Cervical cell gene methylation detection kit and detection method

The fluorescent quantitative PCR-based kit for detecting MTHFR, PAX1, and SGSH gene methylation in cervical cells addresses the limitations of current tests, offering high sensitivity and specificity for early cervical cancer detection by combining methylation analysis and regression equation determination.

JP2025528974AActive Publication Date: 2025-09-04QINGDAO RUISIDE MEDICAL LABORATORY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2024529129
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-08-14
Filing Date
2023-10-30
Publication Date
2025-09-04
Estimated Expiration
2043-10-30

AI Technical Summary

Technical Problem

Current cytological and virological tests for cervical cancer have limitations and do not meet clinical needs for sensitivity, specificity, and accuracy, necessitating a more effective method for early detection.

Method used

A kit and method utilizing fluorescent quantitative PCR technology for combined methylation detection of MTHFR, PAX1, and SGSH genes in cervical cells, employing specific primers and probes to amplify nucleic acid after bisulfite treatment, with a regression equation to determine methylation levels.

Benefits of technology

The method provides high sensitivity and specificity for early cervical cancer screening by reducing randomness in base changes and compensating for site and reaction system differences, achieving 83.3% sensitivity and 100% specificity in detecting cervical cancer and precancerous lesions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025528974000001_ABST
    Figure 2025528974000001_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of biomedical testing, and particularly to a kit and method for detecting gene methylation in cervical cells. [Solution] The present invention is used to determine whether a sample has precancerous lesions by detecting the methylation levels of the promoter regions of three genes, MTHFR, PAX1, and SGSH, in the sample. The operation is convenient and simple, and the detection sensitivity and specificity are high, which is of significant positive significance in the detection of cervical cancer.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the technical field of biomedical testing, and particularly to a kit and method for detecting gene methylation in cervical cells based on fluorescent quantitative PCR technology. [Background technology]

[0002] In China, cervical cancer is one of the most common malignant tumors threatening women's health, ranking second in both incidence and mortality. In 2018, there were more than 569,000 new cases and more than 311,000 deaths worldwide. Of these, 85% occurred in developing countries. In China, there were approximately 111,000 new cases and 34,000 deaths in 2015. Overall, cervical cancer deaths in China are slightly higher in rural areas than in urban areas, with the midwestern region experiencing a rate roughly twice that of the eastern region. The median age of onset of cervical cancer in China is 51 years, but the disease is most prevalent in two age groups: those aged 40-50 years, with a peak in those aged 60-70 years, and rare cases under 20 years. However, it is noteworthy that the average age of onset of cervical cancer has gradually decreased in recent years, with a trend toward younger cases. Therefore, there is a strong need for nationwide regulation of cervical cancer diagnosis and treatment. In addition, the development of cervical cancer can be effectively prevented by screening and treating precancerous lesions.

[0003] Currently, the cytological TCT and virological HPV tests used in clinical practice have limitations and cannot fully meet clinical needs. Cervical cancer gene methylation detection has high sensitivity, specificity, and accuracy, which can effectively fill the current clinical gaps and provide clinicians with a more valuable reference, thereby making better contributions to clinical practice and the public. Summary of the Invention [Problem to be solved by the invention]

[0004] To solve the problems of existing technologies, the present invention provides a kit and method for detecting gene methylation in cervical cells based on fluorescent quantitative PCR technology, which can realize the combined detection of multi-gene methylation and realize early screening for cervical cancer. [Means for solving the problem]

[0005] This invention employs fluorescent quantitative PCR technology to perform combined methylation detection of the MTHFR, PAX1, and SGSH genes in exfoliated cervical tissue from patients. After bisulfite treatment of the sample, specific primers and a fluorescent probe are used to amplify the nucleic acid, enabling rapid detection of the methylation of the methylation-related genes MTHFR, PAX1, and SGSH, providing a simpler and more accurate clinical screening test. The NCBI database number for the MTHFR gene sequence of this invention is NC_000001.11, and the NCBI database numbers for the PAX1 gene and SGSH gene are NC_000020.11 and NC_000017.11, respectively.

[0006] To achieve the objectives of the invention, the first technical solution provided by the present invention is as follows: The present invention provides a kit for detecting gene methylation in cervical cells, which is characterized as follows: The kit includes an MTHFR PCR reaction solution used to detect the methylation level in at least one target region in the MTHFR gene promoter region; a PAX1 PCR reaction solution used to detect the methylation level in at least one target region in the PAX1 gene promoter region; and an SGSH PCR reaction solution used to detect the methylation level in at least one target region in the SGSH gene promoter region. The kit further includes a positive control substance and a negative control substance; the promoter region is not strictly limited to a region located within the promoter fragment, but can be a gene fragment in a region near the promoter.

[0007] The MTHFR, PAX1, and SGSH genes are all closely related to the progression of cervical cancer. The methylation detection regions of each target gene contain multiple CpGs, which reduces the randomness of base changes compared to single base detection. At the same time, methylation detection for the three target genes MTHFR, PAX1, and SGSH can be combined to effectively compensate for differences that may arise due to site selection and reaction system, thereby improving the accuracy of gene methylation detection in cervical cells.

[0008] The MTHFR PCR reaction mixture contains MTHFR forward and reverse primers, an MTHFR probe, an internal standard ACTB forward and reverse primers, and an internal standard ACTB probe. The PAX1 PCR reaction mixture contains PAX1 forward and reverse primers, a PAX1 probe, an internal standard ACTB forward and reverse primers, and an internal standard ACTB probe. The SGSH PCR reaction mixture contains SGSH forward and reverse primers, an SGSH probe, an internal standard ACTB forward and reverse primers, and an internal standard ACTB probe.

[0009] The MTHFR, PAX1, and SGSH PCR reaction mixture contained 10x buffer, 10 mM dNTP mixture, and an enzyme mixture containing Taq polymerase and UNG enzyme, where the Taq polymerase is a hot-start Taq polymerase and the UNG enzyme is uracil-N-glycosylase.

[0010] The nucleotide sequence of the MTHFR forward primer is tcggtttttattggtcgcgg (SEQ ID NO: 1), the nucleotide sequence of the THFR reverse primer is tacctcgaaacaaaacgc (SEQ ID NO: 2), and the nucleotide sequence of the MTHFR probe is accgcgaaaccaac (SEQ ID NO: 3). The nucleotide sequence of the PAX1 forward primer is tcgacgttgtagtttttcggttagacgaat (SEQ ID NO: 4), the nucleotide sequence of the PAX1 reverse primer is tacccctccaaaacctcccac (SEQ ID NO: 5), and the nucleotide sequence of the PAX1 probe is cccgaccccaacccaaataacttcat (SEQ ID NO: 6). The nucleotide sequence of the SGSH forward primer is gtttcgcgtcgcgttt (SEQ ID NO: 7), the nucleotide sequence of the SGSH reverse primer is acgacgacgaaccacc (SEQ ID NO: 8), and the nucleotide sequence of the SGSH probe is cgcgccctaaact (SEQ ID NO: 9). The nucleotide sequence of the internal standard ACTB forward primer is taggatttttatttag (SEQ ID NO: 10), the nucleotide sequence of the internal standard ACTB reverse primer is tgtgaatttttgttat (SEQ ID NO: 11), and the nucleotide sequence of the internal standard ACTB probe is ttttaagggaggagt (SEQ ID NO: 12).

[0011] Both ends of the MTHFR probe, PAX1 probe, SGSH probe, and ACTB probe are labeled with a reporter and a quencher, respectively.

[0012] The reporter is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5, and the quencher is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, DABCYL.

[0013] Both ends of each probe are labeled with a reporter / quencher, respectively, and the reporters at the 5' ends may be the same or different and are selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3, or CY5, and the quenchers at the 3' ends may be the same or different and are selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

[0014] In one specific embodiment of the present invention, the 5'-end reporter of the MTHFR fluorescent probe is FAM, the 3'-end quencher is BHQ1, the 5'-end reporter of the internal standard gene fluorescent probe is VIC, and the 3'-end quencher is BHQ1. The 5'-end reporter of the PAX1 fluorescent probe is FAM, the 3'-end quencher is BHQ1; the 5'-end reporter of the internal standard gene fluorescent probe is VIC, and the 3'-end quencher is BHQ1. The 5'-end reporter of the SGSH fluorescent probe is FAM, the 3'-end quencher is BHQ1, and the 5'-end reporter of the internal standard gene fluorescent probe is VIC, and the 3'-end quencher is BHQ1.

[0015] The positive standard was selected from DNA of cervical squamous cell carcinoma Hisa cells; the negative standard was sterile water.

[0016] To achieve the object of the invention, the second technical solution provided by the present invention is as follows: The present invention provides a method for detecting gene methylation in cervical cells, which is characterized by comprising the following steps: (1) Extract DNA from the test sample. (2) The DNA of the test sample is subjected to bisulfite conversion to obtain purified Bis-DNA. (3) Using the purified Bis-DNA as a template, PCR amplification reactions are performed using the primer and probe combinations in the MTHFR PCR reaction solution, PAX1 PCR reaction solution, and SGSH PCR reaction solution of the kit of the present invention. For the three target genes, MTHFR, PAX1, and SGSH, ACTB is selected as an internal control gene, and the target genes and internal control gene are simultaneously detected based on multichannel fluorescent probe labeling. (4) Based on the above steps, the ΔCt values ​​(target Ct value = internal standard Ct value) of the three target genes, MTHFR, PAX1, and SGSH, are obtained. X1 = MTHFR Ct - ACTB Ct value, X2 = PAX1 Ct - ACTB Ct value, and X3 = SGSH Ct - ACTB Ct value. These values ​​are then substituted into the regression equation Y = 10.326 - 0.309 x X1 - 0.623 x X2 - 0.552 x X3 to determine the degree of methylation. If Y ≥ 0, the test sample is determined to be cervical cancer methylation-positive; if Y < 0, the test sample is determined to be cervical cancer methylation-negative. [Effects of the Invention]

[0017] 1. The present invention provides a combination of methylation genes for use in detecting methylation in cervical cancer, including the methylation genes MTHFR, PAX1, and SGSH. In the present invention, the MTHFR, PAX1, and SGSH genes are all closely related to the progression of cervical cancer. The methylation detection region of each target gene contains multiple CpGs, which reduces the randomness of base changes compared to single-base detection. The methylation determination of target genes is not limited to one or two bases.

[0018] 2. ACTB was selected as the internal control gene for the three target genes, and the target genes and internal control genes were simultaneously detected based on multi-channel fluorescent probe labeling. Finally, the ΔCt values ​​(target Ct value + internal control Ct value) of the three genes were substituted into the regression equation Y = 10.326 - 0.309 × X1 - 0.623 × X2 - 0.552 × X3 to determine the methylation level.

[0019] 3. The present invention provides a reaction mixture and detection method for cervical cancer methylation PCR, along with the accompanying methods for nucleic acid extraction and sulfite conversion of samples. The sulfite-converted DNA is used as a template for PCR, enabling simultaneous detection of three target genes: MTHFR, PAX1, and SGSH. By combining the detection of MTHFR, PAX1, and SGSH methylation, the present invention effectively compensates for differences that may arise due to site selection and reaction system, thereby improving the accuracy of cervical cancer methylation detection. [Brief explanation of the drawings]

[0020] [Figure 1] Figure 1 shows PCR amplification curves for gene (MTHFR, PAX1, SGSH) methylation in a typical cervical cancer exfoliated cell sample. (The kit uses primer-probe combinations of MTHFR (F / R / P), PAX1 (F / R / P), and SGSH (F / R / P)) indicates that the Ct values ​​of the MTHFR, PAX1, and SGSH genes in the cervical cancer exfoliated cell sample are all ≤32. [Figure 2] Figure 2 shows the PCR amplification curves of unmethylated genes (MTHFR, PAX1, SGSH) in a typical normal cervical exfoliated cell sample. (The primer-probe combination kit is MTHFR (F / R / P), PAX1 (F / R / P), and SGSH (F / R / P)) shows that the Ct values ​​of the MTHFR, PAX1, and SGSH genes in a normal cervical exfoliated cell sample are all >32. [Figure 3] Figure 3 shows the ROC curve for cervical precancerous lesions (CIN2 or higher) and normal controls. The area under the ROC curve (AUC) was 0.965 (95% CI: 0.914-1; P<0.0001). [Figure 4] FIG. 4 is a parameter setting table for channel selection and amplification cycle for fluorescence detection in Example 2 of the present invention. [Figure 5] FIG. 5 is a comparison table of the measurement results of the kit of the present invention and the pathological test results in Example 3 of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0021] (1) Example 1: Cervical Cell Gene Methylation Detection Kit of the Present Invention The gene methylation detection kit for cervical cells in the present invention comprises: an MTHFR PCR reaction solution used to detect the methylation level in at least one target region in the MTHFR gene promoter region; a PAX1 PCR reaction solution used to detect the methylation level in at least one target region in the PAX1 gene promoter region; and an SGSH PCR reaction solution used to detect the methylation level in at least one target region in the SGSH gene promoter region; and further comprises a positive standard substance and a negative standard substance; and the promoter region is not strictly limited to a region located within the promoter fragment, but is a gene fragment in a region near the promoter.

[0022] The MTHFR PCR reaction mixture contained an MTHFR forward primer, an MTHFR reverse primer, an MTHFR probe, an internal standard ACTB forward primer, an internal standard ACTB reverse primer, an internal standard ACTB probe, 10x buffer, a 10mM dNTP mix, and an enzyme mix.

[0023] The PAX1 PCR reaction mixture contained a PAX1 forward primer, a PAX1 reverse primer, a PAX1 probe, an internal standard ACTB forward primer, an internal standard ACTB reverse primer, an internal standard ACTB probe, 10x buffer, a 10mM dNTP mix and an enzyme mix.

[0024] The SGSH PCR reaction mixture contained an SGSH forward primer, an SGSH reverse primer, an SGSH probe, an internal standard ACTB forward primer, an internal standard ACTB reverse primer, an internal standard ACTB probe, 10x buffer, a 10 mM dNTP mixture, and an enzyme mixture.

[0025] The ratio of forward primer, reverse primer and probe in the above MTHFR PCR reaction mixture, PAX1 PCR reaction mixture and SGSH PCR reaction mixture was 4:4:2; forward primer was 200 nM, reverse primer was 200 nM and probe was 100 nM.

[0026] The enzyme mixture includes Taq polymerase and UNG enzyme, where the Taq polymerase is a hot-start Taq polymerase and the UNG enzyme is a uracil-N-glycosylase.

[0027] The nucleotide sequences of the primers and probes for the cervical cancer methylation genes MTHFR, PAX1, and SGSH, and the internal control gene ACTB in this example are shown in Table 1. The nucleotide sequence listing of this invention has been submitted to the State Intellectual Property Office in accordance with WIPO Standard ST.26.

[0028] [Table 1]

[0029] Furthermore, the positive standard is selected from DNA of cervical squamous cell carcinoma Hisa cells, and the negative standard is sterile water.

[0030] The specific kit configuration is shown in the table below.

[0031] [Table 2]

[0032] (2) Example 2 A method for detecting gene methylation in cervical cells using the kit for detecting gene methylation in cervical cells of the present invention comprises the following steps. (1) Extract DNA from the test sample Cellular DNA was extracted from the exfoliated cervical cell samples. Once extraction was complete, the DNA concentration and OD260 / OD280 were measured using a Nano-500 microspectrophotometer. The OD260 / OD280 ratio was between 1.6 and 2.0.

[0033] (2) The DNA of the test sample is subjected to bisulfite conversion to obtain purified Bis-DNA. Once the cell DNA is extracted, the extracted DNA is subjected to bisulfite conversion. Unmethylated cytosines (C) are converted to uracil (U), while methylated cytosines (C) remain unconverted, yielding purified Bis-DNA. The resulting Bis-DNA should be detected immediately. It can be stored at 20°C for up to four months, but should be stored at 80°C for longer periods.

[0034] (3) Using the purified Bis-DNA as a template, PCR amplification reactions are carried out using the combinations of primers and probes in the MTHFR PCR reaction solution, PAX1 PCR reaction solution, and SGSH PCR reaction solution in the kit of the present invention. For the three target genes, MTHFR, PAX1, and SGSH, ACTB was selected as the internal control gene, and the target genes and the internal control gene were simultaneously detected based on multi-channel fluorescent probe labeling. The specific operation is as follows: S1. Preparation of Reagents The PCR reaction system for the MTHFR gene consists of the following reagent components: the volume of the MTHFR PCR reaction solution is 15 μL, the volume of the Bis-DNA template is 2-5 μL, and the volume is adjusted to 20 μL with purified water. The PCR reaction system for the PAX1 gene consists of the following reagent components: PAX1 PCR reaction solution volume: 15 μL, Bis-DNA template volume: 2-5 μL, and purified water to bring the volume to 20 μL. The PCR reaction system for the SGSH gene consists of the following reagent components: SGSH PCR reaction solution volume is 15 μL, Bis-DNA template volume is 2-5 μL, and purified water is added to bring the volume to 20 μL. S2. Addition of sample Add 2-5 μL of the nucleic acid sample to each of the 8 tubes, for a final volume of 20 μL per tube. Tightly close the caps, centrifuge briefly at low speed, and perform detection in a PCR device. S3. PCR amplification Select the fluorescence detection channel and set the amplification cycle parameters as shown in Figure 4. Note: Do not select ROX compensation and select None for quencher. Once the settings are complete, save the file and run the reaction program.

[0035] (4) Based on the above steps, the ΔCt values ​​(target Ct value = internal standard Ct value) of the three target genes, MTHFR, PAX1, and SGSH, are obtained. X1 = MTHFR Ct - ACTB Ct value, X2 = PAX1 Ct - ACTB Ct value, and X3 = SGSH Ct - ACTB Ct value. These values ​​are then substituted into the regression equation Y = 10.326 - 0.309 x X1 - 0.623 x X2 - 0.552 x X3 to determine the degree of methylation. If Y ≥ 0, the test sample is determined to be cervical cancer methylation-positive; if Y < 0, the test sample is determined to be cervical cancer methylation-negative.

[0036] (3) Example 3: Testing the accuracy of detection by the kit A comparison of the detection results using the kit of the present invention and the pathological test results is shown in FIG. The results of gene (MTHFR, PAX1, SGSH) methylation detection performed on 60 cervical exfoliated cell samples are shown in Figures 1 and 2. Figure 1 shows the PCR amplification curves for gene (MTHFR, PAX1, SGSH) methylation in a typical cervical cancer exfoliated cell sample. (The kit used primer-probe combinations of MTHFR (F / R / P), PAX1 (F / R / P), and SGSH (F / R / P)) indicates that the Ct values ​​of the MTHFR, PAX1, and SGSH genes in the cervical cancer exfoliated cell samples were all ≤32. Figure 2 shows the PCR amplification curves for gene (MTHFR, PAX1, SGSH) unmethylation in a typical normal cervical exfoliated cell sample. (The kit with primer-probe combinations of MTHFR (F / R / P), PAX1 (F / R / P), and SGSH (F / R / P)) shows that the Ct values ​​of the MTHFR gene, PAX1 gene, and SGSH gene in normal cervical exfoliated cell samples are all >32. When the clinical diagnostic threshold is CIN2, the experimental data show that the detection sensitivity of the kit provided in Example 1 of the present invention is 83.3% and 100%, respectively.

[0037] (4) Example 4 ROC curves for healthy subjects and CIN2 or higher based on pathological diagnosis results As shown in Figure 3, the kit provided in Example 1 of the present invention can clearly distinguish between cervical precancerous lesions (CIN2 or higher) and normal controls, with an area under the receiver operating characteristic curve (AUC) of 0.965 (95% CI: 0.914-1: P<0.0001).

[0038] (5) Example 5 Logistic Regression Analysis Experiments have yielded a logistic regression equation for determining normal samples and CIN2 or higher: Y = A0 + A1 × X1 + A2 × X2 + A3 × X3; where A0, A1, A2, and A3 are clinical coefficients. The weighting relationship of the clinical coefficients is as follows: the proportional coefficient for MTHFR is A1 = -0.309, the proportional coefficient for PAX1 is A2 = -0.623, the proportional coefficient for SGSH is A3 = -0.552, and the proportional coefficient for the constant is A0 = 10.326.

[0039] The differences in the amplification cycle numbers of the MTHFR, PAX1, SGSH genes, and the internal control gene ACTB are X1, X2, and X3, respectively. The methylation level is determined by substituting X1 = MTHFR Ct - ACTB Ct value, X2 = PAX1 Ct - ACTB Ct value, and X3 = SGSH Ct - ACTB Ct value into the regression equation Y = 10.326 - 0.309 x X1 - 0.623 x X2 - 0.552 x X3. If Y ≥ 0, the test sample is determined to be cervical cancer methylation-positive; if Y < 0, the test sample is determined to be cervical cancer methylation-negative.

[0040] By analyzing the methylation of the three genes and applying regression analysis, a combined detection of cervical cancer and precancerous lesions was performed, with sensitivity and specificity much higher than that of single-gene detection analyses of MTHFR, PAX1, and SGSH.

Claims

1. A kit for detecting gene methylation in cervical cells, comprising: an MTHFR PCR reaction solution used to detect the degree of methylation in at least one target region in the MTHFR gene promoter region; a PAX1 PCR reaction solution used to detect the degree of methylation in at least one target region in the PAX1 gene promoter region; and an SGSH PCR reaction solution used to detect the degree of methylation in at least one target region in the SGSH gene promoter region; further comprising a positive standard and a negative standard; and wherein the promoter region is not strictly limited to a region located within the promoter fragment, but is a gene fragment in a region near the promoter.

2. The kit for detecting gene methylation in cervical cells according to claim 1, characterized in that the MTHFR PCR reaction solution comprises MTHFR forward and reverse primers, an MTHFR probe, internal standard ACTB forward and reverse primers, and an internal standard probe; the PAX1 PCR reaction solution comprises PAX1 forward and reverse primers, a PAX1 probe, internal standard ACTB forward and reverse primers, and an internal standard ACTB probe; and the SGSH PCR reaction solution comprises SGSH forward and reverse primers, an SGSH probe, internal standard ACTB forward and reverse primers, and an internal standard ACTB probe.

3. 3. The kit for detecting gene methylation in cervical cells according to claim 2, wherein the MTHFR, PAX1, and SGSH PCR reaction solution further comprises 10x buffer, 10 mM dNTP mixture, and an enzyme mixture, the enzyme mixture comprising Taq polymerase and UNG enzyme, the Taq polymerase being a hot-start Taq polymerase, and the UNG enzyme being uracil-N-glycosylase.

4. the nucleotide sequence of the MTHFR forward primer is tcggttttttaattggtcgcgg (SEQ ID NO: 1), the nucleotide sequence of the THFR reverse primer is tacctcgaaacaaacgc (SEQ ID NO: 2), and the nucleotide sequence of the MTHFR probe is accgcgaaaccaac (SEQ ID NO: 3); the nucleotide sequence of the PAX1 forward primer is tcgacgttgtagtttttcggtttagacgaat (SEQ ID NO: 4), the nucleotide sequence of the PAX1 reverse primer is taccccctccaaaacctcccac (SEQ ID NO: 5), and the nucleotide sequence of the PAX1 probe is cccgaccccaaccccaaataacttcat (SEQ ID NO: 6); 3. The kit for detecting gene methylation in cervical cells according to claim 2, wherein the base sequence of the forward primer is gtttcgcgtcgcgttt (SEQ ID NO: 7), the base sequence of the SGSH reverse primer is acgacgacgaaccacc (SEQ ID NO: 8), and the base sequence of the SGSH probe is cgcgccctaaact (SEQ ID NO: 9); the base sequence of the internal standard ACTB forward primer is taggatttttattatttag (SEQ ID NO: 10), the base sequence of the internal standard ACTB reverse primer is tgtgaatttttgttat (SEQ ID NO: 11), and the base sequence of the internal standard ACTB probe is ttttaagggaggagt (SEQ ID NO: 12).

5. The kit for detecting gene methylation in cervical cells according to claim 2, characterized in that both ends of the MTHFR probe, PAX1 probe, SGSH probe and ACTB probe are labeled with a reporter and a quencher, respectively; the reporter is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5; and the quencher is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse and DABCYL.

6. The kit for detecting gene methylation in cervical cells according to claim 1, wherein the positive standard is selected from DNA of cervical squamous cell carcinoma Hisa cells; and the negative standard is sterile water.

7. The following process (1) Extract DNA from the test sample; (2) subjecting the DNA of the test sample to bisulfite conversion to obtain purified Bis-DNA; (3) Using the purified Bis-DNA as a template, PCR amplification reactions are carried out using the combinations of primers and probes in the MTHFR PCR reaction solution, PAX1 PCR reaction solution, and SGSH PCR reaction solution in the kit of claim 1; ACTB is selected as an internal control gene for the three target genes MTHFR, PAX1, and SGSH, and the target genes and internal control gene are simultaneously detected based on multi-channel fluorescent probe labeling; (4) Based on the above steps, the ΔCt values ​​(target Ct value, internal standard Ct value) of three target genes, MTHFR, PAX1, and SGSH, are obtained, where X1 = MTHFR Ct - ACTB Ct value, X2 = PAX1 Ct - ACTB Ct value, and X3 = SGSH Ct - ACTB Ct value, and these are substituted into a regression equation Y = 10.326 - 0.309 x X1 - 0.623 x X2 - 0.552 x X3 to determine the degree of methylation. If Y≧0, the test sample is determined to be methylation-positive in cervical cancer; if Y<0, the test sample is determined to be methylation-negative in cervical cancer.

Citation Information

Patent Citations

  • Primer pair, kit and method based on cervical cancer specificity methylation detection

    CN106755491A

  • Primer probe combination and kit for methylation detection of cervical cancer related genes and application thereof

    CN113249485A

  • Kit for detecting gene methylation of cervical cells based on fluorescent quantitative PCR technology and application of kit

    CN113817833A

  • Primer probe, method and kit for detecting methylation of cervical cancer related gene PAX1

    CN116287244A

  • Cervical cell gene methylation detection kit and detection method thereof

    CN116926196A