Optimized guide RNA, CRISPR / AcC2C9 gene editing system and gene editing method

Abstract

The present invention relates to the field of biotechnology, and in particular to an optimized guide RNA, CRISPR / AcC2C9 gene editing system, and gene editing method. The guide RNA comprises an RNA backbone and a gene target region, the RNA backbone comprising a tracrRNA and a tracr pairing, the nucleotide sequence of the tracrRNA being a sequence in which some nucleotides have been added, deleted, or substituted with respect to the nucleotide sequence set forth in SEQ ID NO: 117, and the nucleotide sequence of the tracr pairing being a sequence in which some nucleotides have been added, deleted, or substituted with respect to the nucleotide sequence set forth in SEQ ID NO: 127. Use of the optimized guide RNA and CRISPR / AcC2C9 gene editing system enables intracellular gene editing with high efficiency and precision. Furthermore, use of the optimized guide RNA and CRISPR / AcC2C9 gene editing system significantly improves the editing efficiency and applicability of this editing system compared to previous unoptimized CRISPR / AcC2C9 gene editing systems.

Description

[Technical Field]

[0001] The present invention relates to the field of biotechnology, and in particular to guide RNAs, CRISPR / AcC2C9 gene editing systems and gene editing methods. [Background technology]

[0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and its associated genes (Cas) were originally discovered as adaptive immune systems in archaea and bacteria. Due to their nuclease activity, their effector proteins have been developed as multifunctional genome editing tools. Guide RNAs can guide Cas nucleases to specific target sites in the genomes of multiple cell types, where they cleave the target sites, causing double-strand breaks in DNA. Target genes can then be modified by utilizing endogenous or exogenously introduced DNA repair mechanisms. Genome editing technology can facilitate genetic engineering, cell engineering, the construction of model animals, and plant genetic screening, and holds great potential for the treatment of human diseases.

[0003] Currently, CRISPR / Cas9 and CRISPR / Cas12a are the two most widely used genome editing systems. However, these systems are large, consisting of large proteins containing over 1,000 amino acids. Such large molecular weights make them difficult to deliver in the field of disease treatment. Recently, a miniature Cas protein, C2C9, consisting of approximately 400–700 amino acid residues and containing a single RuvC nuclease domain, has been discovered. This small protein can help overcome the packaging capacity limitations of adeno-associated virus vectors. Actinomadura craniellae C2C9 (AcC2C9, 506 amino acids) was first reported to target target genes in eukaryotic cells and cause gene insertions or deletions, but its editing efficiency is only 0.1%–25%. Therefore, optimizing the miniature AcC2C9 gene editing system to create a highly efficient and precise gene editing tool is highly desirable. Summary of the Invention

[0004] In view of the above-mentioned drawbacks of the prior art, the present invention aims to provide a guide RNA, a CRISPR / AcC2C9 gene editing system, and a gene editing method to solve the problems of the prior art. The present invention overcomes the drawback of low gene editing efficiency of small nucleases in the existing technical framework, and by using the optimized gene editing system and method of the present invention, it is possible to edit target genes or target genomes in vitro or in vivo (including in cells) with high efficiency and precision, thereby significantly improving the gene editing efficiency of the small CRISPR / AcC2C9 system.

[0005] In order to achieve the above and other related objects, the present invention provides a guide RNA comprising an RNA backbone and a gene target region, wherein the RNA backbone comprises a tracrRNA and a tracr pairing, the tracrRNA and the tracr pairing are linked directly or via a linker, the nucleotide sequence of the tracrRNA is a sequence in which some nucleotides are added, deleted, or substituted with respect to the nucleotide sequence set forth in SEQ ID NO: 117, and the nucleotide sequence of the tracr pairing is a sequence in which some nucleotides are added, deleted, or substituted with respect to the nucleotide sequence set forth in SEQ ID NO: 127. A guide RNA is provided.

[0006] The present invention further provides an isolated polynucleotide encoding the guide RNA of any one of the preceding claims.

[0007] The present invention further provides a construct comprising the aforementioned isolated polynucleotide.

[0008] The present invention further provides an expression system comprising the above-described construct or having an exogenous above-described polynucleotide integrated into its genome.

[0009] The present invention further provides a gene editing system comprising the guide RNA or the polynucleotide described in any one of the above.

[0010] The present invention further provides compositions, said gene editing systems, and pharmaceutically acceptable carriers.

[0011] The present invention further provides a gene editing method, which includes contacting a target gene with the aforementioned gene editing system to achieve editing of the target gene.

[0012] The present invention further provides the use of the aforementioned guide RNA, isolated polynucleotide, construct, expression system, gene editing system, pharmaceutical composition or method in gene editing of a target gene and / or its associated polypeptide in vivo, in an in vitro cell or in a cell-free environment.

[0013] The present invention further provides cells, including host cells genetically modified with the AcC2C9 nuclease or a polynucleotide encoding it, a guide RNA or a polynucleotide encoding it, a recombinant expression vector, a system, or a composition.

[0014] As described above, the guide RNA, CRISPR / AcC2C9 gene editing system, and gene editing method of the present invention have the following beneficial effects.

[0015] (1) The present invention evolves the CRISPR / AcC2C9 system into a highly efficient and precise genome editing tool by thoroughly examining the AcC2C9 guide RNA through multiple guide RNA modifications and identifying the guide RNA with the highest editing efficiency. In genome editing experiments in mammalian cells, the present invention tested the editing efficiency of a total of 35 target sequences for six endogenous genes. The results showed that the optimized version, gRNA_M9, can improve gene editing efficiency at all tested target sites. At 32 of these sites, the optimized gRNA_M9 of the present invention improved editing efficiency by 2- to 10-fold compared to the original version, gRNA_M1.

[0016] (2) With the use of the optimized gRNA_M9 of the present invention, the editing activity of the CRISPR / AcC2C9 system changed from absent to present at some sites. Of the 35 tested sites, gene editing could not be detected at three sites when the original version of the guide RNA, gRNA_M1, was used. However, when the optimized version, gRNA_M9, was used, a gene editing efficiency of approximately 10% was detected. This indicates that the guide RNA of the present invention improves the applicability of the miniature CRISPR system in cellular gene editing.

[0017] (3) In this study, the guide RNA was reconstructed to significantly reduce the size of the guide RNA, resulting in a more compact volume for the engineered AcC2C9 system, which could potentially be used in gene editing and gene therapy via AAV delivery. Such a compact and ultra-small CRISPR system is expected to be widely used in genome editing. [Brief explanation of the drawings]

[0018]

Figure 1

Figure 2

Figure 3

[0019] The present invention provides a guide RNA (gRNA) comprising an RNA backbone and a gene target region, wherein the nucleotide sequence of the RNA backbone is the nucleotide sequence shown in SEQ ID NO: 106 to 107, or a sequence in which some nucleotides have been added, deleted, or substituted with respect to the nucleotide sequence shown in SEQ ID NO: 106 or SEQ ID NO: 107.

[0020] The RNA backbone comprises a trans-activating CRISPR RNA (tracrRNA) and a tracr pairing. The tracrRNA and the tracr pairing may be linked directly or via a linker. The linker is selected from oligonucleotides, preferably having a length of 3 to 18 nt. More preferably, in one embodiment, the nucleotide sequence of the linker is GAAA.

[0021] In the guide RNA described in the present invention, the tracr pairing and the tracrRNA sequence can be linked to each other to form a single RNA backbone, i.e., the guide RNA is single-stranded and from its 5' end to its 3' end, the tracr The guide RNA comprises an RNA sequence and a tracr pairing sequence, in that order. When the guide RNA is single-stranded, the 3' end of the tracr RNA sequence and the 5' end of the tracr pairing sequence are linked directly or via a linker. When no linker is present, the tracr RNA sequence + tracr pairing sequence form an RNA backbone; when a linker is present, the tracr RNA sequence + linker + tracr pairing sequence form an RNA backbone.

[0022] The guide RNA described in the present invention includes a sequence in which some nucleotides have been added, deleted, or substituted at the 5' or 3' end of the nucleotide sequence, for example, a sequence in which 15 to 150 nucleotides have been added, deleted, or substituted at the 5' or 3' end of the nucleotide sequence, or a sequence in which some nucleotides have been shortened in the center of the nucleotide sequence, 15 to 150 nucleotides have been substituted, and then linked via a linker selected from oligonucleotides. The number may be 15 to 30, 30 to 45, 45 to 60, 60 to 75, 75 to 90, 90 to 105, 105 to 120, 120 to 135, or 135 to 150.

[0023] In the guide RNA described in the present invention, the gene target region is a nucleotide sequence complementary to a target sequence in a target gene and is located at the 3' end of the RNA backbone. The gene target region recognizes a PAM sequence in the target sequence, preferably 5'-NAAN (where N is A, T, C, or G), more preferably 5'-NAAG. The gene target region targets a 12-40 bp nucleic acid fragment following the PAM sequence, and may be, for example, 13-20, 18-25, 22-32, 26-37, 30-38, or 32-40 nucleotides in length, with a preferred length of 20 bp. In the present invention, the percentage of complementarity between the target region of the guide RNA and the target sequence of the target gene may be at least 50% (e.g., at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%). In one embodiment, the nucleotide sequence of the gene target region is set forth in SEQ ID NO: 145.

[0024] The guide RNA described in the present invention comprises a stem-loop structure that forms a protein-binding structure that interacts with a nuclease (e.g., AcC2C9). In some embodiments, the protein-binding structure of the guide RNA comprises six stem-loop structures including stem-loops 1, 2, 3, 4, 5, and 6 (as shown in Figure 1, Stem 1, Stem 2, Stem 3, Stem 4, Stem 5, and Stem 6 represent stem-loops 1 to 6, respectively). In other embodiments, the protein-binding structure of the guide RNA comprises five stem-loop structures including stem-loops 2, 3, 4, 5, and 6 (i.e., a guide RNA in which Stem 1 in Figure 1 has been removed).

[0025] In one embodiment, the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 106, wherein the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 117 and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 127. Furthermore, the nucleotide sequence of the guide RNA is set forth in SEQ ID NO: 4, and the guide RNA is referred to as gRNA_M1.

[0026] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence of SEQ ID NO: 106 minus 30 bases of stem-loop 1. The nucleotide sequence of the RNA backbone is SEQ ID NO: 107, in which the nucleotide sequence of the tracrRNA is SEQ ID NO: 140 and the nucleotide sequence of the tracr pairing is SEQ ID NO: 127. Furthermore, the nucleotide sequence of the guide RNA is SEQ ID NO: 5, and the guide RNA is referred to as gRNA_M2.

[0027] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence set forth in SEQ ID NO: 107 minus 34 bases of stem-loop 6. The nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 108, of which the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 118 and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 128. Furthermore, the nucleotide sequence of the guide RNA is set forth in SEQ ID NO: 6, and the guide RNA is referred to as gRNA_M3.

[0028] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence of SEQ ID NO: 107 with 43 bases of stem-loop 6 deleted, and the nucleotide sequence of the RNA backbone is SEQ ID NO: 109, of which the nucleotide sequence of the tracrRNA is SEQ ID NO: 119, and the nucleotides of the tracr pairing are The nucleotide sequence of the guide RNA is shown in SEQ ID NO: 129. Furthermore, the nucleotide sequence of the guide RNA is shown in SEQ ID NO: 7, and the guide RNA is called gRNA_M4.

[0029] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence set forth in SEQ ID NO: 107 minus 51 bases of stem-loop 6. The nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 110, wherein the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 120 and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 130. Furthermore, the nucleotide sequence of the guide RNA is set forth in SEQ ID NO: 8, and the guide RNA is referred to as gRNA_M5.

[0030] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence set forth in SEQ ID NO: 107 minus 57 bases of stem-loop 6. The nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 111, wherein the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 121 and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 131. Furthermore, the nucleotide sequence of the guide RNA is set forth in SEQ ID NO: 9, and the guide RNA is referred to as gRNA_M6.

[0031] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence set forth in SEQ ID NO: 107 minus 64 bases of stem-loop 6. The nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 112, wherein the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 122 and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 132. Furthermore, the nucleotide sequence of the guide RNA is set forth in SEQ ID NO: 10, and the guide RNA is referred to as gRNA_M7.

[0032] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence set forth in SEQ ID NO: 107 minus 70 bases of stem-loop 6. The nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 113, of which the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 123 and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 133. Furthermore, the nucleotide sequence of the guide RNA is set forth in SEQ ID NO: 11, and the guide RNA is referred to as gRNA_M8.

[0033] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence set forth in SEQ ID NO: 107 minus 74 bases of stem-loop 6. The nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 114, of which the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 124 and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 134. Furthermore, the nucleotide sequence of the guide RNA is set forth in SEQ ID NO: 12, and the guide RNA is referred to as gRNA_M9.

[0034] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence set forth in SEQ ID NO: 107 minus 78 bases of stem-loop 6. The nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 115, wherein the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 125 and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 135. Furthermore, the nucleotide sequence of the guide RNA is set forth in SEQ ID NO: 13, and the guide RNA is referred to as gRNA_M10.

[0035] In one embodiment, the nucleotide sequence of the RNA backbone is the nucleotide sequence of SEQ ID NO: 107 minus 82 bases of stem-loop 6. The nucleotide sequence of the RNA backbone is SEQ ID NO: 116, in which the nucleotide sequence of the tracrRNA is SEQ ID NO: 126 and the nucleotide sequence of the tracr pairing is SEQ ID NO: 136. Furthermore, the nucleotide sequence of the guide RNA is As shown in SEQ ID NO: 14, the guide RNA is called gRNA_M11.

[0036] In one embodiment of the present invention, the guide RNA further comprises an RNA structure-stabilizing sequence provided at the 3' end of the guide RNA.

[0037] In one embodiment of the present invention, the RNA structure-stabilizing sequence is represented by SEQ ID NOs: 137 to 139.

[0038] In one embodiment, the RNA structure-stabilizing sequence TTTTATTTTTT is provided after the gene target region of gRNA_M1 to obtain gRNA_M12, whose nucleotide sequence is set forth in SEQ ID NO: 15.

[0039] In one embodiment, the RNA structure-stabilizing sequence TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA is inserted after the gene target region of gRNA_M1 to obtain gRNA_M13, the nucleotide sequence of which is set forth in SEQ ID NO: 16.

[0040] In one embodiment, the RNA structure-stabilizing sequence ACATGCGATTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA is inserted after the gene target region of gRNA_M1 to obtain gRNA_M14, the nucleotide sequence of which is set forth in SEQ ID NO: 17.

[0041] In some embodiments, the guide RNA further comprises a transcription terminator.

[0042] In the guide RNA described in the present invention, the gene target region comprises a nucleotide sequence complementary to a sequence in a target gene, and the target sequence of the target gene interacts with the target gene in a sequence-specific manner by hybridization (i.e., base pairing). The gene target region of the guide RNA can be modified, for example, by genetic engineering methods, so that the guide RNA hybridizes to any desired sequence in the target gene. The guide RNA guides the bound polypeptide to a specific nucleotide sequence in the target gene via the gene target region.

[0043] In some embodiments, the target gene is a DNA sequence. In some embodiments, the target gene is an RNA sequence.

[0044] The present invention further provides a method for modifying the guide RNA, wherein the variant sequence of the guide RNA refers to a sequence in which some nucleotides have been added, deleted, or substituted relative to the nucleotide sequence shown in SEQ ID NO: 4 to SEQ ID NO: 5. Preferably, the variant sequence of the guide RNA refers to a sequence in which nucleotides have been deleted from the 5'-end and / or 3'-end of the nucleotide sequence shown in SEQ ID NO: 4 to SEQ ID NO: 5. That is, a certain number of nucleotides can be deleted or truncated only at the 5'-end, a certain number of nucleotides can be deleted or truncated only at the 3'-end, or a certain number of nucleotides can be deleted or truncated simultaneously at both the 5'-end and the 3'-end. Preferably, the variant sequence of the guide RNA refers to a sequence in which nucleotides have been shortened, added, or substituted within the nucleotide sequence shown in SEQ ID NO: 4 to SEQ ID NO: 5. That is, nucleotide shortening, addition, and substitution can be performed in multiple combinations at any one or more positions in the center. Preferably, the variant sequence of the guide RNA refers to a sequence in which some nucleotides have been added, deleted, or substituted at any position at the 5' end and / or 3' end and / or center of the nucleotide sequence shown in SEQ ID NO: 4 to SEQ ID NO: 5.

[0045] In one embodiment, the variant sequence of the guide RNA is obtained by deleting 30 bases of stem-loop 1 from the nucleotide sequence set forth in SEQ ID NO: 4, and the nucleotides obtained after the deletion are referred to as gRNA_M2, and the gRNA_M2 nucleotide sequence is set forth in SEQ ID NO: 5.

[0046] In one embodiment, the variant sequence of the guide RNA is gRNA_M3 obtained by deleting 34 nt bases of stem-loop 6 from the nucleotide sequence shown in SEQ ID NO: 5 and then adding a GAAA linker to the shortened site, and the nucleotide sequence of gRNA_M3 is shown in SEQ ID NO: 6.

[0047] In one embodiment, the variant sequence of the guide RNA is gRNA_M4 obtained by deleting 43 nt bases of stem-loop 6 from the nucleotide sequence shown in SEQ ID NO: 5 and then adding a GAAA linker to the shortened site, and the nucleotide sequence of gRNA_M4 is shown in SEQ ID NO: 7.

[0048] In one embodiment, the variant sequence of the guide RNA is gRNA_M5 obtained by deleting 51 nt bases of stem-loop 6 from the nucleotide sequence shown in SEQ ID NO: 5 and then adding a GAAA linker to the shortened site, and the nucleotide sequence of gRNA_M5 is shown in SEQ ID NO: 8.

[0049] In one embodiment, the variant sequence of the guide RNA is gRNA_M6, which is obtained by deleting 57 nt bases of stem-loop 6 from the nucleotide sequence shown in SEQ ID NO: 5 and then adding a GAAA linker to the shortened site, and the nucleotide sequence of gRNA_M6 is shown in SEQ ID NO: 9.

[0050] In one embodiment, the variant sequence of the guide RNA is gRNA_M7, which is obtained by deleting 64 nt bases of stem-loop 6 from the nucleotide sequence shown in SEQ ID NO: 5 and then adding a GAAA linker to the shortened site, and the nucleotide sequence of gRNA_M7 is shown in SEQ ID NO: 10.

[0051] In one embodiment, the variant sequence of the guide RNA is gRNA_M8 obtained by deleting 70 nt bases of stem-loop 6 from the nucleotide sequence shown in SEQ ID NO: 5 and then adding a GAAA linker to the shortened site, and the nucleotide sequence of gRNA_M8 is shown in SEQ ID NO: 11.

[0052] In one embodiment, the variant sequence of the guide RNA is gRNA_M9 obtained by deleting 74 nt bases of stem-loop 6 from the nucleotide sequence shown in SEQ ID NO: 5 and then adding a GAAA linker to the shortened site, and the nucleotide sequence of gRNA_M9 is shown in SEQ ID NO: 12.

[0053] In one embodiment, the variant sequence of the guide RNA is gRNA_M10, which is obtained by deleting 78 nt bases of stem-loop 6 from the nucleotide sequence shown in SEQ ID NO: 5 and then adding a GAAA linker to the shortened site, and the nucleotide sequence of gRNA_M10 is shown in SEQ ID NO: 13.

[0054] In one embodiment, the variant sequence of the guide RNA is gRNA_M11, which is obtained by deleting 82 nt bases of stem-loop 6 from the nucleotide sequence shown in SEQ ID NO: 5 and then adding a GAAA linker to the shortened site, and the nucleotide sequence of gRNA_M11 is shown in SEQ ID NO: 14.

[0055] In one embodiment, the variant sequence of the guide RNA is gRNA_M12 obtained by adding TTTATTTTTTT to the 3' end of the nucleotide sequence shown in SEQ ID NO: 4, and the nucleotide sequence of gRNA_M12 is shown in SEQ ID NO: 15.

[0056] In one embodiment, the variant sequence of the guide RNA is gRNA_M13 obtained by adding TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA to the 3' end of the nucleotide sequence shown in SEQ ID NO: 4, and the nucleotide sequence of gRNA_M13 is shown in SEQ ID NO: 16.

[0057] In one embodiment, the variant sequence of the guide RNA is gRNA_M14 obtained by adding ACATGCGATTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA to the 3' end of the nucleotide sequence shown in SEQ ID NO: 4, and the nucleotide sequence of gRNA_M14 is shown in SEQ ID NO: 17.

[0058] The present invention provides modified guide RNAs that can be modified to hybridize with any desired sequence within a target gene; or to alter the properties of the guide RNA itself, for example, to increase the stability of the guide RNA (including, but not limited to, increasing resistance to degradation by ribonucleases (RNases) present in cells) and thereby extend its half-life in cells; or to enhance the formation or stability of a CRISPR-AcC2C9 genome editing complex comprising a guide RNA and an endonuclease (e.g., AcC2C9 nuclease) through modification; or to enhance the specificity of the genome editing complex through modification; or to enhance the initiation site, stability, or kinetics of the interaction between the genome editing complex and a target sequence in the genome through modification; or to reduce the likelihood or extent of an innate immune response caused by RNA introduced into a cell through modification. In the present invention, guide RNA can be modified to alter several properties of the CRISPR-AcC2C9 system (described below), for example, to enhance the formation, target-specific activity, specificity, stability, or kinetics of the CRISPR-AcC2C9 genome editing complex. RNA can be modified by any modification known in the art, including, but not limited to, 2'-fluoro or 2'-amino modifications of pyrimidine ribose, base residues, or the reverse base at the 3' end of the RNA. In the present invention, guide RNA can be modified by any one or a combination of multiple modifications. In some embodiments, guide RNA introduced into a cell is modified to edit any one or more genomic loci.

[0059] The present invention further provides an isolated polynucleotide encoding the guide RNA of any one of the preceding claims.

[0060] The present invention further provides a construct comprising the isolated polynucleotide described above. The construct can generally be constructed by inserting the isolated polynucleotide into an appropriate expression vector, and those skilled in the art can select an appropriate expression vector. The construct may be, for example, a recombinant expression vector. Any appropriate expression vector compatible with the host cell may be used, including, but not limited to, viral vectors (e.g., vaccinia virus-based viral vectors, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus), retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, e.g., Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus).

[0061] In some embodiments, multiple guide RNAs are used simultaneously in the same cell to simultaneously regulate the transcription of different positions on the same target gene or different target genes.When multiple guide RNAs are used simultaneously, they can be present in the same expression vector or different vectors, and can be expressed simultaneously, and when present in the same vector, they can be expressed under the same control element.

[0062] In some embodiments, the nucleotide sequence encoding the guide RNA is operably linked to a control element, such as a transcriptional control element, such as a promoter. In some embodiments, the nucleotide sequence encoding the guide RNA is operably linked to an inducible promoter. In some embodiments, the nucleotide sequence encoding the guide RNA is scannably linked to a constitutive promoter. The transcriptional control element can function in eukaryotic cells, such as mammalian cells (HEK293T cells), or prokaryotic cells (e.g., bacterial or archaeal cells). In some embodiments, the nucleotide sequence encoding the guide RNA is operably linked to multiple control elements so that the nucleotide sequence encoding the guide RNA can be expressed in both prokaryotic and eukaryotic cells.

[0063] In the present invention, the guide RNA can be synthesized by artificial synthesis, for example, by chemical synthesis, and thus can be easily modified in various ways. The modification can be any modification method known in the art, such as the use of a polyA tail, the addition of a 5' cap analog, the addition of a 5' or 3' untranslated region (UTR), the introduction of thiophosphorylated 2'-O-methyl nucleotides at the 5' or 3' end, or the removal of 5'-terminal phosphate esters by phosphatase treatment.

[0064] In some embodiments, the nucleotide sequence encoding the guide RNA comprises one or more modifications used, for example, to enhance activity, stability or specificity, alter delivery, reduce the innate immune response in host cells, or otherwise enhance.

[0065] In some embodiments, one or more targeting moieties or conjugates for the activity, cellular distribution, or cellular uptake of the nucleotide sequence encoding the guide RNA are chemically linked to the guide RNA. The targeting moiety or conjugate may include a conjugate group covalently linked to a functional group, including a reporting molecule, a polyamine, or polyethylene glycol. In some embodiments, a group that enhances pharmacodynamic properties is linked to the gRNA, including a group that improves uptake, a group that enhances resistance to degradation, and / or a group that enhances sequence-specific hybridization of the target nucleic acid.

[0066] In the present invention, the nucleic acid comprising a polynucleotide encoding a guide RNA may be a nucleic acid mimic, such as a peptide nucleic acid, which is a polynucleotide mimic with excellent hybridization properties.

[0067] In the present invention, the guide RNA or a polynucleotide encoding the guide RNA can be applied to any organism or in vitro environment, including but not limited to bacteria, archaea, fungi, protists, plants, or animals. Correspondingly, applicable target cells include but are not limited to bacterial cells, archaea cells, fungal cells, protists, plant cells, or animal cells. Applicable target cells can be any type of cell, including stem cells, somatic cells, etc.

[0068] The present invention further provides an expression system comprising the above-described construct or having an exogenous polynucleotide integrated into its genome. The host cell is selected from the group consisting of a eukaryotic cell or a prokaryotic cell, preferably, the host cell is selected from the group consisting of a mouse cell and a human cell.

[0069] The present invention further provides a gene editing system comprising the guide RNA or the polynucleotide described in any one of the above, which may further comprise a nuclease or a polynucleotide encoding the same.

[0070] In the editing system described herein, the polynucleotide encoding the nuclease comprises a coding sequence encoding only the nuclease, a coding sequence for the nuclease and various additional coding sequences, a coding sequence for the nuclease (and any additional coding sequences), and a non-coding sequence. The polynucleotide encoding the guide RNA comprises a coding sequence encoding only the guide RNA, a coding sequence for the guide RNA and various additional coding sequences, a coding sequence for the guide RNA (and any additional coding sequences), and a non-coding sequence. In some embodiments, the gene editing system comprises one or more vectors, wherein the one or more vectors comprise (i) a first regulatory element operably linked to the polynucleotide encoding the nuclease and (ii) a second regulatory element operably linked to the polynucleotide encoding the guide RNA nucleotide sequence, wherein (i) and (ii) are located on the same or different vectors. In some embodiments, the gene editing system comprises (i) a nuclease or a variant thereof and (ii) a vector comprising a coding sequence for the guide RNA. In another embodiment, the system comprises a complex of a guide RNA and a nuclease.

[0071] The first regulatory element can regulate transcription of a polynucleotide encoding the nuclease or a variant thereof. The number of polynucleotides encoding the nuclease or a variant thereof may be one or more, and the number of first regulatory elements may be one or more. The second regulatory element can regulate transcription of a polynucleotide encoding the guide RNA. The number of polynucleotides encoding the guide RNA may be one or more, and the number of second regulatory elements may be one or more.

[0072] The system described in the present invention can include one guide RNA or multiple guide RNAs at the same time. In one embodiment, the system includes multiple guide RNAs at the same time, so as to simultaneously modify different positions on the same target DNA or different target DNAs. In one embodiment, two or more guide RNAs target the same gene, transcript, or locus. In one embodiment, two or more guide RNAs target different, unrelated loci. In some embodiments, two or more guide RNAs target different, but related loci.

[0073] In the gene editing system described in the present invention, the nuclease is a CRISPR nuclease. Preferably, the nuclease is selected from the group consisting of the Cas9, Cas12, and Cas13 protein families or variants thereof. More preferably, the Cas nuclease is selected from the group consisting of nSpCas9 and mutants thereof, SaCas9 and mutants thereof, Cas12a and mutants thereof, or C2C9 and mutants thereof, and even more preferably, AcC2C9 nuclease or a variant thereof. In some embodiments, the AcC2C9 nuclease is provided directly as a protein, for example, using exogenous protein and / or nucleic acid transformation fungal methods for protoplast transformation. The AcC2C9 nuclease can be introduced into cells by any suitable method, such as injection. The gene editing system described in the present invention recognizes a PAM sequence in the target sequence. Preferably, the PAM sequence is 5'-NAAN (where N is A, T, C, or G), and more preferably, the PAM sequence is 5'-NAAG. The above remains The gene editing system comprises a nucleic acid fragment of 12 bp to 40 bp in length, preferably 20 bp, followed by a PAM sequence, and targets at least one target sequence in a cell genome.

[0074] In one embodiment, the nucleic acid encoding the AcC2C9 nuclease is DNA. In one embodiment, the nucleic acid encoding the AcC2C9 nuclease is RNA. In one embodiment, the nucleic acid encoding the AcC2C9 nuclease is an expression vector, such as a recombinant expression vector. Any appropriate expression vector compatible with the host cell may be used, including, but not limited to, viral vectors (e.g., vaccinia virus-based viral vectors, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus), retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus).

[0075] In one embodiment, the nucleic acid encoding the AcC2C9 nuclease is set forth in SEQ ID NO: 2. In one embodiment, the present invention provides a codon-optimized polynucleotide sequence of AcC2C9 nuclease, which has at least 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.5%, 99.8%, 99.9%, or 100% sequence identity with SEQ ID NO: 2. In a preferred embodiment, a more preferred human codon-optimized coding sequence for the AcC2C9 nuclease is set forth in SEQ ID NO: 3 in the Sequence Listing, which encodes one or more functional AcC2C9 domains or encodes a polypeptide having the same function as the polypeptide encoded by the original native nucleotide sequence.

[0076] In some embodiments, the nucleotide sequence encoding the AcC2C9 nuclease is operably linked to a control element, such as a transcriptional control element, such as a promoter. In some embodiments, the nucleotide sequence encoding the AcC2C9 nuclease is operably linked to an inducible promoter. In some embodiments, the nucleotide sequence encoding the AcC2C9 nuclease is operably linked to a constitutive promoter. The transcriptional control element can function in eukaryotic cells, such as mammalian cells (HEK293T cells), or prokaryotic cells (e.g., bacterial or archaeal cells). In some embodiments, the nucleotide sequence encoding the AcC2C9 nuclease is operably linked to multiple control elements so that the nucleotide sequence encoding the AcC2C9 nuclease can be expressed in both prokaryotic and eukaryotic cells. In some embodiments, the polynucleotide sequence encoding the AcC2C9 nuclease is operably linked to an appropriate nuclear localization signal for expression in a cell or in vitro environment.

[0077] In the present invention, the polynucleotide encoding the AcC2C9 nuclease can be synthesized by artificial synthesis, for example, by chemical synthesis, and thus multiple modifications can be easily made to the polynucleotide. Any modification method known in the art can be used for the modification. In some embodiments, the polynucleotide encoding the AcC2C9 nuclease can include one or more modifications, thereby easily introducing multiple modifications, such as enhanced transcriptional activity, modified enzymatic activity, improved translation or stability (e.g., resistance to proteolysis or degradation) or specificity, modified solubility, modified delivery, or reduced innate immune response in host cells. Any modification method known in the art can be used for the modification. In some embodiments, DNA or RNA encoding the AcC2C9 nuclease to be introduced into cells is modified. In some embodiments, the nucleic acid sequence encoding the AcC2C9 nuclease is a modified nucleic acid, such as a codon-optimized nucleic acid. The modification may be a single modification or a combination of modifications.

[0078] In the present invention, a nucleic acid comprising a polynucleotide encoding an AcC2C9 nuclease may be a nucleic acid mimetic, such as a polynucleotide mimetic peptide nucleic acid with excellent hybridization properties.

[0079] In the present invention, the AcC2C9 nuclease or a polynucleotide encoding the AcC2C9 nuclease can be applied to any organism or in vitro environment, including, but not limited to, bacteria, archaea, fungi, protists, plants, or animals. Correspondingly, applicable target cells include, but are not limited to, eukaryotic and prokaryotic cells, such as, for example, bacterial cells, archaea cells, fungi cells, protists, plants, or animal cells. Eukaryotic cells include mammalian cells and plant cells, and prokaryotic cells include Escherichia coli and Mycobacterium pneumoniae. Applicable target cells may be any type of cell, including stem cells, somatic cells, etc. The present invention preferably uses mammalian HEK293T cells. The cells may be in vivo or in vitro. In one embodiment, the AcC2C9 nuclease or a nucleic acid encoding the AcC2C9 nuclease is formulated in a liposome or lipid nanoparticle.

[0080] In the system described in the present invention, AcC2C9 nuclease and guide RNA form a complex in a host cell and can recognize a PAM sequence in a target gene (e.g., target DNA) sequence, and the target sequence of the CRISPR / AcC2C9 gene editing system is a 20-bp-long nucleic acid fragment (e.g., a DNA fragment) following the PAM sequence. In one embodiment, the complex can selectively regulate transcription of the target DNA in a host cell. The CRISPR / AcC2C9 gene editing system can cleave the double strand of the target DNA, causing DNA cleavage.

[0081] In one embodiment, the system comprises a recombinant expression vector. In one embodiment, the system comprises a recombinant expression vector comprising: (i) a nucleotide sequence encoding a guide RNA, the guide RNA having (a) a first region comprising a nucleotide sequence complementary to a sequence of a target DNA and (b) a second region that interacts with an AcC2C9 nuclease, and (ii) a nucleotide sequence encoding an AcC2C9 nuclease, the AcC2C9 nuclease comprising (a) an RNA-binding portion that interacts with the guide RNA and (b) an activity portion that regulates transcription in the target DNA, wherein a site of regulated transcription in the target DNA is determined by the guide RNA.

[0082] In the present invention, AcC2C9 nuclease variants can be created by methods such as modification, mutation, DNA recombination, etc., so that the AcC2C9 nuclease variants have desired improved characteristics, such as function, activity, kinetics, and half-life. The modification can be, for example, amino acid deletion, insertion, or substitution, or can be, for example, replacing the "cleavage domain" of AcC2C9 nuclease with a homologous or heterologous cleavage domain from a different nuclease (e.g., the HNH domain of a CRISPR-associated nuclease). Any modification method for DNA-binding and / or DNA-modifying proteins known in the art, such as methylation, demethylation, or acetylation, can be used to change the DNA targeting of AcC2C9 nuclease. The DNA recombination can involve exchanging sequence fragments between DNA sequences of AcC2C9 nucleases from different sources to create chimeric DNA fragments encoding synthetic proteins with RNA-guided endonuclease activity. The above modifications, mutations, DNA recombination, etc. can be used alone or in combination.

[0083] Specifically, the AcC2C9 nuclease according to the present invention may be:

[0084] (I) A wild-type AcC2C9 nuclease or a fragment thereof, having RNA-guided nucleic acid binding activity, wherein the AcC2C9 nuclease is derived from Actinomadura craniellae C2C9, and has an amino acid sequence shown in SEQ ID NO: 1. Preferably, the humanized codon-optimized nucleic acid sequence of the AcC2C9 nuclease is shown in SEQ ID NO: 3.

[0085] (II) A variant having at least 50% sequence identity with the amino acid sequence of (I), which has RNA-guided nucleic acid binding activity.

[0086] (III) (I) or (II) above, further comprising a kernel localization signal region.

[0087] (IV) (a) one or more modifications or mutations that have significantly reduced endonuclease activity compared to before the modification or mutation, or that result in the loss of endonuclease activity; and (b) (I), (II), or (III) further comprising a polypeptide or domain having another functional activity.

[0088] (V) The AcC2C9 nuclease has endonuclease activity, (I), (II), or (III).

[0089] In some embodiments, the AcC2C9 can be used in combination with other enzyme components or other components to further develop various potential uses of the AcC2C9 nuclease. Non-limiting examples of the AcC2C9 nuclease variant in (IV) include the development of a single gene editing system based on the AcC2C9 nuclease by fusing inactivated AcC2C9 with a base deaminase, the development of a prime editing system based on the AcC2C9 nuclease by fusing inactivated AcC2C9 with a reverse transcriptase, the development of a transcription activation system based on the AcC2C9 nuclease by fusing inactivated AcC2C9 with a transcription activator, the development of an epigenetic system based on the AcC2C9 nuclease by fusing inactivated AcC2C9 with a nucleic acid epigenetic enzyme, and the development of a transcription repression system based on the AcC2C9 nuclease using inactivated AcC2C9.

[0090] AcC2C9 nuclease variants can have the following specific properties, but are not limited to:

[0091] They may have an enhanced or decreased ability to bind to a target site, or they may maintain the ability to bind to a target site.

[0092] They may have enhanced or decreased ribonuclease and / or endonuclease activity, or may maintain ribonuclease and / or endonuclease activity.

[0093] It has deaminase activity that can act on cytosine, guanine, or adenine bases, and then the deaminated site is replicated and repaired intracellularly to produce guanine, thymine, and guanine, respectively. Generates an

[0094] It has an activity of regulating the transcription of target DNA, and may either increase or decrease the transcription of target DNA at a specific position in the target DNA.

[0095] It has modified DNA targeting properties.

[0096] Increased or decreased or maintained stable.

[0097] It is capable of cleaving the complementary strand of the target DNA, but has a reduced ability to cleave the non-complementary strand of the target DNA.

[0098] It is capable of cleaving the non-complementary strand of the target DNA, but has a reduced ability to cleave the complementary strand of the target DNA.

[0099] It has the ability to cleave both complementary and non-complementary strands of reduced target DNA.

[0100] The nuclease has an enzymatic activity that modifies DNA-associated polypeptides (e.g., histones), and the enzymatic activity may be one or more of methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitination activity, ribosylation activity, etc. (These enzymatic activities catalyze covalent modifications to proteins; for example, AcC2C9 nuclease variants modify histones by methylation, acetylation, ubiquitination, phosphorylation, etc., thereby causing structural changes in DNA associated with histones and regulating the structure and properties of DNA).

[0101] In some embodiments, the AcC2C9 nuclease variant has no cleavage activity. In some embodiments, the AcC2C9 nuclease variant has single-strand cleavage activity. In some embodiments, the AcC2C9 nuclease variant has double-strand cleavage activity.

[0102] Having enhanced activity or potency means having at least 1%, 5%, 10%, 20%, 30%, 40%, 50% improved activity or potency relative to wild-type AcC2C9 nuclease.

[0103] Having reduced activity and potency means having less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5% or less than 1% of the activity or potency of wild-type AcC2C9 nuclease.

[0104] These small AcC2C9 and its variants according to the present invention can be used in any of the systems, compositions, kits and methods of the present invention described below.

[0105] Unless otherwise specified, the terms "AcC2C9" and "AcC2C9 nuclease" include wild-type AcC2C9 nuclease and all its variants, and those skilled in the art can determine the type of AcC2C9 nuclease variant by conventional means, but are not limited to those listed above.

[0106] Each component of the system described in the present invention can be delivered by a vector method, for example, for polynucleotides, nanoparticles, liposomes, ribose nucleoproteins, small molecule RNA-conjugates, chimeric and RNA-fusion protein complexes, etc. It can be, but is not limited to, these.

[0107] The system according to the present invention may further comprise one or more donor templates, hi one embodiment, the donor templates comprise a donor sequence for inserting a target gene.

[0108] The system described herein further comprises a dimeric FOK1 nuclease, optionally linked to a complete C2C9 nuclease or a partial or completely deleted AcC2C9 nuclease or guide RNA, for guiding endonucleolytic cleavage when guided to one or more specific DNA target sites by one or more guide RNA molecules.

[0109] The systems described herein can be used for gene therapy by editing or modifying DNA at multiple locations in a cell, including, but not limited to, gene therapy for disease, biological research, improving crop resistance and yield, etc.

[0110] The present invention further provides compositions comprising one or more of the aforementioned AcC2C9 nuclease or a polynucleotide encoding it, a guide RNA or a polynucleotide encoding it, a recombinant expression vector, and a system, and may further comprise an acceptable carrier, vehicle, etc. Examples of acceptable carriers and vehicles include sterile water or physiological saline, stabilizers, excipients, antioxidants (such as ascorbic acid), buffers (such as phosphate, citric acid, and other organic acids), preservatives, surfactants (such as PEG and Tween), chelating agents (such as EDTA), and binders. The compositions may also contain other low-molecular-weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; amino acids such as glycine, glutamine, asparagine, arginine, and lysine; sugars or carbohydrates such as polysaccharides and monosaccharides; and sugar alcohols such as mannitol or sorbitol. When preparing an injectable aqueous solution, such as an isotonic solution containing saline, glucose, or other auxiliary drugs (e.g., D-sorbitol, D-mannose, D-mannitol, sodium chloride), an appropriate solubilizing agent, such as alcohol (e.g., ethanol), polyalcohol (e.g., propylene glycol, PEG), or nonionic surfactant (e.g., Tween 80, HCO-50), can be used in combination. In some embodiments, the composition comprises a guide RNA and a buffer to stabilize the nucleic acid.

[0111] The present invention further provides a kit including the aforementioned system or composition. The kit may further include one or more additional reagents selected from the group consisting of a dilution buffer, a wash buffer, and a control reagent. In some embodiments, the kit includes (a) the aforementioned AcC2C9 nuclease or a nucleic acid encoding the AcC2C9 nuclease, and (b) a guide RNA or a nucleic acid encoding the guide RNA, wherein the guide RNA is capable of guiding the AcC2C9 nuclease or a variant thereof to a target polynucleotide sequence. In some embodiments, the kit further includes a donor template including a foreign polynucleotide sequence, wherein the foreign polynucleotide sequence is capable of being inserted into the target polynucleotide sequence.

[0112] The present invention further provides a gene editing method, which involves contacting a target gene with the above-mentioned gene editing system to edit the target gene.The method of the present invention can be used to target, edit, modify or manipulate a target gene (e.g., target DNA) in a cell or in vivo, in an in vitro cell or cell-free system, and the method includes introducing the above-mentioned AcC2C9 nuclease or a polynucleotide encoding it, a guide RNA or a polynucleotide encoding it, a recombinant expression vector, a system, a composition, etc. into an in vivo, in vitro cell or cell-free system of the kit, and targeting the target gene. In one embodiment, the method comprises the steps of:

[0113] (a) introducing the AcC2C9 nuclease or a nucleic acid encoding the AcC2C9 nuclease into an in vivo, in vitro cell or cell-free system;

[0114] (b) introducing said guide RNA (gRNA) or a nucleic acid (e.g., DNA) suitable for generating such a guide RNA in situ.

[0115] (c) contacting a cell or a target gene with AcC2C9 nuclease or a nucleic acid encoding AcC2C9 nuclease, a guide RNA (gRNA) or a nucleic acid suitable for generating such a guide RNA in situ, to cause one or more cuts, nicks or edits in the target gene, wherein the AcC2C9 nuclease is guided to the target gene by a processed or unprocessed form of the guide RNA.

[0116] In some embodiments, the gene editing method described in the present invention comprises the following steps:

[0117] i) introducing the AcC2C9 nuclease or a polynucleotide encoding it, and the guide RNA or a polynucleotide encoding it into a cell.

[0118] ii) creating one or more nicks in the target gene mediated by the AcC2C9 nuclease, or targeting, editing, modifying or manipulating the target gene.

[0119] The parameter conditions in the gene editing method described in the present invention can be adjusted based on the general knowledge in the art, for example, the concentration of the expression vector containing the nuclease and guide RNA is preferably 1 μg, and the time from transfecting the cells to editing is preferably 72 hours.

[0120] In the gene editing method described in the present invention, the AcC2C9 nuclease is guided to a target gene by a guide RNA in a processed or unprocessed form. The AcC2C9 nuclease and the guide RNA form a complex and recognize a PAM sequence on the target gene. In some preferred embodiments, the method further comprises introducing a donor template containing a foreign polynucleotide sequence into a cell.

[0121] The present invention further provides use of the aforementioned guide RNA, isolated polynucleotide, construct, expression system, gene editing system, pharmaceutical composition, or method in performing gene editing on a target gene and / or its associated polypeptide in vivo, in an in vitro cell, or in a cell-free environment. The in vitro cell is at least one selected from the group consisting of a bacterial cell, an archaeal cell, a fungal cell, a protist cell, a viral cell, a plant cell, and an animal cell. The gene editing is selected from the group consisting of gene truncation, gene deletion, gene insertion, point mutation, transcriptional repression, transcriptional activation, base editing, and guided editing, including, but not limited to: cleaves the target gene; Regulating the expression of target genes; Genetically modifying target genes; Genetically modifying target gene-related polypeptides; Used for deliberate and controlled damage at any desired location in the target gene; Used for deliberate and controlled repair at any desired location in a target gene; The target gene is modified by means other than introducing a double-strand break. (AcC2C9 nuclease has enzymatic activity and modifies the target gene by means other than introducing a double-strand break. The enzymatic activity may be that possessed by AcC2C9 itself, or may be obtained by fusing a heterologous polypeptide having enzymatic activity to AcC2C9 nuclease to form a chimeric AcC2C9 nuclease. The enzymatic activity includes, but is not limited to, methyltransferase activity, deammoniating activity, dismutase activity, alkylating activity, demethylase activity, DNA repair activity, transposon activity, recombinase activity, DNA damaging activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, etc.)

[0122] Preferably, the gene editing is gene deletion or gene truncation, and the gene editing includes, but is not limited to, one or more of the following: correction of pathogenic sites, research into gene function, enhancement of cell function, cell therapy, etc.

[0123] The AcC2C9 nuclease or polynucleotide encoding it, guide RNA or polynucleotide encoding it, recombinant expression vector, system, composition and kit of the present invention can be used in the fields of research, diagnostics, industry (e.g., microbial engineering), drug discovery (e.g., high-throughput screening), target validation, imaging and therapeutics.

[0124] In some embodiments, the target gene is target DNA. In some embodiments, the target DNA may be in vitro naked DNA not bound to DNA-associated proteins. In some embodiments, the target DNA is chromosomal DNA in an in vitro cell. In some embodiments, the target gene is target RNA. In some embodiments, the target DNA is contacted with a targeting complex comprising the AcC2C9 nuclease and a guide RNA, where the guide RNA contains a nucleotide sequence complementary to the target DNA, thereby providing target specificity to the targeting complex, and the AcC2C9 nuclease provides site-specific activity. In some embodiments, the targeting complex modifies the target DNA, for example, causing DNA cleavage, DNA methylation, DNA damage, DNA repair, etc. In some embodiments, the targeting complex modifies a target DNA-associated polypeptide (e.g., histone, DNA-binding protein, etc.), for example, causing target DNA-associated polypeptide-histone methylation, histone acetylation, histone ubiquitination, etc.

[0125] In the methods described herein, a nucleic acid containing a nucleotide sequence of an AcC2C9 nuclease or a polypeptide encoding an AcC2C9 nuclease can be introduced into cells by known methods. Similarly, a guide RNA or a nucleic acid containing a nucleotide sequence encoding a guide RNA can be introduced into cells by known methods. Known methods include DEAE-dextran-mediated transfection, liposome-mediated transfection, virus or phage infection, lipofection, transfection, conjugation, protoplast fusion, polyethyleneimine-mediated transfection, electroporation, calcium phosphate precipitation, gene gun, calcium phosphate precipitation, microinjection, nanoparticle-mediated nucleic acid delivery, and the like. For example, plasmids are delivered by electroporation, calcium chloride transfection, microinjection, and lipofection. For delivery by a viral vector, cells are contacted with viral particles containing a nucleic acid and / or donor polynucleotide encoding a guide RNA and / or an AcC2C9 nuclease and / or a chimeric AcC2C9 nuclease.

[0126] In some embodiments, in the methods of the present invention, the nuclease is They cleave the target DNA in the target region, generating double-strand breaks, which the cell then repairs, typically by non-homologous end joining (NHEJ) and homology-directed repair.

[0127] The present invention further provides host cells genetically modified with the above-mentioned AcC2C9 nuclease or a polynucleotide encoding it, a guide RNA or a polynucleotide encoding it, a recombinant expression vector, a system, or a composition, or cells obtained by gene editing using the above-mentioned gene editing system or method.

[0128] In the present invention, the effective dosage of the guide RNA and / or AcC2C9 nuclease and / or recombinant expression vector and / or donor polynucleotide is conventional for those skilled in the art and can be determined according to different administration routes and the characteristics of the disease to be treated.

[0129] In the present invention, the bacteria or prokaryotic bacteria may be Escherichia coli, Pneumoniae klebsiella, Bacteroides obatus, Campylobacter jejuni, saprophytic Staphylococcus aureus, Enterococcus faecalis, Bacteroides thetaiotaomicron, Bacteroides vulgatus, Bacteroides uniformis, Lactobacillus casei, Bacteroides fragilis, Acinetobacter ruvofii, Fusobacterium nucleatum, Parabacteroides johnsonii, Bacteroides oreiciprenus, Lactobacillus rhamnosus, Bacteroides massiliensis, Parabacteroides meldae, Fusobacterium mortiferum, Bifidobacterium breve, etc.

[0130] In the present invention, the eukaryotic cells include, but are not limited to, eukaryotic cells such as mammalian cells and fungi. The fungi include yeasts and Aspergillus, such as Saccharomyces cerevisiae, Hansenula polymorpha, Pichia pastoris, Kluyveromyces fragilis, Kluyveromyces lactis, and Schizosaccharomyces pombe, Candida albicans, Candida dubliniensis, Candida glabrata, Candida guilliermondii, Candida kefir, Candida krusei, Candida lusitaniae, and Candida. The species may be, for example, Candida melinii, Candida oleophila, Candida parapsilosis, Candida tropicalis and Candida utilis, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus clavatus, Aspergillus glaucus group, Aspergillus nidulans, Aspergillus oryzae, Aspergillus terreus, Aspergillus ustus, and Aspergillus versicolor.

[0131] In the present invention, a novel genome editing method based on the ultra-small CRISPR / AcC2C9 nuclease is disclosed. The present invention demonstrates that, thanks to the guiding and localization functions of the guide RNA, AcC2C9 can precisely cleave genomic DNA, creating double-strand breaks in the genomic DNA. By utilizing the host cell's own or exogenous repair mechanisms, the system can achieve highly efficient and precise gene editing in living cells.

[0132] The present invention further provides a method for preparing the above-mentioned guide RNA, which includes individually or in combination modifying the tracrRNA and crRNA of the basic guide RNA, and the modification is selected from shortening, elongating, or substituting some nucleotides in the tracrRNA or crRNA, or linking the tracrRNA and crRNA via a linker to prepare the guide RNA.

[0133] Some of the sequences described in this invention are shown below.

[0134] The AcC2C9 nuclease according to the present invention is Actinomadura craniellae C2C9 (AcC2C9), and its amino acid sequence preferably comprises the sequence shown below. (SEQ ID NO: 1) JPEG2025532580000001.jpg70167

[0135] The E. coli codon-optimized nucleotide sequence encoding the AcC2C9 nuclease comprises the following sequence: (SEQ ID NO: 2) JPEG2025532580000002.jpg211169

[0136] The human codon-optimized nucleotide sequence encoding the AcC2C9 nuclease comprises the following sequence: (SEQ ID NO: 3) JPEG2025532580000003.jpg188169

[0137] The different versions of the guide RNA sequences corresponding to the AcC2C9 nuclease described in the present invention are shown below, where the part marked in light gray is the RNA backbone sequence, and if the guide RNA has a linker, the linker sequence is GAAA, and the linker functions as a part of the backbone; Dotted underline The part marked with is tracrRNA, Double underline The part marked with is the tracrRNA mate sequence, Underline The sequence marked with is the gene target region, Wavy line The part marked with is an RNA structure-stabilizing sequence.

[0138] gRNA_M1, the guide RNA for the original version of the previously discovered CRISPR / AcC2C9 system: (SEQ ID NO: 4) 5'- GAACGCGGCCCGGAACAUCGAACGCCACGCAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGC UCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAACCUUGAAUAACGAAACGGCAACGC CUCCAUA GCGGUGCAGGUCAAUAAGGGUCGGCCCCACGCGUGUAGGGAGCG AUCG agugacaguauccucuguau -3' (SEQ ID NO.4) A schematic diagram of its secondary structure is shown in Figure 1, in which the nucleotide sequence of the RNA backbone is shown in SEQ ID NO: 106, the nucleotide sequence of the tracrRNA is shown in SEQ ID NO: 117, and the nucleotide sequence of the tracr pairing is shown in SEQ ID NO: 127.

[0139] gRNA_M2, a guide RNA sequence of the CRISPR / AcC2C9 optimized version according to the present invention: (SEQ ID NO: 5) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAACCUUGAAUAACGAAACGGCAACGC CUCCAUA GCGGUGCAGGUCAAUAAGGGUCGGCCCCACGCGUGUAGGGAGCG AUCG agugacaguauccucuguau -3' (SEQ ID NO.5) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 107, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 140, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 127.

[0140] gRNA_M3: (SEQ ID NO: 6) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAACCUUGAAUAACGAAAC GAAA GUCGGCCCCACGCGUGUAGGGAGCG AUCG agugacaguauccucuguau -3' (SEQ ID NO.6) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 108, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 118, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 128.

[0141] gRNA_M4: (SEQ ID NO: 7) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAACCUUGAAUAACG GAAA CCCCACGCGUGUAGGGAGCG AUCG agugacaguauccucuguau -3' (SEQ ID NO.7) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 109, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 119, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 129.

[0142] gRNA_M5: (SEQ ID NO: 8) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAACCUUGAAU GAAA ACGCGUGUAGGGAGCG AUCG agugacaguauccucuguau -3' (SEQ ID NO.8) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 110, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 120, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 130.

[0143] gRNA_M6: (SEQ ID NO: 9) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAACCUUG GAAA CGUGUAGGGAGCG AUCG agugacaguauccucuguau -3' (SEQ ID NO.9) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 111, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 121, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 131.

[0144] gRNA_M7: (SEQ ID NO: 10) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAAC GAAA GUAGGGAGCG AUCG agugacaguauccucuguau -3' (SEQ ID NO.10) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 112, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 122, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 132.

[0145] gRNA_M8: (SEQ ID NO: 11) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCC GAAA GGGAGCG AUCG agugacaguauccucuguau -3' (SEQ ID NO.11) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 113, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 123, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 133.

[0146] gRNA_M9: (SEQ ID NO: 12) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUC GAAA GAGCG AUCG agugacaguauccucuguau -3' (SEQ ID NO.12) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 114, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 124, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 134.

[0147] gRNA_M10: (SEQ ID NO: 13) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGC GAAA GCG AUCG agugacaguauccucuguau -3' (SEQ ID NO. 13) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 115, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 125, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 135.

[0148] gRNA_M11: (SEQ ID NO: 14) 5'- CAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGAC GAAA G AUCG agugacaguauccucuguau -3' (SEQ ID NO. 14) wherein the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 116, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 126, and the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 130. The nucleotide sequence is shown in SEQ ID NO:136.

[0149] gRNA_M12: (SEQ ID NO: 15) 5'- GAACGCGGCCCGGAACAUCGAACGCCACGCAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAACCUUGAAUAACGAAACGGCAACGC CUCCAUA GCGGUGCAGGUCAAUAAGGGUCGGCCCCACGCGUGUAGGGAGCG AUCG agugacaguauccuguauUUUUAUUUUUU -3' (SEQ ID NO.15) Here, the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 106, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 117, the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 127, and the nucleotide sequence of the RNA structure-stabilizing sequence is set forth in SEQ ID NO: 137.

[0150] gRNA_M13: (SEQ ID NO: 16) 5'- GAACGCGGCCCGGAACAUCGAACGCCACGCAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAACCUUGAAUAACGAAACGGCAACGC CUCCAUA GCGGUGCAGGUCAAUAAGGGUCGGCCCCACGCGUGUAGGGAGCG AUCG agugacaguauccucuguauUUGACGCGGUUCUAUCUAGUUACGCGUUAAACCAACUAGAAA -3' (SEQ ID NO.16) Here, the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 106, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 117, the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 127, and the nucleotide sequence of the RNA structure-stabilizing sequence is set forth in SEQ ID NO: 138.

[0151] gRNA_M14: (SEQ ID NO: 17) 5'- GAACGCGGCCCGGAACAUCGAACGCCACGCAGUGCUGAUCGAUCGAAACGUCGCCUGCGAUAGGCGGGAGACGCUAAACGCCCGUGGAGCAUCCAUAAGACCAACCACCUCUCGGGGCGGUAGGCACGACGCAUCGAAGCGGGAAGGCUCCGGCGCUCGGCCUGAGUCACCUCAGCAGAGUGAUCUGCUGACGCUCCCAACCUUGAAUAACGAAACGGCAACGC CUCCAUA GCGGUGCAGGUCAAUAAGGGUCGGCCCCACGCGUGUAGGGAGCG AUCG agugacaguauccucuguauACAUGCGAUUGACGCGGUUCUAUCUAGUUACGCGUUAAACCAACUAGAAA -3' (SEQ ID NO.17) Here, the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO: 106, the nucleotide sequence of the tracrRNA is set forth in SEQ ID NO: 117, the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 127, and the nucleotide sequence of the RNA structure-stabilizing sequence is set forth in SEQ ID NO: 139.

[0152] The terms "AcC2C9," "AcC2C9 nuclease," "AcC2C9 polypeptide," "AcC2C9 protein," and "AcC2C9 protein" can be used interchangeably.

[0153] The terms "guide RNA," "gRNA," "single gRNA," and "chimeric gRNA" can be used interchangeably.

[0154] The term "one" or "an" entity refers to one or more entities, and thus the terms "one" (or "one"), "one or more," and "at least one" can be used interchangeably herein.

[0155] The terms "homology" or "identity" or "similarity" refer to the degree of similarity between two peptides or refers to the sequence similarity between two nucleic acid molecules. Homology can be determined by comparing corresponding positions in different polypeptide or nucleic acid molecules; if the same position in the compared molecular sequences is occupied by the same base or amino acid in the different sequences, the molecules are homologous at that position. The degree of homology between sequences is determined as a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence should have less than 20% homology with one of the sequences disclosed in this invention.

[0156] A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a certain percentage of sequence identity (e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%) with another polynucleotide or polynucleotide region (or polypeptide or polypeptide region) means that, in the case of a match, that percentage of bases (or amino acids) in the two sequences being matched are the same. Such alignments and percentage homology or sequence identity can be determined using software programs and methods known in the art.

[0157] In the present invention, the terms "polynucleotide" and "oligonucleotide" are used interchangeably and refer to a polymeric form of nucleotides of any length, whether deoxyribonucleotides, ribonucleotides, or analogs thereof. Polynucleotides can have any three-dimensional structure and can perform any function, known or unknown. Examples of polynucleotides include, but are not limited to, genes or gene fragments (including probes, primers, ESTs, or SAGE tags), exons, introns, messenger RNA (mRNA), transporter RNA, ribosomal RNA, ribozymes, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides also include modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications, if present in a polynucleotide, can be imparted before or after assembly of the polynucleotide. Nucleotide sequences can be cleaved by non-nucleotide moieties. Polynucleotides can be further modified after polymerization and labeled, for example, by coupling with a labeling moiety. The term refers simultaneously to double-stranded and single-stranded polynucleotide molecules. Any embodiment of a polynucleotide disclosed in the present invention includes its double-stranded form and any of two complementary single-stranded forms known or predicted to be capable of constituting a double-stranded form, unless otherwise stated or required.

[0158] The term "encode," when applied to a polynucleotide, refers to a polynucleotide that "encodes" a polypeptide, i.e., that in its natural state or when manipulated by methods known to those of skill in the art, is capable of producing a target polypeptide and / or fragments thereof by transcription and / or translation, or of producing mRNA that encodes the target polypeptide and / or fragments thereof. An antisense strand is a sequence complementary to the polynucleotide from which a coding sequence can be derived.

[0159] The term "genomic DNA" refers to the DNA of an organism's genome, and includes the DNA of a bacterium, archaea, fungus, protist, virus, plant, or animal genome.

[0160] The term "manipulating" DNA includes binding to the DNA, creating a nick in a single strand, or breaking a double strand of the DNA, or modifying or editing the DNA or a polypeptide bound to the DNA. Manipulating DNA can also include silencing, activating, or modulating (preventing transcription or reducing transcriptional activity or inhibiting translation) the expression of an RNA or polypeptide encoded by said DNA. The cleavage can be achieved by various methods, such as enzyme-catalyzed or chemical hydrolysis of phosphodiester bonds, can result in single-strand or double-strand breaks, and can generate blunt or overhanging ends.

[0161] The terms "hybridizable" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA) that comprises a nucleotide sequence that allows it to non-covalently bind to another nucleic acid in a sequence-specific, antiparallel manner, i.e., form Watson-Crick and / or G / U base pairs, "anneal" or "hybridize," under appropriate in vitro and / or in vivo conditions of temperature and solution ionic strength.

[0162] It should be understood in the art that the sequence of a polynucleotide does not need to be 100% complementary to the sequence of a target nucleic acid to be specifically hybridizable. A polynucleotide can hybridize to one or more regions. A polynucleotide can comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it is targeted.

[0163] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein and refer to polymeric forms of amino acids of any length, and may include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones.

[0164] The term DNA sequence "encoding" a particular RNA refers to a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA that is translated into protein (mRNA) or an RNA that is not translated into protein (e.g., tRNA, rRNA, or gRNA, also referred to as "non-coding" RNA or "ncRNA"). A "protein coding sequence," or a sequence that encodes a particular protein or polypeptide, is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and translated into a polypeptide (in the case of mRNA) in vivo or in vitro under the control of appropriate regulatory sequences.

[0165] The term "vector" or "expression vector" refers to a replicon, such as a plasmid, phage, virus, or cosmid, to which another DNA region, i.e., an "insert," can be attached so as to bring about replication of the attached fragment in a cell.

[0166] The term "expression cassette" comprises a DNA coding sequence operably linked to a promoter. "Operably linked" refers to a juxtaposition in which the components are in a relationship permitting them to function in their expected manner. The terms "recombinant expression vector" or "DNA construct" are used interchangeably herein to refer to a DNA molecule comprising a vector and at least one insert. Recombinant expression vectors are typically generated for the purposes of expressing and / or amplifying an insert or constructing other recombinant nucleotide sequences.

[0167] A cell has been "genetically modified," "transformed," or "transfected" by foreign DNA, such as a recombinant expression vector, when that DNA has been introduced into the cell. The presence of the foreign DNA results in a permanent or temporary genetic alteration. The transforming DNA may or may not be integrated into the cell's genome.

[0168] The term "target DNA" refers to a DNA polynucleotide that contains a "target site" or "target sequence." In the present invention, the terms "target site," "target sequence," "target protospacer DNA," or "protospacer-like sequence" are used interchangeably and refer to a nucleic acid sequence present in the target DNA to which the DNA-targeting region of a gRNA binds when sufficient binding conditions exist. The RNA molecule contains a sequence that binds to, hybridizes with, or is complementary to the target sequence in the target DNA, thereby targeting the bound polypeptide to a specific location (target sequence) in the target DNA. "Cleavage" refers to a break in the covalent backbone of a DNA molecule.

[0169] The terms "nuclease" and "endonuclease" are used interchangeably and refer to an enzyme having catalytic internal nucleolytic activity to cleave polynucleotides. A "cleavage domain" or "active domain" or "nuclease domain" of a nuclease is a polypeptide sequence or domain that possesses catalytic activity for DNA cleavage in a nuclease. A cleavage domain may be contained in a single polypeptide chain, or the cleavage activity may result from the combination of two or more polypeptides.

[0170] "Localization polypeptide" or "RNA-binding site guide polypeptide" refers to a polypeptide that binds to RNA and targets it to a specific DNA sequence.

[0171] The term "guide sequence" or DNA-target region (or "DNA-target sequence") comprises a nucleotide sequence (complementary strand of target DNA) that is complementary to a specific sequence in the target DNA, referred to in the present invention as a "protospacer-like" sequence.

[0172] The term "recombination" refers to the process of exchanging genetic information between two polynucleotides. As used herein, "homologous recombination repair (HDR)" refers to a specific type of DNA repair that occurs, for example, during the repair of double-strand breaks in cells. This process requires nucleotide sequence homology and uses a "donor" molecule as a template to repair a "target" molecule (i.e., the molecule that has suffered a double-strand break), resulting in the transfer of genetic information from the donor to the target. If the donor polynucleotide and the target molecule are different and some or all of the sequence of the donor polynucleotide is incorporated into the target DNA, homologous recombination repair can result in an alteration (e.g., insertion, deletion, mutation) of the target molecule sequence.

[0173] The term "non-homologous end joining (NHEJ)" refers to the repair of double-strand breaks in DNA by directly joining the broken ends without the need for a homologous template. NHEJ often results in the deletion of nucleotide sequences near the double-strand break.

[0174] The term "treatment" includes preventing the onset of a disease or condition, suppressing a disease or condition, or alleviating a disease.

[0175] The terms "individual," "subject," "host," and "patient" are used interchangeably herein and refer to any mammalian subject, particularly humans, for whom diagnosis, treatment, or therapy is desired.

[0176] While the present invention will be described below using specific examples, those skilled in the art will readily understand other advantages and effects of the present invention from the contents disclosed herein. The present invention can be implemented or applied in various different embodiments, and the details in this specification can be modified or changed in various ways based on different perspectives and applications without departing from the spirit of the present invention.

[0177] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the following specific embodiments, and the terms used in the examples of the present invention are intended to describe specific embodiments and do not limit the scope of protection of the present invention. After reading the contents of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent embodiments should also be understood to be within the scope limited by the claims appended hereto. For example, the development of a single gene editing system based on AcC2C9 nuclease by fusing inactivated and optimized AcC2C9 with base deaminase, the development of a prime editing system based on AcC2C9 nuclease by fusing inactivated AcC2C9 with reverse transcriptase, the development of a transcription activation system based on AcC2C9 nuclease by fusing inactivated AcC2C9 with a transcription activator, the development of an epigenetic system based on AcC2C9 nuclease by fusing inactivated AcC2C9 with a nucleic acid epigenetic enzyme, and the development of a transcription repression system based on AcC2C9 nuclease using inactivated AcC2C9. In the present description and claims, the singular forms "a," "one," and "the" are intended to include the plural forms unless expressly stated otherwise herein.

[0178] When a numerical range is given in the examples, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected unless otherwise specified in the present invention. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art. In addition to the specific methods, devices, and materials used in the examples, the present invention can also be realized using any conventional methods, devices, and materials similar or equivalent to the methods, devices, and materials described in the examples of the present invention, based on the understanding of the prior art by those skilled in the art and the description of the present invention.

[0179] The CRISPR system primarily used in the embodiments of the present invention is a V-U4 CRISPR system, in which the effector protein is primarily the Actinomadura craniellae C2C9 (AcC2C9) nuclease. AcC2C9 nuclease, guided by the corresponding guide RNA, precisely localizes the target gene and cleaves the genomic DNA, thereby creating a double-strand break in the genomic DNA. By utilizing the host cell's own or exogenous repair mechanisms, this system can achieve highly efficient and precise gene editing in living cells.

[0180] Unless specific techniques or conditions are specified in the examples, they are carried out in accordance with conventional techniques or conditions described in the literature of the art or in accordance with the specifications of the product manufacturer.

[0181] The primers used in the examples were all synthesized by Shanghai Biotechnology Co., Ltd. and Suzhou Jinweizhi Biotechnology Co., Ltd., and the reagents or equipment used, if the manufacturer is not specified, are considered to be ordinary products that can be purchased commercially. Example 1: Engineering of guide RNA corresponding to AcC2C9 nuclease

[0182] In this example, based on gRNA_M1, modifications and combination modifications were made to the guide RNA corresponding to AcC2C9 nuclease. The specific modification sites and corresponding base lengths are shown in Figure 1. The specific engineering method and modified base lengths are shown in the following sequence.

[0183] Nucleotides encoding gRNA_M1: (SEQ ID NO: 92) JPEG2025532580000004.jpg43169

[0184] Nucleotides encoding gRNA_M2, which is based on the M1 version and has 30 nt of stem-loop 1 cut off: (SEQ ID NO: 93) JPEG2025532580000005.jpg36169

[0185] Based on the M2 version, the upper half of stem-loop 6 was truncated by 34 nt, and then four bases of GAAA were added to the truncated region to form gRNA_M3: (SEQ ID NO: 94) JPEG2025532580000006.jpg37169

[0186] Based on the M2 version, the upper half of stem-loop 6 (43 nt bases) was cut, and then four bases (GAAA) were added to the shortened site, resulting in gRNA_M4: (SEQ ID NO: 95) JPEG2025532580000007.jpg37169

[0187] Based on the M2 version, the upper half of stem-loop 6 was cut off by 51 nt, and then shortened. Nucleotides encoding gRNA_M5 linked by adding four bases GAAA to the ligation site: (SEQ ID NO: 96) JPEG2025532580000008.jpg30165

[0188] Based on the M2 version, the upper half of stem-loop 6 (57 nt bases) was truncated, and then four bases (GAAA) were added to the truncated site to form gRNA_M6: (SEQ ID NO: 97) JPEG2025532580000009.jpg32165

[0189] The nucleotides encoding gRNA_M7, which was created by cutting the upper half of stem-loop 6 (64 nt bases) based on the M2 version and then adding and ligating four bases (GAAA) to the shortened site, are shown below. (SEQ ID NO: 98) JPEG2025532580000010.jpg30165

[0190] Based on the M2 version, the upper half of stem-loop 6 was truncated by 70 nt, and then four bases of GAAA were added to the truncated region to form gRNA_M8: (SEQ ID NO: 99) JPEG2025532580000011.jpg29165

[0191] Nucleotides encoding gRNA_M9, which was derived from the M2 version by cutting the upper half of stem-loop 6 (74 nt bases) and then adding four bases (GAAA) to the shortened site: (SEQ ID NO: 100) JPEG2025532580000012.jpg31167

[0192] Based on the M2 version, the upper half of stem-loop 6 (78 nt bases) was truncated, and then four bases (GAAA) were added to the truncated site to form gRNA_M10: (SEQ ID NO: 101) JPEG2025532580000013.jpg32167

[0193] Based on the M2 version, the upper half of stem-loop 6 (82 nt bases) was truncated, and then four bases (GAAA) were added to the truncated site to form gRNA_M11: (SEQ ID NO: 102) JPEG2025532580000014.jpg33167

[0194] Nucleotides encoding gRNA_M12, which is based on the M1 version and has TTTATTTTTTT added to the 3' end: (SEQ ID NO: 103) JPEG2025532580000015.jpg44167

[0195] Based on the M1 version, nucleotides encoding gRNA_M13 with TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA added to the 3' end: (SEQ ID NO: 104) JPEG2025532580000016.jpg45164

[0196] Nucleotides encoding gRNA_M14, based on the M1 version, with ACATGCGATTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA added to the 3' end: (SEQ ID NO: 105) JPEG2025532580000017.jpg50164

[0197] The nucleotide sequences of the guide RNAs are shown in SEQ ID NOs: 4 to 17. The underlined portions are the gene target regions, preferably the 20-bp fragment following the PAM sequence. In this example, human embryonic kidney cells (HEK293T) were used in the experiments.

[0198] 1. Construction of pAcC2C9hs-M1-G1 plasmid 1.1 Construction of pAcC2C9hs-M1-NSP plasmid (not including the gene target region) The following sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0199] Human codon-optimized AcC2C9 encoding gene expression cassette: (SEQ ID NO: 18) JPEG2025532580000018.jpg101169JPEG2025532580000019.jpg191168

[0200] gRNA_M1 expression cassette, a guide RNA corresponding to AcC2C9 in human cells: (SEQ ID NO: 19) JPEG2025532580000020.jpg78170

[0201] Puromycin resistance gene expression cassette: (SEQ ID NO: 20) JPEG2025532580000021.jpg111170

[0202] Human transient expression plasmid backbone: (SEQ ID NO: 21) JPEG2025532580000022.jpg200166JPEG2025532580000023.jpg16167

[0203] These four fragments were assembled into the pAcC2C9hs-M1-NSP plasmid using Gibson assembly technology. The pAcC2C9hs-M1-NSP plasmid was transformed into E. coli DH5α cells, and monoclonal clones were selected and sequenced to obtain the pAcC2C9hs-M1-NSP plasmid.

[0204] 1.2 Construction of pAcC2C9hs-M1-G1 plasmid VEGFA in the HEK293T cell genome was selected as the target sequence, and a 20-bp target sequence DNA was selected from the target sequence. The following sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0205] (SEQ ID NO: 22) Guide1_F:5'-ATCGAAGTGACAGTATCCTCTGTAT-3'

[0206] (SEQ ID NO: 23) Guide1_R:5'-AAAAATACAGAGGATACTGTCACT-3'

[0207] Phosphorylation and annealing of target sequence DNA: Annealing systems were prepared according to Table 1 below. [Table 1]

[0208] The phosphorylation process was as follows: The reaction was carried out at 37°C for 30 minutes. After that, NaCl (final concentration: 50 mM) was added to 10 μl of the reaction mixture, and annealing was carried out slowly to obtain the annealed target sequence DNA.

[0209] Next, the target sequence DNA was inserted into the pAcC2C9hs-M1-NSP plasmid by Golden Gate assembly to construct the pAcC2C9hs-M1-G1 series plasmids. The Golden Gate assembly scheme is shown in Table 2 below. [Table 2]

[0210] The ligation procedure was as follows: 37°C for 2 minutes, 16°C for 3 minutes, and then this step was repeated for a total of 25 cycles, followed by a final 80°C for 10 minutes.

[0211] The ligation product was transformed into Escherichia coli DH5α cells, and monoclonality was selected and sequenced to obtain the pAcC2C9hs-M1-G1 plasmid (transient expression plasmid) containing the target sequence.

[0212] 2. Construction of pAcC2C9hs-M2~M14-G1 series plasmids The construction steps of the plasmids were the same as in step 1, except that the gRNA_M1 expression cassette, which is the gRNA corresponding to AcC2C9 in human cells, was replaced with the gRNA_M2-gRNA_M14 expression cassettes. Thirteen optimized versions of the plasmids were designated pAcC2C9hs-M2-G1, pAcC2C9hs-M3-G1, pAcC2C9hs-M4-G1, and pAc They were named pAcC2C9hs-M5-G1, pAcC2C9hs-M6-G1, pAcC2C9hs-M7-G1, pAcC2C9hs-M8-G1, pAcC2C9hs-M9-G1, pAcC2C9hs-M10-G1, pAcC2C9hs-M11-G1, pAcC2C9hs-M12-G1, pAcC2C9hs-M13-G1, and pAcC2C9hs-M14-G1, respectively.

[0213] 3. Human cell gene editing mediated by pAcC2C9hs-M2~M14-G1 series plasmids Activated HEK293T cells were cultured in DMEM medium containing 10% FBS by volume. After the cell growth density reached approximately 90%, they were subcultured into 24-well plates, with the number of cells per well reaching approximately 1.0 × 10 5 After 16–18 hours, cells were transfected with 1000 ng of pAcC2C9hs-M1–M14-G1 plasmids, which edit different genes, using 2 μL of lipofectamine 3000 (Invitrogen) per well. After 24 hours, selection was performed by adding fresh medium containing puromycin at a final concentration of 2 μg / ml. After an additional 48 hours of culture, adherent cells were detached and genomic DNA was extracted.

[0214] The target gene fragment was amplified using PCR, and the PCR product recovered from the gel was annealed in NEBuffer2 (NEB). T7 endonuclease 1 (NEB) was then added to the PCR reaction system, and the enzyme digestion was carried out at 37°C for 15 minutes. The reaction was then terminated by adding 6x Gel Loading Dye (NEB). The reaction products were separated by 6% TBE-PAGE and stained with 4SReddye (Sangon Biotech (Shanghai) Co., Ltd.) for imaging.

[0215] 4. The results of gene editing in mammalian cells using engineered AcC2C9 RNAs, gRNA_M1 to gRNA_M14, are shown in Figure 2. As shown in the figure, gRNA_M2, gRNA_M3, gRNA_M4, gRNA_M5, gRNA_M6, gRNA_M7, gRNA_M8, gRNA_M9, and gRNA_M10, obtained by engineering RNAs corresponding to AcC2C9, were able to improve the gene editing efficiency of AcC2C9 in mammalian cells. Among these, gRNA_M9 showed the highest efficiency, while adding a stabilizing structure to the 3' end did not lead to an improvement in gene editing efficiency. Example 2 Gene editing in mammalian cells using engineered AcC2C9 nuclease gRNA

[0216] Further limitations of the AcC2C9 nuclease in this example are as described in Example 1. The preferred AcC2C9 engineered guide RNA in this example is gRNA_M9 (shown in SEQ ID NO: 12). In this example, human embryonic kidney cells HEK293T were used as the cells in the experiment.

[0217] 1. Construction of pAcC2C9hs-M1-G series plasmids In this example, six genes in the HEK293T cell genome were selected as target sequences: VEGFA, AAVS1, PDCD1, HEXA, EMX1, and TP53. Thirty-five 20-bp target sequence DNAs were selected from these target sequences. The 35 target sequences included G1, as described in Example 1. The following sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0218] (SEQ ID NO: 24) Guide2_F:5'-ATCGCATGGAAACAGACCTGGCAG-3'

[0219] (SEQ ID NO: 25) Guide2_R:5'-AAAACTGCCAGGTCTGTTTCCATG-3'

[0220] (SEQ ID NO: 26) Guide3_F:5'-ATCGGGATGTGGTGCATTTGGAAT-3'

[0221] (SEQ ID NO: 27) Guide3_R:5'-AAAAATTCCAAATGCACCACATCC-3'

[0222] (SEQ ID NO: 28) Guide4_F:5'-ATCGCGACTCAACCTGGTAAACAT-3'

[0223] (SEQ ID NO: 29) Guide4_R:5'-AAAAATGTTTACCAGGTTGAGTCG-3'

[0224] (SEQ ID NO: 30) Guide5_F:5'-ATCGAATCATTTCCCCAAGAGGAA-3'

[0225] (SEQ ID NO: 31) Guide5_R:5'-AAAATTCCTCTTGGGGAAATGATT-3'

[0226] (SEQ ID NO: 32) Guide6_F:5'-ATCGAGGCAAGCATGGAAACAGAC-3'

[0227] (SEQ ID NO: 33) Guide6_R:5'-AAAAGTCTGTTTCCATGCTTGCCT-3'

[0228] (SEQ ID NO: 34) Guide7_F:5'-ATCGTGTTTCTGCCAGGTCTGTTT-3'

[0229] (SEQ ID NO: 35) Guide7_R:5'-AAAAAAACAGACCTGGCAGAAACA-3'

[0230] (SEQ ID NO: 36) Guide8_F:5'-ATCGAAGGGATGTGGTGCATTTGG-3'

[0231] (SEQ ID NO: 37) Guide8_R:5'-AAAACCAAATGCACCACATCCCTT-3

[0232] (SEQ ID NO: 38) Guide9_F:5'-ATCGTGTAAGGAAGCTGCAGCACC-3'

[0233] (SEQ ID NO: 39) Guide9_R:5'-AAAAGGTGCTGCAGCTTCCTTACA-3'

[0234] (SEQ ID NO: 40) Guide10_F:5'-ATCGGGAGACATCCGTCGGAGAAG-3'

[0235] (SEQ ID NO: 41) Guide10_R:5'-AAAACTTCTCCGACGGATGTCTCC-3'

[0236] (SEQ ID NO: 42) Guide11_F:5'-ATCGAAGGATGGAGAAAGAGAAAG-3'

[0237] (SEQ ID NO: 43) Guide11_R:5'-AAAACTTTCTCTTTCTCCATCCTT-3'

[0238] (SEQ ID NO: 44) Guide12_F:5'-ATCGAGGAGAAGCAGTTTGGAAAA-3'

[0239] (SEQ ID NO: 45) Guide12_R:5'-AAAATTTTCCAAACTGCTTCTCCT-3'

[0240] (SEQ ID NO: 46) Guide13_F:5'-ATCGCAAACCTTAGAGGTTCTGGC-3'

[0241] (SEQ ID NO: 47) Guide13_R:5'-AAAAGCCAGAACCTCTAAGGTTTG-3'

[0242] (SEQ ID NO: 48) Guide14_F:5'-ATCGGAATCTGCCTAACAGGAGGT-3'

[0243] (SEQ ID NO: 49) Guide14_R:5'-AAAAACCTCCTGTTAGGCAGATTC-3'

[0244] (SEQ ID NO: 50) Guide15_F:5'-ATCGGAGAGAGATGGCTCCAGGAA-3'

[0245] (SEQ ID NO: 51) Guide15_R:5'-AAAATTCCTGGAGCCATCTCTCTC-3'

[0246] (SEQ ID NO: 52) Guide16_F:5'-ATCGAGGATGGAGAGGTGCTAAA-3'

[0247] (SEQ ID NO: 53) Guide16_R:5'-AAAATTTAGCCACCTCTCCATCCT-3'

[0248] (SEQ ID NO: 54) Guide17_F:5'-ATCGAGCTAGCACAGACTAGAGAG-3'

[0249] (SEQ ID NO: 55) Guide17_R:5'-AAAACTCTCTAGTCTGTGCTAGCT-3

[0250] (SEQ ID NO: 56) Guide18_F:5'-ATCGGCCATCCTAAGAAACGAGAG-3'

[0251] (SEQ ID NO: 57) Guide18_R:5'-AAAACTCTCGTTTCTTAGGATGGC-3'

[0252] (SEQ ID NO: 58) Guide19_F:5'-ATCGTACCCCGTCTCCCTGGCTTT-3'

[0253] (SEQ ID NO: 59) Guide19_R:5'-AAAAAAAGCCAGGGAGACGGGGTA-3'

[0254] (SEQ ID NO: 60) Guide20_F:5'-ATCGGGGGCAAAGACTGGACCCTG-3'

[0255] (SEQ ID NO: 61) Guide20_R:5'-AAAACAGGGTCCAGTCTTTGCCCC-3'

[0256] (SEQ ID NO: 62) Guide21_F:5'-ATCGCTCGGAGCTGGGACCACGTG-3'

[0257] (SEQ ID NO: 63) Guide21_R:5'-AAAACACGTGGTCCCAGCTCCGAG-3'

[0258] (SEQ ID NO: 64) Guide22_F:5'-ATCGACAGTGGGGACTAGAGCTCA-3'

[0259] (SEQ ID NO: 65) Guide22_R:5'-AAAATGAGCTCTAGTCCCCACTGT-3'

[0260] (SEQ ID NO: 66) Guide23_F:5'-ATCGCATCTTTGCTGTGAGCTCTA-3'

[0261] (SEQ ID NO: 67) Guide23_R:5'-AAAATAGAGCTCACAGCAAAGATG-3'

[0262] (SEQ ID NO: 68) Guide24_F:5'-ATCGATGCTTCAGAGACGAGATGG-3'

[0263] (SEQ ID NO: 69) Guide24_R:5'-AAAACCATTCGTCTCTGAAGCAT-3'

[0264] (SEQ ID NO: 70) Guide25_F:5'-ATCGGAGCTCTACACCACACCCAA-3'

[0265] (SEQ ID NO: 71) Guide25_R:5'-AAAATTGGGTGTGGTGTAGAGCTC-3'

[0266] (SEQ ID NO: 72) Guide26_F:5'-ATCGCTTAAGCAAATGCCACAGCT-3'

[0267] (SEQ ID NO: 73) Guide26_R:5'-AAAAAAGCTGTGGCATTTGCTTAAG-3'

[0268] (SEQ ID NO: 74) Guide27_F:5'-ATCGTTTAACTACTTACTGTTTGT-3'

[0269] (SEQ ID NO: 75) Guide27_R:5'-AAAAAACAAACAGTAAGTAGTTAAA-3'

[0270] (SEQ ID NO: 76) Guide28_F:5'-ATCGCTGTGGCATTTGCTTAAGCT-3'

[0271] (SEQ ID NO: 77) Guide28_R:5'-AAAAAGCTTAAGCAAATGCCACAG-3'

[0272] (SEQ ID NO: 78) Guide29_F:5'-ATCGGTTGAACAAACAGTAAGTAG-3'

[0273] (SEQ ID NO: 79) Guide29_R:5'-AAAACTACTTACTGTTTGTTCAAC-3'

[0274] (SEQ ID NO: 80) Guide30_F:5'-ATCGAGAGATGCCTTACTAGGTAC-3'

[0275] (SEQ ID NO: 81) Guide30_R:5'-AAAAGTACCTAGTAAGGCATCTCT-3'

[0276] (SEQ ID NO: 82) Guide31_F:5'-ATCGAGCTTTACAAAAGAAGGGGA-3'

[0277] (SEQ ID NO: 83) Guide31_R:5'-AAAATCCCCTTCTTTTGTAAAGCT-3'

[0278] (SEQ ID NO: 84) Guide32_F:5'-ATCGGACAAGGTTGAACAAACAGT-3'

[0279] (SEQ ID NO: 85) Guide32_R:5'-AAAAACTGTTTGTTCAACCTTGTC-3'

[0280] (SEQ ID NO: 86) Guide33_F:5'-ATCGCAGCTCATTTACAGACGGGA-3'

[0281] (SEQ ID NO: 87) Guide33_R:5'-AAAATCCCGTCTGTAAAATGAGCTG-3'

[0282] (SEQ ID NO: 88) Guide34_F:5'-ATCGGTGTCAGTTTAAGAATGGTG-3'

[0283] (SEQ ID NO: 89) Guide34_R:5'-AAAACACCATTCTTAAACTGACAC-3'

[0284] (SEQ ID NO: 90) Guide35_F:5'-ATCGGGTGCAGTTATGCCTCAGAT-3'

[0285] (SEQ ID NO: 91) Guide35_R:5'-AAAAATCTGAGGCATAACTGCACC-3'

[0286] The plasmid construction step was the same as in 1. of Example 1, and the annealed double-stranded DNA was inserted into the pAcC2C9hs-M1-NSP plasmid using the Golden gate assembly method to obtain 35 plasmids of the pAcC2C9hs-M1-G series.

[0287] 3. Construction of pAcC2C9hs-M9-G series plasmids The guide gRNA_M1 expression cassette corresponding to AcC2C9 in human cells was replaced with the guide gRNA_M9 expression cassette. Following the above method, 35 plasmids containing different target sequences were obtained: the pAcC2C9hs-M9-G series.

[0288] 4. Gene editing in human cells mediated by pAcC2C9hs-M9-G series plasmids The operation steps were the same as in 3. of Example 1, except that only the pAcC2C9hs-M1-M14-G1 series plasmids were replaced with the pAcC2C9hs-M1-G series plasmids and the pAcC2C9hs-M9-G series plasmids.

[0289] 5.Results Figure 3 shows a comparison of the editing efficiencies of gRNA_M1 and gRNA_M9 in HEK293T cells. As can be seen, the engineered gRNA_M9 achieved highly efficient editing in mammalian cells, with up to 10-fold higher editing efficiency at the same site than gRNA_M1. For example, the editing efficiency at the Guide2 site increased from 3% to 30%. The gene editing efficiency of AcC2C9 in mammalian cells increased up to 85%, significantly improving the activity and versatility of AcC2C9 in mammalian cells. Furthermore, while no gene editing activity was detected at the three sites, Guide6, Guide8, and Guide23, using gRNA_M1, the engineered gRNA_M9 achieved approximately 10% gene editing efficiency. The engineered gRNA_M9 expanded the editing range of the CRISPR / AcC2C9 gene editing system.

[0290] The above examples are intended to illustrate the embodiments disclosed in the present invention and should not be construed as limiting the present invention. Furthermore, various modifications and variations of the methods of the invention described herein will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. While the present invention has been specifically described in connection with specific preferred embodiments thereof, it should be understood that the present invention should not be limited to these specific examples. Indeed, all of the various modifications apparent to those skilled in the art for achieving the invention, as described above, are intended to be included within the scope of the present invention.

Claims

1. an RNA backbone and a gene target region; The RNA backbone comprises a tracrRNA and a tracr pairing, and the tracrRNA and the tracr pairing are directly linked or linked via a linker; A guide RNA characterized in that the nucleotide sequence of the tracrRNA is a sequence in which some nucleotides are added, deleted, or substituted with respect to the nucleotide sequence shown in SEQ ID NO: 117, and the nucleotide sequence of the tracr pairing is a sequence in which some nucleotides are added, deleted, or substituted with respect to the nucleotide sequence shown in SEQ ID NO:

127.

2. The guide RNA of claim 1, wherein the linker is selected from oligonucleotides, preferably the number of oligonucleotides in the linker is 3 to 18 nt, and more preferably the nucleotide sequence of the linker is GAAA.

3. The gene target region has the following characteristics: 1) the gene target region is located at the 3' end of the RNA backbone; 2) the gene target region recognizes a PAM sequence on the target gene, preferably the PAM sequence is 5'-NAAN, where N is A, T, C, or G; 3) the gene target region targets a nucleic acid fragment of 12 to 40 bp in length following a PAM sequence; 2. The guide RNA of claim 1, further comprising one or more of:

4. The guide RNA of claim 1, wherein the guide RNA comprises a stem-loop structure, and preferably the guide RNA comprises five stem-loop structures, namely stem-loop 2, stem-loop 3, stem-loop 4, stem-loop 5 and stem-loop 6.

5. The guide RNA of claim 1, wherein the RNA backbone comprises nucleotides obtained by adding, deleting, or substituting 15 to 150 nucleotides at the 5' or 3' end of the nucleotide sequence set forth in SEQ ID NO: 106, or nucleotides obtained by shortening or substituting 15 to 150 nucleotides in the center of the nucleotide sequence set forth in SEQ ID NO: 106 and linking them with a linker.

6. The guide RNA according to claim 1, wherein the RNA backbone is a gRNA_M2 RNA backbone, and the gRNA_M2 RNA backbone is an RNA backbone having a nucleotide sequence, for example, one having 30 bases of stem-loop 1 deleted from the RNA backbone shown in SEQ ID NO: 106, and preferably, the nucleotide sequence of tracrRNA of the gRNA_M2 RNA backbone is shown in SEQ ID NO: 140, and / or the nucleotide sequence of tracr pairing is shown in SEQ ID NO: 127, and more preferably, the nucleotide sequence of the gRNA_M2 RNA backbone is shown in SEQ ID NO:

107.

7. The RNA backbone is a gRNA_M3 RNA backbone, and the gRNA_M3 RNA backbone is an RNA backbone having a nucleotide sequence shown in SEQ ID NO: 107 with four bases (3 of stem-loop 6) deleted. Preferably, the nucleotide sequence of the tracrRNA of the gRNA_M3 RNA backbone is shown in SEQ ID NO: 118, and / or the nucleotide sequence of the tracr pairing is shown in SEQ ID NO: 128, and more preferably, the nucleotide sequence of the gRNA_M3 RNA backbone is shown in SEQ ID NO:

108. The guide RNA of claim 1 ,

8. The guide RNA according to claim 1, wherein the RNA backbone is a gRNA_M4 RNA backbone, and the gRNA_M4 RNA backbone is an RNA backbone having a nucleotide sequence set forth in SEQ ID NO: 107 with 43 bases of stem-loop 6 deleted, and preferably, the nucleotide sequence of tracrRNA of the gRNA_M4 RNA backbone is set forth in SEQ ID NO: 119, and / or the nucleotide sequence of tracr pairing is set forth in SEQ ID NO: 129, and more preferably, the nucleotide sequence of the gRNA_M4 RNA backbone is set forth in SEQ ID NO:

109.

9. The guide RNA according to claim 1, wherein the RNA backbone is a gRNA_M5 RNA backbone, and the gRNA_M5 RNA backbone is an RNA backbone having a nucleotide sequence set forth in SEQ ID NO: 107 with 51 bases of stem-loop 6 deleted, and preferably, the nucleotide sequence of tracrRNA of the gRNA_M5 RNA backbone is set forth in SEQ ID NO: 120 and / or the nucleotide sequence of tracr pairing is set forth in SEQ ID NO: 130, and more preferably, the nucleotide sequence of the gRNA_M5 RNA backbone is set forth in SEQ ID NO:

110.

10. The guide RNA according to claim 1, wherein the RNA backbone is a gRNA_M6 RNA backbone, and the gRNA_M6 RNA backbone is an RNA backbone having a nucleotide sequence set forth in SEQ ID NO: 107 with 57 bases of stem-loop 6 deleted, and preferably, the nucleotide sequence of tracrRNA of the gRNA_M6 RNA backbone is set forth in SEQ ID NO: 121, and / or the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 131, and more preferably, the nucleotide sequence of the gRNA_M6 RNA backbone is set forth in SEQ ID NO:

111.

11. The guide RNA according to claim 1, wherein the RNA backbone is a gRNA_M7 RNA backbone, and the gRNA_M7 RNA backbone is an RNA backbone having a nucleotide sequence set forth in SEQ ID NO: 107 with four bases of stem-loop 6 deleted, and preferably, the nucleotide sequence of tracrRNA of the gRNA_M7 RNA backbone is set forth in SEQ ID NO: 122 and / or the nucleotide sequence of tracr pairing is set forth in SEQ ID NO: 132, and more preferably, the nucleotide sequence of the gRNA_M7 RNA backbone is set forth in SEQ ID NO:

112.

12. The guide RNA according to claim 1, wherein the RNA backbone is a gRNA_M8 RNA backbone, and the gRNA_M8 RNA backbone is an RNA backbone having a nucleotide sequence set forth in SEQ ID NO: 107 with 70 bases of stem-loop 6 deleted, and preferably, the nucleotide sequence of tracrRNA of the gRNA_M8 RNA backbone is set forth in SEQ ID NO: 123 and / or the nucleotide sequence of tracr pairing is set forth in SEQ ID NO: 133, and more preferably, the nucleotide sequence of the gRNA_M8 RNA backbone is set forth in SEQ ID NO:

113.

13. The RNA backbone is a gRNA_M9 RNA backbone, and the gRNA_M9 RNA backbone is an RNA backbone having a nucleotide sequence set forth in SEQ ID NO: 107 with four bases deleted from stem-loop 6-7, preferably, the nucleotide sequence of tracrRNA of the gRNA_M9 RNA backbone is set forth in SEQ ID NO: 124, and / or the nucleotide sequence of tracr pairing is set forth in SEQ ID NO: 134, more preferably, the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO:

114. The guide RNA of claim 1,

14. The guide RNA according to claim 1, wherein the RNA backbone is a gRNA_M10 RNA backbone, and the gRNA_M10 RNA backbone is an RNA backbone having a nucleotide sequence set forth in SEQ ID NO: 107 with 78 bases of stem-loop 6 deleted, and preferably, the nucleotide sequence of the tracrRNA of the gRNA_M10 RNA backbone is set forth in SEQ ID NO: 125, and / or the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 135, and more preferably, the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO:

115.

15. The guide RNA of claim 1, wherein the RNA backbone is a gRNA_M11 RNA backbone, and the gRNA_M11 RNA backbone is an RNA backbone having a nucleotide sequence set forth in SEQ ID NO: 107 with 82 bases of stem-loop 6 deleted, and preferably, the nucleotide sequence of the tracrRNA of the gRNA_M11 RNA backbone is set forth in SEQ ID NO: 126, and / or the nucleotide sequence of the tracr pairing is set forth in SEQ ID NO: 136, and more preferably, the nucleotide sequence of the RNA backbone is set forth in SEQ ID NO:

116.

16. The guide RNA of claim 1, wherein the guide RNA further comprises an RNA structure-stabilizing sequence, the RNA structure-stabilizing sequence being located at the 3' end of the guide RNA, and preferably the RNA structure-stabilizing sequence being located at the 3' end of the gene target region.

17. The guide RNA of claim 16, wherein the RNA structure-stabilizing sequence is set forth in SEQ ID NOs: 137 to 139.

18. The guide RNA of claim 1, wherein the nucleotide sequence of the guide RNA is set forth in any one of SEQ ID NOs: 5 to 17.

19. An isolated polynucleotide, characterized in that it encodes the guide RNA according to any one of claims 1 to 18.

20. A construct comprising the isolated polynucleotide of claim 19.

21. An expression system comprising the construct of claim 20 or having an exogenous polynucleotide of claim 19 integrated into its genome.

22. A gene editing system comprising a guide RNA according to any one of claims 1 to 18 or a polynucleotide according to claim 19.

23. The gene editing system of claim 22, further comprising a nuclease or a polynucleotide encoding the same.

24. The gene editing system of claim 23, wherein the nuclease is a CRISPR nuclease, preferably selected from the group consisting of Cas9, Cas12, and Cas13 protein families or variants thereof, more preferably selected from the group consisting of nSpCas9 and mutants thereof, SaCas9 and mutants thereof, Cas12a and mutants thereof, or C2C9 and mutants thereof, and even more preferably AcC2C9 nuclease or a variant thereof.

25. The AcC2C9 nuclease according to the present invention comprises: (I) A wild-type AcC2C9 nuclease or a fragment thereof, wherein the AcC2C9 nuclease is derived from Actinomadura craniellae C2C9 and has an amino acid sequence as set forth in SEQ ID NO: 1, and preferably, a humanized codon-optimized nucleic acid sequence of the AcC2C9 nuclease as set forth in SEQ ID NO: 3; The gene editing system of claim 24, characterized in that (I) above further contains (II) a nuclear localization signal fragment.

26. A pharmaceutical composition comprising the gene editing system of any one of claims 22 to 24 and a pharmaceutically acceptable carrier.

27. A gene editing method, comprising contacting a target gene with the gene editing system according to any one of claims 22 to 24, thereby editing the target gene.

28. i) introducing the AcC2C9 nuclease or a coding polynucleotide encoding the same and the guide RNA or a polynucleotide encoding the same into a cell; ii) creating one or more nicks in a target gene mediated by the AcC2C9 nuclease, or targeting, editing, modifying or manipulating the target gene.

29. 1) The AcC2C9 nuclease is guided to a target gene by a guide RNA according to any one of claims 1 to 18; 2) forming a complex between the AcC2C9 nuclease and the guide RNA according to any one of claims 1 to 18 and recognizing a PAM sequence on the target gene; 3) introducing into the cell a donor template comprising a foreign polynucleotide sequence. The gene editing method of claim 27 or 28, further comprising:

30. Use of the guide RNA of any one of claims 1 to 18, the isolated polynucleotide of claim 19, the construct of claim 20, the expression system of claim 21, the gene editing system of any one of claims 22 to 25, the pharmaceutical composition of claim 26 or the method of any one of claims 27 to 29 in gene editing of a target gene and / or its associated polypeptide in vivo, in an in vitro cell or in a cell-free environment.

31. 31. The use of claim 30, wherein the gene editing is selected from the group consisting of gene truncation, gene deletion, gene insertion, point mutation, transcriptional repression, transcriptional activation, and / or base editing.

32. A cell obtained by performing gene editing using the gene editing system according to any one of claims 21 to 24 or the method according to any one of claims 26 to 28.

33. A method for preparing a guide RNA, comprising modifying the RNA backbone of a base guide RNA, wherein the modification is selected from individual or combined modifications to the tracrRNA or crRNA in the RNA backbone, and the modification is selected from addition, deletion, or substitution of some nucleotides to the tracrRNA and / or crRNA, or linking the tracrRNA and crRNA with a linker, to prepare the guide RNA.

Images