Anti-IL27R antibodies and methods of use thereof

Antibodies targeting IL27RA and gp130 address the need for novel treatments for IBD and autoimmune conditions by modulating IL27 activity, providing therapeutic benefits for conditions like IBD, CD, multiple sclerosis, and others.

JP2025525829AInactive Publication Date: 2025-08-07PFIZER INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025505533
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-06-30
Filing Date
2023-08-01
Publication Date
2025-08-07
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

There is a long-standing unmet need for novel therapeutic agents to treat or ameliorate inflammatory bowel disease (IBD), including Crohn's disease (CD) and ulcerative colitis (UC), as well as other autoimmune conditions, with current treatments lacking effective targets for IL27R.

Method used

Development of antibodies that specifically bind to IL27RA and gp130, including bispecific antibodies, which are used in diagnosis, prevention, or treatment of disorders associated with IL27 activity, such as IBD, CD, multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

Benefits of technology

The antibodies effectively modulate IL27 activity, providing therapeutic benefits for the mentioned conditions by targeting IL27RA and gp130, offering potential treatments that were previously unavailable.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025525829000001_ABST
    Figure 2025525829000001_ABST
Patent Text Reader

Abstract

The present invention relates to antibodies that specifically bind to one or both of IL27RA and gp130. The present invention further relates to bispecific antibodies that specifically bind to IL27RA and gp130. The present invention also relates to related molecules, e.g., nucleic acids encoding such antibodies or bispecific antibodies, compositions, and related methods, e.g., methods for producing and purifying such antibodies and bispecific antibodies, and their use in diagnostic and therapeutic agents. [Figure 1] TIFF2025525829000035.tif134115
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Reference to sequence listing This application contains a Sequence Listing that has been submitted electronically in .xml format and is incorporated by reference herein in its entirety. The .xml copy, created on June 30, 2023, is named PC072877 Sequence Listing ST26.xml and is 72,523 bytes in size. [Background technology]

[0002] The present invention relates to antibodies that specifically bind to one or both of IL27RA and gp130. The present invention further relates to bispecific antibodies that specifically bind to IL27RA and gp130. The present invention also relates to related molecules, e.g., nucleic acids encoding such antibodies or bispecific antibodies, compositions, and related methods, e.g., methods for producing and purifying such antibodies and bispecific antibodies, and their use in diagnostic and therapeutic agents.

[0003] Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), refers to a collection of idiopathic chronic inflammatory disorders of the intestine. Crohn's disease involves the ileum and colon but can affect any region of the intestine, often discontinuously. Ulcerative colitis involves the rectum, part of the colon, or the entire colon (pancolitis) in an uninterrupted pattern. The pathogenesis of IBD remains unclear but is thought to be multifactorial, including genetic and environmental components, among which aberrant immune responses to commensal bacteria and / or food antigens may play a central role. Therefore, the development of highly effective patient treatments to modulate excessive immune responses represents a significant unmet need. Hazel K and O'Connor A. Emerging treatments for inflammatory bowel disease. Therapeutic Advances in Chronic Disease. 2020, Vol. 11:1-12.

[0004] Interleukin (IL)-27 is a heterodimeric cytokine in the IL-12 cytokine family. It is composed of two subunits: Epstein-Barr virus-inducible gene 3 (EBi3) and IL-27p28. IL-27 exerts immunoregulatory roles after binding to its heterodimeric receptor, which contains the IL-27-selective subunit IL27RA and glycoprotein 130 (gp130), a subunit common to multiple signaling receptors. Coexpression of the two receptor subunits has been confirmed on T cells, monocytes, macrophages, dendritic cells, colon epithelial cells, keratinocytes, and other cells. Engagement of the two receptor subunits directly activates JAK1, JAK2, and Tyk2 kinases, inducing tyrosine phosphorylation of signal transducers and activators of transcription (STATs). These STATs then form homodimers or heterodimers, translocate to the nucleus, and modulate gene expression. In addition to the Jak / STAT signaling pathway, IL-27 has been reported to induce p38 MAPK, ERK, and Akt signaling under certain cellular conditions. Hunter CA and Kastelein R. Fifteen years of interleukin-27 discovery, advances, and translation. Immunity. 2012 Dec 14;37(6):960-969.

[0005] IL-27 has been implicated as a candidate for IBD treatment in multiple studies. A genome-wide association study in early-onset IBD identified IL-27 within a susceptibility locus in a North American-European cohort. Supporting this conclusion, the authors also demonstrated that healthy individuals with two copies of the risk allele expressed significantly less IL-27 than individuals with two copies of the non-risk allele, and that colonic gene expression of IL-27 was significantly lower in samples from individuals with early-onset CD and UC cases than in normal tissue. Imielinski M, Baldassano RN, Griffiths A, et al., Common variants at five new loci associated with early-onset inflammatory bowel disease. Nat Genet. 2009 Dec;41(12):1335-1340. IL-27 polymorphisms have also been associated with IBD risk in both Chinese and Korean populations. Wang Z, Wang L, Fan R et al., Association of IL-27 gene three polymorphisms with Crohn's disease susceptibility in a Chinese Han population.Int J Clin Exp Pathol.2014;7(12):8952~8957 and Li CS, Zhang Q, Lee KJ et al., Interleukin-27 polymorphisms are associated with inflammatory bowel diseases in a Korean population.J Gastroenterol Hepatol.2009;24(10):1692~1696.

[0006] IL-27 has been shown to ameliorate colitis in mouse models through a reduction in induced colonic inflammation by IL-27 administration and by directly promoting intestinal epithelial barrier function through transcriptional activation of anti-inflammatory and antibacterial genes, and conversely, through the demonstration of more severe colitis in mice lacking IL-27Rα due to gene knockout. Hanson ML, Hixon JA and Li W et al., Oral Delivery of IL-27 Recombinant Bacteria Attenuates Immune Colitis in Mice.Gastroenterology 2014;146:210~221;Troy AE, Zaph C and Du Y et al., IL-27 Regulates Homeostasis of the Intestinal CD4_Effector T Cell Pool and Limits Intestinal Inflammation in a Murine Model of Colitis.JI, 2009, 183:2037~2044;Diegelmann J, Olszak T and Goke B et al., A Novel Role for Interleukin-27(IL-27) as Mediator of Intestinal Epithelial Barrier Protection Mediated via Differential Signal Transducer and Activator of Transcription(STAT)Protein Signaling and Induction of Antibacterial and Anti-inflammatory Proteins. JBC. 2012, 287(1), pp. 286-298. More specifically, mucosal administration of the food-grade bacterium Lactococcus lactis (LL-IL-27) expressing IL-27 or subcutaneous treatment with IL-27 has been shown to protect mice from intestinal inflammation and death in T cell transfer-induced colitis and 2,4,6-trinitrobenzenesulfonic acid (TNBS)-induced colitis models.Hanson ML, Hixon JA, Li W et al., Oral Delivery of IL-27 Recombinant Bacteria Attenuates Immune Colitis in Mice. Gastroenterology 2014;146:210-221; Sasaoka T, Ito M, Yamashita J et al., Treatment with IL-27 attenuates experimental colitis through the suppression of the development of IL-17-producing T helper cells. Am J Physiol Gastrointest Liver Physiol 2011,300:G568-G576; Andrews C, McLean MH, Durum SK. IL-27 as a novel therapy for inflammatory bowel disease: a critical review of the literature. Inflamm Bowel Dis. 2016 Sep;22(9):2255-2264.

[0007] A role for IL-27 as a potential therapeutic approach has been suggested for various autoimmune conditions in addition to IBD, including asthma and allergic diseases.[11, 12] Metabolic disorders, such as obesity and type 2 diabetes, in which IL-27 agonism may be beneficial, are also attractive therapeutic areas to explore.

[13] Summary of the Invention [Problem to be solved by the invention]

[0008] There is a long-standing unmet need for novel therapeutic agents for treating or ameliorating IBD, including UC and CD, as well as for treating other autoimmune conditions. Although IL27R has been implicated as a target for the treatment of IBD, including UC and CD, there are currently no effective treatments that target IL27R. The present invention fulfills these needs. [Means for solving the problem]

[0009] Provided herein are antibodies (including antigen-binding fragments thereof) that bind to one or more of interleukin receptor subunit alpha (IL27RA) and glycoprotein 130 (gp130), including bispecific antibodies that specifically bind to IL27RA and gp130, as well as other related antibodies, and uses of these antibodies and related methods.

[0010] The present disclosure also provides processes for generating, preparing, and producing antibodies that bind to one or more of IL27RA and gp130, including bispecific antibodies that specifically bind to IL27RA and gp130. The antibodies of the present disclosure are useful in one or more of the diagnosis, prevention, or treatment of disorders or conditions mediated by or associated with IL27 activity, including, but not limited to, inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0011] The present disclosure further encompasses the expression of the antibodies, as well as the preparation and manufacture of compositions comprising the antibodies of the present disclosure, for example, pharmaceuticals for use of the antibodies.

[0012] Polynucleotides encoding antibodies that bind to one or more of IL27RA and gp130, including bispecific antibodies that specifically bind to IL27RA and gp130, are also provided. Polynucleotides encoding the antibody heavy or light chain, or both, are also provided. Host cells that express the antibodies are provided. Methods of treatment using the antibodies are provided. Such methods include, but are not limited to, one or more of methods of treating or preventing diseases associated with or mediated by IL27 expression and / or binding to the IL27 receptor. Diseases associated with or mediated by IL27 expression and / or binding to the IL27 receptor include inflammatory bowel disease (IBD), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0013] In some embodiments, an isolated antibody that specifically binds to IL27RA is provided, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL), wherein the antibody comprises the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 7 and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 8.

[0014] In some embodiments, an isolated antibody that specifically binds to IL27RA is provided, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL), the antibody comprising a CDR-H1 sequence according to SEQ ID NO: 1; a CDR-H2 sequence according to SEQ ID NO: 2; a CDR-H3 sequence according to SEQ ID NO: 3, and comprising a CDR-L1 sequence according to SEQ ID NO: 4; a CDR-L2 sequence according to SEQ ID NO: 5, and a CDR-L3 sequence according to SEQ ID NO: 6.

[0015] In some embodiments, an isolated antibody is provided that comprises an IL27RA-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 31 and an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 32.

[0016] In some embodiments, an isolated antibody that specifically binds to IL27RA is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 13 and a light chain having the amino acid sequence of SEQ ID NO: 14. In some embodiments, an isolated antibody that specifically binds to IL27RA is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 27 and a light chain having the amino acid sequence of SEQ ID NO: 14.

[0017] In some embodiments, an isolated antibody is provided that competes with a second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 7 and a VL having the amino acid sequence of SEQ ID NO: 8 for binding to IL27RA.

[0018] In some embodiments, an isolated polynucleotide encoding the VH of an antibody that binds to IL27RA is provided, comprising the nucleic acid sequence of SEQ ID NO: 31.

[0019] In some embodiments, an isolated polynucleotide encoding the VL of an antibody that binds to IL27RA is provided, comprising the nucleic acid sequence of SEQ ID NO: 32.

[0020] In some embodiments, isolated polynucleotides are provided encoding the VH and VL of an antibody that binds IL27RA, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO: 31 and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO: 32.

[0021] In some embodiments, an isolated antibody that specifically binds to glycoprotein 130 (gp130) is provided, comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL), the antibody comprising CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 21 and CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 22.

[0022] In some embodiments, an isolated antibody that specifically binds to gp130 is provided, comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL), the antibody comprising a CDR-H1 sequence according to SEQ ID NO: 15; a CDR-H2 sequence according to SEQ ID NO: 16; a CDR-H3 sequence according to SEQ ID NO: 17, a CDR-L1 sequence according to SEQ ID NO: 18; a CDR-L2 sequence according to SEQ ID NO: 19, and a CDR-L3 sequence according to SEQ ID NO: 20.

[0023] In some embodiments, an isolated antibody that specifically binds to gp130 is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 23 and a light chain having the amino acid sequence of SEQ ID NO: 24. In some embodiments, an isolated antibody that specifically binds to gp130 is provided, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 30 and a light chain having the amino acid sequence of SEQ ID NO: 24.

[0024] In some embodiments, an isolated antibody is provided that competes for binding to gp130 with a second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 21 and a VL having the amino acid sequence of SEQ ID NO: 22.

[0025] In some embodiments, an isolated polynucleotide encoding a VH of an antibody that binds gp130 is provided, comprising the nucleic acid sequence of SEQ ID NO:35.

[0026] In some embodiments, an isolated polynucleotide encoding the VL of an antibody that binds gp130 is provided, comprising the nucleic acid sequence of SEQ ID NO:36.

[0027] In some embodiments, isolated polynucleotides are provided encoding the VH and VL of an antibody that binds to gp130, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO: 35 and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO: 36.

[0028] In some embodiments, an isolated polynucleotide encoding the heavy chain, the light chain, or both, of an antibody that binds to gp130 is provided, the heavy chain, the light chain, or both, comprising the nucleic acid sequence of SEQ ID NO: 37, the nucleic acid sequence of SEQ ID NO: 38, or both.

[0029] In some embodiments, an isolated polynucleotide is provided that encodes the heavy chain, the light chain, or both, of an antibody that binds to gp130, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 40, the nucleic acid sequence of SEQ ID NO: 38, or both.

[0030] In some embodiments, an isolated antibody comprises a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises a VH and a VL, and the second antigen-binding site comprises a VH and a VL; a. the first antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 3; and b. The first antigen-binding site VL comprises: (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 5; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 6. and / or

[0031] In some embodiments, an isolated antibody comprises a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises a VH and a VL, and the second antigen-binding site comprises a VH and a VL; a. the second antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 17; and b. The second antigen-binding site, VL, comprises: (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 20. and / or

[0032] In some embodiments, an isolated antibody comprises a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises a VH and a VL, and the second antigen-binding site comprises a VH and a VL; a. a first antigen-binding site, VH, comprising: (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 3; b. the first antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO:4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO:5; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO:6; c. the second antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 17; d. The second antigen-binding site, VL, comprises: (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 20. Antibodies are provided.

[0033] In some embodiments, an isolated antibody is provided, comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, the antibody comprising the first antigen-binding site VH comprising the amino acid sequence of SEQ ID NO:7, the first antigen-binding site VL comprising the amino acid sequence of SEQ ID NO:8, the second antigen-binding site VH comprising the amino acid sequence of SEQ ID NO:21, and the second antigen-binding site VL comprising the amino acid sequence of SEQ ID NO:22.

[0034] In some embodiments, an antibody that binds to both IL27RA and gp130 is provided, comprising a first heavy chain and a first light chain and a second heavy chain and a second light chain, wherein the first heavy chain and the first light chain comprise a first antigen-binding site that binds to IL27RA, and the second heavy chain and the second light chain comprise a second antigen-binding site that binds to gp130, wherein the first antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 27, the first antibody light chain comprises the amino acid sequence of SEQ ID NO: 14, the second antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 30, and the second antibody light chain comprises the amino acid sequence of SEQ ID NO: 34. [Brief explanation of the drawings]

[0035] [Figure 1] Figure 1 shows a schematic diagram of the bispecific anti-IL27RA / gp130 antibody of the invention. Fc heterodimerization is driven via mutations engineered into the CH3 domain. [Figure 2] Figure 2 shows that the co-crystal structure of the parental anti-IL27RA clone 2255 Fab fragment in complex with the human IL27RA extracellular domain recombinant protein is available at 3.2 Å resolution. The protein components were expressed from HEK293. [Figure 3] Figure 3 shows that the co-crystal structure of a humanized version (3754) of the parent anti-gp130 clone 2246 Fab fragment in complex with human gp130 extracellular domain recombinant protein component is available at 2.7 Å resolution expressed from HEK293. [Figure 4]FIG. 4 shows the absence of effect of IL-27R agonists on IFNγ production in differentiated Th1 cells. [Figure 5] FIG. 5 shows that anti-IL27RA / gp130 antibodies of the invention increased the CD4+CD25+FoxP3+ iTreg population and increased LAG-3 and Tim-3 surface expression. [Figure 6] Figure 6 shows a schematic diagram of the mono-Fc version of the IL27-ligand complex. CH23LS-Fc: human IgG1 Fc with mutations to stabilize the monomeric Fc; Flag: Flag tag; H6: His tag; p28(f29-p243)-C107-L212C: p28 subunit of IL27 ligand, amino acid sequence F29 to P243, with a mutation at C107 to S and at L212 to C to stabilize disulfide bond formation between L212 in p28 and M99 in Ebi3; Ebi3(R21-K229)-M99C: Ebi3 subunit of IL27 ligand, amino acids R21 to K229, with a mutation at M99 to C to stabilize disulfide bond formation with L212C in the p28 subunit. CIDs 1613 and 1617: construct numbering. [Figure 7]Figure 7 shows a schematic representation of the knob and hole versions of the IL27-ligand complex. huIgG1Fc "knob": human IgG1 Fc with a "knob" mutation; huIgG1Fc "hole": human IgG1 Fc with a "hole" mutation; Flag: Flag tag; H6: His tag; p28(f29-p243)-C107-L212C: p28 subunit of IL27 ligand, amino acid sequence F29 to P243, with a mutation at C107 to S and a mutation at L212 to C to stabilize disulfide bond formation between L212 in p28 and M99 in Ebi3; Ebi3(R21-K229)-M99C: Ebi3 subunit of IL27 ligand, starting at amino acid R21 and ending at K229, with a mutation from M99 to C to stabilize disulfide bond formation with L212C in the p28 subunit. CID1353, 1643 and 1617: construct numbering. [Figure 8] Figure 8 shows an Octet competition assay of 2255 versus IL27R ligand for IL27RA. These sensorgrams were aligned at the end of the first association step (approximately 1059 seconds). The sensorgram from 1060 seconds assesses whether GBT-IL-27R-2255 can bind to hIL27R-CH23Fc-Flag in the presence of hIL27:EBi3. (Middle line on the right panel) has hIL27:EBi3 bound to hIL27R; GBT-IL-27R-2255 did not show any binding. This demonstrated that the IL27Ra lead IgG GBT-IL-27R-2255 competes with the IL-27 ligand for binding to IL27R. Sensor C6 (top line on the right panel) has only hIL27R on the sensor without hIL27LEBi3, which showed binding to GBT-IL-27R-2255 in this assay format. Sensor D6 (bottom line on the right panel) was a buffer control. Sensor D6 did not overlay with B6, potentially due to dissociation of hIL27:EBi3 on sensor D6 when immersed in buffer. [Figure 9]Figure 9 shows a schematic diagram of two bispecific formats. Left: EE / RR format (GBT-IL27R-4894). Right: Knob-in-hole mFd format (GBT-IL27R-4933). IL-27RA and gp130 binding Fabs and their VH, VL, CH1 and CL components are displayed. Features used for heterodimerization (E and R mutations or knob and hole) are indicated. DETAILED DESCRIPTION OF THE INVENTION

[0036] The present invention can be more readily understood by reference to the following detailed description of embodiments of the invention and the examples contained herein. It should be understood that the present invention is not limited to specific methods of preparation, which may of course vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only, and is not intended to be limiting.

[0037] Exemplary embodiments (E) of the invention provided herein include the following: E1. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL), wherein the antibody comprises the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 7 and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 8;

[0038] E2. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL), the antibody comprising a CDR-H1 sequence according to SEQ ID NO: 1; a CDR-H2 sequence according to SEQ ID NO: 2; a CDR-H3 sequence according to SEQ ID NO: 3, and a CDR-L1 sequence according to SEQ ID NO: 4; a CDR-L2 sequence according to SEQ ID NO: 5, and a CDR-L3 sequence according to SEQ ID NO: 6.

[0039] E3. The antibody of E1 or E2, comprising an IL27RA-VH framework sequence derived from a human germline VH sequence selected from the group consisting of DP7, DP10, DP35, DP47, DP50, DP51, DP54 and DP77.

[0040] E4. The antibody of E1 or E2, comprising an IL27RA-VH framework sequence derived from a human germline DP54 sequence.

[0041] E5. The antibody of any one of E1 to E4, comprising an IL27RA-VL framework sequence derived from a human germline VL sequence selected from the group consisting of DPK1, DPK3, DPK4, DPK5, DPK7, DPK8 and DPK9.

[0042] E5. The antibody of any one of E1 to E4, comprising an IL27RA-VL framework sequence derived from a human germline DPK9 sequence.

[0043] E6. The antibody of any one of E1 to E5, comprising an IL27RA-VL framework sequence and an IL27RA-VH framework sequence, wherein one or both of the IL27RA-VL framework sequence and the IL27RA-VH framework sequence are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the human germline sequence from which it is derived.

[0044] E7. The antibody of any one of E1 to E6, comprising an IL27RA-VL framework sequence and an IL27RA-VH framework sequence, wherein one or both of the IL27RA-VL framework sequence or the IL27RA-VH framework sequence are identical to the human germline sequence from which it is derived.

[0045] E8. The antibody of any one of E1 to E7, comprising an IL27RA-VH sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 7, and an IL27RA-VL sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 8.

[0046] E9. The antibody of any one of E1 to E8, which comprises the IL27RA-VH sequence of SEQ ID NO: 7 and the IL27RA-VL sequence of SEQ ID NO: 8.

[0047] E10. The antibody of any one of E1 to E9, comprising an IL27RA-VH sequence encoded by the polynucleotide sequence of SEQ ID NO: 31.

[0048] E11. The antibody of any one of E1 to E10, comprising an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 32.

[0049] E12 An isolated antibody comprising an IL27RA-VH sequence encoded by the nucleic acid sequence of SEQ ID NO:31 and an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO:32.

[0050] E13. The antibody of any one of E1 to E12, further comprising an Fc domain, wherein the Fc domain is of the IgA (e.g., IgA1 or IgA2), IgD, IgE, IgM, or IgG (e.g., IgG1, IgG2, IgG3, or IgG4) isotype.

[0051] E14. The antibody according to any one of E1 to E13, which comprises an Fc domain of an IgG isotype.

[0052] E15. The antibody according to any one of E1 to E14, which comprises an Fc domain of the IgG1 isotype.

[0053] E16. The antibody of any one of E13 to E15, wherein the Fc domain is of human IgG1 containing one or more substitutions selected from the group consisting of L234A, L235A, and G237A according to EU numbering (which may also be referred to as L247A, L248A, and G250A according to Kabat numbering), wherein numbering is according to wild-type human IgG1.

[0054] E17. The antibody of E16, comprising an Fc domain comprising the substitutions L234A, L235A and G237A (according to EU numbering) or L247A, L248A and G250A (according to Kabat numbering), wherein numbering is according to human IgG1 wild type.

[0055] E18. The antibody of any one of E1 to E17, comprising an Fc domain comprising the substitutions D221E and L368E (according to EU numbering) or D234E and L381E (according to Kabat numbering), wherein numbering is according to human IgG1 wild type.

[0056] E19. The antibody of any one of E1-E17, comprising an Fc domain comprising the substitutions D221R and K409R (according to EU numbering) or D234R and K422R (according to Kabat numbering), wherein numbering is according to human IgG1 wild type.

[0057] E20. The antibody of any one of E1 to E19, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 27.

[0058] E21. The antibody according to any one of E1 to E20, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 13.

[0059] E22. The antibody according to any one of E1 to E20, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 27.

[0060] E23. The antibody according to any one of E1 to E22, comprising a light chain having the amino acid sequence of SEQ ID NO: 14.

[0061] E24. The antibody according to any one of E1 to E23, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 27 and a light chain having the amino acid sequence of SEQ ID NO: 14.

[0062] E25. The antibody according to any one of E1 to E24, which antagonizes IL27RA.

[0063] E26. The antibody according to any one of E1 to E25, which agonizes IL27RA.

[0064] E27. The antibody according to any one of E1 to E25, which binds to cynomolgus monkey IL27RA.

[0065] E28. The antibody according to any one of E1 to E27, wherein the binding KD of the antibody to cynomolgus monkey IL27RA is within 10 orders of magnitude of the binding KD of the antibody to human IL27RA, as measured by SPR.

[0066] E29. An isolated antibody that competes with a second antibody comprising a VH having the amino acid sequence of SEQ ID NO:7 and a VL having the amino acid sequence of SEQ ID NO:8 for binding to IL27RA.

[0067] E30. A pharmaceutical composition comprising a therapeutically effective amount of the antibody according to any one of E1 to E29 and a pharmaceutically acceptable carrier.

[0068] E31 An isolated polynucleotide encoding the antibody according to any one of E1 to E29.

[0069] E32. The polynucleotide of E31, which is RNA.

[0070] E33. The polynucleotide of E32, comprising at least one chemical modification.

[0071] E34. The polynucleotide of E33, wherein the chemical modification is selected from pseudouridine, 1-methylpseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0072] E35. The polynucleotide of E31, which does not contain chemical modifications.

[0073] E35. An isolated polynucleotide encoding the VH of an antibody that binds to IL27RA, comprising the nucleic acid sequence of SEQ ID NO: 31.

[0074] E36. An isolated polynucleotide encoding the VL of an antibody that binds to IL27RA, comprising the nucleic acid sequence of SEQ ID NO: 32.

[0075] E37. An isolated polynucleotide encoding the VH and VL of an antibody that binds to IL27RA, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO: 31, and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO: 32.

[0076] E38. An isolated polynucleotide encoding the heavy chain, the light chain, or both, of an antibody that binds to IL27RA, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 33, the nucleic acid sequence of SEQ ID NO: 34, or both.

[0077] E39. An isolated polynucleotide encoding the heavy chain, the light chain, or both, of an antibody that binds to IL27RA, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 39, the nucleic acid sequence of SEQ ID NO: 34, or both.

[0078] E40. A vector comprising the polynucleotide according to any one of E31 to E39.

[0079] E41. An isolated host cell comprising the polynucleotide of any one of E31 to E39 or the vector of E40.

[0080] E42. A method of producing an isolated antibody, comprising culturing a host cell according to E41 under conditions that result in the production of the antibody, and recovering the antibody.

[0081] E43. The antibody according to any one of E1 to E29 or the pharmaceutical composition according to E30 for use as a pharmaceutical.

[0082] E44. The antibody of any one of E1 to E29 or the pharmaceutical composition of E30 for use in treating an inflammatory disease.

[0083] E45. The antibody of any one of E1 to E29 or the pharmaceutical composition of E30 for use in treating one or more conditions selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0084] E46. The antibody of any one of E1 to E29 or the pharmaceutical composition of E30 for use in treating inflammatory bowel disease (IBD).

[0085] E47. The antibody or pharmaceutical composition according to any one of E1 to E29 or E30, for use according to E46, wherein the use is for the treatment of Crohn's disease (CD) or ulcerative colitis (UC).

[0086] E48. A method for treating a medical condition, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody described in any one of E1-E29 or a pharmaceutical composition described in E30.

[0087] E49. The method of E48, wherein the condition is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic disease, obesity, type 2 diabetes, and cancer.

[0088] E50. The method of E48, wherein the condition is an inflammatory disease.

[0089] E51. The method of E48, wherein the condition is inflammatory bowel disease (IBD).

[0090] E52. The method according to any one of E48 to E51 or the use according to E43 to E47, comprising a step of subcutaneously administering the antibody or pharmaceutical composition.

[0091] E53. The method of any one of E48 to E51 or the use of E43 to E47, wherein the antibody or pharmaceutical composition is administered about twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, twice a month, once a month, once every two months, once every three months, or once every four months.

[0092] E54. Use of the antibody of any one of E1-E29 for the manufacture of a medicament for use in the treatment of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0093] E55. Use of an antibody according to any one of E1 to E29 for the manufacture of a medicament for use in treating an inflammatory disease.

[0094] E56. Use of the antibody of E54 or E55, wherein the condition is inflammatory bowel disease (IBD).

[0095] E57. An isolated antibody that specifically binds to glycoprotein 130 (gp130), comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL), the antibody comprising CDR-H1, CDR-H2 and CDR-H3 sequences of SEQ ID NO: 21 and CDR-L1, CDR-L2 and CDR-L3 sequences of SEQ ID NO: 22.

[0096] E58. An isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL), the antibody comprising a CDR-H1 sequence according to SEQ ID NO: 15; a CDR-H2 sequence according to SEQ ID NO: 16; a CDR-H3 sequence according to SEQ ID NO: 17, and comprising a CDR-L1 sequence according to SEQ ID NO: 18; a CDR-L2 sequence according to SEQ ID NO: 19, and a CDR-L3 sequence according to SEQ ID NO: 20.

[0097] E59 The antibody of E57 or E58, comprising a gp130-VH framework sequence derived from a human germline VH sequence selected from the group consisting of DP7, DP10, DP35, DP47, DP50, DP51, DP54 and DP77.

[0098] E60. The antibody of any one of E57 to E59, comprising a gp130-VH framework sequence derived from a human germline DP10 sequence.

[0099] E61. The antibody of any one of E57 to E60, comprising a gp130-VL framework sequence derived from a human germline VL sequence selected from the group consisting of DPK1, DPK3, DPK4, DPK5, DPK7, DPK8 and DPK9.

[0100] E62. The antibody of any one of E57 to E61, comprising a gp130-VL framework sequence derived from a human germline DPK9 sequence.

[0101] E63. The antibody of any one of E57 to E62, comprising a gp130-VL framework sequence and a gp130-VH framework sequence, wherein one or both of the gp130-VL framework sequence and the gp130-VH framework sequence are at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the human germline sequence from which it is derived.

[0102] E64. The antibody of any one of E57 to E63, comprising a gp130-VL framework sequence and a gp130-VH framework sequence, wherein one or both of the gp130-VL framework sequence or the gp130-VH framework sequence are identical to the human germline sequence from which it is derived.

[0103] E65. The antibody of any one of E57 to E64, comprising a gp130-VH sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 21 and a gp130-VL sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 22.

[0104] E66. The antibody according to any one of E57 to E65, which comprises the gp130-VH sequence of SEQ ID NO: 21 and the gp130-VL sequence of SEQ ID NO: 22.

[0105] E67. The antibody of any one of E57 to E66, comprising a gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 35.

[0106] E68. The antibody of any one of E57 to E67, comprising a gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 36.

[0107] E69 An antibody comprising a gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO:35 and a gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO:36.

[0108] E70. The antibody of any one of E57 to E69, further comprising an Fc domain, wherein the Fc domain is of the IgA (e.g., IgA1 or IgA2), IgD, IgE, IgM, or IgG (e.g., IgG1, IgG2, IgG3, or IgG4) isotype.

[0109] E71. The antibody of E70, comprising an Fc domain of the IgG isotype.

[0110] E72. The antibody of either E70 or E71, which comprises an Fc domain of the IgG1 isotype.

[0111] E73. The antibody of E72, wherein the Fc domain is that of a human IgG1 containing one or more substitutions selected from L234A, L235A and G237A (according to EU numbering) or L247A, L248A and G250A (according to Kabat numbering), wherein numbering is according to human IgG1 wild type.

[0112] E74. The antibody of E73, comprising the substitutions L234A, L235A, G237A (according to EU numbering) or L247A, L248A, G250A (according to Kabat numbering), wherein numbering is according to human IgG1 wild type.

[0113] E75. The antibody of any one of E57 to E74, wherein the Fc domain comprises the substitutions D221E and L368E (according to EU numbering) or D234E and L381E (according to Kabat numbering), wherein numbering is according to human IgG1 wild type.

[0114] E76. The antibody of any one of E57 to E74, wherein the Fc domain comprises the substitutions D221R and K409R (according to EU numbering) or D234R and K422R (according to Kabat numbering), wherein numbering is according to human IgG1 wild type.

[0115] E77. The antibody according to any one of E57 to E76, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 23 or SEQ ID NO: 30.

[0116] E78. The antibody of any one of E57 to E77, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 23.

[0117] E79. The antibody of any one of E57 to E77, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 30.

[0118] E80. The antibody according to any one of E57 to E79, comprising a light chain having the amino acid sequence of SEQ ID NO: 24.

[0119] E81. The antibody according to any one of E57 to E80, comprising a heavy chain having the amino acid sequence of SEQ ID NO: 23 and a light chain having the amino acid sequence of SEQ ID NO: 24.

[0120] E82. The antibody according to any one of E57 to E81, which antagonizes gp130.

[0121] E83. The antibody according to any one of E57 to E82, which binds to cynomolgus monkey gp130.

[0122] E84. The antibody according to any one of E57 to E83, wherein the binding KD of the antibody to cynomolgus monkey gp130 is within three orders of magnitude of the binding KD of the antibody to human gp130, as measured by SPR.

[0123] E85. An isolated antibody that competes for binding to gp130 with a second antibody comprising a VH having the amino acid sequence of SEQ ID NO:21 and a VL having the amino acid sequence of SEQ ID NO:22.

[0124] E86. A pharmaceutical composition comprising a therapeutically effective amount of the antibody according to any one of E57 to E85 and a pharmaceutically acceptable carrier.

[0125] E87. An isolated polynucleotide encoding the antibody of any one of E57 to E87.

[0126] E88. The polynucleotide of E87, which is RNA.

[0127] E89. The polynucleotide of E88, comprising at least one chemical modification.

[0128] E90. The polynucleotide of E89, wherein the chemical modification is selected from pseudouridine, 1-methylpseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine.

[0129] E91. The polynucleotide of E87 or E88, which does not comprise a chemical modification.

[0130] E92. An isolated polynucleotide encoding the VH of an antibody that binds to gp130, comprising the nucleic acid sequence of SEQ ID NO:35.

[0131] E93. An isolated polynucleotide encoding the VL of an antibody that binds to gp130, comprising the nucleic acid sequence of SEQ ID NO:36.

[0132] E94. Isolated polynucleotides encoding the VH and VL of an antibody that binds to gp130, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO: 35, and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO: 36.

[0133] E95. An isolated polynucleotide encoding the heavy chain, the light chain, or both, of an antibody that binds gp130, comprising the nucleic acid sequence of SEQ ID NO:37, the nucleic acid sequence of SEQ ID NO:38, or both.

[0134] E96. An isolated polynucleotide encoding a heavy chain, a light chain, or both, of an antibody that binds to gp130, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO:40, the nucleic acid sequence of SEQ ID NO:38, or both.

[0135] E97. A vector comprising the polynucleotide according to any one of E87 to E96.

[0136] E98. An isolated host cell comprising the polynucleotide of any one of E87 to E96 or the vector of E97.

[0137] E99. A method of producing an isolated antibody, comprising culturing the host cell of E98 under conditions that result in the production of the antibody, and recovering the antibody.

[0138] E100. The antibody according to any one of E57 to E85 or the pharmaceutical composition according to E86 for use as a pharmaceutical.

[0139] E101. The antibody according to any one of E57 to E85 or the pharmaceutical composition according to E86 for use in treating an inflammatory disease.

[0140] E102. The antibody of any one of E57 to E85 or the pharmaceutical composition of E86 for use in treating one or more conditions selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0141] E103. The antibody according to any one of E57 to E85 or the pharmaceutical composition according to E86 for use in treating inflammatory bowel disease (IBD).

[0142] E104. The antibody or pharmaceutical composition according to any one of E57 to E85 or E86, for use according to E46, wherein the use is for the treatment of Crohn's disease (CD) or ulcerative colitis (UC).

[0143] E105. A method for treating a medical condition, comprising administering to a subject in need thereof a therapeutically effective amount of the antibody described in any one of E57-E85 or the pharmaceutical composition described in E86.

[0144] E106. The method of E105, wherein the condition is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic disease, obesity, type 2 diabetes, and cancer.

[0145] E107. The method according to E105, wherein the condition is an inflammatory disease.

[0146] E108. The method according to E106 or E107, wherein the condition is inflammatory bowel disease (IBD).

[0147] E109. The method according to any one of E105 to E108 or the use according to E100 to E104, comprising a step of subcutaneously administering the antibody or pharmaceutical composition.

[0148] E110. The method of any one of E105 to E108 or the use of E100 to E104, wherein the antibody or pharmaceutical composition is administered about twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, twice a month, once a month, once every two months, once every three months, or once every four months.

[0149] E111. Use of the antibody of any one of E57 to E85 for the manufacture of a medicament for use in the treatment of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0150] E112. Use of an antibody according to any one of E57 to E85 for the manufacture of a medicament for use in treating an inflammatory disease.

[0151] E113. The use of the antibody of E111 or E112, wherein the condition is inflammatory bowel disease (IBD).

[0152] E114. The use of the antibody of E113, wherein the condition is Crohn's disease (CD) and ulcerative colitis (UC).

[0153] E115. An isolated antibody comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises a VH and a VL, and the second antigen-binding site comprises a VH and a VL; a. the first antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 3; and b. The first antigen-binding site VL comprises: (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 5; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 6. an antibody, which is one or both of:

[0154] E116. An isolated antibody comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises a VH and a VL, and the second antigen-binding site comprises a VH and a VL; a. the second antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 17; and b. The second antigen-binding site, VL, comprises: (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 20. an antibody, which is one or both of:

[0155] E117. An isolated antibody comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises a VH and a VL, and the second antigen-binding site comprises a VH and a VL; a. a first antigen-binding site, VH, comprising: (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 3; b. the first antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO:4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO:5; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO:6; c. the second antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 17; d. An antibody wherein the second antigen-binding site VL comprises: (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 20.

[0156] E118. An isolated antibody comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, the antibody comprising the first antigen-binding site VH comprising the amino acid sequence of SEQ ID NO:7, the first antigen-binding site VL comprising the amino acid sequence of SEQ ID NO:8, the second antigen-binding site VH comprising the amino acid sequence of SEQ ID NO:21, and the second antigen-binding site VL comprising the amino acid sequence of SEQ ID NO:22.

[0157] E119. The antibody according to any one of E115 to E118, which is a bispecific antibody.

[0158] E120. The antibody of any one of E115 to E119, comprising an Fc domain comprising a first and a second Fc chain.

[0159] E121. The antibody of E120, wherein the Fc domain is of the IgA (e.g., IgA1 or IgA2), IgD, IgE, IgM, or IgG (e.g., IgG1, IgG2, IgG3, or IgG4) isotype.

[0160] E122. The antibody of E120 or E121, wherein the Fc domain is an IgG1 Fc domain, an IgG2 Fc domain, or an IgG4 Fc domain.

[0161] E123. The antibody according to any one of E120 to E122, which comprises an Fc domain of the IgG1 isotype.

[0162] E124. The antibody of E123, wherein the first and second Fc chains comprise one or more amino acid modifications at positions 234, 235, and 237 (according to EU numbering) of human IgG1.

[0163] E124. The antibody of E124, wherein the first and second Fc chains comprise one or more substitutions selected from L234A, L235A and G237A (according to EU numbering) of IgG1.

[0164] E125. The antibody of E124, wherein the first and second Fc chains comprise IgG1 substitutions L234A, L235A and G237A (according to EU numbering).

[0165] E126. The antibody of any one of E120 to E125, wherein the first Fc chain and the second Fc chain of the Fc domain each contain one or more amino acid modifications that promote association between the first Fc chain and the second Fc chain.

[0166] E127. A device comprising a first and a second arm; a. the first arm comprises a first antigen-binding site and a first Fc chain, wherein the first Fc chain comprises amino acid modifications at positions 221 and 409 (EU numbering) of human IgG1; and b. the second arm comprises a second antigen-binding site and a second Fc chain, wherein the second Fc chain comprises amino acid modifications at positions 221 and 368 (according to EU numbering) of human IgG1. The antibody described in E126.

[0167] E128. A device comprising a first and a second arm; a. the first arm comprises a first antigen-binding site and a first Fc chain, wherein the first Fc chain comprises amino acid modifications at positions 221 and 368 (EU numbering) of human IgG1; and b. the second arm comprises a second antigen-binding site and a second Fc chain, wherein the second Fc chain comprises amino acid modifications at positions 221 and 409 (according to EU numbering) of human IgG1. The antibody described in E126.

[0168] E129. A device comprising a first and a second arm; a. the first arm comprises a first antigen-binding site and a first Fc chain, wherein the first Fc chain comprises human IgG1 substitutions D221R and K409R (according to EU numbering); b. the second arm comprises a second antigen-binding site and a second Fc chain, wherein the second Fc chain comprises human IgG1 substitutions D221E and L368E (according to EU numbering). The antibody described in E126.

[0169] E130. A device comprising a first and a second arm; a. the first arm comprises a first antigen-binding site and a first Fc chain, wherein the first Fc chain comprises human IgG1 substitutions D221E and L368E (according to EU numbering); b. the second arm comprises a second antigen-binding site and a second Fc chain, wherein the second Fc chain comprises human IgG1 substitutions D221R and K409R (according to EU numbering). The antibody described in E126.

[0170] E131. An antibody that binds to both IL27RA and gp130, comprising a first heavy chain and a first light chain and a second heavy chain and a second light chain, wherein the first heavy chain and the first light chain comprise a first antigen-binding site that binds to IL27RA, and the second heavy chain and the second light chain comprise a second antigen-binding site that binds to gp130, wherein the first antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 27, the first antibody light chain comprises the amino acid sequence of SEQ ID NO: 14, the second antibody heavy chain comprises the amino acid sequence of SEQ ID NO: 30, and the second antibody light chain comprises the amino acid sequence of SEQ ID NO: 34.

[0171] E132. The antibody according to any one of E115 to E131, which has a higher binding affinity for IL27RA than for gp130, as measured by SPR.

[0172] E133. The antibody of any one of E115 to E132, which has at least a 10-fold higher binding affinity for IL27RA than for gp130, as measured by SPR.

[0173] E134. The antibody of any one of E115 to E133, which has at least a 100-fold higher binding affinity for IL27RA than for gp130, as measured by SPR.

[0174] E135. The antibody of any one of E115 to E134, which has at least a 1000-fold higher binding affinity for IL27RA than for gp130, as measured by SPR.

[0175] E136. The antibody of any one of E115 to E135, which binds to human IL27RA with an affinity of less than 1 nM as measured by SPR.

[0176] E137. The antibody of any one of E115 to E136, which binds to human gp130 with an affinity of less than 1000 nM as measured by SPR.

[0177] E138. The antibody of any one of E115 to E135, which binds to human IL27RA with an affinity of between 0.01 nM and 5 nM, between 0.05 nM and 1 nM, or between 0.1 nM and 1 nM, and binds to human gp130 with an affinity of between 10 nM and 1000 nM, between 50 nM and 1000 nM, between 100 nM and 1000 nM, between 10 nM and 500 nM, or between 10 nM and 250 nM, as measured by SPR.

[0178] E139. The antibody of any one of E115 to E135, which binds to human IL27RA with an affinity between 0.1 nM and 5 nM and binds to human gp130 with an affinity between 50 nM and 1000 nM, as measured by SPR.

[0179] E140. The antibody of any one of E115 to E139, which binds to human IL27RA with an affinity between 0.1 nM and 1 nM and binds to human gp130 with an affinity between 100 nM and 500 nM, as measured by SPR.

[0180] E141. The antibody of any one of E115-E140, characterized by an EC50 of less than 10 nM in a fluorescent flow cytometry assay of phosphorylated STAT1 CD3+ T cells.

[0181] E142. The antibody of any one of E115-E141, characterized by an EC50 of less than 5 nM in a flow cytometry assay of phosphorylated STAT1 CD3+ T cells.

[0182] E143. The antibody of any one of E115-E142, characterized by an EC50 of less than 1 nM in a flow cytometry assay of phosphorylated STAT1 CD3+ T cells.

[0183] E144. The antibody of any one of E115-E143, characterized by an EC50 of less than 0.5 nM in a flow cytometry assay of phosphorylated STAT1 CD3+ T cells.

[0184] E145. The antibody of any one of E115 to E144, characterized by an EC50 in a flow cytometry assay of phosphorylated STAT1 CD3+ T cells of between 10 nM and 0.01 nM, between 10 nM and 0.1 nM, between 1 nM and 0.01 nM, or between 1 nM and 0.1 nM.

[0185] E146. The antibody of any one of E115-E145, characterized by an EC50 of between 1 nM and 0.1 nM in a flow cytometry assay of phosphorylated STAT1 CD3+ T cells.

[0186] E147. The antibody of any one of E115-E146, characterized by an EC50 of less than 1 nM in a flow cytometry assay of phosphorylated STAT3 in CD3+ T cells.

[0187] E148. The antibody of any one of E115 to E147, characterized by an EC50 of less than 0.5 nM in a flow cytometry assay of phosphorylated STAT3 in CD3+ T cells.

[0188] E149. The antibody of any one of E115 to E148, characterized by an EC50 of less than 10 nM, less than 1 nM, less than 0.5 nM, less than 0.3 nM, or less than 0.1 nM in a flow cytometry assay of phosphorylated STAT3 in CD3+ T cells.

[0189] E150. The antibody of any one of E115 to E149, characterized by an EC50 of less than 0.3 nM in a flow cytometry assay of phosphorylated STAT3 in CD3+ T cells.

[0190] E151. The antibody of any one of E115 to E150, characterized by an EC50 of between 10 nM and 0.01 nM, between 10 nM and 0.1 nM, between 1 nM and 0.01 nM, or between 1 nM and 0.1 nM in a flow cytometry assay of phosphorylated STAT3 in CD3+ T cells.

[0191] E152. The antibody of any one of E115 to E151, characterized by an EC50 of between 1 nM and 0.1 nM in a flow cytometry assay of phosphorylated STAT3 in CD3+ T cells.

[0192] E153. The antibody of any one of E115 to E152, characterized by activation of phosphorylated STAT1 and STAT3 in CD3+ T cells.

[0193] E154. The antibody according to any one of E115 to E153, which binds to cynomolgus monkey IL27RA and cynomolgus monkey gp130.

[0194] E155. The antibody of any one of E115 to E154, which is capable of downregulating pathogenic cytokine production.

[0195] E156. The antibody of E155, which is capable of downregulating Il-17 production in helper T cells.

[0196] E157. The antibody of any one of E115-E156, characterized by an IC50 of less than 0.05 nM as measured by Il-17 immunoassay.

[0197] E158. The antibody of any one of E115 to E157, characterized by an IC50 of less than 0.01 nM as measured by Il-17 immunoassay.

[0198] E159. The antibody of any one of E115 to E158, characterized by an IC50 of between 1 nM and 0.0001 nM, between 1 nM and 0.01 nM, between 0.1 nM and 0.0001 nM, between 0.1 nM and 0.001 nM, between 0.01 nM and 0.0001 nM, or between 0.01 nM and 0.001 nM, as measured by 11-17 immunoassay.

[0199] E160. The antibody of any one of E115 to E159, characterized by an IC50 of between 0.01 nM and 0.001 nM as measured by Il-17 immunoassay.

[0200] E161. The antibody according to any one of E115 to E160, which is capable of promoting regulatory T cell differentiation.

[0201] E162. The antibody of E161, wherein the regulatory T cells are natural Tregs (nTregs) and inducible Tregs (iTregs).

[0202] E163. The antibody according to any one of E115 to E162, which is capable of upregulating indoleamine-pyrrole 2,3-dioxygenase (IDO1) expression.

[0203] E164. The antibody of any one of E115 to E163, which is capable of upregulating indoleamine-pyrrole 2,3-dioxygenase (IDO1) expression in CD14+ human monocytes and / or human colonocytes.

[0204] E165. The antibody of any one of E115-E164, characterized by an EC50 of less than 100 nM as determined by an LC-MS assay of kynurenine production.

[0205] E166. The antibody of any one of E115-E165, characterized by an EC50 of less than 10 nM as determined by an LC-MS assay of kynurenine production.

[0206] E167. The antibody of any one of E115 to E166, characterized by an EC50 of between 100 nM and 0.1 nM, between 100 nM and 1 nM, between 10 nM and 0.1 nM, or between 10 nM and 1 nM as determined by an LC-MS assay of kynurenine production.

[0207] E168. The antibody of any one of E115 to E167, characterized by an EC50 of between 10 nM and 1 nM as determined by an LC-MS assay of kynurenine production.

[0208] E169. A pharmaceutical composition comprising a therapeutically effective amount of the antibody according to any one of E115 to E168 and a pharmaceutically acceptable carrier.

[0209] E170. A vector comprising the polynucleotide of either E37 or E39.

[0210] E171. A vector comprising the polynucleotide of either E94 or E96.

[0211] E172. An isolated host cell comprising the polynucleotide of E37 or E39 or the vector of E170.

[0212] E173. An isolated host cell comprising the polynucleotide of either E94 or E96 or the vector of E171.

[0213] E174. i) a polynucleotide described in either E94 or E96 or a vector described in E170, and ii) a polynucleotide described in either E94 or E96 or a vector described in E171 1. An isolated host cell comprising:

[0214] E175. The antibody according to any one of E115 to E168 or the pharmaceutical composition according to E169 for use in treating an inflammatory disease.

[0215] E176. The antibody of any one of E115 to E168 or the pharmaceutical composition of E169 for use in treating one or more selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0216] E177. The antibody of any one of E115 to E168 or the pharmaceutical composition of E169 for use in treating inflammatory bowel disease (IBD).

[0217] E178. The antibody according to any one of E115 to E168 or the pharmaceutical composition according to E169, for use according to E46, wherein the use is for the treatment of Crohn's disease (CD) or ulcerative colitis (UC).

[0218] E179. A method for treating a medical condition, comprising administering to a subject in need thereof a therapeutically effective amount of the antibody of any one of E115-E168 or the pharmaceutical composition of E169.

[0219] E180. The method of E179, wherein the condition is selected from the group consisting of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0220] E181. The method of E179, wherein the condition is an inflammatory disease.

[0221] E182. The method of E180 or E181, wherein the condition is inflammatory bowel disease (IBD).

[0222] E183. The method according to any one of E179 to E182 or the use according to E175 to E178, comprising the step of subcutaneously administering the antibody or pharmaceutical composition.

[0223] E184. The method or use according to any one of E175 to E183, wherein the antibody or pharmaceutical composition is administered about twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, twice a month, once a month, once every two months, once every three months, or once every four months.

[0224] E185. Use of the antibody of any one of E115 to E168 for the manufacture of a medicament for use in the treatment of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

[0225] E186. Use of an antibody according to any one of E115 to E168 for the manufacture of a medicament for use in the treatment of an inflammatory disease.

[0226] E187. The use of the antibody of E185 or E186, wherein the condition is inflammatory bowel disease (IBD).

[0227] E188. The use of the antibody of E187, wherein said conditions are Crohn's disease (CD) and ulcerative colitis (UC).

[0228] E189. An isolated antibody comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises a VH and a VL and the second antigen-binding site comprises a VH and a VL, and the antibody has a binding affinity for human IL27RA that is at least two orders of magnitude lower than the antibody's binding affinity for human gp130.

[0229] E190. The antibody of any one of E1 to E189, comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises a VH and a VL and the second antigen-binding site comprises a VH and a VL, and wherein the antibody has a binding affinity for human IL27RA that is at least two orders of magnitude lower than the antibody's binding affinity for human gp130.

[0230] E191. The antibody of any one of E189 to E190, having a binding affinity for human IL27RA that is at least three orders of magnitude lower than the antibody's binding affinity for human gp130.

[0231] E192 The antibody according to E189 to E191, which binds to human IL27RA with an affinity of less than 1 nM as measured by SPR.

[0232] E193. The antibody according to E189 to E192, which binds to human gp130 with an affinity greater than 100 nM as measured by SPR.

[0233] Without wishing to be limited by any particular theory, binding of the antibody to the IL27R subunit IL27RA, without engagement of the gp130 subunit of IL27R, acts to antagonize the IL27 receptor.

[0234] E194. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127622.

[0235] E195. An isolated antibody that specifically binds to IL27RA, comprising a light chain variable region (IL27RA-VL) encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127623.

[0236] E196. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127622, and a light chain variable region (IL27RA-VL) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127623.

[0237] E197. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) encoded by the plasmid deposited with the ATCC having ATCC accession number PTA127626.

[0238] E198. An isolated antibody that specifically binds to IL27RA, comprising a light chain (IL27RA-LC) encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127627.

[0239] E199. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127626, and a light chain (IL27RA-LC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127627.

[0240] E200. An isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) encoded by the plasmid deposited with the ATCC having ATCC Accession No. PTA-127624.

[0241] E201. An isolated antibody that specifically binds to gp130, comprising a light chain variable region (gp130-VL) encoded by the plasmid deposited with the ATCC having ATCC Accession No. PTA-127625.

[0242] E202. An isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127624, and a light chain variable region (gp130-VL) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127624.

[0243] E203. An isolated antibody that specifically binds to gp130, comprising a heavy chain (gp130-HC) encoded by the plasmid deposited with the ATCC having ATCC Accession No. PTA-127628.

[0244] E204. An isolated antibody that specifically binds to gp130, comprising a light chain (gp130-LC) encoded by the plasmid deposited with the ATCC having ATCC Accession No. PTA-127629.

[0245] E205. An isolated antibody that specifically binds to gp130, comprising a heavy chain (gp130-VH) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127628, and a light chain (gp130-LC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127629.

[0246] E206. An isolated antibody that specifically binds to IL27RA and gp130, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127622 and a light chain variable region (IL27RA-VL) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127623, and further comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127624 and a light chain variable region (gp130-VL) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127625.

[0247] E207. An isolated antibody that specifically binds to IL27R and gp130, comprising a heavy chain (IL27RA-HC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127626, and a light chain (IL27RA-LC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127627, and further comprising a heavy chain (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127628, and a light chain (gp130-LC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA127629.

[0248] E208. The isolated antibody according to any one of E194 to E207, further comprising an antibody according to any one of E1 to E30, E43 to E47, E57 to E85, E100 to E104, E115 to E168, E175 to E178, and E189 to E193.

[0249] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0250] All references cited herein, including patent applications, patent publications, and UniProtKB accession numbers, are hereby incorporated by reference as if each individual reference was specifically and individually indicated to be incorporated by reference in its entirety.

[0251] The techniques and procedures described and referred to herein are generally well understood and commonly employed by those of skill in the art using conventional methodologies, such as, for example, widely utilized methodologies described in: Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition (2001), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F.M.A.usubel et al., eds., (2003)); Series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M.J. MacPherson, B.D. Hames, and G.R. Taylor, eds. (1995)); Harlow and Lane, eds. (1988); ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R.I. Freshney, ed. (1987)); Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (ed. J.E.Cellis, 1998) Academic Press; Animal Cell Culture (ed. R.I. Freshney, 1987); Introduction to Cell and Tissue Culture (J.P. Mather and P.E. Roberts, 1998) Plenum Press; Cell and Tissue Culture Laboratory Procedures (eds. A. Doyle, J.B. Griffiths, and D.G. Newell, 1993-98) J. Wiley and Sons; Handbook of Experimental Immunology (eds. D.M. Weir and C.C. Blackwell); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P.Calos, 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., 1994); Current Protocols in Immunology (JE Coligan et al., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C.A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty, ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, ed., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999)); The Antibodies (M. Zanetti and J.D. Capra, ed., Harwood Academic Press Publishers, 1995); and their latest editions.

[0252] definition Unless otherwise defined herein, scientific and technical terms used in connection with the present invention have the meanings that are commonly understood by those of ordinary skill in the art.

[0253] As used herein, the singular forms "a," "an," and "the" include plural references unless otherwise specified. For example, "an" antibody includes one or more antibodies.

[0254] When aspects or embodiments of the invention are described in terms of a Markush group or other grouping of alternatives, the invention encompasses the entire recited group as a whole, but also each member of the group individually and all possible subgroups of the main group, as well as the main group in which one or more of the group members are absent. The invention also envisions the explicit exclusion of one or more of any of the group members in the claimed invention.

[0255] Any examples following the term "eg" or "for example" are not meant to be exhaustive or limiting.

[0256] As used herein, the term "about" when used to modify a numerically defined parameter (e.g., *** A dose of about 5 mg means that the parameter can vary by 10% below or above the stated value for that parameter. For example, a dose of about 5 mg means 5%±10%, i.e., it can vary between 4.5 mg and 5.5 mg.

[0257] antibody "Antibody" refers to an immunoglobulin molecule capable of specifically binding to a target, e.g., a polypeptide, carbohydrate, polynucleotide, lipid, etc., via at least one antigen-binding site located in the variable region of the immunoglobulin molecule. As used herein, the term "antibody" can encompass any type of antibody (e.g., monospecific, bispecific), including portions of intact antibodies that retain the ability to bind to a given antigen (e.g., "antigen-binding fragments"), and any other modified configuration of an immunoglobulin molecule that contains an antigen-binding site.

[0258] Antibodies include antibodies of any class, e.g., IgG, IgA, or IgM (or subclasses thereof); antibodies need not be of any particular class. Depending on the antibody amino acid sequence of the constant region of its heavy chain (HC), immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, some of which can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant regions corresponding to the different classes of immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.

[0259] Examples of antigen-binding fragments of antibodies and modified configurations include: (i) a Fab fragment (a monovalent fragment consisting of the VL, VH, CL, and CH1 domains); (ii) a F(ab')2 fragment (a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region); and (iii) a Fv fragment consisting of the VL and VH domains of a single antibody arm. Furthermore, although the two domains of an Fv fragment, VL and VH, are encoded by separate genes, they can be joined using recombinant methods by a synthetic linker that allows them to be produced as a single protein chain in which the VL and VH regions pair to form a monovalent molecule (also known as a single-chain Fv (scFv)); see, for example, Bird et al., Science 1988;242:423-426 and Huston et al., Proc. Natl. Acad. Sci. 1988 USA 85:5879-5883. Other forms of single chain antibodies, such as diabodies, are also encompassed.

[0260] Additionally, antibodies lacking a C-terminal lysine (K) amino acid residue on the heavy chain polypeptide are further encompassed (e.g., human IgG1 heavy chains contain a terminal lysine). As is known in the art, the C-terminal lysine may be omitted during antibody production, resulting in an antibody having a heavy chain lacking a C-terminal lysine. Alternatively, the antibody heavy chain may be produced using nucleic acid that does not contain a C-terminal lysine.

[0261] Variable region The "variable region" of an antibody refers to the variable region of the antibody light chain or the variable region of the antibody heavy chain, either alone or in combination. As is known in the art, the variable regions of the heavy and light chains each consist of four framework regions (FRs) connected by three complementarity-determining regions (CDRs), also known as hypervariable regions, which contribute to the formation of the antigen-binding site of the antibody. In particular, when a variant of a subject variable region is desired that has a substitution of an amino acid residue outside the CDR region (i.e., in the framework region), appropriate amino acid substitutions, preferably conservative amino acid substitutions, can be identified by comparing the subject variable region with the variable regions of other antibodies containing CDR1 and CDR2 sequences in the same canonical class as the subject variable region (Chothia and Lesk, J Mol Biol 196(4):901-917, 1987).

[0262] In certain embodiments, the delineation of CDRs and the identification of the residues that make up the antibody binding site are achieved by solving the structure of the antibody or the structure of the antibody-ligand complex. In certain embodiments, this can be achieved by any of a variety of techniques known to those skilled in the art, such as X-ray crystallography. In certain embodiments, various methods of analysis can be used to identify or approximate CDR regions. In certain embodiments, various methods of analysis can be used to identify or approximate CDR regions. Examples of such methods include, but are not limited to, the Kabat definition, the Chothia definition, the AbM definition, the contact definition, the extended definition, and the conformational definition.

[0263] The Kabat definition is a standard for numbering residues in antibodies and is typically used to identify CDR regions. See, e.g., Johnson and Wu, 2000, Nucleic Acids Res., 28:214-8. The Chothia definition is similar to the Kabat definition, but takes into account the location of certain structural loop regions. See, e.g., Chothia et al., 1986, J. Mol. Biol., 196:901-17; Chothia et al., 1989, Nature, 342:877-83. The extended definition is a combination of the Kabat definition and the Chothia definition. The AbM definition uses an integrated suite of computer programs created by the Oxford Molecular Group to model antibody structure. See, e.g., Martin et al., 1989, Proc Natl Acad Sci (USA), 86:9268-9272; "AbM™ A Computer Program for Modeling Variable Regions of Antibodies," Oxford, UK; Oxford Molecular, Ltd. The AbM definition models the tertiary structure of antibodies from primary sequence using a combination of knowledge databases and ab initio methods, such as those described by Samudrala et al., 1999, "Ab Initio Protein Structure Prediction Using a Combined Hierarchical Approach," in PROTEINS, Structure, Function and Genetics Suppl., 3:194-198. The contact definition is based on an analysis of available complex crystal structures. See, e.g., MacCallum et al., 1996, J. Mol. Biol., 5:732-45. In another approach, referred to herein as "conformational definition" of CDRs, CDR positions can be identified as residues that contribute enthalpic- ically to antigen binding. See, e.g., Makabe et al., 2008, Journal of Biological Chemistry, 283:1156-1166.Still other CDR boundary definitions may not strictly follow one of the above approaches, but still overlap with at least a portion of Kabat CDR, but may be shortened or extended in light of prediction or experimental findings that certain residues or groups of residues do not significantly affect antigen binding.As used herein, CDR can refer to the CDR defined by any approach known in the art, including a combination of approaches.The method used herein can utilize the CDR defined according to any of these approaches.For any given embodiment that contains more than one CDR, the CDR can be defined according to any one or more of Kabat, Chothia, extended, AbM, contact or conformation definitions.

[0264] Pfabat numbering system developed for consistent antibody numbering The Pfabat numbering method is a defined algorithm for consistent antibody numbering based on the Kabat numbering system (Sequences of Proteins of Immunological Interest, 5th Edition, by Kabat et al., NIH Publication NO:91-3242, 1991). Unlike many other computer implementations of Kabat numbering, Pfabat numbers the entire human IgG1 heavy and light chains, including the constant (C) region and heavy chain hinge. Unless otherwise specified, the numbering system used herein is the Pfabat system.

[0265] constant region The "constant region" of an antibody refers to the constant region of the antibody light chain or the constant region of the antibody heavy chain, either alone or in combination. The IgG heavy chain constant region contains three sequential immunoglobulin domains (CH1, CH2, and CH3), along with a hinge region between the CH1 and CH2 domains. The IgG light chain constant region contains a single immunoglobulin domain (CL).

[0266] Fc domains and Fc chains "Fc domain" refers to the portion of an immunoglobulin (Ig) molecule that correlates with the crystallizable fragment obtained by papain digestion of an Ig molecule. As used herein, this term refers to the two-chain constant region of an antibody, each chain excluding the first constant region immunoglobulin domain. Within the Fc domain, there are two "Fc chains" (e.g., "first Fc chain" and "second Fc chain"). "Fc chain" generally refers to the C-terminal portion of an antibody heavy chain. Thus, the Fc chain refers to the last two constant region immunoglobulin domains (CH2 and CH3) of IgA, IgD, and IgG heavy chains, and the last three constant region immunoglobulin domains of IgE and IgM heavy chains, and optionally the flexible hinge N-terminal to these domains.

[0267] Although the boundaries of an Fc chain might vary, the human IgG heavy chain Fc chain is usually defined to include residues C226 or P230 at its carboxyl terminus, numbering according to the EU index of Edelman et al., Proc. Natl. Acad. Sci. USA 1969;63(1):78-85, and as described in Kabat et al., 1991. Typically, an Fc chain includes from about amino acid residues 236 to about 447 of the human IgG1 heavy chain constant region. "Fc chain" can refer to this polypeptide in isolation or in the context of a larger molecule (e.g., in an antibody heavy chain or an Fc fusion protein).

[0268] A "functional" Fc domain refers to an Fc domain that retains at least one effector function of a native-sequence Fc domain. Exemplary "effector functions" include C1q binding; complement-dependent cytotoxicity (CDC); Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down-regulation of cell surface receptors (e.g., B cell receptors); and B cell activation. Such effector functions generally require that the Fc domain be combined with a binding domain (e.g., an antibody variable region), and can be assessed using a variety of assays known in the art for assessing such antibody effector functions.

[0269] A "native sequence" Fc chain refers to an Fc chain comprising an amino acid sequence identical to that of an Fc chain found in nature. A "variant" Fc chain comprises an amino acid sequence that differs from that of a native sequence Fc chain by virtue of at least one amino acid modification.

[0270] Monoclonal antibodies A "monoclonal antibody" (mAb) refers to an antibody derived from a single copy or clone, including, for example, any eukaryotic, prokaryotic, or phage clone. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler and Milstein, 1975, Nature 256:495, or may be made by recombinant DNA methods such as those described in U.S. Pat. No. 4,816,567. In another example, the monoclonal antibodies can be isolated from phage libraries, such as those generated using the techniques described in McCafferty et al., 1990, Nature 348:552-554.

[0271] Human antibodies "Human antibody" refers to an antibody that possesses an amino acid sequence corresponding to that of an antibody produced by a human, or that is produced using any technique for producing a fully human antibody. For example, a fully human antibody can be obtained by using commercially available mice engineered to express specific human immunoglobulin proteins, or by library (e.g., phage, yeast, or ribosome) display techniques to prepare a fully human antibody. This definition of a human antibody specifically excludes humanized antibodies that contain non-human antigen-binding residues.

[0272] chimeric antibodies A "chimeric antibody" refers to an antibody in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, e.g., the variable region sequences are derived from a murine antibody and the constant region sequences are derived from a human antibody.

[0273] humanized antibodies "Humanized" antibodies refer to non-human (e.g., murine) antibodies that are chimeric antibodies containing minimal sequence derived from non-human immunoglobulin. Preferably, humanized antibodies are human immunoglobulins (recipient antibodies) in which residues from the recipient's CDRs are replaced by residues from CDRs of a non-human species (donor antibody), e.g., mouse, rat, or rabbit, having the desired specificity, affinity, and capacity. Humanized antibodies may contain residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences, but are included to further refine and optimize antibody performance.

[0274] antigen "Antigen" refers to a molecular entity used to immunize an immunocompetent vertebrate to produce antibodies that recognize the antigen, or to screen an expression library (e.g., phage, yeast, or ribosome display library, among others) for antibody selection. As used herein, antigen is termed more broadly and is generally intended to include the target molecule that is specifically recognized by an antibody, and thus includes fragments or mimetics of the molecule used in the immunization process to raise antibodies or in library screening to select antibodies.

[0275] epitope "Epitope" refers to the area or region of an antigen to which an antibody specifically binds, for example, the area or region containing the residue that interacts with the antibody, as determined by any method known in the art.There are many methods known in the art for mapping and characterizing the location of epitopes on proteins, including elucidating the crystal structure of antibody-antigen complexes, competitive assays, gene fragment expression assays, epitope mapping, and synthetic peptide-based assays, as described, for example, in Chapter 11 of Harlow and Lane, "Using Antibodies," a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1999.In addition or alternatively, during the discovery process, generating and characterizing antibodies can reveal information about desired epitopes.This information can then be used to competitively screen antibodies for binding to the same epitope.

[0276] Furthermore, the epitope that an antibody binds can be determined in a systematic screening by using overlapping peptides derived from the antigen and determining the binding by the antibody.In gene fragment expression assay, the open reading frame encoding the antigen can be fragmented randomly or by specific genetic structure, and the reactivity of the expressed fragment of the antigen with the antibody being tested is determined.The gene fragment can be produced, for example, by PCR, and then transcribed and translated into protein in vitro in the presence of radioactive amino acids.Then, the binding of the antibody to the radiolabeled antigen fragment is determined by immunoprecipitation and gel electrophoresis.

[0277] Specific epitopes can also be identified by using large libraries of random peptide sequences displayed on the surface of phage particles (phage libraries) or yeast (yeast display). Alternatively, defined libraries of overlapping peptide fragments can be tested for binding to a test antibody in a simple binding assay. In additional examples, antigen mutagenesis, domain swapping experiments, and alanine scanning mutagenesis can be performed to identify residues required, sufficient, or necessary for epitope binding.

[0278] At its most detailed level, an epitope for an interaction between an antigen and an antibody can be defined by spatial coordinates defining the atomic contacts present in the antigen-antibody interaction, as well as information about their relative contributions to binding thermodynamics. At a less detailed level, an epitope can be characterized by spatial coordinates defining the atomic contacts between the antigen and the antibody. At an even less detailed level, an epitope can be characterized by the amino acid residues it contains, or by specific criteria, such as the distance between atoms (e.g., heavy atoms, i.e., non-hydrogen atoms) in the antibody and the antigen. At an even less detailed level, an epitope can be characterized via function, such as competitive binding with other antibodies. An epitope can also be defined more generally as including amino acid residues whose substitution with another amino acid alters the characteristics of the interaction between the antibody and the antigen (e.g., using alanine scanning).

[0279] The fact that epitope description and definition can be obtained at different levels of detail depending on the epitope mapping method used means that comparison of epitopes for different antibodies on the same antigen can likewise be performed at different levels of detail.

[0280] Epitopes described at the amino acid level, for example, by X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, or hydrogen / deuterium exchange mass spectrometry (H / D-MS), are said to be identical if they contain the same set of amino acid residues. Epitopes are said to overlap if at least one amino acid is shared by the epitopes. Epitopes are said to be distinct (unique) if no amino acid residues are shared by the epitopes.

[0281] Another method that can be used to characterize an antibody is to use a competitive assay with another antibody known to bind to the same antigen to determine whether the antibody of interest binds to the same epitope as the other antibody. Competitive assays are well known to those skilled in the art. Epitopes characterized by competitive binding are said to overlap if the binding of corresponding antibodies is mutually exclusive, i.e., if the binding of one antibody excludes the simultaneous or sequential binding of the other antibody. Epitopes are said to be separate (unique) if the antigen can simultaneously accept the binding of both corresponding antibodies.

[0282] Epitopes can be linear or conformational. In a linear epitope, all points of interaction between the protein and the interacting molecule (e.g., an antibody) occur linearly along the primary amino acid sequence of the protein. A "non-linear epitope" or "conformational epitope" comprises non-contiguous polypeptides (or amino acids) within an antigenic protein to which an antibody specific for the epitope binds.

[0283] binding affinity The term "binding affinity" refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise specified, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of a molecule X for its partner Y is generally determined by the dissociation constant (K D) Affinity can be measured by common methods known in the art. Low affinity antibodies generally bind antigens slowly and tend to dissociate easily, whereas high affinity antibodies generally bind antigens faster and tend to remain bound longer. In particular, the term "binding affinity" is intended to refer to the dissociation rate of a particular antigen-antibody interaction. K D is the "off-rate (k off )" or "k d The rate of dissociation, also called the on-rate (k on )" or "k a " is the ratio to K D is k off / k on (or k d / k a ) and is expressed as molar concentration (M). D The smaller the K, the stronger the binding affinity. D has a K of 1 nM D The K for antibodies shows weaker binding affinity compared to D The K value can be determined using methods well established in the art. D One exemplary method for determining the K of an antibody is by using surface plasmon resonance (SPR), typically by using a biosensor system, such as a BIACORE system. BIACORE kinetic analysis involves analyzing the binding and dissociation of an antigen from chips having molecules (e.g., molecules containing epitope-binding domains) immobilized on their surface. D Another method for determining β-glucan is to use biolayer interferometry, typically OCTET technology (Octet QK). e Alternatively or additionally, the KinExA (Kinetic Exclusion Assay) assay available from Sapidyne Instruments (Boise, ID) can also be used.

[0284] Monospecific antibodies A "monospecific antibody" refers to an antibody that contains one or more antigen-binding sites per molecule, such that any and all binding sites of the antibody specifically recognize the same epitope on the antigen. Thus, if a monospecific antibody has more than one antigen-binding site, the binding sites compete with each other for binding to a single antigen molecule.

[0285] bispecific antibody A "bispecific antibody" refers to a molecule that has binding specificities for at least two different epitopes. In some embodiments, a bispecific antibody can simultaneously bind to two different antigens. In other embodiments, the two different epitopes may be present on the same antigen.

[0286] Half-maximal effective concentration (EC 50 ) The term "half-maximum effective concentration (EC 50 ) refers to the concentration of a therapeutic agent that causes a response halfway between baseline and maximum after a specified exposure time. The therapeutic agent can cause inhibition or stimulation. As a measure of efficacy, the EC 50 The values are commonly used and are used herein.

[0287] Agonists "Agonist" refers to a substance that promotes (i.e., induces, causes, enhances, or increases) the biological activity or effect of another molecule. The term agonist includes substances (e.g., antibodies) that bind to a molecule and promote the activity of that molecule.

[0288] Antagonist "Antagonist" refers to a substance that prevents, blocks, inhibits, neutralizes, or reduces the biological activity or effect of another molecule, e.g., a receptor. The term antagonist includes substances (e.g., antibodies) that bind to a molecule and prevent or reduce the activity of that molecule.

[0289] competing The term "compete," as used herein with respect to antibodies, means that a first antibody binds to an epitope in a manner sufficiently similar to that of a second antibody such that the result of binding of the second antibody to its cognate epitope is detectably reduced in the presence of the first antibody, compared to binding of the second antibody in the absence of the first antibody. Alternatively, the binding of the first antibody to its epitope may, but need not, also be detectably reduced in the presence of the second antibody. That is, a first antibody may inhibit binding of a second antibody to its epitope without the second antibody inhibiting binding of the first antibody to its respective epitope. However, if each antibody detectably inhibits binding of the other antibody to its cognate epitope or ligand, whether to the same extent, a greater extent, or a lesser extent, the antibodies are said to "cross-compete" with each other for binding of their respective epitopes. Both competing and cross-competing antibodies are encompassed by the present invention. Regardless of the mechanism by which such competition or cross-competition occurs (e.g., steric hindrance, conformational change, or binding to a common epitope or portion thereof), one of skill in the art will understand, based on the teachings provided herein, that such competing or cross-competing antibodies are encompassed and may be useful in the methods disclosed herein.

[0290] Fc receptors "Fc receptor" (FcR) refers to a receptor that binds to the Fc region of an antibody. In some embodiments, the FcR is a native human FcR. In some embodiments, the FcR is one that binds IgG antibodies (gamma receptors), which include receptors of the FcgRI, FcgRII, and FcgRIII subclasses, including allelic variants and alternatively spliced forms of these receptors. FcgRII receptors include FcgRIIA (an "activating receptor") and FcgRIIB (an "inhibitory receptor"), which have similar amino acid sequences that differ primarily in their cytoplasmic domains. Activating receptor FcgRIIA contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain. Inhibitory receptor FcgRIIB contains an immunoreceptor tyrosine-based inhibitory motif (ITIM) in its cytoplasmic domain (see, e.g., Daeron, Annu. Rev. Immunol. 1997;15:203-234). FcRs are reviewed, for example, in Ravetch and Kinet, Annu. Rev. Immunol 1991;9:457-92; Capel et al., Immunomethods 1994;4:25-34; and de Haas et al., J. Lab. Clin. Med. 1995;126:330-41. Other FcRs, including those identified in the future, are encompassed herein by the term "Fc receptor." The term "Fc receptor" also includes the neonatal receptor FcRn, which is responsible for regulating maternal IgG transfer to the fetus (Guyer et al., J. Immunol. 1976;117:587 and Kim et al., J. Immunol. 1994;24:249) and immunoglobulin homeostasis. Methods for measuring binding to FcRn are known (see, e.g., Ghetie and Ward, Immunol. Today 1997;18(12):592-598; Ghetie et al., Nature Biotechnology 1997;15(7):637-640; Hinton et al., J. Biol. Chem. 2004;279(8):6213-6216; WO2004 / 92219).

[0291] Effector cells "Effector cells" refer to leukocytes that express one or more FcRs and perform effector functions. In certain embodiments, effector cells express at least FcgRIII and perform ADCC effector functions. Examples of leukocytes that mediate ADCC include peripheral blood mononuclear cells (PBMCs), natural killer (NK) cells, monocytes, macrophages, cytotoxic T cells, and neutrophils. Effector cells can be isolated from native sources, such as blood.

[0292] Antibody-dependent cell-mediated cytotoxicity (ADCC) The term "antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig bound to Fc receptors (FcR) present on certain cytotoxic cells (e.g., NK cells, neutrophils, and macrophages) enables these cytotoxic effector cells to specifically bind to antigen-bearing target cells and subsequently kill the target cells using cytotoxins. NK cells, the primary cells mediating ADCC, express only FcgRIII, whereas monocytes express FcgRI, FcgRII, and FcgRIII. To assess the ADCC activity of a molecule of interest, an in vitro ADCC assay, such as that described in U.S. Pat. Nos. 5,500,362, 5,821,337, or 6,737,056, can be performed. Useful effector cells for such assays include PBMCs and NK cells. Alternatively, or additionally, ADCC activity of the molecule of interest may be assessed in vivo, e.g., in an animal model such as that disclosed in Clynes et al., Proc. Natl. Acad. Sci. (USA) 1998;95:652-656. Additional antibodies with altered Fc region amino acid sequences and increased or decreased ADCC activity are described, e.g., in U.S. Patent Nos. 7,923,538 and 7,994,290.

[0293] Enhanced ADCC activity The term "enhanced ADCC activity" refers to an antibody that is more effective in mediating ADCC in vitro or in vivo than a parent antibody, when essentially the same amounts of such antibody and parent antibody are used in the assay, and the antibody and parent antibody differ in at least one structural aspect. In some embodiments, the antibody and parent antibody have the same amino acid sequence, but the antibody is afucosylated, while the parent antibody is fucosylated. In some embodiments, ADCC activity is determined using an in vitro ADCC assay, although other assays or methods for determining ADCC activity, such as in animal models, are contemplated. In some embodiments, an antibody with enhanced ADCC activity has enhanced affinity for FcgRIIIA.

[0294] Altered FcR binding or ADCC activity The term "altered" FcR binding affinity or ADCC activity refers to an antibody that has either enhanced or diminished activity in one or more of its FcR binding or ADCC activities compared to a parent antibody, which differs from the parent antibody in at least one structural aspect. An antibody that "exhibits increased binding" to an FcR binds to at least one FcR with better affinity than the parent antibody. An antibody that "exhibits reduced binding" to an FcR binds to at least one FcR with lower affinity than the parent antibody. Such antibodies that exhibit reduced binding to an FcR may retain little or no appreciable binding to an FcR, e.g., may retain 0 to 20 percent of FcR binding compared to a native-sequence IgG Fc region.

[0295] Complement-dependent cytotoxicity (CDC) The term "complement-dependent cytotoxicity" or "CDC" refers to the lysis of target cells in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (C1q) to antibodies (of the appropriate subclass) bound to their cognate antigen. To assess complement activation, a CDC assay, such as that described in Gazzano-Santoro et al., J. Immunol. Methods 1996;202:163, can be performed. Antibodies with altered Fc region amino acid sequences and increased or decreased C1q binding ability are described, for example, in U.S. Pat. No. 6,194,551, U.S. Pat. No. 7,923,538, U.S. Pat. No. 7,994,290, and WO1999 / 51642.

[0296] host cell "Host cell" refers to an individual cell or cell culture that can be or has been the recipient of a vector for incorporation of a polynucleotide insert. A host cell includes the progeny of a single host cell, which progeny may not necessarily be completely identical (in morphology or genomic DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation. A host cell includes cells transfected in vivo with a polynucleotide of the invention.

[0297] vector A "vector" refers to a construct capable of delivering one or more genes or sequences of interest (e.g., antibody-encoding genes) into a host cell, and preferably expressing them in the host cell. Examples of vectors include, but are not limited to, plasmids and viral vectors, and may include naked nucleic acid or may include nucleic acid associated with a delivery aid (e.g., cationic condensing agents, liposomes, etc.). A vector may include DNA or RNA. As used herein, an "expression vector" refers to a vector containing at least one polypeptide-encoding gene and at least one regulatory element (e.g., promoter sequence, poly(A) sequence) for the transcription or translation of the gene. Typically, a vector used herein contains at least one antibody-encoding gene and one or more regulatory elements or selectable markers. Vector components may include, for example, one or more of the following: a signal sequence; an origin of replication; one or more marker genes; and appropriate transcription control elements (e.g., promoters, enhancers, and terminators). For translation, one or more translational control elements may also be included, such as a ribosome binding site, a translation initiation site, and a stop codon.

[0298] isolated An "isolated" molecule (e.g., an antibody) refers to a molecule that, by virtue of its origin or source of derivation, (1) is not associated with naturally associated components that accompany it in its native state; (2) is substantially free of other molecules from the same source, e.g., the species, the cell in which it is expressed, a library, etc.; (3) is expressed by cells from a different species; or (4) does not exist in nature. Thus, a molecule that is chemically synthesized or expressed in a cellular system different from the system in which it naturally originates is "isolated" from its naturally associated components. A molecule can also be rendered substantially free of naturally associated components by isolation using purification techniques well known in the art.

[0299] Polypeptides / Proteins "Polypeptide" or "protein" (used interchangeably herein) refer to a chain of amino acids of any length. The chain can be linear or branched. The chain can contain one or more modified amino acids. These terms also encompass amino acid chains that are modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. For example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art, are also included within this definition. It is understood that a polypeptide can exist as a single chain or associated chains.

[0300] Polynucleotides / Nucleic Acids "Polynucleotide" or "nucleic acid" (used interchangeably herein) refer to a chain of nucleotides of any length, including DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases or their analogs, or any substrate that can be incorporated into a chain by DNA or RNA polymerase. A polynucleotide can contain modified nucleotides, such as methylated nucleotides and their analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the chain. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications include, for example, "caps," substitution of one or more naturally occurring nucleotides with analogs, internucleotide modifications, such as those with uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and those with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, metal oxides, etc.), those containing alkylating agents, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), and unmodified forms of polynucleotides. Additionally, any of the hydroxyl groups normally present in the sugar can be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to provide for additional linkage to additional nucleotides, or conjugated to a solid support. The 5' and 3' terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of 1 to 20 carbon atoms. Other hydroxyls can also be derivatized to standard protecting groups.Polynucleotides may also contain analogous forms of ribose or deoxyribose sugars commonly known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl, 2'-fluoro-, or 2'-azido-ribose, carbocyclic sugar analogs, alpha- or beta-anomeric sugars, epimeric sugars such as arabinose, xylose, or lyxose, pyranose sugars, furanose sugars, sedoheptulose, acyclic analogs, and abasic nucleoside analogs such as methyl riboside.

[0301] conservative substitution "Conservative substitution" refers to the replacement of one amino acid with a biologically, chemically, or structurally similar residue. Biologically similar means that the substitution does not destroy biological activity. Structurally similar means that the amino acids have side chains with similar lengths or side chains with similar sizes, such as alanine, glycine, and serine. Chemical similarity means that the residues have the same charge or are both hydrophilic or hydrophobic. Specific examples include the replacement of a hydrophobic residue, such as isoleucine, valine, leucine, or methionine, with another residue, or the replacement of one polar residue with another polar residue, such as the replacement of arginine with lysine, the replacement of glutamic acid with aspartic acid, or the replacement of glutamine with asparagine, or the replacement of serine with threonine, etc. Specific examples of conservative substitutions include substitutions of hydrophobic residues, such as isoleucine, valine, leucine, or methionine, for one another, substitution of one polar residue for another, such as substitution of arginine for lysine, substitution of glutamic acid for aspartic acid, or substitution of glutamine for asparagine, etc. Conservative amino acid substitutions typically include, for example, substitutions within the following groups: glycine, alanine, valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.

[0302] identity The terms "identity" or "identical to" refer to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules or RNA molecules) or polypeptide molecules. "Identity" measures the percent of identical matches between two or more sequences using gap alignment, which is handled by specific mathematical models (e.g., algorithms) of computer programs well known in the art. Calculation of percentage identity between two polymeric molecules is performed using the formula N / T * The total number of positions compared, including gaps, can be calculated from the alignment, such as '100, where N is the number of positions where the sequences share identical residues, and T is the total number of positions compared, either including or excluding overhang sequences, in one embodiment, overhang sequences are included in the calculation.

[0303] The terms "increase," "improve," "decrease," or "reduce" refer to a value compared to a baseline measurement, e.g., a measurement in the same individual before the initiation of a treatment described herein, or a measurement in a control individual or subject (or multiple control individuals or subjects) in the absence of a treatment described herein. In some embodiments, a "control individual" is an individual suffering from the same form of disease or disorder as the individual being treated. In some embodiments, a "control individual" is an individual not suffering from the same form of disease or disorder as the individual being treated.

[0304] excipients The term "excipient" refers to any material that combines with a desired active ingredient (e.g., an antibody) to enable the active ingredient to retain its biological activity. The choice of excipient will depend to a large extent on factors such as the mode of administration, the excipient's effect on solubility and stability, and the nature of the dosage form. As used herein, "excipient" includes any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, carriers, diluents, and the like. Examples of excipients include one or more of water, saline, phosphate buffer solution, dextrose, glycerol, ethanol, and the like, and combinations thereof, and may include isotonic agents, such as sugars, sodium chloride, or polyalcohols such as mannitol or sorbitol, in the composition.

[0305] Treat The terms "treating," "treat," or "treatment" refer to any type of treatment, such as to alleviate, relieve, or slow the progression of a patient's disease, disorder, or condition, or any tissue damage associated with the disease. In some embodiments, the disease, disorder, or condition is inflammatory bowel disease (IBD). In some embodiments, the disease, disorder, or condition is Crohn's disease (CD). In some embodiments, the disease, disorder, or condition is ulcerative colitis (UC).

[0306] Prevent The term "prevent" or "prevention" refers to one or more of delaying the onset, reducing the frequency, or reducing the severity of at least one sign or symptom of a particular disease, disorder, or condition (e.g., inflammatory bowel disease (IBD)). In some embodiments, prevention is assessed on a population basis, such that an agent is considered to "prevent" a particular disease, disorder, or condition if a statistically significant reduction in the onset, frequency, or intensity of one or more symptoms of the disease, disorder, or condition is observed in a population susceptible to that disease, disorder, or condition. Prevention may be considered complete if the onset of the disease, disorder, or condition is delayed for a predefined period of time.

[0307] subject The terms "subject," "individual," or "patient" (used interchangeably herein) refer to any animal, including mammals. Mammals according to the present invention include dogs, cats, cows, goats, horses, sheep, pigs, rodents, lagomorphs, primates, humans, and the like, including mammals in utero. In certain embodiments, humans are suitable subjects. Human subjects can be of any gender and at any stage of development. In some embodiments, the subject is a patient with inflammatory bowel disease (IBD).

[0308] Therapeutically effective dose The term "therapeutically effective amount" refers to that amount of active ingredient that elicits the biological or medicinal response sought by a researcher, veterinarian, physician or other clinician in a tissue, system, animal, individual or human, which may include one or more of the following: (1) Preventing disease; e.g., preventing a disease, condition, or disorder in an individual who may be predisposed to the disease, condition, or disorder but who has not yet experienced or exhibited the pathology or symptomology of the disease; (2) inhibiting a disease; e.g., inhibiting a disease, condition, or disorder (i.e., halting or slowing further development of the pathology or symptomology) in an individual experiencing or exhibiting the pathology or symptomology of the disease, condition, or disorder; and (3) Ameliorating the disease; for example, ameliorating the disease, condition, or disorder (i.e., reversing the pathology or symptomology) in an individual experiencing or exhibiting the pathology or symptomology of the disease, condition, or disorder.

[0309] Antibody against IL27RA The present disclosure provides antibodies that bind to interleukin-27 receptor subunit alpha (IL27RA), also known as cytokine receptor-like 1, cytokine receptor WSX-1, Zcytor1, T-cell and cytokine receptor type 1.

[0310] As used herein, the term IL27RA includes variants, isoforms, homologs, orthologs, and paralogs of IL27RA. In some embodiments, the antibodies disclosed herein cross-react with IL27RA from species other than human, e.g., cynomolgus monkey IL27RA, as well as different forms of IL27RA. In some embodiments, the antibodies may be fully specific for human IL27RA and may not exhibit species cross-reactivity (e.g., do not bind to mouse IL27RA) or other types of cross-reactivity. As used herein, the term IL27RA refers to naturally occurring human IL27RA, unless the context indicates otherwise. Thus, "IL27RA antibody," "anti-IL27RA antibody," or other similar designation refers to any antibody (as defined herein) that binds to or reacts with IL27RA, its isoforms, fragments, or derivatives. The full-length mature form of IL27RA, designated by UniProtKB / Swiss-Prot accession number Q6UWB1, is provided herein as SEQ ID NO: 41. The full-length mature form of mouse IL27RA, designated by UniProtKB / Swiss-Prot accession number O70394, is provided herein as SEQ ID NO: 44. The full-length mature form of cynomolgus monkey IL27RA, designated by UniProtKB / Swiss-Prot accession number A0A2K5WKA4, is provided herein as SEQ ID NO: 42.

[0311] Without wishing to be limited by any particular theory, binding of the antibody to the IL27R subunit IL27RA, without engagement of the gp130 subunit of IL27R, acts to antagonize the IL27 receptor.

[0312] The "biological function" or "biological activity" of IL27RA refers to modifying inflammation and modifying regulatory functions in innate immunity and T cells. The biological function or activity of IL27RA may, but need not, be mediated by the interaction between IL27 and its ligand.

[0313] In some embodiments, anti-IL27RA antibodies of the present disclosure include antibodies that either i) compete with an antibody having a heavy chain variable region amino acid sequence set forth as SEQ ID NO: 31 and a light chain variable region amino acid sequence set forth as SEQ ID NO: 32 for binding to human IL27RA, or ii) bind to the same epitope as such an antibody, or both.

[0314] Anti-IL27RA antibodies of the present disclosure may include monoclonal antibodies, polyclonal antibodies, antibody fragments (e.g., Fab, Fab', F(ab')2, Fv, Fc, etc.), chimeric antibodies, bispecific antibodies, heteroconjugate antibodies, single-chain (ScFv), variants thereof, fusion proteins comprising antibody fragments (e.g., domain antibodies), humanized antibodies, and any other modified configuration of an immunoglobulin molecule comprising an antigen-binding site of the required specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies. The antibodies may be murine, rat, human, or any other origin (including chimeric or humanized antibodies). In some embodiments, the anti-IL27RA antibody is a monoclonal antibody. In some embodiments, the anti-IL27RA antibody is a human or humanized antibody. In some embodiments, the anti-IL27RA antibody is a chimeric antibody.

[0315] In some embodiments, the invention provides antibodies having the light chain variable region (VL) and heavy chain variable region (VH) sequences found in Table 13, or variants thereof.

[0316] The present invention also provides CDR portions of antibodies against IL27RA. Determining CDR regions is well within the skill of one in the art. It is understood that in some embodiments, a CDR may be a combination of a Kabat CDR and a Chothia CDR (also referred to as a "combined CDR" or "extended CDR"). In another approach, referred to herein as "conformational definition" of a CDR, CDR positions may be identified as residues that contribute enthalpic-wise to antigen binding. See, e.g., Makabe et al., 2008, Journal of Biological Chemistry, 283:1156-1166. Generally, "conformational CDRs" include residue positions in the Kabat CDRs and Vernier zones that are constrained to maintain the appropriate loop structure for an antibody to bind to a specific antigen. Determining conformational CDRs is well within the skill of one in the art. In some embodiments, the CDR is a Kabat CDR. In other embodiments, the CDR is a Chothia CDR. In other embodiments, the CDRs are extended, AbM, conformational, or contact CDRs. In other words, in embodiments using more than one CDR, the CDRs may be any of Kabat, Chothia, extended, AbM, conformational, contact CDRs, or a combination thereof.

[0317] In some embodiments, the antibody comprises the three CDRs of any one of the heavy chain variable regions shown in Table 13. In some embodiments, the antibody comprises the three CDRs of any one of the light chain variable regions shown in Table 13. In some embodiments, the antibody comprises the three CDRs of any one of the heavy chain variable regions shown in Table 13 and the three CDRs of any one of the light chain variable regions shown in Table 13.

[0318] In some embodiments, the antibody comprises three light chain CDRs and three heavy chain CDRs from Table 13.

[0319] In some embodiments, the antibody comprises one or both of i) the full-length heavy chain with or without the C-terminal lysine, or ii) the full-length light chain of an anti-IL27RA antibody, anti-Il27RA-4701 or anti-Il27RA 4880 EE. The amino acid sequences of the full-length heavy and light chains for the antibodies are shown in Table 13 below.

[0320] Table 13 also provides the heavy and light chain sequences for the mAbs of the invention.

[0321] In some embodiments, the antibody may comprise a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 7 and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 8.

[0322] In some embodiments, the antibody may comprise a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising a CDR-H1 sequence according to SEQ ID NO: 1; a CDR-H2 sequence according to SEQ ID NO: 2; a CDR-H3 sequence according to SEQ ID NO: 3, and comprising a CDR-L1 sequence according to SEQ ID NO: 4; a CDR-L2 sequence according to SEQ ID NO: 5, and a CDR-L3 sequence according to SEQ ID NO: 6.

[0323] In some embodiments, the antibody comprises an IL27RA-VH sequence encoded by the nucleic acid sequence of SEQ ID NO:31 and an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO:32.

[0324] In some embodiments, the antibody comprises an IL27RA-VH framework sequence derived from a human germline VH sequence selected from the group consisting of DP7, DP10, DP35, DP47, DP50, DP51, DP54, and DP77. In some embodiments, the IL27RA-VH framework sequence may be derived from a human germline DP54 sequence.

[0325] In some embodiments, the antibody comprises an IL27RA-VL framework sequence derived from a human germline VL sequence selected from the group consisting of DPK1, DPK3, DPK4, DPK5, DPK7, DPK8, and DPK9. In some embodiments, the antibody comprises an IL27RA-VL framework sequence that can be derived from a human germline DPK9 sequence.

[0326] In some embodiments, the IL27RA-VL and IL27RA-VH framework sequences may contain one or more amino acid substitutions, additions, or deletions, while still retaining functional and structural similarity to the germline sequences from which they are derived. In some embodiments, one or both of the IL27RA-VL and IL27RA-VH framework sequences may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the human germline sequences from which they are derived. In some embodiments, one or both of the IL27RA-VL or IL27RA-VH framework sequences may be identical to the human germline sequences from which they are derived.

[0327] In some embodiments, the IL27RA-VH sequence may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7 and comprises an IL27RA-VL sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:8.

[0328] In some embodiments, the IL27RA antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 27. In some embodiments, the IL27RA antibody comprises a light chain having the amino acid sequence of SEQ ID NO: 14.

[0329] In some embodiments, an IL27RA antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO: 13 and a light chain having the amino acid sequence of SEQ ID NO: 14. In some embodiments, an IL27RA antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO: 27 and a light chain having the amino acid sequence of SEQ ID NO: 14.

[0330] Antibodies to gp130 The present disclosure provides antibodies that bind to glycoprotein 130 (gp130), also known as interleukin-6 receptor subunit beta, CD130, and interleukin-6 cytokine family signaling factor.

[0331] As used herein, the term gp130 includes variants, isoforms, homologs, orthologs, and paralogs of gp130. In some embodiments, the antibodies disclosed herein cross-react with gp130 from species other than human, e.g., cynomolgus monkey gp130, as well as different forms of gp130. In some embodiments, the antibodies may be completely specific for human gp130 and may not exhibit species cross-reactivity (e.g., do not bind to mouse gp130) or other types of cross-reactivity. As used herein, the term gp130 refers to naturally occurring human gp130, unless the context indicates otherwise. Thus, a "gp130 antibody," "anti-gp130 antibody," or other similar designation refers to any antibody (as defined herein) that binds to or reacts with gp130, its isoforms, fragments, or derivatives. The full-length mature form of gp130, designated by UniProtKB / Swiss-Prot accession number P40189, is provided herein as SEQ ID NO: 45. The full-length mature form of mouse gp130, designated by UniProtKB / Swiss-Prot accession number Q00560, is provided herein as SEQ ID NO: 48. The full-length mature form of cynomolgus monkey gp130, designated by Gene ID number 3572, is provided herein as SEQ ID NO: 46.

[0332] The biological function or activity of IL27RA may, but need not, be mediated by the interaction between gp130 and its ligand.

[0333] In some embodiments, the anti-gp130 antibodies of the present disclosure include antibodies that either i) compete for binding to human gp130 with an antibody having the amino acid sequence of the heavy chain variable region set forth as SEQ ID NO: 20 and the amino acid sequence of the light chain variable region set forth as SEQ ID NO: 21, or ii) bind to the same epitope as such an antibody.

[0334] Anti-gp130 antibodies of the present disclosure may include monoclonal antibodies, polyclonal antibodies, antibody fragments (e.g., Fab, Fab', F(ab')2, Fv, Fc, etc.), chimeric antibodies, bispecific antibodies, heteroconjugate antibodies, single-chain (ScFv), variants thereof, fusion proteins comprising antibody fragments (e.g., domain antibodies), humanized antibodies, and any other modified configuration of an immunoglobulin molecule comprising an antigen-binding site of the required specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies. The antibodies may be murine, rat, human, or of any other origin (including chimeric or humanized antibodies). In some embodiments, the anti-gp130 antibody is a monoclonal antibody. In some embodiments, the anti-gp130 antibody is a human or humanized antibody. In some embodiments, the anti-gp130 antibody is a chimeric antibody.

[0335] In some embodiments, the invention provides antibodies having the light chain variable region (VL) and heavy chain variable region (VH) sequences found in Table 13, or variants thereof.

[0336] The present invention also provides CDR portions of antibodies against gp130. Determining CDR regions is well within the skill of one in the art. It is understood that in some embodiments, a CDR may be a combination of a Kabat CDR and a Chothia CDR (also referred to as a "combined CDR" or "extended CDR"). In another approach, referred to herein as "conformational definition" of a CDR, CDR positions may be identified as residues that contribute enthalpic-wise to antigen binding. See, e.g., Makabe et al., 2008, Journal of Biological Chemistry, 283:1156-1166. Generally, "conformational CDRs" include residue positions in the Kabat CDRs and Vernier zones that are constrained to maintain the appropriate loop structure for an antibody to bind to a specific antigen. Determining conformational CDRs is well within the skill of one in the art. In some embodiments, the CDR is a Kabat CDR. In other embodiments, the CDR is a Chothia CDR. In other embodiments, the CDRs are extended, AbM, conformational, or contact CDRs. In other words, in embodiments using more than one CDR, the CDRs may be any of Kabat, Chothia, extended, AbM, conformational, contact CDRs, or a combination thereof.

[0337] In some embodiments, the antibody comprises the three CDRs of any one of the heavy chain variable regions shown in Table 13. In some embodiments, the antibody comprises the three CDRs of any one of the light chain variable regions shown in Table 13. In some embodiments, the antibody comprises the three CDRs of any one of the heavy chain variable regions shown in Table 13 and the three CDRs of any one of the light chain variable regions shown in Table 13.

[0338] Table 13 provides examples of CDR sequences for the anti-gp130 antibodies provided herein. In some embodiments, the antibody comprises three light chain CDRs and three heavy chain CDRs from Table 13.

[0339] In some embodiments, the antibody comprises one or both of i) the full-length heavy chain with or without the C-terminal lysine, or ii) the full-length light chain of the anti-gp130 antibody anti-gp130 4574 or anti-gp130-4875 RR. The amino acid sequences of the full-length heavy and light chains for the antibody anti-gp130 4574 or anti-gp130-4875 RR are shown in Table 13 below.

[0340] In some embodiments, an antibody that specifically binds to glycoprotein 130 (gp130) comprises a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL) comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 21 and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 22.

[0341] In some embodiments, the antibody comprises a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL) comprising a CDR-H1 sequence according to SEQ ID NO: 15; a CDR-H2 sequence according to SEQ ID NO: 16; a CDR-H3 sequence according to SEQ ID NO: 17, and comprising a CDR-L1 sequence according to SEQ ID NO: 18; a CDR-L2 sequence according to SEQ ID NO: 19; and a CDR-L3 sequence according to SEQ ID NO: 20.

[0342] In some embodiments, the antibody comprises a gp130-VH framework sequence derived from a human germline VH sequence selected from the group consisting of DP7, DP10, DP35, DP47, DP50, DP51, DP54, and DP77, hi some embodiments, the antibody comprises a gp130-VH framework sequence derived from a human germline DP10 sequence.

[0343] In some embodiments, the antibody comprises an IL27RA-VL framework sequence derived from a human germline VL sequence selected from the group consisting of DPK1, DPK3, DPK4, DPK5, DPK7, DPK8, and DPK9, hi some embodiments, the antibody comprises a gp130-VL framework sequence derived from a human germline DPK9 sequence.

[0344] In some embodiments, the gp130-VL and gp130-VH framework sequences may contain one or more amino acid substitutions, additions, or deletions while still retaining functional and structural similarity to the germline sequences from which they are derived. In some embodiments, one or both of the gp130-VL and IL27RA-VH framework sequences may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the human germline sequences from which they are derived. In some embodiments, one or both of the gp130-VL and gp130-VH framework sequences may be identical to the human germline sequences from which they are derived.

[0345] In some embodiments, the antibody comprises a gp130-VH sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:21 and a gp130-VL sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:22.

[0346] In some embodiments, the antibody comprises the gp130-VH sequence of SEQ ID NO:21 and the gp130-VL sequence of SEQ ID NO:22.

[0347] In some embodiments, the antibody comprises a gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 35. In some embodiments, the antibody comprises a gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 36. In some embodiments, the antibody comprises a gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 35 and a gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 36.

[0348] In some embodiments, the antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO:23 or SEQ ID NO:30.45. In some embodiments, the antibody comprises a light chain having the amino acid sequence of SEQ ID NO:24. In some embodiments, the antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO:23 and a light chain having the amino acid sequence of SEQ ID NO:24. In some embodiments, the antibody comprises a heavy chain having the amino acid sequence of SEQ ID NO:30 and a light chain having the amino acid sequence of SEQ ID NO:24.

[0349] Antibodies against IL27RA and gp130 IL-27 has been implicated as playing an important role in autoimmune inflammatory diseases, and receptor agonism provides a means by which pathogenic immune responses associated with autoimmune inflammatory diseases can be downregulated. Thus, without wishing to be limited by any particular theory, the bispecific IL27RA / gp130 antibody disclosed herein, such as the antibody defined in the Examples as mAb-4894, acts as an agonist for IL27R and binds to the IL27 receptor subunits IL27RA and gp130, inducing immunomodulatory effects. Examples of immunomodulatory effects of the bispecific IL27RA / gp130 antibody include attenuating intestinal inflammation and promoting intestinal barrier integrity.

[0350] IL-27 acts through a heterodimeric receptor composed of the IL27RA and gp130 chains, which mediates signal transduction through signal transducer and activator of transcription (STAT) 1 and STAT 3. Thus, bispecific antibodies disclosed herein that bind to both IL27RA and gp130 are capable of binding to both subunits of the IL27RA / gp130 heterodimer and induce phosphorylation of STAT 1 and 3 signaling in a manner similar to the native IL27R ligand IL27, as shown in Example 8.

[0351] Without wishing to be limited by any particular theory, the immunosuppressive effects of the IL27RA / gp130 antibody may be due to multiple actions of the antibody resulting from activation of the IL27 receptor, examples of which are provided below.

[0352] The IL27RA / gp130 antibody can reduce Th17 and Th2 responses, such that the antibody downregulates GATA-3 and IL-13 expression during Th2 cell differentiation and downregulates IL-17A expression during Th17 cell differentiation, as shown in Example 9. CD4+ helper T cells play a variety of important roles in the development and maintenance of various autoimmune diseases, including IBD. Based on the differentially secreted cytokine panel that subsequently mediates unique cellular activities, CD4+ helper T cells can be characterized into distinct subtypes: Th1, Th2, and Th17 cells.

[0353] As shown in Example 8, the IL27RA / gp130 antibody can upregulate IDO1 expression in CD14+ monocyte cytoplasm and human colonocytes, thereby providing immunoprotective and immunosuppressive effects. IDO1 is a cytosolic enzyme with a heme (Fe2+) prosthetic group that catalyzes tryptophan (Trp) catabolism, converting it to kynurenine (Kyn). The IDO1 pathway was originally described as an innate immune mechanism that defends host organisms against infection. Elevated levels of IDO1 strongly inhibit the proliferation and apoptosis of effector T cells, and accumulating Trp metabolites induce the differentiation of Tregs, which collectively produce immunosuppression. The immunoprotective and immunosuppressive roles of IDO1 and Trp metabolites are tightly controlled by the stoichiometry of available local factors. The effects resulting from these local activities modulate IDO1 expression, helping to maintain global immune homeostasis and peripheral immune tolerance.

[0354] The IL27RA / gp130 antibody can induce PD-L1 expression, as shown in Example 8. PD-L1 (CD274) is the dominant inhibitory ligand for PD-1 (also known as programmed cell death protein 1, CD279). Engagement of PD-1 by PD-L1 alters T cell activity in many ways, including inhibition of T cell proliferation, survival, cytokine production, and other effector functions.

[0355] The IL27RA / gp130 antibody can upregulate IL-10 gene expression and LAG3 expression, which deliver negative immunoregulatory signals upon T cell activation. Regulatory T (Treg) cells are important for maintaining peripheral tolerance, preventing autoimmune diseases, and limiting chronic inflammatory diseases. There are two types of Tregs: natural Tregs (nTregs) and inducible Tregs (iTregs). Compared with control antibodies, the IL27RA / gp130 antibody induced more CD4+CD25+FOXP3+iTregs from naive CD4+T cells, upregulated the LAG3+ population, upregulated Tim-3 expression levels, and increased the Tim-3+ cell population.

[0356] The IL27RA / gp130 antibody could induce inhibitory effects on allogeneic T cell proliferation mediated by three types of DCs: immature DCs, immunogenic DCs, and tolerogenic DCs, whereby the IL27RA / gp130 antibody significantly down-regulated cell surface CD83 expression and up-regulated ILT4 expression.

[0357] In one embodiment, the IL27RA / gp130 antibody induces an anti-inflammatory response. In one embodiment, the IL27RA / gp130 antibody does not induce a pro-inflammatory response. In one embodiment, the gp130 antibody does not induce IFN-gamma expression from Th1 cells.

[0358] The gp130 subunit is widely distributed and present on other gp130-containing receptors, such as the interleukin-6 receptor (IL-6R), interleukin-11 receptor (IL-11R), oncostatin M receptor (OSMR), and LIF receptor subunit alpha (LIFR), leaving the possibility of off-target effects associated with binding to non-target gp130 subunit-containing receptors.

[0359] Thus, in one embodiment, as shown in Example 6, the binding affinity of the two arms of an IL27RA / gp130 antibody is tailored so that the antibody has higher affinity for the IL27RA subunit compared to the more widely distributed gp130 subunit. This differential affinity allows for sufficient potency for agonist activity at IL27R while minimizing binding to other gp130-containing receptors. In some embodiments, the IL27RA / gp130 antibody has at least a 10-fold higher binding affinity for IL27RA than gp130, as measured by SPR. In some embodiments, the IL27RA / gp130 antibody has at least a 100-fold higher binding affinity for IL27RA than gp130, as measured by SPR. In some embodiments, the IL27RA / gp130 antibody has at least a 1000-fold higher binding affinity for IL27RA than gp130, as measured by SPR. In some embodiments, the IL27RA / gp130 antibody binds to human IL27RA with an affinity of less than 1 nM as measured by SPR. In some embodiments, the IL27RA / gp130 antibody binds to human gp130 with an affinity of less than 1000 nM as measured by SPR. In some embodiments, the IL27RA / gp130 antibody binds to human IL27RA with an affinity of between 0.01 nM and 5 nM, between 0.05 nM and 1 nM, or between 0.1 nM and 1 nM, and binds to human gp130 with an affinity of between 10 nM and 1000 nM, between 50 nM and 1000 nM, between 100 nM and 1000 nM, between 10 nM and 500 nM, or between 10 nM and 250 nM, as measured by SPR. In some embodiments, an IL27RA / gp130 antibody binds to human IL27RA with an affinity between 0.1 nM and 5 nM and binds to human gp130 with an affinity between 50 nM and 1000 nM as measured by SPR. In some embodiments, an IL27RA / gp130 antibody binds to human IL27RA with an affinity between 0.1 nM and 1 nM and binds to human gp130 with an affinity between 100 nM and 500 nM as measured by SPR.

[0360] The present disclosure provides antibodies that bind to IL27RA and gp130. As used herein, the terms IL27RA and gp130 include variants, isoforms, homologs, orthologs, and paralogs of IL27RA and gp130, respectively. In some embodiments, the antibodies disclosed herein cross-react with one or more of IL27RA and gp130 from species other than human, such as cynomolgus monkey IL27RA and gp130. In some embodiments, the antibodies may be completely specific for IL27RA and gp130 and may not exhibit species cross-reactivity or other types of cross-reactivity. As used herein, the terms TL1A and gp130 refer to naturally occurring human IL27RA and gp130, unless the context indicates otherwise. By "IL27RA / gp130 antibody," "anti-IL27RA / gp130 antibody," or other similar designation is meant any antibody (as defined herein) that binds to or reacts with IL27RA and gp130, its isoforms, fragments, or derivatives.

[0361] In some embodiments, the invention provides an IL27RA / gp130 antibody having a light chain variable region (VL) sequence and a heavy chain variable region (VH) sequence found in Tables 13 or 14, or a variant thereof.

[0362] The present invention also provides CDR portions of IL27RA / gp130 antibodies. The CDR regions are defined. In some embodiments, an IL27RA / gp130 antibody comprises three CDRs of an IL27RA antibody in Table 13 and three CDRs of a gp130 antibody in Tables 13 or 14.

[0363] In some embodiments, the disclosure provides anti-IL27RA / gp130 antibodies containing variations of the CDR, VH, VL, HC and LC regions set forth in Tables 13 and 14, such variant polypeptides sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with any of the amino acid sequences disclosed in one or more of Tables 13 and 14. These amounts are not meant to be limiting, and increments between the recited percentages are specifically contemplated as part of this disclosure.

[0364] In certain embodiments, the antibodies described herein comprise an Fc domain. The Fc domain may be derived from IgA (e.g., IgA1 or IgA2), IgG, IgE, or IgG (e.g., IgG1, IgG2, IgG3, or IgG4). In some embodiments, the anti-IL27RA antibody is an IgG2 antibody. In some embodiments, the anti-IL27RA antibody is an IgG1 antibody.

[0365] The present invention encompasses modifications to the variable regions, CDRs, and heavy and light chain sequences shown in Tables 13 or 14. For example, the present invention includes antibodies containing functionally equivalent variable regions and CDRs that do not significantly affect their properties, as well as variants with enhanced or decreased activity or affinity. For example, the amino acid sequence can be mutated to obtain an antibody with the desired binding affinity for IL27RA and gp130. Modification of polypeptides is routine practice in the art and need not be described in detail herein. Examples of modified polypeptides include conservative substitutions of amino acid residues, polypeptides with one or more deletions or additions of amino acids that do not significantly adversely alter functional activity or that mature (increase) the affinity of the polypeptide for its ligand, or the use of chemical analogs.

[0366] Modifications or variations may also be made in the framework or constant regions to increase the half-life of the antibodies provided herein. See, for example, PCT Publication No. WO 00 / 09560. Variations in the framework or constant regions may also be made to alter the immunogenicity of the antibody, to provide sites for covalent or non-covalent binding to another molecule, or to alter properties such as complement binding, FcR binding, and antibody-dependent cell-mediated cytotoxicity. In some embodiments, no more than one to five conservative amino acid substitutions are made in the framework or constant regions. In other embodiments, no more than one to three conservative amino acid substitutions are made in the framework or constant regions. According to the present invention, a single antibody may have variations in any one or more of the CDRs or framework regions of the variable domain or in the constant region.

[0367] In some embodiments, the antibody comprises a modified constant region that has increased or decreased binding affinity to human Fc gamma receptors, is immunologically inactive or partially inactive, for example, does not induce complement-mediated lysis, does not stimulate antibody-dependent cell-mediated cytotoxicity (ADCC), or does not activate microglia; or has reduced activity (compared to the unmodified antibody) in any one or more of the following: induce complement-mediated lysis, stimulate ADCC, or activate microglia. Different modifications of the constant region can be used to achieve an optimal level or combination of effector functions. See, e.g., Morgan et al., Immunology 86:319-324, 1995; Lund et al., J. Immunology 157:4963-9 157:4963-4969, 1996; Idusogie et al., J. Immunology 164:4178-4184, 2000; Tao et al., J. Immunology 143:2595-2601, 1989; and Jefferis et al., Immunological Reviews 163:59-76, 1998. In some embodiments, the constant region is modified as described in Eur. J. Immunol., 1999, 29:2613-2624; PCT Publication No. WO 99 / 058572.

[0368] In some embodiments, the antibody may comprise amino acid modifications at one or more of positions L234, L235 and G237 (according to EU numbering) or L247, L248 and G250 (according to Kabat numbering) in human isotype IgG1.

[0369] In some embodiments, the antibody may comprise amino acid modifications at positions L234, L235, and G237 (according to EU numbering) or L247, L248, and G250 (according to Kabat numbering) in human IgG1.

[0370] In some embodiments, the antibody may include one or more of the following amino acid modifications in human IgG1: L234A, L235A, and G237A (according to EU numbering) or L247A, L248A, and G250A (according to Kabat numbering).

[0371] In some embodiments, the antibody may include one or more of the following amino acid modifications in human IgG2: L234A, L235A, and G237A (according to EU numbering) or L247A, L248A, and G250A (according to Kabat numbering).

[0372] In some embodiments, the antibody may include one or more of the following amino acid modifications in human IgG3: L234A, L235A, and G237A (according to EU numbering) or L247A, L248A, and G250A (according to Kabat numbering).

[0373] In some embodiments, the antibody may include one or more of the following amino acid modifications in human IgG4: L234A, L235A, and G237A (according to EU numbering) or L247A, L248A, and G250A (according to Kabat numbering).

[0374] Modifications also include glycosylated and non-glycosylated polypeptides, as well as polypeptides with other post-translational modifications, such as glycosylation with different sugars, acetylation, and phosphorylation. Antibodies are glycosylated at conserved positions in their constant regions (Jefferis and Lund, 1997, Chem. Immunol. 65:111-128; Wright and Morrison, 1997, TibTECH 15:26-32). The oligosaccharide side chains of immunoglobulins affect protein function (Boyd et al., 1996, Mol. Immunol. 32:1311-1318; Wittwe and Howard, 1990, Biochem. 29:4175-4180) and intramolecular interactions between glycoprotein moieties, which can affect the glycoprotein's conformation and presented three-dimensional surface (Jefferis and Lund, supra; Wyss and Wagner, 1996, Current Opin. Biotech. 7:409-416). Oligosaccharides can also function to target a given glycoprotein to a specific molecule based on specific recognition structures. Glycosylation of antibodies has also been reported to affect antibody-dependent cellular cytotoxicity (ADCC). In particular, antibodies produced in CHO cells using tetracycline-regulated expression of β(1,4)-N-acetylglucosaminyltransferase III (GnTIII), a glycosyltransferase that catalyzes the formation of bisected GlcNAc, have been reported to have improved ADCC activity (Umana et al., 1999, Nature Biotech. 17:176-180).

[0375] In some embodiments, the disclosure provides anti-antibodies containing variations of the variable region, CDR, or heavy and light chain sequences set forth in Table 13, such variant polypeptides sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with any of the amino acid sequences disclosed in Table 13. These amounts are not meant to be limiting, and increments between the recited percentages are specifically contemplated as part of the present disclosure.

[0376] The present invention also encompasses fusion proteins comprising one or more components of the antibodies disclosed herein. In some embodiments, fusion proteins can be produced comprising all or a portion of an antibody of the present invention linked to another polypeptide. In another embodiment, only the variable domain of the antibody is linked to the polypeptide. In another embodiment, the VH domain of the antibody is linked to a first polypeptide, while the VL domain of the antibody is linked to a second polypeptide that associates with the first polypeptide in such a manner that the VH and VL domains can interact with each other to form an antigen-binding site. In another embodiment, the VH domain is separated from the VL domain by a linker so that the VH and VL domains can interact with each other. The VH-linker-VL antibody is then linked to a polypeptide of interest. Furthermore, fusion antibodies can be created in which two (or more) single-chain antibodies are linked to each other. This is useful when it is desired to create a bivalent or multivalent antibody on a single polypeptide chain, or when it is desired to create a bispecific antibody.

[0377] In addition to binding epitopes on IL27RA and gp130, the anti-IL27RA / gp130 antibodies of the present disclosure can mediate biological activities, as shown in the Examples for the bispecific anti-IL27RA / gp130 antibody mAb-4894.

[0378] That is, the present disclosure includes isolated antibodies that specifically bind to IL27RA and gp130 and mediate at least one detectable activity selected from the following: i) Down-regulates pathogenic cytokine production. In some embodiments, an anti-IL27RA / gp130 antibody down-regulates pathogenic cytokine production by reducing interleukin-17 production in helper T cells, e.g., type 17 (Th17), which can be measured by immunoassay and described in Example 9. Thus, in some embodiments, an anti-IL27RA / gp130 antibody has an IC50 of less than 0.05 nM as measured by 11-17 immunoassay. In some embodiments, an anti-IL27RA / gp130 antibody has an IC50 of less than 0.01 nM as measured by 11-17 immunoassay. In some embodiments, the anti-IL27RA / gp130 antibody has an IC50 of between 1 nM and 0.0001 nM, between 1 nM and 0.01 nM, between 0.1 nM and 0.0001 nM, between 0.1 nM and 0.001 nM, between 0.01 nM and 0.0001 nM, or between 0.01 nM and 0.001 nM as measured by 11-17 immunoassay. In some embodiments, the anti-IL27RA / gp130 antibody has an IC50 of between 0.01 nM and 0.001 nM as measured by 11-17 immunoassay. In some embodiments, the anti-IL27RA / gp130 antibody may downregulate pathogenic cytokine production by inhibiting T helper type 2 (Th2) responses, for example, by reducing interleukin-13 (IL-13) production and GATA-3 expression; ii) Promoting regulatory T cell differentiation, e.g., promoting differentiation of natural Tregs (nTregs) and inducible Tregs (iTregs), as shown in Example 8. In some embodiments, iTregs are characterized by expression of CD4+CD25+FOXP3+. iii) upregulating the expression of immune checkpoint molecules, such as Tim-3, LAG-3, and IL-10. In some embodiments, the expression of IL-10, Tim-3, and LAG-3 can be determined at both the transcriptional and protein levels, for example, by flow cytometry, as demonstrated in Example 9. iv) inhibiting T-cell proliferation; v) induce programmed death-ligand 1 (PD-L1) expression in monocytes, which can be measured by flow cytometry and is described in Example 8; and vi) upregulates indoleamine-pyrrole 2,3-dioxygenase enzyme (IDO1) expression in colonocytes and / or monocytes, which can be measured by determining the production of kynurenine (Kyn), which reflects IDO1 activity, by liquid chromatography-mass spectrometry (LC-MS) assay, as described in Example 8. Thus, in some embodiments, an anti-IL27RA / gp130 antibody has an EC50 of less than 100 nM by LC-MS assay of kynurenine production. In some embodiments, an anti-IL27RA / gp130 antibody has an EC50 of less than 10 nM by LC-MS assay of kynurenine production. In some embodiments, an anti-IL27RA / gp130 antibody has an EC50 of between 100 nM and 0.1 nM, between 100 nM and 1 nM, between 10 nM and 0.1 nM, or between 10 nM and 1 nM by LC-MS assay of kynurenine production. In some embodiments, the anti-IL27RA / gp130 antibody has an EC50 of between 10 nM and 1 nM as determined by an LC-MS assay of kynurenine production.

[0379] Thus, bispecific antibodies disclosed herein, such as the antibody defined in the Examples as mAb-4894, have the potential to downregulate pathogenic T helper 17 cells (Th17) while upregulating cell surface markers associated with regulatory T cells (Tregs), more specifically, two subpopulations: natural Tregs (nTregs) and inducible Tregs (iTregs). Furthermore, targeting both IL27RA and gp130 allows for the reduction of type 2 cytokines and upregulates negative regulators of monocytes and dendritic cells. Bispecific IL27R agonists have a direct effect on human primary colonocytes, as evidenced by the upregulation of the indoleamine-pyrrole 2,3-dioxygenase enzyme (IDO1), known to be associated with immunosuppression and mucosal healing.

[0380] In some embodiments, the bispecific antibody comprises a first antigen-binding site that binds IL27RA and a second antigen-binding site that binds gp130, wherein the first antigen-binding site comprises a VH and a VL and the second antigen-binding site comprises a VH and a VL; a. the first antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 3; and b. The first antigen-binding site VL comprises: (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO:4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO:5; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO:6. Either or both of the following may be true:

[0381] In some embodiments, the bispecific antibody comprises a first antigen-binding site that binds IL27RA and a second antigen-binding site that binds gp130, wherein the first antigen-binding site comprises a VH and a VL and the second antigen-binding site comprises a VH and a VL; a. the second antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 17; and b. The second antigen-binding site, VL, comprises: (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 20. Either or both of the following may be true:

[0382] In some embodiments, the bispecific antibody comprises a first antigen-binding site that binds IL27RA and a second antigen-binding site that binds gp130, wherein the first antigen-binding site comprises a VH and a VL and the second antigen-binding site comprises a VH and a VL; a. the first antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 3; b. the first antigen-binding site VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO:4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO:5; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO:6; c. the second antigen-binding site, VH, comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 17; d. The second antigen-binding site, VL, comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 20.

[0383] In some embodiments, the bispecific antibody comprises a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, and comprises the first antigen-binding site VH comprising the amino acid sequence of SEQ ID NO: 7, the first antigen-binding site VL comprising the amino acid sequence of SEQ ID NO: 8, the second antigen-binding site VH comprising the amino acid sequence of SEQ ID NO: 21, and the second antigen-binding site VL comprising the amino acid sequence of SEQ ID NO: 22.

[0384] In some embodiments, the bispecific antibody comprises a first heavy chain and a first light chain and a second heavy chain and a second light chain, wherein the first heavy chain and the first light chain comprise a first antigen-binding site that binds to IL27RA, and the second heavy chain and the second light chain comprise a second antigen-binding site that binds to gp130, wherein the first antibody heavy chain comprises the amino acid sequence of SEQ ID NO:27, the first antibody light chain comprises the amino acid sequence of SEQ ID NO:14, the second antibody heavy chain comprises the amino acid sequence of SEQ ID NO:30, and the second antibody light chain comprises the amino acid sequence of SEQ ID NO:34.

[0385] Polynucleotides encoding the antibodies of the present invention The present disclosure also provides polynucleotides encoding any of the antibodies of the present invention, including the antibody portions and modified antibodies described herein. The present invention also provides methods of making any of the antibodies and polynucleotides described herein. Polynucleotides can be made and proteins expressed by procedures known in the art.

[0386] If desired, the antibody of interest (monoclonal or polyclonal) can be sequenced, and then the polynucleotide sequence can be cloned into a vector for expression or propagation.The sequence encoding the antibody of interest can be maintained in a vector in a host cell, and then the host cell can be expanded and frozen for further use.The production of recombinant monoclonal antibodies in cell culture can be carried out by cloning antibody genes from B cells by means known in the art.See, for example, Tiller et al., 2008, J.Immunol.Methods 329, 112; U.S. Patent No. 7,314,622.

[0387] In some embodiments, the present invention provides a polynucleotide comprising a sequence encoding one or both of the heavy chain or light chain variable regions of the antibody provided herein.The sequence encoding the antibody of interest can be maintained in a vector in a host cell, and the host cell can then be expanded and frozen for further use.Vectors (including expression vectors) and host cells are further described herein.

[0388] In some embodiments, the disclosure provides a polynucleotide encoding the amino acid sequence of any of the antibodies listed in Tables 13 or 14.

[0389] In one embodiment, the invention provides polynucleotides encoding the amino acid sequence of an anti-IL27RA antibody.

[0390] In some embodiments, the disclosure provides polynucleotides encoding one or more anti-IL27RA antibody heavy chain polypeptides comprising an amino acid sequence selected from SEQ ID NO: 13 or 27. In some embodiments, the disclosure provides polynucleotides encoding one or more anti-IL27RA antibody light chain polypeptides comprising the amino acid sequence of SEQ ID NO: 14.

[0391] In some embodiments, the disclosure provides polynucleotides encoding one or more anti-IL27RA antibody VH polypeptides comprising the amino acid sequence of SEQ ID NO: 7. In some embodiments, the disclosure provides polynucleotides encoding one or more anti-IL27RA antibody VL polypeptides comprising the amino acid sequence of SEQ ID NO: 8.

[0392] In some embodiments, the present disclosure provides polynucleotides encoding one or more anti-gp130 antibody heavy chain polypeptides comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 23 or 30. In some embodiments, the present disclosure provides polynucleotides encoding one or more anti-gp130 antibody light chain polypeptides comprising the amino acid sequence of SEQ ID NO: 24. In some embodiments, the present disclosure provides polynucleotides encoding one or more anti-gp130 antibody VH polypeptides comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, the present disclosure provides polynucleotides encoding one or more anti-gp130 antibody VL polypeptides comprising the amino acid sequence of SEQ ID NO: 21.

[0393] In some embodiments, a polynucleotide encoding an anti-IL27RA antibody HC comprises the nucleic acid sequence of SEQ ID NO: 33. In some embodiments, a polynucleotide encoding an anti-IL27RA antibody LC polypeptide comprises the nucleic acid sequence of SEQ ID NO: 34. In some embodiments, the present disclosure provides a polynucleotide encoding an anti-IL27RA antibody HC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 33 and a polynucleotide encoding an anti-IL27RA antibody LC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 34.

[0394] In some embodiments, a polynucleotide encoding an anti-IL27RA antibody HC comprises the nucleic acid sequence of SEQ ID NO: 39. In some embodiments, a polynucleotide encoding an anti-IL27RA antibody LC polypeptide comprises the nucleic acid sequence of SEQ ID NO: 34. In some embodiments, the present disclosure provides a polynucleotide encoding an anti-IL27RA antibody HC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 39 and a polynucleotide encoding an anti-IL27RA antibody LC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 34.

[0395] In some embodiments, a polynucleotide encoding an anti-gp130 antibody HC comprises the nucleic acid sequence of SEQ ID NO: 37. In some embodiments, a polynucleotide encoding an anti-gp130 antibody LC polypeptide comprises the nucleic acid sequence of SEQ ID NO: 38. In some embodiments, the present disclosure provides a polynucleotide encoding an anti-gp130 antibody HC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 37 and a polynucleotide encoding an anti-gp130 antibody LC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 38.

[0396] In some embodiments, a polynucleotide encoding an anti-gp130 antibody HC comprises the nucleic acid sequence of SEQ ID NO: 40. In some embodiments, a polynucleotide encoding an anti-gp130 antibody LC polypeptide comprises the nucleic acid sequence of SEQ ID NO: 38. In some embodiments, the present disclosure provides a polynucleotide encoding an anti-gp130 antibody HC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 40 and a polynucleotide encoding an anti-gp130 antibody LC polypeptide comprising the nucleic acid sequence of SEQ ID NO: 38.

[0397] In some embodiments, the present disclosure provides a polynucleotide encoding the heavy chain, the light chain, or both of an antibody that binds to gp130, comprising the nucleic acid sequence of SEQ ID NO: 37, the nucleic acid sequence of SEQ ID NO: 38, or both. In some embodiments, the present disclosure provides a polynucleotide encoding the heavy chain, the light chain, or both of an antibody that binds to gp130, comprising the nucleic acid sequence of SEQ ID NO: 40, the nucleic acid sequence of SEQ ID NO: 38, or both.

[0398] It will be understood by those skilled in the art that, due to the degeneracy of the genetic code, there are many nucleotide sequences encoding the polypeptides described herein. Some of these polynucleotides bear minimal homology to the nucleotide sequence of any native gene. Nevertheless, polynucleotides that vary due to differences in codon usage are specifically contemplated by the present invention. Furthermore, alleles of genes comprising the polynucleotide sequences provided herein are within the scope of the present invention. An allele is an endogenous gene that has been altered as a result of one or more mutations, such as deletions, additions, or substitutions of nucleotides. The resulting mRNA and protein may, but need not, have altered structure or function. Alleles can be identified using standard techniques (e.g., hybridization, amplification, or database sequence comparison).

[0399] In one embodiment, the VH and VL domains or the full-length HC or LC are encoded by separate polynucleotides, or alternatively, both the VH and VL, or both the HC and LC, are encoded by a single polynucleotide.

[0400] Polynucleotides complementary to any such sequences are also encompassed by the present disclosure. Polynucleotides can be single-stranded (coding or antisense) or double-stranded, and can be DNA (genomic, cDNA, or synthetic) or RNA molecules. RNA molecules include HnRNA molecules, which contain introns and correspond one-to-one to DNA molecules, and mRNA molecules, which do not contain introns. Additional coding or non-coding sequences can be, but need not be, present within the polynucleotides of the present disclosure, and polynucleotides can be, but need not be, linked to other molecules or support materials.

[0401] Manufacturing method A variety of techniques have been described for the production of antibodies, including traditional hybridoma methods for making monoclonal antibodies, recombinant techniques for making antibodies (including chimeric antibodies, e.g., humanized antibodies), antibody production in transgenic animals, and the recently described phage display technology for preparing "fully human" antibodies.

[0402] Methods for producing any of the antibodies provided herein are provided herein. The antibodies of the present invention can be produced by procedures known in the art. Polypeptides can be produced by proteolytic or other degradation of the antibody, by recombinant methods (i.e., single or fusion polypeptides), or by chemical synthesis. Antibody polypeptides, particularly shorter polypeptides up to about 50 amino acids, are conveniently produced by chemical synthesis. Methods for chemical synthesis are known in the art and commercially available. For example, antibodies can be produced by automated polypeptide synthesizers using solid-phase methods. See also U.S. Patent Nos. 5,807,715; 4,816,567; and 6,331,415.

[0403] Any suitable method for preparing multispecific antibodies can be used to prepare the multispecific antibodies provided herein (e.g., depending on the antibody characteristics and choice of components).

[0404] According to one approach to generating multispecific antibodies, antibody variable domains with the desired binding specificities are fused to immunoglobulin constant region sequences. Fusions are preferably with immunoglobulin heavy chain constant regions, including at least part of the hinge, CH2, and CH3 regions. In some embodiments, the first heavy chain constant region (CH1), containing the site for light chain binding, may be present in at least one of the fusions. In some embodiments, polynucleotides encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, may be inserted into separate expression vectors and co-transfected into a suitable host organism. In other embodiments, the coding sequences for two or all three polypeptide chains may be inserted into a single expression vector, where expression of at least two polypeptide chains in equal ratios results in high yields, or where the ratio is not particularly important.

[0405] In one approach, multispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. This asymmetric structure, with immunoglobulin light chains in only half of the multispecific molecule, facilitates separation of the desired multispecific compound from undesired immunoglobulin chain combinations. This approach is described in PCT Publication No. WO 94 / 04690.

[0406] In another approach, a multispecific antibody is constructed with amino acid modifications in a first hinge region in one arm, where the substituted amino acid in the first hinge region has an opposite charge to the corresponding amino acid in a second hinge region in another arm. This approach is described in International Patent Application No. PCT / US2011 / 036419 (WO2011 / 143545).

[0407] In another approach, the formation of desired heteromultimeric or heterodimeric proteins (e.g., bispecific antibodies) is enhanced by altering or manipulating the interface between a first Fc chain and a second Fc chain. In this approach, the multispecific antibody can be composed of a CH3 region, which includes a first CH3 polypeptide and a second CH3 polypeptide that interact together to form a CH3 interface, and one or more amino acids within the CH3 interface destabilize homodimer formation and are not electrostatically unfavorable for homodimer formation. This approach is described in International Patent Application No. PCT / US2011 / 036419 (WO2011 / 143545). In some embodiments, one constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region of human IgG1 (e.g., (D221E or D221R)) and position 409 in the CH3 region (e.g., K409R (EU numbering scheme)), and the other constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region of human IgG1 (e.g., (D221E or D221R)) and position 368 in the CH3 region (e.g., L368E (EU numbering scheme)). In some embodiments, one constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region of human IgG2 (e.g., (D221E or D221R)) and position 409 in the CH3 region (e.g., K409R (EU numbering scheme)), and the other constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region of human IgG2 (e.g., (D221E or D221R)) and position 368 in the CH3 region (e.g., L368E (EU numbering scheme)). In some embodiments, one constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region (e.g., (D221E or D221R)) and position 409 in the CH3 region (e.g., K409R (EU numbering scheme)) of human IgG4, and the other constant region of the bispecific antibody may comprise an amino acid modification at position 221 in the hinge region (e.g., (D221E or D221R)) and position 368 in the CH3 region (e.g., L368E (EU numbering scheme)) of human IgG4.

[0408] In some embodiments, multispecific antibodies may have knobs-in-hole mutations in the Fc chain. For example, in some embodiments, in a bispecific antibody with knobs-in-hole mutations, a first Fc chain of the antibody Fc domain has one or more mutations that form the "knob" and a second Fc chain of the antibody Fc domain has one or more mutations that form the "hole" (or vice versa). Exemplary knobs-in-hole engineering of antibodies is described in U.S. Pat. No. 5,731,168, PCT Publication No. WO2009089004, U.S. Patent Application Publication No. 20090182127, Marvin and Zhu, Acta Pharmacologica Sincia (2005) 26(6):649-658, and Kontermann (2005) Acta Pharacol. Sin., 26:1-9.

[0409] The term "knob" refers to at least one amino acid side chain that protrudes from the interface of a first polypeptide (e.g., a first Fc chain) and can therefore be positioned in a compensatory hole in an adjacent second polypeptide (e.g., a second Fc chain) to stabilize heterodimers and thereby favor heterodimer formation over homodimer formation. The knob can be present in the original interface or can be synthetically introduced (e.g., by modifying the nucleic acid encoding the interface). Typically, the nucleic acid encoding the interface of the first polypeptide is modified to encode the knob. To achieve this, the nucleic acid encoding at least one original amino acid residue in the first polypeptide is replaced with a nucleic acid encoding at least one "import" amino acid residue having a side chain volume larger than that of the original amino acid residue. Certain import residues for forming the knob are generally naturally occurring amino acid residues, preferably selected from arginine (R), phenylalanine (F), tyrosine (Y), and tryptophan (W).

[0410] A "hole" refers to at least one amino acid side chain that is recessed from the interface of a second polypeptide (e.g., a second constant domain) and thus accommodates a corresponding knob in an adjacent first polypeptide (e.g., a first constant domain). The hole can be present in the original interface or can be synthetically introduced (e.g., by modifying the nucleic acid encoding the interface). Typically, the nucleic acid encoding the interface of the second polypeptide is modified to encode the hole. To achieve this, the nucleic acid encoding at least one original amino acid residue of the second polypeptide is replaced with DNA encoding at least one "import" amino acid residue having a smaller side chain volume than the original amino acid residue. The specific import residue for forming the hole is usually a naturally occurring amino acid residue, preferably selected from alanine (A), serine (S), threonine (T), and valine (V).

[0411] The term "interface," as used herein, typically refers to any amino acid residue present in a domain that may be involved in contact between a first polypeptide and a second polypeptide. An "original amino acid" residue is a residue that is replaced by an "import amino acid" residue, which may have a smaller or larger side chain volume than the original residue. The import amino acid residue may be a naturally occurring or non-naturally occurring amino acid residue, preferably the former. A "naturally occurring" amino acid residue is a residue encoded by the genetic code. A "non-naturally occurring" amino acid residue refers to a residue that is not encoded by the genetic code but can be covalently bound to adjacent amino acid residue(s) in a polypeptide chain. Examples of non-naturally occurring amino acid residues include norleucine, ornithine, norvaline, homoserine, and other amino acid residue analogs, such as those described in Ellman et al., Meth. Enzym. 202:301-336 (1991).

[0412] The polynucleotide of the present invention can be obtained by chemical synthesis, recombinant method or PCR.The method of chemical polynucleotide synthesis is well known in the art and does not need to be described in detail herein.Those skilled in the art can use the sequence provided herein and commercially available DNA synthesizers to produce desired DNA sequence.

[0413] As discussed further herein, to prepare a polynucleotide using recombinant methods, a polynucleotide containing a desired sequence can be inserted into an appropriate vector, and the vector can then be introduced into a suitable host cell for replication and amplification. The polynucleotide can be inserted into the host cell by any means known in the art. Cells are transformed by introducing an exogenous polynucleotide by direct uptake, endocytosis, transfection, F-mating, or electroporation. Once introduced, the exogenous polynucleotide can be maintained in the cell as a non-integrated vector (e.g., a plasmid) or can be integrated into the host cell genome.

[0414] Suitable cloning vectors can be constructed according to standard techniques or selected from a large number of cloning vectors available in the art. While the cloning vector selected can vary according to the host cell intended for use, useful cloning vectors generally possess one or more features, such as i) the ability to replicate autonomously, ii) a single target for a specific restriction endonuclease, or iii) a marker gene that can be used to select clones containing the vector. Suitable examples include plasmids and bacterial viruses, such as pUC18, pUC19, Bluescript (e.g., pBS SK+) and its derivatives, mp18, mp19, pBR322, pMB9, ColE1, pCR1, RP4, phage DNA, and shuttle vectors, such as pSA3 and pAT28. These and many other cloning vectors are available from commercial suppliers, such as BioRad, Strategene, and Invitrogen.

[0415] Further provided is an expression vector. An expression vector is generally a replicable polynucleotide construct containing a polynucleotide according to the present invention. It is implied that an expression vector must be replicable in a host cell, either as an episome or as an integrated part of chromosomal DNA. Suitable expression vectors include, but are not limited to, plasmids, viral vectors, including adenoviruses, adeno-associated viruses, retroviruses, cosmids, and expression vectors disclosed in PCT Publication No. WO87 / 04462. Vector components may generally include, but are not limited to, one or more of the following: a signal sequence; an origin of replication; one or more marker genes; and appropriate transcription control elements (e.g., promoters, enhancers, and terminators). For expression (i.e., translation), one or more translation control elements, such as a ribosome binding site, a translation initiation site, and a stop codon, are also usually required.

[0416] A vector containing a polynucleotide of interest can be introduced into a host cell by any of several suitable means, including electroporation, transfection using calcium chloride, rubidium chloride, calcium phosphate, DEAE-dextran, or other substances; particle bombardment; lipofection; and infection (e.g., where the vector is an infectious agent, such as vaccinia virus). The choice of introducing a vector or polynucleotide often depends on the characteristics of the host cell.

[0417] The present invention also provides host cells containing any of the polynucleotides described herein. Any host cell capable of overexpressing heterologous DNA can be used to isolate genes encoding antibodies, polypeptides, or proteins of interest. Non-limiting examples of mammalian host cells include, but are not limited to, COS, HeLa, and CHO cells. See also PCT Publication No. WO 87 / 04462. Suitable non-mammalian host cells include prokaryotes (e.g., E. coli or B. subtilis) and yeast (e.g., S. cerevisiae, S. pombe, or K. lactis).

[0418] Additionally, any number of commercially available and non-commercially available cell lines that express polypeptides or proteins can be utilized in accordance with the present invention. Those skilled in the art will understand that different cell lines may have different nutritional requirements or require different culture conditions for optimal growth and polypeptide or protein expression, and will be able to modify the conditions as needed.

[0419] Pharmaceutical Composition In another embodiment, the present invention comprises a pharmaceutical composition.

[0420] A "pharmaceutical composition" refers to a mixture of an antibody of the invention and one or more excipients.

[0421] The pharmaceutical compositions of the present invention can be in a variety of forms. These include, for example, liquid, semi-solid, and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, and lyophilized powders. The form depends on the intended mode of administration and therapeutic application.

[0422] Other excipients and modes of administration known in the pharmaceutical field can also be used.The pharmaceutical composition of the present invention can be prepared by any well-known technique in pharmacy, for example, by effective formulation and administration procedures.The above considerations regarding effective formulation and administration procedures are well known in the art and are described in standard textbooks.Drug formulation is discussed, for example, in Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania, 1975; Liberman et al., eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Kibbe et al., eds., Handbook of Pharmaceutical Excipients (3rd Edition), American Pharmaceutical Association, Washington, 1999.

[0423] Acceptable excipients are nontoxic to recipients at the dosages and concentrations employed and include buffers, e.g., phosphate, citric acid, and other organic acids; salts, e.g., sodium chloride; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl, or benzyl alcohol; alkyl parabens, e.g., methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, For example, it may include serum albumin, gelatin, or immunoglobulin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); or non-ionic surfactants such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG).

[0424] Therapeutic, Diagnostic and Other Methods The antibodies and antibody conjugates of the present invention are useful in a variety of applications, including, but not limited to, therapeutic and diagnostic treatment methods.

[0425] In some embodiments, antibodies of the present invention may agonize or modulate the activity of the IL27 receptor and may be useful in the treatment, prevention, suppression, and amelioration of inflammatory diseases, such as IBD, or diseases, disorders, and conditions mediated by IL27. In another embodiment, antibodies of the present invention may agonize or modulate the activity of the IL27 receptor and may be useful in the treatment, prevention, suppression, and amelioration of multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, or cancer.

[0426] In one aspect, the present invention provides methods for treating inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, or cancer. In one aspect, the present invention provides methods for treating inflammatory bowel disease (IBD). In some embodiments, a method of treating inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, or cancer in a subject comprises administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising any of the antibodies described herein. In some embodiments, a method of treating IBD in a subject is provided, comprising administering to a subject in need thereof an effective amount of a composition comprising an antibody provided herein.

[0427] In another aspect, the present invention further provides an antibody or pharmaceutical composition described herein for use in the described methods of treating inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic disease, obesity, type 2 diabetes, or cancer. In another aspect, the present invention further provides an antibody or pharmaceutical composition described herein for use in the described methods of treating an autoimmune disease. In another aspect, the present invention further provides an antibody or pharmaceutical composition described herein for use in the described methods of treating inflammatory bowel disease (IBD). In another aspect, the present invention further provides an antibody or pharmaceutical composition described herein for use in the described methods of treating ulcerative colitis or Crohn's disease. In another aspect, the present invention further provides an antibody or pharmaceutical composition described herein for use in the described methods of treating ulcerative colitis. The invention also provides the use of an antibody described herein in the manufacture of a medicament for treating inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, an allergic disease, obesity, type 2 diabetes, or cancer.

[0428] In another aspect, one or more methods are provided for detecting, diagnosing, or monitoring inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic disease, obesity, type 2 diabetes, or cancer.For example, the antibodies described herein can be labeled with detectable moieties, such as imaging agents and enzyme-substrate labels.The antibodies described herein can be used for in vivo diagnostic assays, for example, in vivo imaging (e.g., PET or SPECT), or staining reagents.

[0429] For all methods described herein, reference to an antibody also includes a pharmaceutical composition comprising the antibody and one or more additional agents.

[0430] Administration and Dosage Typically, the antibodies of the invention are administered in an amount effective to treat the conditions described herein. The antibodies of the invention can be administered as the antibodies themselves, or alternatively, as pharmaceutical compositions containing the antibodies.

[0431] The antibodies of the present invention are administered by any suitable route in the form of a pharmaceutical composition adapted to such route, and in a dose effective for the intended treatment.

[0432] In some embodiments, the antibody may be administered parenterally, for example, directly into the bloodstream, muscle, or internal organs. Suitable means for parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular, and subcutaneous. In some embodiments, the antibody may be administered subcutaneously. Suitable devices for parenteral administration include needle (including microneedle) injectors, needle-free injectors, and infusion techniques.

[0433] In another embodiment, the compounds of the present invention may also be administered topically to the skin or mucosa, i.e., dermally or transdermally. In another embodiment, the compounds of the present invention may also be administered intranasally or by inhalation. In another embodiment, the compounds of the present invention may also be administered rectally or vaginally. In another embodiment, the compounds of the present invention may also be administered directly to the eye or ear.

[0434] Dosing regimens for antibodies of the invention or compositions containing the antibodies are based on a variety of factors, including the type, age, weight, sex, and medical condition of the subject; the severity of the condition; the route of administration; and the activity of the particular antibody used. Thus, dosing regimens can vary widely. In one embodiment, the total daily dose of an antibody of the invention is typically about 0.01 to about 100 mg / kg (i.e., mg of antibody of the invention per kg of body weight) for treatment of the indicated conditions discussed herein. In another embodiment, the total daily dose of an antibody of the invention is about 0.1 to about 50 mg / kg, and in another embodiment, about 0.5 to about 30 mg / kg.

[0435] The antibodies of the present invention can be used alone or in combination with one or more other therapeutic agents. The present invention provides any of the uses, methods, or compositions defined herein in which the antibodies of the present invention are used in combination with one or more other therapeutic agents discussed herein.

[0436] The administration of two or more drugs in " combination " means that all drugs are administered close enough in time to affect the treatment of the subject.Two or more drugs can be administered simultaneously or sequentially.Furthermore, simultaneous administration can be carried out by mixing the drugs before administration, or by administering the drugs as separate dosage forms at the same time but at the same or different administration sites.

[0437] Various formulations of the antibodies of the present invention (e.g., one or more of anti-IL27RA, gp130, and anti-IL27A / gp130 antibodies) can be used for administration. In some embodiments, the antibody can be administered neat. In some embodiments, the antibody and pharmaceutically acceptable excipients can be in various formulations. Pharmaceutically acceptable excipients are known in the art and are relatively inert substances that facilitate the administration of pharmacologically active substances. For example, excipients can provide form or consistency or act as diluents. Suitable excipients include, but are not limited to, stabilizers, wetting and emulsifying agents, salts for varying osmolality, encapsulating agents, buffers, and skin penetration enhancers. Excipients and formulations for parenteral and nonparenteral drug delivery are set forth in Remington, The Science and Practice of Pharmacy, 21st Edition, Mack Publishing, 2005.

[0438] In some embodiments, these agents are formulated for administration by injection (e.g., intraperitoneally, intravenously, subcutaneously, intramuscularly, etc.). Thus, these agents may be combined with a pharmaceutically acceptable vehicle, such as saline, Ringer's solution, dextrose solution, etc. The particular dosing regimen, i.e., dosage, timing, and repetition, will depend on the particular individual and their medical history.

[0439] The antibodies described herein (e.g., one or more of anti-IL27RA, gp130, and anti-IL27A / gp130 antibodies) can be administered using any suitable method, including by injection (e.g., intraperitoneally, intravenously, subcutaneously, intramuscularly, etc.). Antibodies, e.g., monoclonal or multispecific antibodies, can also be administered via inhalation, as described herein. Generally, for administration of the antibodies of the present invention, the dosage will depend on the host treated and the particular mode of administration. In one embodiment, the dose range of the antibodies of the present invention is from about 0.001 μg / kg body weight to about 20,000 μg / kg body weight. The term "body weight" is applicable when a patient is being treated. When isolated cells are being treated, "body weight," as used herein, refers to "total cell body weight." The term "total body weight" can be used to apply to the treatment of both isolated cells and patients. All concentrations and treatment levels are expressed in this application as "body weight" or simply "kg" and are also considered to cover similar "total cell weight" and "total body weight" concentrations. However, one of ordinary skill in the art will recognize the utility of various dosage ranges, e.g., 0.01 μg / kg body weight to 20,000 μg / kg body weight, 0.02 μg / kg body weight to 15,000 μg / kg body weight, 0.03 μg / kg body weight to 10,000 μg / kg body weight, 0.04 μg / kg body weight to 5,000 μg / kg body weight, 0.05 μg / kg body weight to 2,500 μg / kg body weight, 0.06 μg / kg body weight to 1,000 μg / kg body weight, 0.07 μg / kg body weight to 500 μg / kg body weight, 0.08 μg / kg body weight to 400 μg / kg body weight, 0.09 μg / kg body weight to 200 μg / kg body weight, or 0.1 μg / kg body weight to 100 μg / kg body weight.Additionally, one of skill in the art would be able to administer a variety of different dosage levels, e.g., 0.0001 μg / kg, 0.0002 μg / kg, 0.0003 μg / kg, 0.0004 μg / kg, 0.005 μg / kg, 0.0007 μg / kg, 0.001 μg / kg, 0.1 μg / kg, 1.0 μg / kg, 1.5 μg / kg, 2.0 μg / kg, 5.0 μg / kg, 10.0 μg / kg, 15.0 μg / kg, 30.0 μg / kg, 50 μg / kg, 75 μg / kg, 80 μg / kg, 90 μg / kg, 100 μg / kg, 120 μg / kg, 140 μg / kg, 150 μg / kg, 160 μg / kg, 170 μg / kg, 180 μg / kg, 190 μg / kg, 210 μg / kg, 220 μg / kg, 230 μg / kg, 240 μg / kg, 250 μg / kg, 260 μg / kg, 270 μg / kg, 280 μg / kg, 290 μg / kg, 300 μg / kg, 310 μg / kg, 320 μg / kg, 330 μg / kg, 340 μg / kg, 350 μg / kg, 360 μg / kg, 370 μg / kg, 380 μg / kg, 390 μg / kg, 400 μg / kg, 410 μg / kg, 420 μg / kg, 430 μg / kg, 440 μg / kg, 450 μg / kg, It is recognized that one or more of the following may be used: 1 μg / kg, 180 μg / kg, 200 μg / kg, 225 μg / kg, 250 μg / kg, 275 μg / kg, 300 μg / kg, 325 μg / kg, 350 μg / kg, 375 μg / kg, 400 μg / kg, 450 μg / kg, 500 μg / kg, 550 μg / kg, 600 μg / kg, 700 μg / kg, 750 μg / kg, 800 μg / kg, 900 μg / kg, 1 μg / kg, 5 μg / kg, 10 μg / kg, 12 μg / kg, 15 mg / kg, 20 mg / kg, and 30 mg / kg. All of these dosages are exemplary, and any dosage between these points is also expected to be of use in the present invention. Any of the above dosage ranges or dosage levels can be used for the antibodies of the present invention. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until a desired suppression of symptoms occurs or sufficient therapeutic levels are achieved.

[0440] Generally, for administration of the antibodies provided herein, the candidate dosage may be administered daily, weekly, every 2 weeks, every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 10 weeks, every 12 weeks or more than every 12 weeks.

[0441] In some embodiments, the candidate dosage is administered daily at a dosage ranging from about 1 μg / kg, up to 30 μg / kg, up to 300 μg / kg, up to 3 mg / kg, up to 30 mg / kg, up to 100 mg / kg or more, depending on the factors mentioned above. For example, daily dosages of about 0.01 mg / kg, about 0.03 mg / kg, about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg and about 25 mg / kg can be used.

[0442] In some embodiments, the candidate dosage is administered weekly at a dosage ranging from about 1 μg / kg, up to 30 μg / kg, up to 300 μg / kg, up to 3 mg / kg, up to 30 mg / kg, up to 100 mg / kg or more, depending on the factors mentioned above. For example, weekly dosages of about 0.01 mg / kg, about 0.03 mg / kg, about 0.1 mg / kg, about 0.3 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 25 mg / kg and about 30 mg / kg can be used.

[0443] In some embodiments, the candidate dosage is administered every two weeks at a dosage ranging from about 1 μg / kg, up to 30 μg / kg, up to 300 μg / kg, up to 3 mg / kg, up to 30 mg / kg, up to 100 mg / kg or more, depending on the factors mentioned above. For example, biweekly dosages of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 25 mg / kg and about 30 mg / kg can be used.

[0444] In some embodiments, the candidate dosage is administered every three weeks at a dosage ranging from about 1 μg / kg, up to 30 μg / kg, up to 300 μg / kg, up to 3 mg / kg, up to 30 mg / kg, up to 100 mg / kg or more, depending on the factors mentioned above. For example, three-weekly dosages of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg and about 50 mg / kg can be used.

[0445] In some embodiments, the candidate dosage is administered monthly or every four weeks at a dosage ranging from about 1 μg / kg, up to 30 μg / kg, up to 300 μg / kg, up to 3 mg / kg, up to 30 mg / kg, up to 100 mg / kg or more, depending on the factors mentioned above. For example, monthly dosages of about 0.1 mg / kg, about 0.3 mg / kg, about 1 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg and about 50 mg / kg can be used.

[0446] In other embodiments, the candidate dosage is administered daily at a dosage ranging from about 0.01 mg to about 1200 mg or more, depending on the factors mentioned above. For example, a daily dosage of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, or about 1200 mg may be used. In one embodiment, a daily dosage between 0.01 mg and 100 mg may be used. In one embodiment, a daily dosage between 0.01 mg and 1 mg may be used. In one embodiment, a daily dosage between 0.1 mg and 100 mg may be used. In one embodiment, a daily dosage between 1 mg and 100 mg may be used.

[0447] In other embodiments, the candidate dosage is administered weekly at a dosage ranging from about 0.01 mg to about 2000 mg or more, depending on the factors mentioned above. For example, a weekly dosage of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, about 1600 mg, about 1700 mg, about 1800 mg, about 1900 mg, or about 2000 mg may be used. In one embodiment, a weekly dosage between 0.01 mg and 0.1 mg may be used. In one embodiment, a weekly dosage of between 0.01 mg and 100 mg may be used. In one embodiment, a weekly dosage of between 0.01 mg and 1 mg may be used. In one embodiment, a weekly dosage of between 0.1 mg and 100 mg may be used. In one embodiment, a weekly dosage of between 1 mg and 100 mg may be used.

[0448] In other embodiments, the candidate dosage is administered every two weeks at a dosage ranging from about 0.01 mg to about 2000 mg or more, depending on the factors mentioned above. For example, a biweekly dosage of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, about 1600 mg, about 1700 mg, about 1800 mg, about 1900 mg, or about 2000 mg may be used. In one embodiment, a biweekly dosage of between 0.01 mg and 0.1 mg may be used. In one embodiment, a biweekly dosage of between 0.01 mg and 100 mg may be used. In one embodiment, a biweekly dosage of between 0.01 mg and 1 mg may be used. In one embodiment, a biweekly dosage of between 0.1 mg and 100 mg may be used. In one embodiment, a biweekly dosage of between 1 mg and 100 mg may be used.

[0449] In another embodiment, the candidate dosage is administered every three weeks at dosages ranging from about 0.01 mg to about 2500 mg or more, depending on the factors mentioned above. For example, a triweekly dosage of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, about 1600 mg, about 1700 mg, about 1800 mg, about 1900 mg, about 2000 mg, about 2100 mg, about 2200 mg, about 2300 mg, about 2400 mg, or about 2500 mg may be used. In one embodiment, a triweekly dosage of between 0.01 mg and 0.1 mg may be used. In one embodiment, a dosage of between 0.01 mg and 100 mg every three weeks may be used. In one embodiment, a dosage of between 0.01 mg and 1 mg every three weeks may be used. In one embodiment, a dosage of between 0.1 mg and 100 mg every three weeks may be used. In one embodiment, a dosage of between 1 mg and 100 mg every three weeks may be used.

[0450] In other embodiments, the candidate dosage is administered every four weeks or once a month at dosages ranging from about 0.01 mg to about 3000 mg or more, depending on the factors mentioned above. For example, a monthly dosage of about 0.01 mg, about 0.1 mg, about 1 mg, about 10 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, about 1000 mg, about 1100 mg, about 1200 mg, about 1300 mg, about 1400 mg, about 1500 mg, about 1600 mg, about 1700 mg, about 1800 mg, about 1900 mg, about 2000 mg, about 2100 mg, about 2200 mg, about 2300 mg, about 2400 mg, about 2500, about 2600 mg, about 2700 mg, about 2800 mg, about 2900 mg or about 3000 mg may be used. In one embodiment, a monthly dosage of between 0.01 mg and 0.1 mg may be used. In one embodiment, a monthly dosage of between 0.01 mg and 100 mg may be used. In one embodiment, a monthly dosage of between 0.01 mg and 1 mg may be used. In one embodiment, a monthly dosage of between 0.1 mg and 100 mg may be used. In one embodiment, a monthly dosage of between 1 mg and 100 mg may be used.

[0451] Other dosing regimens may also be useful, depending on the pattern of pharmacokinetic decay the practitioner wishes to achieve. In one embodiment, the antibody of the present invention is administered by an initial dose followed by higher and / or successive substantially constant doses. In some embodiments, dosing is contemplated 1-4 times per week. In other embodiments, dosing is contemplated once per month, or once every two or three months. The progress of this therapy is easily monitored by conventional techniques and assays. Dosing regimens may be varied over time.

[0452] For purposes of the present invention, the appropriate dosage of an antibody (e.g., one or more selected from the group consisting of anti-IL27RA, gp130, and anti-IL27A / gp130 antibodies) depends on the antibody or composition thereof used, the type and severity of the condition being treated, whether the agent is administered for therapeutic purposes, previous treatments, the patient's clinical history and response to the agent, the patient's clearance rate for the administered agent, and the judgment of the attending physician. Typically, a clinician will administer the antibody until a dosage is reached that achieves the desired result. Dosage and / or frequency may vary over the course of treatment. Empirical considerations, e.g., half-life, generally contribute to determining the dosage. For example, antibodies compatible with the human immune system, e.g., humanized or fully human antibodies, may be used to extend the half-life of the antibody and to prevent the antibody from being attacked by the host's immune system. The frequency of administration can be determined and adjusted over the course of treatment, but is generally, but not necessarily, based on the treatment and / or suppression and / or remission and / or delay of symptoms. Alternatively, a sustained continuous release formulation of the antibody may be appropriate. Various formulations and devices for achieving sustained release are known in the art.

[0453] In one embodiment, dosage for an antibody (e.g., one or more selected from the group consisting of anti-IL27RA, gp130, and anti-IL27A / gp130 antibodies) can be empirically determined in an individual given one or more administrations of the antibody. The individual is given increasing dosages of the antibody. Disease indicators can be followed to assess efficacy.

[0454] In some embodiments, the antibodies provided herein (e.g., one or more selected from the group consisting of anti-IL27RA, gp130, and anti-IL27A / gp130 antibodies) may be administered to a subject who has previously received one or more antibodies selected from the group consisting of anti-IL27RA, gp130, and anti-IL27A / gp130 antibody therapeutics for the treatment of a disease. In some embodiments, the antibodies provided herein may be administered to subjects who have previously received an antibody selected from the group consisting of anti-IL27RA, gp130, and anti-IL27A / gp130 antibody therapeutics for the treatment of a disease, as well as subjects in whom previous anti-IL27RA, gp130, and anti-IL27A / gp130 antibody therapeutics have had limited or no effectiveness in the subject (e.g., the subject's disease is resistant to treatment with the previous therapeutic agent).

[0455] Administration of antibodies according to the methods of the present invention can be continuous or intermittent, depending, for example, on the physiological condition of the recipient, whether the purpose of administration is therapeutic or prophylactic, and other factors known to those skilled in the art. Administration of antibodies can be essentially continuous over a preselected period of time, or in a series of spaced doses. Therapeutic formulations of antibodies used according to the present invention are prepared for storage in the form of lyophilized formulations or aqueous solutions by mixing antibodies having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients, or stabilizers (Remington, The Science and Practice of Pharmacy, 21st ed., Mack Publishing, 2005). Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and include, but are not limited to, buffers, e.g., phosphate, citric acid, and other organic acids; salts, e.g., sodium chloride; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl, or benzyl alcohol; alkyl parabens, e.g., methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins The carrier may include proteins such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG).

[0456] kit Another aspect of the present invention provides a kit comprising an antibody of the present invention or a pharmaceutical composition comprising the antibody. The kit may include a diagnostic or therapeutic agent in addition to the antibody or pharmaceutical composition of the present invention. The kit may also include instructions for use in a diagnostic or therapeutic method. In some embodiments, the kit includes the antibody or pharmaceutical composition thereof and a diagnostic agent. In other embodiments, the kit includes the antibody or pharmaceutical composition thereof and one or more therapeutic agents.

[0457] In yet another embodiment, the present invention includes a kit suitable for use in practicing the methods of treatment described herein. In one embodiment, the kit contains a first dosage form comprising one or more antibodies of the present invention in an amount sufficient to practice the method of the present invention. In another embodiment, the kit includes one or more antibodies of the present invention in an amount sufficient to practice the method of the present invention, and at least a first container for the first dosage and a second container for the second dosage.

[0458] A further aspect of the present invention is a kit comprising one or more selected from the group consisting of anti-IL27RA, anti-gp130 and anti-IL27RA / gp130 antibodies disclosed herein above and instructions for use in accordance with any of the methods of the invention described herein. Generally, these instructions will include instructions for the administration of one or more selected from the group consisting of anti-IL27RA, anti-gp130 and anti-IL27RA / gp130 antibodies for said therapeutic treatment.

[0459] A further aspect of the present invention is a kit comprising an anti-IL27RA / gp130 antibody as disclosed herein above and instructions for use according to any of the methods of the invention described herein.

[0460] The following examples of specific embodiments for carrying out the present invention are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way.

[0461] The above description and the following examples detail certain specific embodiments of the present disclosure and describe the best mode contemplated by the inventors. However, no matter how detailed the above appears in text, it will be understood that the present disclosure can be implemented in many ways and that the present disclosure should be construed in accordance with the appended claims and any equivalents thereof.

[0462] While the disclosed teachings have been described with respect to various applications, methods, kits, and compositions, it will be understood that various changes and modifications can be made without departing from the teachings herein and the following claimed disclosure. The following examples are provided to better illustrate the disclosed teachings and are not intended to limit the scope of the teachings set forth herein. While the present teachings have been described with respect to these exemplary embodiments, those skilled in the art will readily appreciate that numerous variations and modifications of these exemplary embodiments are possible without undue experimentation. All such variations and modifications are within the scope of the present teachings.

[0463] biological deposit Representative material of the present invention was deposited on December 17, 2021 at the American Type Culture Collection, 10801 University Boulevard, Manassas, VA 20110-2209, USA.

[0464] The vector "mAb-4894 IL267RA VH" having ATCC accession number PTA-127622 contains a DNA insert encoding "mAb-4894 IL267RA VH." The vector "mAb-4894 IL267RA VL" having ATCC accession number PTA-127623 contains a DNA insert encoding "mAb-4894 IL267RA VL." The vector "mAb-4894 IL267RA HC" having ATCC accession number PTA127626 contains a DNA insert encoding "mAb-4894 IL267RA HC." The vector "mAb-4894 IL267RA LC" having ATCC accession number PTA-127627 contains a DNA insert encoding "mAb-4894 IL267RA LC."

[0465] The vector "mAb-4894 gp130 VH," having ATCC accession number PTA-127624, contains a DNA insert encoding "mAb-4894 gp130 VH." The vector "mAb-4894 gp130 VL," having ATCC accession number PTA-127625, contains a DNA insert encoding "mAb-4894 gp130 VL." The vector "mAb-4894 gp130 HC," having ATCC accession number PTA127628, contains a DNA insert encoding "mAb-4894 gp130 HC." The vector "mAb-4894 gp130 LC," having ATCC accession number PTA-127629, contains a DNA insert encoding "mAb-4894 gp130 LC."

[0466] [Table 1]

[0467] The deposit was made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and Regulations thereunder (Budapest Treaty), which assures maintenance of viable cultures of the deposit for 30 years from the date of deposit. The deposit will be made available by ATCC under the terms of the Budapest Treaty, pursuant to an agreement between Pfizer Inc. and ATCC assuring perpetual and unlimited availability of the progeny of the cultures of the deposit to the public upon the issuance of the relevant U.S. patent or the public publication of any U.S. or foreign patent application, whichever occurs first, and compensating for the availability of the progeny to persons determined by the Director of the U.S. Patent and Trademark Office to be entitled pursuant to 35 U.S.C. Section 122 and the Director's regulations thereunder (including 37 CFR Section 1.14, which specifically pursuant to 886 OG 638).

[0468] The assignee of the present application has agreed that should cultures of the deposited material die when cultivated under appropriate conditions or be lost or destroyed, such material will be replaced without delay with identical material upon notice. The availability of the deposited material is not to be construed as a license to practice the invention in contravention of rights granted under the authority of any government pursuant to its patent laws.

[0469] The present disclosure provides a polynucleotide encoding IL27RA-VH encoded by a plasmid deposited with the ATCC having ATCC Accession No. PTA-127622.

[0470] The present disclosure provides a polynucleotide encoding IL27RA-VL encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127623.

[0471] The present disclosure provides polynucleotides encoding the IL27RA-VH sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127622, and the IL27RA-VL sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127623.

[0472] The present disclosure provides a polynucleotide encoding IL27RA-HC encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127626.

[0473] The present disclosure provides a polynucleotide encoding IL27RA-LC encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127627;

[0474] The present disclosure provides polynucleotides encoding the IL27RA-HC sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127626, and the IL27RA-LC sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127627.

[0475] The present disclosure provides a polynucleotide encoding gp130-VH encoded by the plasmid deposited with the ATCC having ATCC Accession No. PTA-127624.

[0476] The present disclosure provides a polynucleotide encoding gp130-VL encoded by the plasmid deposited with the ATCC having ATCC Accession No. PTA-127625.

[0477] The present disclosure provides polynucleotides encoding the gp130-VH sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127624, and the gp130-VL sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127625.

[0478] The present disclosure provides a polynucleotide encoding gp130-HC encoded by the plasmid deposited with the ATCC having ATCC Accession No. PTA-127628.

[0479] The present disclosure provides a polynucleotide encoding gp130-LC encoded by the plasmid deposited with the ATCC having ATCC Accession No. PTA-127629.

[0480] The present disclosure provides polynucleotides encoding the gp130-VH sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127628, and the gp130-LC sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127629.

[0481] The present disclosure provides an isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with the ATCC having ATCC Accession No. PTA-127622.

[0482] The present disclosure provides an isolated antibody that specifically binds to IL27RA, comprising a light chain variable region (IL27RA-VL) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127623.

[0483] The present disclosure provides an isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127622, and a light chain variable region (IL27RA-VL) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127623.

[0484] The present disclosure provides an isolated antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127626.

[0485] The present disclosure provides an isolated antibody that specifically binds to IL27RA, comprising a light chain (IL27RA-LC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127627.

[0486] The present disclosure provides an isolated antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127626, and a light chain (IL27RA-LC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127627.

[0487] The present disclosure provides an isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127624.

[0488] The present disclosure provides an isolated antibody that specifically binds to gp130, comprising a light chain variable region (gp130-VL) encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127625.

[0489] The present disclosure provides an isolated antibody that specifically binds to gp130, comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127624, and a light chain variable region (gp130-VL) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127625.

[0490] The present disclosure provides an isolated antibody that specifically binds to gp130, comprising a heavy chain (gp130-HC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127628.

[0491] The present disclosure provides an isolated antibody that specifically binds to gp130, comprising a light chain (gp130-LC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127629.

[0492] The present disclosure provides an isolated antibody that specifically binds to gp130, comprising a heavy chain (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127628, and a light chain (gp130-LC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127629.

[0493] The present disclosure provides an isolated antibody that specifically binds IL27RA and gp130, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127622, and a light chain variable region (IL27RA-VL) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127623, and further comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127624, and a light chain variable region (gp130-VL) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127625.

[0494] The present disclosure provides an isolated antibody that specifically binds IL27R and gp130, comprising a heavy chain (IL27RA-HC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127626, and a light chain (IL27RA-LC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127627, and further comprising a heavy chain (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127628, and a light chain (gp130-LC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127629. [Example]

[0495] In order that this invention may be better understood, the following examples are set forth. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention in any way.

[0496] Example 1 Generation of gp130 / IL27a / il27 recombinant proteins Generation of recombinant antigens for immunization and hybridoma screening Human gp130 and IL27RA receptor extracellular domain (ECD) complex-Fc fusions (huGP130_IL27RA knob and hole huFc) were generated by transfection of two expression plasmids: one encoding the hugp130 ECD fused to a human Fc with a knob mutation in its CH3 region (VEC-40821:CID1452-IgVHSS_huGP130_ECD_TEV_knobFc_2xST), and the other encoding the IL27RA ECD fused to a human Fc with a hole mutation in its CH3 region (VEC-40820:CID1451-IgVHSS_huIL27R_ECD_TEV_holeFc_Flag). The knob and hole mutations in the Fc region facilitate efficient formation of heterodimeric complexes between gp130 Fc fusion and IL27RA Fc fusion via knob and hole interactions within the respective Fc domains.

[0497] Expi293F™ cells (Gibco A14527) were propagated in expression medium (Gibco A14351) and unbaffled shake flasks at 36°C with 8.0% CO2 in a Kühner ISF1-X incubator, rotating at 120 RPM. One day before transfection, the cell culture was diluted to 1.6E6 / ml in unbaffled shake flasks or Sartorius Wave bags. If necessary, the cell culture was adjusted to 3.0E6 / ml on the day of transfection. Immediately prior to transfection, expression plasmid DNA (1.3 mg per liter of cell culture) and polyethyleneimine (2.6 mg per liter of cell culture, Polyscience, 24765) were separately diluted in OptiMEM (Gibco 31985-070) and then 0.2 μM filtered. After a 5-minute incubation at room temperature, the diluted reagents were combined and incubated for an additional 6 minutes at room temperature and then added to the cell culture. Two and a half hours after transfection, valproic acid (Sigma P4543) was added to a final concentration of 3 mM. One hundred and twenty hours after transfection, the cell culture was transferred to a sterile 1 L Nalgene bottle and centrifuged at 1-3,000 x g for 5-10 minutes. The clarified conditioned medium was filtered (Sartopore 2 XLG) to a depth of 0.8 / 0.2 μM and then further processed or stored frozen at -20°C.

[0498] The conditioned medium was batch-bound to Protein A resin (MabSelect SuRe, Cytiva) equilibrated and washed in Buffer A (PBS with 20 mM imidazole). Bound protein was eluted using Buffer B (150 mM glycine pH 3.5, 40 mM NaCl), which was immediately neutralized with 10% 1 M Tris-HCl pH 8.0. Elution fractions containing the protein of interest were pooled, concentrated using a 10K MWCO Amicon Ultra concentrator (Millipore), and applied to a HiLoad Superdex S200 16 / 60 pg column (Cytiva).

[0499] Furthermore, expression and purification of recombinant cyno huGP130_IL27RA knob and hole Fc proteins was performed in a similar manner.

[0500] Generation of recombinant IL27 ligand for activity assays For the ligand IL27, there are two subunits: p28 and Ebi3. Two forms of the ligand complex were generated: 1. Mono Fc format: IL27 huIL27p28_C107S_L212C_CH23LSFc_His6 / huEBI3_M99C_Flag shown in Figure 6 below

[0501] The IL27 p28 monoFc construct sequence is provided as SEQ ID NO:49 and the EBI3 construct sequence is provided as SEQ ID NO:50.

[0502] Expression was performed in a similar manner as described for antigen expression, with a similar purification process: CM was batch-bound to Protein A resin washed with 15 CV of buffer A (137 mM NaCl, 2.7 mM KCl, 8.1 mM NaHPO, 1.47 mM KHPO, 20 mM imidazole). The sample was eluted using a low pH buffer (buffer B: 150 mM glycine pH 3.5, 40 mM NaCl) and neutralized with buffer C (1 M Tris pH 8) at a V:V ratio (buffer to sample) of 1:10. Different fractions were then run on a gel, and those containing protein were pooled and concentrated using 10K MWCO Amicon Ultra 4 tubes. Final purification was performed at 4°C using a HiLoad Superdex column equilibrated with PBS + 1 M NaCl. The collected fractions were run on a gel, and those containing protein were pooled. Analytical SEC was performed on the final samples using equilibration buffers of either PBS or PBS with 1 M NaCl.

[0503] Heterodimeric knob and hole format: IL27_huIL27A_C107S_L212C_TEV_knobFc_His6 / huEBI3_M99C_Flag / Hole empty shown in Figure 7.

[0504] EBI3 provided as SEQ ID NO: 50. IL27 p28 Fc knob [knob mutations Y349C-T366W] provided as SEQ ID NO: 51. Fc hole (empty) [hole mutations S354C-T366S-L368A-Y407V] provided as SEQ ID NO: 52.

[0505] Expression was performed in a similar manner to that described for antigen expression, with a similar purification process: CM was batch-bound to Protein A resin washed with 15 CV of Buffer A (PBS). The sample was eluted using a low pH buffer (Buffer B, 150 mM glycine pH 3.5, 40 mM NaCl) and neutralized with Buffer C (1 M Tris pH 8) at a V:V ratio (buffer to sample) of 1:10. Different fractions were then run on a gel, and those containing the protein were pooled and concentrated using 10K MWCO Amicon Ultra 4 tubes. The protein was then batch-bound to anti-flag resin (10 ml) that had been washed with PBS. After overnight batch binding, the protein was eluted with low pH Buffer B and neutralized with Buffer C (V:V ratio (buffer to sample) of 1:10). The different fractions were then run on a gel, and those containing the protein were pooled and concentrated using a 10K MWCO Amicon Ultra 4 tube. Final purification was performed at 4°C using a HiLoad Superdex column equilibrated with PBS. The collected fractions were run on a gel, and those containing the protein were pooled and stored at -80°C.

[0506] Example 2 Derivation of IL27RA and gp130 binding domains via hybridoma approach Generation and isolation of monoclonal antibodies from humanized mice that bind to human and cyno gp130 AlivaMab κλ mice were immunized once a week with soluble hIL-27RA_gp130 knob and hole hFc protein combined with a mixture of TLR agonists as adjuvants according to the following schedule shown in Table 1 below:

[0507] [Table 2]

[0508] The TLR agonist mixture consisted of the following components:

[0509] [Table 3]

[0510] Proteins were combined with the indicated volume of TLR agonist cocktail (40 uL per mouse) and injected.

[0511] Immune sera were collected on day 28. These were screened in a protein ELISA format for binding to hIL-27RA_gp130 knob and hole hFc and control hFc-tagged proteins. Sera were also screened by flow cytometry for binding to HEK293 cells expressing the native IL-27RA / gp130 receptor and CHO cells expressing recombinant IL-27RA / gp130. Finally, sera were screened for IL-27RA / gp130 agonist activity in a pSTAT3 HTRF assay. The two mice with the best titers received an additional boost on day 56 and a final boost of 50 μg of immunogen without adjuvant on day 62. Four days later, the mice were euthanized, and their splenocytes and lymph node cells were fused with Sp2mIL6 mouse myeloma cells by electrofusion.

[0512] Hybridomas were screened in a protein ELISA format for binding to hIL-27RA_gp130 knob and hole hFc and control hFc-tagged proteins. They were also tested by flow cytometry for binding to CHO parental cells, CHO cells expressing only IL-27RA chains, CHO cells expressing only gp130, and CHO cells expressing the complete IL-27RA-gp130 receptor. High-priority hybridomas producing antibodies that used the kappa light chain and bound to CHO-gp130 and CHO IL-27RA_gp130 cells were identified as gp130-specific antibodies and subjected to VH-VL molecular cloning.

[0513] Briefly, cDNA was generated from purified RNA using SMARTer IIA oligonucleotides (Clontech) and oligo(dT)20. The cDNA was then amplified using RACE PCR. To amplify the heavy chain, oligo SMART 2ndF (GTGGTATCAACGCAGAGTACGCG) (SEQ ID NO: 55) was used as the forward primer, and GGGTGCCAGGGGGAAGACSGA (SEQ ID NO: 56), specific for mouse IgG, was used as the reverse primer. To amplify the kappa light chain, oligo SMART 2ndF (GTGGTATCAACGCAGAGTACGCG) (SEQ ID NO: 53) was also used as the forward primer, and the kappa-specific primer GAAGATGAAGACAGATGGTGCAGCCAC (SEQ ID NO: 54) was used as the reverse primer. The VH amplicon was then cloned into the pTT5-hIgG_EFN_EEE_Flag (SAPI, SMART) vector via infusion cloning, and the VL amplicon was cloned into the pTT5-hKappa (SAPI, SMART) vector. Thirteen unique paired sequences were identified and selected for further characterization (clones -2194, -2211, -2191, -2203, -2200, -2207, -2183, -2214, -2202, -2187, -2189, -2199, and -2201). Clone -2187, derived from hybridoma 13B10, provided the lead binding domain.

[0514] Isolation of a rat monoclonal antibody that binds to human and cynomolgus monkey IL27RA Sprague-Dawley rats were immunized with 12 IP injections of 20 μg of soluble hIL-27Rα_gp130 knob and hole hFc protein emulsified in Ribi adjuvant (Sigma S6322). The first nine immunizations were performed twice weekly; the remaining three immunizations were performed once weekly. Immune sera were screened for binding to HEK293 cells and HEK293 cells that had been deficient in native IL-27Rα / gp130 expression by CRISPR knockdown. These were also tested for agonist activity in the pSTAT3 HTRF assay. The rat with the best titer received a final boost of 20 μg of immunogen without adjuvant. Seven days later, the rats were euthanized, and their splenocytes were fused with P3X mouse myeloma cells by electrofusion.

[0515] Hybridomas were screened for binding to hIL-27RA_gp130 knob and whole hFc and control hFc-tagged proteins in a protein ELISA format, as well as for binding to HEK293 cells and HEK293 IL-27RA / gp130 CRISPR knockdown cells by flow cytometry. High-priority hybridomas were subjected to limiting dilution subcloning. Subclones were tested for binding to hIL-27RA_gp130 knob and whole hFc by ELISA, and for binding to CHO parental cells, CHO cells expressing only the IL-27RA chain, CHO cells expressing only gp130, and CHO cells expressing the complete IL-27RA-gp130 receptor by flow cytometry. Twenty-three hybridomas expressing antibodies specific for the IL-27RA chain were subjected to VH-VL molecular cloning. Clone -0917, derived from hybridoma 1C5_A6-10-7, provided the lead binding domain.

[0516] Screening antibody pairs to identify IL27RA / gp130 agonists Screening of antibodies against IL27RA or gp130 from hybridomas described in Example 2 failed to identify a single mAb capable of agonizing overexpressed IL-27RA / gp130 in CHO cells as measured by STAT3 phosphorylation. Therefore, a matrix of antibodies was tested in a bispecific format to identify agonists of the heterodimer.

[0517] A set of 87 anti-IL27RA antibodies representing 44 distinct CDR H3 families and 72 unique CDR H3-CDR L3 sequences and a mixture of IL-27 functional inhibitors and non-inhibitors was collected from hybridoma screening as described in Example 2 and from screening of a phage display library (data not shown). A set of 89 anti-gp130 antibodies representing 76 distinct CDR H3 families and 89 unique CDR H3-CDR L3 sequences and a mixture of IL-27 functional inhibitors and non-inhibitors was collected from similar sources. Bispecific antibodies were generated by cloning an anti-IL-27RA antibody into a human IgG1 vector ("RRR") carrying engineered arginine residues D221R, P228R, and K409R (EU numbering), and an anti-gp130 antibody into a human IgG1 vector ("EEE") carrying engineered glutamic acid residues D221E, P228E, and L368E (EU numbering). Under mild reduction and reoxidation, a mixture of antibodies carrying the RRR and EEE mutations preferentially forms RRR-EEE heterodimers (Strop et al., 2012). This redox procedure was scaled up so that bispecific antibodies could be formed from a mixture of 20 micrograms of each starting antibody, first incubated with 1 mM reduced glutathione (GSH) for 1 hour at 37°C, followed by reoxidation with 1 mM glutathione disulfide (GSSG). The resulting material was shown to be compatible with cell and whole blood assays for IL-27R activity, including phosphorylation of STAT3 in CHO cells overexpressing IL-27RA and gp130 (described in Example 2), and phosphorylation of STAT3 and STAT1 in CD3+ T cells in human whole blood (described in Example 8).

[0518] A total of 2156 bispecific IgGs were generated. Of these, 50 demonstrated agonism in the CHO pSTAT3 assay, and 12 (out of 29 strong agonists tested) demonstrated robust agonism of pSTAT1 in CD3+ T cells in human whole blood (data not shown). These observations were reproduced when these 12 bispecific antibodies were produced at multimilligram scale and purified from redox buffer and any remaining parental antibodies. These 12 represented combinations of four anti-gp130 antibodies (Ab 2187 and three unrelated antibodies) and five anti-IL-27RA antibodies (Ab 917 and four unrelated antibodies), each with unique VH and VL sequences. Within this set of antibodies, two "clusters" were evident: any member of one set of three anti-gp130 antibodies (including Ab-2187) could be paired with any member of one set of three anti-IL-27RA antibodies (including Ab-0917) to form an active bispecific agonist. The most potent activity was observed from the bispecific pair of Ab-0917 and Ab-2187, which were selected as the lead binding domain for humanization and optimization (Example 3).

[0519] Example 3 Binding domain humanization and optimization Humanization and optimization of anti-gp130 binding domains The heavy chain variable domain of anti-gp130 clone 2187 was subcloned into an expression vector containing untagged human Fc, and the protein thus produced was renamed clone 2246, which will be referred to as the parent clone in the description of humanization and optimization.

[0520] The 2246 binding domain is IGHV4-4 for VH. * 07_IGHJ4 * 03, VL is IGKV3-20 * 01_IGKJ4 * 01, which had a human framework. * 07_IGHJ4 *03 is a less optimal framework than the preferred framework in terms of biophysical properties and manufacturability. Furthermore, in-silico T cell epitope analysis revealed an extremely poor Epivax ISPRI immunogenicity propensity score for the 2246 VH sequence (+6.2 compared to a preferred score of <-50). While this high score was primarily modulated by germline epitopes rather than non-germline epitopes, this score still represents an increased immunogenicity risk unless associated with one of the preferred germline sequences empirically reduced in multiple late-stage programs. Therefore, rehumanization was performed to replace the VH CDRs with another framework, IGHV1-69, which has six back mutations (A24V, M48I, I69M, A71V, E73T, A78F) (Pfabat numbering). * The 2246 VL CDR was also grafted into the IGKV1-39 framework without backmutation to restore binding activity. * 01. The rehumanized clone 4247 fully retained the binding activity of the parent clone 2246. However, it still possessed three non-germline T cell epitopes in the CDRs, two in the VH, and one in the VL, as well as a moderately high immunogenicity score of −40.05 (current standard, Pfizer TReg-Adjusted v1.00); it also possessed an N-linked glycosylation site in CDR-H2.

[0521] Before the co-crystal structures of the 2246 series were available, a set of 96 point mutations predicted to reduce T cell epitope content and eliminate N-linked glycosylation sites in H2 with minimal impact on stability were designed, synthesized, and characterized for retention of gp130 binding. None of the mutations were able to remove the glycosylation site in H2 without significant loss of binding activity. However, this liability was determined to be of low risk and experimentally demonstrated to be unoccupied. Therefore, no further efforts were made to remove it. Once the co-crystal structure of gp130 / Fab3754 (a rehumanized variant of the parent 2246) was solved, a second set of mutations was also designed to potentially enhance binding activity without adding new T cell epitopes to hedge against loss of binding activity. Twenty affinity mutations were combined with nine binding-verified epitope-eliminating mutations to generate a set of 54 VH chains and 7 VL chains, which were then matrixed to create 378 antibody-optimized variants.These mutant variants were screened for the retention of gp130 binding activity, and then 10 constructs that did not reduce binding activity or molecular properties were carried forward to the next round of screening triage, along with two new combination variants.At the same time, 20 reverse mutation variants of 4247 were evaluated for reduced in silico immunogenicity risk and retention of gp130 binding; three of these variants plus unmodified 4247 were carried forward to the next screening round.In the final round of screening, 12 optimized CDR constructs were crossed with four framework variants to test for gp130 binding and molecular properties. The final resulting IgG molecule, clone 4574, incorporated a total of five mutations: two into the VH CDR, two into the VL CDR, and one into the FW-H. The mutations S(H54)T, S(H65)D, F(H78)H, and S(L52)E (Pfabat numbering) reduce T cell epitope content, while the mutation S(L94)Y appears to compensate for the small loss in gp130 binding.Clone 4574 lacks predicted non-germline epitopes and other tier 1 sequence liabilities.

[0522] Humanization and optimization of anti-IL27RA binding domain The heavy chain variable domain of anti-IL27RA clone 0917 was subcloned into an expression vector containing untagged human Fc, and the protein thus produced was renamed clone 2255, which will be referred to as the parent clone for the description of humanization and optimization.

[0523] For humanization, the VH CDRs of 2255 were cloned into the framework IGHV3-7 with two back mutations V48I and A49G (Pfabat numbering). * 01 and the VL CDRs were grafted into IGKV1-39 with three back mutations L46R, L47V, Y49F (Pfabat numbering). *The resulting humanized molecule fully retained the binding activity of the parent clone 2255. However, it had six non-germline T cell epitopes spread among all three heavy chain CDRs, two additional non-germline T cell epitopes in L2, one potential Tier 1 deamidation site in CDR-L1, and a very high polyreactivity score (despite the desired score of <5, DNA was 26 and insulin was 14). Limited screening of 16 CDR variants aimed at reducing the T cell epitope content revealed that the K(L53)G mutation (clone 4207) significantly reduced the DNA binding polyreactivity score while maintaining much of the parent IL27R binding activity and eliminating the T cell epitopes. Additional screening of humanized 2255 variants (approximately 500 clones) and homologous humanized 2257 antibody variants (approximately 150 clones) with the alternative K(L53)D mutation identified several mutations with putative immunogenicity- or DNA-affinity-reducing benefits that were likely to be tolerated as mutations for 4207. The results of these screens, combined with structural analysis of the newly available co-crystal structure of IL27R / Fab2255, generated a set of 48 single CDR variants of 4207, each containing one to three mutations predicted to reduce T-cell epitope content and / or polyreactivity with minimal impact on stability and affinity, or potentially enhance avidity if needed to compensate for loss of avidity from the liability-eliminating mutations. The mutant variants were screened for retention of IL27R binding and DNA polyreactivity, and mutations from approximately 10 variants with favorable profiles were recombined into 80 VH sequences and 9 VL sequences, which were then matrixed to create a final set of 720 antibody-optimized variants. The optimized variant set was similarly synthesized, screened, and triaged to identify the final resulting IgG molecule, clone 4701. Clone 4701 incorporated five mutations in the VH CDR and one additional mutation in L2.The mutations N(H35)Q, I(H51)T, I(H57E), and K(L53)G (Pfabat numbering) each reduce T cell epitope content, and all of these likely contribute at least somewhat to the reduced DNA binding; the mutation S(H30)E appears to reduce DNA binding, while A(H96)K appears to compensate for IL-27R binding activity lost through other mutations. Although no tolerated mutations were identified that remove potential NS deamination sites in CDR-L1, this deamination liability was down-regulated in the expanded Stage I evaluation and therefore was not pursued further. Clone 4701 lacks predicted non-germline epitopes and retains only one down-regulated Tier 1 sequence liability in CDR-L1. This also significantly reduced the polyreactivity scores: 10-13 for DNA and 5-7 for insulin. When combined with the optimized anti-gp130 arm (4574) in a bispecific molecule, the polyreactivity score was further reduced to an acceptable range of <5.

[0524] Example 4 Multireactive / nonspecific interaction assessment The final optimized binding domains for both gp130 and IL27Ra were evaluated in a molecular evaluation suite of biophysical properties as monospecific homodimeric IgGs (clone 4574 for the anti-gp130 arm and clone 4701 for the anti-IL27RA arm) and also as the final bispecific molecule, mAb-4894. Three types of assays were performed to assess polyreactive / nonspecific interaction propensity, as described below.

[0525] DNA and insulin ELISA 384-well ELISA plates (Nunc Maxisorp) were coated overnight at 4°C with DNA (10 μg / ml) and insulin (5 μg / ml) in PBS pH 7.2. The ELISA, adapted from the assay described in Tiller et al., J. Immunol. Methods 329, 112, 2008; U.S. Patent No. 7,314,622, was performed on a PerkinElmer Janus liquid-handling robot. The wells were washed with water, blocked with 50 μl of polyreactive ELISA buffer (PEB; PBS pH 7.2 containing 0.05% Tween-20, 1 mM EDTA) at room temperature for 1 hour, and rinsed once with 80 μl of water. Test samples at 10 μg / ml (in PBS pH 7.2, 0.05% Tween-20, 1 mM EDTA) were added to the wells in quadruplicate and incubated at room temperature for 1 hour. The plate was washed three times with 80 μl of water, and 25 μl of horseradish peroxidase-conjugated goat anti-human IgG (Fcγ fragment-specific) (Jackson ImmunoResearch) at 32 ng / ml in PBS pH 7.2, 0.05% Tween-20, and 1 mM EDTA was added to each well. The plate was incubated at room temperature for 1 hour, washed three times with 80 μl of water, and 25 μl of TMB substrate (Sigma Aldrich) was added to each well. The reaction was stopped after 6 minutes and 45 seconds by adding 25 μl of 0.18 M ortho-phosphoric acid to each well, and absorbance was read at 450 nm. DNA binding scores and insulin binding scores were calculated as the ratio of the ELISA signal of 10 μg / ml of antibody to the signal of buffer-containing wells.

[0526] Affinity capture self-interacting nanoparticle spectroscopy (AC-SINS) Proteins have the potential to interact with themselves, especially at increased concentrations. This self-interaction can lead to formulation-related viscosity challenges during drug development, as well as increased risk of clearance (Avery et al., MAbs. 2018;10(2):244-255). The AC-SINS assay is used to measure self-interactions and help predict high viscosity and the potential for poor pharmacokinetic properties.

[0527] The AC-SINS assay was standardized in a 384-well format on a Perkin-Elmer Janus liquid handling robot. 20 nm gold nanoparticles (Ted Pella, Inc., No. 15705) were buffer-exchanged into 20 mM sodium acetate, pH 4.3, and coated with a mixture of 80% goat anti-human Fc (Jackson ImmunoResearch Laboratories, Inc., No. 109-005-098) and 20% nonspecific goat polyclonal antibody (Jackson ImmunoResearch Laboratories, Inc., No. 005-000-003) diluted to 0.4 mg / ml. After 1 hour of incubation at room temperature, unoccupied sites on the gold nanoparticles were blocked with thiolated polyethylene glycol (2 kDa). The coated nanoparticles were then concentrated 10-fold using a syringe filter, and 10 μl was added to 100 μl of test sample at 0.05 mg / ml in PBS, pH 7.2. The coated nanoparticles were incubated with test samples in a 96-well polypropylene plate for 2 hours, then transferred to a 384-well polystyrene plate and read on a Tecan spectrophotometer. Absorbance was read from 450 nm to 650 nm in 2 nm increments, and a Microsoft Excel macro was used to identify the maximum absorbance, smooth the data, and fit the data using a second-order polynomial. The smoothed maximum absorbance of the average blank (PBS buffer alone) was subtracted from the smoothed maximum absorbance of the sample to determine the AC-SINS score.

[0528] Human FcRn column A human FcRn affinity column was prepared as previously described in Koch et al., mAb 5:576-586, 2013 (see below). To determine human FcRn column retention time, 50 μg of test sample adjusted to pH 5.5 was injected onto a GE High Performance Streptavidin Sepharose column (catalog no. 17-5113-01) coated with in-house expressed and purified biotinylated hFcRn, and a linear pH gradient from pH 5.5 (MES) to 8.8 (Tris) in the presence of 150 mM NaCl was applied to elute the sample. FcRn column data are reported as relative retention times, where the sample elution time is subtracted from the elution time of the assay performance control mAb-A to normalize for intra-assay variability.

[0529] An acceptably low level risk, typical of monoclonal antibodies, was determined for the final bispecific molecule mAb-4894 based on the results from these assays, as shown in Table 3 below.

[0530] [Table 4]

[0531] Example 5 Large-scale production of lead antibodies Generation of stable CHO cell pools for large-scale production of mAb-4894 The two binding arms for the final bispecific molecule, mAb-4894, were expressed separately as IgGs (homodimers) with either EE or RR mutations in their IgG1 Fc domains to facilitate heterodimer formation during the redox reaction performed later in the purification. In particular, the anti-gp130 binding arm with the RR mutation in its Fc is designated clone anti-gp130 4875 RR (derived from 4574, also referred to as anti-gp130-4574), and the anti-IL27RA arm with the EE mutation is designated clone anti-IL27RA 4880 EE (derived from 4701, referred to as IL27RA-4701). EE / RR mutations in the heavy chain constant region to facilitate heterodimer formation: on the EE side, D221E and L368E (according to EU numbering) or D234E and L381E (according to Kabat numbering); on the RR side, D221R and K409R (according to EU numbering) or D234R and K422R (according to Kabat numbering). The EE arm holds the anti-IL27RA binding variable domain, and the RR arm holds the anti-gp130 variable domain. The binding arm of the final bispecific also contained alanine mutations to minimize effector function: L234A, L235A, G237A (according to EU numbering) or L247A, L248A, G250A (according to Kabat numbering), according to human IgG1.

[0532] Expression vectors carrying cDNAs encoding clonal anti-gp130 4875 RR and IL27RA 4880 EE were constructed at SSI Systems as pSSI2.0-IL27-4574-2X and pSSI2.0-IL27-4701-2X, respectively. The two expression vectors were transfected into CHOK1 SV SSI 7876 (HCLIB-53) cells using Neon electroporation (Bio-Rad) to generate two independent stable pools. Transfectants stably expressing the appropriate antibody proteins were selected based on glutamine synthesis in CDCHO (Invitrogen) medium and blasticidin (Gibco Cell Culture) resistance.

[0533] Both pools were then separately expressed using 10 L of CHO cells grown in Pfizer production medium. Conditioned media for both homodimers (EE and RR) were collected on day 12 and processed for purification as described below. (CHO cell lines secreting IL-27R antibody homodimers (designated IL-27R-4880 EE and gp130-4875 RR) were generated using Pfizer's Biotherapeutics Pharmaceutical Sciences (PharmSci) Cell Line Development Laboratory's protocol (CLD_SSI 2.0 v1).)

[0534] IL27RA-4880 EE homodimer cell line generation: CHOK1 SV SSI 7876 cells (HCLIB-53) were electroporated at 300V and 900uF using 5µg of the pSSI2.0 expression plasmid (VEC-38718) encoding the anti-IL27RA-4880 EE homodimer antibody and 45µg of the pFlpE recombinase plasmid (AVEC-25020). Transfections were performed in triplicate to generate three independent pools (DX18-1, DX18-2, and DX18-3). The resulting pools were fluid-changed to L-glutamine-free medium (CDCHO - Invitrogen catalog no. 10743-029 lot 2085431) 24 hours after transfection. Cultures were monitored on a 3-4 day schedule. After establishment, small-scale production studies were performed by culturing 200 mL volumes of cultures containing 0.3 × 10 cells in CDCHO completely defined pre-load media (MFR H000002813). 6Conditioning was performed by inoculating 1000 cells / mL. On days 3–6 and 10 and 11, cultures were sampled and fed with 5.4 mL of completely defined feed version 6.2A (CDFv6.2A) and 5.0 mL of 10% glucose. On day 7, cultures were sampled and fed with 16.2 mL of CDFv6.2A and 15.0 mL of 10% glucose. Conditioned medium was collected from pools DX18-1, DX18-2, and DX18-3 on day 12 for crude Protein A titer evaluation. In two 10 L working volume control reactors, cell cultures containing one pool (DX18-1, DX18-2, and DX18-3, DX18-PoP in a 1:1:1 ratio) were added to 8 L of M310 production medium (PFP SOI AN LAB 0701:GS AU8 (M310) with spermine 4HCl, 12 mM asparagine, 12 mM aspartic acid, 8 g / L glucose + 14 mM KCl). ** The cultures were inoculated in a 1000 ml M391 (EXP M391 Lot No. 0A215201026026) medium. The cultures were maintained at a temperature of 36.5°C with rocking at 18 RPM at a 12° angle. The cultures were fed 3.4% M391 (EXP M391 Lot No. 0A215201028002) per day (days 3-12) and 2.5% 10% glucose per day (days 4-12). The pH was controlled at 7.05 + / - 0.15. The dissolved oxygen set point was 30%. The conditioned medium was harvested on day 12 by filtration through a 30" 5 μm Pall Profile® II filter (catalog no. NP8Y050BP1G) and a 10" 0.22 μm Pall Support filter (catalog no. NP6EKVP1GA).

[0535] [Table 5]

[0536] Anti-gp130-4875 RR homodimer cell line generation: CHOK1 SV SSI 7876 cells (HCLIB-53) were electroporated at 300V and 900uF using 5µg of the pSSI2.0 expression plasmid (VEC-38719) encoding the anti-gp130-4875 RR homodimer antibody and 45µg of the pFlpE recombinase plasmid (AVEC-25020). Transfections were performed in triplicate to generate three independent pools (DX19-1, DX19-2, and DX19-3). The resulting pools were fluid-switched to L-glutamine-free medium (CDCHO - Invitrogen catalog number 10743-029 lot 2085431) 24 hours after transfection. Cultures were monitored on a 3-4 day schedule. After establishment, small-scale production studies were performed by culturing 200 mL volumes of cultures containing 0.3 x 10 cells in CDCHO Complete Defined Preload Medium (MFR H000002813). 6 Conditioning was performed by seeding at 1000 cells / mL. On days 3–6 and 10 and 11, cultures were sampled and fed with 5.4 mL of complete defined feed version 6.2A (CDFv6.2A) and 5.0 mL of 10% glucose. On day 7, cultures were sampled and fed with 16.2 mL of CDFv6.2A and 15.0 mL of 10% glucose. Conditioned medium was collected from pools DX19-1, DX19-2, and DX19-3 on day 12 for crude Protein A titer evaluation. In one 10 L working volume control reactor, cell cultures containing the combined pools (DX19-1, DX19-2, and DX19-3, DX19-PoP in a 1:1:1 ratio) were added to 8 L of M310 production medium (PFP SOI AN LAB 0701: GS AU8 (M310) with spermine 4HCl, 12 mM asparagine, 12 mM aspartic acid, 8 g / L glucose + 14 mM KCl). **The cultures were inoculated in a 1000 ml M391 (EXP M391 Lot No. 0A215201026026) medium. The cultures were maintained at a temperature of 36.5°C with rocking at 18 RPM at a 12° angle. The cultures were fed 3.4% M391 (EXP M391 Lot No. 0A215201028002) per day (days 3-12) and 2.5% 10% glucose per day (days 4-12). The pH was controlled at 7.05 + / - 0.15. The dissolved oxygen set point was 30%. The conditioned medium was harvested on day 12 by filtration through a 30" 5 μm Pall Profile® II filter (catalog no. NP8Y050BP1G) and a 10" 0.22 μm Pall Support filter (catalog no. NP6EKVP1GA).

[0537] [Table 6]

[0538] Redox and purification of lead bispecific antibodies Conditioned media for the EE and RR homodimers were separately captured on MabSelect Sure LX resin on an Äkta Avant (GE Healthcare Life Sciences). The redox reaction to produce the heterodimer was performed in vitro. A 1:1 ratio of homodimer and a molar excess of cysteine were incubated together. The post-redox material was purified in weak-partitioning mode on a column with Fractogel TMAE Hicap(M) (EMD Millipore) resin equilibrated in 50 mM Tris, pH 8.1. Further purification was optimized using a micro-column screen of ion exchange (IEX) and hydrophobic interaction chromatography (HIC) resins. The material was diluted 1:1 with 800 mM sodium sulfate, 700 mM sodium phosphate, 100 mM Tris, pH 7.2, and purified using Butyl HP HIC resin (Cytiva) with a gradient of elution buffer (50 mM sodium phosphate, pH 7.2). A final buffer exchange into His / sucrose buffer (20 mM histidine, 8.5% sucrose, pH 5.8) utilized a 30 kDa regenerated cellulose membrane (EMD Millipore). Absorbance at 280 nm was used to quantify protein concentration using the calculated absorption coefficient.

[0539] The % conversion was assessed by HP-HIC (High-Performance Hydrophobic Interaction Chromatography), a method that exploits the difference in hydrophobicity between the two homodimers / components (anti-IL27RA (IL27R-4880 EE) and anti-gp130 (IL27R-4875 RR)) and the final product protein (heterodimer). Samples were run on a ProPac HIC-10 column (Thermo Fisher) using a gradient of 1 M sodium sulfate, 50 mM sodium phosphate, pH 7.2. HP-SEC was performed by injecting 15 μL of the reaction mixture into an HPLC equipped with a YMC-pack-Diol 200 column and a UV detector (280 nM). The column temperature was set at 25 °C, and the flow rate was maintained at 0.3 mL / min using isocratic elution (buffer 50 mM sodium phosphate).

[0540] Example 6 Evaluation of IL27RA / gp130 binding to human and cynomolgus monkey IL27RA and gp130 result The cross-reactivity of mAb-4894 to the human and cynomolgus antigens gp130 (human-SEQ ID NO: 45, cynomolgus-SEQ ID NO: 46) and IL27RA (human-SEQ ID NO: 41, cynomolgus-SEQ ID NO: 42) was measured by surface plasmon resonance by anti-FAB capture of mAb-4894 (containing anti-IL27RA-4880 EE and anti-gp130-4875 RR arms) on a biacore chip. Human or cynomolgus IL27RA or gp130 were flown over the chip, the on-rate and off-rate were determined, and the affinity constants were calculated.

[0541] As shown in Table 6, the mAb-4894 bispecific antibody can bind to both human and cynomolgus monkey gp130 and IL27RA. The binding affinities of the two arms of mAb-4894 are tuned to have a difference of approximately 1000-fold, with an affinity approaching 0.1 nM for the IL27RA subunit but greater than 100 nM for the widely distributed gp130 subunit. This differential affinity is expected to allow sufficient potency for agonist activity while minimizing binding to other gp130-containing receptors.

[0542] [Table 7]

[0543] material and method Preparation of biosensor sensor chips An anti-Fab sensor chip was prepared by amine coupling of anti-human Fab antibody to all eight channels of a CM5 sensor chip according to the manufacturer's instructions. The flow channels were activated by injecting a 1:1 mixture of 400 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and 100 mM N-hydroxysuccinimide (NHS) at a flow rate of 10 μL / min for 7 minutes. Anti-Fab IgG antibody was diluted to 25 μg / mL in 10 mM sodium acetate, pH 5.0, and injected over all flow cells at 10 μL / min for 7 minutes. All channels were blocked with 1 M ethanolamine-HCl (ETH) at 10 μL / min for 7 minutes. The final immobilization level of the capture antibody was approximately 14,000 resonance units (RU). The running buffer for immobilization and reaction kinetics was HBS-EP+ (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) pH 7.4, 150 mM sodium chloride, 3 mM ethylenediaminetetraacetic acid (EDTA), 0.05% (v / v) Tween-20).

[0544] SPR analysis The binding affinity of mAb-4894 to human and cynomolgus gp130 and IL27RA was determined using a BIAcore 8K+ instrument (Cytiva) at 37°C with a 10 Hz acquisition rate. The mAb-4894 bispecific antibody was diluted to 0.08 μg / mL in HBS-EP+ buffer and captured by anti-Fab IgG immobilized on flow cell 2 of all eight channels at a flow rate of 10 μL / min for 100 s, achieving a capture level of approximately 50 RU. Flow cell 1 for each channel was used as the reference flow cell. After antibody capture, a 3-fold dilution series of cytokines, ranging in concentration from 405 nM to 15 nM for huGP130 and cyGP130 and from 45 nM to 1.67 nM for huIL27R and cyIL27R, or HBS-EP+ buffer was injected over the sensor surface at 50 μL / min for 60 s. Dissociation was monitored for 600 seconds, and the surface was regenerated with two injections of 10 mM glycine, pH 1.7, at 30 μl / min. Data were double-referenced (Myszka, D., J. Mol. Recognit 1999;279-284). Binding affinities and rate constants were determined for human and cyno GP130 and IL27R by fitting the resulting sensorgram data to a 1:1 Langmuir model in BIAcore Insight Evaluation software version 3.0.12.15655 (Cytiva).

[0545] Example 7 Epitope overlap assessment of the IL27RA arm for the ligand IL27: result Because both the IL-27 ligand complex (composed of p28 and Ebi3) and mAb-4894 bind to the IL-27 receptor, it is possible that the ligand and mAb-4894 may bind to similar epitopes on the receptor complex, potentially resulting in antagonist activity of the IL27RA arm of mAb-4894 against the ligand. Therefore, we used the Octet system to evaluate potential epitope competition between the binding domain of mAb-4894 and the ligand complex.

[0546] Briefly, two sets of sensor tips were first coated with IL27 recombinant ligand complex (complex generation as described in Example 1), then one set was allowed to bind saturating levels of IL27RA and then subjected to IL27RA-binding clone 2255 (parent clone) to determine whether the ligand could simultaneously bind to both IL27RA and antibody 2255. However, the other set was incubated in plain buffer and then subjected to 2255 as a positive control for binding of 2255 to the ligand.

[0547] As shown in Figure 8, 2255 failed to show any detectable binding to the IL27RA-bound ligand sensor tip (sensor B6), whereas binding to the bare sensor tip pre-exposed to buffer only (sensor C6) was readily apparent. This result suggests potential antagonist activity of the IL27RA-binding domain of mAb-4894 (anti-IL27RA-4880 EE) against the IL27 ligand when used as a monospecific antibody.

[0548] material and method Samples were diluted using 1x sample dilution buffer (Sartorius), which was also used as the assay buffer. Plates were shaken at 30°C between experimental steps. Sensors were used in duplicate.

[0549] Amine Reactive 2nd Generation (AR2G) sensors (Sartorius) were activated by immersion in a 1:1 mixture of 11.0 mM 1-ethyl-3-(3 dimethylaminopropyl)carbodiimide hydrochloride (EDC) and 5.8 mM N-hydroxysuccinimide (NHS) for 180 seconds. The sensors were then immersed in hIL27R-CH23Fc-Flag diluted to 25 μg / mL in 10 mM sodium acetate, pH 5.0, for 300 seconds to directly immobilize hIL27R-CH23Fc-Flag onto the sensors. Finally, the sensors were immersed in 1 M ethanolamine-HCl (ETH) for 200 seconds to block all amine binding sites. The final immobilization level of hIL27R was approximately 1.0 nM.

[0550] The same set of sensors was immersed in sample buffer for 100 seconds to establish a baseline, and then immersed in 300 nM hIL27:EBi3 for 260 seconds to allow hIL27:EBi3 to bind to hIL27RA (association 1). With a high concentration of 300 nM hIL27:EBi3, it is estimated that almost all hIL27R on the sensor is bound to hIL27:EBi3. The sensors were immediately immersed in 300 nM GBT-IL27R-2255 for 260 seconds to assess whether GBT-IL27R-2255 could still bind to the complex of hIL27:EBi3 and hIL27R-CH23Fc-Flag.

[0551] A set of sensors was used as a negative control by immersing them in a buffer solution instead of GBT-IL27R-2255 after binding of hIL27:EBi3 to demonstrate dissociation of hIL27:EBi3 from immobilized hIL27RA. No binding should be observed on these sensors.

[0552] A set of sensors was used as a positive control by immersing it in a buffer solution instead of hIL27:EBi3 after establishing a baseline. These sets of biosensors without bound hIL27:EBi3 were then immersed in GBT-IL27R-2255 to demonstrate binding of GBT-IL27R-2255 to hIL27RA immobilized on the sensors.

[0553] [Table 8]

[0554] Example 8 Evaluation of the biological activity of the IL27RA / gp140 bispecific against human and cynomolgus monkey T cells, monocytes, and colonocytes result Key pharmacological endpoints were used to assess the biological activity of IL27RA / gp140 bispecific mAb-4894 to specifically determine its ability to activate pathways associated with IL27R agonism and the expression of associated factors, including phosphorylation of signal transduction and activator of transcription 1 and 3 (pSTAT1 and pSTAT3) in CD3+ T cells, and activity of anti-inflammatory mediators, such as programmed death-ligand 1 (PD-L1) and the enzyme indoleamine-pyrrole 2,3-dioxygenase (IDO1), in CD14+ monocytes and primary colonocytes. The results are described below and summarized in Table 9.

[0555] mAb-4894 induced pSTAT1 and pSTAT3 in CD3+ T cells from human whole blood with mean EC50s of 0.43 nM and 0.23 nM, respectively (n=3). The window for STAT3 phosphorylation was smaller than that of STAT1 and showed higher donor-to-donor variability. In cynomolgus monkey whole blood, mAb-4894 induced pSTAT1 and pSTAT3 in CD3+ T cells with mean EC50s of 1.74 nM and 1.17 nM, respectively (n=4).

[0556] IDO1 is a cytosolic enzyme with a heme (Fe2+) prosthetic group that catalyzes tryptophan (Trp) catabolism, converting it to kynurenine (Kyn). The IDO1 pathway was originally described as an innate immune mechanism that defends host organisms against infection. Elevated levels of IDO1 strongly inhibit the proliferation of effector T cells and induce their apoptosis, and accumulating Trp metabolites induce the differentiation of Tregs, which collectively produce immunosuppression. The immunoprotective and immunosuppressive roles of IDO1 and Trp metabolites are tightly controlled by the stoichiometry of available local factors. The effects resulting from these local activities modulate IDO1 expression, helping to maintain global immune homeostasis and peripheral immune tolerance. IL-27 is one of the immunoregulatory cytokines that induce IDO1. In human peripheral blood mononuclear cell (PBMC) populations, the IL-27 bispecific antibody mAb-4894 upregulated IDO1 expression in the cytoplasm of CD14+ monocytes in a dose-dependent manner. The mean EC50 for the monocyte population (flow cytometry analysis) was 0.005 nM (n=3). In primary cultured human colonocytes from two donors, IDO1 mRNA expression was significantly upregulated by mAb-4894 with a mean EC50 of 20 nM. The activity of secreted IDO1 in cell culture supernatants was also assessed by LC-MS assay. The mean EC50 for IDO-1 activity assay for colonocytes from two donors was 5.4 nM (n=2). The results are summarized in Table 9.

[0557] PD-L1 (CD274) is the dominant inhibitory ligand of PD-1 (also known as programmed cell death protein 1, CD279). Engagement of PD-1 by PD-L1 alters T cell activity in many ways, including inhibition of T cell proliferation, survival, cytokine production, and other effector functions. In human whole blood, mAb-4894 induced PD-L1 expression in a dose-dependent manner with a mean EC50 of 0.002 nM (n=2). The results are summarized in Table 9.

[0558] [Table 9]

[0559] material and method Whole blood from healthy human donors or untreated cynomolgus monkeys was collected into tubes containing anticoagulant, distributed into 96-well plates, warmed to 37°C, and stimulated with serially diluted concentrations of mAb-4894 or isotype control IgG8.8 antibody for 15 minutes (human) or 20 minutes (cynomolgus monkey), followed by additional Lyse / Fix buffer (BD Biosciences, catalog no. 558049) according to the manufacturer's instructions. Cells were washed in FACS buffer and then permeabilized in pre-chilled 90% methanol (for human samples) or BD Phosflow Perm buffer III (for cynomolgus monkey samples). T cells were labeled with anti-CD3 antibody during agonist stimulation. Cells were washed again and incubated with fluorescently labeled antibodies recognizing phosphorylated STAT1 (pY701) or STAT3 (pY705) (Table 10), followed by evaluation on a flow cytometer and analysis using FlowJo software. The mean relative fluorescence units (RFU) in the gated T cell population was calculated by multiplying the percentage of pSTAT+ cells by the mean fluorescence intensity (MFI). EC50 values (Table 9) were determined by graphing the agonist concentration versus the RFU response from all donors using nonlinear three-parameter best-fit analysis software from GraphPad Prism 9 (GraphPad Software, Inc.).

[0560] 95 μl of healthy human whole blood was aliquoted into a 96-deep well plate and then treated with 5 μl of serially diluted mAb-4894 or isotype control IgG8.8 antibody for 3 hours in a 37°C incubator. Cells were stained for an additional 30 minutes in a 37°C incubator with human FC block (BD Biosciences, catalog no. 564220), anti-CD3, anti-CD14, and anti-PDL-1 antibodies (Table 10) at dilution factors of 1:10, 1:50, 1:5, and 1:20, respectively. Samples were lysed / fixed for 20 minutes at 37°C with prewarmed 1x Lyse / Fix buffer according to the manufacturer's instructions. Cells were centrifuged, washed, and resuspended in FACS buffer. Monocyte PD-L1 expression was assessed by flow cytometry, and MFI was analyzed using FlowJo software 10.7.1 (FlowJo, LLC). The EC50 value (0.002 nM, Table 9) was determined by graphing the concentration of agonist versus the MFI from all donors using non-linear three-parameter best-fit analysis software from GraphPad Prism 9.

[0561] Human PBMCs were isolated from healthy human whole blood by density gradient centrifugation using SepMate tubes (Stemcell technologies, catalog no. 85450) and 15 ml of Ficoll-Paque Premium Reagent (GE Healthcare, catalog no. 17-5442-02). 190 μl of freshly isolated human PBMCs (5 × 10^6 cells / ml in 10% FBS RPMI) were aliquoted into a 96-well plate (Corning Costar, catalog no. 3879, polypropylene) and then treated with 10 μl of serially diluted mAb-4894 or isotype control IgG8.8 antibody for 20 hours in a 37°C incubator. Cells were washed and further stained with Live / Dead Fixable Aquaous Cell Staining Kit (Invitrogen, Cat. No. L34966), human FC block, and anti-CD14 (Table 10), followed by fixation / permeabilization with Cyto Fix / Cyto Perm buffer (BD, Cat. No. 554722) for 20 min at 4°C, and finally stained with 1:100 anti-IDO1 (Table 9) for 30 min at 4°C. Monocyte IDO1 expression was assessed by flow cytometry, and MFI was analyzed using FlowJo software 10.7.1. EC50 values (0.005 nM, Table 9) were determined by graphing agonist concentration versus MFI from all donors using nonlinear three-parameter best-fit analysis software from GraphPad Prism 9.

[0562] Human primary colonocytes (Cell Biologics, H-6047) from two donors (Lot No. 02130, Lot No. 041417ABC) were purchased and seeded in 48-well plates in complete DMEM / F-12 culture medium to 90% confluency and then treated with serially diluted mAb-4894 or isotype control IgG8.8 antibody for 24 hours in a 37°C incubator. Supernatant samples were saved and QCed, after which proteins were precipitated with additional acetonitrile reagent. Isotopically labeled tryptophan and kynurenine were added as internal standards. The supernatants were evaporated under nitrogen and reconstituted in injection buffer. The production of kynurenine (Kyn), which reflects IDO1 activity, was assessed by LC-MS assay. The mean EC50 value (5.4 nM, Table 9) was determined by graphing the concentration of agonist versus Kyn production from all donors using nonlinear three-parameter best-fit analysis software from GraphPad Prism 9.

[0563] [Table 10]

[0564] Example 9 Biological effects of the IL27RA / gp140 bispecific on T helper and Treg cells result CD4+ helper T cells play a variety of important roles in the development and maintenance of various autoimmune diseases, including IBD. Based on differentially secreted cytokine panels that subsequently mediate unique cellular activities, CD4+ helper T cells can be characterized into distinct subtypes, such as Th1, Th2, and Th17 cells. In vitro, naive CD4+ T cells can be induced to differentiate into these three types of helper T cells. During the skewing period, mAb-4894 upregulated IFNγ and T-bet expression during Th1 cell differentiation (data not shown), but had no effect on the expression of pro-inflammatory IFNγ in fully differentiated Th1 cells, suggesting that mAb-4894 does not induce a pro-inflammatory response, as shown in Figure 4. mAb-4894 downregulated GATA-3 and IL-13 expression during Th2 cell differentiation (data not shown) and downregulated IL-17A expression during Th17 cell differentiation. mAb-4894 also downregulated IL-17A and granulocyte-macrophage colony-stimulating factor (GM-CSF) in fully differentiated Th17 cells. The data are shown in Table 11.

[0565] [Table 11]

[0566] Regulatory T (Treg) cells are important for maintaining peripheral tolerance, preventing autoimmune diseases, and limiting chronic inflammatory diseases. There are two types of Tregs: natural Tregs (nTregs) and inducible Tregs (iTregs). Tregs also express several immune checkpoint molecules, including Tim-3 and LAG-3, which deliver negative immunoregulatory signals upon engagement with T cell activation. Compared with the negative control antibody 8.8, mAb-4894 induced more CD4+CD25+FOXP3+iTregs from naive CD4+T cells, upregulated the LAG3+ population, upregulated Tim-3 expression levels, and increased the Tim-3+ cell population. In nTregs, mAb-4894 upregulated IL-10 gene expression in two donors and upregulated LAG3 expression at both the transcriptional (n=2) and protein (n=2) levels. The data are shown in FIG.

[0567] mAb-4894 was tested on three types of dendritic cell (DC) differentiation states: immature DCs, immunogenic DCs, and tolerogenic DCs. Peripheral CD83 expression may have functional significance and affect lymphocyte maturation, survival, or function. Overexpression of CD83 by antigen-presenting cells (APCs) has been reported to enhance T cell proliferation in vitro. Immunoglobulin-like transcript 4 (ILT4) is an immunosuppressive molecule primarily expressed in myeloid cells. mAb-4894 significantly downregulated cell surface CD83 expression and upregulated ILT4 expression, which may also contribute to the mAb-4894-induced inhibitory effect on allogeneic T cell proliferation mediated by all three types of DCs. Other markers, such as HLA-DR and PD-L1, were also upregulated by the bispecific antibody mAb-4894 on immature and immunogenic DCs in the two donors tested.

[0568] material and method Naive human CD4+ T cells were isolated from human Leukopaks using the Easysep Human Naive CD4+ T Cell Isolation Kit (Stemcell Technologies, Catalog No. 17555). Cells were cultured in a human Th17 differentiation cocktail (IL-6, TGFb1, IL-1b, IL-21, and IL-23, Table 12) and immunocult (Stemcell Technologies, Catalog No. 10971) with or without serial dilutions of mAb-4894 for 4 days in a 37°C incubator. IL-17A concentrations in the supernatants were assessed by an MSD assay (V-PLEX Human IL-17A Kit, Meso Scale Discovery, Catalog No. K151RFD-2) and analyzed using GraphPad Prism 9. The IL-17A inhibitory IC50 (0.0055 nM, Table 11) was averaged from two independent donors.

[0569] Naive human CD4+ T cells were isolated from healthy human whole blood and treated with a Th1-skewing cocktail (immunocult, IL-12, IL-18, and anti-IL-4 antibodies, Table 10) for 7 days in a 37°C incubator. After a 1-day rest period, cells were treated with serially diluted mAb-4894 or isotype control IgG8.8 antibodies (0.15 pM to 3 nM) for 1 day. Supernatants were saved, and IFNg production was measured by MSD Research (Meso Scale Discovery, catalog number K151QOD-2). Data were analyzed using Graphpad Prism software.

[0570] Naive human CD4+ T cells were isolated from human Leukopaks using the Easysep Human Naive CD4+ T Cell Isolation Kit and cultured for 4 days in a 37°C incubator with RPMI complete culture medium plus anti-CD3 / CD28 beads (Dynabeads Human T-Activator CD3 / CD28, Gibco, catalog no. 11131D), IL-2 (5 ng / ml) (Table 12), with or without mAb-4894 or isotype control IgG8.8 antibody treatment (1.35 nM). After removing the beads, cells were rested overnight in complete RPMI culture medium followed by fluorescently labeled antibodies recognizing CD4, CD25, LAG3, Tim3, CD127, and FOXP3 (Table 10). Data were evaluated by flow cytometer and analyzed using FlowJo software 10.7.1.

[0571] [Table 12]

[0572] Example 9 In vivo biological effects of the IL27RA / gp140 bispecific result Changes in in vivo markers of pharmacological activity of mAb-4894 anti-IL27RA / gp130 bispecific (IDO-1 activity, CXCL10 and CXCL11 concentrations, platelet counts) were demonstrated in cynomolgus monkeys. mAb-4894-associated increases in serum chemokine concentrations were noted for CXCL10 (also known as IP-10) (ranging from 5.30× to 20.96× compared to baseline) and CXCL11 (4.76× to 74.44×). Increases in IDO-1 activity, measured as a function of unlabeled kynurenine and 13C-kynurenine, were also observed. The largest increases (4.29× to 9.81× compared to baseline) were observed at the 1 mg / kg / dose. Results are shown in Tables 17 and 18.

[0573] These results demonstrate that the anti-IL27RA / gp130 bispecific antibody mAb-4894 modulates pharmacological biomarkers in vivo consistent with IL-27 activity / agonism.

[0574] [Table 13]

[0575] [Table 14]

[0576] method In vivo pharmacology of mAb-4894 in cynomolgus monkeys Male and female cynomolgus monkeys of Mauritian origin, aged greater than 2.5 years, were acclimated for a minimum of 30 days before initiating dosing. In Study 1, dose groups containing one male and one female monkey received 0.1, 1, 10, or 100 mg / kg PF-08314470 by intravenous (IV) injection on days 1 and 8. In Study 2, dose groups containing one male and one female monkey received vehicle control by IV and subcutaneous (SC) injection, or 0.01, 0.1, or 1 mg / kg IV or 1 mg / kg SC PF-08314470 on days 1, 8, 15, 22, and 29. Blood was collected at various time points throughout the course of each study for assessment of indoleamine 2,3-dioxygenase 1 (IDO-1) enzyme activity or serum chemokine concentrations. After the final dose, blood was collected at various time points over 72 hours (Study 1) or 360 hours (Study 2) for toxicokinetic analysis. Total mAb-4894 concentrations in serum were determined using a ligand binding assay, and the area under the curve (AUC) concentration was assessed for each individual animal.

[0577] IDO1 activity assay Whole blood samples collected in anticoagulant before dosing and at various time points after administration of mAb-4894 were mixed ex vivo with C-labeled tryptophan and stored at 37°C. After overnight incubation, plasma was separated by centrifugation and stored at -80°C. At the end of each study, the concentrations of C-labeled kynurenine and unlabeled kynurenine (the end products of IDO-1 enzymatic conversion of C-labeled tryptophan and endogenous tryptophan, respectively) in each plasma sample were measured by LC-MS / MS. The fold change in both kynurenine products in each animal was determined by comparison with their respective concentrations in the pre-dose sample. For each animal, the peak fold change increase for each kynurenine product between the start of dosing and 7 days after the final dose was determined.

[0578] Serum CXCL10 and CXCL11 Serum was collected from all animals at various time points, and concentrations of the CXC chemokines CXCL10 and CXCL11 were determined using ligand binding assays. The peak fold-change increase compared to pre-dose levels for each chemokine was determined in each animal.

[0579] Example 11 IL27RA / gp130 bispecific epitope Experimental Method IL27Ra(D1-D2)+FAb-2255. Cocrystals of IL27Ra (D1-D2) bound to the FAb fragment of GBT-IL27R-2255 were obtained by hanging-drop vapor diffusion in conditions containing 20% PEG 4000, 200 mM lithium sulfate, and 100 mM MES pH 6. The crystals had unit cell parameters a = 83.97 Å; b = 235.16 Å; c = 84.22 Å, beta = 90.6°, and symmetry consistent with the monoclinic space group P21, with four copies of the complex in the crystallographic asymmetric unit. Crystals were flash-frozen in liquid nitrogen using 20% EG as the cryoprotectant solution. Data sets up to 3.2 Å resolution were collected from a single frozen crystal at IMCA beamline 17-ID at Argonne National Laboratory (APS). Data were processed and scaled using autoPROC, and the final data set was 82.5% complete. The structure was solved by molecular replacement using PHASER. Several iterative rounds of manual adjustment and model rebuilding using COOT and crystallographic refinement using autoBUSTER resulted in a crystallographic R of 23.1%. work and 26.2% R free A final model with R work =||F obs |-|F calc || / |F obs | and R free is R work is calculated for 5% of the randomly selected reflections that were omitted from the refinement process. A ribbon diagram of the cocrystal structure is shown in Figure 2.

[0580] gp130(D1-D2-D3)+Fab-3754(humanized 2246) Cocrystals of gp130 (D1-D2-D3) bound to Fab-3754 (a humanized variant of antibody 2246) were obtained by hanging-drop vapor diffusion in conditions containing 20% PEG 6000, 200 mM calcium chloride, and 100 mM MES pH 6. The crystals had unit cell parameters a = 67.98 Å; b = 93.97 Å; c = 100.63 Å, alpha = 62.8°, beta = 77.36°, gamma = 86.1°, and symmetry consistent with the simple space group P1, with two copies of the complex in the crystallographic asymmetric unit. Crystals were flash-frozen in liquid nitrogen using 20% glycerol as the cryoprotectant solution. Data sets up to 2.72 Å resolution were collected from a single frozen crystal at IMCA beamline 17-ID at Argonne National Laboratory (APS). Data were processed and scaled using autoPROC, and the final data set was 72% complete. The structure was solved by molecular replacement using PHASER. Several iterative rounds of manual adjustment and model rebuilding using COOT and crystallographic refinement using autoBUSTER resulted in a crystallographic R of 22%. work and 24.4% R free A final model with R work =||F obs |-|F calc || / |F obs | and R free is R work is calculated for 5% of the randomly selected reflections that were omitted from the refinement process. A ribbon diagram of the cocrystal structure is shown in Figure 3.

[0581] result The amino acids of IL-27RA and gp130 that made close contacts (within 3.80 Å) with anti-IL-27RA antibody 2255 and gp130 antibody 3754 are shown in Tables 19 and 20, respectively. Briefly, the epitopes of the two Fabs are described as follows: Fab-2255 binds exclusively to domain D2 of the receptor, utilizing all CDR loops for contacts except CDR-L1. The binding interface is dominated by polar and electrostatic interactions (a total of nine hydrogen bond contacts) with heavy chain loops CDR-H2 and -H1 contributing most to the interaction. The buried surface area on the antigen is extensive -1,714 Å. 2 is.

[0582] Fab-3754 binds at the tip of domain D1 of gp130. All CDR loops except CDR-L2 contact the antigen. The binding interface is predominantly polar, with nine specific hydrogen bond contacts in its center. Heavy chain loops CDR-H3, -H2, and -H1 contribute most to the interaction. The size of the binding interface is 1,461 Å, located at the bottom to the mid-end of the mAb-antigen interface. 2 is.

[0583] [Table 15]

[0584] [Table 16]

[0585] Example 12 Expression, purification and characterization of alternative bispecific format variants The IL27RA / gp130 bispecific antibody GBT-IL-27R-4933 was constructed using the same variable heavy and variable light regions from GBT-IL-27R-4894 in an alternative format to test the impact of altered heterodimerization strategies on bispecific function and manufacturing characteristics. The alternative format, utilizing knobs-in-holes Fc (KiH) heterodimerization, is termed KiH mFd ( FIG. 9 ). This utilizes a Fab configuration termed "modified Fd" (mFd) and was used for the anti-gp130 FAb. In this configuration, the anti-gp130 light chain (Table 21) was conjugated to the lower hinge region of a human IgG1-effector function-minimized Fc region (DKTHTCPPCP) to generate the VL-CL-Fc protein chain of this bispecific modality. An engineered Fd chain was designed to pair with the anti-gp130 LC in a VL-CL-Fc chain, consisting of the anti-gp130 VH, human IgG1-CH1 (Table 21), and the upper human IgG1 hinge amino acids EPKSC harboring a Cys at linear position 221 for interchain disulfide formation with a Cys (linear position 214) in the anti-gp130 Fab kappa constant domain. The GBT-IL-27R-4933 bispecific was constructed using the KiH mFd-bispecific modality.

[0586] Specifically, the LC of gp130-4875 (SEQ ID NO: 24) was grafted to the lower hinge region of an IgG1-effector function-minimized Fc engineered with whole heterodimerization mutations T(360)S, L(362)A, and Y(401)V along with S(348)C (linear numbering) to generate the GBT-IL-27R-4933 VL-CL-Fc chain (Table 21). The modified Fd chain of GBT-IL-27R-4933 (Table 21) was constructed by fusing the gp130-4875 VH (SEQ ID NO: 21) to the IgG1 CH1 (SEQ ID NO: 9) and upper hinge sequence EPKSC. IL-27RA 4880 VH (SEQ ID NO: 7) was fused to IgG CH1 (SEQ ID NO: 9) and an IgG1-effector function-minimized Fc bearing knob heterodimerization mutations T(364)W+Y(347)C (linear numbering) to generate GBT-IL-27R-4933 HC (Table 21). GBT-IL-27R-4933 LC is identical to IL-27RA 4880 LC (SEQ ID NO: 14).

[0587] [Table 17-1]

[0588] [Table 17-2]

[0589] The KiH-mFd IL27RA / gp130 bispecific antibody GBT-IL-27R-4933 was produced by transient co-expression of all four protein chains in Expi293F™ host cells using the manufacturer's recommended protocol or by generation of a stable CHO cell line using the methods described in Example 5. Purification of the bispecific was performed in a multi-step process, first using standard Protein A (MabSelect SuRe LX) and TMAE chromatography (run in 50 mM Tris, pH 8.3), followed by mixed-mode anion exchange chromatography (CaptoAdhere, Cytiva) and hydrophobic interaction chromatography (HIC) on a Phenyl 650M column (TOSOH). A final buffer exchange was performed as described in Example 5.

[0590] A comparison of the process yield and purity of two IL27RA / gp130 bispecific antibodies: GBT-IL-27R-4894 (EE-RR format) and GBT-IL-27R-4933 (KiH-mFd format) is shown in Table 22. Significant differences were observed between the two formats. Although GBT-IL-27R-4894 (EE-RR format) required two separate Protein A chromatography columns for initial purification of the EE and RR parent molecules prior to oxidation-reduction, the overall process required fewer non-standard steps and produced protein with higher yield and purity than GBT-IL-27R-4933 (KiH-mFd format). Stable CHO pool expression of GBT-IL-27R-4933 was 0.35 / g / L as measured by Protein A yield, while expression of GBT-IL-27R-4894 was approximately three-fold higher. After Protein A purification, the EE and RR arms of GBT-IL-27R-4894 were >99% pure as measured by SEC, whereas GBT-IL-27R-4933 was only 55% pure, which was close to the 40% high molecular weight species that were not removed by TMAE. High molecular weight material was removed from GBT-IL-27R-4933 by mixed-mode and HIC steps, but 5–10% residual homodimer remained in the final product. In contrast, GBT-IL-27R-4894 (EE-RR format) protein could be purified to >99% purity, with <0.01% homodimer remaining in the final material.

[0591] [Table 18]

[0592] Biophysical and bioanalytical evaluation: The IL27RA / gp130 bispecific antibodies GBT-IL27R-4933 (knobs-in-holes) and GBT-IL27R-4894 (EE-RR) were subjected to extensive characterization to assess the bioanalytical and biophysical properties of these complex molecules. In particular, the following methods were used to evaluate key molecular properties: analytical size-exclusion chromatography (aSEC) to determine percent high molecular weight species (HMMS) as an indicator of aggregation, thermal stability using differential scanning calorimetry (DSC), non-reducing capillary gel electrophoresis (cGE) to assess percent peak of interest (POI), imaging capillary electrophoresis (iCE) to assess charge heterogeneity, dynamic light scattering (DLS) to assess viscosity, and AC-SINS for nonspecificity, DNA ELISA, insulin ELISA, and human FcRn chromatography.

[0593] Analytical SEC was performed using a YMC-Pack Diol-200 SEC column in 20 mM NaPO, 400 mM NaCl, pH 7.2 buffer. The retention time (min) and peak width (min) at 50% height of the main peak, as well as the areas under the curve for the main peak (POI), low molecular weight species (LMMS), and HMMS peaks, were recorded and used to calculate percent main peak (POI), HMMS, and LMMS. Protein samples were concentrated to approximately 150 mg / mL and maintained at 25°C for up to 6 weeks, or concentrated to 5 mg / mL and subjected to stress at 40°C for up to 4 weeks.

[0594] For the DSC method, 0.3 mg / mL of sample was dispensed into the sample tray of a MicroCal PEAQ-DSC Automated (Malvern Panalytical, Ltd.), equilibrated at 10°C for 5 minutes, and then scanned at a rate of 100°C / h to 110°C. Raw data were baseline corrected and normalized to protein concentration. Data were fitted to a non-two-state model with the appropriate number of transitions using MicroCal PEAQ-DSC software (Malvern Panalytical, Ltd.).

[0595] Viscosity was measured by a DLS (dynamic light scattering) bead-based method at concentrations up to approximately 175 mg / mL. Purified antibodies in phosphate buffer solution pH 7.2 (PBS) were extensively dialyzed against 20 mM histidine, 8.5% sucrose, 0.05 mg / mL EDTA pH 5.8 using a membrane cassette device 10K MWCO (Thermo Scientific). The antibodies were concentrated using a Viva spin centrifugal concentrator 10K MWCO (GE Healthcare). Proteins were concentrated to approximately 175 mg / mL, and lower concentrations were prepared by dilution with sample buffer. All samples were prepared in 12 μL. 300 nm beads (Nanosphere, Thermo Scientific) were added to protein samples and buffer blanks. The beads were diluted 1:100 in 20 mM histidine, 8.5% sucrose, 0.05 mg / mL EDTA pH 5.8, and 0.75 μL of the diluted beads was spiked into the protein sample. The protein / bead and buffer / bead samples were mixed by gentle vortexing. 8 μL of the sample was transferred to a 1536-well plate (SensoPlate, glass bottom, Greiner Bio-One) for analysis by DLS. The plate was sealed with optically clear tape and centrifuged at 2000 RPM for 2 minutes to remove bubbles. DLS measurements were performed using a DynaPro Plate Reader (Wyatt Technology, Santa Barbara, Calif.). Samples were incubated at 25°C and measured over 15 sequential 25-second acquisitions. Bead radii were averaged for data acquisitions with acceptable decay curves. Viscosity was calculated based on the Stokes-Einstein equation. Sample viscosity was calculated as the measured apparent radius divided by the nominal bead radius times the viscosity of water at 25°C, 0.893 cP.

[0596] Non-reduced cGE was performed using a Caliper LabChip GXII (PerkinElmer Inc., Hopkinton, MA) according to the manufacturer's recommended protocol. Charge heterogeneity was analyzed using a Protein Simple iCE3 instrument (ProteinSimple, San Jose, CA) equipped with a PrinCE Autosampler according to the following specifications: Protein was diluted to 2 mg / mL in water. Sample diluent consisted of 0.01 mg / mL pI marker 7.55, 0.01 mg / mL pI marker 10.1, 1.0% Pharmalyte pH 5-8, 3.0% Pharmalyte pH 8-10.5, 0.25% methylcellulose, 2.0 M urea, and 4.25 mM arginine. Samples contained 15 μL of 2 mg / mL protein and 85 μL of sample diluent. Samples were focused at 1500 volts for 1 minute, then at 3000 volts for 9 minutes. The IL27RA / gp130 bispecific antibody was further subjected to DNA / insulin polyreactivity, AC-SINS self-association, and human FcRn chromatography biophysical characterization assays to assess non-specific properties as described in Example 4.

[0597] A summary of the results of the biophysical and bioanalytical evaluation of GBT-IL27R-4933 (knobs-in-holes) and GBT-IL27R-4894 (EE-RR) indicates that both generally possess favorable molecular properties comparable to standard well-behaved antibodies (Table 23). Both exhibit good thermal stability with Tm values >65°C and low viscosity (15 cP or less at 175 mg / ml) in 20 mM histidine, 8.5% sucrose, 0.05 mg / mL EDTA pH 5.8. Both variants exhibit acceptable nonspecific binding profiles and acceptable stability by aSEC, cGE, and iCE after challenge or incubation in the presence of mouse serum at 25°C and 40°C (Table 23).

[0598] [Table 19-1]

[0599] [Table 19-2]

[0600] Functional activity: Comparison of functional activity showed that GBT-IL27R-4933 (knobs-in-holes) had slightly lower agonist potency than GBT-IL27R-4894 (EE-RR) in three assays in human whole blood (Table 24). Assays were performed as described in Example 8. EC for STAT1 phosphorylation in CD3+ T cells 50 The EC values for PD-L1 upregulation in CD14+ monocytes were 0.233 and 0.083 nM for -4933 and -4894, respectively (2.8-fold ratio). 50 were 0.006 and 0.002 nM for -4933 and -4894, respectively (a 3-fold ratio), and the EC 50 were 0.015 and 0.008 nM for -4933 and -4894, respectively (a 1.8-fold ratio).

[0601] Based on observed differences in bioactivity and manufacturing characteristics, GBT-IL27R-4894 (EE-RR format) demonstrated consistent advantages over GBT-IL27R-4933 (knob-in-hole).

[0602] [Table 20]

[0603] [Table 21]

[0604] [Table 22]

[0605] Table 23

[0606]

Table 24-1

[0607]

Table 24-2

[0608]

Table 24-3

[0609]

Table 24-4

[0610]

Table 24-5

[0611]

Table 24-6

[0612]

Table 24-7

[0613]

Table 24-8

Claims

1. An isolated antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL), (i) an antibody comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising the CDR-H1, CDR-H2, and CDR-H3 sequences of SEQ ID NO: 7 and the CDR-L1, CDR-L2, and CDR-L3 sequences of SEQ ID NO: 8; (ii) an antibody comprising a heavy chain variable region (IL27RA-VH) and a light chain variable region (IL27RA-VL) comprising a CDR-H1 sequence according to SEQ ID NO: 1; a CDR-H2 sequence according to SEQ ID NO: 2; a CDR-H3 sequence according to SEQ ID NO: 3, and comprising a CDR-L1 sequence according to SEQ ID NO: 4; a CDR-L2 sequence according to SEQ ID NO: 5; and a CDR-L3 sequence according to SEQ ID NO: 6; (iii) an antibody comprising the IL27RA-VH sequence of SEQ ID NO: 7 and the IL27RA-VL sequence of SEQ ID NO: 8; (iv) an antibody comprising an IL27RA-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 31 and an IL27RA-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 32; (v) an antibody that competes with a second antibody for binding to IL27RA, the second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 7 and a VL having the amino acid sequence of SEQ ID NO: 8; and (vi) An antibody that specifically binds to IL27RA, comprising a heavy chain variable region (IL27RA-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127622, and a light chain variable region (IL27RA-VL) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127623. An antibody selected from the group consisting of:

2. further comprising an Fc domain, wherein the Fc domain is an IgA, IgD, IgE, IgM, or IgG isotype; (i) L234A, L235A and G237A, according to EU numbering according to human IgG1 wild type; (ii) D221E and L368E (according to EU numbering), where numbering is according to human IgG1 wild type; and (iii) D221R and K409R (according to EU numbering), where numbering is according to human IgG1 wild type.

2. The antibody of claim 1, which may be a human IgG1 comprising one or more substitutions selected from one or more of the group consisting of:

3. (i) an antibody comprising a heavy chain having the amino acid sequence of SEQ ID NO: 13 and a light chain having the amino acid sequence of SEQ ID NO: 14; (ii) an antibody comprising a heavy chain having the amino acid sequence of SEQ ID NO: 27 and a light chain having the amino acid sequence of SEQ ID NO: 14; and (iii) an antibody encoded by an isolated polynucleotide encoding a heavy chain, a light chain, or both, of an antibody that binds to IL27RA, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 33, the nucleic acid sequence of SEQ ID NO: 34, or both; (iv) an antibody encoded by an isolated polynucleotide encoding a heavy chain, a light chain, or both, of an antibody that binds to IL27RA, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO:39, the nucleic acid sequence of SEQ ID NO:34, or both; and (v) An antibody that specifically binds to IL27RA, comprising a heavy chain (IL27RA-HC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127626, and a light chain (IL27RA-LC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127627. The antibody of claim 1 , comprising a heavy chain (HC) and a light chain (LC) selected from the group consisting of:

4. The antibody of claim 1 , which antagonizes IL27RA.

5. 4. The antibody of claim 1, further comprising a binding domain for a second target, wherein the second target may be gp130.

6. 1. An isolated antibody that specifically binds to glycoprotein 130 (gp130), comprising a heavy chain variable region (gp130-VH) and a light chain variable region (gp130-VL), (i) an antibody comprising the CDR-H1, CDR-H2 and CDR-H3 sequences of SEQ ID NO: 21 and the CDR-L1, CDR-L2 and CDR-L3 sequences of SEQ ID NO: 22; (ii) an antibody comprising a CDR-H1 sequence according to SEQ ID NO: 15; a CDR-H2 sequence according to SEQ ID NO: 16; a CDR-H3 sequence according to SEQ ID NO: 17, and comprising a CDR-L1 sequence according to SEQ ID NO: 18; a CDR-L2 sequence according to SEQ ID NO: 19; and a CDR-L3 sequence according to SEQ ID NO: 20; (iii) an antibody comprising the gp130-VH sequence of SEQ ID NO: 21 and the gp130-VL sequence of SEQ ID NO: 22; (iv) an antibody comprising a gp130-VH sequence encoded by the nucleic acid sequence of SEQ ID NO: 35 and a gp130-VL sequence encoded by the nucleic acid sequence of SEQ ID NO: 36; (v) an antibody that competes with a second antibody for binding to pg130, the second antibody comprising a VH having the amino acid sequence of SEQ ID NO: 21 and a VL having the amino acid sequence of SEQ ID NO: 22; and (vi) an antibody comprising a heavy chain variable region (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127624, and a light chain variable region (gp130-VL) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127625. An antibody comprising one or more selected from the group consisting of:

7. further comprising an Fc domain, wherein the Fc domain is an IgA, IgD, IgE, IgM, or IgG isotype; (i) L234A, L235A and G237A, according to EU numbering according to human IgG1 wild type; (ii) D221E and L368E (according to EU numbering), where numbering is according to human IgG1 wild type; and (iii) D221R and K409R (according to EU numbering), where numbering is according to human IgG1 wild type.

7. The antibody of claim 6, which may be a human IgG1 comprising one or more substitutions selected from one or more of the group consisting of:

8. (i) an antibody comprising a heavy chain having the amino acid sequence of SEQ ID NO: 30 and a light chain having the sequence of SEQ ID NO: 24; (ii) an antibody comprising a heavy chain having the amino acid sequence of SEQ ID NO: 23 and a light chain having the amino acid sequence of SEQ ID NO: 24; (iii) an antibody encoded by an isolated polynucleotide encoding a heavy chain, a light chain, or both, of an antibody that binds to gp130, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 33, the nucleic acid sequence of SEQ ID NO: 34, or both; (iv) an antibody encoded by an isolated polynucleotide encoding a heavy chain, a light chain, or both, of an antibody that binds to gp130, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 40, the nucleic acid sequence of SEQ ID NO: 38, or both; and (v) An antibody that specifically binds to gp130, comprising a heavy chain (gp130-HC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127628, and a light chain (gp130-LC) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127629. The antibody of any one of claims 6 to 7, comprising a heavy chain (HC) and a light chain (LC) selected from the group consisting of:

9. The antibody of claim 6 , further comprising a binding domain for a second target, wherein the second target may be IL27RA.

10. An isolated antibody comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises an antibody described in any one of claims 1 to 5, and the second antigen-binding site comprises an antibody described in any one of claims 6 to 9.

11. An isolated antibody comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises IL27RA-VH and IL27RA-VL, and the second antigen-binding site comprises gp130-VH and gp130-VL; (i) a) the IL27RA-VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 1; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 2; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 3; b) the IL27RA-VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO:4; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO:5; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO:6; c) the gp130-VH comprises (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 15; (ii) a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 16; and (iii) a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 17; d) an antibody wherein the gp130-VL comprises (i) a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 18; (ii) a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 19; and (iii) a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 20; (ii) an antibody comprising an IL27RA-VH comprising the amino acid sequence of SEQ ID NO: 7, an IL27RA-VL comprising the amino acid sequence of SEQ ID NO: 8, a gp130-VL comprising the amino acid sequence of SEQ ID NO: 21, and a gp130-VL comprising the amino acid sequence of SEQ ID NO: 22; and (iii) an antibody comprising an IL27RA-VH sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127622 and an IL27RA-VL sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127623, and further comprising a gp130-VH sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127624 and a light chain variable region (gp130-VL) sequence encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127625. An antibody selected from the group consisting of:

12. further comprising an Fc domain, wherein the Fc domain is an IgA, IgD, IgE, IgM, or IgG isotype; (i) L234A, L235A and G237A according to EU numbering, where numbering is according to human IgG1 wild type; (ii) D221E and L368E (according to EU numbering), where numbering is according to human IgG1 wild type; and (iii) D221R and K409R (according to EU numbering), where numbering is according to human IgG1 wild type.

12. The antibody of any one of claims 10 to 11, which may be a human IgG1 comprising one or more substitutions selected from one or more of the group consisting of:

13. 13. The antibody of claim 12, comprising an Fc domain comprising a first and second Fc chain, each containing one or more amino acid modifications that promote association of the first Fc chain with the second Fc chain.

14. 14. The antibody of claim 13, wherein the first Fc chain comprises amino acid modifications at positions 221 and 409 (EU numbering) of human IgG1, and the second Fc chain comprises amino acid modifications at positions 221 and 368 (EU numbering) of human IgG1, wherein the modifications may be D221R and K409R in the first chain and D221E and L368E in the second chain.

15. An isolated antibody comprising a first antigen-binding site that binds to IL27RA and a second antigen-binding site that binds to gp130, wherein the first antigen-binding site comprises a VH and a VL, and the second antigen-binding site comprises a VH and a VL, and the antibody has a binding affinity for human IL27RA that is at least two orders of magnitude lower than the antibody's binding affinity for human gp130.

16. (i) an antibody comprising a first heavy chain and a first light chain and a second heavy chain and a second light chain, wherein the first heavy chain and the first light chain comprise a first antigen-binding site that binds to IL27RA, and the second heavy chain and the second light chain comprise a second antigen-binding site that binds to gp130, wherein the first antibody heavy chain comprises the amino acid sequence of SEQ ID NO:27, the first antibody light chain comprises the amino acid sequence of SEQ ID NO:14, the second antibody heavy chain comprises the amino acid sequence of SEQ ID NO:30, and the second antibody light chain comprises the amino acid sequence of SEQ ID NO:34; and (ii) an antibody comprising a heavy chain (IL27RA-HC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127626, and a light chain (IL27RA-LC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127627, and further comprising a heavy chain (gp130-VH) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127628, and a light chain (gp130-LC) encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127629.

16. The antibody of any one of claims 1 to 15, selected from the group consisting of:

17. (i) a higher binding affinity for IL27RA than for gp130 as measured by SPR; (ii) at least a 10-fold higher binding affinity for IL27RA than for gp130, as measured by SPR; (iii) the antibody binds to human IL27RA with an affinity of less than 1 nM, as measured by SPR; (iv) the antibody binds to human gp130 with an affinity of less than 1000 nM as measured by SPR; (v) the antibody agonizes IL27RA; (vi) the antibody binds to cynomolgus monkey IL27RA; (vii) the binding KD of the antibody to cynomolgus IL27RA is within 10 orders of magnitude of the binding KD of the antibody to human IL27RA, as measured by SPR; (viii) the antibody antagonizes gp130; (ix) the antibody binds to cynomolgus gp130; (x) the binding KD of the antibody to cynomolgus gp130 is within three orders of magnitude of the binding KD of the antibody to human gp130, as measured by SPR; (xi) the antibody has at least a 100-fold higher binding affinity for IL27RA than for gp130, as measured by SPR; (xii) the antibody binds to human IL27RA with an affinity of less than 1 nM, as measured by SPR; (xiii) the antibody binds to human gp130 with an affinity of less than 1000 nM, as measured by SPR; (xiv) the antibody binds to human IL27RA with an affinity between 0.01 nM and 5 nM and binds to human gp130 with an affinity between 10 nM and 1000 nM, as measured by SPR; (xv) the antibody is characterized by an EC50 of less than 10 nM in a fluorescent flow cytometry assay of phosphorylated STAT1 CD3+ T cells; (xvi) the antibody is characterized by an EC50 of less than 5 nM in a phosphorylated STAT1 CD3+ T cell flow cytometry assay; (xvii) the antibody is capable of down-regulating pathogenic cytokine production; (xviii) the antibody is capable of downregulating Il-17 production in helper T cells; (xix) the antibody is characterized by an IC50 of less than 0.05 nM as measured by Il-17 immunoassay; (xx) the antibody is capable of promoting regulatory T cell differentiation; (xxi) the antibody is capable of upregulating indoleamine-pyrrole 2,3-dioxygenase (IDO1) expression; (xxii) the antibody is capable of upregulating indoleamine-pyrrole 2,3-dioxygenase (IDO1) expression in CD14+ human monocytes and / or human colonocytes; and (xxiii) the antibody is characterized by an EC50 of less than 100 nM as determined by an LC-MS assay of kynurenine production; 17. The antibody of any one of claims 9 to 16, having one or more characteristics selected from the group consisting of:

18. 18. A pharmaceutical composition comprising a therapeutically effective amount of an antibody according to any one of claims 1 to 17 and a pharmaceutically acceptable carrier.

19. 19. The antibody of any one of claims 1 to 17 or the pharmaceutical composition of claim 18, for use in the treatment of a disease, wherein the inflammatory disease may be one or more selected from the group consisting of inflammatory diseases, inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

20. 19. A method of treating a medical condition, comprising the step of administering to a subject in need thereof a therapeutically effective amount of the antibody of any one of claims 1 to 17 or the pharmaceutical composition of claim 18, wherein the medical condition may be one or more selected from the group consisting of inflammatory diseases, inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), multiple sclerosis, rheumatoid arthritis, celiac disease, asthma, allergic diseases, obesity, type 2 diabetes, and cancer.

21. 18. An isolated polynucleotide encoding the antibody of any one of claims 1 to 17.

22. 22. The polynucleotide of claim 21, which is RNA.

23. 1. An isolated polynucleotide comprising: (i) a polynucleotide encoding the VH of an antibody that binds to IL27RA, comprising the nucleic acid sequence of SEQ ID NO: 31; (ii) a polynucleotide encoding the VL of an antibody that binds to IL27RA, comprising the nucleic acid sequence of SEQ ID NO: 32; (iii) a polynucleotide encoding a VH and a VL of an antibody that binds to IL27RA, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO: 31, and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO: 32; (iv) a polynucleotide encoding the heavy chain, the light chain, or both, of an antibody that binds to IL27RA, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 33, the nucleic acid sequence of SEQ ID NO: 34, or both. (v) an isolated polynucleotide encoding the heavy chain, the light chain, or both, of an antibody that binds to IL27RA, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO:39, the nucleic acid sequence of SEQ ID NO:34, or both; (vi) a polynucleotide encoding the VH of an antibody that binds to gp130, comprising the nucleic acid sequence of SEQ ID NO: 35; (vii) a polynucleotide encoding the VL of an antibody that binds to gp130, comprising the nucleic acid sequence of SEQ ID NO: 36; (viii) a polynucleotide encoding a VH and a VL of an antibody that binds to gp130, wherein the polynucleotide encoding the VH comprises the nucleic acid sequence of SEQ ID NO: 35, and the polynucleotide encoding the VL comprises the nucleic acid sequence of SEQ ID NO: 36; (ix) a polynucleotide encoding the heavy chain, the light chain, or both, of an antibody that binds to gp130, comprising the nucleic acid sequence of SEQ ID NO: 37, the nucleic acid sequence of SEQ ID NO: 38, or both; (x) a polynucleotide encoding a heavy chain, a light chain, or both, of an antibody that binds to gp130, wherein the nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 40, the nucleic acid sequence of SEQ ID NO: 38, or both; (xi) a polynucleotide encoding IL27RA-VH encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127622. (xii) IL27RA-VL encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127623. (xiii) a polynucleotide encoding the IL27RA-VH sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127622, and the IL27RA-VL sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127623; (xiv) a polynucleotide encoding IL27RA-HC encoded by a plasmid deposited with the ATCC having ATCC accession number PTA-127626; (xv) a polynucleotide encoding IL27RA-LC encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127627; (xvi) a polynucleotide encoding the IL27RA-HC sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127626, and the IL27RA-LC sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127627; (xvii) a polynucleotide encoding gp130-VH encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127624; (xviii) a polynucleotide encoding gp130-VL encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127625; (xix) a polynucleotide encoding the gp130-VH sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127624, and the gp130-VL sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127625; (xx) a polynucleotide encoding gp130-HC encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127628; (xxi) a polynucleotide encoding gp130-LC encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127629; and (xxii) a polynucleotide encoding the gp130-VH sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127628, and the gp130-LC sequence encoded by the plasmid deposited with the ATCC having ATCC accession number PTA-127629. A polynucleotide comprising one or more selected from the group consisting of:

24. A vector comprising the polynucleotide of claim 23.

25. 25. An isolated host cell comprising the polynucleotide of claim 23 or the vector of claim 24.

26. 26. A method of producing an isolated antibody, comprising culturing the host cell of claim 25 under conditions that result in the production of said antibody, and recovering said antibody.