Non-coding RNA agents (BCYRN1 and its derivatives) for treating immune disorders
BCYRN1-derived binding sequences enhance Treg function by inhibiting specific microRNAs, addressing the need for effective treatments in immune-related disorders and inflammatory conditions by promoting tissue repair and reducing inflammation.
Patent Information
- Application Number
- JP2024573490
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-15
- Filing Date
- 2023-06-13
- Publication Date
- 2025-08-05
AI Technical Summary
Current treatments for immune-related disorders and inflammatory conditions, such as myocarditis and autoimmune diseases, lack effective therapeutic agents that can enhance regulatory T cell (Treg) function to alleviate tissue damage and promote recovery.
Therapeutic compositions comprising BCYRN1-derived binding sequences (BDSS) or derivatives, which function as miRNA sponges to inhibit miR-138, miR-150, and miR-98, thereby enhancing Treg proliferation, migration, and IL-10 production.
The compositions increase Treg functionality, leading to improved tissue repair and reduced inflammation in immune-related disorders, including myocarditis and autoimmune diseases.
Smart Images

Figure 2025525333000001_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 366,459, filed June 15, 2022, which is incorporated herein by reference in its entirety.
[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with government support under Grant No. R01 HL124074 awarded by the National Institutes of Health to Dr. Eduardo Marban. The government has certain rights in this invention.
[0003] Reference to sequence listing This application is filed with an electronic Sequence Listing. The Sequence Listing is provided as a file entitled CSMC020WO_SEQLIST.xml, created on June 13, 2023, and 32,404 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.
[0004] The present disclosure relates to therapeutic RNAs, their derivatives and sequence variants, and their use to treat immune-related disorders or inflammatory conditions. [Background technology]
[0005] Inflammation and tissue damage are major factors in the pathology of certain cardiac injuries and other diseases. Increasing evidence suggests that regulatory T cells (Tregs) prioritize tissue repair and functional recovery. In particular, the CD4+Foxp3+Treg subset has the potential to alleviate injury through the release of inhibitory cytokines (e.g., IL-10), growth factors (e.g., TGFβ), or contact-dependent effects. Summary of the Invention
[0006] Provided herein are therapeutic compositions comprising at least one nucleic acid comprising a BDSS (BCYRN1-derived binding sequence), wherein the BDSS comprises a nucleotide sequence provided by any one of SEQ ID NOs: 11-16, or a sequence at least 90% identical thereto, and wherein each of the at least one nucleic acid is 35 nucleotides in length or less. In some embodiments, the BDSS comprises a nucleotide sequence provided by any one of SEQ ID NOs: 11-16, or a sequence at least 95% identical thereto. In some embodiments, the BDSS comprises a nucleotide sequence provided by any one of SEQ ID NOs: 11-16. In some embodiments, the composition comprises at least one of: a first nucleic acid comprising BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArCrCrCrC) (SEQ ID NO: 14), or a sequence at least 90% identical thereto, and being 35 nucleotides in length or less; a second nucleic acid comprising BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrArGrGrArU) (SEQ ID NO: 15), or a sequence at least 90% identical thereto, and being 35 nucleotides in length or less; and a third nucleic acid comprising BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArCrC) (SEQ ID NO: 16), or a sequence at least 90% identical thereto, and being 35 nucleotides in length or less. In some embodiments, the composition comprises at least two of the first, second, and third nucleic acids, wherein the composition comprises the first, second, and third nucleic acids. In some embodiments, the first nucleic acid consists of or consists essentially of BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArCrCrCrC) (SEQ ID NO: 14), the second nucleic acid consists of or consists essentially of BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrArGrGrArU) (SEQ ID NO: 15), and the third nucleic acid consists of or consists essentially of BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArCrC) (SEQ ID NO: 16).
[0007] In some embodiments, the composition comprises at least one of: a first nucleic acid comprising a BDSS comprising UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), or a sequence at least 90% identical thereto, and 35 nucleotides or less in length; a second nucleic acid comprising a BDSS comprising GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), or a sequence at least 90% identical thereto, and 35 nucleotides or less in length; and a third nucleic acid comprising a BDSS comprising ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a sequence at least 90% identical thereto, and 35 nucleotides or less in length. In some embodiments, the composition comprises at least two of the first, second, and third nucleic acids. In some embodiments, the composition comprises the first, second, and third nucleic acids. In some embodiments, a first nucleic acid comprises a BDSS consisting of or consisting essentially of UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), a second nucleic acid comprises a BDSS consisting of or consisting essentially of GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), and a third nucleic acid comprises a BDSS consisting of or consisting essentially of ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13).
[0008] Also provided is a therapeutic composition comprising at least one BDSS (BCYRN1-derived binding sequence) compound for treating an immune and / or inflammatory disorder, wherein the BDSS compound each comprises a nucleotide sequence provided by any one of SEQ ID NOS: 11-16, or a derivative having 1, 2, 3, 4, or 5 substitutions thereto. In some embodiments, the at least one BDSS compound each comprises at least one of BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrCrC) (SEQ ID NO: 14), BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrArGrGrArGrArU) (SEQ ID NO: 15), or BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArArCrC) (SEQ ID NO: 16), or a derivative having 1, 2, 3, 4, or 5 substitutions thereto. In some embodiments, at least one BDSS compound each comprises a nucleotide sequence comprising UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), or ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a derivative having 1, 2, 3, 4, or 5 substitutions thereto. In some embodiments, at least one BDSS compound comprises a nucleotide sequence comprising UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), or ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a derivative having at least 80% sequence identity thereto.
[0009] Also provided are therapeutic compositions comprising at least one inhibitory nucleic acid that binds to at least one of miR-138, miR-150, and miR-98, respectively, wherein the at least one nucleic acid is up to 35 nucleotides in length. In some embodiments, the composition comprises at least one of a first inhibitory nucleic acid that binds to miR-138, a second inhibitory nucleic acid that binds to miR-150, and a third inhibitory nucleic acid that binds to miR-98, wherein each of the first, second, and third inhibitory nucleic acids is up to 35 nucleotides in length. In some embodiments, the composition comprises at least two of the first, second, and third inhibitory nucleic acids. In some embodiments, the composition comprises the first, second, and third inhibitory nucleic acids.
[0010] In some embodiments, an inhibitory nucleic acid that binds to miR-138 or miR-98 comprises ACAAC (SEQ ID NO: 18). In some embodiments, an inhibitory nucleic acid that binds to miR-150 comprises GGGAG (SEQ ID NO: 19). In some embodiments, a nucleic acid or BDSS compound comprises ACAAC (SEQ ID NO: 18). In some embodiments, a nucleic acid or BDSS compound comprises GGGAG (SEQ ID NO: 19).
[0011] In some embodiments, at least one nucleic acid or BDSS compound comprises RNA. In some embodiments, at least one nucleic acid or BDSS compound comprises at least one chemically modified nucleotide. In some embodiments, at least one chemically modified nucleotide comprises a backbone modification. In some embodiments, at least one chemically modified nucleotide comprises a locked nucleic acid (LNA) and / or methylation.
[0012] The following long non-coding RNAs: TIFF2025525333000002.tif28158 (SEQ ID NO: 17) or one or more synthetic derivatives thereof, wherein the derivatives are 35 nucleotides in length or less, and wherein the long non-coding RNA or synthetic derivatives thereof enhance Treg functionality.
[0013] Also provided is a therapeutic composition comprising a first BDSS (BCYRN1-derived binding sequence) compound provided by SEQ ID NO: 11 and having a length of 35 nucleotides or less, a second BDSS compound provided by SEQ ID NO: 12 and having a length of 35 nucleotides or less, a third BDSS compound provided by SEQ ID NO: 13 and having a length of 35 nucleotides or less, and a pharmaceutically acceptable excipient.
[0014] In some embodiments, the composition comprises a transfection reagent. In some embodiments, the transfection reagent comprises one or more of liposomes, lipid nanoparticles (LNPs), extracellular vesicles (EVs), and polyethylene glycol (PEG) cationic lipid complexes (PCLCs). In some embodiments, the transfection reagent comprises EVs derived from cardiosphere-derived cells (CDCs).
[0015] Also provided is an isolated nucleic acid comprising the nucleotide sequence UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), which is RNA and is up to 35 nucleotides in length. Further provided is an isolated nucleic acid comprising the nucleotide sequence GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), which is RNA and is up to 35 nucleotides in length. Provided herein is an isolated nucleic acid comprising the nucleotide sequence ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), which is RNA and is up to 35 nucleotides in length. Also provided is an isolated nucleic acid comprising a nucleotide sequence at least 95% identical to any one of SEQ ID NOs: 11-13, which is RNA and is up to 35 nucleotides in length.
[0016] In some embodiments, the nucleic acid comprises at least one chemically modified nucleotide. In some embodiments, the at least one chemically modified nucleotide comprises a backbone modification. In some embodiments, the backbone modification comprises a backbone sugar modification. In some embodiments, the at least one chemically modified nucleotide comprises a locked nucleic acid (LNA) and / or a methylated nucleotide.
[0017] Provided herein are vectors comprising a nucleic acid sequence encoding an RNA comprising at least one of the following sequences: UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), and ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13). Also provided are collections of vectors, including a first vector comprising a nucleic acid sequence encoding a first RNA comprising UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), wherein the first RNA is up to 35 nucleotides in length; a second vector comprising a nucleic acid sequence encoding a second RNA comprising GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), wherein the second RNA is up to 35 nucleotides in length; and a third vector comprising a nucleic acid sequence encoding a second RNA comprising ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), wherein the second RNA is up to 35 nucleotides in length. In some embodiments, the vectors are lentiviral vectors.
[0018] Provided herein are regulatory T cells comprising any one of the nucleic acids of the present disclosure, wherein the anti-inflammatory activity of the regulatory T cells is increased compared to regulatory T cells without the nucleic acid. Also provided are regulatory T cells genetically modified to comprise any one of the vectors or collections of vectors of the present disclosure. In some embodiments, the cells are in a subject. In some embodiments, the cells are in culture.
[0019] Also provided are cardiosphere-derived cells (CDCs) that have been genetically modified to include any one of the vectors or collections of vectors of the present disclosure.
[0020] Also provided is a method of treating an immune-related disorder, comprising administering to a subject in need thereof a therapeutically effective amount of any one of the compositions of the present disclosure or any one of the nucleic acids of the present disclosure, thereby treating the immune-related disorder.
[0021] Also provided are methods for treating an immune-related disorder, comprising administering a therapeutically effective amount of non-coding RNA BCYRN1 or a derivative thereof to a subject in need thereof. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a composition comprising at least one BDSS (BCYRN1-derived binding sequence) compound comprising a nucleic acid sequence selected from SEQ ID NOs: 11-13. In some embodiments, the non-coding RNA BCYRN1 or a derivative thereof comprises one or more of a nucleic acid sequence selected from UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), and ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a sequence having one, two, three, four, or five substitutions therein. In some embodiments, the non-coding RNA BCYRN1 or a derivative thereof comprises one or more nucleic acid sequences selected from UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), and ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a sequence at least 80% identical thereto. In some embodiments, the non-coding RNA BCYRN1 or a derivative thereof has a length of about 15-50 nt.
[0022] In some embodiments, the immune-related disorder comprises an inflammatory disorder. In some embodiments, the immune-related disorder comprises an immune-related disorder of the heart, an autoimmune disease, or transplant rejection. In some embodiments, the immune-related disorder of the heart comprises myocarditis. In some embodiments, the immune-related disorder comprises one or more of myocarditis, myocardial infarction, an autoimmune condition, or an inflammatory condition associated with a viral infection. In some embodiments, the method comprises oral, intravenous, intramuscular, intracardiac, airway (aerosol), or pulmonary administration. In some embodiments, the immune-related disorder is secondary to a viral infection.
[0023] Also provided are methods for modulating regulatory T cell (Treg) activity, comprising contacting Tregs with an effective amount of non-coding RNA BCYRN1 or a derivative thereof, thereby modulating the activity of Tregs. In some embodiments, the method comprises contacting Tregs with non-coding RNA BCYRN1 or a derivative thereof, thereby increasing Treg proliferation, migration, and / or IL-10 production. In some embodiments, the contacting comprises administering an effective amount of non-coding RNA BCYRN1 or a derivative thereof to the subject, thereby modulating the activity of Tregs in the subject.
[0024] Also provided is a use of any one of the compositions of the present disclosure or any one of the nucleic acids of the present disclosure for the treatment of an immune-related disorder in a subject in need thereof.
[0025] Also provided is the use of any one of the compositions of the present disclosure or any one of the nucleic acids of the present disclosure for the preparation of a medicament for the treatment of an immune-related disorder in a subject in need thereof.
[0026] The following nucleotide sequence: TIFF2025525333000003.tif8158TIFF2025525333000004.tif20158 (SEQ ID NO: 17) or a synthetic derivative thereof, wherein the derivative is 35 nucleotides in length or less, and wherein the long non-coding RNA or synthetic derivative thereof enhances Treg functionality.
[0027] Also provided is the administration of non-coding RNA BCYRN1 or a derivative thereof as a therapeutic agent for immune and inflammatory disorders.
[0028] Also provided are methods for treating an immune-related disorder, comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of miR-138, miR-150, and / or miR-98. In some embodiments, the inhibitor is BCYRN1 or a derivative thereof.
[0029] Also provided are kits comprising any one of the compositions of the present disclosure, any one of the nucleic acids of the present disclosure, or any one of the vectors or vector collections of the present disclosure, and a transfection reagent. The kits can include any suitable transfection reagent described herein. In some embodiments, the transfection reagent comprises one or more of lipids, liposomes, lipid nanoparticles (LNPs), PEGylated lipids, and extracellular vesicles (EVs). In some embodiments, the kits include a pharmaceutically acceptable excipient. [Brief explanation of the drawings]
[0030] [Figure 1-1]Figure 1 is a series of graphs showing the effects of cardiosphere-derived extracellular vesicles (CDC-EVs) on the proliferation, migration, and IL-10 induction of human iTreg cells. An experimental outline for in vitro Treg cell global transcriptome analysis is shown in panel A, in which total CD4+ T cell populations were isolated from FOXP3 reporter mice, followed by differentiation of isolated naive CD4+ T cells into inducible Tregs (iTregs). iTreg cells were exposed to either vehicle or human CDC-EVs for 5 days, followed by assessment of transcriptome changes, as shown in panels B and C. Functional heat maps depict the enrichment of functional categories of cell survival (panel B) and cell motility (panel C) in upregulated transcripts in the CDC-EV group compared to vehicle, based on IPA analysis. As shown in panels D–F, human iTreg cells were exposed to either CDC-EVs or fibroblast EVs (NHDF-EVs) at the indicated concentrations (0–5,000 EVs / cell) for 24 hours (panel D), 72 hours (panel E), and 5 days (panel F). Migration of human iTreg cells toward 500 ng / mL of recombinant CCL20 after exposure to CDC-EVs or NHDF-EVs was assessed using a 24-well Transwell plate and is shown in panel G. Real-time PCR analysis of IL-10 mRNA expression in human iTreg cells exposed to either CDC-EVs or NHDF-EVs is shown in panel H. IL-10 protein levels were assayed by ELISA in the supernatants of human iTreg cells exposed to either CDC-EVs or NHDF-EVs for 72 hours and are shown in panel I. One-way ANOVA followed by Bonferroni post-hoc test was used to determine statistical significance between multiple groups. All data are presented as the mean ± SD or SEM of three or four separate experiments (biological replicates). *: P<0.05, **: P<0.01, ***: P<0.001 compared with the control group. [Figure 1-2] Continued from Figure 1-1. [Figure 2-1]Figure 2 is a series of graphs showing the evaluation of CDC-EVs as mediating increased BCYRN1 expression in Treg cells. RNA sequencing of CDC-EVs demonstrated the enrichment of lncRNAs compared with NHDF-EVs, shown in panel A. A list of the top 10 abundant lncRNAs and BCYRN1, which were most enriched in CDC-EVs (CDC-EVs (left bar) and NHDF-EVs (right bar)), is shown in panel B. BCYRN1 was more highly expressed in CDC-EVs than in NHDF-EVs by qPCR, shown in panel C. Confocal microscopy demonstrated the uptake of PKH26-labeled CDC-EVs by human iTregs, shown in panel D. Evaluation of BCYRN1 expression by q-PCR in human iTregs exposed to CDC-EVs or NHDF-EVs for the indicated times is shown in panel E. One-way ANOVA followed by Bonferroni post-hoc test was used to determine statistical significance between multiple groups. All data are presented as the mean ± SD or SEM of three or four separate experiments (biological replicates). Compared with the control group, *: P<0.05, **: P<0.01, ***: P<0.001. [Figure 2-2] Continued from Figure 2-1. [Figure 3] Figure 3 is a series of graphs showing the evaluation of CDC-EV-mediated Treg proliferation, migration, and IL-10 induction involving EV-BCYRN1. Overexpression of BCYRN1 (OE) in human iTreg cells was evaluated for proliferation (Panel A), migration (Panel B), and IL-10 production (Panel C). CDC transfected with siRNA-BCYRN1 resulted in BCYRN1 knockdown in both CDC and CDC-EV, as shown in Panels D and E. Exposure of human iTreg cells to CDC-EV with BCYRN1 knockdown was evaluated for proliferation (Panel F), migration (Panel G), and IL-10 production (Panel H). One-way ANOVA followed by Bonferroni post-hoc test was used to determine statistical significance between multiple groups. All data are presented as the mean ± SD or SEM of three or four separate experiments (biological replicates). *: P<0.05, **: P<0.01, ***: P<0.001 compared to the control group. ##: P < 0.01 compared with the si-Ctrl-CDC-EV group. [Figure 4-1] Figure 4 is a series of graphs depicting the evaluation of CDC-EV BCYRN1 induction of autophagy by competitively binding with miR-138 and regulating ATG7 expression. Human iTreg cells were exposed to CDC-EV or untreated (control, ctrl), as shown in panel A. The expression of autophagy markers (LC3b, ATG7, and p62) was assessed by WB. Human iTreg cells were exposed to ctrl-CDC-EV, si-BCYRN1 CDC-EV (EV with BCYRN1 knockdown), or untreated (ctrl), as shown in panel B. The expression of autophagy markers (LC3b, ATG7, and p62) was assessed by WB, as shown in panel C. Human iTreg cells were transfected with vector or OE-BCYRN1 lentivector, followed by evaluation of autophagy markers by WB, as shown in panel D. A biotin-labeled BCYRN1 probe was used to pull down BCYRN1-binding RNA, followed by qPCR to assess the expression of miR-138, negative controls (U6 and GAPDH), and positive controls (BCYRN1), as shown in panel E. miR-13 and the putative lncRNA BCYRN1-binding site in human iTregs were cotransfected with mimic miR-138 and wild-type or mutant luciferase reporters into HEK-293T cells, followed by assessment of relative luciferase activity, as shown in panel F. Cotransfected miR-138 and BCYRN1 in Tregs were assessed for ATG7 by WB. One-way ANOVA followed by Bonferroni post-hoc test was used to determine statistical significance between multiple groups. All data are presented as the mean ± SD or SEM of three or four separate experiments (biological replicates). *: P < 0.05, **: P < 0.01, ***: P < 0.001 compared to the control group. [Figure 4-2] Continued from Figure 4-1. [Figure 4-3] Continued from Figure 4-2. [Figure 4-4] Continued from Figure 4-3. [Figure 5]Figure 5 is a series of graphs depicting the evaluation of CDC-EV BCYRN1 induction of Treg migration by competitively binding with miR-150 and regulating CCR6 expression. Human iTreg cells were exposed to CDC-EV or untreated (ctrl). CCR6 expression was assessed by qPCR and shown in panel A. As shown in panel B, human Treg cells were exposed to ctrl-CDC-EV, si-BCYRN1 CDC-EV (EV with BCYRN1 knockdown), or untreated (ctrl). CCR6 expression was assessed by qPCR and shown in panel C. Human Treg cells were transfected with vector or OE-BCYRN1 lentivector, followed by CCR6 assessment by qPCR and shown in panel D. A biotin-labeled BCYRN1 probe was used to pull down BCYRN1-bound RNA, followed by qPCR assessment of miR-150, negative controls (U6 and GAPDH), and positive control (BCYRN1) expression and shown in panel E. The miR-150 and putative lncRNA BCYRN1 binding sites in human iTregs were cotransfected with mimic miR-150 and wild-type or mutant luciferase reporters into HEK-293T cells, followed by assessment of relative luciferase activity, as shown in panels F and G. Cotransfected miR-150 and BCYRN1 in Tregs were assessed for CCR6 by WB (panel F) and for cell migration by trans-well migration assay (panel G). One-way ANOVA followed by Bonferroni post-hoc test was used to determine statistical significance between multiple groups. All data are presented as the mean ± SD or SEM of three or four separate experiments (biological replicates). Compared to the control group, *: P<0.05, **: P<0.01, ***: P<0.001. Compared to the miR-150 group, ###: P<0.001. [Figure 6]Figure 6 is a series of graphs showing the evaluation of BCYRN1-mediated induction of IL-10 in Tregs by competitively binding with miR-98 to regulate IL-10 expression. As shown in panel A, a biotin-labeled BCYRN1 probe was used to pull down BCYRN1-binding RNA, followed by qPCR evaluation of the expression of miR-98, negative controls (U6 and GAPDH), and positive controls (BCYRN1) (panel B). miR-98 and the putative lncRNA BCYRN1 binding site in human iTregs were cotransfected with mimic miR-98 and wild-type or mutant luciferase reporters into HEK-293T cells, followed by evaluation of relative luciferase activity, as shown in panels C and D. Cotransfected miR-98 and BCYRN1 in Tregs were evaluated for IL-10 expression by qPCR (panel C) and ELISA (panel D). Statistical significance between multiple groups was determined using one-way ANOVA followed by Bonferroni post-hoc test. All data are presented as the mean ± SD or SEM of three or four separate experiments (biological replicates). Compared with the control group, *: P<0.05, **: P<0.01, ***: P<0.001. Compared with the miR-150 group, ##: P<0.01, ###: P<0.001. [Figure 7-1]Figure 7 is a series of graphs showing the evaluation of the therapeutic efficacy of CDC-EV, CDC-EV-BCYRN1 in an I / R mouse model to induce Treg proliferation, infiltration, and IL-10 induction in the heart. A schematic diagram of the in vivo I / R protocol is shown in panel A. Representative flow cytometry plots and quantitative measurements of CD4+Foxp3+, CD4+Foxp3+IL10+, and CD4+Foxp3+Brdu+ populations in the hearts of CDC-EV-, CDC-EV-BCYRN1-, and IMDM (vehicle)-treated animals (n = 5 mice per group) are shown in panel B. Representative TTC-stained hearts and quantitative measurements of % infarct mass in CDC-EV-, CDC-EV-BCYRN1-, and vehicle-injected animals (n = 5 mice per group) 72 hours (h) after IR insult are shown in panel C. Plasma cTnI levels in CDC-EV-, CDC-EV-BCYRN1-, and vehicle-injected animals (n = 5 mice per group) 24 hours after IR insult are shown in panel D. One-way ANOVA followed by Bonferroni post-hoc test was used to determine statistical significance between multiple groups. *: P < 0.05, **: P < 0.01, ***: P < 0.001 compared to the control group. #: P < 0.05 compared to the CDC-EV group. [Figure 7-2] Continued from Figure 7-1. [Figure 8] Figure 8 is a schematic demonstrating the mechanism by which CDC-EV BCYRN1 mediates the regulation of Treg cells, which in turn leads to cardioprotection in myocardial infarction (MI). BCYRN1 functions as a miRNA sponge that mediates the cardioprotective effects of CDC-EVs through promoting Treg infiltration (miR-150 / CCR6-dependent migration), proliferation (miR-138 / ATG7-dependent autophagy), and IL-10 production (miR-98 / IL-10) in the heart. [Figure 9] Depicts assessment of CD8+ T cell proliferation after co-culture with DCs and various ratios of hTreg / hTreg-BCYRN1. n=5-6 / group. [Figure 10]Figure 10 is a series of graphs showing the evaluation of hTregs exposed to a mixture of BDSSs (100 nM each) and then assessed for proliferation (CCK-8), transwell migration, and IL-10 (ELISA), as shown in panel A. As shown in panels B and C, hTregs were exposed to BDSS-98 (B, 0-100 nM) for 72 hours and then assessed for IL-10 production. Panel C shows hTregs exposed to BDSS-150, BDSS-138, or BDSS-98 (100 nM) for 72 hours and then assessed for IL-10 production. [Figure 11] Figure 11 is a series of graphs depicting the evaluation that a cocktail of three BDSSs is cardioprotective against MI in mice and comparable to the autophagy inducer rapamycin. Panel A shows the schematic protocol of the experiment. Panel B shows pooled data of representative TTC-stained cardiac sections and infarct mass (% of LV, n = 5 per group) from BDSS- and rapamycin-injected animals 72 hours after MI. Panel C shows circulating cTnI levels in BDSS- and vehicle-injected mice (n = 5 per group). [Figure 12] Figure 12 is a series of graphs showing the finding that Treg depletion blocks BDSS activity. Panel A shows a schematic of the Treg depletion and in vivo I / R protocol. Mice were administered anti-CD25 antibody (100 μg / mouse / injection ip) twice or an isotype control daily for 2 days prior to I / R. On day 3, IS (mean ± SEM, n = 5 mice / group) was assessed using a TTC assay. Panel B shows a representative plot showing the percentage of CD25+FoxP3+ (Q2 quadrant) among CD4+ T cells. Panel C shows quantitative measurements of infarct mass % (n = 5 mice per group) in BDSS- and Mut-BDSS-injected animals (WT / Treg-depleted) 72 hours after IR insult. [Figure 13] FIG. 13 depicts the evaluation that transfection of CDCs with a BCYRN1 overexpression (OE) vector resulted in upregulation of BCYRN1 in both CDCs and CDC-EVs. [Figure 14]FIG. 14 shows a schematic of cardiac-infiltrating Treg analysis by flow cytometry. [Figure 15] Figure 15 shows a schematic of encapsulating GFP mRNA into CDC-EVs. As shown in panel A, the mixture was incubated, and then the exosomes were immunoprecipitated with anti-CD9, anti-CD63, and anti-CD81. As shown in panel B, the pulldown was characterized by size and GFP expression. Panel C shows that the exosomes expressed GFP in neonatal rat cardiomyocytes. DETAILED DESCRIPTION OF THE INVENTION
[0031] Non-coding RNAs (ncRNAs) in CDC-EVs are involved in the disease-modifying biological activities of CDC-EVs. BCYRN1 is an ncRNA found in CDC-EVs. BCYRN1 can enhance the proliferation, migration, and / or activation of regulatory T cells. The nucleotide sequence of BCYRN1 is provided by SEQ ID NO: 17. The present disclosure provides nucleic acids that are BCYRN1-derived binding sequences (BDSS), e.g., sequences provided by SEQ ID NOs: 11-16. BCYRN1 and its derivatives can have potent disease-modifying biological activities in numerous inflammation-related diseases, including cardiac immune-related disorders, e.g., myocarditis, autoimmune diseases, transplant rejection, and inflammatory or immune-related disorders secondary to viral infection. Without being bound by theory, BCYRN1 and its derivatives are thought to behave as microRNA (miRNA) "sponges" and inhibit miRNA-138, miR-150, and miR-98.
[0032] Provided herein are isolated nucleic acids, e.g., RNAs, which may comprise the nucleotide sequences of SEQ ID NOs: 11-17, sequence variants and / or chemical modifications thereof, as well as methods of use thereof. As used herein, "chemical modification" refers to a chemical difference in the structure of a nucleotide of a nucleic acid compared to the corresponding base nucleotide (e.g., adenine, guanine, uracil, thymidine, cytosine). A chemical modification may be a natural or artificial modification of the chemical structure of a base nucleotide. In some embodiments, the isolated nucleic acid comprises at least one non-natural chemical modification. Generally, the nucleic acid is 35 nucleotides (nt) or less in length (e.g., 15-35 nt, or 21-35 nt). In some embodiments, the nucleic acid is BCYRN1 (SEQ ID NO: 17), or a sequence variant or derivative thereof (e.g., one or more BDSS (BCYRN1-derived binding sequence) compounds, e.g., BDSS-138, BDSS-150, and / or BDSS-98). Generally, derivatives of nucleic acids, such as sequence variants or chemical modifications, include functional variants and chemical modifications. Thus, contemplated sequence variations and chemical modifications are those that substantially retain the therapeutic efficacy of the original molecule (e.g., having the nucleotide sequence of SEQ ID NOs: 11-16). In some embodiments, isolated nucleic acids of the present disclosure are provided.
[0033] Nucleic acids of the present disclosure, e.g., BCYRN1 and / or its variants and / or derivatives, find use in treating conditions in which inflammation and / or tissue damage are primary pathological factors. In some embodiments, nucleic acids of the present disclosure, e.g., BCYRN1 and / or its variants and / or derivatives, treat diseases and conditions characterized by inflammation. In some embodiments, conditions treated by nucleic acids of the present disclosure, e.g., BCYRN1 and / or its variants and / or derivatives, include, but are not limited to, inflammatory diseases, muscular dystrophy, or cardiac injury. In some embodiments, nucleic acids of the present disclosure, e.g., BCYRN1 and / or its variants and / or derivatives, have cardioprotective effects when administered to subjects suffering from cardiac injury due to, but not limited to, myocardial infarction and / or heart failure. Without being bound by theory, nucleic acids, e.g., BCYRN1, can increase the anti-inflammatory activity of Tregs, for example, by promoting Treg cell proliferation, CCR6-dependent Treg migration, and / or interleukin-10 (IL-10) secretion from Tregs. In some embodiments, the nucleic acids of the present disclosure induce altered expression of one or more gene products and / or epigenetic changes in Tregs exposed to the nucleic acid. In some embodiments, the condition treated by the nucleic acids of the present disclosure, e.g., BCYRN1 and / or its variants and / or derivatives, such as inflammatory disease, muscular dystrophy, or cardiac injury, is a condition responsive to the anti-inflammatory effects of IL-10. Without being bound by theory, nucleic acids such as BCYRN1 can suppress prohypertrophic and / or profibrotic signaling cascades, e.g., in injured tissue.
[0034] Without being bound by theory, as described above, it is believed that BCYRN1 and / or its variants and / or derivatives exhibit their therapeutic effects by behaving as miRNA "sponges" and inhibiting miRNA-138, miR-150, and miR-98. Without being bound by theory, the miRNA sponge may bind (or hybridize) to target miRNAs in a sequence-dependent manner and prevent the bound miRNA from exerting a physiological effect (e.g., suppressing expression from target mRNA). Thus, wherever BCYRN1 and / or its variants and / or derivatives are discussed in the present disclosure, any agent, e.g., nucleic acid, that specifically acts as a miRNA sponge for miRNA-138, miR-150, and miR-98 is also contemplated. In any of the treatment methods, in some embodiments, the treatment method contemplates administering a nucleic acid with miRNA sponge functionality for miRNA-138, miR-150, and miR-98.
[0035] In some embodiments, the nucleic acids of the present disclosure are chemically modified to increase stability, for example, in vivo and / or in vitro stability. In some embodiments, the nucleic acids of the present disclosure are chemically modified to reduce immunogenicity. In some embodiments, chemical modification of the nucleic acid increases the therapeutic activity of the nucleic acid. In some embodiments, the nucleic acids of the present disclosure have enhanced therapeutic efficacy compared to endogenously encoded RNA molecules. In some embodiments, the nucleic acids of the present disclosure can be provided in a composition (e.g., a pharmaceutical composition) or kit.
[0036] Therapeutic nucleic acids of the present disclosure can be administered by any suitable route, including, but not limited to, intravenous or oral. Provided herein are intravenous or oral formulations for the administration of nucleic acids of the present disclosure, such as BCYRN1 and / or its variants and / or derivatives, and their uses for the treatment of immune-related disorders or conditions associated with inflammation.
[0037] definition As used herein, the term "nucleic acid" or "oligonucleotide" refers to a molecule comprising a plurality of nucleotides (e.g., a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and an interchangeable organic base (either a substituted pyrimidine (e.g., cytosine (C), thymidine (T), or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G))). The term includes polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base-containing polymer. Purines and pyrimidines include, but are not limited to, adenine, cytosine, guanine, thymidine, inosine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally occurring and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties. Nucleic acids can include any other suitable modifications. Thus, the term nucleic acid also encompasses nucleic acids with substitutions or modifications, such as in the bases and / or sugars.
[0038] A polypeptide or nucleic acid molecule of the present disclosure may share a degree of sequence similarity or identity with a reference molecule (e.g., a reference polypeptide or reference polynucleotide), such as a molecule described in the art (e.g., an engineered or designed molecule or a wild-type molecule). The term "identity," as known in the art, refers to the relationship between two or more polypeptide or polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between two or more stretches of amino acid or nucleic acid residues, as determined by the number of matches between them. Identity measures the percent of identical matches between the smaller of two or more sequences, with gap alignments, if any, accommodated by a particular mathematical model or computer program (e.g., an "algorithm"). The identity of related peptides can be readily calculated by known methods. "Percent identity," as applied to polypeptide or polynucleotide sequences, is defined as the percentage of residues (amino acid residues or nucleic acid residues) in a candidate amino acid or nucleic acid sequence that are identical to the residues in the amino acid or nucleic acid sequence of a second sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Any suitable method and computer program for alignment can be used. It is understood that identity depends on the calculation of percent identity, but values may vary depending on gaps and penalties introduced into the calculation. Generally, a particular polynucleotide or polypeptide variant will have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide, as determined by sequence alignment programs and parameters described herein and known to those of skill in the art.Such alignment tools include the BLAST suite of tools (Stephen F. Altschul, et al (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402). Another common local alignment technique is based on the Smith-Waterman algorithm (Smith, TF & Waterman, MS (1981) "Identification of common molecular subsequences", J. Mol. Biol. 147:195-197). A common global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, SB & Wunsch, CD (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins", J. Mol. Biol. 48:443-453). More recently, the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed, which is believed to produce global alignments of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm. Other tools are described herein, particularly in the definition of "identity" below.
[0039] The term "identity" refers to the overall relatedness between polymer molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleic acid sequences can be performed, for example, by aligning the two sequences for optimal comparison purposes (e.g., for optimal alignment, gaps can be introduced into one or both of the first and second nucleic acid sequences, and non-identical sequences can be ignored for comparison purposes). In certain embodiments, the length of the sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. Nucleotides at corresponding nucleotide positions are then compared. If a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a suitable mathematical algorithm.For example, the percent identity between two nucleic acid sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, DW, ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, AM, and Griffin, HG, eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991 (each of which is incorporated herein by reference). For example, the percent identity between two nucleic acid sequences can be determined using the Meyers and Miller algorithm (CABIOS, 1989, 4:11-17), as incorporated into the ALIGN program (version 2.0), using a PAM 120 weighted residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percent identity between two nucleic acid sequences can be determined using the GAP program in the GCG software package, using the NWSgapdna.CMP matrix. Commonly used methods for determining percent identity between sequences include, but are not limited to, those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988), incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs.Exemplary computer software for determining homology between two sequences includes, but is not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).
[0040] The term "Watson-Crick base pairing" or "base pairing" refers to the formation of hydrogen bonds between specific pairs of nucleotide bases ("complementary base pairs"). For example, two hydrogen bonds form between adenine (A) and uracil (U), and three hydrogen bonds form between guanine (G) and cytosine (C). One way to assess the strength of a bond between two polynucleotides is by quantifying the percentage of bonds formed between guanine and cytosine bases ("GC content") of the two polynucleotides. In some embodiments, the GC content of the bond between two nucleic acids of a multimeric molecule (e.g., a multimeric mRNA molecule) is at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the GC content of the linkage between two nucleic acids in a multimeric molecule (e.g., a multimeric mRNA molecule) is between 10% and 70%, about 20% and about 60%, or about 30% and about 60%. The formation of a nucleic acid duplex by binding of complementary base pairs can also be referred to as "hybridization." Generally, two nucleic acids that share a complementary region can hybridize (e.g., via nucleic acid base pairing) to form a duplex structure under suitable conditions. The complementary region can vary in size. In some embodiments, the complementary region ranges from about 2 base pairs to about 100 base pairs in length. In some embodiments, the complementary region ranges from about 5 base pairs to about 75 base pairs in length. In some embodiments, the complementary region ranges from about 10 base pairs to about 50 base pairs in length. In some embodiments, the complementary region ranges from about 20 base pairs to about 30 base pairs in length.
[0041] "Isolated," as used herein with respect to isolated biomolecules, e.g., nucleic acids, has its ordinary and accustomed meaning to those of skill in the art in light of the present disclosure. Isolated biomolecules, e.g., isolated nucleic acids, are generally in a non-native environment or an environment in which the biomolecule would not be present but for human intervention of the biomolecule or its environment. In some embodiments, an isolated biomolecule is not inside a cell or organism.
[0042] "Extracellular vesicles" or "EVs," as used herein, have their ordinary and accustomed meaning as understood by those of skill in the art in light of the present disclosure. EVs include lipid bilayer structures produced by cells, and include exosomes, microvesicles, epididymosomes, argosomes, exosome-like vesicles, microparticles, promininosomes, prostasomes, dexosomes, texosomes, dex, tex, archeosomes, and oncosomes.
[0043] “Regulatory T cells” or “T reg "Cell" is used interchangeably herein and has its customary and ordinary meaning as understood by those of skill in the art in light of the present disclosure. reg The cells are anti-inflammatory T cells and T reg The cells can be characterized by the expression of cell surface markers that distinguish them from other immune cells (e.g., effector T cells, B cells, macrophages, NK cells, etc.). In some embodiments, T reg The cells are CD4 + , as well as at least CD25 + and FOXP3 + In some embodiments, T reg The cells are induced T reg Cells (iT reg In some embodiments, T reg Cells, e.g., iT reg Cells are naive CD4+ In some embodiments, the T cells are differentiated in vitro from T cells. reg Cells are in vivo T reg It is a cell.
[0044] "Subject," as used herein, refers to any vertebrate, including mammals and non-mammals. Subjects can include primates, such as humans, and non-primate mammals, such as rodents, livestock, or game animals. Non-primate mammals include mice, rats, hamsters, rabbits, dogs, foxes, wolves, cats, horses, cows, pigs, sheep, goats, camels, deer, buffalo, bison, and the like. Non-mammals include birds (e.g., chickens, ostriches, emus, pigeons), reptiles (e.g., snakes, lizards, turtles), amphibians (e.g., frogs, salamanders), fish (e.g., salmon, cod, pufferfish, tuna), and the like. The terms "individual," "patient," and "subject" are used interchangeably herein.
[0045] "Administering," as used herein, can include any suitable route of administering a therapeutic agent or composition as disclosed herein. Suitable routes of administration include, but are not limited to, oral, parenteral, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, dermal, injection, or topical administration. Administration can be local or systemic.
[0046] As used herein, "treating" and "treatment" include curing, ameliorating, ameliorating, reducing the severity of, preventing, slowing the progression of, and / or delaying the onset of a disease, condition, and / or symptoms thereof.
[0047] As used herein, a treatment can be considered "effective" or "therapeutically effective" if, following treatment with the methods described herein, one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically acceptable symptoms are improved or even ameliorated, or a desired response is induced (e.g., by at least 2%, 3%, 4%, 5%, 10%, or more). Efficacy can be assessed, for example, by measuring markers, indicators, symptoms, and / or incidence of a condition treated according to the methods described herein, or any other suitable measurable parameter, such as exercise endurance. Efficacy can also be measured by the individual's lack of deterioration as assessed by hospitalization or the need for medical intervention (e.g., halting the progression of the disease). Treatment includes any treatment of a disease or condition in an individual or animal (some non-limiting examples include humans or animals), including: (1) inhibiting the disease or condition, e.g., preventing the worsening of symptoms (e.g., pain or inflammation); or (2) alleviating the severity of the disease or condition, e.g., causing regression of symptoms. An effective amount for treating a disease or condition means an amount sufficient to, when administered to a subject in need thereof, effect effective treatment for that disease or condition, as that term is defined herein. The effectiveness of an agent can be determined by assessing physical indicators of the condition or desired response (e.g., muscle function, mass, or volume). One skilled in the art can monitor the effectiveness of administration and / or treatment by measuring any one or any combination of such parameters.
[0048] The term "effective amount" or "therapeutically effective amount," as used herein, refers to the amount of a composition or agent necessary to alleviate at least one or more symptoms of a disease or condition, and relates to an amount of a therapeutic composition sufficient to provide the desired effect. The term "effective amount" or "therapeutically effective amount" may refer to the amount of a composition or therapeutic agent sufficient to provide a particular anti-inflammatory and / or cardioprotective effect when administered to a typical subject. An effective amount, as used herein, can include, in various contexts, an amount sufficient to delay the onset of symptoms of a disease or condition, alter the course of symptoms of a disease or condition (e.g., but not limited to, slowing the progression of symptoms of a disease or condition), or reverse symptoms of a disease or condition. In some embodiments, a therapeutically effective amount is administered in one or more doses of a therapeutic agent. In some embodiments, a therapeutically effective amount is administered in a single dose or in multiple doses over a period of time.
[0049] As used herein, the phrases "physiologically compatible" and "pharmaceutically acceptable" are used interchangeably herein to refer to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. As used herein, "therapeutic" or "pharmaceutically acceptable" indicates that an item (e.g., a composition) is suitable for administration to a subject, e.g., a patient.
[0050] Definitions of common terms in cell and molecular biology are given in "The Merck Manual of Diagnosis and Therapy," 19 thEdition, published by Merck Research Laboratories, 2006 (ISBN 0-91 1910-19-0); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); Benjamin Lewin, Genes X, published by Jones & Bartlett Publishing, 2009 (ISBN-10: 0763766321); Kendrew et al. (eds.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8) and Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan et al., eds.
[0051] The singular terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly dictates otherwise. The abbreviation "eg" is used herein to indicate a non-limiting example. Thus, the abbreviation "eg" is synonymous with the term "for example." The term "about," when used herein to specify values and ranges, e.g., molecular weight, means that the stated value and / or range limits may vary within ±20%, e.g., within ±10%, e.g., within ±5%. The use of "about" before a number is inclusive of the number itself. For example, "about 5" provides an explicit basis for "5." Numbers provided in ranges include overlapping ranges and integers therebetween; for example, the ranges 1 to 4 and 5 to 7 include, for example, 1 to 7, 1 to 6, 1 to 5, 2 to 5, 2 to 7, 4 to 7, 1, 2, 3, 4, 5, 6, and 7.
[0052] Nucleic acid and BCYRN1-derived binding sequence (BDSS) Provided herein is an isolated nucleic acid comprising the nucleotide sequence of TIFF2025525333000005.tif35146 (SEQ ID NO: 17), or a variant or derivative thereof. In some embodiments, the nucleic acid is or comprises RNA. In some embodiments, the nucleic acid comprises a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% identical to SEQ ID NO: 17. In some embodiments, the nucleic acid comprises one or more binding sites for (e.g., sequences that hybridize to) miR-138, miR-150, or miR-98. In some embodiments, the nucleic acid comprises at least ACAAC (SEQ ID NO: 18) and / or GGGAG (SEQ ID NO: 19). In some embodiments, the nucleotide sequence of the nucleic acid is or comprises SEQ ID NO: 17 or a sequence variant thereof. In some embodiments, the nucleotide sequence of the nucleic acid is SEQ ID NO: 17 or a derivative thereof having 1, 2, 3, 4, or 5 substitutions. Nucleic acids comprising a subsequence of SEQ ID NO: 17 are also provided. The subsequence of SEQ ID NO: 17 can be of any suitable length. In some embodiments, the subsequence of SEQ ID NO: 17 is 35 nucleotides (nt) in length, is about 35 nucleotides (nt) in length, or is up to 35 nucleotides (nt) in length. In some embodiments, the subsequence of SEQ ID NO: 17 is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nt in length or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nt in length. In some embodiments, the nucleic acid is up to 35 nt in length, hi some embodiments, the nucleic acid is 15-35 nt in length or 21-35 nt in length.
[0053] Also provided are BCYRN1-derived binding sequences (BDSS) or BDSS compounds comprising a subsequence of SEQ ID NO: 17. In some embodiments, the BDSS or BDSS compound is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length. In some embodiments, the BDSS or BDSS compound (e.g., BDSS-138) comprises a subsequence of residues 170-190 of SEQ ID NO: 17 that is 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length, or at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length. In some embodiments, a BDSS or BDSS compound (e.g., BDSS-150) comprises a subsequence of residues 43-63 of SEQ ID NO: 17. In some embodiments, a BDSS or BDSS compound (e.g., BDSS-98) comprises a subsequence of residues 167-187 of SEQ ID NO: 17.
[0054] In some embodiments, BDSS-138 is or includes rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrCrC (SEQ ID NO: 14). As used herein, the designation of a nucleic acid sequence including an "r" adjacent to one of the bases (A, U, G, or C) indicates that the sugar backbone is ribose (e.g., the nucleic acid containing the sequence is RNA). Without being bound by theory, BDSS-138 may act as a sponge for miR-138, which in turn can suppress the expression of ATG-7, which mediates autophagy, which is involved in the survival and proliferation of Treg cells. In some embodiments, BDSS-150 is or comprises rGrArGrGrCrUrArArGrArGrGrCrGrGrArGrArGrArU (SEQ ID NO: 15). Without being bound by theory, BDSS-150 may act as a sponge for miR-150, which in turn can suppress expression of CCR6, which mediates Treg cell migration. In some embodiments, BDSS-98 is or comprises rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArCrC (SEQ ID NO: 16). Without being bound by theory, BDSS-98 may act as a sponge for miR-98, which in turn can suppress expression of IL-10, an anti-inflammatory cytokine produced by Treg cells.
[0055] Provided herein is an isolated nucleic acid or BDSS (e.g., BDSS-138) comprising the nucleotide sequence of UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11) or a derivative (e.g., sequence variant) thereof. In some embodiments, the nucleic acid is or comprises RNA. In some embodiments, the BDSS is or comprises RNA. In some embodiments, the nucleic acid or BDSS comprises a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% identical to UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11). In some embodiments, the nucleic acid or BDSS comprises at least ACAAC (SEQ ID NO: 18). In some embodiments, the nucleotide sequence of the nucleic acid or BDSS is UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11) or a sequence variant thereof. In some embodiments, the nucleotide sequence of the nucleic acid or BDSS is UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), or a derivative thereof having 1, 2, 3, 4, or 5 substitutions. The nucleic acid or BDSS can be of any suitable length. In some embodiments, the nucleic acid or BDSS is 35 nucleotides (nt) in length, is about 35 nucleotides (nt) in length, or is up to 35 nucleotides (nt) in length. In some embodiments, the nucleic acid or BDSS is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 , 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length, or up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length. In some embodiments, the nucleic acid or BDSS compound is about 15-35 nt in length or about 21-35 nt in length.In some embodiments, the BDSS (eg, BDSS-138) comprises the nucleotide sequence UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), or a sequence at least 90% identical thereto, and is no more than 35 nucleotides in length.
[0056] Provided herein is an isolated nucleic acid or BDSS (e.g., BDSS-150) comprising the nucleotide sequence of GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12) or a derivative (e.g., sequence variant) thereof. In some embodiments, the nucleic acid is or comprises RNA. In some embodiments, the BDSS is or comprises RNA. In some embodiments, the nucleic acid or BDSS comprises a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% identical to GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12). In some embodiments, the nucleic acid or BDSS comprises at least GGGAG (SEQ ID NO: 19). In some embodiments, the nucleotide sequence of the nucleic acid is GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12) or a sequence variant thereof. In some embodiments, the nucleotide sequence of the nucleic acid is GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12) or a derivative having 1, 2, 3, 4, or 5 substitutions thereto. The nucleic acid can be of any suitable length. In some embodiments, the nucleic acid is 35 nucleotides (nt) in length, about 35 nucleotides (nt) in length, or up to 35 nucleotides (nt) in length. In some embodiments, the nucleic acid or BDSS is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 , 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length, or up to 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length. In some embodiments, the nucleic acid or BDSS is about 15-35 nt in length or about 21-35 nt in length.In some embodiments, the BDSS (eg, BDSS-150) comprises the nucleotide sequence GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), or a sequence at least 90% identical thereto, and is no more than 35 nucleotides in length.
[0057] Provided herein is an isolated nucleic acid or BDSS (e.g., BDSS-98) comprising the nucleotide sequence of ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13) or a derivative (e.g., sequence variant) thereof. In some embodiments, the nucleic acid is or comprises RNA. In some embodiments, the BDSS is or comprises RNA. In some embodiments, the nucleic acid or BDSS comprises a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% identical to ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13). In some embodiments, the nucleic acid or BDSS comprises at least ACAAC (SEQ ID NO: 18). In some embodiments, the nucleotide sequence of the nucleic acid is ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13) or a sequence variant thereof. In some embodiments, the nucleotide sequence of the nucleic acid is ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13) or a derivative having 1, 2, 3, 4, or 5 substitutions thereto. Nucleic acids can be of any suitable length. In some embodiments, the nucleic acid or BDSS is 35 nucleotides (nt) in length, about 35 nucleotides (nt) in length, or up to 35 nucleotides (nt) in length. In some embodiments, the nucleic acid or BDSS compound is 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length, or about 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length. In some embodiments, the nucleic acid or BDSS is about 21-50 nt in length or about 21-35 nt in length.In some embodiments, the BDSS (eg, BDSS-98) comprises the nucleotide sequence ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a sequence at least 90% identical thereto, and is no more than 35 nucleotides in length.
[0058] Provided herein are BDSS compounds comprising BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrCrC) (SEQ ID NO: 14) or a derivative (e.g., sequence variant) thereof. In some embodiments, the BDSS compound comprises a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% identical to BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrC) (SEQ ID NO: 14). In some embodiments, the BDSS compound comprises at least the sequence ACAAC (SEQ ID NO: 18). In some embodiments, the BDSS compound is BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrC) (SEQ ID NO: 14) or a sequence variant thereof. In some embodiments, the BDSS compound is BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrCrC) (SEQ ID NO: 30), or a derivative thereof having one, two, three, four, or five substitutions. BDSS compounds can comprise a nucleotide sequence of any suitable length. In some embodiments, the BDSS compound comprises a nucleotide sequence that is 35 nucleotides (nt) in length, is about 35 nucleotides (nt) in length, or is at most 35 nucleotides (nt) in length. In some embodiments, the BDSS compounds are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, , 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length, or at most 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length.In some embodiments, the BDSS compound comprises a nucleotide sequence that is about 15-35 nt in length or about 21-35 nt in length.
[0059] Provided herein are BDSS compounds comprising BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrGrArGrArGrArU) (SEQ ID NO: 15) or a derivative (e.g., sequence variant) thereof. In some embodiments, the BDSS compound comprises a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% identical to BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrGrArGrArU) (SEQ ID NO: 15). In some embodiments, the BDSS compound comprises the sequence GGGAG (SEQ ID NO: 19). In some embodiments, the BDSS compound is BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrGrArGrArGrArU) (SEQ ID NO: 15) or a sequence variant thereof. In some embodiments, the BDSS compound is BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrGrArGrArU) (SEQ ID NO: 15), or a derivative thereof having one, two, three, four, or five substitutions. BDSS compounds can comprise a nucleotide sequence of any suitable length. In some embodiments, the BDSS compound comprises a nucleotide sequence that is 35 nucleotides (nt) in length, is about 35 nucleotides (nt) in length, or is up to 35 nucleotides (nt) in length. In some embodiments, the BDSS compounds are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, , 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length, or at most 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length.In some embodiments, the BDSS compound comprises a nucleotide sequence that is about 15-35 nt in length or about 21-35 nt in length.
[0060] Provided herein are BDSS compounds comprising BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArArCrC) (SEQ ID NO: 16) or a derivative (e.g., sequence variant) thereof. In some embodiments, the BDSS compound comprises a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%, or 99% identical to BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArArCrC) (SEQ ID NO: 16). In some embodiments, the BDSS compound comprises the sequence ACAAC (SEQ ID NO: 18). In some embodiments, the BDSS compound is BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArArCrC) (SEQ ID NO: 16) or a sequence variant thereof. In some embodiments, the BDSS compound is BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArCrC) (SEQ ID NO: 32), or a derivative thereof having one, two, three, four, or five substitutions. BDSS compounds can comprise a nucleotide sequence of any suitable length. In some embodiments, the BDSS compound comprises a nucleotide sequence that is 35 nucleotides (nt) in length, is about 35 nucleotides (nt) in length, or is up to 35 nucleotides (nt) in length. In some embodiments, the BDSS compounds are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, , 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length, or at most 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nt in length.In some embodiments, the BDSS compound comprises a nucleotide sequence that is about 15-35 nt in length or about 21-35 nt in length.
[0061] Also provided are inhibitory nucleic acids (e.g., miRNA sponges) that bind to miR-138, miR-150, and / or miR-98. In some embodiments, the inhibitory nucleic acid binds to miR-138, miR-150, and / or miR-98 and inhibits their function (e.g., prevents, suppresses, or promotes expression of one or more genes targeted by the respective miRNA). In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to at least a portion of one or more of miR-138, miR-150, and / or miR-98 such that the inhibitory nucleic acid binds to (or hybridizes with) the respective miRNA. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a portion of a target miRNA that is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a contiguous portion of a target miRNA that is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence having two or more (e.g., 2, 3, 4 or more) regions of complementarity to a target miRNA (e.g., each region separated by at least one non-complementary nucleotide), and the total length of complementarity is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length.In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence having two or more (e.g., 2, 3, 4, or more) regions of complementarity (e.g., each region separated by at least one non-complementary nucleotide) to a corresponding colinear portion of a target miRNA, and the total length of complementarity is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a portion of the target miRNA that is about 5-20 nucleotides in length, about 5-15 nucleotides in length, or about 5-10 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises one or more binding sites for (e.g., sequences that hybridize to) miR-138, miR-150, or miR-98. In some embodiments, the inhibitory nucleic acid that binds to miR-138 or miR-98 comprises ACAAC (SEQ ID NO: 18). In some embodiments, the inhibitory nucleic acid that binds to miR-150 comprises GGGAG (SEQ ID NO: 19).
[0062] In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to at least a portion of miR-138. In some embodiments, the inhibitory nucleic acid that binds to miR-138 inhibits repression of ATG-7 expression by miR-138 in cells (e.g., Tregs). In some embodiments, the miR-138 is human miR-138. In some embodiments, the nucleic acid binds to hsa-miR-138-5p, which has the nucleotide sequence 5'-agcugguguugugaaucaggccg-3' (SEQ ID NO: 7). In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a portion of miR-138 (e.g., hsa-miR-138-5p) that is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence having two or more (e.g., 2, 3, 4 or more) regions of complementarity (e.g., each region separated by at least one non-complementary nucleotide) to miR-138 (e.g., hsa-miR-138-5p), and the total length of complementarity is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence having two or more (e.g., 2, 3, 4 or more) regions of complementarity (e.g., each region separated by at least one non-complementary nucleotide) to a corresponding colinear portion of miR-138 (e.g., hsa-miR-138-5p), and the total length of complementarity is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length.In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a portion of miR-138 (e.g., hsa-miR-138-5p) that is about 5-20 nucleotides in length, about 5-15 nucleotides in length, or about 5-10 nucleotides in length. In some embodiments, the nucleic acid comprises one or more miR-138 binding sites. In some embodiments, the nucleic acid comprises ACAAC (SEQ ID NO: 18).
[0063] In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to at least a portion of miR-150. In some embodiments, the inhibitory nucleic acid that binds to miR-150 inhibits the repression of CCR6 expression by miR-150 in cells (e.g., Tregs). In some embodiments, the miR-150 is human miR-150. In some embodiments, the nucleic acid binds to hsa-miR-138-5p, which has the nucleotide sequence 5'-ucucccaacccuuguaccagug-3' (SEQ ID NO: 9). In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a portion of miR-150 (e.g., hsa-miR-150-5p) that is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a contiguous portion of miR-150 (e.g., hsa-miR-150-5p) that is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence having two or more (e.g., 2, 3, 4 or more) regions of complementarity (e.g., each region separated by at least one non-complementary nucleotide) to miR-150 (e.g., hsa-miR-150-5p), and the total length of complementarity is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length.In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence having two or more (e.g., 2, 3, 4 or more) regions of complementarity (e.g., each region separated by at least one non-complementary nucleotide) to a corresponding colinear portion of miR-150 (e.g., hsa-miR-150-5p), and the total length of complementarity is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a portion of miR-150 (e.g., hsa-miR-150-5p) that is about 5-20 nucleotides in length, about 5-15 nucleotides in length, or about 5-10 nucleotides in length. In some embodiments, the nucleic acid comprises one or more miR-150 binding sites. In some embodiments, the nucleic acid comprises GGGAG (SEQ ID NO: 19).
[0064] In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to at least a portion of miR-98. In some embodiments, the inhibitory nucleic acid that binds to miR-98 inhibits the suppression of IL-10 expression by miR-98 in cells (e.g., Tregs). In some embodiments, the miR-98 is human miR-98. In some embodiments, the nucleic acid binds to hsa-miR-98-5p, which has the nucleotide sequence 5'-ugagguaguaaguuguauuguu-3' (SEQ ID NO: 10). In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a portion of miR-98 (e.g., hsa-miR-98-5p) that is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a contiguous portion of miR-98 (e.g., hsa-miR-98-5p) that is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence having two or more (e.g., 2, 3, 4 or more) regions of complementarity (e.g., each region separated by at least one non-complementary nucleotide) to miR-98 (e.g., hsa-miR-98-5p), and the total length of complementarity is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length.In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence having two or more (e.g., 2, 3, 4 or more) regions of complementarity (e.g., each region separated by at least one non-complementary nucleotide) to a corresponding colinear portion of miR-98 (e.g., hsa-miR-98-5p), and the total length of complementarity is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length, or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides in length. In some embodiments, the inhibitory nucleic acid comprises a nucleotide sequence complementary to a portion of miR-98 (e.g., hsa-miR-98-5p) that is about 5-20 nucleotides in length, about 5-15 nucleotides in length, or about 5-10 nucleotides in length. In some embodiments, the nucleic acid comprises one or more miR-98 binding sites. In some embodiments, the nucleic acid comprises ACAAC (SEQ ID NO: 18).
[0065] Nucleic acids of the present disclosure may be single-stranded or double-stranded (e.g., RNA / DNA hybrids). In some embodiments, a nucleic acid is single-stranded. As used herein, "single-stranded" indicates that a nucleic acid is composed of one continuous molecule of nucleic acid. In some embodiments, a single-stranded nucleic acid can have regions of self-complementarity, such that complementary regions within the molecule can hybridize to each other under suitable conditions (e.g., to form a hairpin loop).
[0066] In some embodiments, the isolated nucleic acids of the present disclosure comprise one or more chemically modified nucleotides, e.g., nucleotides with modified backbones. Generally, the chemical modification(s) substantially maintain or enhance the therapeutic efficacy of the nucleic acid. Any suitable number of nucleotides in the nucleic acid can be chemically modified. In some embodiments, the nucleic acid comprises 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, 34 or more, or 35 or more chemically modified nucleotides. In some embodiments, the nucleic acid comprises 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, or 1 to 35 chemically modified nucleotides. In some embodiments, the nucleic acid comprises 1 to 10 chemically modified nucleotides. In some embodiments, the nucleic acid comprises 8 chemically modified nucleotides. In some embodiments, the nucleic acid comprises 6 chemically modified nucleotides.
[0067] Chemically modified nucleotides may be distributed along the isolated nucleic acid or BDSS compound in any suitable manner. In some embodiments, the nucleic acid comprises at least one chemically modified nucleotide within the first half of the nucleic acid, e.g., the 5' half of the nucleic acid. In some embodiments, the nucleic acid comprises at least one chemically modified nucleotide within the second half of the nucleic acid, e.g., the 3' half of the nucleic acid. In some embodiments, the nucleic acid comprises at least one chemically modified nucleotide within the first half of the nucleic acid, e.g., the 5' half of the nucleic acid, and at least one chemically modified nucleotide within the second half of the nucleic acid, e.g., the 3' half of the nucleic acid. In some embodiments, the nucleic acid comprises one or more chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides from the 5' end of the nucleic acid. In some embodiments, the nucleic acid comprises one or more chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides from the 3' end of the nucleic acid. In some embodiments, two chemically modified nucleotides are not adjacent to each other in the nucleic acid. In some embodiments, the nucleic acid comprises 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 5' end of the nucleic acid. In some embodiments, the nucleic acid comprises 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 3' end of the nucleic acid. In some embodiments, the nucleic acid comprises the same number of chemically modified nucleotides in the 5' and 3' halves of the nucleic acid. In some embodiments, the nucleic acid comprises three chemically modified nucleotides within five nucleotides from the 5' end of the nucleic acid and / or three chemically modified nucleotides within five nucleotides from the 3' end of the nucleic acid.
[0068] In some embodiments, the chemically modified nucleotide is in the nucleotide sequence of (SEQ ID NO: 17), or a sequence variant thereof. In some embodiments, the chemically modified nucleotide is in the nucleotide sequence of UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), or a sequence variant thereof. In some embodiments, the chemically modified nucleotide is in the nucleotide sequence of GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), or a sequence variant thereof. In some embodiments, the chemically modified nucleotide is in the nucleotide sequence of ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a sequence variant thereof. In some embodiments, the chemically modified nucleotide is in the nucleotide sequence of rUrCrCrCrUrCrArArArGrCrArArCrArCrCrCrCrC (SEQ ID NO: 14), or a sequence variant thereof. In some embodiments, the chemically modified nucleotide is in the nucleotide sequence of rGrArGrGrCrUrArArArGrArGrCrGrGrGrArGrGrArU (SEQ ID NO: 15), or a sequence variant thereof. In some embodiments, the chemically modified nucleotides are within the nucleotide sequence of rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArArCrC (SEQ ID NO: 16) or a sequence variant thereof. In some embodiments, the nucleic acid comprises one or more chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 5' end of the nucleotide sequence. In some embodiments, the nucleic acid comprises one or more chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 3' end of the nucleotide sequence. In some embodiments, two chemically modified nucleotides are not adjacent to each other in the nucleotide sequence. In some embodiments, the nucleic acid comprises 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 10 nucleotides from the 5' end of the nucleotide sequence, respectively. In some embodiments, the nucleic acid comprises 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides from the 3' end of the nucleotide sequence, respectively.In some embodiments, the nucleic acid comprises the same number of chemically modified nucleotides in the 5' and 3' halves of the nucleotide sequence. In some embodiments, the nucleic acid comprises three chemically modified nucleotides within five nucleotides from the 5' end of the nucleotide sequence and / or three chemically modified nucleotides within five nucleotides from the 3' end of the nucleotide sequence. In some embodiments, the nucleic acid comprises different numbers of chemically modified nucleotides in the 5' and 3' halves of the nucleotide sequence. In some embodiments, the nucleic acid comprises a greater number of chemically modified nucleotides in the 3' half than in the 5' half of the nucleotide sequence. In some embodiments, the nucleic acid comprises three chemically modified nucleotides within five nucleotides from the 5' end of the nucleotide sequence and / or three, four, or five chemically modified nucleotides within five nucleotides from the 3' end of the nucleotide sequence.
[0069] In some embodiments, the chemically modified nucleotide(s) increase the in vitro and / or in vivo stability of the nucleic acid, hi some embodiments, the chemically modified nucleotides increase the therapeutic efficacy of the nucleic acid, for example, for treating an immune-related disorder, e.g., an inflammatory condition, myocarditis, or myocardial infarction.
[0070] In some embodiments, the isolated nucleic acid or BDSS compound comprises one or more different types of chemically modified nucleotides. In some embodiments, the chemically modified nucleotide has a methylene bridge connecting the 2'-O atom and the 4'-C atom of the nucleotide sugar ring to lock the conformation (locked nucleic acid (LNA)). In some embodiments, the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 17 or a sequence variant thereof, wherein one or more nucleotides are LNA. In some embodiments, the isolated nucleic acid has the nucleotide sequence of SEQ ID NO: 17 or a sequence variant thereof, wherein one or more positions are LNA. In some embodiments, the chemically modified nucleotide comprises a modified sugar. In some embodiments, the chemically modified nucleotide comprises methylation. In some embodiments, the modification is the introduction of a 2'-O-methyl or 2'-O-methoxyethyl group, or a 2' fluoride group into the nucleic acid, for example, to improve nuclease resistance and binding affinity to RNA, e.g., miR. In some embodiments, the chemically modified nucleotide comprises 2'-O-methylation.
[0071] In some embodiments, the chemically modified nucleotide comprises a modified nucleobase. In some embodiments, the modified nucleobase in the nucleic acid is selected from the group consisting of 1-methyl-pseudouridine (m1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (ψ), α-thio-guanosine, and α-thio-adenosine. In some embodiments, the polynucleotide comprises a combination of at least one (e.g., 1, 2, 3, 4, or more) modified nucleobase. In some embodiments, the nucleic acid comprises pseudouridine (ψ), 5-methoxy-uridine (mo5U), pseudouridine (ψ), and / or 5-methyl-cytidine (m5C). In some embodiments, the nucleic acid comprises 1-methyl-pseudouridine (m1ψ). In some embodiments, the nucleic acid comprises 1-methyl-pseudouridine (m1ψ) and 5-methyl-cytidine (m5C). In some embodiments, the nucleic acid comprises 5-methoxy-uridine (mo5U).
[0072] In some embodiments, nucleic acids are uniformly modified with a particular modification (e.g., fully modified, modified throughout the entire sequence). For example, a polynucleotide may be uniformly modified with 1-methyl-pseudouridine (m1ψ), meaning that all uracil residues in the sequence are replaced with 1-methyl-pseudouridine (m1ψ). Similarly, nucleic acids may be uniformly modified with any type of nucleoside residue present in the sequence, replacing it with a modified residue, such as those described above.
[0073] In some embodiments, nucleobases and nucleosides having modified cytosine include, but are not limited to, N4-acetyl-cytidine (ac4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, 2-thio-cytidine (s2C), and 2-thio-5-methyl-cytidine. In some embodiments, the modified nucleobase is a modified uridine. Exemplary nucleobases and nucleosides having modified uridine (in some embodiments, the modified nucleobase is a modified cysteine) include, but are not limited to, 5-cyanouridine and 4'-thiouridine. In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having modified adenines include, but are not limited to, 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), and N6-methyl-adenosine (m6A). In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having modified guanine include, but are not limited to, inosine (1), 1-methyl-inosine (m1I), wiosine (imG), methylwiosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine.
[0074] In some embodiments, the isolated nucleic acid comprises the nucleotide sequence UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11) or a sequence variant thereof, wherein one or more positions are chemically modified (e.g., LNA or methylated). In some embodiments, the isolated nucleic acid has the nucleotide sequence UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11) wherein one or more positions are chemically modified (e.g., LNA or methylated).
[0075] In some embodiments, the isolated nucleic acid comprises the nucleotide sequence GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12) or a sequence variant thereof, wherein one or more positions are chemically modified (e.g., LNA or methylated). In some embodiments, the isolated nucleic acid has the nucleotide sequence GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12) wherein one or more positions are chemically modified (e.g., LNA or methylated).
[0076] In some embodiments, the isolated nucleic acid comprises the nucleotide sequence ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13) or a sequence variant thereof, wherein one or more positions are chemically modified (e.g., LNA or methylated). In some embodiments, the isolated nucleic acid has the nucleotide sequence ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13) wherein one or more positions are chemically modified (e.g., LNA or methylated).
[0077] In some embodiments, the BDSS compound comprises BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrCrC) (SEQ ID NO: 14) or a sequence variant thereof, wherein one or more positions are chemically modified (e.g., LNA or methylated). In some embodiments, the BDSS compound is BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrCrC) (SEQ ID NO: 14) wherein one or more positions are chemically modified (e.g., LNA or methylated).
[0078] In some embodiments, the BDSS compound comprises BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrGrArGrArGrArU) (SEQ ID NO: 15) or a sequence variant thereof, wherein one or more positions are chemically modified (e.g., LNA or methylated). In some embodiments, the BDSS compound is BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrGrArGrArU) (SEQ ID NO: 15) wherein one or more positions are chemically modified (e.g., LNA or methylated).
[0079] In some embodiments, the BDSS compound comprises BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArArCrC) (SEQ ID NO: 16) or a sequence variant thereof, wherein one or more positions are chemically modified (e.g., LNA or methylated). In some embodiments, the BDSS compound is BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArArCrC) (SEQ ID NO: 16) wherein one or more positions are chemically modified (e.g., LNA or methylated).
[0080] The isolated nucleic acid may, in some embodiments, comprise any suitable chemical modification. In some embodiments, the chemical modification is a backbone modification, e.g., a sugar / phosphate backbone modification. In some embodiments, the chemical modification is a backbone sugar modification. In some embodiments, the chemically modified nucleotide comprises an LNA. In some embodiments, the chemically modified nucleotide comprises a methylation. In some embodiments, the chemical modification comprises the introduction of a phosphorothioate group as an internucleotide linker. Suitable backbone modifications of chemically modified nucleotides include, but are not limited to, phosphorothioates, phosphotriesters, methylphosphonates, short-chain alkyl or cycloalkyl intersugar linkages, or short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, the chemical modification is a base modification.
[0081] The nucleic acids of the present disclosure can be prepared using any suitable option. Suitable options include, but are not limited to, chemical synthesis, enzymatic production, and / or biological production. In some embodiments, the nucleic acids are prepared using chemical synthesis. Any suitable option for chemically synthesizing nucleic acids can be used. Suitable options include, but are not limited to, phosphodiesters, phosphotriesters, phosphoramidites, phosphite-triesters, and solid-phase synthesis approaches. In some embodiments, preparing the nucleic acids comprises in vitro transcription. In some embodiments, the nucleic acids are prepared using recombinant DNA technology. In some embodiments, the nucleic acids are prepared by chemically modifying an unmodified nucleic acid having a desired nucleotide sequence.
[0082] vector Also provided are vectors (e.g., plasmids) or populations of vectors encoding any one or more of the nucleic acids of the present disclosure. In some embodiments, the vector comprises a nucleic acid sequence encoding an RNA comprising BCYRN1 having the sequence of SEQ ID NO: 17 or a derivative thereof. In some embodiments, the vector comprises a nucleic acid sequence encoding an RNA comprising at least one of the following sequences: UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), and ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13). A vector can encode any suitable number of RNA transcripts. In some embodiments, a single vector encodes a single RNA transcript (e.g., comprising any one of SEQ ID NOs: 11-13). In some embodiments, a single vector encodes two or more different RNA transcripts (e.g., each comprising any one of SEQ ID NOs: 11-13). In some embodiments, the RNAs each comprising SEQ ID NOs: 11-13 are encoded on separate vectors (e.g., three separate vectors). In some embodiments, RNAs comprising at least one of SEQ ID NOs: 11-13 are each encoded on a single vector (eg, as one, two, or three different transcripts).
[0083] In some embodiments, the vector comprises one or more regulatory sequences (e.g., a promoter, a transcription terminator, etc.) configured to express the encoded RNA in a desired environment. In some embodiments, a nucleic acid sequence encoding an RNA comprising BCYRN1 or a derivative thereof having the sequence of SEQ ID NO: 17 is operably linked to a regulatory sequence (e.g., a promoter). In some embodiments, a nucleic acid sequence encoding an RNA comprising at least one of the following sequences: UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), and ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13) is operably linked to a regulatory sequence (e.g., a promoter). In some embodiments, the vector comprises a CMV promoter. In some embodiments, the promoter is a tissue- or cell-type-specific promoter. In some embodiments, the promoter is a conditional promoter. In some embodiments, the vector is a viral vector, such as, but not limited to, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, or a herpes viral vector.
[0084] composition Also provided herein are compositions (e.g., therapeutic compositions) comprising the nucleic acids or BDSS compounds or inhibitory nucleic acids of the present disclosure.
[0085] Provided herein are therapeutic compositions comprising at least one nucleic acid comprising a BDSS (BCYRN1-derived binding sequence) (e.g., one, two, or three, or more), wherein the BDSS comprises a nucleotide sequence provided by any one of SEQ ID NOs: 11-16, or a sequence at least 90% (e.g., at least 95%, or at least 97%, or about 100%) identical thereto, and each of the at least one nucleic acid is 35 nucleotides or less in length (e.g., 35, 30, 25, 24, 23, 22, or 21 nucleotides or less in length). The composition may comprise any suitable BDSS (e.g., BDSS-138, BSS-150, BDSS-98) or BDSS compound, or may comprise any suitable nucleic acid described herein. In some embodiments, the composition comprises at least two of BDSS-138, BDSS-150, and BDSS-98 (e.g., at least BDSS-138 and BDSS-150, at least BDSS-138 and BDSS-98, or at least BDSS-150 and BDSS-98). In some embodiments, the composition comprises at least three BDSS or BDSS compounds (e.g., BDSS-138, BDSS-150, and BDSS-98).
[0086] Also provided are therapeutic compositions comprising at least one nucleic acid comprising a BDSS (BCYRN1-derived binding sequence) (e.g., one, two, or three or more) for treating an immune and / or inflammatory disorder, wherein the BDSS comprises a nucleotide sequence provided by any one of SEQ ID NOS: 11-16, or a derivative having one, two, three, four, or five substitutions thereto. In some embodiments, the BDSS or BDSS compound comprises at least one of BDSS-138, BDSS-150, and BDSS-98, or a derivative having one, two, three, four, or five substitutions thereto. In some embodiments, the BDSS or BDSS compound comprises a nucleotide sequence comprising at least one of SEQ ID NOS: 11-13, or a derivative having one, two, three, four, or five substitutions thereto. In some embodiments, the BDSS or BDSS compound comprises a nucleotide sequence comprising at least one of SEQ ID NOS: 11-13, or a derivative having at least 80% sequence identity thereto.
[0087] Provided herein are therapeutic compositions comprising at least one inhibitory nucleic acid that binds to at least one (e.g., one, two, or three) of miR-138, miR-150, and miR-98, respectively, wherein the at least one nucleic acid is up to 35 nucleotides in length. In some embodiments, the composition comprises a first inhibitory nucleic acid that binds to miR-138, a second inhibitory nucleic acid that binds to miR-150, and a third inhibitory nucleic acid that binds to miR-98, each of the first, second, and third inhibitory nucleic acids being up to 35 nucleotides in length. In some embodiments, the composition comprises at least two of the first, second, and third inhibitory nucleic acids. In some embodiments, the composition comprises the first, second, and third inhibitory nucleic acids. In some embodiments, the inhibitory nucleic acid that binds to (e.g., hybridizes with) miR-138 or miR-98 comprises ACAAC (SEQ ID NO: 18). In some embodiments, the inhibitory nucleic acid that binds to (eg, hybridizes to) miR-150 comprises GGGAG (SEQ ID NO: 19).
[0088] The following long non-coding RNAs: TIFF2025525333000006.tif28158 (SEQ ID NO: 17) Also provided are therapeutic compositions comprising one or more synthetic derivatives of the long non-coding RNA, wherein the derivative is 35 nucleotides or less in length, and wherein the synthetic derivative enhances Treg functionality. The synthetic derivative of the long non-coding RNA can be any suitable derivative that provides enhanced Treg functionality, for example, when administered to a subject in need thereof or when administered to Treg cells in vitro. In some embodiments, the synthetic derivative enhances Treg functionality by enhancing Treg cell proliferation, migration, and / or IL10 production.
[0089] Also provided is a therapeutic composition comprising a first BDSS (BCYRN1-derived binding sequence) compound provided by SEQ ID NO: 11 and having a length of 35 nucleotides or less, a second BDSS compound provided by SEQ ID NO: 12 and having a length of 35 nucleotides or less, a third BDSS compound provided by SEQ ID NO: 13 and having a length of 35 nucleotides or less, and a pharmaceutically acceptable excipient.
[0090] In some embodiments, the composition is a pharmaceutical composition or a therapeutic composition. In some embodiments, the composition comprises a pharmaceutically acceptable excipient. In some embodiments, the composition is a cell-free composition, e.g., the composition is substantially free of cells such as CDCs. In some embodiments, the composition is a composition free of extracellular vesicles, e.g., the composition is substantially free of extracellular vesicles such as exosomes. In some embodiments, the composition comprises extracellular vesicles combined with nucleic acids.
[0091] Some non-limiting examples of materials that can function as pharmaceutically acceptable excipients include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; and (10) glycols, such as propylene glycol. (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffer solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids, (23) serum components, such as serum albumin, HDL, and LDL; (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic, compatible substances used in pharmaceutical formulations.
[0092] In some embodiments, the composition includes a transfection reagent, for example, to facilitate delivery of the nucleic acid to a target cell target (in vitro or in vivo). Any suitable transfection reagent may be included in the composition. Suitable transfection reagents include, but are not limited to, liposomes, lipid nanoparticles (LNPs), extracellular vesicles (EVs), and polyethylene glycol (PEG)-cationic lipid complexes (PCLCs). In some embodiments, the transfection reagent includes a lipid (e.g., a liposome-forming lipid) or a PEGylated lipid. In some embodiments, the lipid is a cationic lipid, as provided herein. In some embodiments, the transfection reagent includes DharmaFECT® or Lipofectamine®. In some embodiments, the nucleic acid of the present disclosure is formulated with a transfection reagent in the composition to facilitate cellular uptake and / or pharmacokinetics of the nucleic acid. In some embodiments, the transfection reagent is an LNP.
[0093] Liposomes are artificially prepared vesicles that may be composed primarily of lipid bilayers and can be used as delivery vehicles for the administration of pharmaceutical formulations. Liposomes can be of various sizes, including, but not limited to, multilamellar vesicles (MLVs) (which may be hundreds of nanometers in diameter and contain a series of concentric bilayers separated by narrow aqueous compartments), small single-cell vesicles (SUVs) (which may be smaller than 50 nm in diameter), and large unilamellar vesicles (LUVs) (which may be between 50 and 500 nm in diameter). Liposome designs can include, but are not limited to, opsonins or ligands to improve attachment of liposomes to target tissues / cells or to activate events such as, but not limited to, endocytosis. Liposomes can also contain low or high pH to improve delivery of cargo, such as the nucleic acids of the present disclosure.
[0094] In some embodiments, the composition comprises liposomes such as, but not limited to, 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), 1,2-dilinoleyloxy-3-dimethylaminopropane (Dlin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (Dlin-KC2-DMA), and MC3, and liposomes such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).
[0095] In some embodiments, the composition comprises a cationic lipid. Any suitable cationic lipid can be used in the composition. Suitable cationic lipids include, but are not limited to, Dlin-DMA, Dlin-D-DMA, Dlin-MC3-DMA, Dlin-KC2-DMA, DODMA, and amino alcohol lipids. In some embodiments, the composition comprises a cationic lipid complex, such as a polyethylene glycol (PEG)-cationic lipid complex (PCLC). In some embodiments, the cationic lipid is PEGylated (e.g., 2 kDa PEG) ("PEG2000"). Any suitable option can be used to PEGylate the cationic lipid. In some embodiments, the PCLC is formed by exposing a mixture of PEG and cationic lipid to one or more freeze / thaw cycles, for example, 1, 2, 3, 4, 5, or more freeze / thaw cycles. In some embodiments, the freeze / thaw cycle comprises freezing the mixture in liquid nitrogen (e.g., at about -190°C) for about 5 minutes and thawing it at about 60°C for about 5 minutes. The nucleic acids of the present disclosure can be mixed with PCLC to form a complex of the nucleic acid and PCLC. In some embodiments, the composition comprises LNPs.
[0096] In some embodiments, the composition comprises extracellular vesicles (EVs), such as exosomes. The extracellular vesicles (EVs) can be derived from any suitable source, for example, EVs derived from cardiosphere-derived cells (CDCs) or fibroblasts. Suitable EVs, such as CDC-derived EVs, are provided, for example, in U.S. Patent Publication Nos. 20080267921, 20160158291, and 20160160181; Smith et al., Circulation. 2007. 115:896-908; Aminzadeh, MA et al. Stem Cell Reports 10, 942-955 (2018); and Ibrahim et al., Stem Cell Reports. 2014 May 8;2(5):606-19; Ibrahim, AG et al. Nanomedicine 33, 102347 (2020), each of which is incorporated by reference in its entirety. In some embodiments, EVs are isolated from serum-free medium conditioned by human CDCs in culture. In some embodiments, the composition comprises EVs and liposomes and / or PCLCs as transfection reagents. In some embodiments, the composition is substantially free of CDC-derived EVs.
[0097] The EVs, e.g., exosomes, disclosed herein can vary in size depending on the embodiment. Depending on the embodiment, the size of the EVs may range from about 15 nm to about 95 nm in diameter, e.g., from about 15 nm to about 20 nm, from about 20 nm to about 30 nm, from about 30 nm to about 40 nm, from about 40 nm to about 50 nm, from about 50 nm to about 60 nm, from about 60 nm to about 70 nm, from about 70 nm to about 80 nm, from about 80 nm to about 90 nm, from about 90 nm to about 95 nm, and overlapping ranges thereof. In some embodiments, the EVs are larger (e.g., in the range of about 140 to about 210 nm, e.g., about 140 nm to about 150 nm, about 150 nm to about 160 nm, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, 190 nm to about 200 nm, about 200 nm to about 210 nm, and overlapping ranges thereof). In some embodiments, the EV diameter is in the range of about 15 nm to about 200 nm in diameter, e.g., about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 100 nm, about 100 nm to about 110 nm, about 110 nm to about 120 nm, about 120 nm to about 130 nm, about 130 nm to about 140 nm, about 140 nm to about 150 nm, about 150 nm to about 160 nm, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, about 190 nm to about 200 nm, and overlapping ranges thereof. In some embodiments, the EVs generated from the original cell body are 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000, 5,000, or 10,000 times smaller in at least one dimension (e.g., diameter) than the original cell body.
[0098] Compositions containing EVs and nucleic acids of the present disclosure can be prepared using any suitable method. In some embodiments, loading EVs with nucleic acids includes formulating the nucleic acids with liposomes and / or PCLCs, e.g., as provided above, to generate a nucleic acid-liposome mixture; combining the nucleic acid-liposome mixture with EVs; and enriching for EVs associated with exosomal markers to generate a population of EVs enriched for nucleic acids. Combining the nucleic acid-liposome mixture with EVs can be performed using any suitable method. In some embodiments, the nucleic acid-liposome mixture is combined with EVs at 37°C with shaking for about 30 minutes or more. Enriching to generate a population of EVs enriched for nucleic acids can be performed using any suitable method. In some embodiments, enriching for EVs associated with exosomal markers includes immunoprecipitating EVs associated with the exosomal marker using an antibody specific for the exosomal marker. In some embodiments, the exosomal marker is one or more of CD9, CD63, and CD81. In some embodiments, enriching for EVs associated with exosome markers comprises immunoprecipitating EVs associated with all of the exosome markers, CD9, CD63, and CD81. In some embodiments, the size distribution of the EV population enriched for nucleic acids is substantially unimodal. In some embodiments, at least 80%, 85%, 90%, 95%, 97%, or 99% of the population have a diameter under a single peak in the size distribution. In some embodiments, the EV population enriched for nucleic acids has an average diameter of about 50-180 nm, e.g., 60-170 nm, 70-160 nm, 80-150 nm, 90-140 nm, 100-130 nm, or about 110-130 nm.
[0099] In some embodiments, the composition includes casein, e.g., casein micelles. In some embodiments, the composition includes chitosan. In some embodiments, the composition includes casein and chitosan, e.g., casein-chitosan micelles. In some embodiments, the composition includes a casein-chitosan complex. In some embodiments, the isolated nucleic acid in the composition is encapsulated in the casein-chitosan complex. In some embodiments, the composition includes one or more of the following phosphoproteins: alpha s1 casein, alpha s2 casein, beta casein, and kappa casein. In some embodiments, the composition includes two or more, three or more, or all four of the following phosphoproteins: alpha s1 casein, alpha s2 casein, beta casein, and kappa casein. The phosphoproteins may be present in the composition in any suitable concentration (relative to each other and to the total volume of the composition) and, in some embodiments, are present in an amount suitable to form casein micelles. In some embodiments, the casein phosphoproteins are present in the composition at a combined concentration of about 5-10% (weight / volume). In some embodiments, the casein phosphoprotein is present in the composition at about 8% (weight / volume) combined. In some embodiments, the casein phosphoprotein is present in the composition at about 5% (weight / volume) combined. The casein phosphoprotein can be derived from any suitable animal, e.g., mammal, including but not limited to, human, non-human primate, cow, pig, horse, camel, goat, and sheep. In some embodiments, the casein phosphoprotein is bovine alpha s1 casein, alpha s2 casein, beta casein, and kappa casein. Suitable casein formulations with EVs are provided, for example, in Aminzadeh et al., J Extracell Vesicles. 2021 Jan;10(3):e12045, incorporated herein by reference in its entirety. In some embodiments, compositions of the present disclosure, e.g., pharmaceutical compositions, formulated with casein, as provided herein, are suitable for oral administration to a subject.Without wishing to be bound by theory, it is believed that the casein phosphoprotein in the composition increases the bioavailability of orally administered EVs and / or liposomes and their cargo, such as the nucleic acids of the present disclosure.
[0100] In some embodiments, the composition comprises at least two phosphoproteins selected from alpha s1 casein, alpha s2 casein, beta casein, and kappa casein, wherein the phosphoproteins are present in a physiologically compatible excipient in an amount between about 5% and about 10% (weight / volume) of the composition. In some embodiments, the composition comprises alpha s1 casein in an amount of between about 0% and about 50% (e.g., about 10% to about 45%, about 20% to about 40%, about 25% to about 40%, e.g., about 30% to about 40%) (by weight) of the phosphoprotein mass in the composition, alpha S2 casein in an amount of between about 0% and about 20% (e.g., about 5% to about 15%, about 7% to about 12%, e.g., about 8% to about 12%) (by weight), beta casein in an amount of between about 0% and about 50% (e.g., about 10% to about 45%, about 20% to about 40%, about 25% to about 40%, e.g., about 30% to about 40%) (by weight), and kappa casein in an amount of between about 0% and about 20% (e.g., about 5% to about 18%, about 8% to about 18%, e.g., about 10% to about 15%) (by weight). The compositions can provide enhanced oral bioavailability of therapeutic nucleic acids, such as BCYRN1 or derivatives thereof (e.g., one or more BDSSs (BCYRN1-derived binding sequences), e.g., BDSS-138, BDSS-150, and / or BDSS-98).
[0101] In some embodiments, the formulations provided herein comprise lipid-bound vesicles, e.g., micelles or liposomes, and thus may comprise any suitable number of particles. In some embodiments, the amount of micelles (e.g., casein-chitosan coated micelles) is about 10 6 ~about 10 10 particles, e.g., about 2 × 10 6 ~about 10 10 particles, approximately 5 × 10 6 ~about 10 10 particles, approximately 10 7~Approx. 5×10 9 particles, approximately 2 × 10 7 ~Approx. 5×10 9 particles, approximately 5 × 10 7 ~Approx. 5×10 9 particles, e.g., about 1×10 8 ~about 2×10 9 In some embodiments, the amount of micelles (e.g., casein-chitin coated micelles) in the population is in the range of about 10 6 pieces, approximately 2×10 6 pieces, about 5×10 6 pieces, about 10 7 pieces, approximately 2×10 7 pieces, about 5×10 7 pieces, about 10 8 pieces, approximately 2×10 8 pieces, about 5×10 8 pieces, about 10 9 pieces, approximately 2×10 9 pieces, about 5×10 9 pieces, or about 10 10 particles, or a quantity between any two of the aforementioned values.
[0102] In some embodiments, the composition comprises casein-chitosan coated lipid micelles, and the casein phosphoproteins are present in a suitable amount in the composition (e.g., a suitable total amount of phosphoprotein mass in the composition, a suitable ratio of phosphoproteins relative to each other). In some embodiments, the composition comprises two, three, or all four phosphoproteins selected from alpha s1 casein, alpha s2 casein, beta casein, and kappa casein. In some embodiments, the amount of phosphoprotein in the composition depends on the amount of one or more other phosphoproteins present in the composition.
[0103] In some embodiments, the alpha s1 casein is a phosphoprotein associated with the gene designated CSN1S1. The alpha s1 casein can be a CSN1S1 phosphoprotein from any suitable mammal. In some embodiments, the alpha s1 casein is bovine (Gene ID: 282208), porcine (Gene ID: 445514), equine (Gene ID: 100033982), ovine (Gene ID: 443382), caprine (Gene ID: 100750242), camel (Gene ID: 105090954), or human (Gene ID: 1446). In some embodiments, the alpha s1 casein is a non-human alpha s1 casein. In some embodiments, the alpha s1 casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 1.
[0104] In some embodiments, the composition comprises any suitable amount of alpha s1 casein. In some embodiments, the composition comprises alpha s1 casein in an amount (by weight) of about 0% to about 50%, e.g., about 5% to about 50%, about 10% to about 50%, about 15% to about 45%, about 20% to about 45%, e.g., about 25% to about 40% of the phosphoprotein mass in the composition. In some embodiments, the composition comprises alpha s1 casein in an amount (by weight) of about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or an amount within a range defined by any two of the foregoing values.
[0105] In some embodiments, alpha s2 casein is a phosphoprotein associated with the gene designated CSN1S2. The alpha s2 casein can be a CSN1S2 phosphoprotein from any suitable mammal. In some embodiments, the alpha s2 casein is bovine (gene ID: 282209), porcine (gene ID: 445515), equine (gene ID: 100327035), ovine (gene ID: 443383), caprine (gene ID: 100861229), or camel (gene ID: 105090951). In some embodiments, the alpha s2 casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 12.
[0106] The composition can include any suitable amount of alpha s2 casein. In some embodiments, the composition includes alpha s2 casein in an amount (by weight) of between about 0% and about 20%, e.g., between about 2% and about 18%, between about 3% and about 18%, between about 4% and about 17%, between about 5% and about 16%, e.g., between about 5% and about 15% of the phosphoprotein mass in the composition. In some embodiments, the composition includes alpha s2 casein in an amount (by weight) of about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, 20%, or an amount within a range defined by any two of the foregoing values.
[0107] In some embodiments, the beta-casein is a phosphoprotein associated with the gene designated CSN2. The beta-casein can be a CSN2 phosphoprotein from any suitable mammal. In some embodiments, the beta-casein is bovine (Gene ID: 281099), porcine (Gene ID: 404088), equine (Gene ID: 100033903), ovine (Gene ID: 443391), caprine (Gene ID: 100860784), camel (Gene ID: 105080412), or human (Gene ID: 1447). In some embodiments, the beta-casein is a non-human beta-casein. In some embodiments, the beta-casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 3 or 4.
[0108] The composition can include any suitable amount of beta-casein. In some embodiments, the composition includes beta-casein in an amount (by weight) of about 0% to about 50%, e.g., about 5% to about 50%, about 10% to about 50%, about 15% to about 45%, about 20% to about 45%, e.g., about 25% to about 40% of the phosphoprotein mass in the composition. In some embodiments, the composition includes beta-casein in an amount (by weight) of about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or an amount within a range defined by any two of the foregoing values.
[0109] In some embodiments, kappa casein is a phosphoprotein associated with the gene designated CSN3. Beta casein can be a CSN3 phosphoprotein from any suitable mammal. In some embodiments, the kappa casein is bovine (gene ID: 281728), porcine (gene ID: 445511), equine (gene ID: 100033983), ovine (gene ID: 443394), caprine (gene ID: 100861231), camelid (gene ID: 105080408 or 105090949), or human (gene ID: 1448). In some embodiments, the kappa casein is a non-human kappa casein. In some embodiments, the kappa casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 5.
[0110] The composition can include any suitable amount of kappa-casein. In some embodiments, the composition includes kappa-casein in an amount (by weight) of between about 0% and about 20%, e.g., between about 2% and about 18%, between about 3% and about 18%, between about 4% and about 17%, between about 5% and about 16%, e.g., between about 5% and about 15% of the phosphoprotein mass in the composition. In some embodiments, the composition includes kappa-casein in an amount (by weight) of about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, 20%, or an amount within a range defined by any two of the foregoing values.
[0111] In some embodiments, a combination of caseins from different species is used. For example, in some embodiments, one or more human caseins are used in combination with one or more bovine caseins. In some embodiments, a ratio of caseins is used, such as 3:1:3:1 of alpha S1 casein:alpha S2 casein:beta casein:kappa casein. In some embodiments, different ratios can be used, such as 4:1:4:1, 2:1:2:1, or 1:1:1:1. Ratios ranging from 1:1, 2:1, 3:1, 4:1, 5:1, 10:1, 1:5, 1:4, 1:3, 1:2, etc., between any two given caseins in the composition can also be used.
[0112] Any suitable total amount of phosphoprotein can be present in the composition. In some embodiments, the phosphoprotein is present in an amount between 5% and about 10%, e.g., between about 6% and about 10%, about 6% and about 9%, e.g., between about 6% and about 8% (weight / volume) of the composition. In some embodiments, the phosphoprotein is present in an amount of about 5%, 6%, 7%, 8%, 9%, 10%, or an amount within a range defined by any two of the foregoing values (weight / volume) of the composition.
[0113] In some embodiments, one or more of the casein phosphoproteins are non-human casein phosphoproteins. In some embodiments, the exosomes and at least one of the casein phosphoproteins are derived from different species. In some embodiments, the exosomes are human exosomes and one or more of the casein phosphoproteins are non-human casein phosphoproteins. In some embodiments, the exosomes are human exosomes and one or more of the casein phosphoproteins are bovine (or ovine, porcine, caprine, camel, or equine) casein phosphoproteins.
[0114] In some embodiments, the composition comprises micellar structures formed by at least a portion of the casein phosphoproteins. In some embodiments, the casein micelles are substantially spherical. In some embodiments, the casein micelles in the composition have an average diameter (measured per micelle) of about 40 nm, about 50 nm, about 60 nm, about 70 nm, about 80 nm, about 90 nm, about 100 nm, about 110 nm, about 120 nm, about 130 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, or more, or an average diameter within a range defined by any two of the foregoing values. In some embodiments, the casein micelles in the composition have an average diameter (measured per micelle) ranging from about 40 nm to about 500 nm, e.g., from about 40 nm to about 400 nm, from about 50 nm to about 300 nm, from about 60 nm to about 250 nm, from about 70 nm to about 250 nm, from about 80 nm to about 200 nm, e.g., from about 90 nm to about 150 nm. The casein micelles in the composition are not entirely precipitated or gel-like.
[0115] In some embodiments, the composition includes one or more colloidal minerals (e.g., minerals in suspension). In some embodiments, complex minerals (e.g., two or more) are used as the colloidal mineral complex. The colloidal mineral complex may include any suitable mineral compound and / or salt thereof. In some embodiments, the colloidal mineral complex may include, but is not limited to, one or more of calcium, magnesium, inorganic phosphate, citrate, sodium, potassium, and chloride, or their respective salts. In some embodiments, the colloidal mineral complex is present in an amount of between about 2% and about 15% (by weight) of the phosphoprotein mass in the composition, e.g., about 2% to about 12%, about 5% to about 10%, about 5% to about 9%, e.g., about 6% to about 9%. In some embodiments, the colloidal mineral complex is present in an amount of about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, or an amount within a range defined by any two of the foregoing percentages.
[0116] In some embodiments, the composition is a parenteral dosage form. In some embodiments, the parenteral dosage form is sterile or can be sterilized before being administered to a patient. Examples of parenteral dosage forms include, but are not limited to, ready-to-inject solutions, dry products that can be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, ready-to-inject suspensions, and emulsions. In addition, controlled-release parenteral dosage forms can be prepared for administration to a subject. Suitable excipients that can be used to provide parenteral dosage forms of nucleic acids include, but are not limited to, sterile water; water for injection, USP; saline solution; glucose solution; aqueous vehicles such as, but not limited to, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.
[0117] Also provided herein are regulatory T cells (Treg cells) comprising a nucleic acid of the present disclosure. In some embodiments, the Treg cells are CD4+Foxp3+ Treg cells. In some embodiments, the Treg cells are human Treg cells. In some embodiments, the Tregs are inducible human Tregs. In some embodiments, the Treg cells exposed to the nucleic acid have increased anti-inflammatory activity compared to a suitable control, e.g., Tregs not exposed to the nucleic acid or Tregs exposed to a control nucleic acid. In some embodiments, the Tregs are derived from the patient's peripheral blood. In some embodiments, the Tregs have increased expression of one or more of IL-10, ATG-7, and CCR6 compared to a suitable control, e.g., Tregs not contacted with the nucleic acid. In some embodiments, the Tregs have increased mRNA expression of one or more of IL-10, ATG-7, and CCR6 compared to a suitable control, e.g., Tregs not contacted with the nucleic acid. In some embodiments, the Tregs have increased mRNA expression of one or more of IL-10, ATG-7, and CCR6 compared to a suitable control, e.g., Tregs not contacted with the nucleic acid. In some embodiments, mRNA expression of one or more of IL-10, ATG-7, and CCR6 in Tregs bearing the nucleic acid is increased by at least 1.5-fold, 2-fold, 4-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 30-fold, 50-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 1,000-fold, or more, or a range defined by any two of the foregoing values, compared to a suitable control, e.g., Tregs not contacted with the nucleic acid. In some embodiments, Tregs have increased protein expression of one or more of IL-10, ATG-7, and CCR6 compared to a suitable control, e.g., Tregs not contacted with the nucleic acid. In some embodiments, protein expression of one or more of IL-10, ATG-7, and CCR6 in Tregs bearing the nucleic acid is increased by at least 1.5-fold, 2-fold, 4-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 30-fold, 50-fold, 100-fold, 200-fold, or more, or a range defined by any two of the foregoing values, relative to a suitable control, e.g., Tregs not contacted with the nucleic acid.In some embodiments, the Tregs have increased secretion of IL-10 compared to a suitable control, e.g., Tregs not contacted with the nucleic acid. In some embodiments, the IL-10 secretion of the Tregs bearing the nucleic acid is increased by at least about 1.2-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 50-fold, or more, or a range defined by any two of the foregoing values, compared to a suitable control, e.g., Tregs not contacted with the nucleic acid. In some embodiments, the Tregs have increased migration compared to a suitable control, e.g., Tregs not contacted with the nucleic acid. In some embodiments, the migration of the Tregs bearing the nucleic acid is increased by at least about 1.2-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 50-fold, or more, or a range defined by any two of the foregoing values, compared to a suitable control, e.g., Tregs not contacted with the nucleic acid. In some embodiments, the Tregs have increased proliferation compared to a suitable control, e.g., Tregs not contacted with nucleic acid. In some embodiments, the proliferation of Tregs bearing the nucleic acid is increased by at least about 1.2-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 50-fold, or more, or a range defined by any two of the foregoing values, compared to a suitable control, e.g., Tregs not contacted with nucleic acid. In some embodiments, the Tregs are in culture. In some embodiments, the Tregs are present in the subject, e.g., in peripheral blood, bone marrow, and / or at the site of tissue injury. In some embodiments, the Tregs are autologous to the subject.
[0118] Also provided are cells, such as regulatory T cells or cardiosphere-derived cells (CDCs), genetically modified to express at least one of the nucleic acids described herein. In some embodiments, the cells are genetically modified with a vector encoding one or more nucleic acids of the present disclosure. In some embodiments, the genetically modified cells overexpress at least one of the BDSS compounds. In some embodiments, the genetically modified cells are genetically modified CDCs, which produce extracellular vesicles (e.g., exosomes) enriched in at least one of the BDSS compounds compared to CDCs that are not genetically modified or that are genetically modified with a control vector.
[0119] method Provided herein are methods of treating a subject in need thereof (also referred to herein as "therapeutic methods") using the nucleic acids of the present disclosure. Conditions treatable by the therapeutic methods include, but are not limited to, immune-related disorders, cardiac conditions, and inflammatory conditions. In some embodiments, the condition includes, but is not limited to, myocarditis, myocardial infarction, cardiac damage, myocardial changes, inflammatory diseases, autoimmune diseases, viral infections, sepsis, or wound healing. In some embodiments, the condition treated by the therapeutic methods includes, but is not limited to, an inflammation-associated condition. In some embodiments, a subject treated by administering a nucleic acid of the present disclosure according to the therapeutic methods herein is in need of treatment for an inflammation-associated condition. Inflammation-associated conditions may include, but are not limited to, inflammation of the heart, skeletal muscle, or skin. In some embodiments, inflammation-associated conditions include aging. In some embodiments, the condition treated by the therapeutic methods is a symptom and / or sequelae of an infectious disease. In some embodiments, the infection is a viral infection, e.g., a respiratory viral infection such as COVID-19, other coronaviruses, or other viral pathogens (e.g., influenza, H1N1, hepatitis C, HIV, etc.).
[0120] In some embodiments, the method of treatment includes a method for treating an immune-related disorder, comprising administering a therapeutically effective amount of a nucleic acid (or a composition containing the nucleic acid) of the present disclosure to a subject in need of treatment for the immune-related disorder. The immune-related disorder can be, but is not limited to, myocardial injury, autoimmune disease, or transplant rejection. In some embodiments, the immune-related disorder includes myocarditis or myocardial infarction. In some embodiments, the subject has muscular myocarditis, has suffered from a myocardial infarction, or is at risk of developing myocarditis or myocardial infarction.
[0121] In some embodiments, the method of treatment includes a method of treating a cardiac condition or symptom thereof, the method comprising administering a therapeutically effective amount of a nucleic acid (or a composition containing the nucleic acid) of the present disclosure to a subject in need of treatment for the cardiac condition or symptom thereof. In some embodiments, the subject is a human subject. In some embodiments, the subject is a non-human subject, e.g., a non-human mammal.
[0122] A variety of cardiac conditions are treatable by the present methods. In some embodiments, the cardiac condition comprises symptoms and / or sequelae of heart failure, ischemic heart disease, or myocardial infarction. In some embodiments, the cardiac condition comprises myocarditis or hypertrophic cardiomyopathy. In some embodiments, the cardiac condition comprises heart failure with preserved ejection fraction (HFpEF).
[0123] In some embodiments, the subject is at risk of developing a cardiac condition. In some embodiments, the subject is at risk of developing a cardiac condition based on one or more of the subject's family history, genetic predisposition, lifestyle, and medical history. In some embodiments, the subject has a mutation in cardiac troponin I that predisposes the subject to developing hypertrophic cardiomyopathy (HCM). In some embodiments, the subject has one or more comorbidities for a cardiac condition. In some embodiments, the one or more comorbidities include obesity and hypertension. In some embodiments, the subject has or is diagnosed with a cardiac condition.
[0124] In some embodiments, the subject exhibits one or more of hypertension, elevated E / e' ratio, cardiac hypertrophy, myocardial fibrosis, obesity, wasting, decreased endurance, and elevated systemic inflammatory markers. In some embodiments, the subject has hypertension, and administering a therapeutically effective amount of a nucleic acid (or a composition thereof) reduces the subject's blood pressure. In some embodiments, the subject with hypertension has a resting blood pressure greater than 130 / 90 mmHg. In some embodiments, the subject with hypertension has a resting blood pressure greater than 140 / 90 mmHg. In some embodiments, administering a therapeutically effective amount of a nucleic acid (or a composition thereof) reduces the subject's systolic or diastolic blood pressure. In some embodiments, the subject's blood pressure (systolic or diastolic) is reduced to at least a level that is no longer considered hypertensive after administering a therapeutically effective amount of a nucleic acid (or a composition thereof).
[0125] In some embodiments, the subject has an elevated E / e' ratio, and administering a therapeutically effective amount of the nucleic acid (or composition thereof) reduces the E / e' ratio. In some embodiments, the subject's E / e' ratio is reduced, at least to a level that is no longer considered clinically relevant, after administering a therapeutically effective amount of the nucleic acid (or composition thereof).
[0126] In some embodiments, the subject has cardiac hypertrophy, and administering a therapeutically effective amount of the nucleic acid (or composition thereof) reduces the cardiac hypertrophy. Cardiac hypertrophy can be measured using any suitable method. In some embodiments, cardiac hypertrophy is measured using echocardiography. In some embodiments, the subject with cardiac hypertrophy has an increased diastolic interventricular septal wall diameter (IVSd) and / or left ventricular posterior wall diameter (LVPWd) as measured by echocardiography, and administering a therapeutically effective amount of the nucleic acid (or composition thereof) reduces the IVSd and / or LVPWd. In some embodiments, the subject's IVSd or LVPWd is reduced, at least to a level that is no longer considered hypertrophic, after administering a therapeutically effective amount of the nucleic acid (or composition thereof).
[0127] In some embodiments, the subject has inflammation associated with an autoimmune condition, non-limiting examples of autoimmune diseases or disorders include autoimmune myocarditis, conditions involving T cell infiltration and a chronic inflammatory response, arthritis (rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis), multiple sclerosis, pemphigus, and type 1 diabetes (also known as insulin-dependent diabetes mellitus (IDDM)).
[0128] In some embodiments, the subject exhibits wasting or weight loss, and the wasting is slowed or prevented by administering a therapeutically effective amount of the nucleic acid (or composition thereof). In some embodiments, the subject's weight is substantially restored to pre-treatment levels or maintained at substantially pre-treatment levels after administering a therapeutically effective amount of the nucleic acid (or composition thereof).
[0129] In some embodiments, a subject exhibits reduced endurance, e.g., exercise endurance, and the decline in endurance is slowed or prevented by administering a therapeutically effective amount of a nucleic acid (or composition thereof). In some embodiments, the subject's exercise endurance is substantially restored to pre-treatment levels or maintained at substantially pre-treatment levels after administering a therapeutically effective amount of a nucleic acid (or composition thereof). In some embodiments, the improvement in endurance after administering a therapeutically effective amount of a nucleic acid (or composition thereof) is maintained over the treatment period. In some embodiments, the improvement in endurance after administering a therapeutically effective amount of a nucleic acid (or composition thereof) is maintained over the administration of multiple doses.
[0130] In some embodiments, the subject exhibits elevated levels of systemic inflammatory markers, e.g., in peripheral blood. In some embodiments, the systemic inflammatory markers include one or more of IL-6 and brain natriuretic peptide (BNP). In some embodiments, the subject's systemic inflammatory markers are reduced, at least to a level that is no longer considered elevated, after administration of a therapeutically effective amount of the nucleic acid (or composition thereof).
[0131] In some embodiments, if the subject is obese, the therapeutic effect of administering the nucleic acid is independent of the subject's obesity, ie, administering the nucleic acid (or composition thereof) does not affect the subject's body weight.
[0132] In some embodiments, the subject exhibits reduced skeletal muscle function, e.g., the amount of force or torque exerted by a skeletal muscle group. In some embodiments, the subject exhibits reduced skeletal muscle function, and administering a therapeutically effective amount of a nucleic acid (or composition thereof) delays the onset of the reduced skeletal muscle function, prevents the deterioration of skeletal muscle function, or enhances skeletal muscle function. In some embodiments, the subject's skeletal muscle function is substantially restored to pre-treatment levels or maintained at substantially pre-treatment levels after administering a therapeutically effective amount of a nucleic acid (or composition thereof).
[0133] In some embodiments, any of the therapeutic effects of administering a therapeutically effective amount of a nucleic acid (or composition thereof) herein are maintained over the treatment period, are maintained over the administration of multiple doses, are maintained over the administration of multiple doses, In some embodiments, any of the therapeutic effects of administering a therapeutically effective amount of a nucleic acid (or composition thereof) herein are not transient over the treatment period.
[0134] In some embodiments, the therapeutic methods of the present disclosure treat any one or more of a variety of inflammatory conditions. In some embodiments, the inflammatory condition is a chronic condition. In some embodiments, the inflammatory condition is a condition responsive to the anti-inflammatory effects of IL-10. In some embodiments, the inflammatory condition comprises an autoimmune disease, graft-versus-host disease (GVHD), or an immune response to an organ transplant. In some embodiments, the inflammatory condition comprises a viral infection, sepsis, arthritis (rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis), multiple sclerosis, pemphigus, and type 1 diabetes (also known as insulin-dependent diabetes mellitus (IDDM)). In some embodiments, inflammatory conditions include Behçet's disease, polymyositis / dermatomyositis, autoimmune cytopenias, autoimmune myocarditis, primary liver cirrhosis, Goodpasture's syndrome, autoimmune meningitis, Sjögren's syndrome, systemic lupus erythematosus, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, insulin-dependent diabetes mellitus, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroma, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis. In some embodiments, the inflammation is associated with bone marrow transplantation. In some embodiments, the inflammation is associated with allograft rejection after tissue transplantation. In some embodiments, the autoimmune disease is a cardiac autoimmune disease, e.g., autoimmune myocarditis, hi some embodiments, the autoimmune disease is scleroderma or systemic sclerosis.
[0135] In some embodiments, the therapeutic methods of the present disclosure treat any one or more symptoms and / or sequelae of a variety of infectious diseases. In some embodiments, the cardiac or inflammatory condition treated by the nucleic acids of the present disclosure comprises a symptom and / or sequelae of an infectious disease. In some embodiments, the infectious disease is associated with myocardial damage. In some embodiments, the cardiac condition comprises acute myocarditis associated with an infectious disease. In some embodiments, the inflammatory condition comprises a cytokine storm or hyperinflammation associated with an infectious disease. In some embodiments, the inflammatory condition comprises acute lung injury or acute respiratory distress syndrome (ARDS).
[0136] In some embodiments, the infectious disease is an infection caused by, but not limited to, one or more of the following pathogens: viruses (such as, but not limited to, coronavirus, human immunodeficiency virus, herpes simplex virus, papilloma virus, parainfluenza virus, influenza virus, hepatitis virus, coxsackie virus, varicella zoster virus, measles virus, mumps virus, rubella, rabies virus, viral hemorrhagic fever, H1N1, etc.), prions, parasites, fungi, molds, yeasts, and bacteria (both gram-positive and gram-negative). In some embodiments, pathogens include, but are not limited to, Candida albicans, Aspergillus niger, Escherichia coli (E. coli), Pseudomonas aeruginosa (P. aeruginosa), and Staphylococcus aureus (S. aureus), Group A streptococci, S. pneumoniae, Mycobacterium tuberculosis, Campylobacter jejuni, Salmonella, Shigella, and various drug-resistant bacteria.
[0137] In some embodiments, the inflammation follows or occurs concomitantly with an infection with a virus, e.g., a DNA virus or an RNA virus. In some embodiments, the virus is an RNA virus, e.g., a single-stranded or double-stranded virus. In some embodiments, the RNA virus is a positive-sense single-stranded RNA virus. In some embodiments, the virus belongs to the order Nidovirales. In some embodiments, the virus belongs to the family Coronaviridae. In some embodiments, the virus belongs to the genus Alphacoronavirus, Betacoronavirus, Gammacoronavirus, or Deltacoronavirus. In some embodiments, the Alphacoronavirus is, but is not limited to, human coronavirus 229E, human coronavirus NL63, or transmissible gastroenteritis virus (TGEV). In some embodiments, the Betacoronavirus is, but is not limited to, severe acute respiratory syndrome coronavirus (SARS-CoV), SARS-CoV-2 (COVID-19), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus HKU1, or human coronavirus OC43. In some embodiments, the Gammacoronavirus is infectious bronchitis virus (IBV).
[0138] The nucleic acid can be administered to a subject in any suitable amount. In some embodiments, a therapeutically effective amount of the nucleic acid is about 0.01 μg, 0.02 μg, 0.05 μg, 0.1 μg, 0.2 μg, 0.5 μg, 1 μg, 2 μg, 3 μg, 4 μg, 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 40 μg, 50 μg, 75 μg, 100 μg, 125 μg, 150 μg, 175 μg, 200 μg, 250 μg, 300 μg, 400 μg, 500 μg, 600 μg, and amounts of 700 μg, 800 μg, 900 μg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 10 mg, 15 mg, 20 mg, 30 mg, 40 mg, 50 mg, 75 mg, 100 mg or more, or a range defined by any two of the foregoing values (e.g., 0.01 μg to 0.1 μg, 0.1 μg to 1 μg, 1 μg to 10 μg, 10 μg to 100 μg, 100 μg to 1 mg, 1 mg to 10 mg, 10 mg to 100 mg). In some embodiments, a therapeutically effective amount of a nucleic acid is about 0.001 μg / g, 0.002 μg / g, 0.005 μg / g, 0.01 μg / g, 0.02 μg / g, 0.05 μg / g, 0.1 μg / g, 0.15 μg / g, 0.2 μg / g, 0.5 μg / g, 1 μg / g, 2 μg / g, 3 μg / g, 4 μg / g, 5 μg / g, 6 μg / g, 7 μg / g, 8 μg / g, 9 μg / g, 10 μg / g, 15 μg / g, 20 μg / g, 25 μg / g, 30 μg / g, 40 μg / g, 50 μg / g, 60 μg / g, 70 μg / g, 80 μg / g, 90 μg / g, 100 μg / g, 150 μg / g, 160 μg / g, 170 μg / g, 180 μg / g, 190 μg / g, 210 μg / g, 220 μg / g, 230 μg / g, 240 μg / g, 250 μg / g, 260 μg / g, 270 μg / g, 280 μg / g, 290 μg / g, 300 μg / g, 310 μg / g, 320 μg / g, 330 μg / g, 340 μg / g, 350 μg / g, 360 μg / g, 370 μg / g, 380 μg / g, 390 μg / g, 410 μg / g, 420 μg / g, 4 μg / g, 35 μg / g, 40 μg / g, 45 μg / g, 50 μg / g, 60 μg / g, 70 μg / g, 80 μg / g, 90 μg / g, 100 μg / g body weight or more, or an amount in a range defined by any two of the foregoing values (e.g., 0.001 μg / g to 0.01 μg / g, 0.01 μg / g to 0.1 μg / g, 0.1 μg / g to 1 μg / g, 1 μg / g to 10 μg / g, 10 μg / g to 100 μg / g).In some embodiments, a therapeutically effective amount of nucleic acid is about 0.001 μg / g, 0.002 μg / g, 0.005 μg / g, 0.01 μg / g, 0.02 μg / g, 0.05 μg / g, 0.1 μg / g, 0.2 μg / g, 0.5 μg / g, or about 1 μg / g body weight or more, or an amount in a range defined by any two of the foregoing values (e.g., 0.001 μg / g to 0.01 μg / g, 0.01 μg / g to 0.05 μg / g, 0.05 μg / g to 0.1 μg / g, 0.1 μg / g to 0.2 μg / g, 0.2 μg / g to 0.5 μg / g, or 0.5 μg / g to 1 μg / g).
[0139] The nucleic acid or composition can be administered to a subject according to any suitable administration schedule. In some embodiments, a therapeutically effective amount of the nucleic acid or composition is administered to a subject twice a week, once a week, once every two weeks, once a month, once every two months, once every three months, once every four or more months, or at a frequency within a range defined by any two of the foregoing values. In some embodiments, the nucleic acid is administered to a subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or more times. In some embodiments, the nucleic acid is administered to a subject at regular intervals.
[0140] The nucleic acid or composition can be administered using any suitable route. Administration can be local or systemic. In some embodiments, administration is parenteral. Suitable options for administration include, but are not limited to, intravenous, intramuscular, subcutaneous, intraarterial, intraperitoneal, or oral administration. In some embodiments, the nucleic acid or composition is administered intravenously. In some embodiments, the nucleic acid or composition is administered by injection. In some embodiments, the nucleic acid or composition is administered orally. Any suitable option can be used to administer the nucleic acid or composition. Non-limiting options for oral administration are provided in WO 2023 / 278802, filed June 30, 2022, which is incorporated herein by reference.
[0141] Also provided herein are methods of promoting the anti-inflammatory activity of regulatory T cells (Tregs) (also referred to herein as Treg modulation methods). The methods generally include contacting a population of Tregs with a nucleic acid or composition of the present disclosure. In some embodiments, the nucleic acid induces gene expression changes and / or epigenetic changes in Tregs exposed to the nucleic acid. In some embodiments, contacting the nucleic acid (or composition) increases expression of one or more of IL-10, ATG-7, and CCR6. In some embodiments, contacting the nucleic acid (or composition) increases transcription or translation of one or more of IL-10, ATG-7, and CCR6. In some embodiments, contact with the nucleic acid (or composition) increases transcription of one or more of IL-10, ATG-7, and CCR6, each independently, by at least about 1.5-fold, 2-fold, 4-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 30-fold, 50-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 1,000-fold, or more, or a range defined by any two of the foregoing values, compared to a suitable control, e.g., a Treg not contacted with the nucleic acid.
[0142] In some embodiments, contact with the nucleic acid (or composition) increases secretion of interleukin-10 (IL-10) in Tregs. In some embodiments, contact with the nucleic acid (or composition) increases IL-10 secretion from Tregs by at least about 1.2-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 50-fold, or more, or a range defined by any two of the foregoing values, relative to a suitable control, e.g., Tregs not contacted with the nucleic acid.
[0143] The population of Tregs can be contacted with the nucleic acid or composition for any suitable period of time, hi some embodiments, the contacting is for 24 hours or more, 36 hours or more, 48 hours or more, 60 hours or more, 72 hours or more, or a range between any two of the foregoing values.
[0144] In some embodiments, the contacting occurs in vitro. In some embodiments, the contacting occurs in vivo. In some embodiments, the contacting comprises administering an effective amount of the nucleic acid or composition to a subject in need of treatment for inflammation. In some embodiments, the Tregs are human Tregs. In some embodiments, the subject is a human subject. In some embodiments, the subject is a non-human subject, e.g., a non-human mammal. In some embodiments, the contacting occurs ex vivo. In some embodiments, the Tregs are autologous to the subject. In some embodiments, the method comprises obtaining Tregs from the subject prior to the contacting. In some embodiments, expanding Tregs obtained from the subject prior to the contacting. In some embodiments, the Tregs are xenogeneic to the subject. In some embodiments, the method comprises administering Tregs that have been contacted with a nucleic acid or composition of the disclosure to a subject in need thereof (e.g., a subject in need of treatment for an immune-related condition described herein).
[0145] Any suitable amount of nucleic acid can be contacted with a population of Tregs to promote anti-inflammatory activity of Tregs. In some embodiments, the effective amount depends on whether the contacting occurs in vivo or in vitro. In some embodiments, the population of Tregs is contacted with at least 0.1, 0.2, 0.5, 1, 1.5, 2, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nM of nucleic acid. The Treg cells are contacted with 0, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nM of a nucleic acid of the present disclosure (e.g., BCYRN1, a nucleic acid containing a BDSS, a BDSS compound, etc.), or with a concentration range defined by any two of the foregoing values (e.g., 0.1-1,000 nM, 1-500 nM, 1-100 nM, 10-200 nM, 50-800 nM, 50-200 nM, etc.). In some embodiments, the Treg cells are genetically modified to express a nucleic acid of the present disclosure (e.g., via transfection with a vector configured to express a nucleic acid of the present disclosure (e.g., BCYRN1, a nucleic acid containing a BDSS, a BDSS compound, etc.)).
[0146] In some embodiments of any of the methods of treatment, the method comprises administering a nucleic acid that acts as a microRNA sponge. Also provided are methods of treating an immune-related disorder, comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of miR-138, miR-150, and / or miR-98. In some embodiments, the inhibitor of miR-138, miR-150, and / or miR-98 is a nucleic acid that binds to miR-138, miR-150, and / or miR-98, respectively. In some embodiments of any of the methods of treatment, the method comprises administering BCYRN1 or a derivative thereof (e.g., a nucleic acid containing BDSS-138, BDSS-150, and / or BDSS-90 and up to 35 nucleotides in length). In some embodiments of any of the methods of treatment, the method comprises administering a nucleic acid that specifically binds to miR-138, miR-150, and / or miR-98. In any of the methods of treatment, in some embodiments, the method comprises administering a nucleic acid that specifically binds to miR-138, miR-150, and / or miR-98. In some embodiments, the miR-138, miR-150, and miR-98 are human miR-138, miR-150, and miR-98. In some embodiments, the nucleic acid comprises the miR-138 and miR-98 binding site ACAAC (SEQ ID NO: 18). In some embodiments, the nucleic acid comprises the miR-150 binding site GGGAG (SEQ ID NO: 19).
[0147] In some embodiments, alternative methods for sequence-specifically targeting microRNAs are provided. In some embodiments, microRNA targeting comprises the use of antisense RNA. In some embodiments, microRNA targeting comprises the use of chemically modified antisense oligonucleotides. In some embodiments, microRNA targeting comprises the use of locked nucleic acids (LNAs). In some embodiments, microRNA targeting comprises the use of aptamers. In some embodiments, microRNA targeting comprises the use of small interfering RNAs. In some embodiments, microRNA targeting is performed in vitro. In some embodiments, microRNA targeting is performed in vivo.
[0148] In some embodiments, BCYRN1 or a derivative thereof, e.g., a synthetic derivative thereof, comprises a miRNA-138, miR-150, and / or miR-98 binding nucleic acid. In some embodiments, the miRNA-138, miR-150, and / or miR-98 binding nucleic acid is 10 -5 M~10 -12 M, e.g. 10 -6 M~10 -11 The nucleic acid specifically binds to miRNA-138, miR-150, and / or miR-98 with a binding affinity of M. In some embodiments, the nucleic acid specifically binds to miRNA-138, miR-150, and / or miR-98 inhibits or reduces the function and / or expression of miRNA-138, miR-150, and / or miR-98. In some embodiments, the nucleic acid specifically binds to miRNA-138, miR-150, and / or miR-98 is RNA. In some embodiments, the nucleic acid specifically binds to miR-138, miR-150, and / or miR-98 is non-coding RNA. In some embodiments, the nucleic acid specifically binds to miR-138, miR-150, and / or miR-98 is any one of the nucleic acids of the present disclosure derived from BCYRN1 (e.g., BDSS-138, BDSS-150, and / or BDSS-150).
[0149] In some embodiments, BCYRN1 or a derivative thereof (e.g., BDSS-138, BDSS-150, and / or BDSS-150) functions as a microRNA sponge. In some embodiments, BCYRN1 or a derivative thereof increases the proliferation, migration, and / or IL-10 production of Treg cells. In some embodiments, administration of BCYRN1 or a derivative thereof acutely increases the function (proliferation, infiltration, and activation) of regulatory T cells. In some embodiments, BCYRN1 or a derivative thereof competitively binds to miR-138 to regulate ATG-7 expression and ATG-7-induced autophagy, thereby modulating proliferation. In some embodiments, BCYRN1 or a derivative thereof competitively binds to miR-150 to regulate CCR6 expression and CCR6-dependent Treg migration, thereby modulating Treg migration. In some embodiments, BCYRN1 or a derivative thereof mediates the induction of IL-10 in Tregs by competitively binding to miR-98 to regulate IL-10 expression. In some embodiments, BCYRN1 or a derivative thereof is itself therapeutically useful, hi some embodiments, the level of BCYRN1 or a derivative thereof is enhanced in EVs to enhance its effectiveness in a therapeutic context.
[0150] In some embodiments, the formulations provided herein enable the use of nucleic acids in the treatment of immune-related disorders in which inflammation and / or tissue injury are primary drivers of pathology. In some embodiments, conditions treated using such formulations include, but are not limited to, inflammatory diseases, cardiac injury, autoimmune diseases, or transplant rejection. In some embodiments, the formulations have a cardioprotective effect when administered to subjects suffering from cardiac injury due to, among other diseases, myocardial infarction and / or heart failure.
[0151] kit Also provided herein are kits comprising one or more of the nucleic acids (e.g., nucleic acids having BCYRN1 or BDSS described herein), compositions, or vectors of the present disclosure. In some embodiments, the kits find use in treating immune-related disorders or inflammatory conditions provided herein. The kits can comprise one or more of the nucleic acids (e.g., nucleic acids having BCYRN1 or BDSS described herein), compositions, or vectors of the present disclosure, and a transfection reagent. The transfection reagent can be any suitable transfection reagent, as provided herein. In some embodiments, the transfection reagent comprises one or more of a lipid (e.g., a liposome-forming lipid), a liposome, a lipid nanoparticle (LNP), a PEGylated lipid, and an extracellular vesicle. In some embodiments, the nucleic acid is in solution. In some embodiments, the nucleic acid is in lyophilized form. In some embodiments, the kit comprises a pharmaceutically acceptable excipient, as provided herein. The kit can include one or more containers (e.g., vials, ampoules, test tubes, flasks, or bottles) for holding one or more components of the kit. The kit may further include instructions for using the kit to treat a condition (e.g., myocarditis). The information and instructions may be in the form of words, pictures, or both.
[0152] All patents and other publications cited throughout this application; e.g., literature references, issued patents, published patent applications, and co-pending patent applications; are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methods described in such publications that may be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of this application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements regarding the date or contents of these documents are based on the information available to the applicant and do not constitute any admission as to the accuracy of the dates or contents of these documents.
[0153] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. Specific embodiments and examples of the present disclosure are described herein for illustrative purposes; however, those skilled in the art will recognize that various equivalent modifications are possible within the scope of the present disclosure. For example, while method steps or functions may be presented in a given order, alternative embodiments may perform the functions in a different order, or may perform the functions substantially simultaneously. The teachings of the present disclosure provided herein may be applied to other procedures or methods, as appropriate. The various embodiments described herein may be combined to provide further embodiments. Aspects of the present disclosure may be modified, if necessary, using the structure, function, and concepts of the above-mentioned references and applications to provide further embodiments of the present disclosure. Furthermore, considerations of biological functional equivalence allow for some changes to be made to protein structure without affecting biological or chemical activity in kind or amount. These and other modifications can be made to the present disclosure in light of the detailed description. All such modifications are intended to be within the scope of the appended claims.
[0154] Particular elements of any of the foregoing embodiments can be combined with or substituted for elements in other embodiments. Furthermore, although advantages associated with certain embodiments of the present disclosure are described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments necessarily exhibit such advantages, to fall within the scope of the present disclosure.
[0155] The technology described herein is further illustrated by the following examples, which should not be construed as further limiting in any way.
[0156] [Example] Materials and Methods: The following materials and methods were used in the examples.
[0157] Animals: Male FOXP3-IRES-mRFP mice (10–12 weeks old) purchased from the Jackson Laboratory were used for in vivo experiments. All animal procedures were performed in accordance with a protocol approved by the Institutional Animal Care and Use Committee (IACUC) of Cedars-Sinai Medical Center (IACUC: 009183).
[0158] Myocardial infarction mouse model: MI was induced in 10-12 week-old male mice as described (Cambier et al., 2017). Briefly, a left parasternal thoracotomy was performed under anesthesia. A ligature was tightened around the left anterior descending artery (LAD) for 45 minutes to induce ischemia and then released to allow reperfusion. After 15 minutes, 100 μl of each test item (EV-BCYRN1 or CDC-EV, 2 × 10 9 EV / mouse), or vehicle (Iscove's modified Dulbecco's medium, IMDM) was administered by intravenous (IV) injection.
[0159] Cell Culture: CDCs were isolated as described (Makkar et al., 2012). Briefly, human cardiac tissue obtained via an IRB-approved protocol was minced into fragments and enzymatically digested with collagenase. The tissue was then cultured as explants in fibronectin-coated flasks (Corning, cat#356009) in IMDM with 20% fetal bovine serum (FBS) and penicillin (100 U / mL) at 37°C, 5% CO2, and 5% O2. After 2–3 weeks, interstitial-like cells and phase-bright round cells grew from the tissue fragments, reaching 80% confluence. These cells were then harvested and seeded into ultra-low attachment flasks to support cardiosphere formation. CDCs were formed 2 days later by seeding the cardiospheres onto fibronectin-coated flasks, culturing them in IMDM with 20% FBS, and expanding them for 4–6 passages for EV isolation.
[0160] Human induced Treg cells were purchased from IQ Biosciences (Cat# IQB-Hu1-iTr-1, Berkeley, CA, USA) and expanded according to the manufacturer's protocol (Treg Expansion Kit, Miltenyi Biotec, Cat# 130-095-353, Santa Barbara, CA). Human Treg cells were used within 5 passages.
[0161] Extracellular vesicles (EV) isolation: EVs were prepared from CDC-conditioned FBS-depleted medium using ultrafiltration by centrifugation as described (Akhmerov et al., 2021). Briefly, 15-day conditioned medium was collected and centrifuged at 1000 x g for 10 minutes to eliminate cells, followed by filtration through a 0.22 μm filter to remove cellular debris. CDC-EVs were then concentrated using a 100 kDa filter (Millipore) at 3000 x g for 30 minutes. EVs were assessed using a nanoparticle tracking system.
[0162] Overexpression of BCYRN1 in human induced Treg cells: For the lentiviral vector overexpressing BCYRN1 (Applied Biological Materials Inc. [abm]), the full-length BCYRN1 cDNA was inserted into the EcoRV site of the pLenti-CMV-GFP-2A-Puro vector (abm), and BCYRN1 expression was driven by the CMV promoter. In this study, human induced Treg cells were transfected with the lentiviral BCYRN1 vector using DharmaFECT Transfection Reagent (PerkinElmer). An empty vector (pLenti-CMV-GFP-2A-Puro) served as a negative control.
[0163] Cell proliferation assay: Cell proliferation was assessed using the Cell Counting Kit-8 (Sigma-Aldrich) according to the manufacturer's instructions (Liao et al., 2020). Briefly, human induced Treg cells were seeded into 96-well plates at a density of 5,000 cells / well, followed by the addition of CDC-EV (1,000 particles / cell) and transfection with lentiviral BCYRN1 vector or empty lentiviral vector for 72 hours. Next, 10 μL of CCK-8 solution (water-soluble tetrazolium salt, WST-8) was added to each well and incubated for 4 hours. WST-8 was reduced by dehydrogenase activity in live cells to yield a yellow formazan dye. Spectrophotometric absorbance was then measured at 450 nm for each well. All experiments were repeated three times in triplicate for each sample. The mean ± SD was presented for pooled data.
[0164] Transwell migration: Treg cell transmigration was determined using a Boyden chamber (Corning Costar) (Cook et al., 2014). Briefly, human induced Tregs (5 × 10 5 Cells (100 cells / well) were seeded into 6.5 mm transwell inserts (Cat# 3464, Costar, Corning, USA) with a PET membrane. Culture medium (600 μL) containing 500 ng / mL recombinant mouse CCL20 was placed in the lower chamber. The transwell plates were incubated at 37°C for 5 hours, and then the migrated Treg cells in the lower chamber were quantified. Data represent results from three biological replicates, each consisting of two to three technical replicates.
[0165] Luciferase activity assay: Putative miR-150 target site (sense 5'-AAACTAGCGGCCGCTAGTGAGGCTAAGAGGCGGGAGGATT-3' (SEQ ID NO: 20) and antisense 5'-CTAGAATCCTCCCGCCTCTTAGCCTCACTAGCGGCCGCTAGTTT-3' (SEQ ID NO: 21)), miR-138 target site (5'-AAACTAGCGGCCGCTAGTTCCCTCAAAGCAACAACCCCCT-3' (SEQ ID NO: 22) and antisense A 40-bp / 44-bp lncRNA BCYRN1 3' UTR segment containing the miR-98 target site (sense 5'-AAACTAGCGGCCGCTAGTACTTCCCTCAAAGCAACAACCT-3' (SEQ ID NO: 40) and antisense 5'-CTAGAGGTTGTTGCTTTGAGGGAAGTACTAGCGGCCGCTAGTTT (SEQ ID NO: 25)) was cloned into the PmeI and XbaI sites of the pmirGLO vector (Cat. # E1330, Promega).In the pmirGLO-BCYRN1 3'UTR-miR-138 targeted mutation segment (sense 5'-AAACTAGCGGCCGCTAGTTCCCTCAAAGCATGTTGCCCCT-3' (SEQ ID NO: 26) and antisense 5'-CTAGAGGGGCAACATGCTTTGAGGGAACTAGCGGCCGCTAGTTT-3' (SEQ ID NO: 27)), the miR-138 target site (ACAAC) in the BCYRN1 3'UTR was changed to (TGTTG) (SEQ ID NO: 32). In the pmirGLO-BCYRN1 3'UTR-miR-150 targeted mutation segment (sense 5'-AAACTAGCGGCCGCTAGTGAGGCTTTCACGCCCCTCGATT-3' (SEQ ID NO: 28) and antisense 5'-CTAGAATCGAGGGGCGTGAAAGCCTCACTAGCGGCCGCTAGTTT-3' (SEQ ID NO: 29), the BCYRN1 The miR-150 target site (GGGAG) in the 3'UTR was changed to (CCCTC) (SEQ ID NO: 33), and the miR-98 target site (ACAAC) in the BCYRN1 3'UTR was changed to (TGTTG) (SEQ ID NO: 32) in the pmirGLO-BCYRN1 3'UTR-miR-98 target mutation segment (sense 5'-AAACTAGCGGCCGCTAGTACTTCCCTCAAAGCATGTTGCT-3' (SEQ ID NO: 30) and antisense 5'-CTAGAGCAACATGCTTTGAGGGAAGTACTAGCGGCCGCTAGTTT-3' (SEQ ID NO: 31). Treg cells were seeded in 24-well plates according to the manufacturer's protocol (Promega). Treg cells in the 24-well plates were transfected with DharmaFECT 1. Two days after co-transfection of either miR-138, miR-98, or miR-150 mimics or a negative control mimic RNA with either the pmirGLO-BCYRN1-3'UTR-miRNA target or pmirGLO-PTEN-3'UTR-BCYRN1-miRNA target mutant luciferase reporter vector using the Reagent (PerkinElmer), luciferase activity was measured using the Dual-Luciferase Reporter Assay (Cat.# E2940, Promega).Firefly luciferase activity was normalized by Renilla luciferase activity and expressed as a percentage of the control (triplicate independent experiments performed in three wells each time).
[0166] Flow cytometry: Staining was performed using the following antibodies: Brilliant Violet 421™ anti-mouse CD4 antibody (clone GK1.5; BioLegend), PE anti-mouse CD25 antibody (PC61; BioLegend), Alexa Fluor® 594-conjugated anti-mouse FoxP3 antibody (clone 1054C; R&D Systems), APC / Cyanine 7 anti-mouse CD45 antibody (clone 30-F11; BioLegend), and Alexa Fluor 700-conjugated anti-IL-10 (clone JES5-16E3; eBioscience). Viability staining was performed with Zombie Aqua (BioLegend), and proliferation assays were performed (In Vivo EdU Flow Cytometry Kit 647, Sigma-Aldrich). Transcription factor staining buffer set (eBioscience) or intracellular fixation and permeabilization buffer (BioLegend) was used for intracellular staining of IL-10 and FOXP3 according to the manufacturer's protocol. Samples were acquired using a Sony SA3800 spectrophotometer and analyzed with FlowJo Software.
[0167] 2,3,5-Triphenyl-2H-tetrazolium chloride staining: MI was induced as described above. Three days after MI, hearts were arrested in diastole (10% KCl), excised, washed with PBS, and cut into approximately 1 mm thick serial sections. Sections were immersed in 2,3,5-triphenyl-2H-tetrazolium chloride (TTC, 1% solution in PBS) for 15-20 minutes at 37°C in the dark. Viable tissue turned deep red, while necrotic tissue remained pale. Once color was established, sections were fixed in 4% formalin for approximately 20 minutes, followed by a PBS wash. Sections were then imaged and weighed.
[0168] ELISA assay: Serum cTnI concentrations were measured by mouse-specific ELISA (Cat# CTNI-1- HSP, Life Diagnostics) according to the manufacturer's instructions. Culture supernatants were collected from human Treg cells exposed to various treatments, and IL-10 was quantified using a human IL-10 ELISA kit (Cat# KHC0101C, Thermo Scientific) according to the manufacturer's instructions.
[0169] Western blotting: At the end of each protocol, human Treg cells were lysed using RIPA buffer (Cat#: PI89900, Fisher Scientific) as described (Liao et al., 2016). Equal amounts of protein were electrophoresed through SDS-polyacrylamide gels under reducing conditions and subsequently transferred to PVDF membranes. Blots were blocked with 3% BSA in TBS-Tween 20 and probed with antibodies specific for ATG7 (1:1,000; Cat#: MAB6608; Novus Biologicals), LC3b (1:1,000; Cat#: NB100-2220; Novus Biologicals), p62 (1:1,000, Cat#: PM045; MBL International), and β-actin (1:5,000; Cat#: MA5-15739-HRP; Thermo Scientific). The secondary antibody was alkaline phosphatase-conjugated goat anti-mouse / rabbit IgG (1:10,000; Jackson ImmunoResearch Labs). Membranes were washed and incubated with ECl solution, and signals were detected using Supersignal West Dura Extended Duration or Pico PLUS Chemiluminescent Substrate (Thermo Fisher Scientific, Waltham, MA) and imaged on a Bio-Rad ChemiDoc imaging system. All experiments had at least three biological replicates, and representative blots are shown in the figures.
[0170] RNA Preparation, Next-Generation Sequencing, and Analysis: EV RNA and Treg cell RNA were extracted with QIAzol (QIAGEN) and isolated using the Rneasy Mini Kit (QIAGEN) according to the manufacturer's instructions. Total RNA yield was quantified using a NanoDrop A260 for total recovery. Total RNA was assessed for quality, enriched, fragmented, adapter-ligated, and converted to cDNA. cDNA was barcoded, amplified, and RNA-seq libraries were assessed. Raw sequencing data were multiplexed and processed into FASTQ format using bcl2fastq v2.20 (Illumina, San Diego, California). EV RNA-seq reads were then aligned and annotated to a comprehensive noncoding RNA (ncRNA) database (Cambier et al., 2017). Treg cell RNA-seq reads were aligned to the mouse GRCm38 transcriptome using STAR / RSEM. Gene expression counts were normalized using the modified trimmed mean of the M-value normalization method. Differential expression between two sample groups was assessed using DESeq2 using the Wald test (Akhmerov et al., 2021). Genes with an absolute log2 fold change (|log2 fold change|) greater than 2.5 and a P value < 0.05 compared to the control sample were defined as differentially expressed and analyzed using Ingenuity Pathway Analysis (IPA) software (version 2021; Ingenuity Systems; QIAGEN). Differentially expressed genes (DEGs) in the RNA sequencing outcomes were uploaded to IPA for disease function analysis and heatmap generation.
[0171] qPCR: For quantitative analysis of mRNA and miRNA expression, comparative real-time PCR was performed using Taqman Universal PCR Master Mix (Applied Biosystems). Specific primers and probes for IL-10, CCR5, CCR6, CCR7, lncRNA BCYRN1, GAPDH, mature miR-138, -150, -98, and snRNA RNU6B (U6) were obtained from Applied Biosystems. All reactions were performed in triplicate. The amount of miRNA was normalized to snRNA RNU6B and relative to the control as reported (Hu et al., 2017).
[0172] [Example 1] This non-limiting example shows that CDC-EV induced Treg proliferation, migration and upregulation of IL-10.
[0173] In previous experiments, naive murine CD4+ T cells were isolated from mice and differentiated into conventional effector T cells (Th1, Th2, and Th17) or regulatory T (iTreg) cells (Figure 1, Panel A). After 5 days of culture, exposure of the cells to CDC-EVs resulted in clear dose-dependent responses among different types of CD4+ T cells, with no change in Th1 or Th2 proliferation, decreased proliferation of Th17 cells, and increased proliferation of iTreg cells (administration of 1,000 EVs / cell induced a strong proliferative response). RNA sequencing (RNA-seq) revealed that CDC-EVs could enhance IL-10 production by Tregs. A novel ingenuity pathway analysis (IPA) of the iTreg cell RNA-seq data (Figure 1, Panels B and C) revealed several significantly upregulated categories (based on Z-scores), which are represented by graded gray shades according to increasing upregulation. Conversely, decreased expression is depicted by light gray shades. Heat maps showed that CDC-EVs increased the expression of genes that promote cell survival and viability, but decreased genes associated with apoptosis and necrosis (Figure 1, Panel B). In addition, CDC-EVs strongly induced the expression of genes that promote cell motility and migration (Figure 1, Panel C). New experiments were performed to test whether CDC-EVs induce cell proliferation, migration, and IL-10 production in human iTregs exposed to different doses (0–5,000 EVs / cell) of CDC-EVs for different periods (0–5 days). Normal human dermal fibroblast EVs (NHDf-EVs) served as a negative control; these EVs have a similar size distribution but are functionally inactive in relevant assays (Ibrahim et al., 2014). Exposure of human iTregs to CDC-EVs resulted in a dose-dependent increase in cell number over time (Figure 1, Panels D–F). Transwell experiments confirmed that CDC-EVs induced human iTreg migration (Figure 1, panel G), IL-10 gene expression (Figure 1, panel H), and IL-10 protein secretion (Figure 1, panel I).
[0174] [Example 2] This non-limiting example demonstrates CDC-EV-mediated expression of BCYRN1 in human iTreg cells.
[0175] To dissect the mechanism by which CDC-EVs enhance human iTregs, we performed RNA sequencing. EVs contain many (typically >10,000) molecularly distinct ncRNA entities with known or plausible biological activity. RNA sequencing revealed that lncRNAs are abundant in CDC-EVs (approximately 50% more abundant than inactive NHDf-EVs; Figure 2, Panel A). RNA sequencing library data quantifying lncRNAs in CDC-EVs (left bar) and NHDF-EVs (right bar) (Figure 2, Panel B) revealed that one specific lncRNA species, BCYRN1, is the most abundant lncRNA in CDC-EVs, a finding confirmed by qPCR (Figure 2, Panel C). We next investigated whether BCYRN1 in CDC-EVs could be transferred from CDCs to human iTregs, leading to enhanced BCYRN1 levels in recipient cells. Human iTregs (labeled with the Treg marker Foxp3 in green) exposed to CDC-EVs and labeled with PKH26 (red) revealed cytoplasmic puncta consistent with EV internalization (Figure 2, Panel D). Exposure to unlabeled CDC-EVs resulted in a time-dependent increase in BCYRN1 expression in human iTregs (Figure 2, Panel E). Cellular levels of BCYRN1 were enhanced up to fourfold, and this effect was selective, as exposure to NHDf-EVs did not significantly alter BCYRN1 levels. Thus, BCYRN1 is highly enriched in CDC-EVs, and uptake of these EVs increases BCYRN1 levels in human iTregs.
[0176] [Example 3] This non-limiting example demonstrates that CDC-EV-mediated human iTreg proliferation, migration, and IL-10 induction involve BCYRN1.
[0177] Next, we sought to determine whether BCYRN1 is responsible for CDC-EV-induced upregulation of human iTregs. In this evaluation, the functional involvement of BCYRN1 was investigated by directly transfecting human iTregs with either an empty lentiviral vector or a vector expressing BCYRN1. Overexpression of BCYRN1 increased human iTreg proliferation (Figure 3, Panel A), migration (Figure 3, Panel B), and IL-10 production (Figure 3, Panel C). To further explore the role of BCYRN1 in human iTreg regulation, we silenced BCYRN1 using siRNA. Transfection of CDCs with siRNA against BCYRN1 (si-BCYRN1) for 48 hours, followed by EV isolation, revealed decreased BCYRN1 expression in both CDCs (Figure 3, Panel D) and CDC-EVs (Figure 3, Panel E) compared with the siRNA control (si-ctrl) group. With respect to Treg proliferation, migration, or IL-10 production, EVs with siRNA-silenced BCYRN1 elicited much weaker responses than CDC-EVs with normal BCYRN1 levels (i.e., responses from CDCs exposed only to si-ctrl; Figure 3, panels F–H). Thus, BCYRN1 underlies the ability of CDC-EVs to enhance the number and biological activity of human iTregs.
[0178] [Example 4] This non-limiting example shows that CDC-EV BCYRN1 induced ATG7-dependent autophagy by sponging miR-138.
[0179] ATG7-dependent autophagy is essential for the survival and proliferation of Treg cells (Wang et al., 2021). To determine whether CDC-EVs promote autophagy, we measured the protein levels of classical autophagy markers in human iTregs. As shown in Figure 4, panel A, CDC-EVs increased ATG7 and LC3b, while P62, a marker of autophagic flux, decreased, consistent with the idea that CDC-EVs induce autophagy. When EVs in which BCYRN1 was silenced by siRNA were applied, autophagy induction was blunted (Figure 4, panel B). Conversely, BCYRN1 overexpression increased autophagy markers in iTregs (Figure 4, panel C). One way lncRNAs, including BCYRN1, alter gene expression is by acting as a "sponge" for specific miRNAs (Bossi & Figueroa-Bossi, 2016; Mu et al., 2020). Because BCYRN1 is predicted to bind miR-138 (Jeggari et al., 2012), we tested this prediction using RNA pull-down. After incubating a biotin-labeled BCYRN1 probe with lysates from iTreg cells overexpressing BCYRN1, the precipitates were enriched for miRNA-138 (and BCYRN1 as a positive control), whereas the negative controls GAPDH and U6 were undetectable (Ct values >40; Figure 4, panel D).
[0180] The interaction between BCYRN1 and miR-138 was further evaluated by mutating potential miR-138 binding sites within BCYRN1 and measuring reporter gene expression. Cotransfection of HEK-293 cells with wild-type (WT) or mutant luciferase reporters and miR-138 revealed that miR-138 reduced the activity of the WT reporter by more than 50% but had no effect on the mutant reporters (Figure 4, Panel E). ATG7 is a known target of miR-138. Indeed, ATG7 was suppressed by miR-138, and this effect was reversed by overexpressing BCYRN1 (Figure 4, Panel F). Thus, these data support the notion that BCYRN1 increases human iTreg proliferation by sponging miR-138 and inducing ATG7-dependent autophagy.
[0181] [Example 5] This non-limiting example shows that CDC-EV BCYRN1 induced CCR6-dependent migration by sponging miR-150.
[0182] CCR6 recruits Treg cells to inflamed tissues (Lim et al., 2006; Yamazaki et al., 2008). Indeed, CCR6 transcript levels were elevated in human iTreg cells exposed to CDC-EV (Figure 5, panel A). To explore the role of BCYRN1, we examined human iTreg cells exposed to either si-ctrl-CDC-EV or si-BCYRN1-CDC-EV (BCYRN1 knockdown in CDC-EV). As shown in Figure 5, panel B, si-ctrl-CDC-EV (i.e., "normal" EV) upregulated CCR6, but this effect was significantly reduced after BCYRN1 suppression in human iTregs exposed to si-BCYRN1-CDC-EV. Direct transfection with a BCYRN1-expressing lentiviral vector also increased CCR6 transcript levels, whereas the empty vector did not (Figure 5, panel C). Analysis of lncRNA-miR interactions predicted miR-150 as a sponge target of BCYRN1 (Jeggari et al., 2012), and CCR6 is a potential target of miR-150. RNA pulldown using a biotin-labeled BCYRN1 probe showed that miR-150 and BCYRN1 (positive control) were highly enriched in the precipitate, while the negative controls GAPDH and U6 were undetectable (Figure 5, Panel D). To further explore the interaction between BCYRN1 and miR-150, we mutated the binding site for miR-150 in BCYRN1 (Lang et al., 2020) and measured luciferase expression. miR-150 reduced the activity of the wild-type reporter but not the mutant reporter. Consistent with a previous report (Ito et al., 2014), miR-150 targets CCR6, and overexpression of BCYRN1 was found to attenuate the ability of miR-150 to downregulate CCR6 (Figure 5, panel F), while promoting human iTreg migration (Figure 5, panel G). Collectively, the data demonstrate that BCYRN1 can sponge miR-150 to induce CCR6-dependent migration of human iTregs.
[0183] [Example 6] This non-limiting example shows that CDC-EV BCYRN1 induced IL-10 expression by sponging miR-98.
[0184] Analysis of lncRNA-miR interactions predicted that BCYRN1 could sponge miR-98 (Jeggari et al., 2012), which targets IL-10 (Liu et al., 2011). miR-98 (and BCYRN1 as a positive control) were enriched in RNA pulldown precipitates, whereas negative controls GAPDH and U6 were undetectable (Ct values >40; Figure 6, Panel A). Additionally, in a luciferase reporter system, miR-98 reduced the activity of a wild-type reporter but not a mutant reporter in which the miR-98 binding site in BCYRN1 was disrupted (Figure 6, Panel B). Furthermore, IL-10 expression was suppressed by miR-98, and this effect was reversed by overexpressing BCYRN1 (Figure 6, Panels C and D). Thus, BCYRN1 increases the expression of IL-10 in human iTregs by sponging miR-98.
[0185] [Example 7] This non-limiting example demonstrates the therapeutic efficacy of CDC-EV and CDC-EV-BCYRN1 in MI.
[0186] CDC-EVs reduce infarct size in rats after MI (Cambier et al., 2017). Here, we demonstrated that BCYRN1 is abundant in CDC-EVs, and BCYRN1 itself can upregulate human iTregs. Therefore, we tested the hypothesis that increased Tregs underlie the cardioprotective effect of CDC-EVs in MI. 15 minutes after MI, mice were intravenously administered CDC-EVs, CDC-EVs with BCYRN1 overexpression, or vehicle (IMDM) (Figure 7, Panel A). Infarct size, circulating TnI levels, and infiltrating Tregs were assessed 72 hours later. The number of CD4+FOXP3+IL10+ cells was increased in mice administered with CDC-EVs compared with vehicle controls, and was even higher in mice administered with CDC-EVs with BCYRN1 overexpression (Figure 7, Panel B). Thus, CDC-EVs and CDC-EVs overexpressing BCYRN1 promoted the infiltration of Treg cells into the heart and expanded IL-10-producing Treg cells. Additionally, CDC-EVs and CDC-EVs with BCYRN1 overexpression increased the number of CD4+FOXP3+Brdu+ cells in the heart (i.e., expanded Tregs). Either CDC-EVs or CDC-EVs with BCYRN1 overexpression significantly reduced infarct size and serum TnI levels compared with vehicle controls (Figure 7, panels C and D). The extent of wound size reduction was substantial (>50% relative reduction), and it is perhaps not surprising that the cardioprotective effects of either intervention (i.e., CDC-EVs with or without enhanced BCYRN1 expression) were comparable.
[0187] Discussion of Examples 1-7 MI, commonly known as a "heart attack," is the leading cause of death in the United States (Tsao et al., 2022). Tregs have the potential to promote tissue repair and functional recovery after MI (Li et al., 2018), but isolating and expanding Treg cells ex vivo for clinical use can be difficult, expensive, and time-consuming (Raffin et al., 2020). Treatments that can selectively and rapidly expand and activate Tregs in vivo are highly desirable. BCYRN1, a lncRNA abundant in EVs, specifically CDC-EVs, has been identified as a potential agent for expanding and activating Tregs. Acting as a miR sponge, BCYRN1 suppresses miR-138 (targeting ATG7-dependent autophagy), miR-150 (targeting CCR6-dependent migration), and miR-98 (targeting IL-10), enhancing Treg proliferation, migration, and IL-10 production in vitro and in vivo. These beneficial effects result in cardioprotection in MI (Figure 8).
[0188] In particular, gene therapy using RNA-based drugs is becoming a promising strategy for treating human diseases that are refractory to conventional approaches (Kim, 2020). Most RNA drugs are targeted therapies, such as small interfering (si)RNAs, antisense RNAs, and aptamers (Egli & Manoharan, 2023), but these are only the tip of the iceberg for RNA-based approaches. Here, a complementary approach is taken: exploring EVs from cells to identify therapeutically active ncRNA lead compounds, which can be used as naturally occurring or as bioinspiration for novel chemical entities.
[0189] Recently, lncRNAs have emerged as potential regulators of gene expression in diverse cell lineages with a wide range of biological activities (Boon et al., 2016). lncRNAs are >200 nt in length and have limited or no coding potential. Various lncRNA isoforms bind to and sequester select miRNAs ("miR sponges"), thereby acting to release functional targets from miR translational repression. These lncRNA characteristics are particularly applicable to immune cells, which exhibit dynamic functional plasticity in response to the local microenvironment (Ahmad et al., 2020). Here, one specific lncRNA species, BCYRN1, was found to be highly enriched in CDC-EVs and to be the most abundant lncRNA.
[0190] CDC-EV BCYRN1 was found to induce human iTreg cell proliferation through miR-138 sponging and enhance ATG7-dependent autophagy. Autophagy, the cellular process of self-degradation, regulates various components of the immune system, including natural killer cells, macrophages, dendritic cells, and T and B lymphocytes (Jiang et al., 2019). Without being bound by theory, this process may affect the homeostasis, survival, activation, proliferation, and differentiation of these immune cells, which are involved in both innate and adaptive immune responses (Jiang et al., 2019). ATG7 is a gene that aids in the formation of autophagosomes. Interestingly, Treg cells lacking Atg7 exhibit increased apoptosis and rapidly lose Foxp3 expression, particularly after activation (Wei et al., 2016). This study found that miR-138 targets ATG7, leading to the inhibition of autophagy, which may reduce iTreg proliferation. Overexpression of BCYRN1 reduced miR-138-mediated downregulation of ATG7 and promoted proliferation.
[0191] Regulatory T cells, like all other lymphocytes, migrate to sites of inflammation to perform their regulatory functions. Without being bound by theory, the expression of specific chemokine receptors on the surface of Tregs may facilitate their homing to these locations. The chemokine CCL20 is associated with ischemic heart disease, particularly acute MI, as blood CCL20 levels are higher in patients with MI than in healthy individuals (Safa et al., 2016) (Schumacher et al., 2021). CCR6, the receptor for CCL20, plays an important role in recruiting Treg cells to the ischemic heart (Yamazaki et al., 2008). CDC-EVs were found to induce CCR6 upregulation and Treg migration, and this effect was enhanced by overexpression of BCYRN1. RNA pull-down and luciferase assays revealed that BCYRN1 acts as a sponge for miR-150. miR-150 suppressed CCR6 protein and human iTreg migration, whereas overexpression of BCYRN1 reversed this suppression. In summary, we demonstrated that CDC-EVs induce CCR6-dependent migration of Tregs via BCYRN1, which acts as a sponge for miR-150. Increased cell migration may facilitate enhanced Treg infiltration into injured cardiac tissue.
[0192] IL-10, a pleiotropic cytokine that plays a key role in regulating immune responses, is produced by Tregs, monocytes, Th2 cells, subsets of activated T cells, and B cells (Wang et al., 2016). Treg-derived IL-10 is involved in the preservation of immune tolerance and the maintenance and stability of FOXP3 expression, a related regulatory mediator (Murai et al., 2009). Using gene knockdown and overexpression approaches, BCYRN1 was suggested to be a key player in CDC-EV-mediated induction of IL-10 in human iTregs. Without wishing to be bound by theory, IL-10 upregulation can be explained by BCYRN1's ability to act as a sponge for miR-98, providing a rational explanation for how CDC-EVs induce IL-10 in human iTreg cells.
[0193] Modulating Tregs is a promising treatment for inflammatory diseases because it harnesses the body's natural immunosuppressive mechanisms. Over 50 clinical trials (Roemhild et al., 2020) are currently exploring Treg autotransfusion for conditions including solid organ transplantation (to increase graft survival), graft-versus-host disease, and autoimmune disorders. However, many of these trials use challenging and complex protocols that involve ex vivo isolation and expansion of Treg cells before reinfusion into patients. This not only introduces uncertainty regarding the suppressive and post-expansion proliferative potential of Tregs, but also involves delays, compromising their applicability to acute diseases such as MI or stroke. This in vivo data demonstrated that CDC-EVs and CDC-EVs with BCYRN1 overexpression can induce and expand IL-10+ Treg infiltration into the heart, reduce infarct size, and decrease cardiac troponin I (cTnI) levels. The approach of utilizing Treg cells in vivo using CDC-EVs or CDC-EVs with BCYRN1 overexpression circumvents the limitations of ex vivo expansion.
[0194] [Example 8] This non-limiting example demonstrates that BCYRN1 maintains the suppressive capacity of hTregs in vitro.
[0195] To determine whether BCYRN1 affects the ability of Tregs to suppress T cell activation and antigen-presenting cell (DC) activation, we used in vitro assays with responder CD8+ T cells, DCs, and hTregs. Both unmodified hTregs (Treg Ctrl) and Treg BCYRN1 (BCYRN1-transfected hTregs) suppressed DC-mediated proliferation of CD8+ T cells (Figure 9), verifying that BCYRN1 does not interfere with the central immunosuppressive phenotype of hTregs.
[0196] [Example 9] This non-limiting example shows the effect of BDSS on Treg proliferation, migration and IL10 production.
[0197] Three BDSSs were prepared and mixed with lipid nanoparticles (LNPs, transfection reagent DharmaFect; manufactured by PerkinElmer). The BDSSs contained the following RNAs: BDSS-13 (UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11)); BDSS-150 (GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12)); and BDSS-98 (ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13)). LNPs containing the three BDSSs induced Treg cell proliferation, migration, and IL-10 induction (Figure 10, panel A).
[0198] Of the three BDSS species, BDSS-98 uniquely upregulated IL-10 production (FIG. 10, panel C) in a dose-dependent manner (FIG. 10, panel B).
[0199] [Example 10] This non-limiting example demonstrates the therapeutic efficacy of a BDSS cocktail in MI.
[0200] Equimolar amounts of all three BDSSs (described in Example 9) were mixed with LNPs to predict whether various BDSS species might act synergistically. MI was induced in 8-10 week-old C57BL / 6 mice by ligating the left coronary artery for 45 minutes followed by reperfusion. Fifteen minutes later, mice were administered (via the tail vein) a BDSS cocktail (BDSS-138, BDSS-150, and BDSS-98, 0.5 mg / kg) or a Mut-BDSS cocktail (binding site mutant). Preliminary in vitro data indicated that increased autophagy underlies enhanced Treg proliferation, with BCYRN1 acting as a "sponge" to sequester miR-138.
[0201] Rapamycin is a potent inducer of autophagy in a diverse range of cell lines, and indeed, rapamycin attenuates MI injury when added to the reperfusion fluid. To further test the role of autophagy, the BDSS cocktail and rapamycin (positive control) were compared for their ability to limit MI size.
[0202] Both the BDSS cocktail and rapamycin reduced infarct mass and serum levels of cardiac troponin I (cTnI) (Figure 11). Thus, the disease-modifying bioactivity of BDSS species in vivo and in vitro in a mouse MI model was demonstrated. The effects of BDSS mimicked and were comparable to those of rapamycin, a known autophagy inducer.
[0203] [Example 11] This non-limiting example demonstrates that Treg depletion with CD25 antibodies blocks the cardioprotective benefits of the BDSS cocktail.
[0204] The benefit of the BDSS cocktail after MI was blocked by Treg depletion (Figure 12). In a blinded study design, Tregs were depleted by daily intraperitoneal (ip) injection of anti-CD25 antibody (100 μg / mouse) to achieve approximately 80% Treg cell depletion (Figure 12, panel B). WT (i.e., non-depleted) mice were administered an isotype control (rat IgG1). The BDSS cocktail or mutated BDSS (with binding site mutations designed to eliminate the miR sponging effect) was then administered intravenously 15 minutes after reperfusion (similar to Figure 12, panel A). Hearts were excised 72 hours after MI and subsequently stained with TTC for histological quantification of infarct mass. Pooled data (Figure 12, panel C) show that the BDSS cocktail reduced infarct mass at 72 hours, and this effect was abolished when Tregs were depleted. Thus, Tregs are required for the disease-modifying bioactivity of BDSS.
[0205] [Example 13] This non-limiting example shows CDC-EV with overexpressed BCYRN1.
[0206] CDCs transduced with the BCYRN1 vector showed increased BCYRN1 expression in both CDCs and CDC-EVs (Figure 13). The vector contained the full-length BCYRN1 cDNA in a lentiviral vector (see Example 14).
[0207] [Example 14] This non-limiting example presents experiments exploring the molecular mechanisms underlying BCYRN1-mediated human Treg cell proliferation, migration, and IL-10 production.
[0208] Experimental design overview: 1. Cells: Two human primary cell types are available: CDCs and hTregs. Human CDCs are re-derived as needed from widely available frozen stocks. Each line passes rigorous quality control, safety inspections, and a potency assay (improved recovery from in vivo MI in rats) as described. Human Treg cells purchased from IQ Biosciences (Cat # IQB-Hu1-iTr-1) were obtained from normal volunteers. Purity and quality were confirmed by flow cytometry (90% CD4+CD25+ (90% CD127, 85% FOXP3+)), and cells tested negative for HIV, HCV, and hepatitis B.
[0209] 2. Vector: BCYRN1 expression is driven by a CMV promoter coexpressed with a GFP reporter in a lentiviral vector, which can be used for non-viral plasmid transfection of BCYRN1 into target cells (e.g., Figure 1). Alternatively, the vector can be packaged into lentiviral particles for highly efficient transduction and stable integrated expression. Because hTregs are primary cells that do not require long-term genetic modification, we primarily rely on transient transfection. We used the pLenti-CMV-GFP-2A-Puro-Blank vector and the BCYRN1 Lentiviral vector (Applied Biological Materials Inc.).
[0210] 3. Cell assay time points: 0, 3, 6, 24, 48, 72 hours unless otherwise stated.
[0211] Experiment 14A: Investigating the mechanism by which BCYRN1 mediates hTreg cell proliferation. Experiments will be performed to determine whether BCYRN1 acts as a miR sponge to sequester miR-138, promote ATG7-dependent autophagy, and enhance hTreg proliferation.
[0212] The following considerations motivated this experiment: 1) both CDC-EV and BCYRN1 induce hTreg cell proliferation (Figure 1); 2) BCYRN1 contains a putative binding site for sponging miR-138 (Figure 4, panel E); 3) miR-138-transfected hTreg cells show downregulation of ATG7 (Figure 4, panel F); and 4) ATG7-dependent autophagy is essential for Treg cell survival and proliferation. BCYRN1 can act as a miR-138 sponge to promote autophagy, which is favorable for hTreg proliferation.
[0213] The following will be assayed: a) autophagy marker expression (LC3, P62, ATG7) using Western blotting (WB) and immunocytochemistry; b) proliferation assay (CCK8); c) qRT-PCR for quantification of BCYRN1 and miR-138; d) RNA pull-down and luciferase reporter assays will be used to verify the functional binding sequence of BCYRN1 targeting miR-138.
[0214] Experimental Example 14A1: Investigating the effect of BCYRN1 on autophagy in hTreg cells. Because autophagy plays a central role in promoting Treg cell proliferation, we tested whether BCYRN1 induces autophagy in Treg cells. Human Tregs were transfected with an empty vector or a BCYRN1 overexpression vector for 48 hours, followed by evaluation of autophagy markers using WB and immunocytochemistry.
[0215] Experimental Example 14A2: Testing whether BCYRN1 functions as a sponge for miR-138. BCYRN1 contains a potential miR-138 binding site, and miR-138 targets ATG-7 (Figure 4, panels E and F). To further test whether BCYRN1 functions as a sponge for miR-138, two experiments are performed: 1. RNA pull-down assay. A 5'-biotinylated BCYRN1 probe is added to hTreg cell lysates. After co-incubation, biotinylated BCYRN1 is precipitated using streptavidin, followed by RNA extraction. BCYRN1-associated RNA is assessed by qPCR for miR-138, as well as for BCYRN1 (positive control), GAPDH, and U6 (both negative controls); 2. Dual-luciferase reporter assay. pmiR-GLO luciferase reporter plasmids containing wild-type (WT) and mutant (Mu) binding sequences of BCYRN1 for miR-138 were generated. hTreg cells were co-transfected with miR-138 mimics (in DharmaFECT LNP) and luciferase reporter constructs for specific targets (WT or Mu) (in DharmaFECT), and luciferase activity was measured 24 hours after transfection. The findings of these experiments determined whether BCYRN1 sponges miR-138 and further confirmed the functional binding sequence of BCYRN1 for miR-138 (this 21-nt BDSS was tested in Example 15).
[0216] Experimental Example 14A3: Investigating the effect of BCYRN1 on miR-138 / ATG7-dependent autophagy. We examine whether BCYRN1 reduces miR-138-mediated downregulation of ATG7 and promotes hTreg cell proliferation. Four groups are tested: 1) hTregs transfected with a mimic control; 2) hTregs transfected with mimic miR-138; 3) hTregs cotransfected with a BCYRN1 overexpression vector and a mimic control; and 4) hTregs cotransfected with a BCYRN1 overexpression vector and mimic miR-138. All groups are evaluated for ATG7 expression (WB) and hTreg proliferation (CCK-8).
[0217] Experimental Example 14A4: Investigating the effect of BCYRN1-overexpressed CDC-EVs on Treg proliferation. As an alternative to plasmid vector transfection, we test whether overexpressing BCYRN1 in CDC-EVs can boost CDC-EV-mediated proliferation of Tregs. CDCs are transfected with empty vector or BCYRN1 lentiviral vector for 48 hours, followed by EV isolation. CDCs transduced with BCYRN1 vectors have been validated to show increased BCYRN1 expression in both CDCs and CDC-EVs (see Example 13). hTregs are exposed to CDC-EV-BCYRN1 (or CDC-EV vector) and subsequently assessed for proliferation (CCK-8 assay). Findings from these experiments will determine whether overexpressing BCYRN1 in CDC-EVs can improve CDC-EV-mediated induction of hTreg cell proliferation.
[0218] Two alternative approaches include: 1) generating lentivirus and using it for in vitro and in vivo transfection of BCYRN1 (as an alternative to this, generating and testing BCYRN1-overexpressing AAV); 2) generating a BDSS targeting miRNA-138 (BDSS-138), which is only 21 nt in size and can therefore be easily synthesized and packaged into LNPs.
[0219] Experimental Example 14B: Investigating the mechanism by which BCYRN1 enhances hTreg cell migration. We conduct experiments showing that BCYRN1 acts as a sponge for miR-150 and promotes CCR6-dependent migration of hTreg cells.
[0220] Preliminary data indicate that 1) both CDC-EV and BCYRN1 enhance hTreg cell migration (Figs. 1 and 3); 2) BCYRN1 contains a putative binding site for sponging miR-150 (Fig. 5); and 3) miR-138 targets CCR6 (Fig. 5). Because CCR6 plays a key role in recruiting Treg cells to inflamed tissues, BCYRN1 may act as a miR-150 sponge to promote hTreg cell migration.
[0221] The following will be assayed: a) CCR6 expression using WB and qPCR; b) transwell migration assay; c) qPCR for quantification of BCYRN1 and miR-150; d) RNA pull-down and luciferase reporter assay will be used to verify the functional binding sequence of BCYRN1 targeting miR-150.
[0222] Experimental Example 14B1: Testing the concept that BCYRN1 functions as a sponge for miR-150. The following experiments were performed: 1. RNA pull-down assay (similar to Experimental Example 14A2). Using qPCR, miR-150 was probed by RNA pull-down with BCYRN1, and BCYRN1 (positive control), GAPDH, and U6 (both negative controls) were also amplified; 2. Dual-luciferase reporter assay. pmiR-GLO luciferase reporter plasmids containing wild-type (WT) and mutant (Mu) BCYRN1 binding sequences for miR-150 were generated. Human Treg cells were cotransfected with miR-150 mimics (in DharmaFECT, as in Figure 8) and luciferase reporter constructs for specific targets (WT / Mu) (in DharmaFECT), and luciferase activity was monitored 24 hours after transfection. These experiments determine whether BCYRN1 sponges miR-150 and further confirm the functional binding sequence of BCYRN1 for miR-150 (this BDSS-150 is tested in Example 15).
[0223] Experimental Example 14B2: Investigate the effect of BCYRN1 on miR-150 / CCR6-dependent migration of Treg cells. Four groups are tested: 1) hTreg cells transfected with a mimic control; group 2) hTreg cells transfected with mimic miR-150; 3) hTreg cells co-transfected with a BCYRN1 overexpression vector and a mimic control; and 4) hTreg cells co-transfected with a BCYRN1 overexpression vector and mimic miR-150. All are probed for CCR6 expression (by WB) and Treg cell migration (by transwell assay).
[0224] Experimental Example 14B3: Investigate the effect of BCYRN1-overexpressed CDC-EVs on Treg cell migration. Human Treg cells were exposed to either CDC-EV vector or CDC-EV-BCYRN1, followed by assessment of Treg cell migration. This experiment will determine whether overexpression of BCYRN1 in CDC-EV can boost the beneficial effects of unprotected CDC-EV on hTreg cells.
[0225] Experiment 14C: Investigating the mechanism by which BCYRN1 increases IL-10 in hTreg cells. Experiments will be performed to determine whether BCYRN1 acts as a miR sponge for miR-98 to promote the induction of IL-10 in hTreg cells.
[0226] Preliminary data indicate that 1) both CDC-EV and BCYRN1 induce IL-10 production in hTreg cells (Figs. 1 and 3); 2) BCYRN1 contains a putative binding site for sponging miR-98 (Fig. 7A); and 3) miR-98 targets IL10, as confirmed in transfected hTregs (Fig. 6).
[0227] The following will be assayed: a) IL10 expression using qPCR and ELISA; b) qRT-PCR for quantification of BCYRN1 and miR-98; d) RNA pull-down and luciferase reporter assays will be used to verify the functional binding sequence of BCYRN1 targeting miR-98.
[0228] Experiment 14C1: Testing the concept that BCYRN1 functions as a sponge for miR-98. The following experiments were performed: 1. RNA pull-down assay (similar to Experiment 14A2). In this, the following were amplified by qPCR: miR-98, BCYRN1 (positive control), GAPDH, and U6 (both negative controls). 2. Dual-luciferase reporter assay. A pmiR-GLO luciferase reporter plasmid containing wild-type (WT) and mutant (Mu) binding sequences of BCYRN1 for miR-98 was generated. Human Treg cells were cotransfected with a miR-98 mimic (DharmaFECT) and luciferase reporter constructs for specific targets (WT / Mu) (using transfection reagent, DharmaFECT), and luciferase activity was monitored 24 hours after transfection. These experiments determine whether BCYRN1 sponges miR-150 and further confirm the functional binding sequence of BCYRN1 for miR-98 (which is tested in Example 15).
[0229] Experimental Example 14C2: Investigate the effect of BCYRN1 on miR-98-dependent IL-10 production in Treg cells. Four groups are tested: 1) hTreg cells transfected with mimic control; group 2) hTreg cells transfected with mimic miR-98; 3) hTreg cells co-transfected with BCYRN1 overexpression vector and mimic control; and 4) hTreg cells co-transfected with BCYRN1 overexpression vector and mimic miR-98 for expression of IL-10 (by WB and ELISA).
[0230] Experimental Example 14C3: Investigating the effect of BCYRN1-overexpressed CDC-EV on the induction of IL-10 in Treg cells. Human Treg cells were exposed to either the CDC-EV vector or CDC-EV-BCYRN1, followed by evaluation of IL-10 induction in hTreg cells.
[0231] [Example 15] This non-limiting example demonstrates the synthesis of functional binding sequences of BCYRN1 (BCYRN1-derived short sequences, BDSS) and testing their effects on proliferation, migration and IL-10 production of Treg cells in vitro.
[0232] All FDA-approved ncRNA drugs (n=12) are short (<35nt) synthetic entities. Truncated forms of BCYRN1 that retain bioactivity in vitro will be created and tested. Preliminary data (Figure 10) showed that LNPs containing the BDSS cocktail induced Treg cell proliferation, migration, and IL-10 induction. Of the three BDSS species, BDSS-98 uniquely upregulated IL-10 production. Other BDSS species will be individually tested for their mechanisms and effects on hTreg proliferation, migration, and IL-10 production.
[0233] Synthetic RNA and transfection method: BDSS-138, BDSS-150, and BDSS-98 were synthesized as in the previous experiment (Integrated DNA Technologies). Each BDSS was mixed with 5 μl of small RNA transfection reagent (DharmaFECT, as in Figure 10) to a final volume of 100 μl in serum-free medium. Following mixing and incubation (to form liposome-RNA complexes), the preparations were added to Treg cell culture medium to achieve final concentrations of 1, 10, and 100 nM.
[0234] Each BDSS will be tested in the following experiments: hTreg cells transfected with BDSS-138, -150, or -98 will be evaluated for proliferation (Experiment 15-1, CCK-8 assay), autophagy pathway (Experiment 15-2, WB and immunostaining), migration (Experiment 15-3, transwell migration assay), CCR-6-dependent migration pathway (Experiment 15-4, WB and qPCR), and IL-10 production (Experiment 15-5, qPCR and ELISA). In these experiments, a synthesized mutant binding sequence (see Figures 11 and 12) will be used as a negative control. Dose-finding studies will determine the minimum dose sufficient to achieve maximum bioactivity for each BDSS.
[0235] Experiments show that BDSS-138 affects the proliferation / autophagy pathway, BDSS-150 affects CCR6-dependent migration, and BDSS-98 affects IL-10 production, with minimal or no effect on each of the other two processes. In some embodiments, a mixture of two or all three BDSSs is packaged into LNPs, as previously done with siRNA cocktails, to achieve the full therapeutic effect of BCYRN1. In some embodiments, chemical RNA modifications are introduced to increase stability. Among alternative strategies, locked nucleic acid (LNA) modifications are tested. Non-Treg cell types can also be affected by BDSSs.
[0236] [Example 16] This non-limiting example tests the therapeutic potential of BCYRN1 and BDSS in vivo in a CVB3-induced myocarditis mouse model.
[0237] The proposed in vivo experiments will validate the in vitro findings and lead to options for treating acute myocarditis.
[0238] Methods (Endpoint Measurements): 1) Transthoracic echocardiography was performed to assess LV end-systolic and end-diastolic diameters and LVEF; 2) Hearts were stained with hematoxylin and eosin to assess the degree of inflammation; 3) Cardiac-infiltrating Tregs were assessed for IL-10 production and proliferation by flow cytometry. As shown in Figure 14, hearts were minced into small tissue fragments and subsequently enzymatically digested with collagenase B (1 mg / mL, Roche) in HEPES buffer (gently agitated at 37°C for 2 hours). The cell suspension was then filtered through a 40 μm cell strainer (BD Bioscience) to separate mononuclear cells. These cells were collected and stained with the following antibodies: anti-CD45, anti-CD4, and anti-Foxp3 (all from Biolegend). The viability of stained cells was determined using the Zombie Aqua Fixable Viability Kit (Biolegend) before fixation. Flow cytometry was performed on a Sony SA3800 Cell Analyzer. Initially, live single mononuclear cells were selected by gating on SSC and CD45+. Within this single cell population, cells were further gated to select for a double-positive CD4+FoxP3+ Treg cell population. Using this strategy, purified cardiac-infiltrating Treg cells were obtained for analysis of IL-10 production (IL-10+FoxP3+) and proliferation (Brdu+FoxP3+).
[0239] Experimental Example 16A: Evaluating the therapeutic potential of BCYRN1 in vivo in a CVB3-induced myocarditis mouse model. Experimental Example 16A1: Myocarditis was induced in 6-8 week-old A / J mice by infection with CVB3 (50 TCID50 / animal 64) (saline recipients served as controls). On day 14, mice were administered CDC-EV-BCYRN1, CDCEV vector, CDC-EV, or vehicle (IMDM) (i.v. via the tail vein) (N = 8-10 per group). At the study endpoint on day 21, several functional endpoints were evaluated: 1) Transthoracic echocardiography was performed on days 0 (baseline) and 21 (endpoint). LV end-systolic and end-diastolic diameters and ejection fraction were assessed by M-mode (Vevo 3100, VisualSonics) using the parasternal short-axis view. The average of three measurements was used for each animal. After in vivo phenotyping, hearts were collected under anesthesia for euthanasia. 2) Cross sections of the heart are frozen, fixed, and stained with hematoxylin and eosin. Semiquantitative assessment of inflammation is performed by a cardiac pathologist blinded to group assignment. The degree of inflammation is scored from 0 to 4, with 0 indicating no inflammatory infiltrate, 1 indicating small foci of inflammatory cells, 2 indicating large foci containing >100 inflammatory cells, 3 indicating >10% cross section involvement, and 4 indicating >30% cross section involvement. 3) Infiltrating Tregs (by flow cytometry) are assessed for IL-10 production and proliferation. Because viable cells cannot be isolated from hematoxylin and eosin-stained hearts, parallel sets of animals are used for flow cytometry analysis.
[0240] Experiments will demonstrate whether the number of CD4+FOXP3+IL10+ cells is higher in animals administered CDC-EV-BCYRN1 compared with vehicle and CDC-EV vector controls due to increased Treg cell infiltration into the heart and increased IL-10 production by Treg cells. CDC-EV-BCYRN1 increases the number of CD4+FOXP3+Brdu+ cells in the heart by inducing Treg cell proliferation. As a result of these multiple effects on Tregs, CDC-EV-BCYRN1 treatment may improve LV ejection fraction and reduce cardiac inflammation. The cardioprotective effects of CDC-EV-BCYRN1 and CDC-EV will be compared to determine whether EV-BCYRN1 has enhanced disease-modifying biological activity compared with CDC-EV (as would be predicted from the overexpression study in Figure 13). The 200-nt BCYRN1 is too long to be produced synthetically using current technology. Therefore, alternative and / or complementary approaches include: 1) knocking down BCYRN1 in CDC-EVs to verify loss of function. This is achieved by transfecting CDCs with either siRNA control or siRNA against BCYRN1 for 48 hours, followed by EV isolation. In preliminary experiments, we found that transfection of CDCs with siRNA-BCYRN1 successfully reduced BCYRN1 expression in both CDCs and CDC-EVs (Figure 9). After achieving BCYRN1 knockdown in CDC EVs, we studied the effects of BCYRN1-depleted CDC-EVs in vivo. 2) We generated BCYRN1 lentivirus and directly tested its effects in vivo by intravenous injection.
[0241] Experimental Example 16B: Evaluating the therapeutic potential of BDSS in vivo in a CVB3-induced myocarditis mouse model. Experimental Design: The default strategy uses LNPs containing synthetic BDSS (single or combination as provided in Example 15) and a transfection reagent (DharmaFECT).
[0242] Experimental Example 16B1: Myocarditis was induced in 6-8 week old A / J mice by injecting CVB3 (50 TCID50 *Mice are induced by infection with BDSS-138, BDSS-150, BDSS-98, a combination of all three BDSSs (BDSS-138+150+98), or mut-BDSS (individually or in combination) via the tail vein (N=8-10 per group). At the end of the study on day 21, the same functional endpoints (as in Example 16A) are assessed.
[0243] Experiments show that BDSS-150 increases Treg infiltration, while BDSS-138 and BDSS-98 increase proliferation and IL-10 in the heart, respectively. A cocktail of BDSS-138+150+98 enhances cardioprotection compared to each BDSS alone. Because these BDSSs are presumed to act by sponging miRs, the mechanism is similar to that of miR-targeted RNA interference. This technique can produce "off-target" effects caused by knockdown of genes other than the target gene. With this in mind, we will explore further studies into the off-target effects of BDSS TC. An alternative approach involves loading each of the BDSSs or a combination of all three BDSSs into CDC-EVs and selecting exosomes using immunoprecipitation. This approach has been successfully implemented with several LNA-modified RNA payloads; Figure 15 shows an example in which LNA-modified mRNA encoding GFP was loaded into CDC-EVs. Liposomes containing BDSS were mixed with CDC-EVs on a shaker at 37°C for 30 minutes. The size distribution of liposome-exosome complexes measured by dynamic light scattering revealed multiple peaks (Figure 15, panel A, center), indicating a heterogeneous population. To select exosomes, immunoprecipitation was performed using anti-CD9, anti-CD63, and anti-CD81 antibodies (all targeting 90 exosome-specific surface proteins). As shown in Figure 15, panel B, the immunoprecipitates exhibited a single peak (approximately 120 nm in diameter), characteristic of exosomes. qPCR revealed significantly higher GFP mRNA levels than in control exosomes. Addition of immunoprecipitated exosomes to cultured neonatal rat cardiomyocytes induced GFP expression when observed by epifluorescence after 24 hours (Figure 15, panel C), confirming the ability of functional transgene expression from the modified GFP mRNA loaded into the exosomes. As an alternative to this strategy, these methods can be used to load BDSSs (either single or in combination) into EVs.
[0244] References TIFF2025525333000007.tif70158TIFF2025525333000008.tif213160TIFF2025525333000009.tif217161 TIFF2025525333000010.tif219160TIFF2025525333000011.tif206161TIFF2025525333000012.tif141160
[0245] Although the foregoing has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be understood by those skilled in the art that modifications can be made without departing from the spirit of the present disclosure. It should therefore be understood that the forms disclosed herein are illustrative only and are not intended to limit the scope of the present disclosure, but are intended to embrace all modifications and alternatives that come within the true scope and spirit of the embodiments of the present disclosure.
[0246] It is contemplated that various combinations or subcombinations of the specific features and aspects of the embodiments disclosed above may be made. Furthermore, any specific attribute, aspect, method, property, characteristic, quality, attribute, element, etc., disclosed herein in connection with an embodiment may be used in all other embodiments described herein. It should therefore be understood that various attributes and aspects of the disclosed embodiments can be combined with or substituted for one another to form varying modes of the disclosed subject matter. It is therefore not intended that the scope of the present disclosure be limited by the specific disclosed embodiments described above. Furthermore, while the disclosed subject matter is susceptible to various modifications and alternative forms, specific examples thereof have been shown in the drawings and are described in detail herein. However, it should be understood that the present disclosure is not limited to the specific forms or methods disclosed, but rather encompasses all modifications, equivalents, and alternatives falling within the spirit and scope of the various described embodiments and the appended claims.
[0247] Any methods disclosed herein need not be performed in the order listed. The methods disclosed herein include certain actions performed by a medical practitioner, but can also include, explicitly or implicitly, any third-party direction of these actions. For example, an action such as "administering a therapeutically effective amount of a nucleic acid to a subject in need of treatment for a cardiac condition or a symptom thereof" includes "directing the subject to administer the effective amount of the nucleic acid." Furthermore, when features or aspects of the present disclosure are described in terms of a Markush group, those skilled in the art will recognize that the present disclosure is also thereby described in terms of any individual member of the Markush group, or subgroup of members of the Markush group.
[0248] Ranges disclosed herein also encompass all overlaps, subranges, and combinations thereof. Language such as "at most," "at least," "greater than," "less than," and "between" includes the recited numbers. Numbers preceded by terms such as "about" or "approximately" include the recited number. For example, "about 90%" includes "90%." In some embodiments, at least 95% homology includes 96%, 97%, 98%, 99%, and 100% homology to the reference sequence. Furthermore, when a sequence is disclosed as "comprising" a nucleotide or amino acid sequence, such reference also includes the sequence "comprising," "consisting of," or "consisting essentially of" the recited sequence, unless otherwise indicated.
[0249] Terms and phrases used in this application, and variations thereof, particularly in the appended claims, unless expressly stated otherwise, should be construed as open-ended as opposed to limiting. As an example of the foregoing, the term "including" should be construed to mean "including but not limited to," "including but not limited to," etc.
[0250] All patents and other publications cited throughout this application; e.g., literature references, issued patents, published patent applications, and co-pending patent applications; are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methods described in such publications that may be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of this application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements regarding the date or contents of these documents are based on the information available to the applicant and do not constitute an admission as to the accuracy of the dates or contents of these documents.
Claims
1. A therapeutic composition comprising at least one nucleic acid comprising a BDSS (BCYRN1-derived binding sequence), wherein the BDSS comprises a nucleotide sequence provided by any one of SEQ ID NOs: 11-16 or a sequence at least 90% identical thereto, and wherein each of the at least one nucleic acid is 35 nucleotides in length or less.
2. 2. The composition of claim 1, wherein the BDSS comprises a nucleotide sequence provided by any one of SEQ ID NOs: 11 to 16 or a sequence at least 95% identical thereto.
3. 2. The composition of claim 1, wherein the BDSS comprises a nucleotide sequence provided by any one of SEQ ID NOs: 11 to 16.
4. a first nucleic acid comprising BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrCrC) (SEQ ID NO: 14), or a sequence at least 90% identical thereto, and which is 35 nucleotides in length or less; a second nucleic acid comprising BDSS-150 (rGrArGrGrCrUrArArGrArGrCrGrGrGrArGrArGrArU) (SEQ ID NO: 15) or a sequence at least 90% identical thereto, and which is 35 nucleotides in length or less; and a third nucleic acid comprising BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArCrC) (SEQ ID NO: 16) or a sequence at least 90% identical thereto, and which is 35 nucleotides in length or less. The composition of claim 1, comprising at least one of:
5. 5. The composition of claim 4, comprising at least two of the first, second and third nucleic acids.
6. The composition of claim 5, comprising a first, second, and third nucleic acid.
7. the first nucleic acid consists of or consists essentially of BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArArCrCrCrCrC) (SEQ ID NO: 14); the second nucleic acid consists of or consists essentially of BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrGrArGrArU) (SEQ ID NO: 15); the third nucleic acid consists of or consists essentially of BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArArCrC) (SEQ ID NO: 16); 5. The composition of claim 4.
8. a first nucleic acid comprising a BDSS comprising UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11) or a sequence at least 90% identical thereto, and which is 35 nucleotides in length or less; a second nucleic acid comprising a BDSS comprising GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12) or a sequence at least 90% identical thereto, the second nucleic acid being 35 nucleotides in length or less; and a third nucleic acid comprising a BDSS comprising ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13) or a sequence at least 90% identical thereto, and which is 35 nucleotides in length or less; The composition of claim 1, comprising at least one of:
9. 9. The composition of claim 8, comprising at least two of the first, second and third nucleic acids.
10. 10. The composition of claim 9, comprising a first, second, and third nucleic acid.
11. the first nucleic acid comprises a BDSS consisting of or consisting essentially of UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11); the second nucleic acid comprises a BDSS consisting of or consisting essentially of GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12); the third nucleic acid comprises a BDSS consisting of or consisting essentially of ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13); 9. The composition of claim 8.
12. A therapeutic composition comprising at least one BDSS (BCYRN1-derived binding sequence) compound for treating an immune and / or inflammatory disease, wherein the BDSS compound each comprises a nucleotide sequence provided by any one of SEQ ID NOs: 11-16, or a derivative thereof having 1, 2, 3, 4, or 5 substitutions thereto.
13. 13. The composition of claim 12, wherein each of the at least one BDSS compound comprises at least one of BDSS-138 (rUrCrCrCrUrCrArArArGrCrArArCrArCrCrCrC) (SEQ ID NO: 14), BDSS-150 (rGrArGrGrCrUrArArGrArGrGrCrGrGrArGrGrArU) (SEQ ID NO: 15), or BDSS-98 (rArCrUrUrCrCrCrUrCrArArArGrCrArArCrArCrC) (SEQ ID NO: 16), or derivatives thereof having 1, 2, 3, 4, or 5 substitutions thereon.
14. 13. The composition of claim 12, wherein at least one BDSS compound comprises a nucleotide sequence comprising UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), or ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a derivative thereof having one, two, three, four, or five substitutions therein.
15. 13. The composition of claim 12, wherein at least one BDSS compound comprises a nucleotide sequence comprising UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), or ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a derivative having at least 80% sequence identity thereto.
16. A therapeutic composition comprising at least one inhibitory nucleic acid that binds to at least one of miR-138, miR-150, and miR-98, respectively, wherein at least one nucleic acid is at most 35 nucleotides in length.
17. a first inhibitory nucleic acid that binds to miR-138; a second inhibitory nucleic acid that binds to miR-150, and A third inhibitory nucleic acid that binds to miR-98 and each of the first, second and third inhibitory nucleic acids is up to 35 nucleotides in length; 17. The composition of claim 16.
18. 18. The composition of claim 17, comprising at least two of the first, second and third inhibitory nucleic acids.
19. 20. The composition of claim 18, comprising a first, second, and third inhibitory nucleic acid.
20. The composition of any one of claims 16 to 19, wherein the inhibitory nucleic acid that binds to miR-138 or miR-98 comprises ACAAC (SEQ ID NO: 18).
21. The composition of any one of claims 16 to 20, wherein the inhibitory nucleic acid that binds to miR-150 comprises GGGAG (SEQ ID NO: 19).
22. 22. The composition of any one of claims 1 to 21, wherein the nucleic acid or BDSS compound comprises ACAAC (SEQ ID NO: 18).
23. 23. The composition of any one of claims 1 to 22, wherein the nucleic acid or BDSS compound comprises GGGAG (SEQ ID NO: 19).
24. 24. The composition of any one of claims 1 to 23, wherein at least one nucleic acid or BDSS compound comprises RNA.
25. 25. The composition of any one of claims 1 to 24, wherein at least one nucleic acid or BDSS compound comprises at least one chemically modified nucleotide.
26. 26. The composition of claim 25, wherein at least one chemically modified nucleotide comprises a backbone modification.
27. 27. The composition of claim 25 or 26, wherein at least one chemically modified nucleotide comprises a locked nucleic acid (LNA) and / or methylation.
28. The following long non-coding RNAs: (SEQ ID NO: 17) or one or more synthetic derivatives thereof, wherein the derivatives are 35 nucleotides in length or less, and wherein the long non-coding RNA or synthetic derivative thereof enhances Treg functionality.
29. a first BDSS (BCYRN1-derived binding sequence) compound provided by SEQ ID NO: 11, which is 35 nucleotides in length or less; a second BDSS compound provided by SEQ ID NO: 12, which is 35 nucleotides in length or less; a third BDSS compound provided by SEQ ID NO: 13, which is 35 nucleotides in length or less; and pharmaceutically acceptable excipients A therapeutic composition comprising:
30. 30. The composition of any one of claims 1 to 29, comprising a transfection reagent.
31. 31. The composition of claim 30, wherein the transfection reagent comprises one or more of a liposome, a lipid nanoparticle (LNP), an extracellular vesicle (EV), and a polyethylene glycol (PEG) cationic lipid complex (PCLC).
32. 32. The composition of claim 30 or 31, wherein the transfection reagent comprises EVs derived from cardiosphere-derived cells (CDCs).
33. An isolated nucleic acid comprising the nucleotide sequence UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), which is RNA and is up to 35 nucleotides in length.
34. An isolated nucleic acid comprising the nucleotide sequence GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), which is RNA and is up to 35 nucleotides in length.
35. An isolated nucleic acid comprising the nucleotide sequence ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), which is RNA and is up to 35 nucleotides in length.
36. An isolated nucleic acid comprising a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 11-13, which is RNA and is up to 35 nucleotides in length.
37. The nucleic acid according to any one of claims 33 to 36, wherein the nucleic acid comprises at least one chemically modified nucleotide.
38. 38. The nucleic acid of claim 37, wherein at least one chemically modified nucleotide comprises a backbone modification.
39. 39. The nucleic acid of claim 38, wherein the backbone modification comprises a backbone sugar modification.
40. 40. The nucleic acid of any one of claims 37 to 39, wherein at least one chemically modified nucleotide comprises a locked nucleic acid (LNA) and / or a methylated nucleotide.
41. A vector comprising a nucleic acid sequence encoding an RNA comprising at least one of the following sequences: UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), and ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13).
42. a first vector comprising a nucleic acid sequence encoding a first RNA comprising UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), wherein the first RNA is at most 35 nucleotides in length; a second vector comprising a nucleic acid sequence encoding a second RNA comprising GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), wherein the second RNA is up to 35 nucleotides in length; and a third vector comprising a nucleic acid sequence encoding a second RNA comprising ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), wherein the second RNA is at most 35 nucleotides in length; A collection of vectors, including
43. 43. The vector of claim 41 or the collection of vectors of claim 42, wherein the vectors are lentiviral vectors.
44. A regulatory T cell comprising the nucleic acid of any one of claims 33 to 40, wherein the anti-inflammatory activity of the regulatory T cell is increased compared to a regulatory T cell that does not have the nucleic acid.
45. A regulatory T cell genetically modified to comprise the vector of claim 41 or a collection of vectors of claim 42 or 43.
46. 46. The regulatory T cell of claim 44 or 45, wherein the cell is in a subject.
47. 46. The regulatory T cell of claim 44 or 45, wherein the cell is in culture.
48. 44. Cardiosphere-derived cells (CDCs) genetically modified to contain the vector of claim 41 or a collection of vectors of claim 42 or 43.
49. 41. A method of treating an immune related disorder, comprising administering to a subject in need thereof a therapeutically effective amount of the composition of any one of claims 1 to 32 or the nucleic acid of any one of claims 33 to 40, thereby treating the immune related disorder.
50. A method for treating an immune-related disorder, comprising administering a therapeutically effective amount of non-coding RNA BCYRN1 or a derivative thereof to a subject in need of treatment for the immune-related disorder.
51. 51. The method of claim 50, comprising administering to a subject in need of treatment for an immune-related disorder a therapeutically effective amount of a composition comprising at least one BDSS (BCYRN1-derived binding sequence) compound comprising a nucleic acid sequence selected from SEQ ID NOs: 11-13.
52. 51. The method of claim 50, wherein the non-coding RNA BCYRN1 or a derivative thereof comprises one or more of the nucleic acid sequences selected from UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), and ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or sequences having one, two, three, four, or five substitutions thereto.
53. 51. The method of claim 50, wherein the non-coding RNA BCYRN1 or a derivative thereof comprises one or more nucleic acid sequences selected from UCCCUCAAAGCAACAACCCCC (SEQ ID NO: 11), GAGGCUAAGAGGCGGGAGGAU (SEQ ID NO: 12), and ACUUCCCUCAAAGCAACAACC (SEQ ID NO: 13), or a sequence at least 80% identical thereto.
54. 54. The method of any one of claims 50 to 53, wherein the non-coding RNA BCYRN1 or a derivative thereof has a length of about 15 to 50 nt.
55. 55. The method of any one of claims 49 to 54, wherein the immune-related disorder comprises an inflammatory disorder.
56. 56. The method of any one of claims 49 to 55, wherein the immune-related disorder comprises an immune-related disorder of the heart, an autoimmune disease, or transplant rejection.
57. 57. The method of claim 56, wherein the immune-related disorder of the heart comprises myocarditis.
58. 58. The method of any one of claims 49-57, wherein the immune-related disorder comprises one or more of myocarditis, myocardial infarction, an autoimmune condition, or an inflammatory condition associated with a viral infection.
59. 59. The method of any one of claims 49 to 58, comprising oral, intravenous, intramuscular, intracardiac, airway (aerosol), or pulmonary administration.
60. 60. The method of any one of claims 49 to 59, wherein the immune-related disorder is secondary to a viral infection.
61. A method for modulating regulatory T cell (Treg) activity, comprising the step of contacting Treg with an effective amount of non-coding RNA BCYRN1 or a derivative thereof, thereby modulating the activity of Treg.
62. 62. The method of claim 61, comprising contacting Tregs with non-coding RNA BCYRN1 or a derivative thereof, thereby increasing Treg proliferation, migration, and / or IL-10 production.
63. 63. The method of claim 61 or 62, wherein the contacting comprises administering an effective amount of non-coding RNA BCYRN1 or a derivative thereof to the subject, thereby regulating Treg activity in the subject.
64. 42. Use of a composition according to any one of claims 1 to 32 or a nucleic acid according to any one of claims 33 to 40 for the treatment of an immune-related disorder in a subject in need thereof.
65. 42. Use of a composition according to any one of claims 1 to 32 or a nucleic acid according to any one of claims 33 to 40 for the preparation of a medicament for the treatment of an immune related disorder in a subject in need thereof.
66. The following nucleotide sequence: (SEQ ID NO: 17) or a synthetic derivative thereof, wherein the derivative is 35 nucleotides in length or less, and wherein the long non-coding RNA or synthetic derivative thereof enhances Treg functionality.
67. Administration of non-coding RNA BCYRN1 or a derivative thereof as a therapeutic agent for immune and inflammatory diseases.
68. A method for treating an immune-related disorder, comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of miR-138, miR-150 and / or miR-98.
69. 69. The method of claim 68, wherein the inhibitor is BCYRN1 or a derivative thereof.
70. A composition according to any one of claims 1 to 32, a nucleic acid according to any one of claims 33 to 40, or a vector according to claim 41, or a collection of vectors according to claim 42 or 43, and Transfection reagents Kit including:
71. 71. The kit of claim 70, wherein the transfection reagent comprises one or more of a lipid, a liposome, a lipid nanoparticle (LNP), a PEGylated lipid, and an extracellular vesicle (EV).
72. 72. The kit of claim 70 or 71, further comprising a pharmaceutically acceptable excipient.