Multi-epitope universal influenza vaccine

Abstract

The present invention relates to the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMF Disclosed is a polyepitope vaccine formulation relating to at least five influenza A virus (IAV) derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides having SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW) and SEQ ID NO: 20 (FLLMDALKL).

Description

[Technical Field]

[0001] The present invention relates to the field of vaccination against influenza virus infection using broad-spectrum influenza vaccines. Influenza is a common acute respiratory disease caused by viruses that cause annual seasonal epidemics. Three major pandemics occurred in the 20th century, in 1918-1919, 1957, and 1968, and one in 2009, primarily due to genetic variants of influenza A viruses (IAVs). In temperate regions, the incidence of hospitalization increases during annual influenza epidemics. More than 90% of influenza-related deaths involve people over 65 years of age. Annual vaccination is the primary preventive measure for this age group. Annual vaccination is also recommended for younger people with severe chronic diseases. Preferably, vaccine strains are antigenically closely matched to the epidemic strains circulating at the time of vaccination to provide optimal protection. Relatively speaking, vaccination of people over 65 years of age reduces influenza-related deaths by up to 80%, hospitalizations and pneumonia by up to 50%, and symptomatic influenza by up to 30%. The full impact of influenza is increasingly recognized as a disease that goes far beyond pneumonia and influenza statistics. Peak months for respiratory disease, ischemic heart disease, cerebrovascular events, and diabetes-related deaths among adults aged 70 years and older coincide with annual influenza epidemics, suggesting that influenza illness is a major cause of excess mortality in this population during the winter months (McElhaney 2011). While current vaccination programs using split-virus vaccines are cost-saving for the over-65 age group, these vaccines often fail to provide adequate protection to older adults, and influenza illness continues to have devastating consequences for this population. Rising hospitalization rates are expected from seasonal influenza, and in the event of an actual pandemic among older adults, they could paralyze health and support systems. Vaccine development, a priority for preparing for a potential pandemic, is complicated by antigenic variation in the surface glycoprotein hemagglutinin (de Vries et al. 2018). [Background technology]

[0002] Vaccination is the most appropriate countermeasure for controlling IAV transmission and preventing disease. However, the lack of an effective method for predicting circulating strains can lead to discrepancies between annual vaccines and circulating viruses. For example, the sudden emergence of the influenza A / H1N1 pandemic strain in 2009 and the recent emergence of the highly pathogenic avian A / H7N9 strain in China in 2013 highlight the unpredictable nature of viruses and the difficulty of understanding the emergence of new strains. Two types of influenza vaccines are widely available: inactivated influenza vaccines (IIV) and live-attenuated influenza vaccines (LAIV). Traditionally, to address annual antigenic variations, influenza vaccines (both IIV and LAIV) have been produced to protect against three or four different seasonal influenza viruses (also known as trivalent or quadrivalent vaccines). Current quadrivalent vaccines contain components from two influenza lineages: influenza A(H3N2), A(H1N1), and influenza B viruses. Although the trivalent or tetravalent vaccines mentioned above rely most heavily on specific targeting of the major surface protein, hemagglutinin (HA), and are standardized to stimulate anti-HA antibodies as the primary correlate of protection, these vaccines have limited and somewhat unpredictable efficacy, particularly in those most in need of protection, such as the elderly, young, and infirm. Regardless of the type or composition of seasonal influenza vaccines, vaccination must be administered annually to provide optimal protection against infection.

[0003] Because the effectiveness of influenza vaccines can vary from year to year due to the constantly evolving nature of influenza viruses, including their propensity to circulate and infect humans, these vaccines are regularly updated to ensure they are antigenically consistent with circulating influenza strains. WHO organizes regular consultations with an advisory group of experts from WHO Collaborating Centers and Essential Regulatory Laboratories to analyze influenza virus surveillance data generated by the WHO Global Influenza Surveillance and Response System. The published recommendations are used by national vaccine regulatory agencies and pharmaceutical companies to develop, produce, and license influenza vaccines for the next influenza season. Due to the evolving nature of influenza, the protection provided by vaccines can still vary from season to season and depends in part on the age and health of the vaccine recipient and the factual similarity, or match, between the virus in the vaccine and the circulating virus. Years of good vaccine match allow for measurable substantial benefits from vaccination in terms of preventing illness and complications following viral infection. However, the benefit of annual influenza vaccination still varies depending on the characteristics of the person being vaccinated (e.g., health status and age), which influenza viruses are circulating that season, and potentially which type of vaccine is used. Indeed, some people may experience symptoms despite being vaccinated, for example, because they may have been exposed to a virus different from the virus used in the vaccine. The ability of an influenza vaccine to protect a person depends largely on the match or mismatch between the vaccine virus selected to create the vaccine used in that person and the virus that spreads to that person and causes disease. There are many different influenza viruses that spread among people and cause disease.During years when vaccine concordance is generally poor, substantial benefits from vaccination in preventing influenza illness and complications are expected to be reduced, with older adults again being most at risk (McElhaney 2011).

[0004] To mitigate the mismatch problem, the use of antiviral drugs such as amantadine, zanamivir, and oseltamivir as adjuncts to influenza vaccination has been suggested in some situations ('Antiviral drugs in influenza: an adjunct to vaccination in some situations' 2006). However, in reality, antiviral drugs are not a substitute for influenza vaccination, but may be a useful adjunct only in some situations. In situations where the risk of contracting influenza virus infection is high, it is best to limit their use to short-term prevention of vulnerable individuals. However, relying on antiviral therapy using antiviral drugs contradicts the fact that the infection is caused by the mismatch. Therefore, instead, it may be better to first improve the mismatch by providing a more well-matched vaccine.

[0005] Furthermore, it is now well recognized that elderly people respond poorly to immunization protocols. Protection against influenza by vaccination with hemagglutinin is a prototypical example. Despite programs that have dramatically increased vaccination rates over the past 30 years, influenza remains a leading cause of morbidity and mortality among the elderly. This is in part due to a reduced vaccine response in elderly recipients. Some have suggested improving annual vaccine responses by using thymosin alpha 1 as an adjunct to influenza vaccination to activate T cell responses in the elderly, but this has not gained practical support (Ershler, Gravenstein, and Geloo 2007).

[0006] Another approach to improving influenza vaccines is to include adjuvants: substances that enhance the immune response. Adjuvants are particularly beneficial for influenza vaccines administered during pandemics when a rapid response is needed, or for use in patients with impaired immune responses, such as infants and the elderly. Tregoning et al. (Tregoning, Russell, and Kinnear 2018) reviewed the current use of adjuvants in human influenza vaccines, including what is known about adjuvants, why they are used, and their mechanism of action. To date, six adjuvants have been used in licensed human vaccines: Alum, MF59, AS03, AF03, virosomes, and heat-labile enterotoxin (LT).

[0007] Still others aim to deviate from selecting a different vaccine virus each year and instead immunize using a universal influenza vaccine to protect against all or most influenza subtypes. The basic principle of such a desired universal influenza vaccine is based on conserved antigens found in most influenza strains, such as matrix 2, nucleocapsid, matrix 1, and the stem of the hemagglutinin protein. These antigens can induce cross-protective immunity against different influenza strains. Many researchers have attempted to generate conserved epitopes of these antigens in the form of peptides in the hope of creating universal influenza vaccine candidates that can broadly induce cross-reactive protection against influenza virus infection, but to date, such efforts have largely failed. Therefore, various strategies, such as combining peptides as multi-epitope vaccines or presenting peptides via vaccinia virus particles, are undergoing clinical trials (Romeli, Hassan, and Yap 2020).

[0008] Sheik et al. (Bioinformatics. 2016 Nov 1;32(21):3233-3239) is an in silico exercise that is said to aid in vaccine design, but none of their proposals lack in vitro or in vivo data that could demonstrate antigenicity or immunogenicity. Although often used interchangeably, the terms immunogenicity and antigenicity have different meanings. The term immunogenicity refers to the ability of a substance to aid and induce cells of the immune system to elicit a cellular and / or humoral immune response, while antigenicity is the ability to be specifically recognized by an immune response or immunological activity against a given substance. While all immunogenic substances are antigenic by default, not all antigenic substances are immunogenic, not all are immunogenic in different hosts, such as mice or humans, or in males or females of various genetic backgrounds. In particular, MHC I processing of proteins or polypeptides depends on the host's genetic background (i.e., HLA haplotype), rendering some antigenic substances immunogenic in some hosts and non-immunogenic in others. Complicating matters, the immune response often relies on specific proteolytic processing of antigenic polypeptides in the proteasome of lysosomes to reach the desired immunogenic substance. To facilitate such processing or degradation, cells often attach degradation signals (degrons) to such polypeptides to facilitate routing to the proteasome or lysosome. In line with the above, an antigenic determinant is defined herein as a site on the surface of an antigen molecule to which a single antibody molecule or T cell binds. Generally, an antigen has several or many different antigenic determinants and reacts with many different antibodies or cells. An antigenic determinant is also called an epitope. An immunogenic determinant is the part of an immunogenic molecule that interacts with T cells to induce or elicit an immune response, and thus reflects the host's action potential to induce the immune response itself.Sheik et al. designed, but did not construct or test, two epitope ensemble vaccine (antigenic in their own right) designs containing influenza A epitopes as putative nonseasonal influenza vaccines; one specifically targeted to the US population, the other meant to be a universal vaccine. The purported US-specific vaccine contained six CD8+ T cell epitopes (among them SEQ ID NO:5 (GILGFVFTL) and SEQ ID NO:8 (FMYSDFHFI)) and three CD4+ epitopes. The purported universal vaccine contained eight CD8+ epitopes: (among them SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:5 (GILGFVFT), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:10 (VSDGGPNLY), and SEQ ID NO:14 (YSHGTGTGY)) and again three CD4+ epitopes. It is suggested that the epitopes may be delivered as polyepitopic peptide(s) or as part of a viral vector. No spacer or linker sequences were attached or provided, nor was a degron, such as ubiquitin, attached or provided in the construct design. Sheik et al. Sheik et al. do not disclose whether their ensemble designs are sufficiently antigenic to be recognized by cells of the immune system, or whether they can be used as immunogenic substances to initiate the desired immune response required for an actual vaccine substance.

[0009] Nielsen et al. (Journal of Immunological Methods 360 (2010) 149-156) did not aim to develop a vaccine, but rather to develop a method to confirm the presence and detectability of CEF virus-specific CD8+ T cells in PBMCs. For this purpose, Nielsen et al. provided an antigen combination of 32 different HLA-1-restricted epitopes of the widely used CEF (cytomegalovirus, Epstein-Barr virus, and influenza virus) positive control peptide pool in a single polyepitope construct presented by mRNA (hence the name CEF-Polypeptide 32 Construct) (among these epitopes are SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), and SEQ ID NO:10 (VSDGGPNLY)), which was used as a positive control pool antigen to test the general presence of CEF virus-specific CD8 T cells. No specific spacer or linker sequences were provided, and the CEF construct epitopes were presented in the context of their simple viral sequences, with three amino acids of heterologous endogenous flanking sequences at the N- and C-termini of each epitope, thereby increasing the risk of neoepitope formation rather than reducing it with appropriate spacers or linkers. Ubiquitin was not conjugated to or provided with the construct. The extent of interferon-gamma (IFNγ) secretion by influenza virus-specific CD8+ CTLs of influenza virus-derived epitopes was not provided, nor was the degree of antigenic conservation of all epitopes in the pool investigated by Nielsen et al. The goal of Nielsen et al. was to provide an antigenic determinant tool for assessing MHC class I processing, regardless of HLA haplotype, not to develop a universal influenza vaccine. Indeed, Nielsen et al. did not disclose whether the diagnostic tool itself is immunogenic.

[0010] As another example of the many epitope proposals that have hindered the understanding of this field without providing sufficient guidance to arrive at the desired universal vaccine, recently (Sharma et al. 2021) suggested an in silico conceptual framework to arrive at a multi-epitope influenza subunit vaccine based on highly conserved antigenic determinants of the virus or epitope sequences of rapidly evolving (HA), moderately evolving (NP) and slowly evolving (M1) proteins. The vaccine grand design includes two peptide adjuvants, 26 diverse cytotoxic T cell (CTL) epitopes, nine helper T cell (HTL) epitopes, and seven linear B cell lymphocyte (BCL) epitopes for inducing innate, cellular, and humoral immune responses against influenza A virus. Three of the 26 CTL epitopes, SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 17 (LLTEVETYV), and SEQ ID NO: 18 (MVLASTTAK), are found in M1, and one of the 26, SEQ ID NO: 15 (HSNLNDATY), is found in NP. Degrons such as ubiquitin are neither attached nor provided. Again, this concept requires experimental validation. The required experimental work may include the synthesis of a bulky engineered subunit vaccine, followed by in vitro and in vivo analysis to determine its immunogenicity and delivery to induce a protective immune response. Formulation, product stability, safety, and protocols for immunization with such large vaccine constructs are also important aspects to consider. In short, Sharma et al. do not disclose whether their ensemble designs are sufficiently antigenic to be recognized by cells of the immune system, or (even better) whether they can be used as immunogenic substances to initiate the desired immune response required for an actual vaccine substance (see also Table 9 herein).

[0011] Multimeric-001 (M-001) is an example of a synthetic peptide vaccine based on nine conserved immunogenic epitopes from the HA, NP, and M1 proteins of influenza A and B strains. The M-001 vaccine consists of three repeats of nine conserved linear epitopes formulated as a single recombinant protein. These epitopes are thought to induce humoral and cellular immune responses (Atsmon et al. 2012). This peptide-based universal influenza vaccine candidate, which is said to induce T cell immunity, completed phase I and II trials but failed to demonstrate any efficacy in primary outcome studies (Atsmon et al. 2012; van Doorn et al. 2017). Indeed, the ability of peptide vaccines to alter and reduce the functionality of T cells, particularly regulatory T cells (Tregs), has been previously observed (Leggatt 2014), and data from various studies demonstrate that low peptide doses induce high T cell avidity, while high or repeated peptide concentrations can favor low avidity T cells and inhibit the T cell proliferative responses necessary to induce vaccine efficacy (Corradin, Etlinger, and Chiller 1977). This may also affect the available T cell repertoire in vivo and subsequent pathogen clearance. Such high- and low-range tolerance following immunization with different doses of antigen is typically considered to require empirical determination (Corradin, Etlinger, and Chiller 1977).

[0012] Stambas et al (Pharmacol Ther. 2008 Nov;120(2):186-96) review our understanding of influenza virus-specific CD8+ T cell immunity in experimental mouse models and humans. The characteristics and nature of CD8+ T cell killing are discussed, as are the selection and maintenance of influenza-specific effector and memory repertoires. Potential future vaccine strategies and the effects of aging are considered. It is hypothesized that understanding the intricacies of CD8+ T cell-mediated immunity and memory has the potential to improve vaccine design, particularly to combat pandemics caused by newly emerging influenza viruses. The review reviews various CD8+ T cell epitopes, inter alia, SEQ ID NO: 1 (ILRGSVAHK), SEQ ID NO: 2 (ELRSRYWAI), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 4 (CTELKLSDY), SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 6 (SIIPSGPLK), SEQ ID NO: 7 (ASCMGLIY), SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 10 (VSDGGPNLY), SEQ ID NO: 12 (NMLSTVLGV), and SEQ ID NO: 16 (RRSGAAGAAVK). How such epitopes can be used to design suitable cross-protective CTL-based vaccines remains undiscussed beyond consideration of using mixtures of dominant and subdominant epitopes in polypeptide-based vaccines as a strategy to confer cross-protective immunity, as previously discussed by Stoloff & Caparros-Wanderley (2007) and discussed below under FLU-v herein.

[0013] FLU-v is a synthetic polyepitope polypeptide vaccine composed of conserved T cell epitopes that specifically complement mouse MHC (H-2Kb) and human HLA (HLA-A*0201) (Stoloff and Caparros-Wanderley 2007). Initially, in animal studies (which have a different HLA system than humans), six polypeptides varying in polymer length (21–35 amino acids) were included in the FLU-v formulation. Two of these peptides were derived from influenza M2 and PB1 (containing SEQ ID NO: 12 (NMLSTVLGV) and SEQ ID NO: 13 (MMMGMFNML) respectively, without spacer or linker separation), while the other four peptides belonged to the M1 (containing SEQ ID NO: 5 (GILGFVFTL)) and NP (containing SEQ ID NO: 1 (ILRGSVAHK)) antigens, also without spacer or linker elements. Polypeptides are selected based on the following criteria: (i) they must be 40 amino acids or less in length; (ii) they must consist of at least five human T-cell epitopes; and (iii) there is a 10 to 10 probability that no peptide will contain at least one of the identified T-cell epitopes. -10However, the results of a human 2b study (EudraCT:2016-002134-74) using a freeze-dried vaccine composed of four short polypeptides: FLU-5 (32 aa), FLU-7 (21 aa), FLU-8N (20 aa), and FLU-10 (24 aa), derived from conserved regions in the internal proteins M1, NPA, NPB, and M2, respectively, demonstrated that this polyepitope peptide-based vaccine (in the absence of induction of an antibody response to HA) again failed to achieve efficacy and provided little protection against influenza (Pleguezuelos et al. 2020). Typically, a single-dose regimen showed some significant benefit over placebo-vaccinated subjects, and repeated vaccination with the four-polypeptide vaccine did not enhance protection as expected in practical use. In contrast, the efficacy of the two-dose regimen was not found to be statistically significantly different from placebo, and repeated vaccination with this four-polypeptide epitope prospective vaccine formulation is rarely used in practice. The authors conclude that formulations should continue to be evaluated and that T-cell immunity should be further investigated as a potentially useful correlate of protection against influenza virus infection.

[0014] Modified vaccinia Ankara (MVA) is an attenuated vaccinia virus that has been shown to prime T cell responses against its antigens. Given its promising adjuvant effect, MVA has been used as a vaccine carrier for malaria, human immunodeficiency virus (HIV), and tuberculosis vaccines. As a vaccine carrier, MVA offers several advantages, including: (i) an excellent safety profile in children and HIV-positive individuals; (ii) high stability; (iii) rapid stimulation of humoral and cellular responses; and (iv) various vaccination routes. Several MVA-based influenza vaccines have been developed and are undergoing rigorous testing. Among them, the MVA-NP+M1 vaccine (modified vaccinia Ankara expressing viral nucleoprotein and matrix protein 1) has reached the clinical trial stage. The aim of a recent 2b study was to evaluate whether inducing additional universal responses against the conserved CD4 and CD8 T cell antigens NP and M1 would provide additional benefits to standard influenza vaccination. However, this vaccine, designed to induce T cell responses against these cross-reactive internal proteins of influenza A, did not result in improved incidence when administered within 28 days of standard quadrivalent vaccine immunization (Evans et al. 2022). The trial was stopped after one season for futility, at the recommendation of a data monitoring committee.

[0015] Despite some of the advances mentioned above, there is no broad-spectrum influenza vaccine available for protection against influenza, indicating that there is no one-way street to achieve such a desired outcome. Mouse studies have done little to improve the chances for that one-way street scenario, and few models of transgenic human HLA expression in mice exist. Thus, in vivo studies in transgenic mice to identify T cell-mediated immunogenicity dependent on human MHC I processing activity are limited and far from sufficient to provide a complete picture of immunogenic activity in humans. [Prior art documents]

Non-licensed literature

[0016] [Non-licensed document 1] McElhaney 2011 [Non-licensed document 2] 'Antiviral drugs in influenza: an adjunct to vaccination in some situations'2006 [Non-licensed document 3] Ershler, Gravenstein, and Geloo 2007

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

[0017] Despite some of the advances mentioned above, there is no broad-spectrum influenza vaccine available for protection against influenza, indicating that there is no one-way street to achieve such a desired outcome. Mouse studies have done little to improve the chances for that one-way street scenario, and few models of transgenic human HLA expression in mice exist. Thus, in vivo studies in transgenic mice to identify T cell-mediated immunogenicity dependent on human MHC I processing activity are limited and far from sufficient to provide a complete picture of immunogenic activity in humans.

[0018] However, there remains a great need for influenza-specific antigenic preparations for the development of immunogens and vaccines that can result in the efficient induction of broad protective responses and thus provide protective immunity and therapeutic activity in the field of influenza control. [Means for solving the problem]

[0019] The present invention discloses a collection of antigenic and immunogenic determinant formulations with demonstrated antigenic and immunogenic potential that can address the need for broad protective responses to provide protective immunity and therapeutic activity in the field of influenza control. In addition, the present invention discloses a multi-epitope influenza A vaccine formulation for use in eliciting or inducing cross-protective immunity against different influenza strains, comprising at least five relatively conserved peptide (amino acid) sequences, each of which has been demonstrated to be capable of eliciting interferon-gamma (IFNγ) secretion by influenza virus-specific CD8+-CTLs.

[0020] In a first embodiment, to accommodate vaccination against currently circulating human viruses in humans and to provide the desired broad protection by providing conserved antigenic and immunogenic determinant peptides, SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY) derived from currently circulating human IAV strains at the forefront of a vaccine (see also Table 2 herein), the present invention discloses nucleic acids encoding at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells, having the amino acid sequences SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY). Such nucleic acids may be complemented with nucleic acids encoding at least five or ten influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:15 (HSNLNDATY), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:17 (LLTEVETYV), SEQ ID NO:18 (MVLASTTAK), SEQ ID NO:19 (RGINDRNFW), and SEQ ID NO:20 (FLLMDALKL).

[0021] To provide optimal release of epitope peptides from polyepitope constructs, regardless of their order of appearance in the polyepitope polypeptide, the nucleic acids encoding at least the disclosed SEQ ID NOs: 8 (FMYSDFHFI), 9 (FVRQCFNPM), 12 (NMLSTVLGV), 13 (MMMGMFNML), and 14 (YSHGTGTGY) are further provided with genetic information to provide appropriate spacer (linker) placement adjacent to the peptides (epitopes) (at the N- and C-termini), as well as genetic information to facilitate accurate and optimal cleavage of peptides from the polyepitope polypeptides of the present invention in the proteasome and prevent the generation of neoepitopes from adjacent epitope sequences, which can reduce vaccine efficacy (Schubert and Kohlbacher 2016). The selected epitopes are then used to construct an artificial gene encoding the polyepitope polypeptide sequence. To dock the polyepitope into the proteasome for optimal antigen processing, four different constructs were generated, with or without genetic information for a spacer (less or more supportive of epitope release) and with or without genetic information encoding a proteasome targeting signal (herein also identified as a degron ((Ravid and Hochstrasser 2008)). Here, we selected the spacer sequence AAY (Ismail, Ahmad, and Azam 2020) to evaluate the best requirements for optimal release of antigenic peptides from our polyepitope polypeptide constructs, and we found that by avoiding the dependency on the order of peptides within our polyepitope polypeptides, which may determine the cleavage probability in the proteasome, we resulted in a strong increase in the number of correctly cleaved epitopes and a decrease in neoimmunogenicity of the complete construct, along with the independent recovery and subsequent MHC binding of individual epitopes, regardless of the order in which they are located in the polyepitope construct. It was demonstrated that the protein can have I processing.The nucleic acids encoding at least the disclosed SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY) are further provided with genetic information encoding a proteasome targeting signal (also identified herein as a degron ((Ravid and Hochstrasser 2008)) to further improve the probability of proper targeting of the polyepitope polypeptide transcribable from the nucleic acid to and cleavage within the proteasome. Ravid and As discussed in detail by Hochstrasser, most short-lived proteins are distinguished by localization structural determinants ("signals") that target them to the ubiquitin ligase machinery or to the proteasome (or sometimes lysosome). A degradation signal or "degron" is usually defined as the minimal element within a protein sufficient for recognition and degradation by the proteolytic machinery. An important property of a degron is that it is transposable; i.e., the engineered attachment of such a sequence confers metabolic instability (shorter half-life) to an otherwise long-lived protein. To provide such a degron, the inventors herein selected ubiquitin, preferably placed N-terminally to the polyepitope polypeptide construct. Such nucleic acids disclosed herein may comprise DNA or RNA, or both, and may enable expression of the individual peptides having SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY) in cells or vaccinated subjects, thereby initiating an immune response and thereby providing antigenic and immunogenic determinant formulations.In a further embodiment, the present invention discloses a nucleic acid according to the invention further encoding five other influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said five other peptides encode epitopes having SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:2 (ELRSRYWAI) and SEQ ID NO:4 (CTELKLSDY).

[0022] In a further embodiment, the present invention provides the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGT The present invention discloses nucleic acids encoding at least 15, preferably at least 18, influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW) and SEQ ID NO: 20 (FLLMDALKL).

[0023] In a further embodiment, the present invention provides the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (NMLSTVLGV), SEQ ID NO:14 (NMLSTVLGV), SEQ ID NO:15 (NMLSTVLGV), SEQ ID NO:16 (NMLSTVLGV), SEQ ID NO:17 (NMLSTVLGV), SEQ ID NO:18 (NMLSTVLGV), SEQ ID NO:19 (NMLSTVLGV), SEQ ID NO:20 (NMLSTVLGV), SEQ ID NO:21 (NMLSTVLGV), SEQ ID NO:22 (NMLSTVLGV), SEQ ID NO:23 (NMLSTVLGV), SEQ ID NO:24 (NMLSTVLGV), SEQ ID NO:25 (NMLSTVLGV), SEQ ID NO:26 (NMLSTVLGV), SEQ ID NO:27 (NMLSTVLGV), SEQ ID NO:28 (NMLSTVLGV), SEQ ID NO:29 (NMLSTVLGV), SEQ ID NO:30 (NMLSTVLGV), SEQ ID NO:31 (NMLSTVLGV), SEQ ID NO:32 (NMLSTVLGV), SEQ ID NO:33 (NMLSTVLGV), SEQ ID NO:34 (NMLSTVLGV), SEQ ID NO:35 (NMLSTVLGV), SEQ ID NO:36 (NMLSTVLG Disclosed are nucleic acids according to the present invention encoding 20 of influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, having sequence number 13 (MMMGMFNML), sequence number 14 (YSHGTGTGY), sequence number 15 (HSNLNDATY), sequence number 16 (RRSGAAGAAVK), sequence number 17 (LLTEVETYV), sequence number 18 (MVLASTTAK), sequence number 19 (RGINDRNFW) and sequence number 20 (FLLMDALKL).

[0024] The present invention further discloses nucleic acids encoding at least six influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein the at least six peptides encode epitopes having SEQ ID NO: 4 (CTELKLSDY), SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), and SEQ ID NO: 14 (YSHGTGTGY). The disclosure further provides genetic information encoding a proteasome targeting signal (also identified herein as a degron (Ravid and Hochstrasser 2008)), which provides for proper targeting of a polyepitopic polypeptide transcribable from the nucleic acid to the proteasome and further improves the probability of cleavage therein. The nucleic acids disclosed herein may comprise DNA or RNA, or both, and may enable expression of the individual peptides, thereby providing antigenic and immunogenic determinant formulations.

[0025] The present invention further discloses nucleic acids encoding at least six influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, the at least six peptides having the epitopes SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), further provided with genetic information encoding appropriate spacing and degrons. Such nucleic acids disclosed herein may comprise DNA or RNA, or both, and may provide antigenic and immunogenic determinant formulations by enabling expression of the individual peptides.

[0026] The present invention further discloses nucleic acids encoding at least six influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, the at least six peptides having the epitopes SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), further provided with genetic information encoding appropriate spacing and degrons. Such nucleic acids disclosed herein may comprise DNA or RNA, or both, and may enable expression of the individual peptides, thereby providing antigenic and immunogenic determinant formulations.

[0027] The present invention further discloses nucleic acids encoding at least seven influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, the at least seven peptides having the following epitopes: SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), further provided with genetic information encoding appropriate spacing and degrons. The nucleic acids disclosed herein may comprise DNA or RNA, or both, and may provide antigenic and immunogenic determinant formulations by enabling expression of the individual peptides.

[0028] The present invention further discloses nucleic acids encoding at least seven influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, the at least seven peptides having the following epitopes: SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), further provided with appropriate spacing and genetic information encoding degrons. The nucleic acids disclosed herein may comprise DNA or RNA, or both, and may provide antigenic and immunogenic determinant formulations by enabling expression of the individual peptides.

[0029] The present invention further discloses nucleic acids encoding at least seven influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, the at least seven peptides having the following epitopes: SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), further provided with genetic information encoding appropriate spacing and degrons. The nucleic acids disclosed herein may comprise DNA or RNA, or both, and may provide antigenic and immunogenic determinant formulations by enabling expression of the individual peptides.

[0030] The present invention further discloses nucleic acids encoding at least eight influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, the at least eight peptides having the following epitopes: SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), further provided with genetic information encoding appropriate spacing and degrons. The nucleic acids disclosed herein may comprise DNA or RNA, or both, and may provide antigenic and immunogenic determinant formulations by enabling expression of the individual peptides.

[0031] The present invention further discloses nucleic acids encoding at least six other peptides derived from influenza A virus (IAV), encoding epitopes capable of inducing IFNγ by CD8+ T cells, the six other peptides having the following sequences: SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:2 (ELRSRYWAI), and SEQ ID NO:4 (CTELKLSDY). The disclosed nucleic acids further provide genetic information encoding appropriate spacing and degrons. The nucleic acids disclosed herein may comprise DNA or RNA, or both, and may provide antigenic and immunogenic determinant formulations by enabling expression of the individual peptides. In a further embodiment, the present invention discloses an RNA or DNA nucleic acid according to the present invention, wherein the peptide spacer comprises the tripeptide AAY.

[0032] In a further embodiment, the present invention discloses an RNA or DNA nucleic acid according to the present invention, wherein the degron comprises ubiquitin. In a further embodiment, the present invention discloses a nucleic acid, vector, virus, cell, or formulation comprising an RNA or DNA nucleic acid according to the present invention. In a further embodiment, the present invention discloses a protein formulation comprising a polyepitope polypeptide derived from a nucleic acid, vector, virus, or cell according to the present invention.

[0033] In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant preparation comprising at least five influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said at least five peptides encode epitopes having SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), wherein said polypeptides are further provided with suitable peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided. In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant formulation comprising at least six influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said at least six peptides encode epitopes having SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), wherein said polypeptides are further provided with suitable peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided.

[0034] In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant preparation comprising at least six influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said at least six peptides encode epitopes having SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), wherein said polypeptides are further provided with suitable peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided.

[0035] In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant formulation comprising at least six influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said at least six peptides encode epitopes having SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), wherein said polypeptides are further provided with suitable peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided.

[0036] In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant preparation comprising at least seven influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said at least seven peptides encode epitopes having SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), wherein said polypeptides are further provided with suitable peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided.

[0037] In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant formulation comprising at least seven influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said at least seven peptides encode epitopes having SEQ ID NO: 4 (CTELKLSDY), SEQ ID NO: 10 (VSDGGPNLY), SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), and SEQ ID NO: 14 (YSHGTGTGY), wherein said polypeptides are further provided with suitable peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided. In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant formulation comprising at least seven influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said at least seven peptides encode epitopes having SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), wherein said polypeptides are further provided with appropriate peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided.

[0038] In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant formulation comprising at least eight influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said at least eight peptides encode epitopes having SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), wherein said polypeptides are further provided with appropriate peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided.

[0039] In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant preparation according to the invention, further provided with five additional influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said additional five peptides encode epitopes having SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:2 (ELRSRYWAI), and SEQ ID NO:4 (CTELKLSDY), wherein said polypeptides are further provided with suitable peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided.

[0040] In a further embodiment, the present invention discloses a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant preparation according to the invention, further provided with six more influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein said six more peptides encode epitopes having SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:2 (ELRSRYWAI), and SEQ ID NO:4 (CTELKLSDY), wherein said polypeptides are further provided with suitable peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein degrons are provided.

[0041] In a further embodiment, the present invention provides the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY), SEQ ID NO:15 Disclosed is a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant formulation according to the present invention comprising at least 15, preferably at least 18, Influenza A virus (IAV) derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the following sequence: (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW) and SEQ ID NO: 20 (FLLMDALKL).

[0042] In a further embodiment, the present invention provides the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML).

[0013] Disclosed is a synthetic polyepitope polypeptide and / or antigenic and immunogenic determinant formulation according to the present invention comprising 20 of influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, having SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW) and SEQ ID NO: 20 (FLLMDALKL).

[0043] In a further embodiment, the present invention discloses antigenic and immunogenic determinant preparations comprising a nucleic acid according to the invention, or comprising a vector, virus, cell or preparation according to the invention, or comprising a protein preparation according to the invention or a synthetic polyepitope polypeptide according to the invention.

[0044] In a further embodiment, the present invention discloses an immunogenic formulation comprising a nucleic acid formulation according to the invention, or a protein formulation according to the invention, or a synthetic polyepitopic polypeptide according to the invention. In a further embodiment, the present invention discloses a vaccine formulation obtainable by mixing an antigenic and immunogenic determinant formulation according to the invention and / or an immunogenic formulation according to the invention with a pharmaceutically acceptable excipient.

[0045] In a further embodiment, the present invention discloses a vaccine formulation according to the invention for use in vaccination, preferably annually, together with, or in addition to, or preferably simultaneously with, vaccination with a vaccine aimed at generating a humoral vaccine response against influenza virus hemagglutinin protein.

[0046] In a further embodiment, the present invention provides the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (MMMGMFNML), SEQ ID NO:15 (MMMGMFNML), SEQ ID NO:16 (MMMGMFNML), SEQ ID NO:17 (MMMGMFNML), SEQ ID NO:18 (MMMGMFNML), SEQ ID NO:19 (MMMGMFNML), SEQ ID NO:20 (MMMGMFNML), SEQ ID NO:21 (MMMGMFNML), SEQ ID NO:22 (MMMGMFNML), SEQ ID NO:23 (MMMGMFNML), SEQ ID NO:24 (MMMGMFNML), SEQ ID NO:25 (MMMGMFNML), SEQ ID NO:26 (MMMGMFNML), SEQ ID NO:27 (MMMGMFNML), SEQ ID NO:28 (MMMGMFNML), SEQ ID NO:29 (MMMGMFNML), SEQ ID NO:30 (MMMGMFNML), SEQ ID NO:31 (MMMGMFNML), SEQ ID NO:32 (MMMGMFNML), SEQ ID NO:33 (MMMGMFNML), SEQ ID NO:34 (MMMGMFNML), SEQ ID NO:35 (MMMGMFNML), SEQ ID NO:36 (MMMGMFN Disclosed herein are nucleic acids encoding at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW), and SEQ ID NO: 20 (FLLMDALKL) (see also Table 1). Such nucleic acids provided herein may comprise DNA or RNA, or both, and may function as antigenic and immunogenic determinant formulations by enabling expression of the peptides in cells or in vaccinated subjects to initiate an immune response.

[0047] In a preferred embodiment, to accommodate vaccination against currently circulating human viruses in humans and to provide the desired broad protection by providing conserved antigenic and immunogenic determinant peptides, SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), derived from currently circulating human IAV strains at the forefront of a vaccine (see also Table 2 herein), the present invention discloses nucleic acids encoding at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells, having the amino acid sequences SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY). Such nucleic acids may be complemented with nucleic acids encoding at least five or ten influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:15 (HSNLNDATY), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:17 (LLTEVETYV), SEQ ID NO:18 (MVLASTTAK), SEQ ID NO:19 (RGINDRNFW), and SEQ ID NO:20 (FLLMDALKL).

[0048] In a further preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 4 (CTELKLSDY) (see also Table 5). In yet another preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 10 (VSDGGPNLY), SEQ ID NO: 1 (ILRGSVAHK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 3 (SRYWAIRTR) (see also Table 6), to provide a vaccine with further improved HLA coverage. In yet another preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the amino acid sequences SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:20 (FLLMDALKL), SEQ ID NO:2 (ELRSRYWAI), and SEQ ID NO:3 (SRYWAIRTR) (see also Table 7) to provide a vaccine response directed against a broad group of viral proteins. Such nucleic acids provided herein may comprise DNA or RNA or both and may function as antigenic and immunogenic determinant formulations by enabling expression of the peptides in cells or in the vaccinated subject.

[0049] In another preferred embodiment, the present invention discloses nucleic acids encoding at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells, having the amino acid sequences SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY), and SEQ ID NO:15 (HSNLNDATY), corresponding to providing conserved antigenic and immunogenic determinant peptides derived from currently circulating porcine IAV strains (see also Table 3 herein) at the forefront of a potent vaccine, for example, to accommodate vaccination against currently circulating porcine viruses in pigs and provide broad protection. Such nucleic acids may be complemented with nucleic acids encoding at least five or ten influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:17 (LLTEVETYV), SEQ ID NO:18 (MVLASTTAK), SEQ ID NO:19 (RGINDRNFW), and SEQ ID NO:20 (FLLMDALKL).In a further preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 4 (CTELKLSDY) (see also Table 5). In yet another preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 10 (VSDGGPNLY), SEQ ID NO: 1 (ILRGSVAHK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 3 (SRYWAIRTR) (see also Table 6), to provide a vaccine with further improved HLA coverage. In yet another preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the amino acid sequences SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:20 (FLLMDALKL), SEQ ID NO:2 (ELRSRYWAI), and SEQ ID NO:3 (SRYWAIRTR) (see also Table 7) to provide a vaccine response directed against a broad group of viral proteins. Such nucleic acids provided herein may comprise DNA or RNA or both and may function as antigenic and immunogenic determinant formulations by enabling expression of the peptides in cells or in the vaccinated subject.

[0050] In another preferred embodiment, the present invention discloses nucleic acids encoding at least six influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells, having the amino acid sequences SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY), and SEQ ID NO:15 (HSNLNDATY), derived from currently circulating human and swine IAV strains, to accommodate vaccination against swine influenza A viruses likely circulating in humans and provide the desired additional protection (see also Tables 2 and 3 herein). In a further preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 4 (CTELKLSDY) (see also Table 5). Such nucleic acids provided herein may comprise DNA or RNA or both and may function as antigenic and immunogenic determinant formulations by enabling expression of the peptides in cells or in the vaccinated subject.

[0051] In another preferred embodiment, the present invention discloses nucleic acids encoding at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells, having the amino acid sequences SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:14 (YSHGTGTGY), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:12 (NMLSTVLGV), and SEQ ID NO:19 (RGINDRNFW), corresponding to providing conserved antigenic and immunogenic determinant peptides from currently circulating avian IAV strains (see also Table 4 herein) at the forefront of a vaccine, for example, to accommodate vaccination against currently circulating avian viruses in birds and to provide broad protection. Such nucleic acids may be complemented with nucleic acids encoding at least five or ten influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:15 (HSNLNDATY), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:17 (LLTEVETYV), SEQ ID NO:18 (MVLASTTAK), and SEQ ID NO:20 (FLLMDALKL).In a further preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 4 (CTELKLSDY) (see also Table 5). In yet another preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 10 (VSDGGPNLY), SEQ ID NO: 1 (ILRGSVAHK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 3 (SRYWAIRTR) (see also Table 6), to provide a vaccine with further improved HLA coverage. In yet another preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the amino acid sequences SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:20 (FLLMDALKL), SEQ ID NO:2 (ELRSRYWAI), and SEQ ID NO:3 (SRYWAIRTR) (see also Table 7) to provide a vaccine response directed against a broad group of viral proteins. Such nucleic acids provided herein may comprise DNA or RNA or both and may function as antigenic and immunogenic determinant formulations by enabling expression of the peptides in cells or in the vaccinated subject.

[0052] In another preferred embodiment, the present invention discloses nucleic acids encoding at least six influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells, having the amino acid sequences SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY), and SEQ ID NO:19 (RGINDRNFW), derived from currently circulating human and avian IAV strains, to accommodate vaccination against avian influenza A viruses likely circulating in humans and provide the desired additional protection (see also Tables 2 and 4 herein). In a further preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 4 (CTELKLSDY) (see also Table 5). Such nucleic acids provided herein may comprise DNA or RNA or both and may function as antigenic and immunogenic determinant formulations by enabling expression of the peptides in cells or in the vaccinated subject.

[0053] In another preferred embodiment, the present invention discloses nucleic acids encoding at least seven influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells, having the amino acid sequences SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY), SEQ ID NO:15 (HSNLNDATY), and SEQ ID NO:19 (RGINDRNFW), derived from currently circulating human, swine, and avian IAV strains, to accommodate vaccination against swine or avian influenza A viruses likely circulating in humans and to provide the desired additional protection (see also Tables 2, 3, and 4 herein). In a further preferred embodiment, the present invention discloses complementing the nucleic acids provided herein with nucleic acids of at least five influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 4 (CTELKLSDY) (see also Table 5). Such nucleic acids provided herein may comprise DNA or RNA or both and may function as antigenic and immunogenic determinant formulations by enabling expression of the peptides in cells or in the vaccinated subject.

[0054] In a further embodiment, the present invention provides the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY), SEQ ID NO:15 (HSNLNDATY), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:17 (LLTEVETYV), SEQ ID NO:18 (MVLASTTAK), SEQ ID NO:19 (RGINDRNFW) and SEQ ID NO:20 (FLL Further provided are nucleic acids encoding at least 10 of influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the following HLA binding domains: IAV-derived peptides ...

[0055] In a still further embodiment, the present invention relates to a peptide from the group of peptides capable of inducing IFNγ by CD8+ T cells having the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY), SEQ ID NO:15 (HSNLNDATY), SEQ ID NO:16 (RRSGAAGAAVK), SEQ ID NO:17 (LLTEVETYV), SEQ ID NO:18 (MVLASTTAK), SEQ ID NO:19 (RGINDRNFW) and SEQ ID NO:20 (FLLMDALKL). Further provided are nucleic acids encoding at least 15 selected influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells, see e.g., Table 8, where a selection of nucleic acids encoding 15 antigenic and immunogenic determinant peptides (SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY), and SEQ ID NO:15 (HSNLNDATY)) already provides greater than 99.5% HLA coverage.

[0056] In a further preferred embodiment, the present invention provides 20 influenza A virus (IAV) derived peptides capable of inducing IFNγ by CD8+ T cells, in particular the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (VSDGGPNLY), SEQ ID NO:12 (VSDGGPNLY), SEQ ID NO:13 (VSDGGPNLY), SEQ ID NO:14 (VSDGGPNLY), SEQ ID NO:15 (VSDGGPNLY), SEQ ID NO:16 (VSDGGPNLY), SEQ ID NO:17 (VSDGGPNLY), SEQ ID NO:18 (VSDGGPNLY), SEQ ID NO:19 (VSDGGPNLY), SEQ ID NO:20 (VSDGGPNLY), SEQ ID NO:21 (VSDGGPNLY), SEQ ID NO:22 (VSDGGPNLY), SEQ ID NO:23 (VSDGGPNLY), SEQ ID NO:24 (VSDGGPNLY), SEQ ID NO:25 (VSDGGPNLY), SEQ ID NO:26 (VSDGGPNLY), SEQ ID NO:27 (VSDGGPNLY), SEQ ID NO:28 (VSDGGPNLY), SEQ ID NO:29 (VSDGGPNLY), SEQ ID NO:30 (VSDGGPNLY), SEQ ID NO:31 (VSDGGPNLY), SEQ ID NO:32 (VSDGGPNLY), SEQ ID NO:33 (VSDGGPNLY), SEQ ID NO:34 (V Further provided are nucleic acids encoding antigenic preparations encoding peptides capable of inducing IFNγ by CD8+ T cells having SEQ ID NO: 11 (FLKDVMESM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW) and SEQ ID NO: 20 (FLLMDALKL), see, e.g., Table 8 and Figure 6.

[0057] In a further preferred embodiment, the present invention discloses a nucleic acid encoding an antigenic preparation comprising a nucleic acid according to Figure 6A.

[0058] In a further preferred embodiment, the present invention discloses a nucleic acid encoding an antigenic preparation comprising a nucleic acid according to Figure 6B.

[0059] In a further preferred embodiment, the present invention discloses a nucleic acid encoding an antigenic preparation comprising a nucleic acid according to Figure 6C.

[0060] In a further preferred embodiment, the present invention discloses a nucleic acid encoding an antigenic preparation comprising a nucleic acid according to Figure 6D.

[0061] In a further preferred embodiment, the present invention discloses a proteinaceous agent at least partially encoded by a nucleic acid encoding an antigenic preparation comprising a nucleic acid according to Figure 6A.

[0062] In a further preferred embodiment, the present invention discloses a proteinaceous agent at least partially encoded by a nucleic acid encoding an antigenic preparation comprising a nucleic acid according to Figure 6B.

[0063] In a further preferred embodiment, the present invention discloses a proteinaceous agent at least partially encoded by a nucleic acid or antigenic preparation comprising a nucleic acid according to Figure 6C.

[0064] In a further preferred embodiment, the present invention discloses a proteinaceous agent at least partially encoded by a nucleic acid encoding an antigenic preparation comprising a nucleic acid according to Figure 6D.

[0065] In a further preferred embodiment, the present invention discloses an antigenic preparation comprising a proteinaceous material at least partially encoded by a nucleic acid encoding the antigenic preparation comprising a nucleic acid according to Figure 6A.

[0066] In a further preferred embodiment, the present invention discloses an antigenic preparation comprising a proteinaceous material at least partially encoded by a nucleic acid encoding the antigenic preparation comprising a nucleic acid according to Figure 6B.

[0067] In a further preferred embodiment, the present invention discloses an antigenic preparation comprising a proteinaceous material at least partially encoded by a nucleic acid encoding the antigenic preparation comprising a nucleic acid according to Figure 6C.

[0068] In a further preferred embodiment, the present invention discloses an antigenic preparation comprising a proteinaceous material at least partially encoded by a nucleic acid encoding the antigenic preparation comprising a nucleic acid according to Figure 6D.

[0069] The present invention also provides nucleic acid vectors (such as pCAGGS as shown herein in the detailed description) comprising a nucleic acid according to the invention. The present invention also provides viruses comprising a nucleic acid according to the invention. The present invention also provides cells comprising a nucleic acid or vector or virus according to the invention. The present invention also provides nucleic acid formulations, such as DNA or RNA vaccine formulations (see, e.g., (Leitner, Ying, and Restifo 1999)), comprising a nucleic acid or vector or virus according to the invention. The present invention also provides protein formulations comprising a polyepitopic polypeptide derived from a nucleic acid or vector or virus or cell according to the invention.

[0070] The present invention also relates to the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY), SEQ ID NO:15 (HSNLND The present invention provides a synthetic polyepitope polypeptide or antigenic and immunogenic determinant preparation comprising at least five, preferably at least ten, and more preferably at least fifteen influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the following sequence: SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW), and SEQ ID NO: 20 (FLLMDALKL).Such polyepitopic peptides include, for example, conserved human IAV antigenic and immunogenic determinant peptides, SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), and SEQ ID NO: 14 (YSHGTGTGY), or porcine IAV antigenic and immunogenic determinant peptides, SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNM L), SEQ ID NO: 14 (YSHGTGTGY) and SEQ ID NO: 15 (HSNLNDATY), or avian IAV antigenic and immunogenic determinant peptides, SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO: 13 (MMMGMFNML), SEQ ID NO: 12 (NMLSTVLGV) and SEQ ID NO: 19 (RGINDRNFW), or SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), SEQ ID NO: 14 (YSHGTGTGY) and SEQ ID NO: 15 (HSNLNDATY), or SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), SEQ ID NO: 14 (YSHGTGTGY) and SEQ ID NO: 19 (RGINDRNFW), or SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 12 (NMLSTVLG V), SEQ ID NO: 13 (MMMGMFNML), SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO: 15 (HSNLNDATY), and SEQ ID NO: 19 (RGINDRNFW), or the immunodominant amino acid sequences SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 4 (CTELKLSDY), or another selection of at least five peptides selected from Table 1. Peptide synthesis is well known in the art (see, e.g., (Stawikowski and Fields 2012)).The present invention also provides the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY The present invention provides a synthetic polyepitope polypeptide or antigenic and immunogenic determinant preparation comprising at least 10 influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the following sequence: SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW), and SEQ ID NO: 20 (FLLMDALKL).

[0071] The present invention also provides the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), SEQ ID NO:14 (YSHGTGTGY The present invention provides a synthetic polyepitope polypeptide or antigenic and immunogenic determinant preparation comprising at least 15 influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the following sequence: SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW), and SEQ ID NO: 20 (FLLMDALKL).

[0072] The present invention also provides antigenic and immunogenic determinant or immunogenic preparations comprising a nucleic acid according to the present invention, or comprising a virus according to the present invention, or comprising a cell according to the present invention, or comprising a protein preparation according to the present invention, or a synthetic polyepitope polypeptide or antigenic and immunogenic determinant preparation according to the present invention (see for example Figures 2 and 3, in which various constructs (polyepitope, polyepitope with a spacer, polyepitope with ubiquitin, and polyepitope with a spacer and ubiquitin) activated specific T cells and IFN-γ secretion). The present invention also provides immunogenic preparations comprising a nucleic acid preparation according to the present invention, or a protein preparation according to the present invention, or a synthetic polyepitope polypeptide or antigenic and immunogenic determinant preparation according to the present invention, and provides vaccine preparations obtainable by mixing the antigenic and immunogenic determinant preparation according to the present invention and / or the immunogenic preparation according to the present invention with a pharmaceutically acceptable excipient.

[0073] The present invention also provides a vaccine formulation according to the invention for use in, preferably annual vaccination, together with, or in addition to, or preferably simultaneously with, vaccination with a vaccine aimed at generating a humoral vaccine response against influenza virus hemagglutinin proteins. In a preferred embodiment, in order to improve and provide alternative influenza vaccines with efficacy in situations of relative mismatch between circulating influenza strains and the vaccine strains used, the inventors propose vaccination with an influenza vaccine in addition to, or preferably simultaneously with, annual vaccination with a trivalent or tetravalent vaccine directed towards a humoral vaccine response against the hemagglutinin proteins. The influenza vaccine induces an immune response to conserved influenza virus antigens, particularly those derived from the amino acid sequences SEQ ID NO:1 (ILRGSVAHK), SEQ ID NO:2 (ELRSRYWAI), SEQ ID NO:3 (SRYWAIRTR), SEQ ID NO:4 (CTELKLSDY), SEQ ID NO:5 (GILGFVFTL), SEQ ID NO:6 (SIIPSGPLK), SEQ ID NO:7 (ASCMGLIY), SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:10 (VSDGGPNLY), SEQ ID NO:11 (FLKDVMESM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML). Preferably, the immune response is induced by providing said vaccine comprising an immunogenic formulation capable of eliciting an immune response in vivo against a peptide capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having the following sequence: SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW), and SEQ ID NO: 20 (FLLMDALKL). Preferably, said response is a cellular immune response, complemented by a humoral response, for example, directed against variable hemagglutinin. The most preferred cellular immune response induced is a CD8+-CTL response as provided herein. [Brief explanation of the drawings]

[0074]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 6A

Figure 6B

Figure 6C

Figure 6D

Figure 7

[0033] Figure 1 shows a diagram of polyepitope constructs cloned into pCAGGS and MVA, useful as antigenic and immunogenic determinant preparations. Using our pCAGGS expression plasmid, we observed IFN-γ responses in enriched T cell populations for all four epitopes tested, indicating that the epitopes could be released from the polyepitope construct and presented to specific T cells. Using our MVA construct, we observed IFN-γ responses in enriched T cell populations only for the construct with ubiquitin and a spacer, indicating that the epitopes could be released from the polyepitope construct and presented to specific T cells. With MVA, we were only able to construe and test two constructs.

Figure 8

Figure 9

Figure 10

Figure 11

[0075] Influenza viruses cause mild epidemics every year and occasionally cause pandemics with millions of deaths. Currently, there is no vaccine effective against all influenza strains. Extensive genetic variability and continuous evolution allow viruses to evade host immunity, necessitating annual renewal of seasonal vaccines. Because the majority of virus-specific T cells, particularly CD8+ cytotoxic T lymphocytes (CTLs), are directed against relatively conserved viral proteins such as nucleoprotein (NP) and matrix 1 protein (M1), it has been suggested decades ago that virus-specific CTLs may contribute to heterosubtypic immunity (Effros et al. 1977). The most important mode of action of virus-specific CTLs is the recognition and elimination of virus-infected cells, thus preventing the production of progeny viruses. Therefore, the presence of pre-existing T cell immunity leads to more rapid clearance of viral infections. The key to heterosubtypic immunity is that CTLs are cross-reactive and recognize epitopes shared by different influenza A virus subtypes. The effector functions of CTLs involved in the elimination of virus-infected cells include the release of perforin and granzymes from their granules and Fas / FasL interaction with infected target cells. Furthermore, upon activation, virus-specific CD8 + T cells can produce a variety of different cytokines, including IFN-γ and TNF-α. Virus-specific CTLs have been shown to recognize viral peptides, generated by endogenous antigen processing pathways and ultimately presented by MHC class I molecules on the surface of antigen-presenting cells or virus-infected cells, via their receptors (Zammit et al. 2005). By specifically focusing on the induction of CD8+ CTL responses, the present invention avoids the reduced efficacy observed, for example, with polypeptide epitope vaccine formulations M-001 and FLU-v.

[0076] Production of recombinant viruses. The coding sequences for each of the 20 selected epitopes (peptide sequences are shown in single-letter amino acid code; see Table 1) and the spacers between epitopes are constructed in silico. For efficient transcription and / or translation, these are preferably modified by introducing silent mutations to remove the guanine or cytosine orphans and the vaccinia virus-specific early transcription termination signal and to add a C-terminal HA tag sequence encoding nine amino acids (SEQ ID NO: 21 (YPYDVPDYA), amino acids 98-106 derived from influenza virus). Ubiquitin can also be added to the N-terminus in the polyepitope construct. cDNA is generated by DNA synthesis and cloned into a vector such as the MVA transfer plasmid pIIIH5red under the transcriptional control of the synthetic vaccinia virus early / late promoter PmH5 (Song et al. 2013). MVA (clonal isolate MVA-F6) can be propagated in CEFs under serum-free conditions and used as a non-recombinant backbone virus to construct MVA vector viruses expressing the desired polyepitope gene sequence. To obtain a vaccine preparation, the recombinant polyepitope can be amplified, for example, on CEF monolayers, purified by ultracentrifugation on a sucrose bed, and reconstituted into a high-titer stock preparation. PFUs can be counted to determine the viral titer.

[0077] Research Subjects Blood obtained from healthy blood donors will be used in the first study. Blood samples were collected from the blood bank of Hannover Medical School (Medizinische Hochschule Hannover, MHH) between April and August 2019. The use of blood for scientific purposes was approved by the local MHH ethics committee, subjects gave written informed consent, and data were used in anonymized form. The work described here was conducted in accordance with the World Medical Association Code of Ethics (Declaration of Helsinki).

[0078] Cell culture. Chicken embryo fibroblasts (CEF or CEF cells) were isolated from 10-day-old chicken embryos (Valo BioMedia GmbH, Germany) and passaged once before use. CEFs were cultured in Eagle's minimum essential medium (MEME; Sigma) containing Earle's salts, L-glutamine, and sodium bicarbonate, supplemented with 10% FBS, 1% penicillin and streptomycin (P / S), and 1% non-essential amino acids (NEAA). A549 cells were cultured in F-12K nutrient mixture (Gibco) supplemented with 10% FBS, 1% P / S, and 1% Glutamax. Transgenic A549 cells were cultured in F-12K nutrient mixture (Gibco) supplemented with 10% FBS, 1% P / S, 1% Glutamax, and 1 μg / ml puromycin. All cell lines were cultured at 37°C in 5% CO2.

[0079] Isolation of PBMCs Peripheral blood mononuclear cells (PBMCs) are isolated from peripheral blood by density gradient centrifugation (lymphocytes; stem cells) according to the manufacturer's instructions. Cells are isolated, then counted and frozen in 90% fetal bovine serum (FBS, Thermo Fisher Scientific), 10% dimethyl sulfoxide (DMSO, Carl Roth), and stored frozen in liquid nitrogen or at -150°C until use. PBMCs are thawed in complete RPMI 1640 medium supplemented with penicillin / streptomycin, Glutamax, vitamins, non-essential amino acids, sodium pyruvate (all 1% v / v, Thermo Fisher Scientific), 10% (v / v) heat-inactivated fetal bovine serum (FBS; Gibco Thermo Fisher Scientific) (R10F), and 50 μg / ml DNAse (Sigma-Aldrich).

[0080] Enrichment of peptide-specific CD8+ T cells. To enrich peptide-specific CD8+ T cells, peptide-specific T cells are expanded using PBMCs from healthy HLA-matched blood donors by incubation with 10 μM of the corresponding peptide at 37°C and 5% CO2. After 3 days, IL-2 is added. After 9 days of expansion, peptide-specific CD8+ T cells are detected by fluorescent dye-conjugated CD8+ staining and flow cytometry. By using CD8+ specific beads, we isolate CD8+ stained cells using magnetic activated cell sorting (MACS).

[0081] Detection of virus-specific T cells by IFN-γ ELISpot assay A human IFN-γ ELISpot kit (Mabtech) containing a 96-well precoated plate was used, and the assay was performed according to the manufacturer's instructions. Isolated CD8+ T cells were cocultured with infected or peptide-loaded HLA-transgenic A549 cells at 37°C and 5% CO2 for 20 hours, and IFN-γ secretion in response to peptide-specific T cell activation was measured by ELISpot. Transgenic A549 cells alone incubated with peptide or CD8+ T cells alone served as positive and negative controls, respectively. After color development, the plates were scanned, and spots were counted using an ImmunoSpot S6 Ultimate Reader and ImmunoSpot Software (version 7.0.20.0, Immunospot, CTL).

[0082] The Immune Epitope Database (IEDB (Bui et al. 2007)) contains 972 unique influenza virus CD8+ T cell epitopes (accessed September 2020). From these, 20 epitopes were selected based on the conservation of individual epitopes in influenza viruses from various hosts and the antigenicity of the identified epitopes.

[0083] -ability to direct IFN-gamma secretion by T cells As a minimum inclusion criterion, the antigenicity of the epitope (antigenic and immunogenic determinant) is confirmed by determining that peptides corresponding to the epitope expressed by the antigenic preparation are capable of inducing interferon-gamma (IFNγ) secretion by virus-specific CD8+ T cells, as demonstrated, for example, by IFNγ ELIspot assay or intracellular cytokine staining.

[0084] - Conservation of epitopes among human, avian and swine influenza A strains Because we aim for a universal vaccine, it is very important to select epitopes that are highly conserved not only in humans but also in other species. Humans can be infected with avian, swine, and other zoonotic influenza viruses, such as avian influenza virus subtypes A(H5N1), A(H7N9), and A(H9N2) and swine influenza virus subtypes A(H1N1), A(H1N2), and A(H3N2). Using the peptides in the current 20-epitope polyepitope construct, we performed sequence analysis and demonstrated the degree to which our peptides are conserved in human, avian, and swine influenza viruses.

[0085] Sequences collected from the NCBI influenza database -The range of matches within the human HLA system When T cells encounter an antigen, if they recognize it as a "normal antigen," nothing happens. However, if they recognize it as a foreign or pathological antigen, the T cells become activated. To be recognized by T cells, the antigen must be loaded onto a human leukocyte antigen (HLA) molecule. In humans, the vertebrate major histocompatibility complex (MHC), a group of cell surface proteins encoded by over 250 genes on chromosome 6, is called HLA. We all inherit several HLA genes from our parents. HLA types are not uniformly distributed across populations, as some HLA types are more frequent than others. For example: The HLA-A2 family is the largest allele family at the HLA-A locus (Bodmer et al. 1999).

[0086] Table 1. Epitopes listed from N- to C-terminus of the expressed polyepitope construct and HLA coverage and conservation of the epitopes in human, avian and porcine:

[0087] [Table 5] TIFF2025531437000007.tif227169TIFF2025531437000008.tif84169*Represents the percentage of viruses in the influenza virus sequence database (www.ncbi.nlm.nih.gov / genomes / FLU / Database / nph-select.cgi?go=database) that do not have any mutations in the epitope sequences shown. Duplicate sequences are excluded in this analysis.

[0088] HLA coverage in the world population: T cells can recognize peptides only when they are bound to HLA molecules. These peptide-HLA complexes interact only with HLA-matched T cells that have the corresponding receptors. To prepare a universal peptide-based vaccine, our main goal is to have very high HLA coverage. In the table below, the number of epitopes and their combined HLA coverage ranges can be seen as percentages. HLA coverage calculations are performed using the IEDB database.

[0089] Table 2 Set 1 According to the most conserved epitopes in humans from our list of 20 epitopes Three of the five epitopes are not only conserved in IAV but also in IBV. Providing good global population HLA coverage

[0090] [Table 6] TIFF2025531437000010.tif244168TIFF2025531437000011.tif42167

[0091] Table 3 Set 2 According to the most conserved epitopes in birds from our list of 20 epitopes Three of the five epitopes are not only conserved in IAV but also in IBV. Providing good global population HLA coverage

[0092] [Table 7] TIFF2025531437000013.tif237169TIFF2025531437000014.tif142168

[0093] Table 4 Set 3 - Based on the most conserved epitopes in pigs from our list of 20 epitopes Two of the five epitopes are not only conserved in IAV but also in IBV. Providing good global population HLA coverage

[0094] [Table 8] TIFF2025531437000016.tif34168

[0095] Table 5 Set 4 According to the immunodominance hierarchy of influenza A virus-specific CTLs (following (Boon et al. 2006))

[0096] [Table 9]

[0097] Table 6 Set 5 Five epitopes that provide good HLA coverage of the world's population

[0098] [Table 10] TIFF2025531437000019.tif27167

[0099] Table 7 Set 6: Five epitopes derived from different IAV antigens

[0100] [Table 11] TIFF2025531437000021.tif66165

[0101] Table 8

[0102] [Table 12] TIFF2025531437000023.tif65164

[0103] Here, 15 epitopes provide the same amount of coverage as 20 epitopes, but having more epitopes with the same HLA improves the T cell induction required for good protection.

[0104] Table 9. Comparative analysis of currently available polyepitope collections according to the concept collection of Sharma et al.

[0105] [Table 13] TIFF2025531437000025.tif82167

[0106] Minimal requirements for optimal release of antigenic peptides from polyepitope constructs One of the most promising approaches to rational vaccine design uses so-called epitope-based vaccines (EVs). Vaccines based on T cell epitopes, short immunogenic peptide sequences derived from antigens, offer several advantages over traditional whole-attenuated or subunit vaccines. Unlike traditional vaccines, EVs do not contain potentially infectious agents, and peptide selection can be tailored to address the genetic variations of the pathogen and the target population or individual patient. Well-established techniques for peptide synthesis ensure rapid, high-quality production and economical storage of the final vaccine. To improve epitope recovery, several groups have suggested the use of spacer sequences between epitopes. For each epitope in a polyepitope construct to be immunogenic, the peptides must be efficiently liberated by antigen processing for subsequent presentation to T cells. Therefore, optimal cleavage of the polyepitope protein by the proteasome is of utmost importance. Epitope presentation can depend on the order of peptides within a polyepitopic protein, and it has been shown that this order can determine the probability of cleavage if such epitopes are not properly spaced. The success of a polypeptide relies on efficient processing: constituent epitopes must be recovered from epitope junctions while avoiding neoepitopes. Spacers between epitopes are used to ensure this, but spacer selection is not straightforward. Schubert and Kohlbacher present a framework for optimally determining spacer length and sequence through multi-objective optimization of human leukocyte antigen class I-restricted polypeptides. This method yields a string-of-beads vaccine with flexible spacer lengths, which increases predicted epitope recovery by 5-fold and reduces immunogenicity from neoepitopes by 44% compared to spacer-free designs. Together, spacer sequences flanking the epitope can facilitate correct cleavage of the epitope and prevent the generation of neoepitopes, which can reduce vaccine efficacy (Schubert and Kohlbacher 2016).Here, the inventors chose the spacer sequence AAY (Ismail, Ahmad, and Azam 2020) and, in addition, the addition of a degron to the polyepitope peptide of the present invention, thereby circumventing the dependency on the order of peptides within the polyepitope protein, which may determine the cleavage probability, resulting in a strong increase in the number of correctly cleaved epitopes and, with it, a decrease in the neoimmunogenicity of the complete construct, as well as the independent recovery of individual epitopes, regardless of the order in which they are located in the polyepitope construct. Indeed, in experiments using an expression plasmid (pCAGGS) expressing three different epitopes (M1 58-66, NP 383-391, and NP 418-426) in all possible sequences, we did not observe any differences in T cell activation, as measured by IFN-g ELISpot, when M1 58-66 peptide-specific T cells were cocultured with HLA-A*0201 transgenic A549 cells transfected with individual plasmids. Furthermore, using the MVA-PE construct, we observed good antigenicity for four different epitopes located at positions 4, 5, 10, and 14 in the polyepitope sequence. This again demonstrates that individual peptides are efficiently released from the polyepitope sequence, regardless of their position in the polyepitope sequence.

[0107] Enrichment of peptide-specific CD8+ T cells Epitope-specific T cells are stimulated with the corresponding peptide and then expanded using PBMCs from healthy HLA-matched blood donors. After 12 days of in vitro expansion, enriched CD8+ T cells are isolated using magnetic beads coated with anti-CD8 antibodies by magnetic-activated cell sorting (MACS) (see Figure 1).

[0108] In vitro antigenicity of polyepitope constructs in pCAGGS Before embarking on the creation of recombinant MVAs that drive the expression of polyepitope sequences, we wish to address the issues of optimizing epitope order, spacer sequences, and antigen processing by fusion of the sequences to ubiquitin.

[0109] The 20 selected epitopes (from the table) were used to construct an artificial gene encoding a polyepitope sequence. As shown in the table below, four different constructs were generated, with or without a spacer (AAY) (to assist in epitope release) and with or without ubiquitin (to dock the polyepitope into the proteasome for optimal antigen processing). Additionally, an MVA-M1 construct was generated as a positive control for the Matrix epitope, containing the prototype M58-66 epitope. To monitor target gene expression, an HA tag (SEQ ID NO: 21 (YPYDVPDYA)) was added to the C-terminus of the polyepitope sequence. These constructs were cloned into the expression vector pCAGGS (Czudai-Matwich, Schnare, and Pinkenburg 2013). We successfully cloned all polyepitope sequences into pCAGGS. The constructs are shown in Figure 4.

[0110] Transgenic A549 cells constitutively expressing the corresponding HLA genes have been previously generated using a retroviral system. HLA-transgenic A549 cells were either transfected with an expression plasmid (pCAGGS) encoding each artificial gene (polyepitope) or incubated with synthetic peptides corresponding to single epitopes contained in the polyepitope. Isolated CD8+ T cells (shown in Figure 1) were cocultured with transfected and / or peptide-loaded HLA-transgenic A549 cells, and IFN-γ secretion in response to peptide-specific T cell activation was measured by ELISpot. Using our pCAGGS expression plasmid, we observed IFN-γ responses in enriched T cell populations for several epitopes, indicating that the epitopes could be released from the polyepitope construct and presented to specific T cells.

[0111] Similar results were obtained for M1 58-66 , NP 44-52, PB1 591-599 and PB1 30-38 Epitopes were also obtained, which are located at positions 4, 5, 10, and 14 in the currently expressed 20-epitope construct. All four epitopes are released from the polyepitope string and presented to specific T cells, ultimately leading to CD8+ T cell activation.

[0112] In vitro antigenicity of recombinant MVA carrying polyepitopes A similar polyepitope construct (shown in pCAGGS) was used to prepare recombinant MVA. These artificial genes were cloned into an MVA shuttle vector using standard techniques, which facilitates homologous recombination and transient expression of a reporter gene (mCherry) for selection of recombinant MVA. In this step, we were able to achieve only constructs containing ubiquitin with or without the spacer and rMVA-M1. These constructs were further evaluated in vitro for their replication capacity, genetic stability, and antigenicity.

[0113] HLA-transgenic A549 cells were infected with recombinant MVA expressing a polyepitope (with or without a spacer) containing ubiquitin or incubated with a synthetic peptide corresponding to a single epitope contained in the polyepitope. Isolated CD8+ T cells (shown in Figure 1) were cocultured with infected or peptide-loaded HLA-transgenic A549 cells, and IFN-γ secretion in response to peptide-specific T cell activation was measured by ELISpot. Infection was performed at two different MOIs (1 and 3). Using our recombinant MVA, we observed IFN-γ responses in enriched T cell populations for some epitopes, but typically only for constructs containing a spacer and ubiquitin. This indicated that epitopes could be released from the polyepitope construct and presented to specific T cells, and that the spacer plays an important role in the proper release of single epitopes from the polyepitope construct.

[0114] Similar results were obtained for M1 58-66 , NP 44-52 , PB1 591-599 and PB1 30-38 Epitopes have also been obtained, which are located at positions 4, 5, 10, and 14 in the current polyepitope construct. All epitopes are released from the polyepitope (with spacer and ubiquitin) and presented to specific T cells, ultimately leading to CD8+ T cell activation.

[0115] In vitro immunogenicity We wanted to test the in vitro immunogenicity of an rMVA construct (rMVA-PE) expressing a synthetic gene (SEQ ID NO: 48) encoding a polyepitope sequence with a spacer fused to ubiquitin. To this end, PBMCs from HLA-A*01-positive healthy blood donors were stimulated with rMVA-PE or wild-type MVA (negative control) or IAV (influenza A virus positive control). After expansion of specific T cells, two HLA-A*01-restricted peptides, SEQ ID NO: 4 (CTELKLSDY) (NP44-52) and SEQ ID NO: 10 (VSDGGPNLY) (PB1 591-599 After restimulation of expanded T cells with rMVA-PE, the presence of influenza A virus epitope-specific T cells was assessed by IFNγ Elispot assay. The magnitude of the in vitro responses induced by rMVA-PE was similar to that induced by IAV. Furthermore, the immunodominance hierarchy between the two peptides tested was also similar. We concluded that rMVA-PE induced T cell responses representative of those induced by IAV stimulation in vitro.

[0116] In vivo immunogenicity Groups (n = 6) of 6- to 8-week-old female C57BL / 6 tg HLA A*02:01 mice were cultured for 10 min. 7Mice were immunized intramuscularly twice (days 0 and 21) with PFU of rMVA-PE, wtMVA, or buffer (see Figures 9 and 10). Fourteen days after the last immunization, mice were sacrificed, and their spleens were harvested and processed to obtain single-cell suspensions using a gentleMACS Octo Dissociator (Miltenyi Biotec, Bergisch Gladbach, Germany), and passed through 100 μm and 70 μm cell strainers (Miltenyi Biotec, Bergisch Gladbach, Germany). Red blood cells were lysed in ACK lysis buffer (Gibco, Waltham, MA, USA) for 1.5 min at room temperature, followed by washing with cold PBS containing 2% FBS. The splenocytes were then resuspended in RPMI 1640 (Gibco, Waltham, MA, USA) supplemented with 10% FBS, 10 mM HEPES, and 1% P / S (R10F) and kept on ice until further use. 5 Cells / well) were incubated in a pre-coated 96-well plate (Mouse IFN-ELISpotPLUS kit, Mabtech, Nacka Strand, Sweden) with the IAV M1 protein of SEQ ID NO: 5 (GILGFVFTL, M1 58-66 Cells were incubated in triplicate with either individual HLA-A*02:01-restricted peptides (10 μM) derived from either MVA(A6L) or MVA(A6L) for 30 hours at 37°C. Cells incubated with PMA / ionomycin (both from Cayman Chemical Company, Ann Arbor, MI, USA) or DMSO served as positive and negative controls, respectively. Plates were developed according to the manufacturer's instructions. Developed plates were scanned using an ImmunoSpot S6 Ultimate M2 reader, and spots were counted using ImmunoSpot software version 7.0.9.5 (both from Cellular Technology Limited, Shaker Heights, OH, USA). Data were expressed as a 10% sigma after subtraction of the negative control. 6 Presented as mean SFU per splenocyte.

[0117] rMVA-PE vaccinated mice were resistant to IAV M1 58-66 The rMVA-PE and wtMVA mice demonstrated responses to the epitope, which was not observed in wt-MVA- or mock-immunized mice. Both rMVA-PE and wtMVA initiated responses to the MVA-derived A6L epitope. Because the available experimental HLA repertoire of transgenic mice is currently depleted with respect to the other epitopes listed herein, a human phase I trial is currently being planned and discussed with authorities to provide qualification for testing the broad HLA-restricted immune responses elicited by rMVA-PE in human clinical trials.

[0118] Sequence Listing

[0119] [Table 14] TIFF2025531437000027.tif138164

[0120] Start codon: atg Stop codon: TAA BamH1:GGATCC Kozak:GCCGCCACC Pme1:GTTTAAAC KpnI:GGTACC (for pCAGGS) XhoI:CTCGAG (for pCAGGS) HA tag, SEQ ID NO: 21 (YPYDVPDYA): SEQ ID NO: 42 (TACCCATACGAT GTTCCAGATTACGCT) Spacer AAY: gcggcgtat

[0121] Ubiquitin: SEQ ID NO: 43 (CAGATCTTCGTGAAGACTCTGACTGGTAAGACCATCACCCTCGAGGTTGAGCCCAGTGACACCATCGAGAATGTCAAGGCAAAGATCCAAGATAAGGAAGGCATCC CTCCTGACCAGCAGAGGCTGATCTTTGCTGGAAAACAGCTGGAAGATGGGCGCACCCTGTCTGACTACAACATCCAGAAAGAGTCCACCCTGCACCTGGTGCTCCGTCTCAGAGGTGTA)

[0122] Optimized M1-HA (809bp) Sequence number 44 (GGTACC GGATCCGCCGCCACC atg agt ctt cta acc gag gtc gaa acg tac gta ctc tct atc atc ccg tca ggc ccT ctc aaa gcc gag atc gca cag aga ctt gaa gat gtc ttt gca ggg aag aac acc gat ctt gag gtt ctc atg gaa tgg cta aag aca aga cca atc ctg tca cct ctg act aag ggT att tta gga ttt gtg ttc acg ctc acc gtg ccc agt gag cga gga ctg cag cgt aga cgc ttt gtc caa aat gcc ctt aat ggg aac ggT gat cca aat aac atg gac aaa gca gtt aaa ctg tat agg aag ctc aag agg gag ata aca ttc cat ggT gcc aaa gaa atc tca ctc agt tat tct gct ggt gca ctt gcc agt tgt atg ggc ctc ata tac aac agg atg ggT gct gtg acc act gaa gtg gca ttt ggc ctg gta tgt gca acc tgt gaa cag att gct gac tcc cag cat cgg tct cat agg caa atg gtg aca aca acc aat cca cta atc aga cat gag aac aga atg gtt tta gcc agc act aca gct aag gct atg gag caa atg gct gga tcg agt gag caa gca gca gag gcc atg gag gtt gct agt cag gct aga caa atg gtg caa gcg atg aga acc att ggg act cat cct agc tcc agt gct ggt ctg aaa aat gat ctt ctt gaa aat ttg cag gcc tat cag aaacga atg ggT gtg cag atg caa cgg ttc aag TAC CCA TAC GAT GTT CCA GAT TAC GCT TAA GTTTAAAC CTCGAG)

[0123] Optimized polyepitope with spacer: (770bp) SEQ ID NO: 45 (GGTACC GGATCC GCCGCCACC atg ata ttg aga ggg tcg gtt gct cac aag gcggcgtat ttc ctg ctg atg gat gcc tta aaa tta gcggcgtat agc agg tac tgg gcc ata agg acc aga gcggcgtat tgc acc gaa ctc aaa ctc agt gat tat gcggcgtat ggg att tta gga ttt gtg ttc acg ctc gcggcgtat tct atc atc ccg tca ggc ccT ctc aaa gcggcgtat gcc agt tgt atg ggc ctc ata tac gcggcgtat ttc atg tat tca gat ttt cac ttc atc gcggcgtat ttt gtg cga caa tgc ttc aat ccg atg gcggcgtat gtc tcc gac gga ggc cca aat tta tac gcggcgtat ttc ctt aag gat gta atg gag tca atg gcggcgtat cgt ggg atc aat gat cgg aac ttc tgg gcggcgtat atg atg atg ggc atg ttc aat atg tta gcggcgtat tac agc cat ggg aca gga aca gga tac gcggcgtat cat tcc aat ttg aat gat gca act tat gcggcgtat agg agg tct gga gcc gca ggt gct gca gtc aaa gcggcgtatctt cta acc gag gtc gaa acg tac gta gcggcgtat atg gtt tta gcc agc act aca gct aag gcggcgtat aat atg tta agc act gta tta ggc gtc gcggcgtat gaa ctg aga agc agg tac tgg gcc ata TAC CCA TAC GAT GTT CCA GAT TAC GCT TAA GTTTAAAC CTCGAG)

[0124] Optimized polyepitope without spacer: (599bp) SEQ ID NO:46 (GGTACC GGATCC GCCGCCACC atg ata ttg aga ggg tcg gtt gct cac aag ttc ctg ctg atg gat gcc tta aaa tta agc agg tac tgg gcc ata agg acc aga tgc acc gaa ctc aaa ctc agt gat tat ggg att tta gga ttt gtg ttc acg ctc tct atc atc ccg tca ggc ccT ctc aaa gcc agt tgt atg ggc ctc ata tac ttc atg tat tca gat ttt cac ttc atc ttt gtg cga caa tgc ttc aat ccg atg gtc tcc gac gga ggc cca aat tta tac ttc ctt aag gat gta atg gag tca atg cgt ggg atc aat gat cgg aac ttc tgg atg atg atg ggc atg ttc aat atg tta tac agc cat ggg aca gga aca gga tac cat tcc aat ttg aat gat gca act tat agg agg tct gga gcc gca ggt gct gca gtc aaa ctt cta acc gag gtc gaa acg tac gta atg gtt tta gcc agc act aca gct aag aat atg tta agc act gta tta ggc gtc gaa ctg aga agc agg tac tgg gcc ata TAC CCA TAC GAT GTT CCA GAT TAC GCT TAA GTTTAAAC CTCGAG)

[0125] Optimized polyepitope without spacer and with ubiquitin (823bp) SEQ ID NO: 47 (GGTACCGGATCCGCCGCCACCatgCAGATCTTCGTGAAGACTCTGACTGGTAAGACCATCACCCTAGAGGTTGAGCCCAGTGACACCATCGAGAATGTCAAGGCAAAGATCCAAGATAAGGAAGGCATCCCTCCTGACCAGCAGAGGCTGATCTTTGCTGGAAAACAGCTGGAAGATGGGCGCACCCTGTCTGACTACAACATCCAGAAAGAGTCCACCCTGCACCTGGTGCTCCGTCTCAGAGGTGT ata ttg aga ggg tcg gtt gct cac aag ttc ctg ctg atg gat gcc tta aaa tta agc agg tac tgg gcc ata agg acc aga tgc acc gaa ctc aaa ctc agt gat tat ggg att tta gga ttt gtg ttc acg ctc tct atc atc ccg tca ggc ccT ctc aaa gcc agt tgt atg ggc ctc ata tac ttc atg tat tca gat ttt cac ttc atc ttt gtg cga caa tgc ttc aat ccg atg gtc tcc gac gga ggc cca aat tta tac ttc ctt aag gat gta atg gag tca atg cgt ggg atc aat gat cgg aac ttc tgg atg atg atg ggc atg ttc aat atg tta tac agc cat ggg aca gga aca gga tac cat tcc aat ttg aat gat gca act tat agg agg tct gga gcc gca ggt gct gca gtc aaa ctt cta acc gag gtc gaa acg tac gta atg gtt tta gcc agc act aca gct aag aat atg tta agc act gta tta ggc gtc gaa ctg aga agc agg tac tgg gcc ata TAC CCA TAC GAT GTTCCA GAT TAC GCT TAA GTTTAAAC CTCGAG)

[0126] Optimized polyepitope (995bp) with spacer and ubiquitin SEQ ID NO: 48 (GGTACCGGATCCGCCGCCACCatgCAGATCTTCGTGAAGACTCTGACTGGTAAGACCATCACCCTAGAGGTTGAGCCCAGTGACACCATCGAGAATGTCAAGGCAAAGATCCAAGATAAGGAAGGCATCCCTCCTGACCAGCAGAGGCTGATCTTTGCTGGAAAACAGCTGGAAGATGGGCGCACCCTGTCTGACTACAACATCCAGAAAGAGTCCACCCTGCACCTGGTGCTCCGTCTCAGAGGTGTA ata ttg aga ggg tcg gtt gct cac aag gcggcgtat ttc ctg ctg atg gat gcc tta aaa tta gcggcgtat agc agg tac tgg gcc ata agg acc aga gcggcgtat tgc acc gaa ctc aaa ctc agt gat tat gcggcgtat ggg att tta gga ttt gtg ttc acg ctc gcggcgtat tct atc atc ccg tca ggc ccT ctc aaa gcggcgtat gcc agt tgt atg ggc ctc ata tac gcggcgtat ttc atg tat tca gat ttt cac ttc atc gcggcgtat ttt gtg cga caa tgc ttc aat ccg atg gcggcgtat gtc tcc gac gga ggc cca aat tta tac gcggcgtat ttc ctt aag gat gta atg gag tca atg gcggcgtat cgt ggg atc aat gat cgg aac ttc tgg gcggcgtat atg atg atg ggc atg ttc aat atg tta gcggcgtattac agc cat ggg aca gga aca gga tac gcggcgtat cat tcc aat ttg aat gat gca act tat gcggcgtat agg agg tct gga gcc gca ggt gct gca gtc aaa gcggcgtat ctt cta acc gag gtc gaa acg tac gta gcggcgtat atg gtt tta gcc agc act aca gct aag gcggcgtat aat atg tta agc act gta tta ggc gtc gcggcgtat gaa ctg aga agc agg tac tgg gcc ata TAC CCA TAC GAT GTT CCA GAT TAC GCT TAA GTTTAAAC CTCGAG)

[0127]

Table 15

Claims

1. A nucleic acid encoding at least a polyepitope polypeptide comprising at least five influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein the at least five peptides encode epitopes having SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), and SEQ ID NO: 14 (YSHGTGTGY), wherein the nucleic acid is further provided with genetic information providing a peptide spacer (linker) arrangement adjacent to the peptides encoding the epitopes, and wherein a nucleic acid encoding a degron is further provided.

2. 2. The nucleic acid of claim 1, further encoding five additional influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein the additional five peptides encode epitopes having SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 4 (CTELKLSDY).

3. Amino acid sequences: SEQ ID NO: 1 (ILRGSVAHK), SEQ ID NO: 2 (ELRSRYWAI), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 4 (CTELKLSDY), SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 6 (SIIPSGPLK), SEQ ID NO: 7 (ASCMGLIY), SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 10 (VSDGGPNLY), SEQ ID NO: 11 (FLKDVMESM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO: 15 (YSHGTGTGY), SEQ ID NO: 16 (YSHGTGTGY), SEQ ID NO: 17 (YSHGTGTGY), SEQ ID NO: 18 (YSHGTGTGY), SEQ ID NO: 19 (YSHGTGTGY), SEQ ID NO: 20 (YSHGTGTGY), SEQ ID NO: 21 (YSHGTGTGY), SEQ ID NO: 22 (YSHGTGTGY), SEQ ID NO: 23 (YSHGTGTGY), SEQ ID NO: 24 (YSHGTGTGY), SEQ ID NO: 25 (YSHGTGTGY), SEQ ID NO: 26 (YSHGTGTGY), SEQ ID NO: 27 (YSHGTGTGY), SEQ ID NO: 28 (YSHGTGTGY), SEQ ID NO: 29 (YSHGTGTGY), SEQ ID NO: 30 (YSHGTGTGY), SEQ ID NO: 31 (YSHGTGTGY), SEQ ID NO: 32 (YSHGTGTGY), SEQ ID NO: 33 (YSH 3. The nucleic acid according to claim 1 or 2, encoding at least 15, preferably at least 18, influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW) and SEQ ID NO: 20 (FLLMDALKL).

4. Amino acid sequences: SEQ ID NO: 1 (ILRGSVAHK), SEQ ID NO: 2 (ELRSRYWAI), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 4 (CTELKLSDY), SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 6 (SIIPSGPLK), SEQ ID NO: 7 (ASCMGLIY), SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 10 (VSDGGPNLY), SEQ ID NO: 11 (FLKDVMESM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFN 4. The nucleic acid of any one of claims 1 to 3, encoding 20 influenza A virus (IAV) derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, having SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW) and SEQ ID NO: 20 (FLLMDALKL).

5. The nucleic acid of any one of claims 1 to 4, wherein the peptide spacer comprises the tripeptide AAY.

6. The nucleic acid of any one of claims 1 to 5, wherein the degron comprises ubiquitin.

7. A nucleic acid vector, virus, cell or preparation comprising the acid according to any one of claims 1 to 6.

8. A protein formulation comprising a polyepitope polypeptide derived from the nucleic acid, vector, virus or cell according to any one of claims 1 to 7.

9. 1. A polyepitope polypeptide comprising at least five influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein the at least five peptides encode epitopes having SEQ ID NO:8 (FMYSDFHFI), SEQ ID NO:9 (FVRQCFNPM), SEQ ID NO:12 (NMLSTVLGV), SEQ ID NO:13 (MMMGMFNML), and SEQ ID NO:14 (YSHGTGTGY), wherein the polypeptide is further provided with suitable peptide spacer (linker) arrangements flanking the epitope-encoding peptides, and wherein a degron is provided.

10. 10. The polyepitope polypeptide of claim 9, further provided with five additional influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, wherein the five additional peptides encode epitopes having SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 2 (ELRSRYWAI), and SEQ ID NO: 4 (CTELKLSDY).

11. Amino acid sequences, SEQ ID NO: 1 (ILRGSVAHK), SEQ ID NO: 2 (ELRSRYWAI), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 4 (CTELKLSDY), SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 6 (SIIPSGPLK), SEQ ID NO: 7 (ASCMGLIY), SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 10 (VSDGGPNLY), SEQ ID NO: 11 (FLKDVMESM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), SEQ ID NO: 14 (YSHGTGTGY), SEQ ID NO:

11. The polyepitope polypeptide according to claim 9 or 10, comprising at least 15, preferably at least 18, influenza A virus (IAV)-derived peptides capable of inducing IFNγ by CD8+ T cells selected from the group of peptides capable of inducing IFNγ by CD8+ T cells having SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW) and SEQ ID NO: 20 (FLLMDALKL).

12. Amino acid sequences, SEQ ID NO: 1 (ILRGSVAHK), SEQ ID NO: 2 (ELRSRYWAI), SEQ ID NO: 3 (SRYWAIRTR), SEQ ID NO: 4 (CTELKLSDY), SEQ ID NO: 5 (GILGFVFTL), SEQ ID NO: 6 (SIIPSGPLK), SEQ ID NO: 7 (ASCMGLIY), SEQ ID NO: 8 (FMYSDFHFI), SEQ ID NO: 9 (FVRQCFNPM), SEQ ID NO: 10 (VSDGGPNLY), SEQ ID NO: 11 (FLKDVMESM), SEQ ID NO: 12 (NMLSTVLGV), SEQ ID NO: 13 (MMMGMFNML), 12. The polyepitope polypeptide according to any one of claims 9 to 11, comprising 20 influenza A virus (IAV)-derived peptides encoding epitopes capable of inducing IFNγ by CD8+ T cells, having sequence number 14 (YSHGTGTGY), SEQ ID NO: 15 (HSNLNDATY), SEQ ID NO: 16 (RRSGAAGAAVK), SEQ ID NO: 17 (LLTEVETYV), SEQ ID NO: 18 (MVLASTTAK), SEQ ID NO: 19 (RGINDRNFW), and SEQ ID NO: 20 (FLLMDALKL).

13. An antigenic preparation comprising a nucleic acid according to any one of claims 1 to 6, or a vector, virus, cell or preparation according to claim 7, or a protein preparation according to claim 8 or a polyepitope polypeptide according to any one of claims 9 to 12.

14. An immunogenic preparation comprising a nucleic acid according to any one of claims 1 to 6, or comprising a vector, virus, cell or preparation according to claim 7, or comprising a protein preparation according to claim 8 or a polyepitope polypeptide according to any one of claims 9 to 12.

15. A vaccine formulation obtainable by mixing the immunogenic formulation of claim 13 with a pharmaceutically acceptable excipient.

16. 16. The vaccine formulation of claim 15, for use in conjunction with, or in addition to, or preferably simultaneously with, vaccination with a vaccine intended to generate a humoral vaccine response against influenza virus hemagglutinin protein, preferably for annual vaccination.

Images