Enhanced antigen-presenting cell preparation

A formulation of enhanced antigen-presenting cells with HPV antigens, cryopreservation medium, and human serum albumin activates T cells independently of HLA, providing a direct therapeutic option for HPV infections with sustained efficacy.

JP2025527190APending Publication Date: 2025-08-20STEMCELL TECHNOLOGIES CANADA INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025504473
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-28
Filing Date
2023-07-28
Publication Date
2025-08-20

AI Technical Summary

Technical Problem

Current treatments for HPV infections are preventative and have side effects, and there is a need for alternative therapeutic options that can target HPV directly.

Method used

A pharmaceutical formulation comprising enhanced antigen-presenting cells (APCs) capable of activating T cells in an HLA-independent manner, using a cryopreservation medium and human serum albumin solution, with APCs expressing increased costimulatory molecules and cytokines, and containing HPV antigens.

Benefits of technology

The formulation maintains APC viability for over a year and effectively activates T cells, offering a direct therapeutic approach to HPV infections without HLA restrictions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025527190000001_ABST
    Figure 2025527190000001_ABST
Patent Text Reader

Abstract

The present application provides formulations of enhanced antigen-presenting cells ("enhanced APCs"), the formulations comprising enhanced APCs that contain an antigen (e.g., a human papillomavirus (HPV) antigen) and one or more of the following: cryopreservation medium, cryopreservation medium, and human serum albumin. Also provided herein are methods of making such formulations and enhanced APCs.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This PCT application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 369,715, filed July 28, 2022, which is incorporated herein by reference in its entirety.

[0002] Reference to an electronically submitted sequence listing The contents of the Sequence Listing have been submitted electronically (Name: 4821_087PC01_SequenceListing_ST26.XML, Size: 36,447 bytes, and Creation Date: July 28, 2023), and are hereby incorporated by reference in their entirety.

[0003] The present disclosure generally relates to formulations comprising enhanced antigen-presenting cells (e.g., comprising one or more HPV antigens and exhibiting increased expression of costimulatory molecules and / or cytokines) that can activate T cells in an HLA-agnostic manner. Methods for producing such formulations are also provided. [Background technology]

[0004] Human papillomavirus, or HPV, is a virus that infects many people. In fact, over 75% of women and men will be infected at some point in their lives. While most HPV infections are asymptomatic and do not cause physical symptoms, infection in some people can cause growths known as papillomas and even cancer of the cervix, vulva, vagina, penis, oropharynx, and anus. In particular, HPV16 and HPV18 are known to cause approximately 70% of cervical cancer cases. Currently, there is no available treatment for HPV itself. Current treatment options generally aim to treat various illnesses that may be associated with HPV infection. While vaccines (e.g., GARDASIL®) have been approved, they are strictly preventative in nature and are not without side effects. Therefore, new and alternative treatment options for HPV infection are needed.

[0005] All references cited herein, including patent applications and publications, are incorporated by reference in their entirety. Patent publications WO2013 / 059343, WO2015 / 023982, WO2016 / 070136, WO2017041050, WO2017008063, WO2017 / 192785, WO2017 / 192786, WO2019 / 178005, WO2019 / 178006, WO2020 / 072833, WO2020 / 154696, and WO2020 / 176789, US20180142198, and US20180201889 are expressly incorporated by reference in their entirety. Summary of the Invention

[0006] Provided herein is a pharmaceutical formulation comprising (a) enhanced antigen-presenting cells ("enhanced APCs"), (b) a cryopreservation medium, and (c) a solution comprising human serum albumin ("human serum albumin solution"), wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner. Provided herein is a pharmaceutical formulation comprising (a) enhanced antigen-presenting cells ("enhanced APCs"), (b) a cryopreservation medium, (c) a cryopreservation medium, and (d) a solution comprising human serum albumin ("human serum albumin solution"), wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner.

[0007] In some embodiments, the human serum albumin solution comprises 25% human serum albumin.

[0008] In some embodiments, the formulation contains about 5×10 6 Approximately 1 × 10 reinforced APC 9 In some embodiments, the formulation comprises about 1 x 10 enriched APCs. 4 enriched APC / mL to approximately 1 x 10 9 In some embodiments, the formulation comprises about 1 x 10 enriched APC / mL. 6 enriched APC / mL to approximately 1 x 10 8 In some embodiments, the formulation comprises about 1.1 x 10 enriched APC / mL. 7containing enriched APC / mL.

[0009] In some embodiments, the viability of the enriched APCs is at least about 70%, at least about 80%, at least about 90%, or about 100%. In some embodiments, the enriched APCs in the formulation maintain a viability of about 70% or greater after storage at -140°C or below for at least about 12 months.

[0010] In some embodiments, the formulation comprises a cryopreservation medium at a concentration of about 40% to about 95% (w / w). In some embodiments, the cryopreservation medium is at a concentration of about 50% (w / w). In some embodiments, the formulation comprises a cryopreservation medium at a concentration of about 25% to about 35% (w / w). In some embodiments, the cryopreservation medium is at a concentration of about 30% (w / w). In some embodiments, the formulation comprises a human serum albumin solution at a concentration of about 15% to about 25% (w / w). In some embodiments, the human serum albumin solution is at a concentration of about 20% (w / w). In some embodiments, the formulation has a pH of about 6.0 to about 8.5. In some embodiments, the pH of the formulation is between about 7.0 and about 7.9.

[0011] As used herein, (a) about 5×10 6 Approximately 1 × 10 reinforced APC 9 (b) a cryopreservation medium at a concentration of about 40% (w / w) to about 95% (w / w); (c) a cryopreservation medium at a concentration of about 25% (w / w) to about 35% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 6.0 to about 8.5, and the enhanced APCs are capable of activating T cells in an HLA-agnostic manner.

[0012] As used herein, (a) about 1.05 × 10 8(b) a cryopreservation medium at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enhanced APCs are capable of activating T cells in an HLA-agnostic manner.

[0013] As used herein, (a) about 7.6 × 10 6 (b) a cryopreservation medium at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enhanced APCs are capable of activating T cells in an HLA-agnostic manner.

[0014] As used herein, (a) about 1 × 10 4 Enhanced APC / mL to approximately 1 x 10 9 Provided is a pharmaceutical formulation comprising: (a) enhanced antigen-presenting cells ("enhanced APC") at a concentration of enhanced APC / mL; (b) a cryopreservation medium at a concentration of about 40% (w / w) to about 95% (w / w); (c) a cryopreservation medium at a concentration of about 25% (w / w) to about 35% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 6.0 to about 8.5, and wherein the enhanced APC are capable of activating T cells in an HLA-agnostic manner.

[0015] As used herein, (a) about 1.1 × 10 7Provided is a pharmaceutical formulation comprising: (a) enhanced antigen-presenting cells ("enhanced APC") at a concentration of enhanced APC / mL; (b) a cryopreservation medium at a concentration of about 50% (w / w); (d) a cryopreservation medium at a concentration of about 30% (w / w); and (c) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is from about 7.0 to about 7.9, and wherein the enhanced APC are capable of activating T cells in an HLA-agnostic manner.

[0016] As used herein, (a) about 8.5 × 10 6 (b) a cryopreservation medium at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enhanced APCs are capable of activating T cells in an HLA-agnostic manner.

[0017] As used herein, (a) about 1.05 × 10 8 (b) about 4.99 g of cryopreservation medium; and (c) about 2.00 g of a solution comprising 25% human serum albumin (the "human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and the enriched APCs are capable of activating T cells in an agnostic manner.

[0018] As used herein, (a) about 1.05 × 10 8 (b) about 4.99 g of cryopreservation medium; (c) about 2.99 g of cryopreservation medium; and (d) about 2.00 g of a solution comprising 25% human serum albumin (the "human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enriched APCs are capable of activating T cells in an agnostic manner.

[0019] For any of the formulations provided herein that include a cryopreservation medium, in some embodiments, the cryopreservation medium is CryoStor® CS10. For any of the formulations provided herein that include a cryopreservation medium, in some embodiments, the cryopreservation medium is HypoThermasol® FRS.

[0020] In some embodiments, the formulations provided herein are sterile. In some embodiments, the formulations contain less than about 5 EU / mL of endotoxin. In some embodiments, the formulations contain less than about 4.2 EU / mL of endotoxin. In some embodiments, the formulations are mycoplasma-free.

[0021] The pharmaceutical formulations provided herein comprise enriched APCs, wherein the enriched APCs comprise T cells, B cells, NK cells, monocytes, or a combination thereof. In some embodiments, the enriched APCs comprise antigens, wherein the antigens comprise human papillomavirus (HPV) antigens. In some embodiments, the HPV comprises HPV-16 or HPV-18. In some embodiments, the antigens comprise peptides derived from HPV E6 and / or HPV E7. In some embodiments, the antigens comprise peptides derived from HPV E6 and HPV E7. In some embodiments, the antigens comprise the amino acid sequence set forth in any one of SEQ ID NOs: 14-17. In some embodiments, the antigens comprise a first antigen comprising the amino acid sequence set forth in SEQ ID NO: 14 and a second antigen comprising the amino acid sequence set forth in SEQ ID NO: 16.

[0022] In some embodiments, the formulations described herein comprise enhanced APCs, where the enhanced APCs exhibit increased expression of costimulatory molecules compared to corresponding non-enhanced APCs ("reference APCs"). In some embodiments, the costimulatory molecule comprises CD86. In some embodiments, the formulations described herein comprise enhanced APCs, where the enhanced APCs exhibit increased expression of cytokines compared to corresponding non-enhanced APCs ("reference APCs"). In some embodiments, the cytokine comprises a membrane-bound cytokine. In some embodiments, the cytokine comprises IL-2, IL-12, or both.

[0023] In some aspects, the formulations provided herein comprise enriched APCs, which are prepared by passing a cell suspension comprising input APCs through a cell-transforming constriction, thereby perturbing the APCs so that nucleic acids encoding antigens, costimulatory molecules, and / or cytokines enter the APCs via the perturbation upon contact with the APCs, thereby generating enriched APCs. In some aspects, the cell suspension comprising input APCs is cultured in combination with nucleic acids encoding antigens, costimulatory molecules, and / or cytokines, thereby contacting the nucleic acids encoding antigens, costimulatory molecules, and / or cytokines with the input APCs.

[0024] In some embodiments, the nucleic acid encoding the antigen, the nucleic acid encoding the costimulatory molecule, and / or the nucleic acid encoding the cytokine is mRNA. In some embodiments, the cell-transforming constriction comprises a diameter of about 4.2 μm to about 6 μm, or about 4.2 μm to about 4.8 μm.

[0025] In some embodiments, the enhanced APCs are conditioned in a medium containing an adjuvant. In some embodiments, the enhanced APCs are conditioned in a medium containing an adjuvant for about 2 hours to about 10 hours. In some embodiments, the enhanced APCs are conditioned in a medium containing an adjuvant for about 3 hours to about 6 hours. In some embodiments, the enhanced APCs are conditioned in a medium containing an adjuvant for about 4 hours. In some embodiments, the enhanced APCs are conditioned in a medium containing an adjuvant at about 37°C. In some embodiments, the adjuvant comprises CpG oligodeoxynucleotide (ODN), LPS, IFN-α, a STING agonist, a RIG-I agonist, poly I:C, R837, R848, a TLR3 agonist, a TLR4 agonist, or a TLR9 agonist. In some embodiments, the adjuvant is an ODN.

[0026] Some aspects of the present disclosure relate to vials containing any of the formulations provided herein.

[0027] Also provided herein are methods for producing a formulation comprising enhanced antigen-presenting cells ("enhanced APCs") capable of activating T cells in an HLA-agnostic manner, the methods comprising combining the enhanced APCs, a cryopreservation medium, and a human serum albumin solution. For such methods, in some embodiments, the human serum albumin solution comprises 25% human serum albumin. In some embodiments, after combination, the formulation comprises (a) about 5×10 6 Approximately 1 × 10 reinforced APC 9 (b) a cryopreservation medium at a concentration of about 40% (w / w) to about 95% (w / w), and (c) a human serum albumin solution at a concentration of about 15% (w / w) to about 25% (w / w), wherein the formulation has a pH of about 6.0 to about 8.5. In some embodiments, after combination, the formulation comprises (a) about 1.1 x 10 7(b) a cryopreservation medium at a concentration of about 50% (w / w); and (c) a human serum albumin solution at a concentration of about 20% (w / w), wherein the formulation has a pH of about 7.0 to about 7.9. In some embodiments, after combination, the formulation comprises (a) about 1.05 x 10 enriched APC / mL. 8 of enhanced APCs, (b) about 4.99 g of cryopreservation medium, and (c) about 2.00 g of human serum albumin solution, wherein the pH of the formulation is from about 7.0 to about 7.9.

[0028] Provided herein are methods for producing a formulation comprising enhanced antigen-presenting cells ("enhanced APCs") capable of activating T cells in an HLA-agnostic manner, the methods comprising combining the enhanced APCs, a cryopreservation medium, a cryopreservation medium, and a human serum albumin solution. For such methods, in some embodiments, the human serum albumin solution comprises 25% human serum albumin. In some embodiments, after combination, the formulation comprises (a) about 5×10 6 Approximately 1 × 10 reinforced APC 9 (b) cryopreservation medium at a concentration of about 40% (w / w) to about 95% (w / w), (c) cryopreservation medium at a concentration of about 25% (w / w) to about 35% (w / w), and (d) human serum albumin solution at a concentration of about 15% (w / w) to about 25% (w / w), wherein the pH of the formulation is about 6.0 to about 8.5. In some embodiments, after combination, the formulation comprises: (a) about 1.1 x 10 7 (b) a cryopreservation medium at a concentration of about 50% (w / w); and (c) a human serum albumin solution at a concentration of about 20% (w / w), wherein the formulation has a pH of about 7.0 to about 7.9. In some embodiments, after combination, the formulation comprises (a) about 1.05 x 10 enriched APC / mL. 8 of enhanced APCs, (b) about 4.99 g of cryopreservation medium, and (c) about 2.00 g of human serum albumin solution, wherein the pH of the formulation is from about 7.0 to about 7.9.

[0029] For the above methods of producing the formulation, in some embodiments, the cryopreservation medium comprises CryoStor® CS10. In some embodiments, the cryopreservation medium comprises HypoThermasol® FRS.

[0030] For any of the manufacturing methods provided above, in some embodiments, the method includes passing a cell suspension containing input APCs through a cell-transforming constriction, whereby nucleic acids encoding antigens, costimulatory molecules, and / or cytokines enter the APCs via the perturbation upon contact with the APCs, thereby perturbing the APCs to generate enhanced APCs. In some embodiments, the cell suspension is cultured with nucleic acids encoding antigens, costimulatory molecules, and / or cytokines, whereby nucleic acids encoding antigens, costimulatory molecules, and / or cytokines contact the input APCs. In some embodiments, the nucleic acids encoding antigens, costimulatory molecules, and / or cytokines are mRNA.

[0031] With respect to any of the manufacturing methods provided above, in some embodiments, the antigen comprises a human papillomavirus (HPV) antigen. In some embodiments, the HPV comprises HPV-16 or HPV-18. In some embodiments, the antigen comprises a peptide derived from HPV E6 and / or HPV E7. In some embodiments, the antigen comprises a peptide derived from HPV E6 and a peptide derived from HPV E7. In some embodiments, the antigen comprises the amino acid sequence set forth in any one of SEQ ID NOs: 14-17. In some embodiments, the antigen comprises a first antigen comprising the amino acid sequence set forth in SEQ ID NO: 14 and a second antigen comprising the amino acid sequence set forth in SEQ ID NO: 16. In some embodiments, the costimulatory molecule comprises CD86. In some embodiments, the cytokine comprises a membrane-bound cytokine. In some embodiments, the cytokine comprises IL-2, IL-12, or both. [Brief explanation of the drawings]

[0032] [Figure 1]

[0023] A schematic diagram of an exemplary strong APC that can be included in the pharmaceutical formulations provided herein is provided. As shown, five different mRNA molecules are encoded: (1) an HPV-16 E6 protein (e.g., a full-length protein) containing multiple epitopes; (2) an HPV-16 E7 protein (e.g., a full-length protein) containing multiple epitopes; (3) a CD86 (co-stimulatory molecule); (4) a membrane-bound IL-2 (cytokine); and (5) a membrane-bound IL-12 (cytokine). Once the mRNA is introduced into a cell (e.g., via squeezing), the mRNA is translated and the encoded protein is expressed by the APC. [Figure 2] Figures 2A-C show exemplary flow plots used to calculate the viability of enriched APCs contained in the pharmaceutical formulations described herein. Percent cell viability was calculated using the following formula: % Viability = (Total AO+ Cells - Dead DAPI+ Cells) / Total AO+ Cells × 100. "Total AO+ Cells" = Number of events captured in the acridine orange-positive gate (Figures 2A and 2C, showing AO intensity and diameter, respectively). "Dead DAPI+ Cells" = Number of events captured in the DAPI-positive gate (Figure 2B). Live cell count and percentage viability of nucleated cells (eAPCs). For the particular flow plot shown, the % viability of enriched APCs was approximately 92.1%. [Figure 3] 1 provides an exemplary flow plot showing that the enriched APCs described herein express CD45+ (a marker for nucleated hematopoietic cells, eg, PBMCs, eg, immune cells). [Figure 4]A and B provide exemplary qPCR analyses showing the amount of delivered mRNA present in the enhanced APCs described herein (A) and control cells (i.e., untreated PBMCs) (B). Specifically, the mRNAs shown include mRNA encoding the HPV-16 E6 protein ("E6"), mRNA encoding the HPV-16 E7 protein ("E7"), mRNA encoding CD86 ("CD86"), mRNA encoding membrane-bound IL-2 ("mbIL-2"), and mRNA encoding membrane-bound IL-12 ("mbIL-12"). [Figure 5] A-D show the frequency of cell subtypes that can be found within the enriched APCs described herein. The cell subtypes shown include B cells (CD19+, A), monocytes (CD14+, B), T cells (CD3+) and NK cells (CD56+) (C for both cell types), and granulocytes (CD66+, D). [Figure 6] Shown is the percentage of Annexin V positive cells observed within the enriched APCs described herein, as measured using flow cytometry. [Figure 7A] Figures A-D provide a comparison of the translation efficiency (as measured using flow cytometry) of CD86 mRNA, membrane-bound IL-2 mRNA, and membrane-bound IL-12 mRNA in different cell subtypes present in the enriched APCs described herein after squeeze treatment. The percentage of B cells among the enriched APCs that expressed CD86, membrane-bound IL-2 (mbIL-2), and membrane-bound IL-12 (mbIL-12) after squeeze treatment is shown. [Figure 7B] A-D provide a comparison of the translation efficiency (as measured using flow cytometry) of CD86 mRNA, membrane-bound IL-2 mRNA, and membrane-bound IL-12 mRNA in different cell subtypes present in the enriched APCs described herein after squeeze treatment. The percentage of T cells among the enriched APCs that expressed CD86, mbIL-2, and mbIL-12 after squeeze treatment is shown. [Figure 7C]Figures A-D provide a comparison of the translation efficiency (as measured using flow cytometry) of CD86 mRNA, membrane-bound IL-2 mRNA, and membrane-bound IL-12 mRNA in different cell subtypes present in the enriched APCs described herein after squeeze treatment. The percentage of monocytic cells among the enriched APCs that expressed CD86, mbIL-2, and mbIL-12 after squeeze treatment is shown. [Figure 7D] A-D provide a comparison of the translation efficiency (as measured using flow cytometry) of CD86 mRNA, membrane-bound IL-2 mRNA, and membrane-bound IL-12 mRNA in different cell subtypes present in the enriched APCs described herein after squeeze treatment. The percentage of NK cells among the enriched APCs that expressed CD86, mbIL-2, and mbIL-12 after squeeze treatment is shown. [Figure 8] A and B show the translation of E6 and E7 mRNAs, respectively, demonstrated by Western blotting in enriched APC after squeeze treatment. DETAILED DESCRIPTION OF THE INVENTION

[0033] The present application generally relates to pharmaceutical preparations comprising a population of antigen-presenting cells that have been modified such that the APCs exhibit one or more enhanced properties. Non-limiting examples of such enhanced properties are provided throughout this disclosure. Unless otherwise indicated, the terms "enhanced APCs" (or derivatives thereof) and "modified APCs" (or derivatives thereof) are used interchangeably to describe such APCs. As further described herein, enhanced APCs differ from other APCs in that these cells are capable of activating T cells in an HLA-agnostic manner. Thus, the pharmaceutical preparations described herein are useful in a variety of clinical settings, enabling treatment of a wide variety of subjects regardless of HLA haplotype. Additional aspects of the present disclosure are provided further below.

[0034] General Technology The techniques and procedures described or referred to herein are generally well understood and may be readily understood by those of skill in the art using conventional methodology, e.g., Molecular Cloning: A Laboratory Manual (Sambrook et al., 2004). th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2012); Current Protocols in Molecular Biology (FMAusubel, et al. eds., 2003); Methods in Enzymology Series (Academic Press, Inc.); PCR 2:A Practical Approach (MJMacPherson, BD Hames and GRTaylor eds., 1995); Antibodies, A Laboratory Manual(Harlow and Lane,eds.,1988);Culture of Animal Cells:A Manual of Basic Technique and Specialized Applications(RIFreshney,6 thed.,J.Wiley and Sons,2010);Oligonucleotide Synthesis(M.J.Gait,ed.,1984);Methods in Molecular Biology,Humana Press;Cell Biology:A Laboratory Notebook(J.E.Cellis,ed.,Academic Press、1998);Introduction to Cell and Tissue Culture(J.P.Mather and P.E.Roberts、Plenum Press、1998);Cell and Tissue Culture:Laboratory Procedures(A.Doyle,J.B.Griffiths、and D.G. Newell,eds.,J.Wiley and Sons、1993-8);Handbook of Experimental Immunology(D.M.Weir and C.C.Blackwell,eds.,1996);Gene Transfer Vectors for Mammalian Cells(J.M.Miller and M.P.Calos,eds.,1987);PCR:The Polymerase Chain Reaction(Mullis et al.,eds.,1994);Current Protocols in Immunology(J.E.Coligan et al.,eds.,1991);Short Protocols in Molecular Biology(Ausubel et al.,eds.,J.Wiley and Sons、2002);Immunobiology(C.A.Janeway et al.,2004);Antibodies(P.Finch、1997);Antibodies:A Practical Approach(D.Catty.,ed.,IRL Press、1988-1989);Monoclonal Antibodies:A Practical Approach(P.Shepherd and C. Dean,eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (VT DeVita et al., eds., JB Lippincott Company, 2011).

[0035] definition For purposes of interpreting this specification, the following definitions shall apply, and whenever appropriate, terms used in the singular shall also include the plural and vice versa. In the event that any definition set forth below conflicts with any document incorporated herein by reference, the definition set forth below shall control.

[0036] As used herein, the singular terms "a," "an," and "the" refer to one or more of that entity, unless otherwise indicated. Thus, the terms "a" (or "an" or "the"), "one or more," and "at least one" can be used interchangeably herein.

[0037] As used herein, the terms "comprising," "having," "containing," and "including," as well as other similar forms and their grammatical equivalents, are intended to be equivalent in meaning and to be open-ended, not to imply that the item(s) following any one of these phrases is an exhaustive list of such item(s) or is limited only to the listed item(s). For example, an article "comprising" components A, B, and C can consist of (i.e., contain only) components A, B, and C, or can include not only components A, B, and C, but also one or more other components. Thus, "comprises" and its similar forms and its grammatical equivalents are intended and understood to include disclosures of "consisting essentially of" or "consisting of" embodiments.

[0038] Where a range of values is provided, unless the context clearly dictates otherwise, it is understood that each intervening value between the upper and lower limit of that range, to the tenth of the unit of the lower limit, and any other stated or intervening value in that stated range, is encompassed within the disclosure, subject to any specifically excluded range within the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0039] As used herein, the term "about" refers to a normal error range for each value, which is readily understood by those skilled in the art. Reference herein to "about" a value or parameter includes (and describes) aspects that are directed to the value or parameter itself. For example, a statement that refers to "about X" includes a statement of "X."

[0040] As used herein, the term "HLA-agnostic" means independent of human leukocyte antigen (HLA) haplotype. Generally, T cell activation requires recognition of antigens (as peptide fragments) presented on "human leukocyte antigens" or "HLA" expressed on certain cells. Due to the variability present in HLA molecules, a certain peptide is restricted to or binds only to a specific HLA molecule. Therefore, whether a specific antigenic peptide fragment induces an immune response in a subject closely depends on the specific HLA molecules present in the subject. As is apparent from the present disclosure, because the enhanced APCs described herein can activate T cells in an HLA-agnostic manner, they may have therapeutic effects in a larger population.

[0041] As used herein, "peripheral blood mononuclear cells" or "PBMCs" refer to a heterogeneous population of blood cells with round nuclei. Examples of cells that can be found in a population of PBMCs include lymphocytes, e.g., T cells, B cells, NK cells (including natural killer T cells (NKT cells) and cytokine-induced killer cells (CIK cells)), and monocytes, e.g., macrophages and dendritic cells. PBMCs can be isolated by means known in the art. For example, PBMCs can be derived from an individual's peripheral blood based on their density relative to other blood cells. In some embodiments, PBMCs are derived from an individual's peripheral blood using Ficoll (e.g., a Ficoll gradient). In some embodiments, PBMCs are derived from an individual's peripheral blood using the ELUTRA® Cell Separation System. PBMCs can be obtained from an individual undergoing apheresis.

[0042] As described and demonstrated herein, the enhanced APCs of the present disclosure are derived from PBMCs, for example, by expressing the PBMCs with one or more nucleic acid constructs (e.g., mRNA encoding an antigen, mRNA encoding a costimulatory molecule, and / or mRNA encoding a cytokine). Intracellular delivery of these constructs alters one or more properties of the PBMCs (e.g., expressing the encoded antigen on their surface such that the PBMCs are capable of activating antigen-specific T cells and exhibit increased expression of costimulatory molecules and / or cytokines), such that, following delivery, the enhanced cells are structurally and / or functionally distinct from the PBMCs.

[0043] As used herein, "payload" refers to a substance delivered into, e.g., loaded onto, a PBMC. "Payload," "cargo," "delivery agent," and "compound" are used interchangeably herein to refer to a substance delivered to a cell. In some embodiments, a payload may refer to a protein, a small molecule, a nucleic acid (e.g., RNA and / or DNA), a lipid, a carbohydrate, a macromolecule, a vitamin, a polymer, a fluorescent dye and fluorophore, a carbon nanotube, a quantum dot, a nanoparticle, and a steroid. In some embodiments, a payload may refer to a protein or a small molecule drug. In some embodiments, a payload may comprise one or more compounds. In some embodiments, a payload comprises a nucleic acid molecule, e.g., a nucleic acid molecule encoding an HPV antigen, a costimulatory molecule, and / or a cytokine.

[0044] As used herein, "treatment" or "treating" refers to an approach to obtaining beneficial or desired results, including clinical results. For purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviating one or more symptoms attributable to a disease, attenuating the extent of the disease, stabilizing the disease (e.g., preventing or delaying the worsening of the disease), preventing or delaying the spread of the disease (e.g., metastasis), preventing or delaying the recurrence of the disease, delaying or slowing the progression of the disease, improving the condition of the patient, providing remission (partial or complete) of the disease, reducing the dose of one or more other drugs required to treat the disease, delaying the progression of the disease, increasing or improving quality of life, increasing weight gain, and / or extending survival. Reduction of the pathological consequences of cancer (e.g., tumor burden) is also encompassed by "treatment." The methods of the present disclosure contemplate any one or more of these aspects of treatment.

[0045] As used herein, the term "enhance" can refer to the action of improving, enhancing, raising, or increasing the presence or activity of a particular target. For example, enhancing an immune response can refer to any action that leads to an improved, enhanced, raising, or increasing immune response. In an illustrative example, enhancing an immune response can refer to employing an antigen and / or adjuvant to improve, enhance, raise, or increase the immune response. In another example, enhancing expression of a nucleic acid can include, but is not limited to, increased transcription of the nucleic acid, increased mRNA abundance (e.g., increased mRNA transcription), decreased mRNA degradation, increased translation of the mRNA, etc. In another example, enhancing expression of a protein can include, but is not limited to, increased transcription of the nucleic acid encoding the protein, increased stability of the mRNA encoding the protein, increased translation of the protein, increased stability of the protein, etc.

[0046] As used herein, the term "induce" can refer to the action of initiating, promoting, stimulating, establishing, or bringing about a result. For example, inducing an immune response can refer to any action that leads to the initiation, promotion, stimulation, establishment, or bringing about a desired immune response. In another example, inducing expression of a nucleic acid can include, but is not limited to, initiating transcription of a nucleic acid, initiating mRNA translation, etc. In another example, inducing expression of a protein can include, but is not limited to, increasing the transcription of a nucleic acid encoding the protein, increasing the stability of an mRNA encoding the protein, increasing the translation of the protein, increasing the stability of the protein, etc.

[0047] The term "polynucleotide" or "nucleic acid," as used herein, refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of a polynucleotide can contain sugars and phosphate groups (as typically found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of a polynucleotide can contain polymers of synthetic subunits, such as phosphoramidates, and thus can be oligodeoxynucleoside phosphoramidates (P-NH2) or mixed phosphoramidate-phosphodiester oligomers. Additionally, double-stranded polynucleotides can be obtained from chemically synthesized single-stranded polynucleotide products by either synthesizing a complementary strand under appropriate conditions and annealing the strands, or by synthesizing a complementary strand de novo using DNA polymerase with an appropriate primer. As described herein, nucleic acids that can be delivered to cells using the expression methods provided herein include RNA (e.g., mRNA). As used herein, "RNA" includes both self-amplifying RNA (e.g., self-amplifying mRNA) and non-self-amplifying RNA (e.g., non-self-amplifying mRNA). As used herein, the term "self-amplifying RNA" refers to an RNA molecule that can replicate within a host, resulting in increased amounts of RNA and the protein (e.g., antigen) encoded by the RNA. As used herein, the term "mRNA" refers to any polynucleotide (either self-amplifying or non-self-amplifying) that encodes at least one polypeptide.

[0048] The terms "polypeptide," "peptide," and "protein" are used interchangeably and refer to a polymer of amino acid residues, but are not limited to a minimum length. Such polymers of amino acid residues can contain natural or unnatural amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by this definition. These terms also include post-expression modifications of the polypeptide, such as glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for purposes of this disclosure, "polypeptide" refers to a protein containing modifications to the native sequence, such as deletions, additions, and substitutions (generally conservative in nature), so long as the protein maintains the desired activity. These modifications may be deliberate, such as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts producing the protein or errors in PCR amplification.

[0049] As used herein, the term "adjuvant" refers to a substance that modulates and / or generates an immune response. Generally, an adjuvant is administered in conjunction with an antigen to result in an enhanced immune response to the antigen compared to the antigen alone. A variety of adjuvants are described herein.

[0050] The terms "CpG oligodeoxynucleotide" and "CpG ODN" as used herein refer to a DNA molecule 10 to 30 nucleotides in length containing a cytosine and guanine dinucleotide separated by a phosphate (also referred to herein as a "CpG" dinucleotide or "CpG"). CpG ODNs of the present disclosure contain at least one unmethylated CpG dinucleotide. That is, the cytosine in the CpG dinucleotide is not methylated (i.e., is not a 5-methylcytosine). CpG ODNs may have a partial or complete phosphorothioate (PS) backbone.

[0051] As used herein, "pharmaceutically acceptable" or "pharmacologically compatible" means a material that is not biologically or otherwise undesirable, i.e., the material can be incorporated into a pharmaceutical composition administered to a patient without causing any significant undesirable biological effects or interacting in a deleterious manner with any other components of the composition in which it is contained. Pharmaceutically acceptable carriers or excipients preferably have met the required standards of toxicology and manufacturing testing and / or are listed in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration.

[0052] For any structural and functional characteristics described herein, methods for determining these characteristics are known in the art.

[0053] As used herein, a "microfluidic system" refers to a system in which low volumes (e.g., m\L, nL, pL, fL) of fluid are processed to achieve individualized treatment of small volumes of liquid. Certain implementations described herein include multiplexing, automation, and high-throughput screening. Fluids (e.g., buffers, solutions, payload-containing solutions, or cell suspensions) can be moved, mixed, separated, or processed. In certain aspects described herein, a microfluidic system is used to apply a mechanical constriction to cells suspended in a buffer to induce a perturbation (e.g., a hole) in the cell, allowing a payload or compound to enter the cytosol of the cell.

[0054] As used herein, the term "constriction" refers to a narrow passage. In some embodiments, the constriction is a microfluidic channel, such as contained within a microfluidic device. In some embodiments, the constriction is a pore or is contained within a pore. When the constriction is a pore, in some embodiments, the pore is contained within a surface. Unless otherwise indicated, the term constriction refers to both microfluidic channels and pores, as well as other suitable constrictions available in the art. Thus, where applicable, disclosure regarding microfluidic channels may also apply to pores and / or other suitable constrictions available in the art. Similarly, where applicable, disclosure regarding pores may equally apply to microfluidic channels and / or other suitable constrictions available in the art.

[0055] As used herein, the term "pore" refers to an opening, including, but not limited to, a hole, crevice, cavity, aperture, gap, gap, or perforation in a material. In some aspects (where indicated), the term refers to a pore in the surface of a microfluidic device as described in this disclosure. In some aspects (where indicated), the pore may refer to a pore in a cell wall and / or cell membrane.

[0056] As used herein, the term "membrane" refers to a selective barrier or sheet containing pores. The term includes, but is not limited to, flexible sheet-like structures that act as boundaries or linings. In some embodiments, the term refers to a surface or filter containing pores. This term differs from the term "cell membrane," which refers to a semipermeable membrane that surrounds the cytoplasm of a cell.

[0057] As used herein, the term "filter" refers to a porous article that selectively allows passage of pores. In some aspects, the term refers to a surface or membrane that contains pores.

[0058] As used herein, the terms "deform" and "deformability" (including derivatives thereof) refer to a physical change within a cell. As described herein, when a cell passes through a constriction (such as that disclosed herein), the cell is subjected to various forces, including, but not limited to, mechanical deforming and / or shear forces, by the confining physical environment, which cause a disturbance in the cell membrane. As used herein, a "disturbance" in the cell membrane refers to any opening in the cell membrane that is not present under normal steady-state conditions (e.g., when no deforming force is applied to the cell). The disturbance can include a hole, tear, cavity, aperture, pore, gap, gap, perforation, or a combination thereof.

[0059] For any structural and functional characteristics described herein, methods for determining these characteristics are known in the art.

[0060] Disclosed Compositions Enhanced APC Provided herein is a pharmaceutical formulation comprising an enhanced APC capable of activating T cells in an HLA-agnostic manner.

[0061] In some embodiments, the formulation contains about 5×10 3 to about 5 × 10 10 In some embodiments, the formulation comprises about 5 x 10 enriched APCs. 4 to about 5 × 10 9 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 5 to about 5 × 10 9 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 6 to about 5 × 10 9 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 7 to about 5 × 10 9 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 8 to about 5 × 10 9 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 4 to about 5 × 10 8 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 4to about 5 × 10 7 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 4 to about 5 × 10 6 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 4 to about 5 × 10 5 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 5 to about 5 × 10 8 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 6 to about 5 × 10 8 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 7 to about 5 × 10 8 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 5 to about 5 × 10 7 In some embodiments, the formulation comprises 5 x 10 enriched APCs. 6 to about 5 × 10 7 Includes reinforced APCs.

[0062] In some embodiments, the formulation contains about 5×10 4 , about 1.0×10 4 , about 5×10 5 , about 1.0×10 5 , about 5×10 6 , about 1.0×10 6 , about 5×10 7 , about 0×10 7 , about 5×10 8 , about 1.0×10 8 , about 5×10 9 , about 1.0×10 9 , about 5.0×10 9 In some embodiments, the formulation comprises about 0.5 x 10 enriched APCs. 4 to approximately 1.0 × 10 4 , about 1.0×10 5 to approximately 0.5 × 10 5 , about 0.5×10 5 to approximately 1.0 × 10 5 , about 1.0×10 5 to approximately 0.5 × 10 6 , about 0.5×10 6 to approximately 1.0 × 106 , about 1.0×10 6 to approximately 0.5 × 10 7 , about 0.5×10 7 to approximately 1.0 × 10 7 , about 1.0×10 7 to approximately 0.5 × 10 8 , about 0.5×10 8 to approximately 1.0 × 10 8 , about 1.0×10 8 to approximately 0.5 × 10 9 , about 0.5×10 9 to approximately 1.0 × 10 9 , or approximately 1.0 × 10 9 to about 5 × 10 9 In some embodiments, the formulation comprises about 1 x 10 enriched APCs. 7 , about 2×10 7 , about 3×10 7 , about 4×10 7 , about 5×10 7 , about 6×10 7 , about 7×10 7 , about 8×10 7 , about 9×10 7 , about 1×10 8 , about 2×10 8 , about 3×10 8 , about 4×10 8 , about 5×10 8 , about 6×10 8 , about 7×10 8 , about 8×10 8 , about 9×10 8 , about 1×10 9 , about 2×10 9 , about 3×10 9 , about 4×10 9 , or about 5 × 10 9 Includes reinforced APCs.

[0063] In some embodiments, the formulation contains about 1 x 10 6 to approximately 1 × 10 9 In some embodiments, the formulation comprises about 1 x 10 enriched APCs. 7 to approximately 1 × 10 9 In some embodiments, the formulation comprises about 1 x 10 enriched APCs. 8 to approximately 1 × 10 9In some embodiments, the formulation comprises about 1 x 10 enriched APCs. 6 In some embodiments, the formulation comprises about 2 x 10 enriched APCs. 6 In some embodiments, the formulation comprises about 3 x 10 enriched APCs. 6 In some embodiments, the formulation comprises about 4 x 10 enriched APCs. 6 In some embodiments, the formulation comprises about 5 x 10 enriched APCs. 6 In some embodiments, the formulation comprises about 6 x 10 enriched APCs. 6 In some embodiments, the formulation comprises about 7 x 10 enriched APCs. 6 In some embodiments, the formulation comprises about 8 x 10 enriched APCs. 6 In some embodiments, the formulation comprises about 9 x 10 enriched APCs. 6 In some embodiments, the formulation comprises about 1 x 10 enriched APCs. 7 In some embodiments, the formulation comprises about 2 x 10 enriched APCs. 7 In some embodiments, the formulation comprises about 3 x 10 enriched APCs. 7 In some embodiments, the formulation comprises about 4 x 10 enriched APCs. 7 In some embodiments, the formulation comprises about 5 x 10 enriched APCs. 7 In some embodiments, the formulation comprises about 6 x 10 enriched APCs. 7 In some embodiments, the formulation comprises about 7 x 10 enriched APCs. 7 In some embodiments, the formulation comprises about 8 x 10 enriched APCs. 7 In some embodiments, the formulation comprises about 9 x 10 enriched APCs. 7 In some embodiments, the formulation comprises about 1 x 10 enriched APCs. 8 In some embodiments, the formulation comprises about 2 x 10 enriched APCs. 8 In some embodiments, the formulation comprises about 3 x 10 enriched APCs. 8 In some embodiments, the formulation comprises about 4 x 10 enriched APCs. 8 The preparation contains approximately 5 x 10 enriched APCs. 8 The preparation contains approximately 6 x 10 enriched APCs. 8The preparation contains approximately 7 x 10 enriched APCs. 8 The preparation contains approximately 8 x 10 enriched APCs. 8 The preparation contains approximately 9 x 10 enriched APCs. 8 The preparation contains approximately 1 x 10 enriched APCs. 9 In some embodiments, the formulation comprises about 1.05 x 10 enriched APCs. 8 In some embodiments, the formulation comprises about 7.6 x 10 enriched APCs. 6 Includes reinforced APCs.

[0064] As further described herein, in some embodiments, the formulations described herein are resuspended in a liquid medium. Thus, in some embodiments, the formulations of the present disclosure comprise liquid formulations. For such formulations, in some embodiments, the enriched cells are at least about 1 x 10 4 to approximately 1 × 10 9 In some embodiments, the enriched cells are present in the formulation at a concentration of about 1 x 10 enriched APC / mL. 5 to approximately 1 × 10 9 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 6 to approximately 1 × 10 9 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 7 to approximately 1 × 10 9 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 8 to approximately 1 × 10 9 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 4 to approximately 1 × 10 8 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 5 to approximately 1 × 10 8 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 6 to approximately 1 × 10 8 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 7 to approximately 1 × 10 8In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 4 to approximately 1 × 10 7 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 5 to approximately 1 × 10 7 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 6 to approximately 1 × 10 7 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 4 to approximately 1 × 10 6 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 4 to approximately 1 × 10 5 In some embodiments, the enriched cells are present at a concentration of about 1 x 10 enriched APC / mL. 4 In some embodiments, the formulation is present at a concentration of about 1.0 x 10 4 , 0.5×10 5 , 1.0×10 5 , 0.5×10 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , and 1.0 × 10 9 In some embodiments, the formulation comprises any one of 0.5×10 enriched APCs / mL. 4 to approximately 1.0 × 10 4 , about 1.0×10 5 to approximately 0.5 × 10 5 , about 0.5×10 5 to approximately 1.0 × 10 5 , about 1.0×10 5 to approximately 0.5 × 10 6 , about 0.5×10 6 to approximately 1.0 × 10 6 , about 1.0×10 6 to approximately 0.5 × 10 7 , about 0.5×10 7 to approximately 1.0 × 10 7, about 1.0×10 7 to approximately 0.5 × 10 8 , about 0.5×10 8 to approximately 1.0 × 10 8 , about 1.0×10 8 to approximately 0.5 × 10 9 , or approximately 0.5 × 10 9 to approximately 1.0 × 10 9 In some embodiments, the formulation comprises about 1 x 10 enriched APC / mL. 6 , 2 × 10 6 , 3×10 6 , 4×10 6 , 5×10 6 , 6×10 6 , 7×10 6 , 8×10 6 , 9×10 6 , and 1 × 10 7 In some embodiments, the enriched APCs comprise about 1 x 10 enriched APCs / mL. 6 cells / mL, approximately 2×10 6 cells / mL, approximately 3×10 6 cells / mL, approximately 4×10 6 cells / mL, approximately 5×10 6 cells / mL, approximately 6×10 6 cells / mL, approximately 7×10 6 cells / mL, approximately 8×10 6 cells / mL, approximately 9×10 6 cells / mL, or approximately 1 x 10 7 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 1 x 10 cells / mL. 6 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 2 x 10 cells / mL. 6 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 3 x 10 cells / mL. 6 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 4 x 10 cells / mL. 6 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 5 x 10 cells / mL. 6 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 6 x 10 cells / mL. 6In some embodiments, the enriched APCs are present in the formulation at a concentration of about 7 x 10 cells / mL. 6 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 8 x 10 cells / mL. 6 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 9 x 10 cells / mL. 6 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 1 x 10 cells / mL. 7 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 1.1 x 10 cells / mL. 7 In some embodiments, the enriched APCs are present in the formulation at a concentration of about 8.5 x 10 cells / mL. 6 Present in the formulation at a concentration of cells / mL.

[0065] The enhanced APCs described herein can include any suitable cells known in the art, so long as the cells can be enhanced to function in an HLA-agnostic manner (e.g., as described herein). Thus, in some embodiments, the formulations described herein include enhanced APCs that can activate T cells in an HLA-agnostic manner, where the enhanced APCs include T cells, B cells, NK cells, monocytes, or a combination thereof.

[0066] In some embodiments, about 10% to about 90% of the enriched APCs are T cells. In some embodiments, about 25% to about 70% of the enriched APCs are T cells. In some embodiments, about 2% to about 20% of the enriched APCs are B cells. In some embodiments, about 2.5% to about 14% of the enriched APCs are B cells. In some embodiments, about 3.5% to about 35% of the enriched APCs are NK cells. In some embodiments, about 4% to about 25% of the enriched APCs are NK cells.

[0067] In some embodiments, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or at least about 80% of the enriched APCs are T cells, hi some embodiments, at least about 25% of the enriched APCs are T cells. In some embodiments, at least about 0.5%, at least about 1%, at least about 1.5%, at least about 2%, at least about 2.5%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 7.5%, at least about 8%, at least about 9%, at least about 10%, at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, or at least about 30% of the enriched APCs are B cells. In some embodiments, at least about 1.5% of the enriched APCs are B cells. In some embodiments, at least about 0.5%, at least about 1%, at least about 1.5%, at least about 2%, at least about 2.5%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 7.5%, at least about 8%, at least about 9%, at least about 10%, at least about 11%, at least about 12%, at least about 13%, at least about 14%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, or at least about 30% of the enriched APCs are NK cells. In some embodiments, at least about 3% of the enriched APCs are NK cells.In some embodiments, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 12%, at least about 14%, at least about 16%, at least about 18%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, or at least about 40% of the enriched APCs are monocytes. In some embodiments, at least about 4% of the enriched APCs are monocytes. In some embodiments, at least about 25% of the enriched APCs are T cells, at least about 1.5% of the enriched APCs are B cells, at least about 3% of the enriched APCs are NK cells, and at least about 4% of the enriched APCs are monocytes.

[0068] In some embodiments, about 40% or less, about 45% or less, about 50% or less, about 55% or less, about 60% or less, about 65% or less, about 70% or less, about 75% or less, about 80% or less, about 85% or less, or about 90% or less of the enhanced APCs are T cells. In some embodiments, about 70% or less of the enhanced APCs are T cells. In some embodiments, about 5% or less, about 10% or less, about 12% or less, about 14% or less, about 16% or less, about 18% or less, about 20% or less, about 22% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, or about 50% or less of the enhanced APCs are B cells. In some embodiments, about 30% or less of the enhanced APCs are B cells. In some embodiments, about 10% or less, about 15% or less, about 20% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, about 45% or less, about 50% or less, or about 60% or less of the enriched APCs are NK cells. In some embodiments, about 20% or less of the enriched APCs are NK cells. In some embodiments, about 5% or less, about 10% or less, about 12% or less, about 14% or less, about 16% or less, about 18% or less, about 20% or less, about 22% or less, about 25% or less, about 30% or less, about 35% or less, about 40% or less, or about 50% or less of the enriched APCs are monocytes. In some embodiments, about 45% or less of the enriched APCs are monocytes. In some embodiments, no more than about 80% of the enriched APCs are T cells, no more than about 30% of the enriched APCs are B cells, no more than about 20% of the enriched APCs are NK cells, and no more than about 45% of the enriched APCs are monocytes.

[0069] antigen As is apparent from the present disclosure, the enhanced APCs described herein comprise an antigen. Thus, when the formulations described herein are administered to a subject, in some embodiments, an immune response against the antigen is induced in the subject. In some embodiments, if the antigen is associated with a specific disease or condition, the induced immune response may be useful for treating the specific disease or condition. Any suitable antigen may be used with the present disclosure.

[0070] In some embodiments, the antigen comprises an antigen derived from human papillomavirus (HPV) (also referred to herein as "HPV antigen"). "HPV" more specifically refers to papillomaviruses originating from the human species and / or capable of infecting humans. Currently, over 100 HPV genotypes have been identified, and they are numbered according to the chronological order in which they were isolated. By convention, HPV classification is based on the degree of relatedness of their genomes. Phylogenetic trees have been constructed from alignments of available nucleotide sequences (Van Ranst et al., 1992, J. Gen. Virol. 73, 2653; De Villiers et al., 2004, Virology 324, 17-27). HPVs can be divided into "high-risk" (HR-HPV) and "low-risk" (LR-HPV). HR-HPV refers to HPVs that are strongly associated with cellular transformation, which can lead to lesions that can progress to malignant lesions. HR-HPV types include, but are not limited to, HPV-16, HPV-18, HPV-30, HPV-31, HPV-33, HPV-35, HPV-39, HPV-45, HPV-51, HPV-52, HPV-56, HPV-58, HPV-59, HPV-66, HPV-68, HPV-70, and HPV-85. LR-HPV refers to HPVs with a weak ability to transform cells, which may lead to benign lesions, such as warts, that are unlikely to progress to malignant lesions. LR-HPV types include, but are not limited to, HPV-6 and HPV-11. Unless otherwise specified, HPV antigens may be derived from any HPV.

[0071] In some embodiments, the HPV antigen is derived from HPV-16, HPV-18, or both. In some embodiments, the antigen is derived from HPV-16. In some embodiments, the antigen is derived from HPV-18. Thus, in some embodiments, the pharmaceutical formulations described herein comprise enhanced APCs comprising HPV antigens, wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner. In some embodiments, the pharmaceutical formulations comprise HPV antigens derived from HPV-16, wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner. In some embodiments, the pharmaceutical formulations comprise HPV antigens derived from HPV-18, wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner.

[0072] In some embodiments, the HPV antigen comprises a full-length HPV E6 protein (e.g., the E6 protein of HPV-16 or HPV-18, both of which are 158 amino acids in length). In some embodiments, the HPV antigen comprises a full-length HPV E7 protein (e.g., the E7 protein of HPV-16, which is 98 amino acids in length, or the E7 protein of HPV-18, which is 105 amino acids in length). The amino acid sequence of the full-length E6 protein of HPV-16 is set forth in SEQ ID NO: 14 (see Table 1 below). The amino acid sequence of the full-length E7 protein of HPV-16 is set forth in SEQ ID NO: 15 (see Table 1 below). The amino acid sequence of the full-length E6 protein of HPV-18 is set forth in SEQ ID NO: 16 (see Table 1 below). The amino acid sequence of the full-length E7 protein of HPV-18 is set forth in SEQ ID NO: 17 (see Table 1 below). JPEG2025527190000002.jpg111135

[0073] Thus, in some embodiments, the formulations provided herein comprise an enhanced APC comprising an HPV antigen, wherein the HPV antigen comprises the amino acid sequence set forth in SEQ ID NO: 14, and the enhanced APC is capable of activating T cells in an HLA-independent manner. In some embodiments, the formulations provided herein comprise an enhanced APC comprising an HPV antigen, wherein the HPV antigen comprises the amino acid sequence set forth in SEQ ID NO: 15, and the enhanced APC is capable of activating T cells in an HLA-independent manner. In some embodiments, the formulations provided herein comprise an enhanced APC comprising an HPV antigen, wherein the HPV antigen comprises the amino acid sequence set forth in SEQ ID NO: 16, and the enhanced APC is capable of activating T cells in an HLA-independent manner. In some embodiments, the formulations provided herein comprise an enhanced APC comprising an HPV antigen, wherein the HPV antigen comprises the amino acid sequence set forth in SEQ ID NO: 17, and the enhanced APC is capable of activating T cells in an HLA-independent manner.

[0074] In some embodiments, the HPV antigen comprises a variant of the full-length HPV E6 protein ("HPV E6 variant"). In some embodiments, the HPV E6 variant is a fragment of the full-length HPV E6 protein. For example, in some embodiments, the HPV E6 variant comprises an about 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, or about 155 amino acid fragment of SEQ ID NO:1 or SEQ ID NO:16. In some embodiments, the HPV E7 variant comprises an about 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 95 amino acid fragment of SEQ ID NO:2. In some embodiments, the HPV E7 variant comprises about a 5, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, or about 100 amino acid fragment of SEQ ID NO:17.

[0075] In some embodiments, HPV E6 variants comprise one or more amino acid substitutions compared to the corresponding wild-type HPV E6 protein. Thus, in some embodiments, HPV E6 variants comprise one or more amino acid substitutions compared to the sequence set forth in SEQ ID NO: 14. In some embodiments, HPV E6 variants comprise one or more amino acid substitutions compared to the sequence set forth in SEQ ID NO: 16. In some embodiments, HPV E6 variants comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, or about 99% sequence identity to the sequence set forth in SEQ ID NO: 14. In some embodiments, HPV E6 variants comprise an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, or about 99% sequence identity to the sequence set forth in SEQ ID NO: 16. Similarly, in some embodiments, HPV E7 variants comprise one or more amino acid substitutions compared to the corresponding wild-type HPV E7 protein. In some embodiments, HPV E7 variants comprise one or more amino acid substitutions compared to the sequence set forth in SEQ ID NO: 15. In some embodiments, the HPV E7 variant comprises one or more amino acid substitutions compared to the sequence set forth in SEQ ID NO: 17. In some embodiments, the HPV E7 variant comprises an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, or about 99% sequence identity to the sequence set forth in SEQ ID NO: 15. In some embodiments, the HPV E7 variant comprises an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, or about 99% sequence identity to the sequence set forth in SEQ ID NO: 17.

[0076] In some embodiments, the enhanced APCs of the formulations provided herein comprise multiple antigens. In some embodiments, the enhanced APCs comprise an HPV antigen and a non-HPV antigen. For example, in some embodiments, the enhanced APCs comprise multiple HPV antigens. In some embodiments, the enhanced APCs comprise at least two, at least three, at least four, or at least five HPV antigens. In some embodiments, the enhanced APCs comprise two HPV antigens, wherein a first HPV antigen is an HPV E6 protein (e.g., a full-length E6 protein of HPV-16) and a second HPV antigen is an HPV E7 protein (e.g., a full-length E7 protein of HPV-16).

[0077] In some embodiments, any of the antigens described herein can be introduced into APCs to generate enhanced APCs using any suitable method known in the art. Non-limiting examples of suitable methods for delivering one or more exogenous nucleotide sequences to cells include transfection (also known as transformation and transduction), electroporation, non-viral delivery, viral transduction, lipid nanoparticle delivery, and combinations thereof. In some embodiments, antigens (e.g., HPV antigens) are introduced into APCs using constriction-mediated delivery as described herein. As further described elsewhere in this disclosure, when cells pass through a constriction, they undergo transient deformation such that their plasma membrane is perturbed. Perturbations in the plasma membrane can allow various payloads (e.g., nucleic acids encoding HPV antigens, costimulatory molecules, and / or cytokines) to enter the cells via agitation (e.g., via diffusion). The particular process by which cells pass through a constriction and undergo transient deformation is referred to herein as "squeezing," "squeezing delivery," or "squeezing."

[0078] Thus, in some embodiments, the enriched cells described herein (e.g., comprising an HPV antigen) pass through a constriction under a set of parameters, thereby causing a perturbation in the APC such that the antigen enters the APC via the perturbation when contacted with the APC. More specifically, in some embodiments, the enriched cells of the formulations described herein pass through a constriction under a set of parameters, thereby causing a perturbation in the APC such that a nucleic acid encoding an HPV E6 protein (e.g., a full-length E6 protein of HPV-16) enters the APC when contacted with the APC. In some embodiments, the enriched cells of the formulations described herein pass through a constriction under a set of parameters, thereby causing a perturbation in the APC such that a nucleic acid encoding an HPV E7 protein (e.g., a full-length E7 protein of HPV-16) enters the APC when contacted with the APC. In some embodiments, the enriched cells of the formulations described herein pass through a constriction under a set of parameters, thereby causing a perturbation in the APC such that nucleic acids encoding an HPV E7 protein (e.g., a full-length E7 protein of HPV-16) and an HPV E6 protein (e.g., a full-length E6 protein of HPV-16) enter the APC upon contact with the APC. In some embodiments, the nucleic acids encoding the HPV E7 protein and / or HPV E6 protein comprise mRNA. Costimulatory molecules and cytokines

[0079] In some aspects, the enhanced APCs useful in the present disclosure further exhibit increased expression of costimulatory molecules compared to corresponding APCs that have not been enhanced as described herein ("reference APCs"). In some aspects, the enhanced APCs described herein further exhibit increased expression of cytokines compared to reference APCs. In some aspects, the enhanced APCs described herein further exhibit increased expression of both costimulatory molecules and cytokines compared to reference APCs.

[0080] As is generally understood in the art, optimal T cell activation requires multiple signals: (1) "signal 1," an antigen-specific signal provided by binding of the TCR to an antigenic peptide complexed with MHC; (2) "signal 2," mediated by binding of costimulatory molecules such as CD80 and CD86 on antigen-presenting cells (APCs); and (3) "signal 3," mediated by cytokines (e.g., IL-2 and / or IL-12). Thus, compared to a reference formulation comprising corresponding APCs that are not modified as described herein (e.g., do not exhibit increased expression of costimulatory molecules and / or cytokines), a formulation comprising the enhanced APCs described herein can induce a much enhanced immune response. In some embodiments, the enhanced immune response includes (i) an increase in the magnitude of the induced immune response compared to that induced by the reference formulation; (ii) an increase in the breadth of the induced immune response compared to that induced by the reference formulation; (iii) an increase in the duration of the induced immune response compared to that induced by the reference formulation; or (iv) any combination of (i) through (iii).

[0081] In some embodiments, the cytokine comprises a type I cytokine. In some embodiments, the cytokine is selected from the group consisting of IL-2, IL-4, IL-7, IL-10, IL-12, IL-15, IL-21, IL-1α, IL-1β, IL-1ra, IL-18, IL-33, IL-36α, IL-36β, IL-36γ, IL-36ra, IL-37, IL-38, IL-3, IL-5, IL-6, IL-11, IL-13, IL-23, granulocyte-macrophage colony-stimulating factor (GM-CSF), granulocyte-colony-stimulating factor (G-CSF), leukemia inhibitory factor (LIF), stem cell factor (SCF), and the like. In some embodiments, the cytokine comprises IL-12. In some embodiments, the cytokine comprises IL-2. In some embodiments, the cytokine comprises both IL-12 and IL-2. In some embodiments, the cytokine comprises a membrane-bound form of a cytokine (a "membrane-bound cytokine"). The amino acid sequences of exemplary membrane-bound cytokines are shown in SEQ ID NOs: 7-10 and 13 (see Table 7 below).

[0082] In some embodiments, the costimulatory molecule comprises OX40, OX40L, CD27, CD70, CD40, CD40L, 4-1BB, 4-1BBL, CD28, CD80, CD86, ICOS, ICOSL, or related molecules thereof, or any combination thereof. In some embodiments, the costimulatory molecule comprises CD80. In some embodiments, the costimulatory molecule comprises CD86.

[0083] Thus, as is apparent from at least the foregoing disclosure, provided herein are pharmaceutical compositions comprising enhanced APCs comprising HPV antigens, wherein the enhanced APCs exhibit increased expression of costimulatory molecules and / or cytokines compared to corresponding APCs that have not been modified (e.g., as described herein), and wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner. More specifically, in some embodiments, the pharmaceutical formulations comprise enhanced APCs comprising an HPV E6 protein or a variant thereof (e.g., a full-length HPV-16 E6 protein) and an HPV E7 protein or a variant thereof (e.g., a full-length HPV-16 E7 protein), wherein the enhanced APCs exhibit increased expression of costimulatory molecules (e.g., CD86) and cytokines (e.g., membrane-bound IL-2 and membrane-bound IL-12) compared to corresponding APCs that have not been modified (e.g., as described herein), and wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner.

[0084] Without being bound by any one theory, in some embodiments, nucleic acids encoding costimulatory molecules and / or nucleic acids encoding cytokines can be introduced into APCs to modify the APCs to exhibit increased expression of costimulatory molecules and / or cytokines. In some embodiments, such nucleic acids can be introduced into APCs using constriction-mediated delivery as described herein. In some embodiments, the enriched cells described herein (e.g., comprising HPV antigens) have been passed through a constriction under a set of parameters, thereby causing a perturbation in the APC such that any of the following nucleic acids enters the APC through the perturbation upon contact with the APC: (i) a nucleic acid encoding an HPV E7 protein (e.g., a full-length E7 protein of HPV-16), (ii) a nucleic acid encoding an HPV E6 protein (e.g., a full-length E6 protein of HPV-16), (iii) a nucleic acid encoding a costimulatory molecule (e.g., CD86), (iv) a nucleic acid encoding a cytokine (e.g., membrane-bound IL-2 and / or membrane-bound IL-12), or (v) any combination of (i) through (iv). In some embodiments, the nucleic acid comprises mRNA.

[0085] In some embodiments, any of the enhanced APCs provided herein (e.g., comprising HPV antigens and / or exhibiting increased expression of costimulatory molecules and / or cytokines) can be conditioned, thereby causing the APCs to exhibit improved properties compared to corresponding unconditioned APCs. As is evident from the present disclosure, in some embodiments, the enhanced APCs described herein are incubated in the presence of an adjuvant, thereby conditioning the APCs. In some embodiments, the enhanced APCs described herein are incubated with an adjuvant for about 2 hours to about 10 hours. In some embodiments, the enhanced APCs described herein are incubated with an adjuvant for about 3 hours to about 6 hours. In some embodiments, the enhanced APCs described herein are incubated with an adjuvant for about 4 hours. In some embodiments, the incubation is performed at about 37°C.

[0086] Non-limiting examples of adjuvants useful in the present disclosure include stimulator of interferon genes (STING) agonists, retinoic acid-inducible gene I (RIG-I) agonists, and agonists of TLR3, TLR4, TLR7, TLR8, TLR9, CpG ODN, interferon-α (IFN-α), IFN-β, IFN-γ, alpha-galactosylceramide, polyinosinic:polycytidylic acid (poly I:C), imiquimod (R837), resiquimod (R848), cyclic dinucleotides (CDNs), or lipopolysaccharide (LPS). In some embodiments, the CpG ODN comprises a class A CpG ODN, a class B CpG ODN, or a class C CpG ODN. In some embodiments, the CpG ODNs include CpG ODN 1018, CpG ODN 1585, CpG ODN 2216, CpG ODN 2336, CpG ODN 1668, CpG ODN 1826, CPG ODN 2006, CpG ODN 2007, CpG ODN BW006, CpG ODN D-SL01, CpG ODN 2395, CpG ODN M362, CpG ODN D-SL03.

[0087] Cryopreservation medium As further described elsewhere in this disclosure, in some embodiments, the enhanced APCs provided herein are then frozen (e.g., cryogenically). For example, in some embodiments, the enhanced APCs are frozen at a temperature of -100°C, -110°C, -120°C, -130°C, -140°C, -150°C, -160°C, -170°C, -180°C, -190°C, or -200°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -100°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -110°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -120°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -130°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -140°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -150°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -160°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -170°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -180°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -190°C or lower. In some embodiments, the enhanced APCs are frozen at a temperature of -200°C or lower.

[0088] In some aspects, pharmaceutical formulations useful in the present disclosure comprise cryopreservation media. As used herein, the term "cryopreservation media" refers to any compound that can be added to a sample to minimize or reduce damage to cells (e.g., enriched APCs) during freezing, thawing, and / or storage at temperatures below freezing. Accordingly, in some aspects, provided herein are pharmaceutical formulations comprising (a) enriched APCs and (b) cryopreservation media, wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some aspects, provided herein are formulations comprising (a) enriched APCs comprising HPV antigens (e.g., HPV E6 protein and / or E7 protein), and (b) cryopreservation media, wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner.

[0089] In some embodiments, the formulations provided herein (e.g., comprising enriched APCs and cryopreservation medium) benefit from freeze-thaw cycles and / or long-term storage under frozen conditions. For example, in some embodiments, a higher percentage of enriched APCs remain viable after freeze-thaw cycles and / or long-term storage under frozen conditions compared to a reference formulation lacking cryopreservation medium (e.g., comprising only enriched APCs). In some embodiments, the percentage of viable cells after freeze-thaw cycles and / or long-term storage under frozen conditions increases by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% compared to the reference formulation. In some embodiments, the percentage of viable cells after freeze-thaw cycles and / or after long-term storage under frozen conditions is increased by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, or at least about 50-fold compared to a reference formulation.

[0090] In some embodiments, the addition of cryopreservation medium to the formulation does not significantly reduce the viability of the enriched APCs. For example, in some embodiments, after the addition of cryopreservation medium (and before any freezing), at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the enriched APCs are viable. Cell viability can be assessed using any suitable method known in the art (e.g., cell counting using a hemocytometer and / or live / dead staining by flow cytometry). Furthermore, in some embodiments, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the enriched APCs remain viable after freeze-thaw cycles and / or long-term storage under frozen conditions. In some embodiments, at least about 70%, about 80%, about 90%, or about 95% of the enriched APCs are viable after up to 1, 2, 3, 4, or 5 freeze-thaw cycles. In some embodiments, at least about 70% of the enriched APCs remain viable after storage at -140°C or below for at least about 12 months.

[0091] In some embodiments, the cryopreservation medium is present in the formulation at a concentration of about 20% to about 98% (w / w). In some embodiments, the cryopreservation medium is at a concentration of about 20% (w / w), about 25% (w / w), about 30% (w / w), about 35% (w / w), about 40% (w / w), about 45% (w / w), about 50% (w / w), about 55% (w / w), about 60% (w / w), about 65% (w / w), about 70% (w / w), about 75% (w / w), about 80% (w / w), about 85% (w / w), about 90% (w / w), about 95% (w / w), or about 98% (w / w). In some embodiments, the cryopreservation medium is at a concentration of about 20% to about 25% (w / w), about 25% to 30% (w / w), about 30% to 35% (w / w), about 35% to 40% (w / w), about 40% to 45% (w / w), about 45% to 50% (w / w), about 50% to 55% (w / w), about 55% to 60% (w / w), about 60% to 65% (w / w), about 65% to 70% (w / w), about 70% to 75% (w / w), about 75% to 80% (w / w), about 80% to 85% (w / w), about 85% to 90% (w / w), or about 90% to 95% (w / w). In some embodiments, the cryopreservation medium is at a concentration of about 40% to about 95% (w / w). In some embodiments, the cryopreservation medium is present at a concentration of about 50% (w / w).

[0092] Thus, in some aspects, provided herein is a pharmaceutical formulation comprising (a) enriched APCs and (b) cryopreservation medium, wherein the cryopreservation medium is at a concentration of about 40% to about 95% (w / w), and wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some aspects, a pharmaceutical formulation useful in the present disclosure comprises (a) enriched APCs comprising HPV antigens (e.g., HPV E6 and / or E7 proteins), and (b) cryopreservation medium, wherein the cryopreservation medium is at a concentration of about 50% (w / w), and wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner.

[0093] In some embodiments, any suitable cryopreservation medium known in the art can be used with the present disclosure. Non-limiting examples of cryopreservation media include disaccharides such as sucrose or trehalose, dimethyl sulfoxide (DMSO), hydroxyethyl starch, glycerol, polyethylene glycol, polyvinylpyrrolidone, methylcellulose, proline, polymers, ectoine, dextran, hypothermosol, plasmalyte, human serum albumin, human serum, and combinations thereof. Cryoprotectants are known in the art and are further described, for example, in Janz et al., Journal of Biomedicine and Biotechnology 2012; Mareschi et al., Experimental Hematology 2006 34:1563-1572; and Hunt et al., Transfus Med Hemother 2011 38:107-123, each of which is incorporated herein by reference in its entirety. In some embodiments, the cryopreservation medium is CryoStor® CS10.

[0094] CryoStor® CS10 (BioLife Solution) is a serum-free, protein-free synthetic cryopreservation medium containing 10% DMSO, which is used as a cryoprotectant, osmolality regulator, and for pH control. CryoStor® CS10 is pre-formulated with DMSO, a cryoprotectant that helps reduce cellular damage due to intracellular ice formation. Thus, in some embodiments, cryopreservation media useful in the present disclosure include DMSO.

[0095] In some embodiments, the cryopreservation medium comprises about 2% to about 25% DMSO. In some embodiments, the cryopreservation medium comprises about 5% to about 15% DMSO. In some embodiments, the cryopreservation medium comprises about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 23%, about 24%, or about 25% DMSO. In some embodiments, the cryopreservation medium comprises about 2% to about 5%, about 5% to about 6%, about 6% to about 7%, about 7% to about 8%, about 8% to about 9%, about 9% to about 10%, about 10% to about 11%, about 11% to about 12%, about 12% to about 13%, about 13% to about 14%, about 14% to about 15%, or about 15% to about 20% DMSO. In some embodiments, the cryopreservation medium comprises about 10% DMSO.

[0096] Cryopreservation medium In some aspects, the pharmaceutical formulations described herein comprise a cryopreservation medium. As used herein, the term "cryopreservation medium" refers to any compound useful for improving and / or prolonging the preservation of cells (e.g., the enhanced APCs described herein), particularly at non-freezing temperatures (e.g., 2-8°C). Accordingly, in some aspects, provided herein are pharmaceutical formulations comprising (a) an enhanced APC and (b) a cryopreservation medium, wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner. In some aspects, the formulations described herein comprise (a) an enhanced APC, (b) a cryopreservation medium, and (c) a cryopreservation medium, wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner. In some aspects, the formulations provided herein comprise (a) an enhanced APC comprising an HPV antigen (e.g., HPV E6 protein and / or E7 protein), (b) a cryopreservation medium, and (c) a cryopreservation medium, wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner.

[0097] In some embodiments, the presence of both the cryopreservation medium and the cryopreservation medium further improves the viability of the enriched APCs. In some embodiments, the viability of the enriched APCs is increased compared to a reference formulation lacking either the cryopreservation medium or the cryopreservation medium. In some embodiments, the viability is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least 100% compared to corresponding cells of the reference formulation. In some embodiments, the viability is increased by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, or at least about 50-fold compared to corresponding cells of the reference formulation.

[0098] In some embodiments, the addition of cryopreservation medium to the formulation does not significantly reduce the viability of the enriched APCs. Thus, in some embodiments, the addition of both cryopreservation medium and cryopreservation medium does not significantly reduce the viability of the enriched APCs. In some embodiments, after the addition of cryopreservation medium (alone or in combination with cryopreservation medium), at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the enriched APCs are viable. Furthermore, in some embodiments, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the enriched APCs remain viable after freeze-thaw cycles and / or after long-term storage under frozen conditions. In some embodiments, at least about 70%, about 80%, about 90%, or about 95% of the enriched APCs are viable after up to 1, 2, 3, 4, or 5 freeze-thaw cycles. In some embodiments, at least about 70% of the enriched APCs remain viable after storage at -140°C or below for at least about 12 months.

[0099] In some embodiments, the cryopreservation medium is present in the formulation at a concentration of about 10% to about 70% (w / w). In some embodiments, the cryopreservation medium is at a concentration of about 10% (w / w), about 15% (w / w), about 20% (w / w), about 25% (w / w), about 30% (w / w), about 35% (w / w), about 40% (w / w), about 45% (w / w), about 50% (w / w), about 55% (w / w), about 60% (w / w), about 65% (w / w), or about 70% (w / w). In some embodiments, the cryopreservation medium is at a concentration of about 10% to about 15% (w / w), about 15% to about 20% (w / w), about 20% to about 25% (w / w), about 25% to about 30% (w / w), about 30% to about 35% (w / w), about 35% to about 40% (w / w), about 40% to about 45% (w / w), about 45% to about 50% (w / w), about 50% to about 55% (w / w), about 55% to about 60% (w / w), about 60% to about 65% (w / w), or about 65% to about 70% (w / w). In some embodiments, the cryopreservation medium is at a concentration of about 25% to about 35% (w / w). In some embodiments, the cryopreservation medium is at a concentration of about 30% (w / w).

[0100] In some aspects, provided herein are pharmaceutical formulations comprising (a) enhanced APCs and (b) cryopreservation medium, wherein the cryopreservation medium is at a concentration of about 25% to about 35% (w / w), and wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner. In some aspects, pharmaceutical formulations useful in the present disclosure comprise (a) enhanced APCs comprising HPV antigens (e.g., HPV E6 and / or E7 proteins), and (b) cryopreservation medium, wherein the cryopreservation medium is at a concentration of about 50% (w / w), and wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner. In some aspects, provided herein are pharmaceutical formulations comprising (a) enriched APCs, (b) cryopreservation medium, and (c) cryopreservation medium, wherein the cryopreservation medium is at a concentration of about 40% to about 95% (w / w) and the cryopreservation medium is at a concentration of about 25% to about 35% (w / w), and wherein the enriched APCs are capable of activating T cells in an HLA-independent manner. In some aspects, pharmaceutical formulations useful in the present disclosure comprise (a) enriched APCs comprising HPV antigens (e.g., HPV E6 protein and / or E7 protein), (b) cryopreservation medium, and (c) cryopreservation medium, wherein the cryopreservation medium is at a concentration of about 50% (w / w) and the cryopreservation medium is at a concentration of about 30% (w / w), and wherein the enriched APCs are capable of activating T cells in an HLA-independent manner.

[0101] In some embodiments, any suitable cryopreservation medium known in the art can be used. In some embodiments, the cryopreservation medium comprises HypoThermosol® FRS. HypoThermosol® FRS (BioLife Solution) is a serum-free, protein-free, DMSO-free cryopreservation medium similar in composition to CryoStor® CS10. The difference is that the DMSO contained in CryoStor® CS10 is replaced with Trolox (a water-soluble analog of vitamin E) in HypoThermosol® FRS. Thus, in some embodiments, the cryopreservation medium comprises a water-soluble analog of vitamin E. In some embodiments, the cryopreservation medium comprises Trolox ((±)-6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid).

[0102] Additional ingredients In some embodiments, the pharmaceutical formulations provided herein further comprise one or more additional components. In some embodiments, the one or more additional components can improve the function of other elements included in the formulation (e.g., cryopreservation medium and / or cryopreservation medium). In some embodiments, the one or more additional components can improve one or more properties of the formulation. Non-limiting examples of such properties include reduced surface adsorption, reduced aggregation, reduced fibrillation, reduced oxidation, improved solubility, improved lyophilization, or a combination thereof. In some embodiments, the one or more additional components enhance endocytosis, improve the stability of the formulation, or both. Non-limiting examples of additional components that may be included in the formulations described herein include divalent metal cations, glucose, ATP, potassium, glycerol, trehalose, D-sucrose, PEG1500, L-arginine, L-glutamine, or EDTA. In some embodiments, the divalent metal cation comprises one or more of Mg2+, Zn2+, or Ca2+. In some embodiments, the one or more additional components comprise sodium pyruvate, adenine, trehalose, dextrose, mannose, sucrose, human serum albumin (HSA), HEPES, glycerol, glutathione, inosine, dibasic sodium phosphate, monobasic sodium phosphate, sodium metal ions, potassium metal ions, magnesium metal ions, chloride, acetate, gluconate, sucrose, potassium hydroxide, or sodium hydroxide. In some embodiments, the one or more additional components comprise sodium pyruvate, adenine, Rejuvesol®, trehalose, dextrose, mannose, sucrose, human serum albumin (HSA), PlasmaLyte®, Cryostor® CS2, Cryostor® CS5, Cryostor® CS15, HEPES, glycerol, or glutathione.

[0103] In some embodiments, such additional components include human serum albumin. Unless otherwise indicated, in some embodiments, human serum albumin can be replaced with albumin from a different source (e.g., murine or bovine). Accordingly, in some embodiments, possible pharmaceutical formulations are provided herein comprising (a) enriched APCs and (b) human serum albumin, wherein the enriched APCs activate T cells in an HLA-independent manner. In some embodiments, the formulations described herein comprise (a) enriched APCs, (b) cryopreservation medium, (c) cryopreservation medium, and (d) human serum albumin, wherein the enriched APCs are capable of activating T cells in an HLA-independent manner. In some aspects, the formulations provided herein comprise (a) enriched APCs comprising HPV antigens (e.g., HPV E6 and / or E7 proteins), (b) cryopreservation medium, (c) cryopreservation medium, and (d) human serum albumin, wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner.

[0104] In some embodiments, the human serum albumin is provided in a human serum albumin solution. In some embodiments, the albumin solution is Albumin (Human) USP, 25% Solution. Albumin (Human) USP, 25% Solution is a sterile albumin preparation for intravenous administration. Albumin (Human) is a 25% sterile solution of albumin in an aqueous diluent. The preparation is stabilized with sodium caprylate (about 0.08 mmol / g albumin) and acetyltryptophan (about 0.08 mmol / g albumin). It is a clear, slightly viscous liquid that can range in color from almost colorless to yellow, amber, or green. In some embodiments, the albumin solution does not contain a preservative.

[0105] In some embodiments, the human serum albumin solution comprises about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, or about 40%. In some embodiments, the human serum albumin solution comprises about 25% human serum albumin (a "25% human serum albumin solution"). In some embodiments, the formulation comprises a human serum albumin solution at a concentration of any one of about 2%, 3%, 4%, 5%, 8%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% (w / w). In some embodiments, the percentage of human serum albumin solution in the formulation is any one of about 2% to 3%, 3% to 5%, 5% to 8%, 8% to 10%, 10% to 15%, 15% to 20%, 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, 40% to 45%, or 45% to 50% (w / w). In some embodiments, the percentage of human serum albumin solution in the formulation is about 15% to about 25% (w / w). In some embodiments, the percentage of human serum albumin solution in the formulation is about 20% (w / w). In some embodiments, the human albumin solution comprises sodium caprylate at a concentration of about 0.001, about 0.01, about 0.02, about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09, about 0.1, about 0.2, about 0.5, or about 1 mmol / g albumin, hi some embodiments, the human albumin solution comprises sodium caprylate at a concentration of about 0.08 mmol / g albumin. In some embodiments, the human albumin solution comprises acetyltryptophan at a concentration of about 0.001, about 0.01, about 0.02, about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09, about 0.1, about 0.2, about 0.5, or about 1 mmol / g albumin, hi some embodiments, the human albumin solution comprises acetyltryptophan at a concentration of about 0.08 mmol / g albumin.

[0106] In some embodiments, the pharmaceutical formulations provided herein comprise (a) enriched APCs and (b) a 25% human serum albumin solution at a concentration of about 15% to about 25% (w / w), wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some embodiments, the pharmaceutical formulations provided herein comprise (a) enriched APCs, (b) a cryopreservation medium at a concentration of about 40% to about 95% (w / w), and (c) a 25% human serum albumin solution at a concentration of about 15% to about 25% (w / w), wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some embodiments, the pharmaceutical formulations provided herein comprise (a) enriched APCs, (b) a cryopreservation medium at a concentration of about 25% to about 35% (w / w), and (c) a 25% human serum albumin solution at a concentration of about 15% to about 25% (w / w), wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some embodiments, the pharmaceutical formulations provided herein comprise (a) enriched APCs, (b) a cryopreservation medium at a concentration of about 40% to about 95% (w / w), (c) a cryopreservation medium at a concentration of about 25% to about 35% (w / w), and (d) a 25% human serum albumin solution at a concentration of about 15% to about 25% (w / w), wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some aspects, the pharmaceutical formulations provided herein comprise (a) enriched APCs comprising HPV antigens (e.g., HPV E6 and / or E7 proteins); (b) cryopreservation medium at a concentration of about 50% (w / w); (c) cryopreservation medium at a concentration of about 30% (w / w); and (d) a 25% human serum albumin solution at a concentration of about 20% (w / w), wherein the enriched APCs are capable of activating T cells in an HLA-independent manner.

[0107] Filling Volume As described herein, in some embodiments, the pharmaceutical formulations described herein are liquid formulations. Any suitable liquid can be used to prepare such liquid formulations. In some embodiments, each of the various components described herein (e.g., enriched APC, cryopreservation medium, cryopreservation medium, and human serum albumin) is combined in a suitable liquid medium, and the total volume of the formulation is about 2 mL to about 150 mL. In some embodiments, the fill volume of the formulation (i.e., the liquid volume in which the other components of the formulation are resuspended) is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 9.5, about 10, about 10.5, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, or about 150 mL or more. In some embodiments, the fill volume is about 1 to about 2, about 2 to about 3, about 3 to about 4, about 4 to about 5, about 5 to about 6, about 6 to about 7, about 7 to about 8, about 8 to about 9, or about 9 to about 10, about 10 to about 11, about 11 to about 12, about 12 to about 13, about 13 to about 14, about 14 to about 15, about 15 to about 16, about 16 to about 17, about 17 to about 18, about 18 to about 19, or about 19 to about 20 mL. In some embodiments, the fill volume of the formulation is about 10 mL. In some embodiments, the fill volume is about 9.5 mL. In some embodiments, the fill volume of the formulation is about 5 mL.

[0108] pH For any pharmaceutical formulation described herein, in some embodiments, the formulation has a particular pH. In some embodiments, the pH of the formulation enhances and / or improves one or more properties of the formulation (e.g., solubility, stability, tolerability, and / or activity). In some embodiments, the pH of the formulation is about 5.0 to about 9.5. In some embodiments, the pH of the formulation is about 6.0 to about 8.5. In some embodiments, the pH of the formulation is about 7.0 to about 7.9. In some embodiments, the pH of the formulation is about 7.9. In some embodiments, the formulation has a pH of about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, about 9, or about 10. In some embodiments, the formulation has a pH of about 7, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, or about 8.0. In some embodiments, the pH of the formulation is about 5 to about 6, about 6 to about 7, about 7 to about 8, about 8 to about 9, or about 9 to about 10. In some embodiments, the pH of the formulation is about 7 to about 7.1, about 7.1 to about 7.2, about 7.2 to about 7.3, about 7.3 to about 7.4, about 7.4 to about 7.5, about 7.5 to about 7.6, about 7.6 to about 7.7, about 7.7 to about 7.8, about 7.8 to about 7.9, or about 7.9 to about 8.0.

[0109] As is evident from at least the above disclosure, in some embodiments, the present disclosure provides: (a) about 5×10 6 of enriched antigen-presenting cells ("enriched APCs") to approximately 1 × 10 9 and (c) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 6.0 to about 8.5, and wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some aspects, provided herein are pharmaceutical formulations comprising: (a) about 1.1 x 10 enriched APCs; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 95% (w / w); and (c) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 6.0 to about 8.5, and wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. 7Provided herein is a pharmaceutical formulation comprising: (a) enriched antigen-presenting cells ("enriched APC") at a concentration of enriched APC / mL; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); and (c) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is from about 7.0 to about 7.9, and wherein the enriched APC are capable of activating T cells in an HLA-agnostic manner. In some embodiments, the pharmaceutical formulation described herein comprises: (a) about 5×10 enriched APC / mL enriched antigen-presenting cells ("enriched APC") at a concentration of about 5×10 enriched APC / mL; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); and (c) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is from about 7.0 to about 7.9; and 6 Enhanced APC / mL to approximately 1 x 10 9 (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 95% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 25% (w / w) to about 35% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 6.0 to about 8.5, and wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some embodiments, provided herein are pharmaceutical formulations comprising: (a) about 1.1 x 10 enriched antigen-presenting cells ("enriched APCs") at a concentration of about 1.1 x 10 enriched APCs / mL; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 95% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 25% (w / w) to about 35% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w), wherein the pH of the formulation is about 6.0 to about 8.5; and wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. 7 Provided herein is a pharmaceutical formulation comprising: enriched antigen-presenting cells ("enriched APC") at a concentration of enriched APC / mL; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is from about 7.0 to about 7.9, and wherein the enriched APC are capable of activating T cells in an HLA-agnostic manner. In some embodiments, provided herein is a pharmaceutical formulation comprising: (a) about 1.05×10 enriched APC / mL enriched antigen-presenting cells ("enriched APC") at a concentration of about 1.05×10 enriched APC / mL enriched APC; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"). 8and (c) about 2.00 g of a solution comprising 25% human serum albumin ("human serum albumin solution"), wherein the pH of the formulation is from about 7.0 to about 7.9, and wherein the enriched APCs are capable of activating T cells in an agnostic manner. In some aspects, provided herein are pharmaceutical formulations comprising: (a) about 1.05×10 enriched APCs; (b) about 4.99 g of cryopreservation medium (e.g., CryoStor® CS10); and (c) about 2.00 g of a solution comprising 25% human serum albumin ("human serum albumin solution"), wherein the pH of the formulation is from about 7.0 to about 7.9, and wherein the enriched APCs are capable of activating T cells in an agnostic manner. 8 (b) about 4.99 g of cryopreservation medium (e.g., CryoStor® CS10); (c) about 2.99 g of cryopreservation medium (e.g., HypoThermasol® FRS); and (d) about 2.00 g of a solution comprising 25% human serum albumin (the "human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and the enriched APCs are capable of activating T cells in an agnostic manner.

[0110] In some embodiments, the enhanced APCs in the formulation maintain about 50% or greater viability after 1, 2, 3, 4, or 5 freeze-thaw cycles. In some embodiments, the enhanced APCs in the formulation maintain at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% viability after 1, 2, 3, 4, or 5 freeze-thaw cycles. In some embodiments, the enhanced APCs in the formulation maintain at least about 70% viability after at least about 12 months of storage at temperatures below -140°C. In some embodiments, the enhanced APCs maintain at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% viability after at least about 12 months of storage at temperatures below -140°C. In some embodiments, the enhanced APCs in the formulation maintain at least about 70% viability after storage for at least about 3, 6, 9, 12, 15, 18, 24, 30, or 36 months at temperatures at or below −140° C. In some embodiments, the enhanced APCs in the formulation maintain at least about 70% viability after storage for at least 3 months at temperatures at or below −100° C., −110° C., −120° C., −130° C., −140° C., −150° C., −160° C., −170° C., −180° C., −190° C., or −200° C. In some embodiments, the enhanced APCs in the formulation maintain at least about 70% viability after storage for at least about 12 months at temperatures below -100°C, -110°C, -120°C, -130°C, -140°C, -150°C, -160°C, -170°C, -180°C, -190°C, or -200°C.

[0111] The pharmaceutical formulations described herein are suitable for in vivo administration. Thus, in some embodiments, the formulations provided herein are sterile. In some embodiments, the formulations contain less than about 2 EU / mL of endotoxin. In some embodiments, the formulations contain less than about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 EU / mL of endotoxin. In some embodiments, the formulations are mycoplasma-free.

[0112] Vials containing pharmaceutical preparations In some aspects, the present disclosure relates to a vial containing any of the pharmaceutical formulations provided herein.

[0113] Thus, in some aspects, the present disclosure provides a vial containing a pharmaceutical formulation comprising (a) an enhanced APC capable of activating T cells in an HLA-independent manner, and (b) a cryopreservation medium. In some aspects, provided herein is a vial containing a pharmaceutical formulation comprising (a) an enhanced APC capable of activating T cells in an HLA-independent manner, and (b) a cryopreservation medium. In some aspects, provided herein is a vial containing a pharmaceutical formulation comprising (a) an enhanced APC capable of activating T cells in an HLA-independent manner, and (b) a human serum albumin solution. In some aspects, the present disclosure provides a vial containing a pharmaceutical formulation comprising (a) an enhanced APC capable of activating T cells in an HLA-independent manner, (b) a cryopreservation medium, (c) a cryopreservation medium, and (d) a human serum albumin solution.

[0114] More specifically, in some embodiments, the present disclosure provides (a) about 5×10 6 of enriched antigen-presenting cells ("enriched APCs") to approximately 1 × 10 9 (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 95% (w / w); and (c) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 6.0 to about 8.5, and the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some embodiments, provided herein are vials containing a pharmaceutical formulation comprising: (a) about 1.1 x 10 enriched APCs; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 95% (w / w); and (c) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w), the pH of the formulation being about 6.0 to about 8.5, the enriched APCs being capable of activating T cells in an HLA-agnostic manner. 7Provided herein are vials containing a pharmaceutical formulation comprising: (a) enriched antigen-presenting cells ("enriched APC") at a concentration of enriched APC / mL; (b) cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); and (c) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enriched APC are capable of activating T cells in an HLA-agnostic manner. In some embodiments, the vials described herein contain (a) about 5×10 enriched APC / mL enriched antigen-presenting cells ("enriched APC") at a concentration of about 5×10 enriched APC / mL. 6 Enhanced APC / mL to approximately 1 x 10 9 Provided herein are vials containing a pharmaceutical formulation comprising: (a) enriched antigen-presenting cells ("enriched APC") at a concentration of enriched APC / mL; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 95% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 25% (w / w) to about 35% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 6.0 to about 8.5, and wherein the enriched APC are capable of activating T cells in an HLA-agnostic manner. In some embodiments, the vials described herein contain (a) about 1.1 x 10 7 Provided herein are vials containing a pharmaceutical formulation comprising: (a) enriched antigen-presenting cells ("enriched APC") at a concentration of enriched APC / mL; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and the enriched APC are capable of activating T cells in an HLA-agnostic manner. In some embodiments, the vials described herein contain (a) about 8.5×10 enriched APC / mL enriched antigen-presenting cells ("enriched APC") at a concentration of about 8.5×10 enriched APC / mL. 6Provided herein are vials containing a pharmaceutical formulation comprising: (a) enriched antigen-presenting cells ("enriched APC") at a concentration of enriched APC / mL; (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enriched APC are capable of activating T cells in an HLA-agnostic manner. In some embodiments, the vials described herein contain (a) about 1.05×10 enriched APC / mL enriched antigen-presenting cells ("enriched APC") at a concentration of about 1.05×10 enriched APC / mL. 8 (b) about 4.99 g of cryopreservation medium (e.g., CryoStor® CS10); and (c) about 2.00 g of a solution comprising 25% human serum albumin ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and the enriched APCs are capable of activating T cells in an HLA-agnostic manner. In some aspects, provided herein are vials containing a pharmaceutical formulation comprising: (a) about 1.05×10 enriched APCs; (b) about 4.99 g of cryopreservation medium (e.g., CryoStor® CS10); and (c) about 2.00 g of a solution comprising 25% human serum albumin ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enriched APCs are capable of activating T cells in an HLA-agnostic manner. 8 (b) about 4.99 g of cryopreservation medium (e.g., CryoStor® CS10); (c) about 2.99 g of cryopreservation medium (e.g., HypoThermasol® FRS); and (d) about 2.00 g of a solution comprising 25% human serum albumin ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and the enriched APCs are capable of activating T cells in an HLA-agnostic manner.

[0115] In some embodiments, the vial contains about 2 mL to about 50 mL of cryopreservation medium. In some embodiments, the vial contains about 4 mL to about 20 mL of cryopreservation medium. In some embodiments, the vial contains about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 9.5, about 10, about 10.5, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 mL of cryopreservation medium. In some embodiments, the vial contains about 1 to about 2, about 2 to about 3, about 3 to about 4, about 4 to about 5, about 5 to about 6, about 6 to about 7, about 7 to about 8, about 8 to about 9, or about 9 to about 10, about 10 to about 11, about 11 to about 12, about 12 to about 13, about 13 to about 14, about 14 to about 15, about 15 to about 16, about 16 to about 17, about 17 to about 18, about 18 to about 19, or about 19 to about 20 mL of cryopreservation medium. In some embodiments, the vial contains about 4 to about 5 mL of cryopreservation medium. In some embodiments, the vial contains about 4.45 mL of cryopreservation medium.

[0116] In some embodiments, the vial contains about 1 mL to about 50 mL of cryopreservation medium. In some embodiments, the vial contains about 2 mL to about 20 mL of cryopreservation medium. In some embodiments, the vial contains about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 9.5, about 10, about 10.5, about 11, about 12, 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 mL of cryopreservation medium. In some embodiments, the vial contains about 1 to about 2, about 2 to about 3, about 3 to about 4, about 4 to about 5, about 5 to about 6, about 6 to about 7, about 7 to about 8, about 8 to about 9, or about 9 to about 10, about 10 to about 11, about 11 to about 12, about 12 to about 13, about 13 to about 14, about 14 to about 15, about 15 to about 16, about 16 to about 17, about 17 to about 18, about 18 to about 19, or about 19 to about 20 mL of cryopreservation medium. In some embodiments, the vial contains about 2 to 3 mL of cryopreservation medium. In some embodiments, the vial contains about 2.67 mL of cryopreservation medium. In some embodiments, the vial contains (i) about 5 x 106 Approximately 1 x 10 from reinforced APC 9 In some embodiments, the vial contains (i) about 7 x 10 enriched APCs; (ii) about 4 to about 5 mL of cryopreservation medium (e.g., CryoStor® CS10); and (iii) about 2 to 3 mL of cryopreservation medium (e.g., HypoThermasol®). 7 Approximately 8 x 10 from reinforced APC 7 Reinforced APC (e.g., approximately 7.6x10 7 (ii) about 4.45 mL of cryopreservation medium (e.g., CryoStor® CS10); and (iii) about 2.67 mL of cryopreservation medium (e.g., HypoThermasol®).

[0117] In some embodiments, the vial contains human serum albumin. In some embodiments, the vial contains about 1 to about 10 mL of human serum albumin solution. In some embodiments, the vial contains about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 9.5, or about 10 mL of human serum albumin solution. In some embodiments, the vial contains about 1 to about 2 mL, about 2 to about 3 mL, about 3 to about 4 mL, about 4 to about 5 mL, about 5 to about 6 mL, about 6 to about 7 mL, about 7 to about 8 mL, about 8 to about 9 mL, or about 9 to about 10 mL of human serum albumin solution. In some embodiments, the vial contains about 1 to about 2 mL of human serum albumin solution. In some embodiments, the vial contains about 1.78 mL of human serum albumin solution.

[0118] In some embodiments, the vial contains (i) about 5 x 10 6 Approximately 1 x 10 from reinforced APC 9 (ii) about 4 to about 5 mL of cryopreservation medium (e.g., CryoStor® CS10); (iii) about 2 to 3 mL of cryopreservation medium (e.g., HypoThermasol®); and (iv) about 1 to about 2 mL of human serum albumin solution. In some embodiments, the vial contains (i) about 7×10 7 Approximately 8 x 10 from reinforced APC 7Reinforced APC (e.g., approximately 7.6x10 7 (ii) about 4.45 mL of cryopreservation medium (e.g., CryoStor® CS10); (iii) about 2.67 mL of cryopreservation medium (e.g., HypoThermasol®); and about 1.78 mL of human serum albumin solution.

[0119] Manufacturing method of pharmaceutical preparation Some aspects of the present disclosure relate to methods of making any of the pharmaceutical formulations described herein. In some aspects, such methods include combining enhanced APCs capable of activating T cells in an HLA-agnostic manner with one or more of the following: cryopreservation medium, cryopreservation medium, and human serum albumin. In some aspects, the methods include combining the enhanced APCs with cryopreservation medium. In some aspects, the methods include combining the enhanced APCs with cryopreservation medium. In some aspects, the methods include combining the enhanced APCs with human serum albumin. In some aspects, the methods include combining the enhanced APCs with cryopreservation medium, cryopreservation medium, and human serum albumin.

[0120] In some embodiments, the method comprises: (a) about 5×10 6 of enriched antigen-presenting cells ("enriched APCs") to approximately 1 × 10 9 1×10 enriched APCs, (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 95% (w / w), and (c) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"). In some embodiments, the method comprises combining (a) about 1.1×10 enriched APCs with (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 95% (w / w). In some embodiments, the method comprises combining (a) about 1.1×10 enriched APCs with (c) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 7 (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); and (c) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"). In some embodiments, the method comprises combining (a) about 5×10 enriched antigen-presenting cells ("enriched APCs") at a concentration of about 5×10 enriched APCs / mL. 6Approximately 1 x 10 from reinforced APC 9 (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 40% (w / w) to about 95% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 25% (w / w) to about 35% (w / w); and (d) a solution comprising about 25% human serum albumin ("human serum albumin solution") at a concentration of about 15% (w / w) to about 25% (w / w). In some embodiments, the method comprises combining (a) about 1.1 x 10 enriched antigen-presenting cells ("enriched APCs") at a concentration of about 1.1 x 10 enriched APCs. 7 (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"). In some embodiments, the method comprises combining (a) about 1.05×10 enriched antigen-presenting cells ("enriched APCs") at a concentration of about 1.05×10 enriched APCs / mL with (b) a cryopreservation medium (e.g., CryoStor® CS10) at a concentration of about 50% (w / w); (c) a cryopreservation medium (e.g., HypoThermasol® FRS) at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"). 8 In some embodiments, the method includes combining (a) about 1.05×10 enriched APCs with (b) about 4.99 g of cryopreservation medium (e.g., CryoStor® CS10), and (c) about 2.00 g of a solution comprising 25% human serum albumin ("human serum albumin solution"). 8 The method includes combining (a) about 4.99 g of the enriched APCs with (b) about 4.99 g of cryopreservation medium (e.g., CryoStor® CS10), (c) about 2.99 g of cryopreservation medium (e.g., HypoThermasol® FRS), and (d) about 2.00 g of a solution comprising 25% human serum albumin (the "human serum albumin solution").

[0121] In some embodiments, the method comprises: 4 to about 5 × 10 9 In some embodiments, the method comprises combining 5×10 enriched APCs with one or more of the other components of the formulation (e.g., cryopreservation medium, cryopreservation medium, and / or human serum albumin).5 to about 5 × 10 9 In some embodiments, the method comprises adding 5×10 enhanced APCs. 6 to about 5 × 10 9 In some embodiments, the method comprises adding 5×10 enhanced APCs. 7 to about 5 × 10 9 In some embodiments, the method comprises adding 5×10 enhanced APCs. 8 to about 5 × 10 9 In some embodiments, the method comprises adding 5×10 enhanced APCs. 4 to about 5 × 10 8 In some embodiments, the method comprises adding 5×10 enhanced APCs. 4 to about 5 × 10 7 In some embodiments, the method comprises adding 5×10 enhanced APCs. 4 to about 5 × 10 6 In some embodiments, the method comprises adding 5×10 enhanced APCs. 4 to about 5 × 10 5 In some embodiments, the method comprises adding 5×10 enhanced APCs. 5 to about 5 × 10 8 In some embodiments, the method comprises adding 5×10 enhanced APCs. 6 to about 5 × 10 8 In some embodiments, the method comprises adding 5×10 enhanced APCs. 7 to about 5 × 10 8 In some embodiments, the method comprises adding 5×10 enhanced APCs. 5 to about 5 × 10 7 In some embodiments, the method comprises adding 5×10 enhanced APCs. 6 to about 5 × 10 7 This involves adding an enhanced APC.

[0122] In some embodiments, the method comprises administering to about 1×10 6 to approximately 1 × 10 9 In some embodiments, the method comprises adding about 1 x 10 enhanced APCs. 7 to approximately 1 × 109 In some embodiments, the method comprises adding about 1 x 10 enhanced APCs. 8 to approximately 1 × 10 9 In some embodiments, the method comprises adding about 1 x 10 enhanced APCs. 6 In some embodiments, the method comprises adding about 2×10 enhanced APCs. 6 In some embodiments, the method comprises adding about 3×10 enhanced APCs. 6 In some embodiments, the method comprises adding about 4×10 enhanced APCs. 6 In some embodiments, the method comprises adding about 5×10 enhanced APCs. 6 In some embodiments, the method comprises adding about 6×10 enhanced APCs. 6 In some embodiments, the method comprises adding about 7×10 enhanced APCs. 6 In some embodiments, the method comprises adding about 8×10 enhanced APCs. 6 In some embodiments, the method comprises adding about 9 x 10 enhanced APCs. 6 In some embodiments, the method comprises adding about 1 x 10 enhanced APCs. 7 In some embodiments, the method comprises adding about 2×10 enhanced APCs. 7 In some embodiments, the method comprises adding about 3×10 enhanced APCs. 7 In some embodiments, the method comprises adding about 4×10 enhanced APCs. 7 In some embodiments, the method comprises adding about 5×10 enhanced APCs. 7 In some embodiments, the method comprises adding about 6×10 enhanced APCs. 7 In some embodiments, the method comprises adding about 7×10 enhanced APCs. 7 In some embodiments, the method comprises adding about 8×10 enhanced APCs. 7 In some embodiments, the method comprises adding about 9 x 10 enhanced APCs. 7 In some embodiments, the method comprises adding about 1 x 10 enhanced APCs. 8In some embodiments, the method comprises adding about 2×10 enhanced APCs. 8 In some embodiments, the method comprises adding about 3×10 enhanced APCs. 8 In some embodiments, the method comprises adding about 4×10 enhanced APCs. 8 In some embodiments, the method comprises adding about 5×10 enhanced APCs. 8 In some embodiments, the method comprises adding about 6×10 enhanced APCs. 8 In some embodiments, the method comprises adding about 7×10 enhanced APCs. 8 In some embodiments, the method comprises adding about 8×10 enhanced APCs. 8 In some embodiments, the method comprises adding about 9 x 10 enhanced APCs. 8 In some embodiments, the method comprises adding about 1 x 10 enhanced APCs. 9 In some embodiments, the method comprises adding about 1.05 x 10 enhanced APCs. 8 This involves adding an enhanced APC.

[0123] In some embodiments, the methods of producing pharmaceutical formulations provided herein include adding a cryopreservation medium to a predetermined range. In some embodiments, the cryopreservation medium is added at a concentration of about 20% to about 98% (w / w). In some embodiments, the cryopreservation medium is added at a concentration of about 20% (w / w), about 25% (w / w), about 30% (w / w), about 35% (w / w), about 40% (w / w), about 45% (w / w), about 50% (w / w), about 55% (w / w), about 60% (w / w), about 65% (w / w), about 70% (w / w), about 75% (w / w), about 80% (w / w), about 85% (w / w), about 90% (w / w), about 95% (w / w), or about 98% (w / w). In some embodiments, the cryopreservation medium is added at a concentration of about 20% to about 25% (w / w), about 25% to 30% (w / w), about 30% to 35% (w / w), about 35% to 40% (w / w), about 40% to 45% (w / w), about 45% to 50% (w / w), about 50% to 55% (w / w), about 55% to 60% (w / w), about 60% to 65% (w / w), about 65% to 70% (w / w), about 70% to 75% (w / w), about 75% to 80% (w / w), about 80% to 85% (w / w), about 85% to 90% (w / w), or about 90% to 95% (w / w). In some embodiments, the cryopreservation medium is added at a concentration of about 40% to about 95% (w / w). In some embodiments, the cryopreservation medium is added at a concentration of about 50% (w / w).

[0124] Thus, in some aspects, provided herein is a method for producing a pharmaceutical formulation comprising enriched APCs capable of activating T cells in an HLA-agnostic manner, the method comprising: (a) administering to the patient about 5×10 6 Approximately 1 × 10 reinforced APC 9 and (b) a cryopreservation medium at a concentration of about 40% to about 95% (w / w). In some embodiments, the method comprises: (a) 1.05 x 10 8and (b) a cryopreservation medium at a concentration of about 50% (w / w). Non-limiting examples of suitable cryopreservation media are provided elsewhere in this disclosure. In some embodiments, the cryopreservation medium comprises DMSO. In some embodiments, the cryopreservation medium comprises CryoStor® CS10.

[0125] In some embodiments, the methods of manufacturing the pharmaceutical formulations provided herein include adding a cryopreservation medium to a predetermined range. In some embodiments, the cryopreservation medium is added to a concentration of about 10% to about 70% (w / w). In some embodiments, the cryopreservation medium is added to a concentration of about 10% (w / w), about 15% (w / w), about 20% (w / w), about 25% (w / w), about 30% (w / w), about 35% (w / w), about 40% (w / w), about 45% (w / w), about 50% (w / w), about 55% (w / w), about 60% (w / w), about 65% (w / w), or about 70% (w / w). In some embodiments, the cryopreservation medium is added to a concentration of about 10% to about 15% (w / w), about 15% to about 20% (w / w), about 20% to about 25% (w / w), about 25% to about 30% (w / w), about 30% to about 35% (w / w), about 35% to about 40% (w / w), about 40% to about 45% (w / w), about 45% to about 50% (w / w), about 50% to about 55% (w / w), about 55% to about 60% (w / w), about 60% to about 65% (w / w), or about 65% to about 70% (w / w). In some embodiments, the cryopreservation medium is added to a concentration of about 25% to about 35% (w / w). In some embodiments, the cryopreservation medium is added to a concentration of about 30% (w / w).

[0126] In some aspects, provided herein are methods for producing a pharmaceutical formulation comprising enriched APCs capable of activating T cells in an HLA-agnostic manner, the method comprising: (a) administering to about 5×10 6 Approximately 1 × 10 reinforced APC 9 and (b) a cryopreservation medium at a concentration of about 25% to about 35% (w / w). In some embodiments, the method comprises combining (a) 1.05 x 10 8In some embodiments, the method comprises combining (a) about 5×10 enriched APCs with (b) a cryopreservation medium at a concentration of about 30% (w / w). 6 Approximately 1 × 10 reinforced APC 9 1.05×10 enriched APCs with (b) a cryopreservation medium at a concentration of about 40% to about 95% (w / w), and (c) a cryopreservation medium at a concentration of about 25% to about 35% (w / w). In some embodiments, the method comprises combining (a) 1.05×10 enriched APCs with (b) a cryopreservation medium at a concentration of about 40% to about 95% (w / w). 8 with (b) a cryopreservation medium at a concentration of about 50% (w / w); and (c) a cryopreservation medium at a concentration of about 30% (w / w).

[0127] Non-limiting examples of suitable cryopreservation media are provided elsewhere in this disclosure. In some embodiments, the cryopreservation media comprises a water-soluble analog of vitamin E. In some embodiments, the cryopreservation media comprises Trolox ((±)-6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid). In some embodiments, the cryopreservation media is HypoThermasol® FRS.

[0128] In some embodiments, the method for producing a pharmaceutical formulation provided herein includes adding human serum albumin to a predetermined range. As described herein, in some embodiments, the human serum albumin is provided in a solution containing about 25% human serum albumin. In some embodiments, the human serum albumin solution is added to a concentration of about 2%, about 3%, about 4%, about 5%, about 8%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% (w / w). In some embodiments, the human serum albumin solution is added to a concentration of about 2% to about 3%, about 3% to about 5%, about 5% to about 8%, about 8% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, or about 45% to about 50% (w / w). In some embodiments, the human serum albumin solution is added to a concentration of about 15% to about 25% (w / w). In some embodiments, the human serum albumin solution is added to a concentration of about 20% (w / w).

[0129] In some embodiments, the method comprises combining (a) the enriched APCs with (b) a 25% human serum albumin solution at a concentration of about 15% to about 25% (w / w). In some embodiments, the method comprises combining (a) the enriched APCs with (b) a cryopreservation medium at a concentration of about 40% to about 95% (w / w), and (c) a 25% human serum albumin solution at a concentration of about 15% to about 25% (w / w). In some embodiments, the method comprises combining (a) the enriched APCs with (b) a cryopreservation medium at a concentration of about 25% to about 35% (w / w), and (c) a 25% human serum albumin solution at a concentration of about 15% to about 25% (w / w). In some embodiments, the method comprises combining (a) enriched APCs, (b) cryopreservation medium at a concentration of about 40% to about 95% (w / w), (c) cryopreservation medium at a concentration of about 25% to about 35% (w / w), and (d) a 25% human serum albumin solution at a concentration of about 15% to about 25% (w / w). In some embodiments, the method comprises combining (a) enriched APCs comprising HPV antigens (e.g., HPV E6 and / or E7 proteins), (b) cryopreservation medium at a concentration of about 50% (w / w), (c) cryopreservation medium at a concentration of about 30% (w / w), and (d) a 25% human serum albumin solution at a concentration of about 20% (w / w).

[0130] In some embodiments, the methods of producing pharmaceutical formulations provided herein include adjusting the formulation to a desired pH. The pH can be adjusted using any suitable method known in the art. In some embodiments, the methods include adjusting the pH of the formulation to about 5.0 to about 9.5. In some embodiments, the methods include adjusting the pH to about 6.0 to about 8.5. In some embodiments, the methods include adjusting the pH to about 7.9. In some embodiments, the methods include adjusting the pH to about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, about 9, or about 10. In some embodiments, the methods include adjusting the pH to about 7, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, or about 8.0. In some embodiments, the method comprises adjusting the pH to about 5 to about 6, about 6 to about 7, about 7 to about 8, about 8 to about 9, or about 9 to about 10. In some embodiments, the method comprises adjusting the pH to about 7 to about 7.1, about 7.1 to about 7.2, about 7.2 to about 7.3, about 7.3 to about 7.4, about 7.4 to about 7.5, about 7.5 to about 7.6, about 7.6 to about 7.7, about 7.7 to about 7.8, about 7.8 to about 7.9, or about 7.9 to about 8.0.

[0131] Method for manufacturing reinforced APC As described herein, the enhanced APCs of the pharmaceutical preparations described herein exhibit certain improved properties compared to other APCs available in the art. For example, the enhanced APCs described herein can activate T cells in an HLA-agnostic manner. Without being bound by any one theory, in some embodiments, the APCs provided herein are able to do so because they are modified to contain full-length HPV antigens. Specifically, in some embodiments, the enhanced APCs contain the full-length HPV E6 protein. In some embodiments, the enhanced APCs contain the full-length HPV E7 protein. In some embodiments, the enhanced APCs contain both the full-length HPV E7 protein and the full-length HPV E6 protein.

[0132] Additionally, as further described elsewhere in this disclosure, in some embodiments, the enhanced APCs useful in the present disclosure exhibit increased expression of costimulatory molecules and / or cytokines. More specifically, in some embodiments, the enhanced cells described herein exhibit increased expression of IL-2 (e.g., membrane-bound IL-2). In some embodiments, the enhanced cells described herein exhibit increased expression of IL-12 (e.g., membrane-bound IL-12). In some embodiments, the enhanced cells described herein exhibit increased expression of CD86. In some embodiments, the enhanced cells described herein exhibit increased expression of IL-2 (e.g., membrane-bound IL-2), IL-12 (e.g., membrane-bound IL-12), and CD86. Thus, in some aspects, the enriched cells provided herein comprise both a full-length HPV E7 protein (e.g., of HPV-16) and a full-length HPV E6 protein (e.g., of HPV-16), and exhibit increased expression of IL-2 (e.g., membrane-bound IL-2), IL-12 (e.g., membrane-bound IL-12), and CD86.

[0133] In some embodiments, modifying APCs to produce enhanced APCs useful in the formulations provided herein comprises intracellularly delivering a nucleic acid encoding an antigen (e.g., an HPV antigen), a costimulatory molecule (e.g., CD86), and / or a cytokine (e.g., membrane-bound IL-2 and / or membrane-bound IL-12). In some embodiments, intracellularly delivering a nucleic acid to a cell comprises passing a cell suspension containing the cells through a constriction under a set of parameters, thereby causing a perturbation within the cell such that upon contact with the cell, the nucleic acid enters the cell via the perturbation (i.e., squeezing). In some embodiments, the method further comprises contacting the cell with the nucleic acid. As used herein, "contact" between a cell and a nucleic acid as described herein does not require that the cell and the nucleic acid be in physical contact. As is clear from the present disclosure, contact between a cell and a nucleic acid occurs so long as the nucleic acid can enter the cell once there is a perturbation in the cell's plasma membrane. For ease of explanation, in some embodiments, a cell and a nucleic acid are in contact if they are both present in the same cell suspension, regardless of whether the cell and the nucleic acid are in physical contact. Thus, in some embodiments, contacting the cells with the nucleic acid comprises incubating a cell suspension comprising the cells with the nucleic acid.

[0134] In some embodiments, when multiple nucleic acids (e.g., a nucleic acid encoding an HPV antigen, a nucleic acid encoding a costimulatory molecule, and a nucleic acid encoding a cytokine) are delivered, they can be delivered to cells using a single squeezing process, e.g., a cell suspension containing the multiple nucleic acids delivered to the cells in combination ("co-delivery"). In some embodiments, multiple nucleic acids can be delivered to cells sequentially. As used herein, the term "sequential delivery" refers to the delivery of multiple nucleic acids to cells, where a first nucleic acid (e.g., encoding an HPV antigen) is delivered to a cell, and then a second (or subsequent) nucleic acid (e.g., encoding a costimulatory molecule and / or cytokine) is delivered to the cell. In some embodiments, the first nucleic acid, the second nucleic acid, or both the first and second nucleic acids can be delivered to cells using squeezing. For example, in some embodiments, the first nucleic acid can be delivered to a cell using squeezing, and the second nucleic acid can be delivered to a cell using a non-squeezing process (e.g., transfection). In some embodiments, a first nucleic acid can be delivered to a cell using a non-compression process (e.g., transfection), and a second nucleic acid can be delivered to a cell using a compression process. In some embodiments, a first nucleic acid can be delivered to a cell using a first compression, and then a second nucleic acid can be delivered to a cell using a second compression (also referred to herein as "sequential compression" or "sequential compression process"). Thus, sequential delivery useful in the present disclosure can include multiple compression processes. In some embodiments, each of the multiple compression processes delivers a separate nucleic acid to a cell. In some embodiments, one or more of the multiple compression processes does not involve the delivery of a nucleic acid. For example, in some aspects, the sequential delivery methods described herein include a first compression, a second compression, and a third compression, where the first compression includes passing cells without a payload through a first constriction, the second compression includes passing cells from the first compression through a second constriction to deliver a first nucleic acid (e.g., encoding an HPV antigen) to the cells, and the third compression includes passing cells from the second compression through a third constriction to deliver a second nucleic acid (e.g., encoding a costimulatory molecule and / or cytokine) to the cells.Without being bound by any one theory, in some embodiments, passing cells through a first constriction without any payload (i.e., a first squeeze) can serve to prepare the cells for subsequent delivery, e.g., improve the efficiency of delivery of the first nucleic acid and / or the second nucleic acid.

[0135] constriction Microfluidic Channels As described herein, a constriction is used to induce a physical deformation in a cell, thereby creating a disturbance in the cell's plasma membrane and enabling delivery of a nucleic acid into the cell. In some embodiments, the constriction is within a channel (referred to herein as a "microfluidic channel" or "channel") contained within a microfluidic device. When multiple channels are involved, in some embodiments, the multiple channels may be arranged in parallel and / or series within the microfluidic device. In some embodiments, cells described herein can pass through at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, at least about 1,000, or more distinct constrictions. In some embodiments, cells described herein pass through more than about 1,000 distinct constrictions. In some embodiments, multiple constrictions can be part of a single microfluidic device (e.g., a multi-row constriction chip). In some embodiments, one or more of the plurality of constrictions may be part of different microfluidic devices. For example, in some embodiments, cells described herein undergo a first squeezing process in which the cells pass through a first constriction in a first microfluidic device (e.g., a chip). Then, after the cells have passed through the first squeezing process (e.g., passed through the first constriction), the cells undergo a second squeezing process in which the cells pass through a second constriction in a second microfluidic device (e.g., a chip). In some embodiments, each of the constrictions is the same (e.g., has the same length, width, and / or depth). In some embodiments, one or more of the constrictions are different.When multiple constrictions are used, the multiple constrictions can include a first constriction associated with a first nucleic acid (e.g., encoding an HPV antigen) and a second constriction associated with a second nucleic acid (e.g., encoding a costimulatory molecule and / or cytokine), where the cell suspension is passed through the first constriction to deliver the first nucleic acid to one or more cells of the plurality of cells, and then the cell suspension is passed through the second constriction to deliver the second nucleic acid to one or more cells of the plurality of cells. In some embodiments, the cell suspension is passed through the second constriction at least about 1 minute, at least about 30 minutes, at least about 1 hour, at least about 6 hours, at least about 12 hours, or at least about 1 day after the cell suspension has passed through the first constriction.

[0136] In some embodiments, when a cell suspension is passed through multiple constrictions (e.g., multiple squeezing), the cells remain viable after passing through each constriction. As is apparent from the present disclosure, in some embodiments, the multiple constrictions include two or more constrictions present within a single microfluidic device (e.g., a multi-row constriction chip), thereby allowing cells to pass sequentially through the multiple constrictions. In some embodiments, the multiple constrictions are part of separate microfluidic devices, whereby a first constriction is associated with the first microfluidic device and a second constriction is associated with the second microfluidic device. For example, in some embodiments, cells pass through a first constriction associated with a first microfluidic device (e.g., chip) (i.e., first squeezing). After the cells pass through the first constriction, the cells pass through a second constriction associated with a second microfluidic device (e.g., chip) (i.e., second squeezing). In some embodiments, after passing through the first constriction, the cells are cultured in medium before passing the cells through the second constriction. In some embodiments, the cells are cultured for at least about 1 minute, at least about 30 minutes, at least about 1 hour, at least about 6 hours, at least about 12 hours, or at least about 1 day before passing the cells through a second constriction. As will be apparent from the present disclosure, in some embodiments, the first and second constrictions have the same length, depth, and / or width. In some embodiments, the first and second constrictions can have different lengths, depths, and / or widths.

[0137] In some embodiments, after passing through a constriction, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the cells remain viable. When cells pass through multiple constrictions (e.g., in a single microfluidic device or as part of separate microfluidic devices), at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the cells remain viable after passing through each of the multiple constrictions. Cell viability can be measured using any suitable method known in the art. In some embodiments, cell viability can be measured using a Nucleocounter NC-200, an Orflo MoxiGo II cell counter, or both.

[0138] Exemplary microfluidic channels containing cell-deforming constrictions for use in the methods described herein are described in U.S. Publication No. 2020 / 0277566A1, U.S. Publication No. 2020 / 0332243A1, U.S. Publication No. 2020 / 0316604A1, U.S. Provisional Application No. 63 / 131,423, and U.S. Provisional Application No. 63 / 131,430, each of which is incorporated by reference herein in its entirety.

[0139] In some embodiments, the microfluidic channels (i.e., including constrictions) described herein include a lumen and are configured to allow cells suspended in a buffer solution (e.g., a cell suspension) to pass through the channel. Microfluidic channels useful in the present disclosure can be fabricated using any suitable material available in the art, including, but not limited to, silicon, metal (e.g., stainless steel), plastic (e.g., polystyrene), ceramic, glass, crystalline substrate, amorphous substrate, polymer (e.g., polymethyl methacrylate (PMMA), PDMS, cyclic olefin copolymer (COC)), or combinations thereof. In some embodiments, the material is silicon. Fabrication of the microfluidic channels can be performed by any method known in the art, including, but not limited to, dry etching, e.g., deep reactive ion etching, wet etching, photolithography, injection molding, laser ablation, SU-8 masking, or combinations thereof. In some embodiments, fabrication is performed using dry etching.

[0140] In some embodiments, microfluidic channels useful in the present disclosure include an inlet portion, a center point, and an outlet portion. In some embodiments, the cross-section of one or more of the inlet portion, center point, and / or outlet portion can vary. For example, the cross-section can be circular, oval, elongated slit, square, hexagonal, or triangular.

[0141] The inlet portion defines a constriction angle. In some embodiments, adjusting (e.g., increasing or decreasing) the constriction angle can reduce or prevent occlusion of the constriction. In some embodiments, the angle of the outlet portion can also be adjusted. For example, in some embodiments, the angle of the outlet portion can be configured to reduce the possibility of turbulence, which can result in non-laminar flow. In some embodiments, the walls of the inlet portion and / or outlet portion are straight. In some embodiments, the walls of the inlet portion and / or outlet portion are curved.

[0142] In some embodiments, the length, depth, and / or width of the constriction can be varied. In some embodiments, adjusting (e.g., increasing or decreasing) the length, depth, and / or width of the constriction can increase or decrease the efficiency of payload delivery. As used herein, the term "delivery efficiency" refers to the amount of payload delivered into a cell. For example, delivery efficiency can increase if the total amount of payload delivered is increased.

[0143] In some embodiments, the stenosis has a length of less than about 1 μm. In some embodiments, the stenosis has a length of about 0 μm to about 100 μm. In some embodiments, the length of the stenosis is less than about 0.1 μm, less than about 0.2 μm, less than about 0.3 μm, less than about 0.4 μm, less than about 0.5 μm, less than about 0.6 μm, less than about 0.7 μm, less than about 0.8 μm, less than about 0.9 μm, less than about 1 μm, less than about 2.5 μm, less than about 5 μm, less than about 7.5 μm, less than about 10 μm, less than about 12.5 μm, less than about 15 μm, less than about 20 μm, less than about 30 μm, less than about 40 μm, less than about 50 μm, less than about 60 μm, less than about 70 μm, less than about 80 μm, less than about 90 μm, or less than about 100 μm. In some embodiments, the length of the constriction is about 0.1 μm, about 0.2 μm, about 0.3 μm, about 0.4 μm, about 0.5 μm, about 0.6 μm, about 0.7 μm, about 0.8 μm, about 0.9 μm, about 1 μm, about 2.5 μm, about 5 μm, about 7.5 μm, about 10 μm, about 12.5 μm, about 15 μm, about 20 μm, about 30 μm, about 40 μm, about 50 μm, about 60 μm, about 70 μm, about 80 μm, about 90 μm, or about 100 μm. In some embodiments, the length of the constriction is about 10 μm. In some embodiments, the constriction has a length of about 0 μm. For example, in some embodiments, a microfluidic device (eg, a chip) useful in the present disclosure comprises a constriction resembling two points of a diamond coming together, whereby the length of the constriction is about 0 μm.

[0144] In some embodiments, the width of the constriction is between about 0 μm and about 10 μm, hi some embodiments, the width of the constriction is less than about 0.1 μm, less than about 0.2 μm, less than about 0.3 μm, less than about 0.4 μm, less than about 0.5 μm, less than about 0.6 μm, less than about 0.7 μm, less than about 0.8 μm, less than about 0.9 μm, less than about 1 μm, less than about 2 μm, less than about 3 μm, less than about 4 μm, less than about 5 μm, less than about 6 μm, less than about 7 μm, less than about 8 μm, less than about 9 μm, or less than about 10 μm. In some embodiments, the width of the constriction is about 0.1 μm, about 0.2 μm, about 0.3 μm, about 0.4 μm, about 0.5 μm, about 0.6 μm, about 0.7 μm, about 0.8 μm, about 0.9 μm, about 1 μm, about 2 μm, about 3 μm, about 4 μm, about 5 μm, about 6 μm, about 7 μm, about 8 μm, about 9 μm, or about 10 μm. In some embodiments, the width of the constriction is between about 3 μm and about 10 μm. In some embodiments, the width of the constriction is about 6 μm.

[0145] In some embodiments, the depth of the constriction is at least about 1 μm. In some embodiments, the depth of the constriction is at least about 2 μm, at least about 3 μm, at least about 4 μm, at least about 5 μm, at least about 10 μm, at least about 20 μm, at least about 30 μm, at least about 40 μm, at least about 50 μm, at least about 60 μm, at least about 70 μm, at least about 80 μm, at least about 90 μm, at least about 100 μm, at least about 110 μm, or at least about 120 μm. In some embodiments, the depth of the constriction is about 5 μm to about 90 μm. In some embodiments, the depth of the constriction is about 5 μm, about 10 μm, about 20 μm, about 30 μm, about 40 μm, about 50 μm, about 60 μm, about 70 μm, about 80 μm, or about 90 μm. In some embodiments, the depth of the constriction is about 70 μm.

[0146] In some embodiments, the length of the constriction is about 10 μm, the width of the constriction is about 6 μm, and the depth of the constriction is about 70 μm. In some embodiments, the length of the constriction is 10 μm, the width of the constriction is 6 μm, and the depth of the constriction is 70 μm.

[0147] In some embodiments, the diameter of a constriction (e.g., contained within a microfluidic channel) is a function of the diameter of one or more cells passing through the constriction. Without being bound by any one theory, in some embodiments, the diameter of the constriction is smaller than the diameter of the cells, thereby exerting a deforming force on the cells as they pass through the constriction, resulting in a transient physical deformation of the cells.

[0148] Thus, in some embodiments, the diameter of the constriction (also referred to herein as "constriction size") is about 20% to about 99% of the diameter of the cell. In some embodiments, the constriction size is about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 99% of the cell diameter. As is apparent from the present disclosure, adjusting (e.g., increasing or decreasing) the diameter of the constriction can also modify the efficiency of delivery of a payload into a cell.

[0149] Porous surface In some embodiments, the constrictions described herein comprise surface-contained pores. Non-limiting examples of surface-contained pores that can be used in the present disclosure are described, for example, in U.S. Publication No. 2019 / 0382796A1, which is incorporated herein by reference in its entirety.

[0150] In some embodiments, surfaces useful in the present disclosure (i.e., comprising one or more pores that can cause physical deformation in cells as they pass through the pores) can be made using any suitable material available in the art and / or can take any one of several forms. Non-limiting examples of such materials include synthetic or natural polymers, polycarbonate, silicon, glass, metals, alloys, cellulose nitrate, silver, cellulose acetate, nylon, polyester, polyethersulfone, polyacrylonitrile (PAN), polypropylene, PVDF, polytetrafluoroethylene, mixed cellulose esters, porcelain, ceramic, or combinations thereof.

[0151] In some embodiments, the surface comprises a filter. In some embodiments, the filter is a tangential flow filter. In some embodiments, the surface comprises a membrane. In some embodiments, the surface comprises a sponge or sponge-like matrix. In some embodiments, the surface comprises a matrix. In some embodiments, the surface comprises a curved path surface. In some embodiments, the curved path surface comprises cellulose acetate.

[0152] The surface (i.e., comprising one or more pores) disclosed herein may have any suitable shape known in the art. When the surface has a two-dimensional shape, the surface may be, but is not limited to, a circle, an ellipse, a round, a square, a star, a triangle, a polygon, a pentagon, a hexagon, a heptagon, or an octagon. In some embodiments, the surface is round in shape. When the surface has a three-dimensional shape, in some embodiments, the surface may be, but is not limited to, a cylinder, a cone, or a cube.

[0153] As is apparent from the present disclosure, surfaces (e.g., comprising one or more pores) useful in the present disclosure can have a variety of cross-sectional widths and thicknesses. In some embodiments, the cross-sectional width of the surface is between about 1 mm and about 1 mm. In some embodiments, the surface has a defined thickness. In some embodiments, the surface thickness is uniform. In some embodiments, the surface thickness can vary. For example, in some embodiments, certain portions of the surface are thicker or thinner than other portions of the surface. In such embodiments, the thickness of different portions of the surface can vary from about 1% to about 90%. In some embodiments, the surface is between about 0.01 μm and about 5 mm thick.

[0154] The cross-sectional width of the pore can depend on the type of cell targeted by the payload. In some embodiments, the size of the pore is a function of the diameter of the cells of the targeted cell cluster. In some embodiments, the size of the pore is such that the cells are perturbed (i.e., physically deformed) as they pass through the pore. In some embodiments, the size of the pore is smaller than the diameter of the cell. In some embodiments, the size of the pore is about 20% to about 99% of the diameter of the cell. In some embodiments, the size of the pore is about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 99% of the diameter of the cell. In some embodiments, the pore size is about 0.4 μm, about 0.5 μm, about 0.6 μm, about 0.7 μm, about 0.8 μm, about 0.9 μm, about 1 μm, about 2 μm, about 3 μm, about 4 μm, about 5 μm, about 6 μm, about 7 μm, about μm, about 9 μm, about 10 μm, about 11 μm, about 12 μm, about 13 μm, about 14 μm, or about 15 μm or larger.

[0155] The entrance and exit of the pores can have various angles. In some embodiments, adjusting (e.g., increasing or decreasing) the pore angle can reduce or prevent any blockage of the constriction. In some embodiments, the flow rate (i.e., the rate at which the cells or cell-containing suspension passes through the pore) is between about 0.001 mL / cm / sec and about 100 L / cm / sec. For example, the angle of the entrance or exit portion can be between about 0 degrees and about 90 degrees. In some embodiments, the pores have the same entrance and exit angles. In some embodiments, the pores have different entrance and exit angles. In some embodiments, the ends of the pores are smooth, e.g., rounded or curved. As used herein, a "smooth" pore end has a continuous, flat, uniform surface without bulges, bumps, or uneven portions. In some embodiments, the ends of the pores are sharp. As used herein, a "sharp" pore end has a thin end that is pointed or has an acute angle. In some embodiments, the pore passage is straight. As used herein, a "straight" pore passage does not include curves, bends, angles, or other irregularities. In some embodiments, the pore passage is curved. As used herein, a "curved" pore passage is curved or deviates from a straight line. In some embodiments, the pore passage has multiple curves, for example, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, or more curves.

[0156] The pores can have any shape known in the art, including two-dimensional or three-dimensional shapes. The pore shape (e.g., cross-sectional shape) can be, but is not limited to, circular, elliptical, round, square, star-shaped, triangular, polygonal, pentagonal, hexagonal, heptagonal, and octagonal. In some embodiments, the cross-section of the pore is round. In some embodiments, the three-dimensional shape of the pore is cylindrical or conical. In some embodiments, the pores have grooved inlet and outlet shapes. In some embodiments, the pore shape is homogeneous (i.e., consistent or regular) among the pores within a given surface. In some embodiments, the pore shape is heterogeneous (i.e., mixed or diverse) among the pores within a given surface.

[0157] Surfaces useful in the present disclosure can have a single pore. In some embodiments, surfaces useful in the present disclosure include multiple pores. In some embodiments, the pores occupy about 10% to about 80% of the total surface area of the surface. In some embodiments, the surface has a total of about 1.0 x 10 5 to approximately 1.0 × 10 30 In some embodiments, the surface comprises pores having a surface area of 1 mm 2 Approximately 10 and 1.0 x 10 15 The pores between the

[0158] Pores can be distributed in many ways within a given surface. In some embodiments, the pores are distributed parallel within a given surface. In some embodiments, the pores are distributed side by side in the same direction and are spaced the same distance apart within a given surface. In some embodiments, the distribution of pores is ordered or homogeneous. In such embodiments, the pores may be distributed in a regular, systematic pattern, or may be spaced the same distance apart within a given surface. In some embodiments, the distribution of pores is random or heterogeneous. For example, in some embodiments, the pores are distributed in an irregular, chaotic pattern, or are spaced different distances apart within a given surface.

[0159] In some embodiments, multiple surfaces are used, whereby cells pass through multiple pores on different surfaces. In some embodiments, the multiple surfaces are distributed in series. The multiple surfaces can be uniform or heterogeneous in surface size, shape, and / or roughness. The multiple surfaces can further comprise pores with uniform or heterogeneous pore sizes, shapes, and / or numbers, thereby allowing for simultaneous delivery of a series of payloads to different cell types.

[0160] In some embodiments, the individual pores, e.g., the pores of a surface that can be used in the present disclosure, have a uniform width dimension (i.e., a constant width along the length of the pore passage). In some embodiments, the individual pores can vary in width (i.e., increasing or decreasing width along the length of the pore passage). In some embodiments, the pores within a given surface have the same individual pore depth. In some embodiments, the pores within a given surface have different individual pore depths. In some embodiments, the pores are immediately adjacent to one another. In some embodiments, the pores are separated from one another by a distance. In some embodiments, the pores are separated from one another by a distance of about 0.001 μm to about 30 mm.

[0161] In some embodiments, the surface is coated with a material. The material can be selected from any material known in the art, including, but not limited to, Teflon, adhesive coatings, surfactants, proteins, adhesion molecules, antibodies, anticoagulants, factors that modulate cell function, nucleic acids, lipids, carbohydrates, transmembrane proteins, or combinations thereof. In some embodiments, the surface is coated with polyvinylpyrrolidone. In some embodiments, the material is covalently bound to the surface. In some embodiments, the material is non-covalently bound to the surface. In some embodiments, the surface molecules are released when cells pass through the pores.

[0162] In some embodiments, the surface has modified chemical properties. In some embodiments, the surface is hydrophilic. In some embodiments, the surface is hydrophobic. In some embodiments, the surface is electrically charged. In some embodiments, the surface is positively and / or negatively charged. In some embodiments, the surface can be positively charged in some areas and negatively charged in other areas. In some embodiments, the surface has an overall positive charge or an overall negative charge. In some embodiments, the surface can be any one of smooth, electropolished, rough, or plasma treated. In some embodiments, the surface comprises a zwitterionic or zwitterionic compound. In some embodiments, the surface is plasma treated.

[0163] In some embodiments, the surface is contained within a larger module. In some embodiments, the surface is contained within a syringe, such as a plastic or glass syringe. In some embodiments, the surface is contained within a plastic filter holder. In some embodiments, the surface is contained within a pipette tip.

[0164] Cellular perturbation As described herein, when a cell passes through a constriction, it is physically deformed, resulting in a disruption (e.g., a hole, a tear, a cavity, an opening, a pore, a gap, a gap, a perforation) in the cell's cell membrane. Such disruption of the cell membrane is temporary and sufficient to allow any of the nucleic acids described herein to be delivered into the cell. Cells have a self-repair mechanism that allows the cell to repair disruption of the cell membrane. See Blazek et al., Physiology (Bethesda) 30(6):438-48 (Nov. 2015) (incorporated herein by reference in its entirety). Thus, in some embodiments, once a cell passes through a constriction (e.g., a microfluidic channel or a pore), the disruption of the cell membrane can be reduced or eliminated, thereby preventing the payload delivered into the cell from leaving the cell.

[0165] In some embodiments, the cell membrane perturbation is greater than or equal to about 1.0×10 after the pressure is removed (e.g., after the cell passes through the constriction). -9 In some embodiments, the cell perturbation lasts from about 1.0 x 10 seconds to about 2 hours. -9 In some embodiments, the cell perturbation lasts from about 1.0 x 10 seconds to about 1 second, from about 1 second to about 1 minute, or from about 1 minute to about 1 hour. -9 seconds to approximately 1.0 x 10 -1 sec, approximately 1.0 x 10 -9 seconds to approximately 1.0 x 10 -2 sec, approximately 1.0 x 10 -9 seconds to approximately 1.0 x 10 -3 sec, approximately 1.0 x 10 -9 seconds to approximately 1.0 x 10 -4 sec, approximately 1.0 x 10 -9 seconds to approximately 1.0 x 10 -5sec, approximately 1.0 x 10 -9 seconds to approximately 1.0 x 10 -6 sec, approximately 1.0 x 10 -9 seconds to approximately 1.0 x 10 -7 seconds, or approximately 1.0 x 10 -9 seconds to approximately 1.0 x 10 -8 In some embodiments, the cell perturbation lasts for about 1.0 x 10 seconds. -8 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -7 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -6 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -5 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -4 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -3 seconds to approximately 1.0 x 10 -1 seconds, or approximately 1.0 x 10 -2 seconds to approximately 1.0 x 10 -1 The cellular perturbations (e.g., pores or holes) created by the methods described herein are not formed as a result of assembly of polypeptide subunits to form multimeric pore structures such as those created by complement or bacterial hemolysin.

[0166] In some embodiments, as cells pass through the constriction, pressure applied to the cells temporarily damages the cell membrane, which causes passive diffusion of material through the constriction. In some embodiments, cells are only deformed or perturbed for a short period of time, e.g., on the order of 100 μs or less, to minimize the opportunity for apoptotic pathways to be activated via cell signaling mechanisms, although other durations are possible (e.g., ranging from nanoseconds to hours). In some embodiments, cells are perturbed to a concentration of about 1.0×10 -9 In some embodiments, the cells are transformed in less than a second to less than about 2 hours. -9 In some embodiments, the cells are deformed in less than a second to less than about 1 second, in less than a second to less than about 1 minute, or in less than a minute to less than about 1 hour. -9In some embodiments, the cells are transformed at a rate of about 1.0 x 10 -9 In some embodiments, the cells are deformed for about 1.0 x 10 seconds to about 1 second, about 1 second to about 1 minute, or about 1 minute to about 1 hour. -9 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -9 seconds to approximately 1.0 x 10 -2 seconds, approximately 1.0×10 -9 seconds to approximately 1.0 x 10 -3 seconds, approximately 1.0×10 -9 seconds to approximately 1.0 x 10 -4 seconds, approximately 1.0×10 -9 seconds to approximately 1.0 x 10 -5 seconds, approximately 1.0×10 -9 seconds to approximately 1.0 x 10 -6 seconds, approximately 1.0×10 -9 seconds to approximately 1.0 x 10 -7 seconds, or approximately 1.0 x 10 -9 seconds to approximately 1.0 x 10 -8 In some embodiments, the cells are about 1.0 x 10 -8 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -7 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -6 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -5 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -4 seconds to approximately 1.0 x 10 -1 seconds, approximately 1.0×10 -3 seconds to approximately 1.0 x 10 -1 seconds, or approximately 1.0 x 10 -2 seconds to approximately 1.0 x 10 -1 In some embodiments, transforming the cells includes, but is not limited to, transforming the cells for a time ranging from about 1 μs to at least about 750 μs, e.g., at least about 1 μs, at least about 10 μs, at least about 50 μs, at least about 100 μs, at least about 500 μs, or at least about 750 μs.

[0167] In some embodiments, the delivery of nucleic acids described herein into cells occurs simultaneously with the cells passing through the constriction. In some embodiments, the delivery of nucleic acids into cells can occur after the cells pass through the constriction (i.e., before the cell membrane of the cells recovers if membrane perturbations are still present). In some embodiments, the delivery of nucleic acids into cells occurs within a few minutes after the cells pass through the constriction. In some embodiments, the intracellular perturbations after the cells pass through the constriction are corrected within about 5 minutes or so after the cells pass through the constriction.

[0168] In some embodiments, cell viability after passage through the constriction is between about 5% and about 100%. In some embodiments, cell viability after passage through the constriction is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%. In some embodiments, cell viability is about 1.0 x 10 cells after passage through the constriction. -2 For example, cell viability is measured at about 1.0 x 10 cells per second to at least about 10 days after the cells pass through the constriction. -2 The cell viability can be measured after about 1.0 x 10 seconds to about 1 second, about 1 second to about 1 minute, about 1 minute to about 30 minutes, or about 30 minutes to about 2 hours. In some embodiments, the cell viability is measured after about 1.0 x 10 cells have passed through the constriction. -2 seconds to about 2 hours, about 1.0 x 10 -2 Seconds to about 1 hour, about 1.0 x 10 -2 seconds to approximately 30 minutes, approximately 11.0 x 10 -2 Seconds to approximately 1 minute, approximately 1.0 x 10 -2 seconds to approximately 30 seconds, approximately 1.0 x 10 -2 seconds to about 1 second, or about 1.0 x 10 -2In some embodiments, cell viability is measured from about 1.5 hours to about 2 hours, from about 1 hour to about 2 hours, from about 30 minutes to about 2 hours, from about 15 minutes to about 2 hours, from about 1 minute to about 2 hours, from about 30 seconds to about 2 hours, or from about 1 second to about 2 hours after the cells have passed through the constriction. In some embodiments, cell viability is measured from about 2 hours to about 5 hours, from about 5 hours to about 12 hours, from about 12 hours to about 24 hours, or from about 24 hours to about 10 days after the cells have passed through the constriction.

[0169] Delivery Parameters As is apparent from the present disclosure, several parameters can affect the efficiency of delivery of nucleic acids into cells using the squeezing method provided herein. Thus, adjusting (e.g., increasing or decreasing) one or more of the delivery parameters can improve the delivery of a payload into cells. Thus, in some aspects, the present disclosure relates to a method for increasing the delivery of a payload (e.g., a nucleic acid described herein) into cells, the method comprising adjusting one or more parameters when passing a cell suspension through a constriction, the cell suspension comprising a population of cells, wherein the one or more parameters increase the delivery of the payload to one or more cells of the population of cells compared to reference parameters. As described elsewhere in this disclosure, the payload can be contacted with the population of cells before, during, or after the squeezing step.

[0170] In some embodiments, by adjusting one or more of the delivery parameters, delivery of a payload (e.g., a nucleic acid described herein) into one or more cells is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 40-fold, or at least about 50-fold compared to delivery of the payload agent into the corresponding cell using the reference parameters.

[0171] In some embodiments, one or more delivery parameters that can be adjusted to increase the efficiency of delivery of the parameters include cell density (i.e., the concentration of cells present in, for example, a cell suspension), pressure, or both. Additional examples of delivery parameters that can be adjusted are provided elsewhere in this disclosure.

[0172] In some embodiments, the cell density is about 1 x 10 7 cells / mL, approximately 2×10 7 cells / mL, approximately 3×10 7 cells / mL, approximately 4×10 7 cells / mL, approximately 5×10 7 cells / mL, approximately 6×10 7 cells / mL, approximately 7×10 7 cells / mL, approximately 8×10 7 cells / mL, approximately 9×10 7 cells / mL, approximately 1×10 8 cells / mL, approximately 1.1×10 8 cells / mL, approximately 1.2×10 8 cells / mL, approximately 1.3×10 8 cells / mL, approximately 1.4×10 8 cells / mL, approximately 1.5×10 8 cells / mL, approximately 2.0×10 8 cells / mL, approximately 3.0×10 8 cells / mL, approximately 4.0×10 8 cells / mL, approximately 5.0×10 8 cells / mL, approximately 6.0×10 8 cells / mL, approximately 7.0×10 8 cells / mL, approximately 8.0×10 8 cells / mL, approximately 9.0×10 8 cells / mL, or approximately 1.0 x 10 9 In some embodiments, the cell density is about 6 x 10 cells / mL or more. 7 cells / mL and approximately 1.2 x 10 8 cells / mL.

[0173] In some embodiments, the pressure is about 20 psi, about 25 psi, about 30 psi, about 35 psi, about 40 psi, about 50 psi, about 55 psi, about 60 psi, about 65 psi, about 70 psi, about 75 psi, about 80 psi, about 85 psi, about 90 psi, about 95 psi, about 100 psi, about 110 psi, about 120 psi, about 130 psi, about 140 psi, about 150 psi, about 160 psi, about 170 psi, about 180 psi, about 190 psi, or about 200 psi or greater. In some embodiments, the pressure is between about 30 psi and about 90 psi.

[0174] In some embodiments, the specific type of device (e.g., a microfluidic chip) can also affect the efficiency of delivery of a payload (e.g., a nucleic acid) described herein. In the case of microfluidic chips, different chips can have different constriction parameters, such as the length, depth, and width of the constriction, the entrance angle, exit angle, length, depth, and width of the access region, etc. As described herein, such variables can affect the delivery of a payload to a cell using the squeezing methods of the present disclosure. In some embodiments, the length of the constriction is up to 100 μm. For example, in some embodiments, the length is about 1 μm, about 5 μm, 10 μm, about 20 μm, about 30 μm, about 40 μm, about 50 μm, about 60 μm, about 70 μm, about 80 μm, about 90 μm, or about 100 μm. In some embodiments, the length of the constriction is less than 1 μm. In some embodiments, the length of the stenosis is less than about 1 μm, less than about 5 μm, less than about 10 μm, less than about 20 μm, less than about 30 μm, less than about 40 μm, less than about 50 μm, less than about 60 μm, less than about 70 μm, less than about 80 μm, less than about 90 μm, or less than about 100 μm. In some embodiments, the stenosis has a length of about 10 μm.

[0175] In some embodiments, the width of the constriction is up to about 10 μm. In some embodiments, the width of the constriction is less than about 1 μm, less than about 2 μm, less than about 3 μm, less than about 4 μm, less than about 5 μm, less than about 6 μm, less than about 7 μm, less than about 8 μm, less than about 9 μm, or less than about 10 μm. In some embodiments, the width is between about 3 μm and about 10 μm. In some embodiments, the width is about 3 μm, about 4 μm, about 5 μm, about 6 μm, about 7 μm, about 8 μm, about 9 μm, or about 10 μm. In some embodiments, the width of the constriction is about 6 μm.

[0176] In some embodiments, the depth of the constriction is at least about 1 μm. In some embodiments, the depth of the constriction is at least about 1 μm, at least about 2 μm, at least about 3 μm, at least about 4 μm, at least about 5 μm, at least about 10 μm, at least about 20 μm, at least about 30 μm, at least about 40 μm, at least about 50 μm, at least about 60 μm, at least about 70 μm, at least about 80 μm, at least about 90 μm, at least about 100 μm, at least about 110 μm, or at least about 120 μm. In some embodiments, the depth is between about 5 μm and about 90 μm. In some embodiments, the depth is about 5 μm, about 10 μm, about 15 μm, about 20 μm, about 30 μm, about 40 μm, about 50 μm, about 60 μm, about 70 μm, about 80 μm, or about 90 μm. In some embodiments, the depth of the constriction is about 70 μm.

[0177] In some embodiments, the length is about 10 μm, the width is about 6 μm, and the depth is about 70 μm.

[0178] Additional examples of parameters that can affect the delivery of a payload into cells include, but are not limited to, the dimensions of the constriction (e.g., length, width, and / or depth), the entrance angle of the constriction, the surface characteristics of the constriction (e.g., roughness, chemical modification, hydrophilicity, hydrophobicity), the operating flow rate, the payload concentration, the time for cells to recover, or a combination thereof. Further parameters that can affect the efficiency of delivery of a payload (e.g., a nucleic acid as described herein) can include the velocity of the cells at the constriction, the shear rate at the constriction, the viscosity of the cell suspension, the velocity component perpendicular to the flow rate, and the time within the constriction. Such parameters can be designed to control the delivery of the payload.

[0179] In some embodiments, the temperature used in the disclosed methods can also affect the efficiency of delivery of the payload into the cells and the viability of the cells. In some embodiments, the compression method is performed at a temperature between about -5°C and about 45°C. For example, the method can be performed at room temperature (e.g., about 20°C), physiological temperature (e.g., about 37°C), higher than physiological temperature (e.g., about 37°C to 45°C or higher), or reduced temperature (e.g., about -5°C to about 4°C), or temperatures between these exemplary temperatures.

[0180] Various methods can be used to drive cells through the constriction. For example, pressure can be applied by a pump (e.g., a gas bottle or compressor) on the inlet side, vacuum can be applied by a vacuum pump on the outlet side, capillary action can be applied through tubing, and / or the system can be gravity-fed. Displacement-based flow systems (e.g., syringe pumps, peristaltic pumps, manual syringes or pipettes, pistons, etc.) can also be used. In some embodiments, cells are passed through the constriction by positive pressure. In some embodiments, cells are passed through the constriction by constant or variable pressure. In some embodiments, pressure is applied using a syringe. In some embodiments, pressure is applied using a pump. In some embodiments, the pump is a peristaltic pump or a diaphragm pump. In some embodiments, pressure is applied using a vacuum. In some embodiments, cells are passed through the constriction by gravity. In some embodiments, cells are passed through the constriction by capillary pressure.

[0181] In some aspects, the fluid flow causes the cells to pass through the constriction. In some aspects, the fluid flow is turbulent before the cells pass through the constriction. Turbulent flow is fluid flow in which the velocity at a given point varies irregularly in magnitude and direction. In some aspects, the fluid flow through the constriction is laminar. Laminar flow involves constant flow in a fluid near a solid boundary where the direction of flow remains constant at all points. In some aspects, the fluid flow is turbulent after the cells pass through the constriction. The velocity at which the cells pass through the constriction can vary. In some aspects, the cells pass through the constriction at a uniform cell velocity. In some aspects, the cells pass through the constriction at fluctuating cell velocities.

[0182] In some embodiments, a combination treatment is used to deliver a payload, e.g., following the methods described herein, cells are exposed to an electric field downstream of the constriction. In some embodiments, after passing through the constriction, the cells pass through an electric field generated by at least one electrode. In some embodiments, the electric field assists in delivering the payload to a second location within the cell, such as the cell nucleus. In some embodiments, one or more electrodes are in close proximity to the cell-deforming constriction to generate the electric field. In some embodiments, the electric field is between about 0.1 kV / m and about 100 MV / m. In some embodiments, an integrated circuit is used to provide the electrical signal to drive the electrodes. In some embodiments, the cells are exposed to the electric field for a pulse width between about 1 ns and about 1 s and a duration between about 100 ns and about 10 s.

[0183] Acclimatization method In some embodiments, the enhanced APCs provided herein are conditioned to further improve one or more properties of the cells. In some embodiments, the enhanced APCs are conditioned after constriction-mediated delivery. In some embodiments, the adjuvant comprises CpG oligodeoxynucleotide (ODN), LPS, IFN-α, a STING agonist, a RIG-I agonist, poly I:C, R837, R848, a TLR3 agonist, a TLR4 agonist, or a TLR9 agonist. In some embodiments, the adjuvant is CpG ODN 2006 (also known as CpG7909) (TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 23)). In some embodiments, the adjuvant is CpG7909. In some embodiments, the adjuvant is CpG7909 oligodeoxynucleotide (ODN).

[0184] In some embodiments, conditioning the enhanced APCs provided herein comprises incubating the enhanced APCs with an adjuvant for about 1 to about 24 hours. In some embodiments, the enhanced APCs are incubated with the adjuvant for about 2 to about 10 hours. In some embodiments, the enhanced APCs are incubated with the adjuvant for about 3 to about 6 hours. In some embodiments, the enhanced APCs are incubated with the adjuvant for about 1 hour, about 2 hours, about 3 hours, about 3.5 hours, about 4 hours, about 4.5 hours, about 5 hours, about 5.5 hours, about 6 hours, about 8 hours, about 12 hours, about 16 hours, about 20 hours, or about 24 hours. In some embodiments, the enhanced APCs are incubated with the adjuvant for about 4 hours. In some embodiments, the enhanced APCs are incubated with the adjuvant for about 3 hours. In some embodiments, the enhanced APCs are incubated with the adjuvant at about 37° C. for about 4 hours. In some embodiments, the enhanced APCs are incubated with the adjuvant at about 37° C. for about 3 hours. In some embodiments, the enhanced APCs are incubated with CpG7909 for about 4 hours. In some embodiments, the enhanced APCs are incubated with CpG7909 for about 3 hours. In some embodiments, the concentration of the adjuvant (e.g., CpG7909) is about 0.20 mg / mL, about 0.25 mg / mL, about 0.30 mg / mL, about 0.35 mg / mL, about 0.40 mg / mL, about 0.45 mg / mL, or about 0.50 mg / mL, or any concentration therebetween. In some embodiments, the enhanced APCs are incubated with CpG7909 at a concentration of about 0.35 mg / mL. In some embodiments, the enhanced APCs are incubated with CpG7909 at a concentration of about 0.35 mg / mL for about 4 hours at about 37° C. In some embodiments, the enhanced APCs are incubated with CpG7909 at a concentration of about 0.35 mg / mL for about 3 hours at about 37°C. [Example]

[0185] Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of the present disclosure. The present disclosure will now be described in more detail by reference to the following non-limiting examples. The following examples further illustrate the present disclosure but, of course, should not be construed as in any way limiting its scope.

[0186] Example 1. Development of enhanced APCs as described herein Each of five different mRNAs (encoding HPV-16 E6 protein, HPV-17 E7 protein, CD86, membrane-bound IL-2, and membrane-bound IL-12) was delivered intracellularly to PBMCs using squeezing. Table 2 (below) shows the sequences of these mRNAs. JPEG2025527190000003.jpg166135JPEG2025527190000004.jpg168135JPEG2025527190 000005.jpg170135JPEG2025527190000006.jpg168135JPEG2025527190000007.jpg86135

[0187] As shown in Figure 1, upon entry into PBMCs, the mRNA is translated and the encoded protein is expressed on the PBMCs, resulting in the enhanced APCs described herein. After squeeze delivery, the viability of the enhanced APCs was assessed with an NC-200 cell counter, which provided the number of live cells / mL. Total cell counts were derived from the number of events captured in the acridine orange-positive (AO+) gate. Dead cell counts were derived from the number of events captured in the DAPI-positive (DAPI+) gate. The AO+ gate, DAPI, and cell diameter are shown in Figures 2A-2C. Such counts were used to calculate percent viability using the following formula: (total AO+) = (total AO+) + (DAPI ... + Cell-DAPI + Dead cells) / Total AO + Cells x 100. Exemplary results from the NC-200 cell counter are shown in Table 3 below. JPEG2025527190000008.jpg36135

[0188] Next, phenotypic analysis was performed using flow cytometry to evaluate the cellular composition of the enriched APCs. As shown in Figure 3, nearly all of the enriched APCs were positive for CD45 expression. Furthermore, as shown in Figures 5A-5D, the enriched APCs primarily contained T cells, monocytes, B cells, and NK cells. No significant population of granulocytes was observed (see Figure 5D). Finally, as shown in Figure 6, a significant proportion of the enriched APCs were positive for Annexin V staining. Annexin V-positive cells are typically thought to be involved in the apoptotic pathway, but here, the positive staining was likely due to transient membrane disruption caused by the squeezing method described herein.

[0189] Next, the efficacy of the enhanced APCs was assessed by measuring the expression of proteins encoded by five mRNAs: HPV-16 E6 protein, HPV-16 E7 protein, CD86, membrane-bound IL-12, and membrane-bound IL-2. As shown in Figures 7A-7D, each of the cell subtypes present within the enhanced APCs (i.e., B cells, T cells, monocytes, and NK cells) showed significantly higher expression of CD86, mbIL-2, and mbIL-12 compared to untreated control PBMCs. Furthermore, using Western blot analysis, the enhanced APCs also expressed significantly higher levels of both HPV-16 E6 protein and HPV-16 E7 protein (see Figures 8A and 8B).

[0190] Taken together, the above results confirm that the expression processing method provided herein was able to successfully modify PBMCs to generate the enhanced APCs of the present disclosure.

[0191] Example 2. Development and Use of the Formulations Described Herein The pharmaceutical formulations described herein are useful as sterile autologous cell therapy products, in which the cells are positive for the major cell type surface marker CD45 with at least 70% cell viability (see Example 1). The pharmaceutical formulation comprises enriched APCs (described in Example 1) at 11 x 10 in a solution containing 50% (w / w) CryoStor® CS10, 30% (w / w) HypoThermosol® FRS, and 20% (w / w) 25% human serum albumin (HSA). 6 The formulation was prepared by formulating to a target concentration of viable cells / mL and filling into vials. The pH of the formulation was adjusted to 7.0-7.9. These vials were stored frozen using a chamber temperature of -170°C or lower, which reached and maintained a temperature of -140°C or lower during different stages of the development process (e.g., manufacturing and storage). The fill volume (i.e., 9.5 mL) was 76 x 10 cells per vial. 6 Expected cell concentration after thawing for a deliverable viable cell dose (8.5x10) 6 The selection was made taking into consideration the viable cells / mL and extractable volume (8.9 mL).

[0192] Table 4 provides additional descriptions of the pharmaceutical formulations described herein. JPEG2025527190000009.jpg156135

[0193] Table 5 outlines the quality target product profile and appropriate testing procedures for the pharmaceutical formulations described herein. JPEG2025527190000010.jpg158135

[0194] Table 6 shows the results of an exemplary stability study of pharmaceutical formulations of the present disclosure. JPEG2025527190000011.jpg170135JPEG2025527190000012.jpg82135JPEG2025527190000013.jpg121135JPEG2025527190000014.jpg173135JPEG2025527190000015.jpg175135JPEG2025527190000016.jpg176135JPEG2025527190000017.jpg114135

Claims

1. (a) enriched antigen-presenting cells ("enriched APCs"); and (b) cryopreservation. A pharmaceutical preparation comprising a storage medium and (c) a solution containing human serum albumin ("human serum albumin solution"), wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner.

2. (a) enriched antigen-presenting cells ("enriched APCs"); and (b) cryopreservation. A pharmaceutical preparation comprising: (a) a storage medium; (b) a cryopreservation medium; and (c) a solution containing human serum albumin ("human serum albumin solution"), wherein the enhanced APCs are capable of activating T cells in an HLA-independent manner.

3. 3. The method of claim 1, wherein the human serum albumin solution comprises 25% human serum albumin.

4. Approximately 5×10 6 from the enriched APC to approximately 1 × 10 9 4. The formulation of claim 1, comprising an enhanced APC of:

5. Approximately 1.05×10 8 The formulation of claim 4, comprising an enhanced APC of

6. Approximately 1×10 4 Enriched APC / mL to approximately 1 x 10 9 4. The formulation of claim 1, comprising an enhanced APC / mL.

7. Approximately 1×10 6 Enriched APC / mL to approximately 1 x 10 8 7. The formulation of claim 6, comprising an enhanced APC / mL.

8. Approximately 1.1×10 7 8. The formulation of claim 7, comprising an enhanced APC / mL.

9. 9. The formulation of any one of claims 1 to 8, wherein the viability of the enriched APCs is at least about 70%, at least about 80%, at least about 90%, or about 100%.

10. 10. The formulation of claim 1, wherein the enhanced APCs in the formulation maintain a viability of about 70% or more after storage at -140°C or lower for at least about 12 months.

11. 11. The formulation of any one of claims 1 to 10, wherein the cryopreservation medium is at a concentration of about 40% to about 95% (w / w).

12. 12. The formulation of claim 11, wherein the cryopreservation medium is at a concentration of about 50% (w / w).

13. 13. The formulation of any one of claims 2 to 12, wherein the cryopreservation medium is at a concentration of about 25% to about 35% (w / w).

14. 14. The formulation of claim 13, wherein the cryopreservation medium is at a concentration of about 30% (w / w).

15. 15. The formulation of any one of claims 1 to 14, wherein the human serum albumin solution is at a concentration of about 15% to about 25% (w / w).

16. 16. The formulation of claim 15, wherein the human serum albumin solution is at a concentration of about 20% (w / w).

17. 17. The formulation of any one of claims 1 to 16, wherein the pH of the formulation is from about 6.0 to about 8.

5.

18. 18. The formulation of claim 17, wherein the pH of the formulation is between about 7.0 and about 7.

9.

19. (a) Approximately 5 × 10 6 Approximately 1 × 10 from the reinforced APC 9 1. A pharmaceutical formulation comprising: (a) an amount of enhanced antigen-presenting cells ("enhanced APCs") in an amount of enhanced APCs; (b) a cryopreservation medium at a concentration of about 40% (w / w) to about 95% (w / w); (c) a cryopreservation medium at a concentration of about 25% (w / w) to about 35% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 6.0 to about 8.5, and the enhanced APCs are capable of activating T cells in an HLA-agnostic manner.

20. (a) Approximately 1.05 × 10 8 1. A pharmaceutical formulation comprising: (a) an amount of enhanced antigen-presenting cells ("enhanced APCs") in an amount of enhanced APCs; (b) a cryopreservation medium at a concentration of about 50% (w / w); (c) a cryopreservation medium at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and the enhanced APCs are capable of activating T cells in an HLA-agnostic manner.

21. (a) Approximately 7.6 × 10 6 1. A pharmaceutical formulation comprising: (a) an amount of enhanced antigen-presenting cells ("enhanced APCs") in an amount of enhanced APCs; (b) a cryopreservation medium at a concentration of about 50% (w / w); (c) a cryopreservation medium at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and the enhanced APCs are capable of activating T cells in an HLA-agnostic manner.

22. (a) Approximately 1 × 10 4 Enriched APC / mL to approximately 1 x 10 9 1. A pharmaceutical formulation comprising: (a) enhanced antigen-presenting cells ("enhanced APC") at a concentration of enhanced APC / mL; (b) a cryopreservation medium at a concentration of about 40% (w / w) to about 95% (w / w); (c) a cryopreservation medium at a concentration of about 25% (w / w) to about 35% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 15% (w / w) to about 25% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 6.0 to about 8.5, and wherein the enhanced APC are capable of activating T cells in an HLA-agnostic manner.

23. (a) Approximately 1.1 × 10 7 1. A pharmaceutical formulation comprising: (a) enhanced antigen-presenting cells ("enhanced APC") at a concentration of enhanced APC / mL; (b) a cryopreservation medium at a concentration of about 50% (w / w); (d) a cryopreservation medium at a concentration of about 30% (w / w); and (c) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enhanced APC are capable of activating T cells in an HLA-agnostic manner.

24. (a) Approximately 8.5 × 10 6 1. A pharmaceutical formulation comprising: (a) enhanced antigen-presenting cells ("enhanced APC") at a concentration of enhanced APC / mL; (b) a cryopreservation medium at a concentration of about 50% (w / w); (c) a cryopreservation medium at a concentration of about 30% (w / w); and (d) a solution comprising about 25% human serum albumin at a concentration of about 20% (w / w) ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enhanced APC are capable of activating T cells in an HLA-agnostic manner.

25. (a) Approximately 1.05 × 10 8 1. A pharmaceutical formulation comprising: (a) about 4.99 g of enriched APCs; (b) about 4.99 g of cryopreservation medium; and (c) about 2.00 g of a solution comprising 25% human serum albumin (the "human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enriched APCs are capable of activating T cells in an agnostic manner.

26. (a) Approximately 1.05 × 10 8 1. A pharmaceutical formulation comprising: (a) about 4.99 g of enriched APCs; (b) about 4.99 g of cryopreservation medium; (c) about 2.99 g of cryopreservation medium; and (d) about 2.00 g of a solution comprising 25% human serum albumin ("human serum albumin solution"), wherein the pH of the formulation is about 7.0 to about 7.9, and wherein the enriched APCs are capable of activating T cells in an agnostic manner.

27. 27. The formulation of any one of claims 1 to 26, wherein the cryopreservation medium is CryoStor® CS10.

28. 28. The formulation of any one of claims 2 to 24, 26, and 27, wherein the cryopreservation medium is HypoThermasol® FRS.

29. 29. The formulation of any one of claims 1 to 28, which is sterile.

30. 30. The formulation of any one of claims 1 to 29, comprising less than about 5 EU / mL endotoxin.

31. 31. The formulation of claim 30, comprising less than about 4.2 EU / mL endotoxin.

32. 32. The formulation of any one of claims 1 to 31, which is mycoplasma-free.

33. 33. The formulation of any one of claims 1 to 32, wherein the enriched APCs comprise T cells, B cells, NK cells, monocytes, or a combination thereof.

34. 34. The formulation of any one of claims 1 to 33, wherein the antigen comprises a human papillomavirus (HPV) antigen.

35. 35. The preparation of claim 34, wherein the HPV comprises HPV-16 or HPV-18.

36. 33. The formulation of claim 34, 35 or 32, wherein the antigen comprises a peptide derived from HPV E6 and / or HPV E7.

37. 37. The formulation of any one of claims 34 to 36, wherein the antigens comprise a peptide derived from HPV E6 and a peptide derived from HPV E7.

38. 38. The formulation of any one of claims 34 to 37, wherein the antigen comprises an amino acid sequence set forth in any one of SEQ ID NOs: 14 to 17.

39. 39. The formulation of claim 38, wherein the antigens comprise a first antigen comprising the amino acid sequence set forth in SEQ ID NO: 14 and a second antigen comprising the amino acid sequence set forth in SEQ ID NO:

16.

40. 38. The formulation of any one of claims 1 to 37, wherein the enhanced APCs exhibit increased expression of costimulatory molecules compared to corresponding non-enhanced APCs ("reference APCs").

41. 39. The formulation of claim 38, wherein the costimulatory molecule comprises CD86.

42. 40. The formulation of any one of claims 1 to 39, wherein the enriched APCs exhibit increased expression of cytokines compared to corresponding non-enriched APCs ("reference APCs").

43. 41. The formulation of claim 40, wherein the cytokine comprises a membrane-bound cytokine.

44. 42. The formulation of claim 40 or 41, wherein the cytokine comprises IL-2, IL-12, or both.

45. 43. The formulation of any one of claims 38 to 42, wherein the enriched APC is prepared by passing a cell suspension containing input APCs through a cell-deforming constriction, whereby the nucleic acid encoding the antigen, the nucleic acid encoding the costimulatory molecule, and / or the nucleic acid encoding the cytokine enters the APC via perturbation upon contact with the APC, thereby causing perturbation in the APC to generate the enriched APC.

46. 44. The formulation of claim 43, wherein the cell suspension comprising the input APCs is cultured in combination with the nucleic acid encoding the antigen, the nucleic acid encoding the costimulatory molecule, and / or the nucleic acid encoding the cytokine, whereby the nucleic acid encoding the antigen, the nucleic acid encoding the costimulatory molecule, and / or the nucleic acid encoding the cytokine contacts the input APCs.

47. 45. The formulation of claim 43 or 44, wherein the nucleic acid encoding the antigen, the nucleic acid encoding the costimulatory molecule, and / or the nucleic acid encoding the cytokine is mRNA.

48. 46. The formulation of any one of claims 43-45, wherein the cell-deforming constriction comprises a diameter of about 4.2 μm to about 6 μm or about 4.2 μm to about 4.8 μm.

49. 47. The formulation of any one of claims 1 to 46, wherein the enriched APCs are conditioned in a medium containing an adjuvant.

50. 48. The formulation of claim 47, wherein the enriched APCs are conditioned in a medium containing an adjuvant for about 2 hours to about 10 hours.

51. 49. The formulation of claim 47 or 48, wherein the enriched APCs are conditioned in a medium containing an adjuvant for about 3 to about 6 hours.

52. 50. The formulation of any one of claims 47 to 49, wherein the enriched APCs have been conditioned in a medium containing an adjuvant for about 4 hours.

53. 51. The formulation of any one of claims 47 to 50, wherein the enriched APCs are conditioned at about 37°C in a medium containing an adjuvant.

54. 52. The formulation of any one of claims 47 to 51, wherein the adjuvant comprises a CpG oligodeoxynucleotide (ODN), LPS, IFN-α, a STING agonist, a RIG-I agonist, poly I:C, R837, R848, a TLR3 agonist, a TLR4 agonist, or a TLR9 agonist.

55. 53. The formulation of claim 52, wherein the adjuvant is an ODN.

56. 54. A vial containing the formulation of any one of claims 1 to 53.

57. A method for producing a formulation comprising enhanced antigen-presenting cells ("enhanced APCs") capable of activating T cells in an HLA-agnostic manner, the method comprising combining the enhanced APCs with a cryopreservation medium and a human serum albumin solution.

58. 56. The method of claim 55, wherein the human serum albumin solution comprises 25% human serum albumin.

59. After said combining, said formulation has: (a) about 5 x 10 6 from the enriched APC to approximately 1 × 10 9 57. The method of claim 55 or 56, comprising: (a) enriched APCs of about 40% (w / w) to about 95% (w / w); (b) a cryopreservation medium at a concentration of about 40% (w / w) to about 95% (w / w); and (c) a human serum albumin solution at a concentration of about 15% (w / w) to about 25% (w / w), wherein the formulation has a pH of about 6.0 to about 8.

5.

60. After said combining, said formulation has: (a) about 1.1 x 10 7 58. The method of any one of claims 55 to 57, comprising: (a) enriched APC at a concentration of enriched APC / mL; (b) the cryopreservation medium at a concentration of about 50% (w / w); and (c) the human serum albumin solution at a concentration of about 20% (w / w), wherein the formulation has a pH of about 7.0 to about 7.

9.

61. After said combining, said formulation has: (a) about 1.05 x 10 8 59. The method of any one of claims 55-58, comprising: (a) about 4.99 g of the enriched APC; (b) about 4.99 g of the cryopreservation medium; and (c) about 2.00 g of the human serum albumin solution, wherein the pH of the formulation is from about 7.0 to about 7.

9.

62. A method for producing a formulation comprising enhanced antigen-presenting cells ("enhanced APCs") capable of activating T cells in an HLA-agnostic manner, the method comprising combining the enhanced APCs with a cryopreservation medium, a cryopreservation medium, and a human serum albumin solution.

63. 61. The method of claim 60, wherein the human serum albumin solution comprises 25% human serum albumin.

64. After said combining, said formulation has: (a) about 5 x 10 6 from the enriched APC to approximately 1 × 10 9 62. The method of claim 60 or 61, comprising: (a) enriched APCs of about 40% (w / w) to about 95% (w / w); (b) a cryopreservation medium at a concentration of about 40% (w / w) to about 95% (w / w); (c) a cryopreservation medium at a concentration of about 25% (w / w) to about 35% (w / w); and (d) a human serum albumin solution at a concentration of about 15% (w / w) to about 25% (w / w), wherein the pH of the formulation is about 6.0 to about 8.

5.

65. After said combining, said formulation has: (a) about 1.1 x 10 7 63. The method of any one of claims 61 to 62, comprising: (a) enriched APC / mL; (b) the cryopreservation medium at a concentration of about 50% (w / w); and (c) the human serum albumin solution at a concentration of about 20% (w / w), wherein the formulation has a pH of about 7.0 to about 7.

9.

66. After said combining, said formulation has: (a) about 1.05 x 10 8 64. The method of any one of claims 61 to 63, comprising: (a) about 4.99 g of the enriched APC; (b) about 4.99 g of the cryopreservation medium; and (c) about 2.00 g of the human serum albumin solution, wherein the pH of the formulation is from about 7.0 to about 7.

9.

67. 65. The method of any one of claims 55 to 64, wherein the cryopreservation medium comprises CryoStor® CS10.

68. 66. The method of any one of claims 60 to 65, wherein the cryopreservation medium comprises HypoThermasol® FRS.

69. 67. The method of any one of claims 55 to 66, comprising passing a cell suspension containing input APCs through a cell-deforming constriction, whereby nucleic acids encoding antigens, nucleic acids encoding costimulatory molecules, and / or nucleic acids encoding cytokines enter the APCs via perturbation upon contact with the APCs, thereby causing perturbation in the APCs to generate the enhanced APCs.

70. 68. The method of claim 67, comprising culturing the cell suspension with the nucleic acid encoding an antigen, the nucleic acid encoding a costimulatory molecule, and / or the nucleic acid encoding a cytokine, whereby the nucleic acid encoding an antigen, the nucleic acid encoding a costimulatory molecule, and / or the nucleic acid encoding a cytokine contacts the input APCs.

71. 69. The method of claim 67 or 68, wherein the nucleic acid encoding an antigen, the nucleic acid encoding a costimulatory molecule, and / or the nucleic acid encoding a cytokine is mRNA.

72. 70. The method of any one of claims 67 to 69, wherein the antigen is a human papillomavirus (HPV) antigen.

73. 71. The method of claim 70, wherein the HPV comprises HPV-16 or HPV-18.

74. 72. The method of claim 70 or 71, wherein the antigen comprises a peptide derived from HPV E6 and / or HPV E7.

75. 73. The method of claim 72, wherein the antigens comprise a peptide derived from HPV E6 and a peptide derived from HPV E7.

76. 74. The method of any one of claims 67 to 73, wherein the antigen comprises an amino acid sequence set forth in any one of SEQ ID NOs: 14 to 17.

77. 76. The method of any one of claims 67 to 75, wherein the antigens comprise a first antigen comprising the amino acid sequence set forth in SEQ ID NO: 14 and a second antigen comprising the amino acid sequence set forth in SEQ ID NO:

16.

78. 77. The method of any one of claims 67 to 76, wherein the costimulatory molecule comprises CD86.

79. 78. The method of any one of claims 67 to 77, wherein the cytokine comprises a membrane-bound cytokine.

80. 79. The method of any one of claims 67 to 78, wherein the cytokine comprises IL-2, IL-12, or both.