more wells of the first region may contain at least one or more different A0, each selective for a different target sequence and each comprising an identifying region.

[0288] In some embodiments, the wells in the second region comprise: dNTPs; buffering agents; Amplification enzymes; Means for detecting signals derived from A1 or a portion thereof, or multiple copies of A1 or multiple copies of a portion thereof may include:

[0289] The wells in the second region may further contain one or more blocking oligonucleotides as described above or below.

[0290] Embodiments of the present invention may further include one or more blocking oligonucleotides located in one or more regions containing dNTPs; buffers; amplification enzymes, etc. In some embodiments, the means for detecting a signal is located in one or more wells of the second region. In some embodiments, the means for detecting a signal is located in the second region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device. In some embodiments, one or more wells of the second region may further include one or more oligonucleotide-binding dyes or molecular probes. In some embodiments, the amplification enzyme and pyrophosphorylation enzyme of the device are the same.

[0291] In some embodiments, the wells in the second region comprise: - two or more ligation chain reaction (LCR) probe oligonucleotides, where the 5' phosphate of one LCR probe is complementary to the adjacent sequence on A1 immediately adjacent to the 3' OH of the other LCR probe when the probes are successfully annealed; and - one or more ligases Further includes:

[0292] In some embodiments, the wells in the second region comprise: - ligation probe oligonucleotide C; - Splint Oligonucleotide D may include; C has a 5' phosphate, the 3' end of splint oligonucleotide D is complementary to the 5' end of C, and the 5' end of D is complementary to the 3' end of A1, so that A1 and C can ligate together to form oligonucleotide A2.

[0293] In some embodiments, the wells in the second region comprise: - a hairpin oligonucleotide 1 (HO1) comprising a fluorophore-quencher pair, wherein HO1 is complementary to A2, and when annealed to A2, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates; and - a hairpin oligonucleotide 2 (HO2) comprising a fluorophore-quencher pair, wherein HO2 is complementary to the open HO1, and when annealed to HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates; It may further include:

[0294] In some embodiments, the wells of the second region may further comprise a plurality of HO1 and HO2.

[0295] In some embodiments, the wells in the second region comprise: - oligonucleotide A comprising a substrate arm, a partial catalytic core, and a sensor arm; - an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; and - Substrates containing fluorophore-quencher pairs may further comprise; The sensor arms of oligonucleotides A and B are complementary to the flanking regions of A2 such that in the presence of A2, oligonucleotides A and B combine to form a catalytic multicomponent nucleic acid enzyme (MNAzyme).

[0296] In some embodiments, the wells of the second region may contain a partially double-stranded nucleic acid construct: - one strand comprises at least one RNA base, at least one fluorophore, and a region of this strand is complementary to a region of A2, this strand may be referred to as the "substrate" strand; and the other strand comprises at least one quencher, a region of this strand being complementary to a region of A2 adjacent to the region to which the substrate strand is complementary, such that in the presence of A2 the nucleic acid construct of the partial strand becomes substantially more double-stranded.

[0297] In some embodiments, the wells in the second region may further comprise an enzyme for removal of at least one RNA base, hi some embodiments, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil.

[0298] In some embodiments, one or more wells in the second region comprise: an oligonucleotide complementary to the region of A2 containing the ligation site, comprising one or more fluorophores aligned such that their fluorescence is quenched by proximity either to each other or to one or more fluorescence quenchers; Double-strand specific DNA digestive enzyme may further comprise; In the presence of A2, the labeled oligonucleotide is digested such that the fluorophores are separated from each other or their corresponding quenchers, and the fluorescent signal, and hence the presence of A2, is detectable.

[0299] In some embodiments, the double-strand-specific DNA digestive enzyme is an exonuclease.

[0300] In some embodiments, the double-strand-specific DNA digestive enzyme is a polymerase with proofreading activity.

[0301] In some embodiments, the fluorophore is selected from dyes of the fluorescein family, carboxyrhodamine family, cyanine family, rhodamine family, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine family dyes, and chelating lanthanide family dyes. In some embodiments, the fluorophore of the device may be selected from any of the commercially available dyes.

[0302] In some embodiments, the quencher of the device is selected from quenchers available under the trade names Black Hole™, Eclipse™ Dark, QX1J, Iowa Black™, ZEN and / or TAO.

[0303] In some embodiments, the quencher of the device can be selected from any commercially available quencher.

[0304] In some embodiments, one or more wells in the second region may further comprise one or more partially double-stranded DNA constructs, each construct containing one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located sufficiently close to each other so that sufficient quenching of the one or more fluorophores occurs.

[0305] In some embodiments, the construct is a single strand of DNA with a self-complementary region that loops back on itself. In some embodiments, the construct includes one primer of a primer pair. In some embodiments, one or more wells in the second region may further include the other primer of the primer pair. In some embodiments, a portion of the single-stranded segment of the construct hybridizes to A2 and is extended against it by DNA polymerase. In some embodiments, the other primer of the primer pair hybridizes to the extended construct that represents A2. This primer is then extended against the construct, displacing the self-complementary region. In this way, the one or more fluorophores and the one or more dyes are sufficiently separated to detect a fluorescent signal indicating the presence of A2. In such embodiments, the construct may be known as a sunrise primer. In some embodiments, the construct includes two separate DNA strands.

[0306] In some embodiments, a portion of the single-stranded segment of the construct hybridizes to A2 and is extended by DNA polymerase. In some embodiments, the other primer of the primer pair hybridizes to the extended construct that represents A2. This primer is then extended toward the construct in the direction of the double-stranded segment, displacing the shorter DNA strand, thus separating the one or more fluorophores and the one or more dyes sufficiently for a fluorescent signal to be detected, indicating the presence of A2. In such embodiments, the construct may be known as a molecular zipper.

[0307] Those skilled in the art will recognize that for both the sunrise primer and the molecular zipper, one or more fluorophore and one or more quencher pairs can be present at various positions within each respective construct. The important feature is that each pair is located sufficiently close to each other so that no fluorescent signal is emitted in the absence of A2, i.e., when extension and strand displacement are not occurring. In some embodiments, one or more wells in one or more regions of the device may further comprise pyrophosphatase. In some embodiments, one or more wells in one or more regions of the device may further comprise a phosphatase or a phosphohydrolase. In some embodiments, one or more wells in the first region of the device may further comprise an enzyme for forming DNA from an RNA template. In some embodiments, the enzyme is reverse transcriptase. In some embodiments, one or more enzymes present in the device are hot start enzymes. In some embodiments, one or more enzymes present in the device are thermostable. In some embodiments, the first and second regions of the device are combined.

[0308] In some embodiments of the present invention: - at least a fluid pathway between the first region, the second region and the third region, wherein the first region comprises one or more wells, each well comprising: - dNTPs; - at least one single-stranded primer oligonucleotide; - Amplification enzyme for the initial amplification of DNA present in the sample and The second region comprises one or more wells, each well comprising: - a single-stranded probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; a pyrophosphorolytic enzyme capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce the partially digested chain A1; and The third region comprises one or more wells, each well comprising: - dNTPs; - buffering agents; - optionally an amplification enzyme; - optionally means for detecting signals derived from A2 or a portion thereof, or multiple copies of A2, or multiple copies of a portion thereof and a fluid pathway in which the wells of the second region or the wells of the third region further comprise at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0; A device including:

[0309] In some embodiments, the wells in the second region comprise: - dNTPs; - one or more single-stranded primer oligonucleotides; - Amplification enzyme for the initial amplification of DNA present in the sample Includes; One or more of the primers have a non-complementary 5' tail. In some embodiments, one or more of the primers have a 5' phosphate. In some embodiments, one or more of the primers are 5' protected.

[0310] In some embodiments, pyrophosphatase present in the wells of the second region is transferred to the wells of the third region, where amplification of A2 is carried out in the presence of dNTPs and a suitable buffer. In some embodiments, the means for detecting a signal is located in one or more wells of the third region. In some embodiments, the means for detecting a signal is located in the third region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device.

[0311] In some embodiments, the dNTPs in each well of the first region may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise a high-fidelity polymerase incorporating dUTP and uracil-DNA N-glycosylase (UDG).

[0312] In some embodiments, each well of the second region may further comprise a source of pyrophosphate ions. In some embodiments, the 5' end of A0 may be resistant to 5'-3' exonuclease digestion, and the wells of the second region may further comprise a 5'-3' exonuclease.

[0313] In some embodiments, each well of the second or third region may further comprise a ligase.

[0314] In some embodiments, each well in the second or third region may further comprise a ligase and a ligation probe oligonucleotide C or a splint oligonucleotide D. Ligation probe C may contain a 3' or internal modification that protects it from 3'-5' exonuclease digestion. Splint oligonucleotide D may contain an oligonucleotide region that is complementary to the 3' end of A1 and a region that is complementary to either the 5' end of oligonucleotide C or the 5' end of A1. D may not be able to extend relative to A1 due to either a 3' modification or a mismatch between the 3' end of D and the corresponding region of A1 or C. In some embodiments, the dNTP may be a hot start. In some embodiments, each well in the second region may further comprise a phosphatase or a phosphohydrolase.

[0315] In some embodiments, each well in the second region may further comprise pyrophosphatase. In some embodiments, the pyrophosphatase is a hot start. In some embodiments, each well in the third region may further comprise one or more oligonucleotide-binding dyes or molecular probes. In some embodiments, each well in the second region may contain at least one or more different A0s selective for the target sequence containing the identification region. In some embodiments, the amplification enzyme and pyrophosphatase in the second region may be the same.

[0316] In some embodiments, there may be a fourth region comprising one or more wells, each well may comprise a proteinase, and said fourth region may be located between the first and second regions. In some embodiments, the wells of the second region comprise: - dNTPs; - buffering agents; - Amplifying enzymes; and Means for detecting signals derived from A1 or a portion thereof, or multiple copies of A1, or multiple copies of a portion thereof The second and third regions of the device may be combined to further include:

[0317] In some embodiments, the wells in the second region comprise: - optionally dNTPs; - optionally an amplification enzyme; - buffering agents; and - Labeled oligonucleotide probes The second and third regions of the device may be combined to further include:

[0318] In some embodiments, amplification of A2 is performed in the presence of dNTPs and a suitable buffer using pyrophosphatase present in the wells of the second region. In some embodiments, the means for detecting a signal is located in one or more wells of the second region. In some embodiments, the means for detecting a signal is located in the second region of the device. In some embodiments, the means for detecting a signal is located in an adjacent region of the device. In some embodiments, the first region can be fluidly connected to a sample container via a fluid interface.

[0319] In some embodiments of the present invention, - at least a fluid pathway between the first, second, third and fourth regions, wherein the first region comprises one or more wells, each well comprising a means for selectively modifying nucleic acids; The second region comprises one or more wells, each well comprising: - dNTPs; - at least one single-stranded primer oligonucleotide; - Amplification enzyme for the initial amplification of DNA present in the sample and The third region comprises one or more wells, each well comprising: - a single-stranded probe oligonucleotide A0 capable of forming a first intermediate product with a target polynucleotide sequence, said intermediate product being at least partially double-stranded; a pyrophosphorolytic enzyme capable of digesting the first intermediate product in the 3'-5' direction from the end of A0 to produce the partially digested chain A1; and The fourth region includes one or more wells, each well containing: - dNTPs; - buffering agents; - optionally an amplification enzyme; - means for detecting signals derived from A2 or a portion thereof, or multiple copies of A2, or multiple copies of a portion thereof; and a fluid pathway in which the wells of the third region or the wells of the fourth region further comprise at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of A0; A device including:

[0320] In some embodiments, the means for selectively modifying nucleic acids may be a chemical capable of converting unmodified cytosine bases in a target polynucleotide sequence. In some embodiments, the means for selectively modifying nucleic acids may be an enzyme capable of converting unmodified cytosine bases in a target polynucleotide sequence. In some embodiments, the wells in the second or third region may further comprise a restriction endonuclease.

[0321] In some embodiments, between the first and second regions, there may be a region containing one or more wells, each of which may contain a restriction endonuclease. In some embodiments, the restriction endonuclease may recognize a sequence in a target polynucleotide sequence generated by chemical or enzymatic conversion of unmodified cytosine bases. In some embodiments, the sequence in the target polynucleotide sequence that the restriction endonuclease can recognize is removed by chemical or enzymatic conversion of unmodified cytosine bases. In some embodiments, the restriction endonuclease may be a methylation-sensitive or methylation-dependent restriction endonuclease. In some embodiments, the wells in the second region may contain reagents for modification-specific multiplex ligation-dependent probe amplification (MS-MLPA) of epigenetically modified DNA.

[0322] In some embodiments, between the first and second regions there may be a region containing one or more wells, where each well may contain reagents for PCR.

[0323] In some embodiments, between the first and second regions, there may be a region containing one or more wells, each of which may contain a reagent for reducing the population of epigenetically modified or unmodified target sequences. In some embodiments, the reagent for reducing the population of epigenetically modified or unmodified target sequences is a reagent for immunoprecipitation of epigenetically modified DNA, optionally methylated DNA immunoprecipitation (MeDIP). In some embodiments, the reagent for reducing the population of epigenetically modified or unmodified target sequences is a methyl-binding protein, such as MBD2b or the MBD2b / MBD3L1 complex. In some embodiments, the reagent for reducing the population of epigenetically modified or unmodified target sequences is located in one or more wells of the first region. In some embodiments of the device, the epigenetic modification may be methylation. In some embodiments, this may be methylation at CpG islands. In some embodiments, this may be hydroxymethylation at CpG islands.

[0324] In some embodiments, the wells in the second, third, or fourth regions comprise: - dNTPs; - at least one single-stranded primer oligonucleotide; and - Amplification enzyme may include:

[0325] In some embodiments, the dNTPs in each well may be dUTP, dGTP, dATP, and dCTP, and each well may further comprise a high-fidelity polymerase incorporating dUTP and uracil-DNA N-glycosylase (UDG).

[0326] In some embodiments, each well may further comprise a source of pyrophosphate ions. In some embodiments, the 5' end of A0 may be made resistant to 5'-3' exonuclease digestion, and the wells in the second or third region may further comprise a 5'-3' exonuclease. In some embodiments, each well in the third or fourth region may further comprise a ligase. In some embodiments, each well in the third or fourth region may further comprise a ligase and a ligation probe oligonucleotide C or a splint oligonucleotide D. Ligation probe C may comprise a 3' or internal modification that protects it from 3'-5' exonuclease digestion.

[0327] Splint oligonucleotide D may contain an oligonucleotide region complementary to the 3' end of A1 and a region complementary to either the 5' end of oligonucleotide C or the 5' end of A1. D may not be able to extend relative to A1 due to either a 3' modification or a mismatch between the 3' end of D and the corresponding region of A1 or C. In some embodiments, the dNTP may be a hot start. In some embodiments, each well in the third region may further contain a phosphatase or a phosphohydrolase. In some embodiments, each well in the third region may further contain a pyrophosphatase. In some embodiments, each well in the fourth region may further contain a pyrophosphatase. In some embodiments, the pyrophosphatase is a hot start. In some embodiments, each well in the fourth region may further contain one or more oligonucleotide-linked dyes or molecular probes. In some embodiments, each well in the third region may contain at least one or more different A0s selective for a target sequence containing the identification region. In some embodiments, the amplification enzyme in the fourth region and the pyrophosphorylase in the third region may be the same; thus, in some embodiments, an amplification enzyme in the fourth region is not required. In some embodiments, there may be a fifth region containing one or more wells, each of which may contain a proteinase, and the fifth region may be located between the first and second regions. In some embodiments, the fifth region may be located between the second and third regions.

[0328] In some embodiments, the wells in the third region comprise: - dNTPs; - buffering agents; - Amplifying enzymes; and The third and fourth regions of the device may be combined to further comprise means for detecting a signal derived from A1 or a portion thereof, or multiple copies of A1, or multiple copies of a portion thereof. In some embodiments, the means for detecting a signal is located within the third region. In some embodiments, the means for detecting a signal is located within an adjacent region. In some embodiments, the wells of the third or fourth region comprise: - two or more ligation chain reaction (LCR) probe oligonucleotides, where the 5' phosphate of one LCR probe is complementary to the adjacent sequence on A1 immediately adjacent to the 3' OH of the other LCR probe when the probes are successfully annealed; and - one or more ligases It may further include:

[0329] In some embodiments, the amplification enzyme and the pyrophosphorylation enzyme of the device are the same. In some embodiments, the wells in the third region contain: - ligation probe oligonucleotide C; - Splint Oligonucleotide D may include; C has a 5' phosphate, the 3' end of splint oligonucleotide D is complementary to the 5' end of C, and the 5' end of D is complementary to the 3' end of A1, so that A1 and C can ligate to form oligonucleotide A2.

[0330] In some embodiments, the wells in the third region comprise: - a hairpin oligonucleotide 1 (HO1) comprising a fluorophore-quencher pair, wherein HO1 is complementary to A2, and when annealed to A2, the hairpin structure of HO1 opens and the fluorophore-quencher pair separates; and - a hairpin oligonucleotide 2 (HO2) comprising a fluorophore-quencher pair, wherein HO2 is complementary to the open HO1, and when annealed to HO1, the hairpin structure of HO2 opens and the fluorophore-quencher pair separates; It may further include:

[0331] In some embodiments, the wells of the third region may further comprise a plurality of HO1 and HO2.

[0332] In some embodiments, the wells in the third region comprise: - oligonucleotide A comprising a substrate arm, a partial catalytic core, and a sensor arm; - an oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; and - Substrates containing fluorophore-quencher pairs may further comprise; The sensor arms of oligonucleotides A and B are complementary to the flanking regions of A2 such that in the presence of A2, oligonucleotides A and B combine to form a catalytic multicomponent nucleic acid enzyme (MNAzyme).

[0333] In some embodiments, the wells of the third region may contain a partially double-stranded nucleic acid construct: - one strand comprises at least one RNA base, at least one fluorophore, and a region of this strand is complementary to a region of A2, this strand may be referred to as the "substrate" strand; and The other strand comprises at least one quencher, a region of this strand complementary to a region of A2 adjacent to the region to which the substrate strand is complementary, such that in the presence of A2, the partial strand nucleic acid construct becomes substantially more double-stranded. In some embodiments, the well in the third region may further comprise an enzyme for removal of at least one RNA base. In some embodiments, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil.

[0334] In some embodiments, one or more wells in the third region comprise: an oligonucleotide complementary to a region of A2 containing the ligation site, the oligonucleotide comprising one or more fluorophores positioned such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescence quenchers; Double-strand specific DNA digestive enzyme may further comprise; In the presence of A2, the labeled oligonucleotide is digested so that the fluorophores separate from each other or from their corresponding quenchers, and the fluorescent signal, and therefore the presence of A2, is detectable. In some embodiments, the double-strand-specific DNA digestion enzyme is an exonuclease. In some embodiments, the double-strand-specific DNA digestion enzyme is a polymerase with proofreading activity. In some embodiments, the fluorophore is selected from dyes of the fluorescein family, carboxyrhodamine family, cyanine family, rhodamine family, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine family dyes, and chelating lanthanide family dyes. In some embodiments, the fluorophore of the device can be selected from any commercially available dye. In some embodiments, the quencher of the device is selected from quenchers available under the trade names Black Hole™, Eclipse™ Dark, QX1J, Iowa Black™, ZEN, and / or TAO. In some embodiments, the quencher of the device can be selected from any commercially available quencher. In some embodiments, the wells of the third region can contain one or more partially double-stranded DNA constructs, each construct containing one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located sufficiently close to each other so that sufficient quenching of the one or more fluorophores occurs.

[0335] In some embodiments, the construct is a single strand of DNA with a self-complementary region that loops back onto itself. In some embodiments, the construct contains one primer of a primer pair. In some embodiments, the well in the third region may further contain the other primer of the primer pair. In some embodiments, a portion of the single-stranded segment of the construct hybridizes to A2 and is extended against it by DNA polymerase. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct. This primer then extends against the construct, displacing the self-complementary region. In this way, the one or more fluorophores and the one or more dyes are sufficiently separated so that a fluorescent signal indicating the presence of A2 in the reaction mixture can be detected. In such embodiments, the construct may be known as a sunrise primer.

[0336] In some embodiments, the construct comprises two separate DNA strands.

[0337] In some embodiments, a portion of the single-stranded segment of the construct hybridizes to A2 and is extended thereto by a DNA polymerase. In some embodiments, the other primer of the primer pair hybridizes to the extended construct and displaces A2. This primer then extends the construct in the direction of the double-stranded segment, displacing the shorter DNA strand, such that the one or more fluorophores and one or more dyes are sufficiently separated to allow a fluorescent signal indicating the presence of A2 in the reaction mixture to be detected.

[0338] In such embodiments, the construct may be known as a molecular zipper.

[0339] Those skilled in the art will recognize that for both sunrise primers and molecular zippers, the fluorophore(s) and quencher(s) pairs can be located at various positions within each respective construct, with the key characteristic being that each pair is located sufficiently close to each other that no fluorescent signal is emitted in the absence of A2, i.e., when extension and strand displacement are not occurring.

[0340] In some embodiments, one or more wells in one or more regions of the device may further comprise pyrophosphatase. In some embodiments, one or more wells in one or more regions of the device may further comprise phosphatase or phosphohydrolase. In some embodiments, one or more wells in a second region of the device may further comprise an enzyme for transcribing RNA into DNA. In some embodiments, the enzyme is reverse transcriptase. In some embodiments, one or more enzymes present in the device are hot start. In some embodiments, one or more enzymes present in the device are thermostable. In some embodiments, the second and third regions of the device are combined.

[0341] In some embodiments, the third and fourth regions of the device are combined. In some embodiments, one or more fluid pathways are located between one or more wells in one or more regions of the device and / or between one or more regions of the device. In some embodiments, the first region may be fluidly connected to a sample container via a fluid interface. In some embodiments, heating and / or cooling elements may be present in one or more regions of the device. In some embodiments, heating and / or cooling may be applied to one or more regions of the device. In some embodiments, each region of the device may independently contain at least 100 or 200 wells. In some embodiments, each region of the device may independently contain between about 100 and 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, or more wells. The wells may be of any shape, and their positions may be arranged in any format or pattern on the substrate. In some embodiments, the well substrate can be constructed from metal (e.g., gold, platinum, or nickel alloys, as non-limiting examples), ceramic, glass, or other PCR-compatible polymeric material, or composite material. The well substrate comprises a plurality of wells.

[0342] In some embodiments, the wells may be formed as blind or through holes in the well substrate. Wells may be fabricated in the well substrate by, for example, laser drilling (e.g., excimer laser or solid-state laser), ultrasonic embossing, hot embossing lithography, nickel electroforming, injection molding, and injection compression molding. In some embodiments, the volume of an individual well may range from 0.1 to 1500 nL. In some embodiments, it is 0.5 to 50 nL. Each well contains approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 110, 111, 112, 113, 114, 115, 116, 117 The well may have a volume of 0, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, or 500 nL. In some embodiments, the well dimensions may be any shape, such as circular, elliptical, square, rectangular, oval, hexagonal, octagonal, conical, and other shapes known to those skilled in the art. In some embodiments, the well shape may have a cross-sectional area that varies along an axis. For example, a square hole may taper from a first size to a second size that is a fraction of the first size. In some embodiments, the well dimensions may be square with approximately equal diameter and depth. In some embodiments, the walls defining the well may be non-parallel. In some embodiments, the walls defining the well may converge. The dimensions of the well may be derived from the total volume of the well substrate. In some embodiments, the depth of the well may range from 25 μm to 1000 μm. In some embodiments, the well may have a depth of 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 μm. In some embodiments, the diameter of the well may range from about 25 μm to about 500 μm.In some embodiments, the wells may have a width of 25, 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475 or 500 μm.

[0343] In some embodiments, portions of one or more regions of the device may be modified to promote or block fluid adhesion. Surfaces defining the wells may be coated with (or modified to be hydrophilic) a hydrophilic material and thus promote fluid retention.

[0344] In some embodiments, a portion of one or more regions of the device may be coated with (or modified to be hydrophobic) a hydrophobic material and thus block fluid retention. Those skilled in the art will appreciate that other surface treatments may be implemented so that fluid is preferably retained within the wells but not at the upper surface so that the upper surface promotes drainage of excess liquid.

[0345] In some embodiments, the wells of the well-substrate may be patterned to have a simple geometric pattern of aligned rows and columns, or a diagonally or hexagonally aligned pattern. In some embodiments, the wells of the well-substrate may be patterned to have a complex geometric pattern, such as a chaotic pattern or an isogeometric design pattern. In some embodiments, the wells may be geometrically separated from one another and / or may feature a large depth-to-width ratio to help prevent cross-contamination of reagents.

[0346] In some embodiments, the device may include one or more auxiliary regions that can be used to provide treatment of a fluid, such as oil or other chemical solution, to one or more of the regions of the device. Such auxiliary regions may be fluidly connected to one or more of the regions of the device via one or more membranes, valves, and / or pressure-separable substrates (i.e., materials that break when subjected to a predetermined amount of pressure from fluid in the auxiliary region or an adjacent portion of the fluid pathway), such as metal foils or thin films.

[0347] In some embodiments, the fluid pathway of the device can include extensive tortuous sections. The tortuous flow path between the fluid pathway inlet and one or more regions of the device can be useful for fluid process control and handling. The tortuous flow path can be useful for reducing the formation of gas bubbles that can impede oil flow in the fluid pathway.

[0348] In some embodiments, the device may further include a gas-permeable membrane that allows gas to escape from the wells of one or more regions of the device but does not allow fluid to pass through. The gas-permeable membrane may be attached to the well-substrate of the device by a gas-permeable adhesive. In some embodiments, the membrane may be constructed from polydimethylsiloxane (PDMS), and the membrane may have a thickness in the range of 20 to 1000 μm. In some embodiments, the membrane may have a thickness in the range of 100 to 200 μm.

[0349] In some embodiments, all or part of the well-substrate may contain a conductive metal portion (e.g., gold) to allow heat transfer from the metal to the well. In some embodiments, the interior surface of the well may be coated with a metal to allow heat transfer.

[0350] In some embodiments, after the appropriate reagents have filled the wells of one or more regions of the device, an insulating oil or thermally conductive liquid may be applied to the device to prevent crosstalk. In some embodiments, the wells of one or more regions of the device may be shaped like a vertebra, tapering from a larger diameter to a smaller diameter. Vertebral-shaped wells with sloping walls allow for the use of non-contact deposition methods of reagents (e.g., inkjet). The conical shape has also been found to aid drying and prevent air bubbles and leakage when a gas-permeable membrane is present. In some embodiments, the wells of one or more regions of the device may be filled by advancing a sample fluid (e.g., via pressure) along the fluid path of the device. As the fluid passes over the wells of one or more regions of the device, each well fills with fluid, which is primarily retained within the well via surface tension. As previously described, portions of the well-substrate of the device may be coated with hydrophilic / hydrophobic materials as desired to promote complete and uniform filling of the wells as the sample fluid passes over them.

[0351] In some embodiments, the wells in one or more regions of the device may be "capped" with oil after filling. This, in turn, may help reduce evaporation when the well-substrate is subjected to thermal cycling. In some embodiments, after capping with oil, an aqueous solution may be filled into one or more regions of the device to improve thermal conductivity. In some embodiments, the static aqueous solution may be pressurized within one or more regions of the device to stop the movement of the fluid and any air bubbles. In some embodiments, an oil such as mineral oil may be used to insulate the wells in one or more regions of the device and provide thermal conductivity. However, any thermally conductive liquid, such as a fluorinated liquid (e.g., 3M FC-40), may be used. References to oil in this disclosure should be understood to include such alternatives as those skilled in the art recognize as applicable.

[0352] In some embodiments, the device may further include one or more sensor assemblies.

[0353] In some embodiments, one or more sensor assemblies may include a charge-coupled device (CCD) / complementary metal-oxide semiconductor (CMOS) detector coupled to a fiber optic faceplate (FOFP). A filter may be layered on top of the FOPF, positioned against or adjacent to the well-substrate. In some embodiments, the filter may be layered (bonded) directly on top of the CCD with the FOPF placed on top. In some embodiments, a hydrating fluid, such as distilled water, may be heated in one of the first or auxiliary regions so that one or more regions of the device have up to 100% humidity, or at least sufficient humidity to prevent excessive evaporation during thermal cycling.

[0354] In some embodiments, after the device is filled, the well-substrate can be heated by an external device that is in thermal contact with the device to perform thermal cycling for PCR.In some embodiments, non-contact heating methods can be used, such as RFID, Curie point, induction heating or microwave heating.These and other non-contact heating methods are well known to those skilled in the art.During thermal cycling, the device can be monitored for chemical reactions through the sensor arrangements described above.

[0355] In some embodiments of the present invention, a device is provided that includes at least a fluid pathway between first, second, third, fourth, fifth, and sixth regions, each region including one or more wells. In some embodiments, a sample is introduced into the first region.

[0356] In some embodiments, there is an additional region connected to one or more of the first, second, third, fourth, fifth, or sixth regions by a fluid pathway. In some embodiments, this additional region comprises one or more wells. In some embodiments, the one or more wells comprise a binding buffer. In some embodiments, the one or more wells comprise a wash buffer. In some embodiments, the one or more wells comprise a binding and wash buffer.

[0357] In some embodiments, one or more wells in the first region comprise: - a single-stranded probe oligonucleotide A0 containing a region complementary to the target nucleic acid sequence; - a capture oligonucleotide B0 comprising a capture portion and a region complementary to a region adjacent to the target nucleic acid sequence; and - solid support Including, In some embodiments, A0 may be as previously described.

[0358] In some embodiments, B0 can be as previously described. In some embodiments, the capture moiety is as previously described. In some embodiments, one or more wells in the first region contain reagents necessary to release B0 from the solid support. In some embodiments, the device is configured such that a releasing agent is introduced to one or more regions from one or more separate chambers. In some embodiments, the solid support is as previously described. In some embodiments, the solid support is a surface of one or more wells. In some embodiments, the solid support is a bead. In some embodiments, the solid support is a magnetic bead. In some embodiments, there are multiple solid supports. In some embodiments, the device further comprises one or more magnets. In some embodiments, the one or more magnets are configured to allow one or more magnetic beads to move from one region of the device to another. In some embodiments, one or more wells in the first region contain multiple single-stranded probe oligonucleotides A0, each complementary to a different target nucleic acid sequence. In some embodiments, one or more wells in the first region of the device may further comprise an enzyme for transcription of DNA from an RNA template. In some embodiments, the enzyme is reverse transcriptase. In some embodiments, one or more wells in the second region contain reagents for a pyrophosphorolysis reaction. In some embodiments, one or more wells in the second region contain: - a source of ions to promote the pyrophosphorolysis reaction; - pyrophosphorolytic enzyme; and - Suitable buffer Includes:

[0359] In some embodiments, one or more wells in the second region further comprise an enzyme that catalyzes the hydrolysis of ATP to produce AMP and inorganic phosphate. In some embodiments, the enzyme is apyrase.

[0360] In some embodiments, one or more wells in the third region contain a ligase reagent. - ligase; and - one or more splint oligonucleotides D Includes:

[0361] In some embodiments, one or more splint oligonucleotides D have a region complementary to the 3' end of A1. In some embodiments, one or more splint oligonucleotides have an additional region complementary to the 5' end of A1. In some embodiments, one or more splint oligonucleotides have an additional region complementary to the 5' end of ligation probe C, and one or more wells in the third region further contain ligation probe C. Ligation probe C may contain a 3' or internal modification that protects it from 3'-5' exonuclease digestion. D may not be able to extend relative to A1 due to either a 3' modification or a mismatch between the 3' end of D and the corresponding region of A1 or C. In some embodiments, one or more wells in the fourth region contain an enzyme that terminates pyrophosphorylation. In some embodiments, the enzyme is pyrophosphatase. In some embodiments, one or more wells in the fifth region contain PCR reagents. In some embodiments, one or more wells in the fifth region contain: - dNTPs; and - one or more primers Includes:

[0362] In some embodiments, one or more wells in the fifth region further comprise a DNA amplification enzyme. In some embodiments, the enzyme is a polymerase. In some embodiments, the one or more primers are capable of priming all of the probes present in one or more wells in the first region. In some embodiments, one or more wells in the sixth region comprise a detection reagent. In some embodiments, one or more wells in the sixth region comprise dNTPs and one or more primers. In some embodiments, one or more wells in the sixth region further comprise a DNA amplification enzyme. In some embodiments, the enzyme is a polymerase. In some embodiments, one or more wells in the sixth region comprise one or more oligonucleotide-binding dyes or molecular probes. In some embodiments, one or more wells in the sixth region comprise two or more ligation chain reaction (LCR) probe oligonucleotides and one or more ligases.

[0363] In some embodiments, two or more regions of the sixth region are - ligation probe oligonucleotide C; and - Splint Oligonucleotide D Includes:

[0364] In some embodiments, one or more wells in the sixth region may further comprise a hairpin oligonucleotide 1 (HO1) and a hairpin oligonucleotide 2 (HO2). In some embodiments, one or more wells in the sixth region may further comprise a plurality of HO1 and HO2.

[0365] In some embodiments, one or more regions of the sixth region are: - oligonucleotide A comprising a substrate arm, a partial catalytic core, and a sensor arm; - oligonucleotide B comprising a substrate arm, a partial catalytic core, and a sensor arm; and - Substrates containing fluorophore-quencher pairs Includes; The sensor arms of oligonucleotides A and B are complementary to the flanking regions of A2 such that, in the presence of A2, oligonucleotides A and B combine to form a catalytic multicomponent nucleic acid enzyme (MNAzyme).

[0366] In some embodiments, one or more regions of the sixth region comprise a nucleic acid construct that is partially double-stranded: - one strand comprises at least one RNA base, at least one fluorophore, and a region of this strand is complementary to a region of A2, this strand may be referred to as the "substrate" strand; and the other strand comprises at least one quencher, a region of this strand being complementary to a region of A2 adjacent to the region to which the substrate strand is complementary, such that in the presence of A2 the nucleic acid construct of the partial strand becomes substantially more double-stranded.

[0367] In some embodiments, one or more regions of the sixth region further comprise an enzyme for removal of at least one RNA base, hi some embodiments, the enzyme is uracil-DNA glycosylase (UDG) and the RNA base is uracil.

[0368] In some embodiments, one or more regions of the sixth region are: - an oligonucleotide complementary to a region of A2 that includes the ligation site, the oligonucleotide comprising one or more fluorophores positioned such that their fluorescence is quenched by their proximity either to each other or to one or more fluorescence quenchers; - Double-strand specific DNA digesting enzyme Includes; In the presence of A2, the labeled oligonucleotide is digested so that the fluorophores are separated from each other or their corresponding quenchers, and the fluorescent signal, and therefore the presence of A2, is detectable. In some embodiments, the double-strand-specific DNA digestion enzyme is an exonuclease. In some embodiments, the double-strand-specific DNA digestion enzyme is a polymerase with proofreading activity. In some embodiments, the fluorophore is selected from dyes of the fluorescein family, carboxyrhodamine family, cyanine family, rhodamine family, polyhalofluorescein family dyes, hexachlorofluorescein family dyes, coumarin family dyes, oxazine family dyes, thiazine family dyes, squaraine family dyes, and chelating lanthanide family dyes. In some embodiments, the fluorophore of the device can be selected from any commercially available dye. In some embodiments, the quencher of the device is selected from quenchers commercially available under the trade names Black Hole™, Eclipse™ Dark, QX1J, Iowa Black™, ZEN, and / or TAO. In some embodiments, the quencher of the device can be selected from any commercially available quencher. In some embodiments, one or more regions of the sixth region comprise one or more partially double-stranded DNA constructs, each construct containing one or more fluorophores and one or more quenchers. In some embodiments, when the construct is partially double-stranded, the one or more fluorophores and the one or more quenchers are located close enough to each other so that sufficient quenching of the one or more fluorophores occurs. In some embodiments, the construct is a single strand of DNA with a self-complementary region that loops back on itself.

[0369] In some embodiments, the construct comprises one primer of a primer pair.

[0370] In some embodiments, one or more regions of the sixth region further comprise the other primer of the primer pair.

[0371] In some embodiments, a portion of the single-stranded segment of the construct hybridizes to A2 and is extended by a DNA polymerase. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct representing A2. This primer is then extended along the construct, displacing the self-complementary region. In this manner, the one or more fluorophores and one or more dyes are sufficiently separated to detect a fluorescent signal indicating the presence of A2. In such embodiments, the construct may be known as a sunrise primer. In some embodiments, the construct comprises two separate DNA strands. In some embodiments, a portion of the single-stranded segment of the construct hybridizes to A2 and is extended by a DNA polymerase. In some embodiments, the other primer of the primer pair then hybridizes to the extended construct representing A2. This primer is then extended along the construct in the direction of the double-stranded segment, displacing the shorter DNA strand; in this manner, the one or more fluorophores and one or more dyes are sufficiently separated to detect a fluorescent signal indicating the presence of A2. In such an embodiment, the construct may be known as a molecular zipper. Those skilled in the art will recognize that for both sunrise primers and molecular zippers, one or more fluorophore and one or more quencher pairs can be located at various positions within each respective construct. The important feature is that each pair is located close enough to each other that no fluorescent signal is emitted in the absence of A2, i.e., when no extension or strand displacement occurs.

[0372] In some embodiments, one or more regions of the device are combined. In some embodiments, the second and third regions are combined. In some embodiments, the second and fourth regions are combined. In some embodiments, the third and fourth regions are combined. In some embodiments, the second and sixth regions of the device are combined. In some embodiments, the fourth and fifth regions are combined. In some embodiments, the second, third and fifth regions are combined. In some embodiments, the third, fourth and fifth regions are combined. In some embodiments, the third, fourth, fifth and sixth regions are combined. In some embodiments, the second, third, fifth and sixth regions are combined. In some embodiments, the reagents deposited in one or more of the wells of one or more regions of the device are deposited in a predetermined arrangement.

[0373] In some embodiments, providing a sample fluid to the fluid pathways of the device, the device including at least a fluid pathway between a first region, a second region, and a third region, the first, second, and third regions independently including one or more wells; filling the second region with the amplified fluid from the first region such that one or more wells of the second region are coated with the amplified fluid; draining the amplified fluid from the second region such that the one or more wells remain wetted by at least a portion of the amplified fluid; filling the third region with the fluid discharged from the second region such that one or more wells of the third region are coated with the fluid; and draining the fluid from the third chamber such that one or more wells remain wetted by at least a portion of the fluid. The present invention provides a method comprising:

[0374] In some embodiments of the method, the fluid path may not include a valve.

[0375] In some embodiments of the method, the ejected second region may be filled with a hydrophobic material. In some embodiments of the method, the ejected third region may be filled with a hydrophobic material. In some embodiments of the method, the hydrophobic material may be provided from an oil chamber in fluid communication with the second and third regions. In some embodiments of the method, the sample fluid may be routed along a tortuous fluid path. In some embodiments, the method may further include applying heating and cooling cycles to one or more of the first, second, or third regions. Various additional aspects and embodiments of the present invention will be apparent to those skilled in the art in view of this disclosure.

[0376] "And / or," as used herein, should be construed as a specific disclosure of each of the two specified features or components in the presence or absence of the other. For example, "A and / or B" should be construed as a specific disclosure of each of (i) A, (ii) B, and (iii) A and B, as if each were individually set forth herein.

[0377] Unless otherwise specified in the context, the above feature descriptions and definitions are not limited to any particular aspect or embodiment of the present invention, but apply equally to all aspects and embodiments described.

[0378] While the present invention has been described by way of example with reference to several embodiments, it will be further recognized by those skilled in the art that the invention is not limited to the disclosed embodiments and that alternative embodiments may be constructed without departing from the scope of the present invention as defined in the appended claims.

[0379] As used herein, "magnetic microparticles" are magnetically responsive microparticles that are attracted by a magnetic field. The magnetic microparticles used in the methods of the present invention comprise a magnetic metal oxide core that is generally surrounded by a polymer coating that creates a surface that can bind to DNA, RNA, or PNA. The magnetic metal oxide core is preferably iron oxide, where the iron is Fe 2+and Fe 3+ The preferred Fe 2+ / Fe 3+ The ratio is preferably 2 / 1, but can vary from about 0.5 / 1 to about 4 / 1.

[0380] Those skilled in the art will recognize that when the term "infer" is used, for example, "inferring the presence or absence of a particular sequence" refers to determining the presence or absence of a particular feature based on the presence or absence of A2, or a copy of A2, or a region of A2, or a copy of region A2.

[0381] Those skilled in the art will recognize that embodiments describing a "primer" include within their scope primers that are as previously described in this document or as described below.

[0382] Those skilled in the art will recognize that embodiments in which a "primer" is described as being located in a particular region / well of a device or present in a particular reaction mixture include within their scope embodiments in which one or more blocking oligonucleotides, as described above or below, are also present in the same region / well or reaction mixture.

[0383] Those skilled in the art will recognize that embodiments in which a "single-stranded probe oligonucleotide A0" is described as being located in a particular region / well of a device or present in a particular reaction mixture also include therein one or more blocking oligonucleotides, as described above or below.

[0384] Further applications of the method of the present invention Methylation frequencies of highly relevant methylation genes (HRMG) in human cancers

[0385] [Table 1]

[0386] Lung cancer biomarker methylation Lung cancer is the leading cause of cancer-related mortality for many reasons, including the late onset of symptoms and the low sensitivity of screening techniques such as chest radiography. DNA fragments shed from tumor cells can provide a convenient and minimally invasive access to a cancer's molecular portrait, as these DNA fragments are found in cell-free DNA sequences (cfDNA) isolated from cancer patients' blood. Cell-free circulating tumor DNA (ctDNA) in plasma represents a surrogate for the entire cancer genome; ctDNA accounts for as little as 0.05% or less of total cfDNA in many cancer patients, especially in the early stages of disease. These characteristics make aberrant methylation of ctDNA a promising cancer biomarker, and recent high-throughput studies have demonstrated concordance between altered methylation profiles of ctDNA and DNA from paired tumor tissues. A list of methylation markers for lung cancer diagnosis and prognosis is provided below.

[0387] [Table 2]

[0388] TERT and MGMT promoter methylation and its impact on brain cancer O 6 The -methylguanine-DNA methyltransferase (MGMT) gene encodes an evolutionarily conserved and ubiquitously expressed methyltransferase involved in DNA repair. MGMT is responsible for the O-methylguanine 6MGMT removes alkyl adducts from the MGMT site, preventing DNA damage and providing protection to normal cells. However, the intrinsic function of MGMT also protects tumor cells from the otherwise lethal effects of chemotherapy with alkylating agents, such as temozolomide (TMZ). Silencing or reduction of MGMT expression through methylation of its respective gene promoter has been observed in 50% of grade IV gliomas, impairing DNA repair and consequently increasing chemosensitivity to agents such as TMZ. Therefore, the methylation status of the MGMT promoter has potential as a biomarker of sensitivity to alkylating chemotherapy, ultimately impacting clinical practice. Although its potential as both a predictive and prognostic biomarker has been extensively studied, there is currently no consensus regarding the optimal method for assessing MGMT gene promoter methylation.

[0389] Telomere maintenance protects the integrity of chromosome ends and preserves unlimited replicative immortality, a hallmark of human cancer. The telomere reverse transcriptase (TERT) oncogene encodes the rate-limiting catalytic subunit of the telomerase holoenzyme, which is involved in telomerase maintenance and is normally expressed exclusively in stem cell subsets. The TERT gene is reactivated in approximately 90% of cancer cells, enabling unlimited proliferation and immortalization of these cell types. Multiple genetic and epigenetic mechanisms underlying TERT dysregulation have been identified, and hypermethylation of the TERT promoter region represents a unique hallmark of cancer cells. Interestingly, methylation, but not mutations, in the TERT gene's upstream transcription start site (UTSS) was found to be strongly associated with increased TERT expression and poor prognosis in pediatric brain tumors. Given the prevalence of TERT promoter hypermethylation in a wide range of cancer cell types, this epigenetic modification represents a useful prognostic biomarker.

[0390] Methylation of genes such as methylated / unmethylated prostate cancer genes Prostate cancer is the most commonly diagnosed non-cutaneous malignancy and the leading cause of cancer-related deaths among men in Western countries. Numerous DNA methylation alterations have been observed between benign and cancerous prostate tissues, and the alterations are often early and recurrent, suggesting potential functional roles. Multiple genome-wide studies have reported that several genes and gene families are recurrently hypermethylated in prostate cancer. These include, but are not limited to, GSTP1, MGMT, AR, ER, VHL, RB1, APC, DAPK, CD44, AOX1, APC, CDKN2A, HOXD3, PTGS2, RARB, WT1, ZNF154, C20orf103, EFS, HOXC11, LHX9, RUNX3, TBX15, BARHL2, BDNF, CCDC8, CYP27A1, DLX1, EN2, ESR1, FBLN1, FOXE3, GP5, FRSP, HHEX, HOXA3, HOXD4, HOXD8.IRX1, KIT, LBX1, LHX2, NKX2-1, NKX2-2, NKX2-5, PHOXRA, POU3F3, RHCG, SIX6, TBX3, TMEM106, VAX1, and WNT2.

[0391] Methylation of pancreatic cancer markers Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal cancer types. This type of cancer is difficult to diagnose due to the lack of currently available early diagnostic tests, and diagnosis is usually made only after the disease has already reached an advanced stage (>75% of diagnosed cases present with stage III / IV disease). This has resulted in a high recorded mortality rate. Early diagnosis has proven challenging due to the lack of reliable biomarkers that can capture the early onset and / or progression of PDAC. Currently, the only biomarker approved by the FDA for the prognosis of PDAC patients is carbohydrate antigen 19-9 (CA19-9 or sialyl Lewis antigen). This antigen exhibits low sensitivity and specificity for detecting the disease. Therefore, its use is not recommended for diagnostic purposes unless used in combination with other circulating biomarkers.

[0392] Recent studies have shown that cell-free DNA (cfDNA) methylation analysis represents a promising noninvasive approach for the discovery of biomarkers with diagnostic potential. It may be possible to utilize cfDNA methylation to identify disease-specific signatures in preneoplastic lesions or chronic pancreatitis (CP). Because CP often progresses to PDAC, dynamic DNA methylation patterns for a defined set of genes may underlie disease progression. The pancreatic ductal cell marker CUX2 shows increased signal in PDAC; and the pancreatic ductal and acinar cell marker REG1A shows increased signal in chronic pancreatitis. The biomarkers ADAMTS1 and BNC1 have been found to have high methylation frequencies (25% and 70% for ADAMTS1 and BNC1, respectively) in primary PDAC and preneoplastic pancreatic intraepithelial neoplasia (PIN). The combination of ADAMTS1 and BNC1 with cfDNA methylation may be utilized for the early diagnosis of pancreatic cancer (i.e., stages I and II). A list of potential biomarkers is provided below.

[0393] [Table 3]

[0394] KRAS detection The KRAS gene controls cell proliferation, and when mutated, this negative signaling is disrupted, allowing cells to proliferate sustainedly and often leading to cancer. Single amino acid substitutions, particularly single nucleotide substitutions, are responsible for activating mutations involved in various cancers: lung adenocarcinoma, mucinous adenoma, pancreatic ductal carcinoma, and colorectal cancer. KRAS mutations have been used as prognostic biomarkers, particularly in lung cancer.

[0395] Driver mutations in KRAS are associated with up to 20% of human cancers, and there are targeted treatments in development for this mutation and its associated diseases; a non-limiting list of some such treatments can be found in the table below.

[0396] [Table 4]

[0397] The presence of KRAS mutations has been found to result in a very poor response to the EGFR inhibitors panitumumab (Vectibix) and cetuximab (Erbitux). Activating mutations in the gene encoding KRAS occur in 30% to 50% of colorectal cancers, and studies have shown that patients whose tumors express this mutant form of the KRAS gene do not respond to panitumumab or cetuximab. While the presence of a wild-type KRAS gene does not guarantee a patient will respond to these drugs, studies have shown that cetuximab has significant efficacy in metastatic colorectal cancer patients with wild-type KRAS tumors. Lung cancer patients who are positive for KRAS mutations (wild-type EGFR) have a 5% or lower response rate to the EGFR antagonists erlotinib or gefitinib, compared with a 60% response rate in patients without KRAS mutations.

[0398] Early detection of the emergence of KRAS mutations (activating or overexpressing), which are frequent drivers of acquired resistance to cetuximab therapy (anti-EGFR treatment) in colorectal cancer, allows for modification of treatment (e.g., early initiation of mitogen-activated protein kinase kinase [MEK] inhibitors) to delay or reverse resistance, and thus it is advantageous that the methods of the present invention allow for rapid and inexpensive detection of KRAS status in patients.

[0399] A non-limiting list of mutations are G12D, G12A, G12C, G13D, G12V, G12S, G12R, A59T / E / G, Q61H, Q61K, Q61R / L, K117N and A146P / T / V.

[0400] A further non-limiting list of mutations is shown in the table below.

[0401] [Table 5]

[0402] BRAF detection BRAF is a human gene that encodes a protein called B-Raf, which is involved in delivering intracellular signals involved in directing cell growth. It has been shown to be mutated in some human cancers. B-Raf is a member of the Raf kinase family of growth-signaling protein kinases and plays a role in regulating the MAP kinase / ERKs signaling pathway, which affects cell division, among other things.

[0403] Certain other inherited BRAF mutations cause birth defects.

[0404] More than 30 mutations in the BRAF gene associated with human cancer have been identified. In 90% of cases, there is a substitution of adenine for thymine at nucleotide 1799. This results in a substitution of glutamate (E) for valine (V) at codon 600 (now called V600E) in the activating segment found in human cancers. This mutation is - Colorectal cancer - melanoma - Papillary thyroid cancer - Non-small cell lung cancer - Ameloblastoma It has been widely observed in

[0405] A non-limiting list of other mutations that have been found are R461I, I462S, G463E, G463V, G465A, G465E, G465V, G468A, G468E, N580S, E585K, D593V, F594L, G595R, L596V, T598I, V599D, V599E, V599K, V599R, V600K and A727V.

[0406] Drugs are being developed to treat cancers driven by BRAF mutations: vemurafenib and dabrafenib have been approved by the FDA for the treatment of advanced melanoma. The response rate to treatment with vemurafenib was 53% for metastatic melanoma, compared with 7-12% for the previous best chemotherapy agent, dacarbazine.

[0407] ERBB2 / HER2 detection Human epidermal growth factor receptor 2 (HER2), also known as CD340 (cluster of differentiation 340), proto-oncogene Neu, Erbb2 (rodent), or ERBB2 (human), is a protein encoded by the ERBB2 gene. Amplification or overexpression of this oncogene plays an important role in the progression of aggressive forms of breast cancer. Overexpression of the ERBB2 gene is also known to occur in ovarian, gastric, and lung adenocarcinomas, as well as in aggressive uterine cancers and 30% of salivary gland carcinomas. Structural alterations that cause ligand-independent activation of the receptor in the absence of overexpression have also been identified.

[0408] Multiple targeted treatments are approved and in development for this mutation and its associated diseases, a non-limiting list of some such treatments can be seen in the table below.

[0409] [Table 6]

[0410] HER2 testing is routinely performed in breast cancer patients to assess prognosis, monitor response to treatment, and determine the appropriateness of targeted therapies (such as trastuzumab). Because trastuzumab is expensive and associated with serious side effects (cardiotoxicity), it is important that only HER2+ patients are selected for treatment; thus, it would be advantageous for the methods of the present invention to allow for rapid and inexpensive detection of a patient's HER2 status.

[0411] In some embodiments, the presence or absence of an ERRB2 exon 20 insertion mutation is detected using the methods of the invention.

[0412] A further non-limiting list of ERBB2 mutations is provided in the table below.

[0413] [Table 7]

[0414] Detection of EML4-ALK EML4-ALK is an abnormal gene fusion between the echinoderm microtubule-associated protein-like 4 (EML4) gene and the anaplastic lymphoma kinase (ALK) gene. This gene fusion leads to the production of the protein EML4-ALK, which appears to promote and maintain the malignant behavior of cancer cells. EML4-ALK-positive lung cancers are primary malignant lung tumors whose cells contain this mutation.

[0415] Multiple targeted treatments are approved and in development for this mutation and its associated diseases, a non-limiting list of some such treatments can be seen in the table below.

[0416] [Table 8]

[0417] The EML4-ALK gene fusion accounts for approximately 5% of non-small cell lung cancer (NSCLC), with approximately 9,000 new cases annually in the United States and approximately 45,000 worldwide.

[0418] Multiple variants of EML4-ALK exist, all of which contain the essential coiled-coil domain in the N-terminal portion of EML4 and the kinase domain of ALK exon 20, which is necessary for transforming activity. A fusion of EML4 exon 13 with ALK exon 20 (variant 1: V1) (detection of which can be seen in Figure 20), EML4 exon 20 with ALK exon 20 (V2), and EML4 exon 6 with ALK exon 20 (V3) are some of the more common variants. The clinical significance of these different variants has only recently become clear.

[0419] V3 has emerged as a preferred marker for select populations of patients who tend to show shorter progression-free survival (PFS) after non-tyrosine kinase inhibitor (TKI) treatment, such as chemotherapy and radiotherapy. Further evidence exists that V3 is associated with shorter PFS in those patients who have received first- and second-generation selective therapy, and is associated with worse overall survival (OS) compared with EML4-ALK V1 and V2.

[0420] It has also been found that V3-positive patients develop resistance to first- and second-line treatment through the development of resistance mutations, which is likely due to the incomplete tumor cell suppression caused by the higher IC50 of wild-type V3.Detection of undesirable V3 can be used to select patients who require more aggressive monitoring and treatment strategies.Administering third-generation lorlatinib to patients with V3 appears to confer longer PFS than patients with V1, and thus the method of the present invention is advantageous in that it allows for rapid and inexpensive detection of variants that patients may have.

[0421] The methods of the present invention further allow for the detection of resistance mutations, such as, but not limited to, G1202R, G1269A, E1210K, D1203, S1206C, L1196M, F1174C, I1171T, I1171N / S, V1180L, T1151K and C1156Y.

[0422] For example, G1202R is a solvent-front mutation that causes disruption of drug binding and confers high-level resistance to first- and second-generation ALK inhibitors. Thus, the methods of the present invention advantageously allow for the identification of those patients who carry this mutation and who may benefit from treatment initiation with third-generation treatment over first- or second-generation treatment.

[0423] A further non-limiting list of EML4-ALK mutations is provided in the table below.

[0424] [Table 9]

[0425] EGFR detection The identification of the epidermal growth factor receptor (EGFR) as an oncogene has led to the development of targeted therapies such as gefitinib, erlotinib, afatinib, brigatinib, and icotinib for lung cancer and cetuximab for colon cancer. However, many people develop resistance to these therapies. The two main sources of resistance are the T790M mutation and the MET oncogene.

[0426] EGFR mutations occur in EGFR exons 18 to 21, and mutations in exons 18, 19, and 21 indicate that treatment with EGFR-TKIs (tyrosine kinase inhibitors) is appropriate. Mutations in exon 20 (with the exception of a few mutations) indicate that the tumor is resistant to EGFR-TKIs and is not suitable for treatment with EGFR-TKIs.

[0427] The two most common EGFR mutations are a short in-frame deletion in exon 19 and a point mutation in exon 21 at nucleotide 2573 (CTG to CGG), which results in a substitution of leucine by arginine at codon 858 (L858R). Together, these two mutations represent approximately 90% of all EGFR mutations in non-small cell lung cancer (NSCLC). Screening for these mutations in NSCLC patients can be used to predict which patients will respond to TKIs.

[0428] Thus, the method of the present invention advantageously allows for the identification of those patients who carry these mutations and who may benefit from initiation of treatment with a TKI. Those skilled in the art will recognize that the method of the present invention allows for the identification of a range of EGFR mutations, a non-exhaustive list of such mutations being G719X, EX19Del, S768I, EX20Ins, and L861Q.

[0429] A further non-limiting list of mutations is shown in the table below.

[0430] [Table 10]

[0431] ROS1 ROS1 is a receptor tyrosine kinase (encoded by the gene ROS1) with structural similarity to the anaplastic lymphoma kinase (ALK) protein; it is encoded by the c-ros oncogene.

[0432] A non-limiting list of ROS1 mutations is shown in the table below.

[0433] [Table 11]

[0434] RET proto-oncogene The RET proto-oncogene encodes a receptor tyrosine kinase for members of the glial cell line-derived neurotrophic factor (GDNF) family of extracellular signaling molecules.

[0435] A non-limiting list of RET mutations is shown in the table below.

[0436] [Table 12]

[0437] MET exon 14 MET exon 14 skipping occurs with a frequency of approximately 5% in NSCLC and is observed in both squamous cell carcinoma and adenocarcinoma histology.

[0438] A non-limiting list of MET mutations is shown in the table below.

[0439] [Table 13]

[0440] NTRK proto-oncogene NTRK gene fusions result in abnormal proteins called TRK fusion proteins, which can cause cancer cell growth. NTRK gene fusions can be found in some types of cancer, including brain, head and neck, thyroid, soft tissue, lung, and colon cancers. They are also called neurotrophic tyrosine receptor kinase gene fusions.

[0441] A non-limiting list of NTRK mutations is shown in the table below.

[0442] [Table 14]

[0443] panel In some embodiments of the present invention, a panel is provided that includes a plurality of probe molecules (A0), each A0 being complementary to a target mutation. The mutations can be selected from any of the mutations previously described, described below, or known. Those skilled in the art will recognize that such panels that can be useful in detecting one or more mutations in any of the proto-oncogenes or oncogenes previously described, described below, or known are within the scope of the present invention.

[0444] In some embodiments, the panel includes between 5 and 500 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 400 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 300 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 200 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 100 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 50 individual probe molecules, each complementary to a specific target mutation.

[0445] In some embodiments, there may be multiple probe molecules specific for the same mutation, hi some embodiments, there may be only one probe molecule specific for each mutation in the panel.

[0446] In some embodiments, a panel is provided that includes a plurality of probe molecules, wherein one or more probes are complementary to EGFR mutations, one or more probes are complementary to KRAS mutations, one or more probes are complementary to ERBB2 / HER2 mutations, one or more probes are complementary to EML4-ALK mutations, one or more probes are complementary to ROS1 mutations, one or more probes are complementary to RET mutations, and one or more probes are complementary to MET mutations.

[0447] In some embodiments, a panel is provided that includes a plurality of probe molecules, wherein one or more probes may be complementary to an EGFR mutation, one or more probes may be complementary to a KRAS mutation, one or more probes may be complementary to an ERBB2 / HER2 mutation, one or more probes may be complementary to an EML4-ALK mutation, one or more probes may be complementary to a ROS1 mutation, one or more probes may be complementary to a RET mutation, and one or more probes may be complementary to a MET mutation.

[0448] In some embodiments, a panel of probes selective for one or more EGFR, KRAS, BRAF, ERBB2 / HER2, EML4-ALK, ROS1, RET, MET mutations is provided.

[0449] In some embodiments, a panel of probe molecules selective for EGFR mutations is provided.

[0450] In some embodiments, a panel of probe molecules selective for KRAS mutations is provided.

[0451] In some embodiments, a panel of probe molecules selective for BRAF mutations is provided.

[0452] In some embodiments, a panel of probe molecules selective for ERBB2 / HER2 mutations is provided.

[0453] In some embodiments, a panel of probe molecules selective for EML4-ALK mutations is provided.

[0454] In some embodiments, a panel of probe molecules selective for ROS1 mutations is provided.

[0455] In some embodiments, a panel of probe molecules selective for RET mutations is provided.

[0456] In some embodiments, a panel of probe molecules selective for NTRK mutations is provided.

[0457] In some embodiments, a panel of probe molecules selective for ROS1 mutations is provided.

[0458] In some embodiments, a panel of probe molecules selective for MET exon 14 mutations is provided.

[0459] In some embodiments, a panel is provided that includes a plurality of probe molecules selective for one or more coding sequences (CDS).

[0460] In some embodiments, methods are provided for detecting one or more mutations using one or more of the panels already described.

[0461] In some embodiments, methods are provided for detecting the presence or absence of one or more mutations using one or more of the panels already described.

[0462] In some embodiments, kits are provided that include a panel, which may be as previously described or described below, in combination with one or more reagents, which may be as previously described or described below.

[0463] Those skilled in the art will recognize that kit embodiments disclosing A0 include within their scope embodiments in which there is a panel comprising multiple A0s.

[0464] Those skilled in the art will recognize that the present disclosure further encompasses embodiments of panels that include a capture oligonucleotide B0, including embodiments in which A0 and B0 are regions of the same oligonucleotide C0.

[0465] In some embodiments, a methylation detection panel is provided.

[0466] In some embodiments, a methylation detection kit is provided.

[0467] Companion Diagnostics The method of the present invention can be used to detect specific genetic markers in samples, which can be used to help guide the selection of appropriate treatments. These markers can be tumor-specific mutations or wild-type genomic sequences, and can be detected using tissue, blood, or any other patient sample type. The marker can also be an epigenetic marker.

[0468] Resistance monitoring Repeated testing of patient samples during disease treatment allows for early detection of the development of resistance to therapy. An example of this application is non-small cell lung cancer (NSCLC), in which epidermal growth factor receptor (EGFR) inhibitors (e.g., gefitinib, erlotinib) are commonly used as first-line treatment. During treatment, tumors often develop mutations in the EGFR gene that confer resistance to drugs (e.g., T790M, C797S). Early detection of these mutations can allow patients to switch to alternative treatments (e.g., Tagrisso). Epigenetic changes to the patient's DNA can indicate the development of resistance.

[0469] Typically, patients monitored for the development of resistance are too ill to undergo repeated tissue biopsies. Repeated tissue biopsies are also expensive, invasive, and carry associated risks. Although testing from blood is preferred, the target mutation present in a reasonable blood sample may have a very low copy number. Therefore, monitoring requires sensitive testing from blood samples using the method of the present invention, which is simple to perform and cost-effective, so that it can be performed regularly.

[0470] Recurrence monitoring In the present application, patients who have been declared disease-free after treatment may be monitored over time to detect disease recurrence. This must be done non-invasively and requires sensitive detection of target sequences from blood samples. The method of the present invention provides a simple and low-cost method that can be performed routinely. The targeted sequences can be common mutations known to be common in the disease of interest, or a custom panel of targets designed for a specific patient based on the detection of variants in tumor tissue before remission.

[0471] Minimal Residual Disease (MRD) Monitoring For some cancers, there are residual cancer cells remaining in patients after treatment, which is the main cause of cancer and leukemia recurrence. MRD monitoring and testing has several important roles: determining whether treatment has eradicated the cancer or whether minimal disease remains, comparing the effectiveness of different treatments, monitoring the patient's remission status and detecting leukemia recurrence, and selecting the treatment that best meets those needs.

[0472] screening Screening populations for early detection of disease has been a long-cherished goal, especially in cancer diagnostics. The problem is two-fold: identifying a panel of markers that allows reliable detection of disease without too many false negatives, and developing a method that is sufficiently sensitive and low-cost. Using the methods of the present invention, it will be possible to address larger panels of mutations than PCR-based tests, and at a lower cost with a significantly simpler workflow than sequencing-based diagnostics.

[0473] Organ transplant rejection When a transplanted organ is rejected by a recipient, DNA from the organ is shed into the recipient's bloodstream. Early detection of this DNA would allow early detection of rejection. This could be achieved by using a custom panel of donor-specific markers, or by using a panel of known common variants in the population, some of which are present in the donor and some of which are present in the recipient. The low-cost and simple workflow of the present invention disclosed herein would allow for routine monitoring of organ recipients over time.

[0474] Non-Invasive Prenatal Testing (NIPT) It has been known for a long time that fetal DNA exists in maternal blood, and the NIPT market is now saturated with companies that use sequencing to identify specific chromosomal mutations and count copy numbers, allowing fetal abnormalities to be detected.The method of the present invention disclosed herein has the ability to detect mutations at very low allele frequencies, potentially allowing for earlier detection of fetal DNA.Identifying common mutations in a given population will allow for the development of assays that target mutations that may exist in either maternal or fetal DNA, or will allow for the development of assays that can detect abnormalities early in pregnancy.

[0475] Various further aspects and embodiments of the present invention will be apparent to those skilled in the art from reading the present disclosure.

[0476] "And / or," as used herein, should be construed as a specific disclosure of each of the two specified features or components in the presence or absence of the other. For example, "A and / or B" should be construed as a specific disclosure of each of (i) A, (ii) B, and (iii) A and B, as if each were individually set forth herein.

[0477] Unless otherwise specified in the context, the above feature descriptions and definitions are not limited to any particular aspect or embodiment of the present invention, but apply equally to all aspects and embodiments described.

[0478] While the present invention has been described by way of example with reference to several embodiments, it will be further recognized by those skilled in the art that the invention is not limited to the disclosed embodiments and that alternative embodiments may be constructed without departing from the scope of the present invention as defined in the appended claims.

[0479] Those skilled in the art will understand that reference to "partially digested strand A1" can refer to a single-stranded oligonucleotide that, when hybridized to a target nucleic acid sequence, is formed by progressive digestion of A0 in the 3'-5' direction until the strands dissociate due to lack of complementarity.

[0480] Those skilled in the art will understand that reference to a "partially double-stranded" nucleic acid can refer to a nucleic acid in which one or more portions are double-stranded and one or more portions are single-stranded.

[0481] Those skilled in the art will understand that reference to a "substantially double-stranded" nucleic acid can refer to a nucleic acid in which one or more portions are double-stranded and one or more smaller portions are single-stranded. [Example]

[0482] Pyrophosphorylase, ligation specificity for single-base mismatches A single-stranded first oligonucleotide 1 (SEQ ID NO: 1) was prepared having the following nucleotide sequence: 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGAAGCTCGCAGATATAGGATGTTGCGATAGTCCAGGAGGCTGC-3'

[0483] A single-stranded ligation oligonucleotide 2 (SEQ ID NO:2) was prepared having the following nucleotide sequence: 5'-TGTCAAAGCTCATCGAACATCCTGGACTATGTCTCC-3' where A, C, G, and T represent nucleotides with the associated characteristic nucleobases of DNA, and / 5Phos / represents the 5' terminal phosphate. * represents a phosphorothioate bond.

[0484] A set of single-stranded oligonucleotides 3-4 (SEQ ID NOs: 3-4) having the following nucleotide sequences in the 5'-3' direction: 3:TGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCAGCCTCCTGGACTATG 4:TGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATG A set of single-stranded oligonucleotides 3 and 4 was also prepared, in which oligonucleotide 3 contained a 17-base region complementary to the 17 bases at the 3' end of oligonucleotide 1, and oligonucleotide 4 contained the same region with a single-base mismatch at position 3. SEQ ID NOs: 3 and 4 represent portions of the human EGFR gene with and without the C797S mutation, respectively.

[0485] A first reaction mixture was then prepared having a composition corresponding to that derived from the following recipe: 0.5μL 20x buffer pH7.0 0.25μL 5x buffer pH8.0 0.25μL 5xHF buffer 0.2 μL Oligonucleotide 1, 1000 nM 0.3 μL Oligonucleotide 2, 1000 nM 1 μL oligonucleotide 2 (500 nM) or a mixture of oligos 2 and 3 (500 and 0.5 nM, respectively) 0.3U Klenow fragment exo-(NEB) 0.01 μL inorganic pyrophosphate, 10 mM 0.0132U apyrase (ex. NEB) 1U E. coli DNA ligase (ex. NEB) Make up to 10 μL with water. The 20x buffer contained the following mixture: 200 μL Tris acetate, 1 M, pH 7.0 342.5 μL magnesium acetate solution, 1M 120 μL potassium acetate solution, 5M 50 μL Triton X-100 surfactant (10%) Make up to 1 mL with water. The 5x buffer contained the following mixture: 50 μL Trizma acetate, 1 M, pH 8.0 25 μL magnesium acetate solution, 1M 25 μL potassium acetate solution, 5M 50 μL Triton X-100 surfactant (10%) Make up to 1 mL with water.

[0486] Pyrophosphorolysis followed by circularization by ligation of oligonucleotide 1 was performed by incubating the mixture at 45° C. for 15 minutes, and the resulting product mixture was used in the amplification reaction (Example 2). [Example]

[0487] Amplification of circularized probes A pair of single-stranded oligonucleotide primers 1 (SEQ ID NO: 5) and 2 (SEQ ID NO: 6) having the following nucleotide sequences were prepared. 1:TCGCAACATCCTATATCTGC 2:TGAGCTTTGACAATACTTGA where A, C, G, and T represent nucleotides with the associated characteristic nucleobases of DNA.

[0488] A second reaction mixture was then prepared having a composition corresponding to that derived from the following recipe: 3μL 10x Thermopol buffer 3.2U BST 2.0 WS 0.32 μL Oligonucleotide 1, 10 μM 0.32 μL Oligonucleotide 2, 10 μM 1.125 μL Syto82, 30 μM 0.165U inorganic pyrophosphatase 1.2 μL dNTP mix, 10 mM 1.25 μL reaction mixture of Example 10 Add water to a total volume of 11.25 μL. The 10x Thermopol buffer contained the following mixture: 200 μL Tris-HCl pH=8.8, 1M 100 μL NH4)2SO4, 1M 100 μL mM KCl, 1M 20 mM MgSO4, 1 M 10 μL Triton® X-100, 10% Add water to a total volume of 1 mL.

[0489] The reaction mixture was then incubated at 50°C for 40 minutes, and the resulting reaction products were analyzed by real-time fluorescence. The results are shown in Figure 6. This analysis shows that when both oligonucleotides 3 and 4 were present, the fluorescent signal appeared faster in the reaction, indicating that pyrophosphorolysis and ligation of oligonucleotide 3 occurred in the first reaction mixture. [Example]

[0490] 1. Multicolor detection using Sunrise Primer-targeted oligo dilution The WT oligonucleotide dilution solution consists of the following components: 0.5x A7 buffer 0.5× Phusion U buffer 200 nM WT oligonucleotide (SEQ ID NO: 7) Total volume: 5μL.

[0491] T790M and C797S 1%AF mutant oligo mix: 0.5x A7 buffer 0.5× Phusion U buffer 100 nM WT oligonucleotide (SEQ ID NO: 7) 2 nM T790M oligonucleotide (SEQ ID NO: 8) 2 nM C797S_2389 oligo (SEQ ID NO: 9) Total volume: 5μL.

[0492] WT oligonucleotide (SEQ ID NO: 7): 5'-CATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATAT-3' T790M oligonucleotide (SEQ ID NO: 8): 5'-CATCTGCCTCACCTCCACCGTGCAGCTCATCATGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATAT-3' C797S_2389 oligonucleotide (SEQ ID NO: 9): 5'-CATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCAGCCTCCTGGACTATGTCCGGGAACACAAAGACAATAT-3'

[0493] 1 x A7 composition Tris acetate pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Triton-X 0.01%

[0494] PhusionU buffer The composition of the PhusionU buffer is not published.

[0495] 2.PPL Mixtures corresponding to the following were prepared: 1 x BFF1 37.5U / mL Mako DNA polymerase (3'→5' exo-) 100U / mL E. coli ligase 1.2U / mL apyrase 0.6mM PPi 20nM T790M probe 20nM C797S_2389 probe 30nM T790M splint oligonucleotide 30nM C797S_2389 splint oligonucleotide 5 μL WT or 1% AF mutant dilution point 1 Total volume 10 μL. The mixture was then incubated at 41°C for 30 minutes.

[0496] 1 x BFF1 composition Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Triton-X 0.01%

[0497] T790M probe (SEQ ID NO: 10): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGAGCACGGCAGATATAGGATGTTGCGAAGGGCATGAGCTGCATGATGAGCTG-3' C797S_2389 probe (SEQ ID NO: 11): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGAAGCTCGCAGATATAGGATGTTGCGATAGTCCAGGAGGCTGC-3' During the ceremony, * represents a phosphorothioate bond.

[0498] 3. TIPP Mixtures corresponding to the following were prepared: 1 x A7 66.6U / mL TIPP 10 μL mixture from point 2 Total volume: 20 μL. The mixture was then incubated at 25°C for 5 minutes and at 95°C for 5 minutes.

[0499] 4. Ligation Mixtures corresponding to the following were prepared: 1 x A7 100U / mL E. coli ligase 20 μL mixture from point 3 10nM T790M splint oligonucleotide 10nM C797S_2389 splint oligonucleotide Total volume: 30μL. The mixture was incubated at 37°C for 10 minutes and at 95°C for 10 minutes.

[0500] T790M splint oligonucleotide (SEQ ID NO: 12): 5'-TGTCAAAGCTCATCGAACATGCCCTTCGCAACATCT-3' C797S_2389 splint oligonucleotide (SEQ ID NO: 13): 5'-TGTCAAAGCTCATCGAACATTCCTGGACTATCGCAT-3'

[0501] 5. Exonuclease Treatment Mixtures corresponding to the following were prepared: 1 x A7 100U / mL E. coli ligase 30 μL mixture from point 4. 625U / mL Exonuclease III 62.5U / mL T5 exonuclease Total volume: 40 μL. The mixture was then incubated at 30°C for 5 minutes and at 95°C for 5 minutes.

[0502] 6.RCA Mixtures corresponding to the following were prepared: 1x Thermopol buffer (53.2 mM Tris-HCl, 26.6 mM (NH4)2SO4, 26.6 mM KCl, 5.32 mM MgSO4, 0.266% Triton® X-100, pH 8.8) 0.2 μM Primer Mix 1 0.4 μM reverse primer 533.3U / mL BST LF 0.4mM dNTP 10 μL reaction mixture from point 5 Total volume 15 μL.

[0503] Primer Mix 1: Cy5 primer (SEQ ID NO: 14) 5'- / Qusar670 / ACGCCTGGTTACCGAGCCAGGTTCGCACATGTAGGCTCGGTAACCAGGCG / BHQ2 / ACATCCTATATCTGCCGTGC-3'

[0504] Texas Red primer (SEQ ID NO: 15): 5'- / TexasRed / ACGCCTGGTTACAGGTTCGCACATGTAGTAACCAGGCG / BHQ2 / CAACATCCTATATCTGCGAG-3' In the formula, / BHQ2 / represents a Black Hole quencher.

[0505] Reverse primer (SEQ ID NO: 16): 5'-ATGTTCGATGAGCTTTGACA-3'

[0506] The mixture was then incubated at 60° C. for 90 minutes. Fluorescence measurements were taken every minute. Cq was obtained based on the automatic threshold provided by the Bio-Rad instrument. The results can be seen in FIG. 7. [Example]

[0507] Multicolor detection using molecular zippers 1. Target Oligo Dilution Prepare WT oligo dilution with the following components: 0.5x A7 buffer 0.5x Q5U buffer 100 nM WT oligonucleotide (SEQ ID NO: 17) Total volume: 1.25 μL.

[0508] G719X_6239, G719X_6252, G719X_6253 0.5% AF mutant oligonucleotide mix: 0.5x A7 buffer 0.5x Q5U buffer 100 nM WT oligonucleotide (SEQ ID NO: 17) 0.5 nM G719X_6239 oligonucleotide (SEQ ID NO: 18) 0.5 nM G719X_6252 oligonucleotide (SEQ ID NO: 19) 0.5 nM G719X_6253 oligonucleotide (SEQ ID NO: 20) Total volume: 1.25 μL.

[0509] WT oligonucleotide (SEQ ID NO: 17): 5'-CCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGGGCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCC-3' G719X_6239 oligonucleotide (SEQ ID NO: 18): 5'-CCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGGCCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCC-3' G719X_6252 oligonucleotide (SEQ ID NO: 19): 5'-CCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGAGCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCC-3' G719X_6253 oligonucleotide (SEQ ID NO: 20): 5'-CCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGTGCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCC-3'

[0510] 1 x A7 composition Tris acetate pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Triton-X 0.01%

[0511] Q5U buffer The composition of the Q5U buffer is not disclosed.

[0512] 2. Pyrophosphorolysis (PPL) and Ligation Mixtures corresponding to the following were prepared: 1 x BFF1 10U / mL Klenow (exo-) 100U / mL E. coli ligase 1.2U / mL apyrase 100U / mL Lambda Exo 0.25mM PPi 6.6 nM G719X_6239 probe oligonucleotide (SEQ ID NO: 21) 6.6 nM G719X_6252 probe oligonucleotide (SEQ ID NO: 22) 6.6 nM G719X_6253 probe oligonucleotide (SEQ ID NO: 23) 30 nM splint oligonucleotide (SEQ ID NO: 24) 1.25 μL mixture from point 2 Total volume 10 μL. The mixture was incubated at 45°C for 15 minutes.

[0513] 1 x BFF1 composition Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Triton-X 0.01%

[0514] G719X_6239 probe oligonucleotide (SEQ ID NO: 21): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGAAACGCACCGGAGGCCAGCACTTTG-3' G719X_6252 probe oligonucleotide (SEQ ID NO: 22): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCCGAGTAATGAGAGTTTCGCAAACGCACCGGAGCTCAGCACTTTG-3' G719X_6253 probe oligonucleotide (SEQ ID NO: 23): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGAGCAATTAGGTAGTGTCGTAACGCACCGGAGCACAGCACTTTG-3' Splint oligonucleotide (SEQ ID NO: 24): 5'-TGTCAAAGCTCATCGAACATCCGGTGCGTTCGGCAA-5' During the ceremony * represents a phosphorothioate bond.

[0515] 3. Detect-RCA Mixtures corresponding to the following were prepared: 2.66x Thermopol buffer (53.2 mM Tris-HCl, 26.6 mM (NH4)2SO4, 26.6 mM KCl, 5.32 mM MgSO4, 0.266% Triton® X-100, pH 8.8) 0.28 μM Dye Primer Mix 1 0.56 μM quencher primer 1 0.28 μM quencher primer 2 0.84 μM reverse primer 568.8U / mL BST2.0 warm start 14.67U / mL TIPP 1.06mM dNTP 1.25 μL reaction mixture from point 2 Total volume 11.25 μL.

[0516] Dye Primer Mix 1 consists of: Dye primer 1 (SEQ ID NO: 25): 5'- / 5Cy5 / A*CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATCGCAACATCCTATATCTGC-3' Dye primer 2 (SEQ ID NO: 26): 5'- / 5TEX615 / A*CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATGCGAAACTCTCATTACTCG-3' Dye primer 3 (SEQ ID NO: 27): 5'- / 5HEX615 / T*ACGACCGACTCACTCCTTACAGCAGTCCGCAGTATGCTACGACACTACCTAATTGCTC-3' During the ceremony * represents a phosphorothioate bond, / 5Cy5 / represents a Cy5 dye at the 5' end, / 5TEX615 / represents a TEX dye at the 5' end, and / 5HEX / represents a Hex dye at the 5' end.

[0517] Quencher primer 1 (SEQ ID NO: 28): 5'-TCGATCATGGCGACAGCGATTGTCATGGAGCTGGTCAGT / 3IAbRQSp / -3' / 3IAbRQSp / represents 3' Iowa Black® RQ quencher.

[0518] Quencher primer 2 (SEQ ID NO: 29): 5'-AGCATACTGCGGACTGCTGTAAGGAGTGAGTCGGTCGTA / 3IABkFQ / -3' / 3IAbkFQ / represents 3' Iowa Black® FQ quencher.

[0519] Reverse primer (SEQ ID NO: 30): 5'-T*G*AGCTTTGACAATACTTGA-3' During the ceremony * represents a phosphorothioate bond.

[0520] The mixture was then incubated for 150 minutes at 58° C. Fluorescence measurements were taken every minute, and the results can be seen in FIG. [Example]

[0521] Pyrophosphorolysis and ligation to target 1. Preparation of Oligonucleotide Dilutions Dilutions of oligonucleotides were prepared in 0.5x A7 and 0.5x Q5 buffers: WT oligonucleotide 200 nM + / - mutant oligonucleotide 500 pM Total volume 1.25 μL.

[0522] WT oligonucleotide (SEQ ID NO: 31): 5'-CTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGG-3' Mutant oligonucleotide (SEQ ID NO: 32): 5'-CTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCATGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGG-3'

[0523] 2. Pyrophosphorolysis and Ligation A PPL mixture was prepared consisting of: 1 x BFF1 10U / mL Klenow (exo-) 100U / mL E. coli ligase 1.2U / mL apyrase 100U / mL Lambda Exo 0.25mM PPi 20nM Probe A0 1.25 μL oligo from point 1 Total volume 10 μL.

[0524] Probe A0 (SEQ ID NO: 33): 5'- / 5Phos / A*G*C*TGCATCTGAGCTTTGACAATACTTGAGCACGGCAGATATAGGATGTTGCGAAGGGCATGAGCTGCATGATG-3' During the ceremony, * phosphorothioate bond

[0525] 1 x BFF1 composition Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Triton-X 0.01%

[0526] 1 x A7 composition Tris acetate pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Triton-X 0.01%

[0527] Q5 buffer The composition of the Q5 buffer is not disclosed.

[0528] The resulting mixture was incubated at 45°C for 15 minutes.

[0529] 3. Detect-RCA An RCA mixture was prepared consisting of: 2.66x Thermopol buffer (53.2mM Tris-HCl, 26.6mM (NH4)2SO4, 26.6mM KCl, 5.32mM MgSO4, 0.266% Triton-X, pH8.8) 0.28μM primer mix 284.4U / mL BST2.0 warm start 14.67U / mL TIPP 1.06mM dNTP Syto82 dye 3μM 1.25 μL reaction from point 2 Total volume 11.25 μL.

[0530] Primer Mix: Forward (SEQ ID NO: 34): 5'-T*C*GCAACATCCTATATCTGC-3' Reverse (SEQ ID NO: 35): 5'-ATGTTGCGAAGGGCATATGT-3'

[0531] The resulting mixture was incubated for 70 minutes at 50° C. Fluorescence readings were taken every minute, and the results can be seen in FIG. [Example]

[0532] Conversion-based methylation detection 1. Oligonucleotide Dilution The methylation mix was made by diluting the following oligonucleotide mixture (Mix 1) in HO: SEQ ID NO: 34 10 μM SEQ ID NO: 35 10 μM Total volume 500μL. An unmethylated mix was made by diluting the following oligonucleotide mixture (Mix 2) in HO: SEQ ID NO: 35 10 μM SEQ ID NO: 36 10 μM Total volume 500μL.

[0533] Methylated oligonucleotide (SEQ ID NO: 36): 5'-CCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGAT / iMe-dC / AAAGTG / iMe-dC / TGG / iMe-dC / / iMe-dC / T / iMe-dC / / iMe-dC / GGTG / iMe-dC / GTT / iMe-dC / GG / iMe-dC / ACGGTGTATAAGGTAAGGTCCC-3'

[0534] Reverse complementary unmethylated nucleotide (SEQ ID NO: 37): 5'-ACCTTACCTTATACACCGTGCCGAACGCACCGGAGGCCAGCACTTTGATCTTTTTGAATTCAGTTTCCTT-3' where / iMe-dC / is 5-methyldeoxycytidine.

[0535] Unmethylated nucleotide (SEQ ID NO: 38): 5'-CCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGGCCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCC-3'

[0536] For both mixes, the concentration of oligonucleotides was measured using a Qubit™ 4 fluorometer (ThermoFisher catalog number Q33238) and a Qubit™ dsDNA HS Assay Kit (ThermoFisher catalog number Q32851) according to the manufacturer's protocol.

[0537] Chain transformation For strand conversion, two commercially available kits were used: EpiMark Bisulfite Conversion Kit (New England Biolabs catalog number E3318S) Methyl-Seq Conversion Module (New England Biolabs catalog number E7125L) The converted DNA was prepared according to the manufacturer's protocol.

[0538] Methylated and unmethylated strands were mixed together to create mixtures containing different possible methylated vs. unmethylated strands (1.56% to 100%).

[0539] 2. Pyrophosphorolysis (PPL) and Ligation PPL mixtures corresponding to the following were prepared: 1 x BFF1 10U / mL Klenow (exo-) 100U / mL E. coli ligase 0.25mM PPi 20 nM probe oligonucleotide 30nM splint oligonucleotide 1.25 μL DNA mix from point 2 Total volume 10 μL.

[0540] The mixture was then incubated at 45°C for 15 minutes.

[0541] 1 x BFF1 composition Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Triton-X 0.01%

[0542] Probe oligonucleotide (SEQ ID NO: 39): 5'- / 5Phos / A*T*G*TTCGATGAGCTTTGACAATACTTGACATGCGCAGATATAGGATGTTGCGAAACGCACCGGAGGCCAGCACTTTG-3' During the ceremony * represents a phosphorothioate bond.

[0543] Splint oligonucleotide (SEQ ID NO: 40): 5'-TGTCAAAGCTCATCGAACATCCGGTGCGTTCGGCAA-3'

[0544] 3. Detect-RCA Mixtures corresponding to the following were prepared: 2.66x Isothermal buffer (53.2mM Tris-HCl, 26.6mM (NH4)2SO4, 133mM KCl, 5.32mM MgSO4, 0.266% Tween20, pH8.8) 0.28 μM Primer Mix 1 284.4U / mL BST 2.0 Warm Start 14.67U / mL TIPP 1.06mM dNTP Syto82 dye 3μM 1.25 μL reaction mixture from point 2 Total volume 11.25 μL.

[0545] Primer Mix 1: Forward (SEQ ID NO: 41): 5'-T*C*GCAACATCCTATATCTGC-3' Reverse (SEQ ID NO: 42): 5'-T*G*AGCTTTGACAATACTTGA-3' During the ceremony * represents a phosphorothioate bond.

[0546] The mixture was then incubated for 90 minutes at 62° C. Fluorescence measurements were taken every minute, and the results can be seen in FIG. [Example]

[0547] Restriction enzyme-based methylation detection 1. Preparation of Target Oligonucleotide Solution The oligo solution was prepared as follows: 1x BFF1 buffer 200nM unmethylated oligonucleotide 0-20nM methylated oligonucleotide (0-10% AF) Total volume 10 μL.

[0548] 1 x BFF1 composition Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM Triton-X 0.01%

[0549] Unmethylated oligonucleotide (SEQ ID NO: 43): 5'-CTCAGCGTACCCTTGTCCCAGGAAGCATACGTGATGGCATACGTGATGGCTGGTGTGGGCTCCCCATATGTCTCCCGCCTTCTGGGCAT-3'

[0550] Methylated oligonucleotide (SEQ ID NO: 44): 5'-CTCAGCGTACCCTTGTCCC / iMe-dC / AGGAAGCATACGTGATGGCATACGTGATGGCTGGTGTGGGCTCCCCATATGTCTCCCGCCTTCTGGGCAT-3' where / iMe-dC / is 5-methyldeoxycytidine.

[0551] 2. Pyrophosphorolysis (PPL) and Ligation PPL mixtures corresponding to the following were prepared: 1 x BFF1 10U / mL Klenow (exo-) 100U / mL E. coli ligase 0.25mM PPi 25nM probe oligonucleotide 30nM splint oligonucleotide 166.6 U / mL MspJI or LpnPI 1.25 μL DNA mix from point 2 Total volume 10 μL. The mixture was then incubated at 37°C for 45 minutes.

[0552] Probe oligonucleotide (SEQ ID NO: 45): 5'- / 5Phos / A*TGTTCGATGAGCTTTGACAATACTTGATCGATGCAGATATAGGATGTTGCGACCATCACGTATGCCATCACGTATGCTTCCTGGGGACATTT / 3SpC3 / -3' During the ceremony * represents a phosphorothioate bond, and / 3SpC3 / represents a C3 spacer.

[0553] Splint oligonucleotide (SEQ ID NO: 46): 5'-TGTCAAAGCTCAGCTATCTGACGTGATTCGCAACAA-3'

[0554] 3. Detect-RCA Mixtures corresponding to the following were prepared: 2.66x Isothermal buffer (53.2mM Tris-HCl, 26.6mM (NH4)2SO4, 133mM KCl, 5.32mM MgSO4, 0.266% Tween20, pH8.8) 0.28 μM Primer Mix 1 284.4U / mL BST2.0 warm start 14.67U / mL TIPP 1.06mM dNTP Syto82 dye 3μM 1.25 μL reaction mixture from point 2 Total volume 11.25 μL.

[0555] Primer Mix 1: Forward (SEQ ID NO: 41): 5'-T*C*GCAACATCCTATATCTGC-3' Reverse (SEQ ID NO: 42): 5'-T*G*AGCTTTGACAATACTTGA-3' During the ceremony * represents a phosphorothioate bond.

[0556] The mixture was then incubated for 60 minutes at 62° C. Fluorescence measurements were taken every minute, and the results can be seen in FIG. [Example]

[0557] Target sequence as a splint 1. PCR Amplification Mixtures corresponding to the following were prepared: 1x Q5U buffer 200nM Primer Mix 2 20U / mL Q5U polymerase 10U / mL thermolabile UDG 0.4ng / μL fragmented human genomic DNA + / - 0.4aM mutant oligonucleotide Total volume 50 μL. The mixture was then incubated: 37℃ 1 minute 55℃ 10 minutes 98℃ 1 minute (98℃ 10 seconds 63℃ 15 seconds 72℃ 15 seconds) x 50 72℃ 5 minutes 4℃∞

[0558] Q5 buffer The composition of the Q5 buffer is not disclosed.

[0559] Primer Mix 2: Forward 1 (SEQ ID NO: 47): 5'- / 5Phos / CCCAACCAAGCTCTCTTGAGGATCTTG-3' Reverse 1 (SEQ ID NO: 48): 5'-G*G*G*ACCTTACCTTATACACCGTGCCG-3' Forward 2 (SEQ ID NO: 49): 5'-G*C*C*TCCCTCGCGCCATCAGAAGGTGAGAAAGTTAAAATTCCCGTC-3' Reverse 2 (SEQ ID NO: 50): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGACAGCAAAGCAGAAACTCACATCG-3' Forward 3 (SEQ ID NO: 51): 5'-G*C*C*TCCCTCGCGCCATCAGTGCCTCACCTCCACCGTGCA-3' Reverse 3 (SEQ ID NO: 52): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGATTGTCTTTGTGTTCCCGGACAT-3' Forward 4 (SEQ ID NO: 53): 5'-G*A*A*GCCACACTGACGTGCCTCTC-3' Reverse 4 (SEQ ID NO: 54): 5'- / 5Phos / AGGCAGATGCCCAGCAGGCGGCA-3' Forward 5 (SEQ ID NO: 55): 5'-C*G*T*ACTGGTGAAAACACCGCAG-3' Reverse 5 (SEQ ID NO: 56): 5'- / 5Phos / CCTTCTGCATGGTATTCTTTCTCTTCC-3' Forward 6 (SEQ ID NO: 57): 5'- / 5Phos / GCTGAAAATGACTGAATATAAACTTGTGGTAGTTG-3' Reverse 6 (SEQ ID NO: 58): 5'-T*G*A*TTCTGAATTAGCTGTATCGTCAA-3' Forward 7 (SEQ ID NO: 59): 5'-C*T*G*GTCCCTCATTGCACTGTACTCC-3' Reverse 7 (SEQ ID NO: 60): 5'- / 5Phos / AGAAACCTGTCTCTTGGATATTCTCGACAC-3' Forward 8 (SEQ ID NO: 61): 5'- / 5Phos / GCCTCCCTCGCGCCATCAGAAAATGGATCCAGACAACTGTTCAAACTGATG-3' Reverse 8 (SEQ ID NO: 62): 5'-G*C*C*TTGCCAGCCCGCTCAGTTCATGAAGACCTCACAGTAAAAATAGGTGATT-3' Forward 9 (SEQ ID NO: 63): 5'-G*C*C*CCCAGCCCTCTGAC-3' Reverse 9 (SEQ ID NO: 64): 5'- / 5Phos / GCCGTCGCTTGATGAGGATCCC-3' Forward 10 (SEQ ID NO: 65): 5'-T*T*G*TCCCCAGGAAGCATACGTG-3' Reverse 10 (SEQ ID NO: 66): 5'- / 5Phos / ATGCCCAGAAGGCGGGAGACAT-3' Mutant oligonucleotide (SEQ ID NO: 67): 5'-GGCCACCATGCGAAGCCACACTGACGTGCCTCTCCCTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACC-3' During the ceremony * represents a phosphorothioate bond, and / 5Phos / represents a 5' terminal phosphate.

[0560] 2. Proteinase K Treatment Mixtures corresponding to the following were prepared: 0.44x Proteinase K Buffer 20U / mL proteinase K 40 μL of the mixture from point a Total volume: 90 μL. The mixture was then incubated at 55°C for 5 minutes and at 95°C for 10 minutes.

[0561] Composition of 1x Proteinase K Buffer Tris acetate pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Tween-20 0.1%

[0562] 3. Pyrophosphorolysis (PPL) and Ligation Mixtures corresponding to the following were prepared: 1 x BFF10 20U / mL Klenow (exo-) 100U / mL E. coli ligase 2U / mL apyrase 100U / mL Lambda Exo 0.5mM PPi 20 nM probe oligonucleotide 2.2 μL mixture from point b Total volume 10μL. The mixture was then incubated at 45°C for 30 minutes.

[0563] 1 x BFF10 composition Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 13.5mM Tween-20 0.01%

[0564] Probe (SEQ ID NO: 68): 5'- / 5Phos / T*GGTGGGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCGCAGGCGGCACAC*GTGGTG-3' Probe (SEQ ID NO: 69): 5'- / 5Phos / G*TGGTGGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCGCAGGCGGCACA*CGTGGTG-3' Probe (SEQ ID NO: 70): 5'- / 5Phos / A*CGTGGTGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCGCAGGCGGCA*CACGTGGTG-3' Probe (SEQ ID NO: 71): 5'- / 5Phos / T*GGTGGGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCAGGCGGCACAC*GTGGTG-3' Probe (SEQ ID NO: 72): 5'- / 5Phos / G*TGGTGGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCAGGCGGCACA*CGTGGTG-3' Probe (SEQ ID NO: 73): 5'- / 5Phos / C*GTGGTGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCAGGCGGCAC*ACGTGGTG-3' Probe (SEQ ID NO: 74): 5'- / 5Phos / T*GGTGGGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCGCAGGCGGCACAC*G-3' Probe (SEQ ID NO: 75): 5'- / 5Phos / G*TGGTGGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCGCAGGCGGCACA*C-3' Probe (SEQ ID NO: 76): 5'- / 5Phos / T*GGTGGGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCAGGCGGCACAC*G-3' Probe (SEQ ID NO: 77): 5'- / 5Phos / G*TGGTGGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCAGGCGGCACA*C-3' Probe (SEQ ID NO: 78): 5'- / 5Phos / C*GTGGTGGTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCAGGCGGCAC*A-3' During the ceremony * represents a phosphorothioate bond, and / 5Phos / represents a 5' terminal phosphate.

[0565] 4. Detect-RCA Mixtures corresponding to the following were prepared: 1x RCA buffer (41.25mM Tris-HCl, 20.625mM (NH4)2SO4, 11.76mM KCl, 4.54mM MgSO4, 0.06% Tween-20, pH8.8) 1 x Primer Mix 3 357.14U / mL BST3.0 0.8mM dNTP Antifoam B 1 μL 1.2 μL reaction mixture from point d or c Total volume 11.2μL.

[0566] Primer Mix 3: 40 μM Primer 1 (SEQ ID NO: 79): 5'-T*G*AGCTTTGACAATACTTGA-3' 10 μM Primer 2 (SEQ ID NO: 80): 5'- / 5Cy5 / A*CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATCGCAACATCCTATATCTGCGC-3' 10 μM Primer 3 (SEQ ID NO: 81): 5'- / 5TEX615 / A*CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATGCGAAACTCTCATTACTCGGC-3' 10 μM Primer 4 (SEQ ID NO: 82): 5'- / 5HEX / T*ACGACCGACTCACTCCTTACAGCAGTCCGCAGTATGCTACGACACTACCTAATTGCTCGC-3' 10 μM Primer 5 (SEQ ID NO: 83): 5'- / 5ATTO488N / T*ACGACCGACTCACTCCTTACAGCAGTCCGCAGTATGCTTCGGTGATCAGTCCTCGATG-3' 20 μM Primer 6 (SEQ ID NO: 84): 5'-TCGATCATGGCGACAGCGATTGTCATGGAGCTGGTCAGT / 3IAbRQSp / -3' 20 μM Primer 7 (SEQ ID NO: 85): 5′-AGCATACTGCGGACTGCTGTAAGGAGTGAGTCGGTCGTA / 3IABkFQ / -3′ During the ceremony * represents a phosphorothioate linkage, / 5Cy5 / represents a Cy5 dye on the 5' end, / 5TEX615 / represents a Texas Red dye on the 5' end, / 5HEX / represents a Hex dye on the 5' end, / 5ATTO488N / represents an Atto488 dye on the 5' end, / 3IAbRQSp / represents an Iowa Black® RQ quencher on the 3' end, and / 3IABkFQ / represents an Iowa Black® FQ on the 3' end.

[0567] The mixture was then incubated for 200 minutes at 57° C. Fluorescence measurements in the four reading channels were taken every minute, and the results can be seen in FIG. [Example]

[0568] Detection of four variants using A0 and X0 probes 1. PCR Amplification Mixtures corresponding to the following were prepared: 1x Q5U buffer 200nM Primer Mix 2 20U / mL Q5U polymerase 10U / mL thermolabile UDG 0.4ng / μL fragmented human genomic DNA + / - 0.4aM mutant oligonucleotide Total volume 50 μL. The mixture was then incubated: 37℃ 1 minute 55℃ 10 minutes 98℃ 1 minute (98℃ 10 seconds 63℃ 15 seconds 72℃ 15 seconds) x 50 72℃ 5 minutes 4℃∞

[0569] Q5 buffer The composition of the Q5 buffer is not disclosed.

[0570] Primer Mix 2: Forward (SEQ ID NO: 47): 5'- / 5Phos / CCCAACCAAGCTCTCTTGAGGATCTTG-3' Reverse (SEQ ID NO: 48): 5'-G*G*G*ACCTTACCTTATACACCGTGCCG-3' Forward (SEQ ID NO: 49): 5'-G*C*C*TCCCTCGCGCCATCAGAAGGTGAGAAAGTTAAAATTCCCGTC-3' Reverse (SEQ ID NO: 50): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGACAGCAAAGCAGAAACTCACATCG-3' Forward (SEQ ID NO: 51): 5'-G*C*C*TCCCTCGCGCCATCAGTGCCTCACCTCCACCGTGCA-3' Reverse (SEQ ID NO: 52): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGATTGTCTTTGTGTTCCCGGACAT-3' Forward (SEQ ID NO: 53): 5'-G*A*A*GCCACACTGACGTGCCTCTC-3' Reverse (SEQ ID NO: 54): 5'- / 5Phos / AGGCAGATGCCCAGCAGGCGGCA-3' Forward (SEQ ID NO: 55): 5'-C*G*T*ACTGGTGAAAACACCGCAG-3' Reverse (SEQ ID NO: 56): 5'- / 5Phos / CCTTCTGCATGGTATTCTTTCTCTTCC-3' Forward (SEQ ID NO: 57): 5'- / 5Phos / GCTGAAAATGACTGAATATAAACTTGTGGTAGTTG-3' Reverse (SEQ ID NO: 58): 5'-T*G*A*TTCTGAATTAGCTGTATCGTCAA-3' Forward (SEQ ID NO: 59): 5'-C*T*G*GTCCCTCATTGCACTGTACTCC-3' Reverse (SEQ ID NO: 60): 5'- / 5Phos / AGAAACCTGTCTCTTGGATATTCTCGACAC-3' Forward (SEQ ID NO: 61): 5'- / 5Phos / GCCTCCCTCGCGCCATCAGAAAATGGATCCAGACAACTGTTCAAACTGATG-3' Reverse (SEQ ID NO: 62): 5'-G*C*C*TTGCCAGCCCGCTCAGTTCATGAAGACCTCACAGTAAAAATAGGTGATT-3' Forward (SEQ ID NO: 63): 5'-G*C*C*CCCAGCCCTCTGAC-3' Reverse (SEQ ID NO: 64): 5'- / 5Phos / GCCGTCGCTTGATGAGGATCCC-3' Forward (SEQ ID NO: 65): 5'-T*T*G*TCCCCAGGAAGCATACGTG-3' Reverse (SEQ ID NO: 66): 5'- / 5Phos / ATGCCCAGAAGGCGGGAGACAT-3' Mutant oligonucleotide (SEQ ID NO: 86): 5'-GAAGCCACACTGACGTGCCTCTCCCTCCCTCCAGGAAGCCTTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCT-3' Mutant oligonucleotide (SEQ ID NO: 87): 5'-ACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCGTGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGC-3' Mutant oligonucleotide (SEQ ID NO: 88): 5'-CCACAAAATGGATCCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCTCTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCATGAAGA-3' Mutant oligonucleotide (SEQ ID NO: 89): 5'-CTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTC-3' During the ceremony * represents a phosphorothioate bond, and / 5Phos / represents a 5' terminal phosphate.

[0571] 2. Proteinase K Treatment Mixtures corresponding to the following were prepared: 0.44x Proteinase K Buffer 20U / mL proteinase K 40 μL of the mixture from point a Total volume: 90 μL. The mixture was then incubated at 55°C for 5 minutes and at 95°C for 10 minutes.

[0572] 1x Proteinase K Buffer Composition Tris acetate pH=8.0 10mM Potassium acetate 25mM Magnesium acetate 5mM Tween-20 0.1%

[0573] 3. Pyrophosphorolysis (PPL) and Ligation Mixtures corresponding to the following were prepared: 1 x BFF10 20U / mL Klenow (exo-) 100U / mL E. coli ligase 2U / mL apyrase 100U / mL Lambda Exo 0.5mM PPi Probe (SEQ ID NO: 90) 5 nM Probe (SEQ ID NO: 91) 5 nM Probe (SEQ ID NO: 92) 3.125 nM Probe (SEQ ID NO: 93) 4.25 nM Sprint (SEQ ID NO: 94) 6.375 nM 2.2 μL mixture from point b Total volume 10 μL. The mixture was then incubated at 45°C for 30 minutes.

[0574] 1 x BFF10 composition Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 13.5mM Tween-20 0.01%

[0575] Probe (SEQ ID NO: 90): 5'- / 5Phos / G*GCTTCCTTGAGCTTTGACAATACTTGATCGGCGCAGATATAGGATGTTGCGAAGGCTTCCTGGA*A-3' Probe (SEQ ID NO: 91): 5'- / 5Phos / C*CCAAAATTGAGCTTTGACAATACTTGATCGGCCGAGTAATGAGAGTTTCGCACAGCAGTTTGGCAC*GCCCAAAAT-3' Probe (SEQ ID NO: 92): 5'- / 5Phos / T*CTGTAGCTGAGCTTTGACAATACTTGATCGGCGAGCAATTAGGTAGTGTCGTCATCGAGATTTCTCTGTAG-3' Probe (SEQ ID NO: 93): 5'- / 5Phos / T*GCAGACTTGAGCTTTGACAATACTTGATCGCATCGAGGACTGATCACCGAAGCGGAGATGTTTTGATAGC-3' Splint (SEQ ID NO: 94): 5'-TGTCAAAGCTCAAGTCTGCAACATCTCCGAATCGCT / 3InvdT / -3' During the ceremony * represents a phosphorothioate bond, / 5Phos / represents a 5'-terminal phosphate, and / 3InvdT / represents a 3'-terminal inverted dT.

[0576] Probe 90 is an example of probe X0. The other probe is an example of probe A0.

[0577] 4. Detect-RCA Mixtures corresponding to the following were prepared: RCA buffer (51.8mM Tris-HCl, 27.6mM(NH4)2SO4, 3.72mM KCl, 3.49mM MgSO4, 0.0567% Tween-20, pH8.8) 0.253x Primer Mix 3 (10x) 298.6U / mL BST3.0 0.8mM dNTP 0.3% Antifoaming Agent B 5 μL reaction mixture from point d or c Total volume 15 μL.

[0578] Primer Mix 3 (10x) 40 μM Primer 1 (SEQ ID NO: 79): 5'-T*G*AGCTTTGACAATACTTGA-3' 10 μM Primer 2 (SEQ ID NO: 80): 5'- / 5Cy5 / A*CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATCGCAACATCCTATATCTGCGC 10 μM Primer 3 (SEQ ID NO: 81): 5'- / 5TEX615 / A*CTGACCAGCTCCATGACAATCGCTGTCGCCATGATCGATGCGAAACTCTCATTACTCGGC 10 μM Primer 4 (SEQ ID NO: 82): 5'- / 5HEX / T*ACGACCGACTCACTCCTTACAGCAGTCCGCAGTATGCTACGACACTACCTAATTGCTCGC 10 μM Primer 5 (SEQ ID NO: 83): 5'- / 5ATTO488N / T*ACGACCGACTCACTCCTTACAGCAGTCCGCAGTATGCTTCGGTGATCAGTCCTCGATG 25 μM Primer 6 (SEQ ID NO: 84): 5'-TCGATCATGGCGACAGCGATTGTCATGGAGCTGGTCAGT / 3IAbRQSp / 25 μM Primer 7 (SEQ ID NO: 85): 5'-AGCATACTGCGGACTGCTGTAAGGAGTGAGTCGGTCGTA / 3IABkFQ / It consists of: During the ceremony * represents a phosphorothioate bond, / 5Cy5 / represents a Cy5 dye, / 5TEX615 / represents a Texas Red dye, / 5HEX / represents a Hex dye, / 5ATTO488N / represents an Atto488 dye, / 3IAbRQSp / represents an Iowa Black® RQ quencher, and / 3IABkFQ / represents an Iowa Black® FQ.

[0579] The mixture was then incubated for 200 minutes at 57° C. Fluorescence measurements in the four reading channels were taken every minute. The results can be seen in FIG.

Claims

1. 1. A method for detecting one or more target polynucleotide sequences in a nucleic acid sample, comprising: (a) subjecting the sample to i. Single-stranded probe oligonucleotide A ０ and ii. Pyrophosphorylase into a first reaction mixture comprising: The target sequence is a single-stranded probe oligonucleotide A ０ anneals to and is at least partially double-stranded, ０ a first intermediate product whose 3' end forms a double-stranded complex with the target sequence, ０ chain A, which is at least partially digested by pyrophosphorolysis in the 3'-5' direction from the 3' end １ generating (b) introducing the first reaction mixture into a second reaction mixture containing a ligase, １ However, after ligation using Sprint, ２ wherein said target polynucleotide sequence serves as a splint or the splint comprises oligonucleotide D and is subjected to ligation, A １ and the 3' end of A １ to the 5' end of the DNA fragment to form a circular construct; or A １ Ligation of the 3' end of the ligation probe oligonucleotide C to the 5' end of the ligation probe oligonucleotide C a step comprising: (c) introducing the second reaction mixture into a third reaction mixture and detecting a signal from the product of the previous step, wherein the product is A ２ or a part thereof, or A ２ multiple copies of, or multiple copies of a portion thereof; and inferring therefrom the presence or absence of one or more target polynucleotide sequences in said sample, wherein one or more of said first, second and / or third reaction mixtures comprise one or more antifoaming agents. A method comprising:

2. 2. The method of claim 1, wherein the first reaction mixture comprises: - single-stranded probe oligonucleotide A ０ ; pyrophosphorolytic enzymes; and - ligase 10. The method of claim 1, further characterized by combining the first and second reaction mixtures to comprise:

3. The method is a method for detecting two or more target polynucleotide sequences in a nucleic acid sample, - the first or second reaction mixture contains a single-stranded probe oligonucleotide X ０ Further comprising X ０ comprises a first target complementarity (TC) region, a second target complementarity (TC) region, a first primer binding site, and a second primer binding site, wherein the first TC region anneals to a first region of the target sequence, the second TC region hybridizes to a second region of the target sequence, and the first and second TC regions anneal to the target adjacent to each other such that they are separated only by a nick; ０ However, it is not pyrophosphorolyzed and X ０ is circularized to the target by ligation of the first and second TC regions to form X １ Forming; the detection step involves detecting a signal derived from the product of the previous step, said product being: i.A ２ or a part thereof, or A ２ multiple copies of, or multiple copies of portions thereof; and / or ii. X １ or part of it, or X １ Multiple copies of, or multiple copies of parts of, and Therefrom, the presence or absence of two or more target polynucleotide sequences in said sample is inferred. The method of claim 1 or claim 2 further characterized by:

4. X ０ 4. The method of claim 3, further characterized in that is resistant to pyrophosphorolysis due to a chemical modification at its 3' end.

5. 5. The method of claim 4, further characterized in that the chemical modification is a phosphorothioate bond.

6. 6. The method of claim 1, further characterized in that the third reaction mixture comprises one or more antifoaming agents.

7. 7. The method of any one of claims 1 to 6, further characterized in that the antifoaming agent is silicone-based.

8. 8. The method of claim 7 further characterized in that the antifoaming agent is Antifoam SE-15.

9. 8. The method of claim 7 further characterized in that the antifoaming agent is an Antifoam B emulsion.

10. 8. The method of claim 7 further characterized in that the antifoaming agent is an Antifoam C emulsion.

11. The first or second reaction mixture comprises: A ０ at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of ０ 11. The method of claim 1, further comprising at least one single-stranded primer oligonucleotide substantially complementary to a portion of:

12. The third reaction mixture comprises: A ０ at least one single-stranded primer oligonucleotide that is substantially complementary to a portion of ０ 11. The method of claim 1, further comprising at least one single-stranded primer oligonucleotide substantially complementary to a portion of:

13. The partially digested chain A １ is circularized through ligation of its 3' and 5' ends to form oligonucleotide A ２ 13. The method of claim 1, further comprising generating:

14. the first or second reaction mixture further comprises a ligation probe oligonucleotide C, and the partially digested strand A １ is ligated at its 3' end to the 5' end of C to form oligonucleotide A ２ 14. The method of any one of claims 1 to 13, further characterized by producing:

15. The first reaction mixture or the second reaction mixture further comprises a 5'-3' exonuclease; ０ and optionally X ０ The method of any one of claims 1 to 14, further characterized in that the 5' end of the

16. 16. The method of any one of claims 1 to 15, further characterized in that the first or second reaction mixture further comprises a phosphatase or a phosphohydrolase.

17. 17. The method of any one of claims 1 to 16, further characterized in that before or during said detection step, the product of the previous step is treated with at least one of a pyrophosphatase or an exonuclease.

18. 18. The method of any one of claims 1 to 17, further characterized in that said oligonucleotide C further comprises a 3' or internal modification that protects it from 3'-5' exonuclease digestion.

19. The first or second reaction mixture comprises: A １ and the 5' end of oligonucleotide C or A １ 19. The method of any one of claims 1 to 18, further characterized in that it further comprises a splint oligonucleotide D comprising a region complementary to either of the 5' ends of:

20. A ０ Partially digested chain A by pyrophosphorolysis of １ The enzyme that forms A ２ and optionally X １ 20. The method of any one of claims 1 to 19, further characterized in that it also amplifies the .

21. (a) A ０ one or more single-stranded probes A, the 3' end of which is complementary to a first target polynucleotide sequence; ０ ; (b) one or more pyrophosphorolysis-resistant single-stranded probes X ０ And X ０ comprises one or more pyrophosphorolysis-resistant single-stranded probes X1, X2, X3, X4, X5, X6, X7, X8, X9, X10, X11, X12, X13, X14, X15, X16, X17, X18, X20, X30, X40, X50, X60, X70, X80, X90, X10, X11, X12, X13, X14, X15, X16, X17, X18, X19, X21, X22, X23, X24, X30, X41, X50, X60, X70, X80, X90, X10, X11, X12, X13, X14, X15, X16, X17, X18, X19 ...4, X25, X30, X41, X50, X60, X70, X80, X90, X10, X11, X12, X13, X14, X15, X16, X17, X18, X19, X23, X24, X25, X30, X41, X50, X60, X70, X80, X90, X10, X11, X12, X13, X14, X15, X16, X17, X18, X19, X25, X26, X27, X30, X41, X50, X60, X70, X80, X9 ０ ; (c) one or more ligases; (d) one or more pyrophosphorolytic enzymes; (e) one or more sources of pyrophosphate ions; (f) one or more buffering agents; and (g) one or more antifoaming agents Kit including:

22. The 5' end of C is the region of oligonucleotide D, or A ０ 22. The kit of claim 21, further comprising an oligonucleotide C that is complementary to a region of the target polynucleotide sequence that is different from the region to which the 3' end of

23. D is A ０ A located in the 5' direction from the 3' end of ０ and the 5' end of C or A ０ 23. The kit of claim 21 or claim 22, further comprising an oligonucleotide D comprising a region complementary to any one of the 5' ends of:

24. 24. The kit of any one of claims 21 to 23, further comprising dNTPs and one or more primers.

25. (a) i.A ０ one or more single-stranded probes A, the 3' end of which is complementary to a first target polynucleotide sequence; ０ ; ii. one or more pyrophosphorolysis-resistant single-stranded probes X ０ And X ０ comprises one or more pyrophosphorolysis-resistant single-stranded probes X1, X2, X3, X4, X5, X6, X7, X8, X9, X10, X11, X12, X13, X14, X15, X16, X17, X18, X20, X30, X40, X50, X60, X70, X80, X90, X10, X11, X12, X13, X14, X15, X16, X17, X18, X19, X21, X22, X23, X24, X30, X41, X50, X60, X70, X80, X90, X10, X11, X12, X13, X14, X15, X16, X17, X18, X19 ...4, X25, X30, X41, X50, X60, X70, X80, X90, X10, X11, X12, X13, X14, X15, X16, X17, X18, X19, X23, X24, X25, X30, X41, X50, X60, X70, X80, X90, X10, X11, X12, X13, X14, X15, X16, X17, X18, X19, X25, X26, X27, X30, X41, X50, X60, X70, X80, X9 ０ ; iii. one or more ligases; iv. one or more pyrophosphorolytic enzymes; and v. One or more sources of pyrophosphate ions a first reaction mixture comprising: (b) i. one or more antifoaming agents; and ii. dNTPs and one or more primers a second reaction mixture comprising A kit comprising: The kit, wherein the first and / or second reaction mixture further comprises one or more buffer solutions.

Images