Therapeutic use of miR155 SNP rs377265631
By employing a recombinant nucleic acid encoding SNP4 in CD8-positive T cells, the anti-tumor activity of CAR-T cells is enhanced, providing superior therapeutic outcomes for cancers like melanoma, NSCLC, and HPV-associated cancers.
Patent Information
- Application Number
- JP2025512853
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-09-02
- Filing Date
- 2023-08-30
- Publication Date
- 2025-08-22
AI Technical Summary
Existing treatments for diseases such as cancer using miR155 do not fully leverage the therapeutic potential of specific SNPs, particularly SNP4, which has been shown to have superior anti-tumor effects.
Utilizing a recombinant nucleic acid encoding the SNP4 sequence (rs377265631) to enhance the anti-tumor activity of immune cells, such as CAR-T cells, by overexpressing SNP4 in CD8-positive T cells.
The overexpression of SNP4 in CD8-positive T cells significantly enhances anti-tumor immunity and therapeutic efficacy, surpassing the effects of wild-type miR155 in treating cancers like melanoma, NSCLC, and HPV-associated cancers.
Smart Images

Figure 2025527838000001_ABST
Abstract
Description
[Technical Field]
[0001] Funding Statement This invention was made in part with government support provided by the National Institutes of Health. The government has certain rights in the invention. [Background technology]
[0002] MicroRNAs (miRNAs; miRs) are small non-coding RNAs that control gene expression of a wide range of target genes based on sequence complementarity. By binding to the 3' untranslated region (3'UTR) of target mRNAs, miRNAs regulate gene expression, potentially enabling the control of multiple gene targets within the same or different signaling pathways (Nat Rev Immunol. 2016;16(5):279-294; Nat Rev Drug Discov. 2010;9(10):775-789). Dysregulation of many miRNAs occurs in cancer, cardiovascular disease, and autoimmune diseases (FEBS J. 2018;285(20):3695-3716). Genomic mutations, deletions, or alterations in key enzymes involved in miRNA biogenesis can all lead to altered miRNA levels. (Nat Rev Cancer.2011;11(12):849-864;Nat Rev Cancer.2009;9(4):293-302).
[0003] MicroRNAs are involved in the normal function of eukaryotic cells. Dysregulation of microRNAs can lead to disease, and the pathogenesis and role of many microRNAs in disease has been reported (FEBS J.2018;285(20):3695-3716). Diseases associated with miRNA dysregulation include cancer (Nature.2012;482(7385):347-355), heart disease (Heart.2015;101:921-928), kidney disease (Nature Reviews Nephrology 2015;11:23-33), nervous system disorders (Brain.2011;134(Pt12):3578-3589), obesity (Cells.2019;8(8):859), and hemostatic disorders (JTH.2015;13(2):170-81). Depending on the type of dysregulation, various therapeutic approaches are available. In certain diseases, particularly those caused by or associated with upregulation of microRNAs, it may be beneficial to inhibit the function or expression of microRNAs (Blood. 2018; 132 (Supplement 1): 2903). For other diseases, particularly those caused by or associated with downregulation of microRNAs, it may be beneficial to recombinantly express microRNAs or to administer therapeutic agents that increase microRNA expression (Proc Natl Acad Sci USA. 2015; 112 (2): 476-81, Blood. 2015; 125 (22): 3377-3387).
[0004] One particular microRNA is miR155. miR155 has been used in numerous approaches, including as a diagnostic or prognostic marker, therapeutic use by inhibiting or blocking miR155 activity, and therapeutic use by expressing miR155 in tissues and cells (Carcinogenesis. 2020;41(1):2-7, Blood. 2018;132(Supplement 1):2903, Blood. 2011;118(21):2728, Int J Mol Sci. 2020;21(16):5834). The biological properties of miR155 are multifaceted. miR155 is a key regulator of Treg homeostasis (Immunity. 2009;30(1):80-91). miR155 also inhibits anti-inflammatory macrophage polarization while promoting pro-inflammatory macrophages (Cell Mol Immunol. 2009;6(5):343-352). miR155 also enhances cytokine production and costimulatory function of DCs (Science. 2007;316(5824):608-611). miR155 also promotes B cell proliferation, survival, germinal center formation, plasma cell differentiation, and antibody production (Immunity. 2007;27(6):847-859). miR155 also promotes Th1, Th17, and Tfh differentiation while suppressing type 2 polarization (Immunity. 2010;33(4):607-619). miR155 also enhances NK cell proliferation, chemotaxis, and effector function (Blood 2013;121(16):3126-3134; Plos One 2020;15(2):e0225820). Finally, miR-155 promotes CD8+ T cell effector responses against viruses and tumors (2013 Apr 18;38(4):742-53; Nat Immunol. 2013 Jun;14(6):593-602).
[0005] WO 2007 / 127190 describes the development of a transgenic mouse model expressing miR155. However, WO 2007 / 127190 does not contemplate the therapeutic use of miR155. WO 2009 / 026576 discloses nucleic acids called external guide sequences (EGS), which can be used to control the activity of miR-155. WO 2010 / 135714 relates to the regulation of genes involved in adipocyte development via compositions containing miR155. WO 2011 / 029903 relates to the therapeutic use of miRs by enriching microRNAs in patient blood products. One miR is miR155. WO 2014 / 059248 relates to the enhancement of anti-cancer immunity through the expression of miR155 in specific T cells. A similar concept is disclosed in WO 2014 / 066137. WO 2016 / 077574 discloses inhibitors of miR-155 that increase atrial natriuretic peptide (ANP) levels for the treatment of cardiovascular disease. WO 2017 / 182580 relates to the treatment of production-related disorders, particularly with miR155. WO 2018 / 177746 relates to the treatment of polycystic ovary syndrome, particularly with miR155. WO 2019 / 227260 relates to mammalian virus-mediated miR expression, including miR155. WO 2020 / 002430 relates to the stimulation of mesenchymal stem cells with miRs, such as miR155. WO 2020 / 221821 relates to the treatment of cognitive disorders, particularly with miR155. Chinese Patent No. 112481218 describes a porcine mIR-155 vector system. Chinese Patent No. 113337544 relates to a retroviral vector expressing a CAR and a microRNA, the microRNA being, inter alia, miR155. However, none of the above documents mentions, anticipates, or suggests SNP4.
[0006] Single nucleotide polymorphisms (SNPs) have been described for many genes. SNPs refer to genetic mutations resulting in the substitution of a single base in the genome. SNPs have also been reported for microRNAs. SNP rs377265631 (SNP4) is one of many SNPs described for miR155. SNP4 has an A to G mutation compared to wild-type miR155: Wild type miR155 ACTCCTACAT A TTAGCATTAA (SEQ ID NO: 1) rs377265631(SNP4)ACTCCTACAT G TTAGCATTAA (SEQ ID NO: 2)
[0007] The function or role of rs377265631 was unknown prior to the present invention. Herein, it is shown for the first time that overexpression of rs377265631 has beneficial effects in the treatment of diseases such as cancer, which are surprisingly superior to those obtained with the corresponding form of microRNA. [Prior art documents] [Patent documents]
[0008] [Patent Document 1] International Publication No. 2007 / 127190 [Patent Document 2] International Publication No. 2009 / 026576 [Patent Document 3] International Publication No. 2010 / 135714 [Patent Document 4] International Publication No. 2011 / 029903 [Patent Document 5] International Publication No. 2014 / 059248 [Patent Document 6] International Publication No. 2014 / 066137 [Patent Document 7] International Publication No. 2016 / 077574 [Patent Document 8] International Publication No. 2017 / 182580 [Patent Document 9] International Publication No. 2018 / 177746 [Patent Document 10] International Publication No. 2019 / 227260 [Patent Document 11] International Publication No. 2020 / 002430 [Patent Document 12] International Publication No. 2020 / 221821 [Patent Document 13] China Patent No. 112481218 Detailed Information [Patent Document 14] China Patent No. 113337544 Detailed Information
Non-licensed literature
[0009] (Non-patented document 1) Nat Rev Immunol. 2016;16(5):279-294 (Non-patent document 2) Nat Rev Drug Discov. 2010;9(10):775-789 (Non-patented document 3) FEBS J. 2018; 285(20): 3695-3716 (Non-patented document 4) Nat Rev Cancer. 2011;11(12):849-864 (Non-patented document 5) Nat Rev Cancer. 2009;9(4):293-302 (Non-patented document 6) Nature. 2012; 482(7385): 347-355 (Non-patented document 7) Heart. 2015;101:921-928 (Non-patented document 8) Nature Reviews Nephrology 2015;11:23-33 (Non-patented document 9) Brain. 2011;134(Pt12):3578-3589 (Non-patented document 10) Cells. 2019;8(8):859 (Non-patented document 11) JTH.2015;13(2):170-81 (Non-patented document 12) Blood. 2018;132(Supplement 1):2903 (Non-Patent Document 13) Proc Natl Acad Sci USA. 2015; 112(2): 476 - 81 (Non-Patent Document 14) Blood. 2015; 125(22): 3377 - 3387 (Non-Patent Document 15) Carcinogenesis. 2020; 41(1): 2 - 7, (Non-Patent Document 16) Blood. 2011; 118(21): 2728 (Non-Patent Document 17) Int J Mol Sci. 2020; 21(16): 5834 (Non-Patent Document 18) Immunity. 2009; 30(1): 80 - 91 (Non-Patent Document 19) Cell Mol Immunol. 2009; 6(5): 343 - 352 (Non-Patent Document 20) Science. 2007; 316(5824): 608 - 611 (Non-Patent Document 21) Immunity. 2007; 27(6): 847 - 859 (Non-Patent Document 22) Immunity. 2010; 33(4): 607 - 619 (Non-Patent Document 23) Blood 2013; 121(16): 3126 - 3134 (Non-Patent Document 24) Plos One 2020; 15(2): e0225820 (Non-Patent Document 25) 2013 Apr 18; 38(4): 742 - 53 (Non-Patent Document 26) Nat Immunol. 2013 Jun; 14(6): 593 - 602
Summary of the Invention
Problems to be Solved by the Invention
[0010] The present disclosure relates to particular SNPs of miR155 that have surprisingly been found to be useful in the treatment of various diseases, such as cancer. In certain embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 for use in medicine. In certain embodiments, the use in medicine is in the treatment of cancer. In certain embodiments, the use in the treatment of cancer is the treatment of melanoma, NSCLC, sarcoma, or HPV-associated cancer. In certain embodiments, the nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is operably linked to a promoter. In certain embodiments, the recombinant nucleic acid is encoded by an expression vector. In certain embodiments, the expression vector is a viral vector or a plasmid. In certain embodiments, the recombinant nucleic acid is an isolated nucleic acid or a purified nucleic acid.
[0011] In certain embodiments, the present disclosure relates to a recombinant immune cell comprising the nucleic acid of SEQ ID NO: 2 or SEQ ID NO: 5. In certain embodiments, the recombinant immune cell is a T cell. In certain embodiments, the T cell is a CD8-positive T cell. In certain embodiments, the CD8-positive T cell is a tumor-infiltrating lymphocyte (TIL) or a peripheral blood lymphocyte (PBL) isolated from a patient suffering from cancer. In certain embodiments, the immune cell further comprises a nucleic acid encoding a chimeric antigen receptor or a T cell receptor.
[0012] In certain embodiments, the nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is located within a coding region of a chimeric antigen receptor or a T cell receptor, such as the intracellular portion of the chimeric antigen receptor or the T cell receptor. In certain embodiments, the chimeric antigen receptor or the T cell receptor is specific for a cancer antigen. In certain embodiments, the immune cell is an isolated or purified immune cell. In certain embodiments, the immune cell is a human immune cell.
[0013] In certain embodiments, the present disclosure relates to a cell population comprising at least one of the aforementioned immune cells. In certain embodiments, the present disclosure relates to a composition comprising at least one of the aforementioned immune cells and a carrier therefor, preferably a pharmaceutically acceptable carrier.
[0014] In certain embodiments, the present disclosure relates to a recombinant immune cell, cell population, or composition described herein for use in medicine. In certain embodiments, the use in medicine is for use in the treatment of cancer. In certain embodiments, the cancer is melanoma, NSCLC, sarcoma, or HPV-associated cancer.
[0015] definition As used herein, the terms "miR," "miRNA," and "microRNA" refer to unprocessed or processed RNA transcripts from miR genes. miRs can regulate gene expression by interacting with messenger RNA molecules (mRNA), DNA, or proteins. Typically, microRNAs consist of nucleic acid sequences of approximately 19-25 nucleotides (bases) and are present in mammalian cells. Mature microRNA molecules are single-stranded RNA molecules processed from double-stranded precursor transcripts that form local hairpin structures. The hairpin structures are typically cleaved by RNAses such as Dicer, Argonaute, and RNAse 111 to produce active 19-25 nucleotide RNA molecules. Unprocessed miR gene transcripts are also called "miR precursors" and typically contain RNA transcripts approximately 70-100 nucleotides in length. These active 19-25 nucleotide RNA molecules are also called "processed" miR gene transcripts or "mature" miRNAs. It should be understood that the term "miR" as used herein can include one or more of a mature miR, a pre-miR, a pri-miR, or a miR-oligonucleotide containing a miR seed sequence. In certain embodiments, the miR may be modified to facilitate delivery. There are various sources of miRNA (miR) information (e.g., Sanger Institute, miRbase, TargetSCAN, miRDB). The term microRNA as used herein includes both double-stranded miRs in the 5' to 3' direction (i.e., double-stranded miRs) and single-stranded miRs with a complementary 3' to 5' direction (i.e., mature miRs).
[0016] As used herein, the terms "miR155," "miRNA155," and "microRNA155" refer to a specific microRNA with GeneID 406947. The sequence of the unprocessed precursor, pre-miR155, is as follows: CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACATATTAGCATTAACAG (SEQ ID NO: 3)
[0017] The sequence of the processed mature miR155 is as follows: ACTCCTACATATTAGCATTAA (SEQ ID NO: 1)
[0018] Orthologues of miR155 exist in many other species: [Table 1]
[0019] As used herein, the terms "rs377265631" and "SNP4" refer to a specific SNP of miR155. The sequence of the unprocessed precursor of SNP4 is as follows: CTGTTAATGCTAATCGTGATAGGGGTTTTTGCCTCCAACTGACTCCTACAT G TTAGCATTAACAG (SEQ ID NO: 5)
[0020] The sequence of the processed SNP4 is as follows: ACTCCTACAT G TTAGCATTAA (SEQ ID NO: 2)
[0021] Notably, the nucleotide sequence of SNP4 is identical to miR155 orthologues in orangutans, gibbons, and several other species (see Table 1).
[0022] The terms "SNP" and "single nucleotide polymorphism" refer to a polymorphism at a particular location in the genome of a species that differs between populations of individuals, i.e., a polymorphism for which more than one allele exists in a population.
[0023] As used herein, the term "cell" refers to a single cell or multiple cells.
[0024] As used herein, the term "host cell" refers to a cell containing a nucleic acid and / or a vector. In the context of the present disclosure, the term host cell refers to a cell containing a nucleic acid and / or a vector encoding a miR, preferably SNP4. Such host cells express miRs and are suitable for medical use. Preferred host cells of the present invention are eukaryotic host cells, such as immune cells. Particularly preferred host cells are T cells, e.g., CD8-positive T cells.
[0025] As used herein, the term "T cell" refers to a type of lymphocyte that plays a central role in cell-mediated immunity. T cells, also known as T lymphocytes, can be distinguished from other lymphocytes, such as B cells and natural killer cells, by the presence of a T cell receptor (TCR) on the cell surface. There are several subsets of T cells with different functions, such as T helper cells, cytotoxic T cells, memory T cells, regulatory T cells, and natural killer T cells. In certain embodiments, the T cells are artificial T cells. In other embodiments, the T cells are CD8-positive T cells. In yet other embodiments, the T cells are CAR-T cells.
[0026] As used herein, the term "CD8" or "cluster of differentiation 8" refers to a transmembrane glycoprotein (UniProt: P01732) present on certain T cells that functions as a co-receptor for the T-cell receptor (TCR). The CD8 co-receptor, together with the TCR, plays a role in T cell signaling and in facilitating the interaction of cytotoxic T cells with antigens. T cells that express CD8 are called "CD8-positive T cells."
[0027] As used herein, the term "CAR" or "chimeric antigen receptor" refers to an artificial cell surface receptor designed to bind to a specific protein on a cell, e.g., a cancer cell. When certain CARs are expressed in T cells, the extracellular binding site of the CAR can bind to a target antigen, activating the T cell. CARs are also known as chimeric T cell receptors or chimeric immune receptors. A typical CAR contains (i) an extracellular domain containing a moiety that binds to the target antigen, (ii) a transmembrane domain, and (iii) an intracellular signaling domain that sends an activation signal when the CAR is stimulated by binding of the extracellular binding site to the target antigen.
[0028] As used herein, the term "CAR-T cells" refers to T cells that have been engineered to express a chimeric antigen receptor.
[0029] As used herein, the term "T cell receptor" or "TCR" refers to a complex of integral membrane proteins that is involved in the activation of T cells in response to antigen binding. TCRs are disulfide-linked, membrane-anchored heterodimers that typically consist of highly variable α and β chains and are expressed as part of a complex with an invariant CD3 (cluster of differentiation 3) chain molecule.
[0030] As used herein, the terms "polynucleotide" and / or "nucleic acid sequence" and / or "nucleic acid" refer to a sequence of nucleoside or nucleotide monomers consisting of bases, sugars, and intersugar (backbone) linkages. The term includes DNA and RNA, can be either double-stranded or single-stranded, and represents either the sense or antisense strand. The term also includes modified or substituted sequences containing non-naturally occurring monomers or portions thereof. The nucleic acid sequences of the present application may be deoxyribonucleic acid sequences (DNA) or ribonucleic acid sequences (RNA) and may contain naturally occurring bases, including adenine, guanine, cytosine, thymidine, and uracil. The sequences may also contain modified bases. Examples of such modified bases include aza- and deaza-adenine, guanine, cytosine, thymidine, and uracil, as well as xanthine and hypoxanthine. Nucleic acids of the present disclosure can be isolated from organisms, produced by recombinant methods in the laboratory, or obtained by chemical synthesis or other known protocols for producing nucleic acids.
[0031] As used herein, the term "modified RNA" or "modified DNA" refers to a nucleic acid molecule in which one or more of the nucleic acid components, i.e., sugar, base, or phosphate moieties, differ from those found in nature. Such molecules have at least one modified internucleoside linkage and / or at least one sugar modification and / or at least one base modification compared to naturally occurring ribonucleotide- or deoxyribonucleotide-based oligonucleotides. Modified internucleoside linkages refer to the presence of modified versions of phosphodiesters that do not naturally occur in RNA or DNA. Examples of internucleoside linkage modifications include, among others, phosphoramidates, phosphorodiamidates, phosphorothioates, phosphorodithioates, H-phosphonates, methylphosphonates, and methylphosphonothioates. Sugar modifications refer to the presence of modified forms of the ribosyl moiety (i.e., furanosyl moiety) naturally occurring in RNA and DNA, such as bicyclic sugars, tetrahydropyrans, morpholinos, 2'-modified sugars, 3'-modified sugars, 4'-modified sugars, 5'-modified sugars, and 4'-substituted sugars.Examples of suitable sugar modifications are known to those skilled in the art and include 2'-O-modified RNA nucleotide residues, such as 2'-O-alkyl or 2'-O-(substituted) alkyl, such as 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl; 2'-O-(haloalkoxy)methyl, such as 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (D), and the like. CEM; 2'-O-alkoxycarbonyl, such as 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DMCE), especially the 2'-O-methyl variant or 2'-O-(2-methoxy)ethyl (2'-MOE).Other important modifications include locked nucleic acid (LNA), xyloLNA, α-L-LNA, β-D-LNA, cEt (2'-0,4'-C constrained ethyl) LNA, cMOEt (2'-0,4'-C constrained methoxyethyl) LNA, ethylene-bridged nucleic acid (ENA), hexitol nucleic acid (ETNA), fluorinated HNA (F-HNA), pyranosyl-RNA (p-RNA), 3'-deoxypyranosyl-DNA (p-DNA); or bridged or bicylic nucleic acid (BNA) modified sugar moieties, including other modified sugar moieties such as morpholino (PMO), cationic morpholino (PMOPlus), or PMO-X. As used herein, the term "base modification" refers to a modification of a naturally occurring base (i.e., a pyrimidine or purine base) in RNA and / or DNA. Base modifications include, but are not limited to, modified versions of natural purine and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine, pseudouracil, pseudothymine, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), 2-6-diaminopurine, 5-substituted pyrimidines (e.g., 5-halouracil, 5-methyluracil), and the like. 2-thiouracil, 2-thiothymine), 2,6-diaminopurine, 5-substituted pyrimidines (e.g., 5-halouracil, 5-methyluracil, 5-methylcytosine), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, etc. It is also encompassed that the oligonucleotide contains one or more, the same or different, internucleoside linkage modifications, sugar modifications, and / or base modifications.
[0032] The term "adenine base editor" or "ABE" refers to a base editor that mediates the conversion of adenosine to guanosine (i.e., AT to GC) via an inosine intermediate. Numerous ABEs are known in the art, including, but not limited to, ABE7.10, ABE6.3, ABE7.8, and ABE7.9.
[0033] As used herein, the term "isolated polynucleotide" or "isolated nucleic acid sequence" refers to a nucleic acid that is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
[0034] As used herein, the term "recombinant nucleic acid" or "artificial nucleic acid" refers to a nucleic acid or polynucleotide that does not exist in an organism. For example, a recombinant nucleic acid may be created in a laboratory by genetic engineering methods (such as molecular cloning) to create a sequence that does not exist in nature. A recombinant nucleic acid may also be created by chemical synthesis or other known protocols for making nucleic acids. Unless otherwise stated, the definitions and embodiments described in this section and other sections are intended to apply to all embodiments and aspects of the application described herein, as would be understood by one of skill in the art.
[0035] As used herein, the term "polypeptide" or "protein" refers to a chain of amino acids. A polypeptide or protein of the present disclosure can be a peptide, which typically refers to a chain of 2 to about 30 amino acids. As used herein, the term protein also refers to a chain of amino acids having 30 or more amino acids, and may be a protein fragment or domain, or a full-length protein. Furthermore, as used herein, the term protein can refer to a linear chain of amino acids or to an amino acid chain that has been processed and folded into a functional protein. However, it should be understood that the number 30 is an arbitrary number used to distinguish between peptides and proteins, and the terms can be used interchangeably with respect to amino acid chains. Proteins of the present disclosure can be obtained by isolation and purification of proteins from cells in which they are naturally produced, by enzymatic (e.g., proteolytic) cleavage, and / or recombinantly by expression of nucleic acids encoding proteins or fragments of the present disclosure. Proteins and / or fragments of the present disclosure can also be obtained by chemical synthesis or other known protocols for producing proteins and fragments.
[0036] The term "isolated polypeptide" refers to a polypeptide that is substantially free of cellular material and culture medium when produced by recombinant DNA techniques, or chemical precursors and other chemicals when chemically synthesized.
[0037] As used herein, the term "vector" refers to a polynucleotide that can be used to deliver a nucleic acid into a cell. In one embodiment, the vector is an expression vector that contains an expression control sequence (e.g., a promoter) operably linked to the nucleic acid to be expressed in the cell. Vectors known in the art include, but are not limited to, plasmids, phages, cosmids, viruses, etc.
[0038] The terms "recipient," "individual," "subject," "host," and "patient" are used interchangeably herein and refer to any mammalian subject, particularly humans, for whom diagnosis, treatment, or therapy is desired.
[0039] As used herein, the terms "treatment," "treating," and the like, in some embodiments, refer to administering an agent or performing a procedure for the purpose of achieving an effect. The effect can be prophylactic, in that it completely or partially prevents a disease or its symptoms, and / or therapeutic, in that it affects a partial or complete cure of the disease and / or its symptoms. The term includes the treatment of diseases or disorders (e.g., inflammation) in mammals, particularly humans, and includes (a) preventing the development of a disease or disease symptoms (e.g., diseases that may be associated with or caused by a primary disease) in a subject who may be predisposed to the disease but has not yet been diagnosed with the disease; (b) inhibiting the disease, i.e., preventing its development; and (c) palliating the disease, i.e., causing regression of the disease. The treatment or alleviation of symptoms is based on one or more objective or subjective parameters (including the results of a physician's examination). Thus, the term "treating" includes administering a compound or agent of the present invention to prevent, delay, reduce, arrest, or inhibit the onset of symptoms or conditions associated with a disease (e.g., inflammation).
[0040] The term "therapeutic effect" refers to the reduction, elimination, or prevention of a disease, a symptom of a disease, or a side effect of a disease in a subject.
[0041] The term "signaling domain" or "intracellular signaling domain" in the context of CAR-T cells refers to the intracellular domain of a CAR that transmits an activation signal. The signaling domain can be an effector domain that can directly or indirectly promote a biological or physiological response in a cell upon receiving an appropriate signal. The effector domain can directly promote a cellular response. The effector domain can also indirectly promote a cellular response by associating with one or more other proteins that promote the cellular response, such as a costimulatory domain. The effector domain can activate at least one function of the modified cell by binding to a cell marker expressed by a cancer cell. Activation of the modified cell can include one or more of differentiation, proliferation, activation, and other effector functions. In certain embodiments, the effector domain can comprise an intracellular signaling component comprising a T cell receptor and a costimulatory domain comprising a cytoplasmic sequence of a co-receptor or costimulatory molecule. The effector domain can comprise a receptor signaling domain, an intracellular signaling component (e.g., a cytoplasmic signaling sequence), a costimulatory domain, or a combination thereof. Exemplary effector domains include signaling and stimulatory domains selected from 4-1BB (CD137), CARD11, CD3γ, CD3δ, CD3ε, CD3ζ, CD27, CD28, CD79A, CD79B, DAP10, FcRa, FcRp (FcsRIb), FcRy, Fyn, HVEM (LIGHTR), ICOS, LAG3, LAT, Lck, LRP, NKG2D, NOTCH1, pTα, PTCH2, 0X40, ROR2, Ryk, SLAMF1, Slp76, TCRα, TCRβ, TRIM, Wnt, Zap70, or combinations thereof.Exemplary effector domains include CD86, FcγRIa, DAP12, CD30, CD40, PD-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, CDS, ICAM-1, GITR, BAFFR, SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, a ligand that specifically binds to CD11d, ITGAE, CD103, ITGAL, CD11a, Signaling and costimulatory domains selected from ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, ITGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, GADS, PAG / Cbp, NKp44, NKp30, or NKp46.
[0042] The terms "is", "are", "is derived from", and "are derived from" in the context of a polypeptide or polypeptide domain refer to the amino acid sequence of said polypeptide or polypeptide domain and indicate that the amino acid sequence is identical to a native version of said polypeptide or polypeptide domain, or is a variant of said polypeptide or polypeptide domain that is in a form that is functionally indistinguishable from the native version of said polypeptide or polypeptide domain.
[0043] As used herein, "immune cells" refer to hematopoietic cells involved in regulating immune responses to antigens (e.g., self-antigens). In various embodiments, the immune cells are, for example, T cells, B cells, dendritic cells, monocytes, natural killer cells, macrophages, Langerhan cells, or Kupffer cells. Preferred immune cells are T cells, for example, CD8-positive T cells.
[0044] As used herein, the term "recombinant" refers to a molecule or cell prepared, produced, or created by recombinant means, such as genetic engineering or molecular biology techniques. Recombinant molecules do not occur in nature. For example, a recombinant polypeptide or recombinant nucleic acid refers to a polypeptide (or nucleic acid) that has been modified or placed in a different context (e.g., cloned behind particular regulatory elements, such as a promoter) compared to the wild-type molecule. Recombinant immune cells, such as recombinant T cells, contain a recombinant polypeptide and / or recombinant nucleic acid.
[0045] As used herein, the term "cancer" refers in its broadest sense to diseases in which abnormal cells divide uncontrollably.
[0046] As used herein, the term "hematological cancer" refers to cancer of the blood, specifically including leukemia, lymphoma, and myeloma. "Leukemia" refers to cancer of the blood in which too many white blood cells, which are ineffective in fighting infection, overwhelm other parts of the blood, such as platelets and red blood cells. It is understood that leukemia can be classified as acute or chronic. Specific forms of leukemia include, by way of non-limiting example, acute lymphocytic leukemia (ALL); acute myeloid leukemia (AML); chronic lymphocytic leukemia (CLL); chronic myelogenous leukemia (CML); myeloproliferative disorder / neoplasm (MPDS); and myelodysplastic syndromes. "Lymphoma" refers to Hodgkin's lymphoma, low-grade non-Hodgkin's lymphoma and high-grade non-Hodgkin's lymphoma, Burkitt's lymphoma, follicular lymphoma (small cell lymphoma and large cell lymphoma), and the like. Myeloma can also refer to multiple myeloma (MM), giant cell myeloma, heavy chain myeloma, light chain myeloma, or Bence Jones myeloma.
[0047] As used herein, the term "solid tumor" or "solid cancer" refers to a tumor that does not usually contain cysts or fluid. Solid tumors, as used herein, include sarcomas and carcinomas, such as breast tumors, ovarian tumors, gastric tumors, lung tumors, pancreatic tumors, prostate tumors, melanoma tumors, colorectal tumors, lung tumors, head and neck tumors, bladder tumors, esophageal tumors, liver tumors, thyroid tumors, non-small-cell lung cancer (NSCLC), and kidney tumors. [Brief explanation of the drawings]
[0048] [Figure 1] The expression levels of miR155 and seven SNPs of miR155 are compared with the housekeeping gene U6. [Figure 2]This shows that SNP4 induces significantly stronger STAT5 signaling compared with wild-type miR155 and control miR. [Figure 3] This figure visualizes the downregulation (Panel A) and upregulation (Panel B) of the most downregulated genes when miR155 or SNP4 is expressed in CD8+ T cells compared to control miR. [Figure 4] The effect of various miR expression on the metabolic capacity of T cells was measured by measuring the extracellular acidification rate (ECAR; left) and oxygen consumption rate (OCR; right). Arrows indicate the timing of compound addition. [Figure 5] Figure 1 shows the cytotoxicity of CAR T cells depending on the expression of various miRs. [Figure 6] The functions induced by various miRs in T cells were summarized. A multifunctional intensity index was calculated. [Figure 7] A more detailed view of which cytokine combinations are simultaneously produced by subpopulations of cells in control miR-, miR-155-, and SNP4-overexpressing CD19-specific CAR T cells. Color intensity indicates the proportion of the subpopulation in each sample. [Figure 8] We demonstrate that CAR T cell-mediated antitumor immunity in mice is dependent on the expression of various miRs. DETAILED DESCRIPTION OF THE INVENTION
[0049] Nucleic acid encoding SNP4 (rs377265631) The present invention is based on the surprising discovery that a specific SNP in miR155 (referred to herein as SNP4) is beneficial for anti-cancer therapy. SNP4 can enhance the anti-tumor activity of other components, such as CAR-T cells. Expression of SNP4 in such cells enhances anti-tumor immunity.
[0050] In certain embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 for use in medicine. The recombinant nucleic acid may be a precursor of the mature miR SNP4, i.e., a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:5. The precursor miR is processed intracellularly to become the mature miR. Thus, in certain embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:5 for use in medicine. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:5 for use in medicine. Alternatively, the recombinant nucleic acid may be the mature miR SNP4, i.e., a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2. Thus, in certain embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 for use in medicine. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 for use in medicine.
[0051] In certain embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is DNA. In other embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is RNA. In preferred embodiments, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is DNA. In certain embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is modified DNA. In certain embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is modified RNA.
[0052] In yet another embodiment of the present disclosure, the nucleic acid molecule comprises or consists of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5, preferably further comprising a regulatory sequence 5' to the nucleic acid sequence encoding SNP4.
[0053] In certain embodiments of the present disclosure, a nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is integrated into the genome of a host cell. Various techniques known to those skilled in the art can be used to integrate nucleic acids into the genome. Such techniques include Crispr-Cas9 gene editing, base editing, prime editing, etc. For example, because SNP4 differs from miR155 by a single base exchange from A to G, a wild-type miR155 sequence can be directly converted to SNP4 by an adenine base editor.
[0054] In other embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is incorporated into an extrachromosomal vehicle or vector, such as a plasmid. In yet other embodiments of the present disclosure, the nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is administered to a cell as a free nucleic acid molecule. In such cases, the nucleic acid molecule may be administered with additional components that serve to enhance uptake and / or stability of the nucleic acid.
[0055] In certain embodiments of the present disclosure, a nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is operably linked to a promoter.
[0056] In certain embodiments of the present disclosure, a nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is encoded by an expression vector. In certain embodiments, the expression vector is a viral vector or a plasmid. In certain embodiments, the expression vector is a viral vector. In certain embodiments, the expression vector is a plasmid.
[0057] In certain embodiments of the disclosure, a nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is an isolated nucleic acid or a purified nucleic acid. In certain embodiments of the disclosure, a nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is an isolated nucleic acid. In certain embodiments of the disclosure, a nucleic acid molecule comprising or consisting of the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 is a purified nucleic acid.
[0058] Immune cells expressing SNP4 In certain embodiments, the present disclosure relates to recombinant immune cells expressing SNP4. The multifunctionality of SNP4 acts directly on immune cells involved in fighting cancerous tissues. Thus, in certain embodiments, the present disclosure relates to recombinant immune cells expressing a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5. In certain embodiments, the present disclosure relates to recombinant immune cells expressing a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2. In other embodiments, the present disclosure relates to recombinant immune cells expressing a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:5. In yet other embodiments, the present disclosure relates to recombinant immune cells expressing a nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:2. In yet other embodiments, the present disclosure relates to recombinant immune cells expressing a nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:5.
[0059] Immune cells can be any cell of the hematopoietic lineage involved in regulating immune responses to antigens. Certain preferred immune cells are T cells. Thus, in certain embodiments, the present disclosure relates to recombinant T cells expressing a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5. In certain embodiments, the present disclosure relates to recombinant T cells expressing a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2. In other embodiments, the present disclosure relates to recombinant T cells expressing a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:5. In yet other embodiments, the present disclosure relates to recombinant T cells expressing a nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:2. In yet other embodiments, the present disclosure relates to recombinant T cells expressing a nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:5.
[0060] In certain preferred embodiments, the T cells are T cells that are positive for the T cell marker CD8. Accordingly, in certain embodiments, the present disclosure relates to CD8-positive recombinant T cells that express a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5. In certain embodiments, the present disclosure relates to CD8-positive recombinant T cells that express a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2. In other embodiments, the present disclosure relates to CD8-positive recombinant T cells that express a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:5. In yet other embodiments, the present disclosure relates to CD8-positive recombinant T cells that express a nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:2. In yet other embodiments, the present disclosure relates to CD8-positive recombinant T cells that express a nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:5. In certain embodiments, the CD8-positive T cells are tumor-infiltrating lymphocytes (TILs) or peripheral blood lymphocytes (PBLs) isolated from a patient suffering from cancer.
[0061] Immune cells expressing SNP4 may also express a recombinant protein or polypeptide. For example, immune cells expressing SNP4 may also express a CAR. Thus, in certain preferred embodiments, the present disclosure relates to recombinant CAR-T cells expressing a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5. In certain embodiments, the present disclosure relates to recombinant CAR-T cells expressing a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2. In other embodiments, the present disclosure relates to recombinant CAR-T cells expressing a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:5. In yet other embodiments, the present disclosure relates to recombinant CAR-T cells expressing a nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:2. In yet other embodiments, the present disclosure relates to recombinant CAR-T cells expressing a nucleic acid consisting of the nucleic acid sequence of SEQ ID NO:5.
[0062] In other embodiments, immune cells expressing SNP4 may also express a T cell receptor. Accordingly, in certain preferred embodiments, the present disclosure relates to recombinant T cells expressing a T cell receptor and a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5. In certain embodiments, the present disclosure relates to recombinant T cells expressing a T cell receptor and the nucleic acid sequence of SEQ ID NO:2. In other embodiments, the present disclosure relates to recombinant T cells expressing a T cell receptor and a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:5. In yet other embodiments, the present disclosure relates to recombinant T cells expressing a T cell receptor and the nucleic acid sequence of SEQ ID NO:2. In yet other embodiments, the present disclosure relates to recombinant T cells expressing a T cell receptor and the nucleic acid sequence of SEQ ID NO:5.
[0063] In certain embodiments, the immune cell expressing the nucleic acid consisting of the nucleic acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 is located within the coding region of a chimeric antigen receptor or a T cell receptor, such as the intracellular portion of a chimeric antigen receptor or a T cell receptor. In certain embodiments, the chimeric antigen receptor or the T cell receptor is specific for a cancer antigen.
[0064] In certain embodiments of the present disclosure, the immune cells are isolated or purified immune cells. In certain embodiments, the immune cells are isolated immune cells. In certain embodiments, the immune cells are purified immune cells. In certain embodiments, the immune cells are human immune cells.
[0065] In certain embodiments, the present disclosure relates to a cell population comprising at least one immune cell described herein. In certain embodiments, the present disclosure relates to a composition comprising at least one immune cell described herein and a pharmaceutically acceptable carrier.
[0066] therapeutic use Expression of SNP4 has a beneficial effect on anti-cancer treatment. Expression of SNP4 also leads to enhanced anti-tumor activity of other components, such as CAR-T cells. Thus, in certain embodiments, the present disclosure relates to a recombinant nucleic acid of the present disclosure for use in treating cancer. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 for use in treating cancer.
[0067] Various types of cancers can be treated using the inventive concepts disclosed herein, including hematological cancers and solid cancers. Thus, in certain embodiments, the present disclosure relates to a recombinant nucleic acid of the present disclosure for use in treating hematological cancers. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 for use in treating hematological cancers. In other embodiments, the present disclosure relates to a recombinant nucleic acid of the present disclosure for use in treating solid cancers. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 for use in treating solid cancers. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 for use in treating melanoma. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 for use in treating cervical cancer. In certain embodiments, the cervical cancer is HPV-associated cervical cancer. In other embodiments, the present disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5 for use in treating HPV-associated cancers. In other embodiments, the disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 for use in treating acute lymphocytic leukemia (ALL). In other embodiments, the disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 for use in treating sarcoma. In other embodiments, the disclosure relates to a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 for use in treating non-small-cell lung cancer (NSCLC).
[0068] In certain embodiments, the present disclosure relates to a method of reducing the size of a tumor in a mammal, comprising administering to the mammal a recombinant nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 in an amount effective to reduce the size of the tumor in the mammal.
[0069] In certain embodiments, the present disclosure relates to a method of reducing tumor size in a mammal, comprising administering to the mammal recombinant immune cells comprising a nucleic acid of SEQ ID NO: 2 or SEQ ID NO: 5 in an amount effective to reduce tumor size in the mammal. In certain embodiments, the immune cells are autologous to the mammal. In other embodiments, the immune cells are allogeneic to the mammal.
[0070] In certain embodiments, the present disclosure relates to a method of increasing T cell-mediated immunity in a subject having a disease condition, comprising isolating a population of immune cells from the subject, introducing into the isolated immune cells a nucleic acid molecule encoding a chimeric antigen receptor or a T cell receptor and a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:5, and reintroducing the immune cells into the subject.
[0071] In certain embodiments, the present disclosure relates to a method of increasing CD8+ T cell-mediated immunity in a subject having a disease condition, comprising isolating a population of immune cells from the subject, introducing a nucleic acid molecule encoding a SNP4 transcript into the isolated immune cells, and reintroducing the immune cells into the subject. In certain embodiments, the nucleic acid is introduced into the immune cells by transduction or transfection. In certain embodiments, the immune cells are autologous to the mammal. In certain embodiments, the immune cells are isolated from the blood of the subject.
[0072] In certain embodiments, the present disclosure relates to a recombinant immune cell, cell population, or composition according to the present disclosure for use in medicine. In certain embodiments, the use in medicine is for use in the treatment of cancer. In certain embodiments, the cancer is melanoma, NSCLC, sarcoma, or HPV-associated cancer. [Example]
[0073] Example 1 Materials and Methods Ethics statement Peripheral blood mononuclear cells for T cell enrichment were isolated from peripheral blood of healthy donors. The collection of immune cells from these donors was performed in accordance with the Declaration of Helsinki after ethical approval by the local ethics committee (National Institutes of Health Clinical Center, reference number NCT00001846 or University of Regensburg, reference number 20-2040-101) and signed informed consent.
[0074] Peripheral blood mononuclear cell isolation and blood lymphocyte pre-enrichment A leukocyte reduction chamber was used to isolate T cells from human blood. Blood was first diluted with PBS, and the resulting blood / PBS mixture was divided into four fractions. An equal volume of Ficoll-Paque™ Plus (Sweden Cytiva) was added, and the samples were centrifuged at 700 x g for 20 minutes at room temperature with an acceleration setting of 9 and a brake setting of 0. The PBMC layer was separated, centrifuged at 300 x g for 10 minutes, and washed twice with PBS. Naive CD8+ T cells were enriched using the EasySep™ Human Naive CD8+ T Cell Isolation Kit II according to the manufacturer's protocol.
[0075] Generation of miRNA-overexpressing CD8+ T cells To generate miRNA-overexpressing T cells, naive human CD8+ T cells were enriched using the EasySep™ Human Naive CD8+ T Cell Isolation Kit II (Stemcell Technologies) according to the manufacturer's protocol. Negatively enriched naive human CD8+ cells were activated with aCD3 / CD28 Dynabeads (Thermo Fisher Scientific) for 2 days in AIM V medium supplemented with 5% FBS (Cytiva), 100 U / ml penicillin, 100 μg / ml streptomycin, 2 mM Glutamax, 10 mM HEPES (Thermo Fisher Scientific), and 40 IU / ml IL-2 (Miltenyi Biotec). To generate miRNA-overexpressing T cells, activated cells were transduced with a gammaretroviral vector overexpressing either a control miR, miR-155, or SNP4, along with the NGFR (CD271) selectable marker. After transfection, the cells were cultured for 7 days in 300 IU / mL IL-2 AIM V medium. The transduced cells were enriched using the CD271 EasySep™ Human CD271 Positive Selection Kit II (StemCell Technologies).
[0076] CD19-specific CAR CD8 overexpressing miRNA + Generation of T cells To generate miRNA-overexpressing CD19-specific CAR T cells, cells were enriched and activated as described above. Two days after activation, cells were co-transduced with a gammaretroviral vector overexpressing the CD19-CAR construct (J Immunother. 2009 Sep;32(7):689-702) and a gammaretroviral vector overexpressing either a control miR, miR-155, or SNP4 and the NGFR selection marker. Transduced cells were cultured in AIMV complete medium supplemented with 300 IU / ml IL-2. Transduced cells were enriched using the CD271 EasySep™ Human CD271 Positive Selection Kit II (StemCell Technologies).
[0077] mouse Animal experiments were performed under protocols approved by the NCI Bethesda Animal Care and Use Committee. NOD scid γ and NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) mice were purchased from the Jackson Laboratory. Two million NALM6-GL cells were intravenously injected, and 3 days later, 7.5 × 10 mice overexpressing either control miR, miR-155, or SNP4 were injected. 5 CD19-specific CAR CD8 + T cells were administered. Recombinant human IL-15 (NCI) was injected intraperitoneally every other day (1 μg per mouse). Tumor burden was measured using a Xenogen IVIS Lumina (Caliper Life Sciences). NSG mice were intraperitoneally injected with 3 mg of D-luciferin (Caliper Life Sciences). Four minutes after injection, anesthetized mice were imaged with a 30-second exposure time. Bioluminescence signals from each mouse were analyzed in photons / second / cm² / sr using Living Image Version 4.1 software (Caliper Life Sciences).
[0078] cell line NALM6-GL (an acute lymphoblastic leukemia cell line stably transfected with green fluorescent protein and luciferase) and CD19-K562 (chronic myeloid leukemia cells stably expressing the CD19 antigen; J Immunother. 2009 Sep;32(7):689-702) were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Cytiva), 100 U / mL penicillin, 100 μg / mL streptomycin, 2 mM glutamate, and 1 mM sodium pyruvate (Thermo Fisher Scientific).
[0079] Flow cytometry Cells were filtered through a 40 μm filter unit and acquired using a BD FACSymphony™, BD FACSCelesta™, or BD FACSFusion™ flow cytometer (all Becton Dickinson, Franklin Lakes, NJ, USA). BD CS&T beads were used to verify instrument functionality. Fluorescence spillover compensation was performed using the AbC™ Total Antibody Compensation Bead Kit (Thermo Fisher Scientific) stained with the corresponding antibodies. Flow cytometry data were analyzed using BD FlowJo™ (version 10.6.2).
[0080] Samples were stained in 5 ml polystyrene tubes or 96-well plates in FACS buffer (1% FCS in PBS). LIVE / DEAD™ Fixable Dead Cell Stain (Thermo Fisher Scientific) was used to identify dead cells. Surface staining of human CD8 T cell samples was performed with anti-CD3 (SK7), anti-CD8 (SK1), anti-NGFR (ME20.4), anti-CD45RA (MEM-56), anti-CD45RO (UCHL1), anti-CD62L (DREG-56), anti-CCR7 (150503), anti-CD25 (BC96), pStat5 (SRBCZX), and anti-CD19 CAR (KIP-1).
[0081] Example 2 miR155 SNP4 is overexpressed in human CD8-positive T cells Expression of miR155 and several SNPs of miR155 was examined in human CD8+ T cells (enriched and transduced as described in Example 1) after transduction of human CD8 T cells with gammaretroviral vectors expressing either a control miR, miR155, or SNP4. The SNPs analyzed are shown in the table below: [Table 2]
[0082] Expression levels were normalized to U6, a commonly used housekeeping non-coding RNA. To quantify miR-155 and U6, total RNA, including small RNAs, was isolated from cells using the RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using the miRCURY LNA RT kit (Qiagen). qPCR was performed using the miRCURY® LNA® miRNA SYBR® Green PCR Assay (Qiagen). The hsa-miR-155-5p miRCURY LNA primer set was used to quantify miR155, and the hsa-6-snRNA miRCURY LNA primer set was used to quantify U6.
[0083] The results are shown in Figure 1. Among all SNPs tested, SNP4 showed the highest expression level. Although the mean expression level of SNP4 is within the range of wild-type miR155, SNP4 exhibits high expression variability, especially for high expression levels. This finding prompted us to further investigate SNP4 and its role in the biology and antitumor function of CD8 T cells.
[0084] Example 3 SNP4 induces stronger STAT5 signaling than wild-type miR155 Next, we investigated the effect of SNP4 on STAT5 signaling in comparison with wild-type miR155 and a control miR. A scrambled control miR (tebubio, France, catalog number 217CmiR0001-MR04) was used as the control miR (Ctrl miR). The control miR has the following scrambled miR sequence: GTAGGTCGACGTTTAAACGCGATCGCAGATCTGCATGTCGATAACGCAGAGACTCAACACCCTGTTTATTGATGCTGATGAATGACAGCTCGTAATTCAGTGACTGACTGGCCAGGTTCATCTGCTGTA ATAACGCCCCGGACGCGGGAGTGGCCGAGGCGTTAGCAGAGAATAACAGGCTACCTGTCACTAATGACATGGCAAACCAAAGTTGCTTCAAAGCTTGATGAATTGAAGCTTTTTTGAATTC (SEQ ID NO: 12)
[0085] To measure STAT5 phosphorylation, human naive CD8 T cells were transduced as described above. Seven days after transduction, cells were deprived of cytokines for 24 hours, followed by cytokine addition for 20 minutes, after which pStat5 levels were measured by flow cytometry.
[0086] The results are shown in Figure 2. SNP4 significantly increased STAT5 phosphorylation compared with wild-type miR155 and control miR, indicating that SNP4 efficiently increased T cell activation in response to cytokine stimulation.
[0087] Example 4 SNP4 suppresses the expression of miR155 target genes more strongly than wild-type miR155 Next, transcriptional changes induced by SNP4 were examined in comparison with miR155 and a control miR (SEQ ID NO: 12). Human CD8+ T cells overexpressing either a control miR, miR-155, or SNP4 were generated by transducing human naive CD8+ T cells as described above. Transduced cells were enriched on day 6. On day 9 (day 7 post-transduction), NGFR-enriched cells were lysed in RLT buffer (Qiagen), and the lysate was frozen at -80°C and stored until total RNA was isolated for total RNA sequencing.
[0088] The most significantly regulated genes were selected. The levels of dysregulation of these genes are visualized in Figure 3. Interestingly, the genes deregulated by SNP4 appear to coincide with those deregulated by miR155. Even more interestingly, the level of deregulation (downregulation seen in Figure 3, Panel A and upregulation seen in Figure 3, Panel B) appears to be more pronounced for SNP4 compared to miR155. This suggests that SNP4 causes the same transcriptional changes but to a stronger extent, further suggesting that SNP4 expression may play a beneficial role in cancer therapy.
[0089] Example 5 SNP4 enhances the metabolic capacity of T cells In this experiment, we investigated the metabolic fitness of T cells when wild-type miR155, SNP4, and control miRs were overexpressed. Naive CD8+ T cells were activated, transduced, and cultured as described above. On day 6 after activation, transduced cells were enriched using the CD271 EasySep™ Human CD271 Positive Selection Kit II (StemCell Technologies). On day 9 after activation, the metabolism of NGFR-enriched cells was examined using the Agilent Seahorse XF Glycolysis Stress Test (GST) and Mito-Stress Test (MST). Basal medium was prepared by adding 143 mM NaCl and 3 mg / L phenol red to serum-free DMEM medium and adjusting the pH to 7.35. For GST experiments, T cells were resuspended in basal medium supplemented with 2 mM L-glutamine. For MST experiments, cells were resuspended in basal medium supplemented with 1 mM sodium pyruvate and 25 mM glucose.
[0090] In GST experiments, transduced CD8 +T cells were treated with 8 mM glucose, followed by 3.9 μM oligomycin, and then 122 mM 2DG at the indicated time points (Figure 4). For MST experiments, cells were treated with 3.75 μM oligomycin, followed by 0.35 μM FCCP and 1.22 μM rotenone plus 1.22 μM antimycin A at the indicated time points (Figure 4). The extracellular acidification rate (ECAR) and oxygen consumption rate (OCR), respectively, were measured.
[0091] The results are shown in Figure 4. Consistent with enhanced effector function, cells overexpressing wild-type miR-155 or SNP4 were more glycolytic than control cells. Interestingly, SNP4-overexpressing cells had a higher oxygen consumption rate than the other two cell types, indicating a greater ability to produce energy under conditions of increased stress. In summary, these data support the metabolic advantage of SNP4-expressing T cells.
[0092] Example 6 SNP4-modified CAR T cells enhance cytotoxic function This experiment also examined whether SNP4 enhances the cytotoxicity of CD19-specific CAR T cells. CAR T cells were engineered to express miR155, SNP4, or a control miR as described above. Six days after activation, NGFR-transduced cells were enriched using the CD271 EasySep™ Human CD271 Positive Selection Kit II (StemCell Technologies). Nine days after activation, miRNA-overexpressing CAR T cells were incubated with Nalm6-GL cells at an E:T ratio of 1:20 and analyzed using the Incucyte Live-Cell Analysis System (Sartorius).
[0093] The results are shown in Figure 5. Nalm6-GL cells continued to be co-cultured with untransduced cells, as indicated by an increase in GFP intensity. GFP intensity decreased in cells co-cultured with T cells transfected with the CAR construct. CD19-specific CAR T cells expressing SNP4 exhibited significantly stronger cytotoxicity than CD19-specific CAR T cells expressing wild-type miR155 or control miR.
[0094] This experiment demonstrates that SNP4 can enhance the cytotoxic function of anticancer agents, such as CAR-expressing T cells.
[0095] Example 7 SNP4-modified CAR T cells exhibit enhanced polyfunctionality In this experiment, the polyfunctionality of miRNA-overexpressing CAR T cells was verified. Cells were transduced as described above. On day 6 after activation, cells were enriched using the CD271 EasySep™ Human CD271 Positive Selection Kit II (StemCell Technologies). On day 9 after activation, cells were incubated with CD19-K562 target cells for 16 hours. After 16 hours, target cells were removed by CD235a magnetic labeling (Miltenyi Biotec), and T cells were analyzed by IsoLight technology.
[0096] Figure 6 is a bar graph summarizing the individual functions induced by various constructs by the polyfunctionality intensity index, calculated by multiplying the mean fluorescence intensity of secreted cytokines by the percentage of polyfunctional cells. CAR T cells expressing miR155 and SNP4 exhibited a strong increase in polyfunctionality compared to CAR T cells expressing control miRs. SNP4-expressing CAR T cells exhibited the highest PSI. Figure 7 shows the combinations of cytokines simultaneously produced by subpopulations of cells present in the three groups of CD19-specific CAR T cells. Overexpression of SNP4 resulted in the highest polyfunctionality of CD19-specific CAR T cells, with simultaneous production of up to eight cytokines.
[0097] In summary, this experiment confirms the beneficial function of SNP4-expressing T cells and shows that this is primarily due to the stimulatory effect induced by SNP4.
[0098] Example 8 SNP4 is CD8 + Further enhancing anti-tumor immunity of CAR T cells In this study, we tested whether SNP4 could enhance antitumor immunity of CAR T cells in mice. + T cells were co-transduced with a gammaretroviral vector overexpressing a CD19 CAR and a gammaretroviral vector overexpressing either a control miR, miR-155, or SNP4 with the NGFR selectable marker. NGFR-transduced cells were enriched using the CD271 EasySep™ Human CD271 Positive Selection Kit II (StemCell Technologies) on day 7 post-transduction. 7,500 CD8+ CAR cells specific for 99% NGFR / 70% CD19 were injected intravenously 3 days after the intravenous injection of 2 million NALM6-GL leukemia cells. Cytokine support (1 μg rhIL-15) was administered intraperitoneally every other day for the duration of the experiment.
[0099] The results are shown in Figure 8. 15 days after administration, all untreated mice died, but all three types of CAR T cells demonstrated strong anti-tumor responses (as indicated by a decrease in the bioluminescence signal from tumor cells). 35 days later, mice transplanted with CAR T cells expressing miR155 and SNP4 showed a clear reduction in cancer cells, with the reduction being particularly pronounced in the SNP4 mice. 65 days later, the effect was even more pronounced, with a strong impact on cancer cells in the miR155 and SNP4 mice.
Claims
1. A recombinant immune cell expressing a nucleic acid of SEQ ID NO: 2 or SEQ ID NO: 5 for use in medicine.
2. 2. The recombinant immune cell of claim 1, wherein the nucleic acid is operably linked to a promoter.
3. 3. The recombinant immune cell according to claim 1 or 2, wherein the recombinant nucleic acid is encoded by an expression vector, preferably a viral vector or a plasmid.
4. 4. The recombinant immune cell of claim 3, wherein the expression vector induces high-level expression of the nucleic acid of SEQ ID NO:2 or SEQ ID NO:
5.
5. 5. The recombinant immune cell of claim 1, further comprising a nucleic acid encoding a chimeric antigen receptor or a T cell receptor.
6. 6. The recombinant immune cell according to claim 5, wherein the nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2 or SEQ ID NO: 5 is located within the coding region of the chimeric antigen receptor or the T cell receptor, preferably in the intracellular part of the chimeric antigen receptor or the T cell receptor.
7. 7. The recombinant immune cell according to claim 5 or 6, wherein the chimeric antigen receptor or the T cell receptor is specific for a cancer antigen.
8. 8. The recombinant immune cell according to any one of claims 1 to 7, wherein said use in medicine is use in the treatment of cancer, preferably in the treatment of melanoma, NSCLC, sarcoma or HPV-associated cancer.
9. The recombinant immune cell according to any one of claims 1 to 8, wherein the recombinant immune cell is a T cell, preferably a CD8-positive T cell, more preferably a tumor-infiltrating lymphocyte (TIL) or a peripheral blood lymphocyte (PBL) isolated from a patient suffering from cancer.
10. 10. The recombinant immune cell according to any one of claims 1 to 9, characterized in that said immune cell is an isolated or purified immune cell, preferably an isolated or purified human immune cell.
11. A cell population comprising at least one recombinant immune cell according to any one of claims 1 to 10.
12. A composition comprising at least one recombinant immune cell according to any one of claims 1 to 10 or a cell population according to claim 11, and a pharmaceutical carrier.
Citation Information
Patent Citations
Cell line for knocking out pig miR-155 gene based on CRISPR / Cas9 gene editing system and construction method
CN112481218A
Retroviral vector for expressing CAR and micro RNA and application thereof
CN113337544A
Pre-b cell proliferation and lymphoblastic leukemia / high-grade lymphoma in mir155 transgenic mice
WO2007127190A2
Targeting RNA with external guide sequences
WO2009026576A1
Methods for modulating adipocyte expression using microrna compositions
WO2010135714A2