Methods for releasing viral vectors

Abstract

The present invention provides a method for releasing viral vectors from cells that produce these viral vectors by contacting the cells with a photosensitizer, which is then irradiated to disrupt the plasma membrane of the cells and release the viral vectors, which can be collected and / or purified. Products of such methods, as well as kits and devices for carrying out the methods, are also provided.

Description

[Technical Field]

[0001] The present invention provides a method for releasing viral vectors, such as adenoviruses or adeno-associated viruses, from cells that produce them by using a photosensitizer that, when activated, disrupts the plasma membrane to allow the viral vectors to be released. Kits and devices for this purpose are also provided. [Background technology]

[0002] Viral vectors (VVs) are of great importance for introducing transgenes into cells, for example in gene therapy applications. Mammalian cells in culture are typically used to produce VVs and are designated as producer cells for VV production. For example, the cell line HEK293 is frequently used for this purpose. To produce VV, producer cells are transfected with one or more plasmids encoding the genes necessary for VV production (and, in most cases, the transgene of interest). After transfection, producer cells assemble functional viral vectors that tend to accumulate intracellularly. To selectively purify VV, the cells must be opened. Current processes use cell lysis to accomplish this. Summary of the Invention

[0003] Purification of VV from producer cells is a major obstacle for manufacturers and has a substantial economic impact on the industry. Although several purification processes have been developed and used, all of them suffer from serious drawbacks, such as lack of efficiency and scalability, as well as complexity and time consumption in implementation (Ehrke-Schulz et al., 2016, J. Vis. Exp., 107, e52894; Grieger et al., 2016, Molec. Ther., 24(2), pp. 287-297). Furthermore, lysis methods generally result in the introduction of DNA from the lysed cells. Therefore, better procedures for obtaining and purifying VV are clearly needed. The present inventors have developed a method that enables the release of VV from producing cells. This method uses photochemical treatment as a means to disrupt the plasma membrane of cells in culture, specifically VV-producing cells, thereby releasing the encapsulated VV into a solution for subsequent purification. This photochemical treatment is also referred to herein as photochemical lysis (PCL). In these methods, a photosensitizing agent is used to cause a light-induced chemical reaction (mainly mediated by reactive oxygen species (ROS)) that disrupts the membrane of VV-producing cells. Preferably, the photosensitizer is selected to remain within the plasma membrane. Furthermore, to avoid harm to the VV, the photosensitizer and VV are preferably selected so that they do not bind to each other. Illumination is easy to apply to producer cells after culturing them and can use artificial light or white light, such as natural sunlight. This provides a simple and scalable method in which the photosensitizer stock solution can be provided at a high concentration that does not dilute the cell-viral vector solution, and illumination can be performed in a wide range of cell-viral vector solution volumes and vessels or containers. This method can be combined with other lysis techniques, if necessary. The VV can then be purified. Purification of VV is currently a multistep process that can include chemical lysis of the plasma membrane, hypotonic lysis of the plasma membrane, centrifugation, homogenization, sonication, freeze-thaw, enzymatic digestion (e.g., DNase), and / or liquid chromatography. The photochemical treatment described herein can be performed in conjunction with one or more of these steps. Specifically, photosensitizing agents can be used to aid in plasma membrane disruption, for example, by addition to detergent-based lysis buffers, hypotonic solutions, or sonication buffers. Detergents referred to herein are sometimes referred to as detergents. As shown in the examples, the photochemical lysis method of the present invention was shown to generate pores in treated cells that allowed the uptake of small molecules (Example 1, Hoechst 33258 dye) and the release of larger molecules (Example 3, lactate dehydrogenase). Surprisingly, DNA present in the cells before illumination was retained within the cells after illumination and did not leak out of the cells (Examples 5, 7, 8, and 9). This illustrates the selective permeabilization achieved by the method of the present invention. This provides a significant advantage for the release of VVs and their collection compared to prior art methods, where, for example, detergent lysis is used, contamination with cellular DNA is common. The photochemical lysis method of the present invention is illustrated in Figure 8, which shows the creation of pores that can release viral vectors without leaking cellular DNA (as demonstrated by the results in the Examples). Example 6 shows the release of VV from producer cells using the method of the present invention.

[0004] Thus, in a first aspect, the present invention provides a method for releasing a viral vector from a cell in which said viral vector is produced, comprising: a) contacting cells in which the viral vector is present with a photosensitizing agent; b) irradiating the cells with light of a wavelength effective to activate the photosensitizing agent, the irradiation being carried out at a light dose and for a time sufficient to disrupt the plasma membrane of the cells, thereby releasing the viral vector; c) optionally collecting and / or purifying the released viral vectors and

[0005] viral vectors A "viral vector" is a virus that can be used as a vector for the delivery of genetic material. Such a viral vector refers to the final viral form, which may contain not only nucleic acid material but also associated capsid, core, and junction proteins. Typically, such viral vectors have been modified for therapeutic purposes. Such modifications can be used to modify naturally occurring viruses to add desired properties and minimize potential pathogenic or other undesirable side effects. Despite the modifications, the viral vector retains essential and identifiable components from the source virus. Such viral vectors generally retain the ability to infect cells. They are capable of replicating in some cells (e.g., for manufacturing) but not in other cells. The term does not include viral-based plasmids or DNA, although such plasmids may be used to generate viral vectors. Preferably, the viral vector is a non-coated viral vector, i.e., a vector lacking an envelope. Adenoviral vectors are widely used to introduce foreign DNA into various cells. For this purpose, various adenoviral vectors can be used, for example, first-, second-, and third-generation adenoviral vectors. These use a variety of different vectors, for example, vectors lacking early genes E1 and / or E3, or vectors lacking all viral coding sequences, requiring the simultaneous use of helper viruses (Ehrke-Schulz et al., 2016, supra). Adeno-associated virus (AAV) is also very suitable as a gene therapy vector and a method for its production, and generally relies on the simultaneous use of adenovirus or herpes simplex virus helper vectors, AAV Rep / Cap vectors, and constructs containing the transgene of interest (Grieger et al., 2016, supra). Such viruses are used in the examples, and for example, AAV type 2 constitutes a preferred embodiment of the present invention. In preferred embodiments, the viral vector is an adenovirus or adeno-associated virus, although other viral vectors, such as Modified Vaccinia Ankara (MVA), are also encompassed. Viruses of this type that can be modified for use as vaccines or for gene therapy are particularly preferred.

[0006] Release from cells As used herein, "release" of a viral vector refers to the viral vector being freed from the constraints of the cell in which it was produced, such that the viral vector can be separated from the cell or from the remains of the cell. Preferably, substantially all of the produced viral vector is released from the cell, or a significant majority (e.g., at least 40%, e.g., at least 50, 60, 70, or 75%, more preferably at least 80, 85, 90, or 95% of the viral vector) is released. Without wishing to be bound by theory, it is believed that the methods used herein enable the creation of pores in the plasma membrane through which the viral vector passes and is released. Such pores are generated by the methods of the present invention, as shown in the Examples. Such release can occur rapidly, but can conveniently be assessed or determined after 0 to 360 minutes, e.g., 10 to 180 or 30 to 120 minutes. As described below, the method may include additional steps of collection, purification, culture, or production, and thus the method may also provide a method for obtaining a preparation of VV by such steps.

[0007] cell The cell may be any cell capable of producing a viral vector. The production of a viral vector refers to the cell's creation of a complete viral vector. This may be the result of the infection of a cell with a viral vector, in which case the production involves the replication of the viral vector. Alternatively, the cell may be transfected with a polynucleotide (and optionally a helper virus) that provides the components necessary for the production of the viral vector in the cell, i.e., provides all the necessary materials for the protein and nucleic acid components of the viral vector. Advantageously, the cells used are cells known to be suitable for producing viral vectors, such as those described below. Advantageously, the cells are eukaryotic cells. In a preferred embodiment, the cells are selected from mammalian cells, such as human or primate cells (such as HEK293, including HEK293T cells, and Vero cells, which are commonly used for producing viral vectors), and insect cells, such as sf9, including cell lines engineered for viral vector production, such as PER.C6. The cells may be adherent or suspension cells.

[0008] photosensitizer "Photosensitizers," as referred to herein, are compounds that, when activated by irradiation at an appropriate wavelength and intensity to generate activated species, can convert absorbed light energy into chemical reactions. The highly reactive end products of these processes can result in cytotoxicity and vascular toxicity. Photosensitizers may exert their effects directly or indirectly through a variety of mechanisms. Thus, for example, some photosensitizers are directly toxic when activated by light, while others act to generate toxic species, e.g., oxidants such as singlet oxygen or other reactive oxygen species, that are highly destructive to cellular material and biomolecules, such as lipids, proteins, and nucleic acids. As described below, various photosensitizing compounds can be used as photosensitizing drugs. In the context of the present invention, the VVs that can be collected by the methods of the present invention are likely to be used therapeutically. Although only small amounts of photosensitizing drugs are expected to be present in the final purified VV preparation, the use of substances known to be safe in humans is a distinct advantage. While several synthetic photosensitizers have already been approved for use in human medicine (mainly based on porphyrin structures), many natural compounds or derivatives of natural compounds (e.g., chlorophyll derivatives; hypericin, curcumin) can also be used as photosensitizing drugs. A variety of such photosensitizers are known in the art and described in literature, including WO96 / 07432, which is incorporated herein by reference, and can be used in the method of the present invention.There are many known photosensitizers, including porphyrins, phthalocyanines, and chlorins (Berg et al., 1997, J. Photochemistry and Photobiology, 65, 403-409, which is incorporated herein by reference).Other photosensitizers include bacteriochlorins. Porphyrins are the most extensively studied photosensitizers. Their molecular structure contains four pyrrole rings linked via methine bridges. They are often natural compounds that can form metal complexes. For example, in the oxygen transport protein hemoglobin, an iron atom is introduced into the porphyrin core of heme B. Chlorins are large heteroaromatic rings consisting of three pyrroles and one pyrroline linked through four methine bonds at the core. Thus, unlike porphyrins, chlorins are primarily aromatic, but not along the entire periphery of the ring. For the practice of the present invention, the photosensitizer is advantageously localized to the plasma membrane. This allows for direct action on the plasma membrane and allows for the use of less invasive and destructive methods to avoid contamination of the harvested product. The plasma membrane-localized photosensitizer is preferably an amphipathic or hydrophobic photosensitizer. While hydrophobic compounds bind to all membranes, amphipathic compounds initially reside in the plasma membrane and then in endosomes as a result of invagination and internalization of the plasma membrane during endocytosis. VVs that are not enveloped in a lipid membrane include, but are not limited to, adenoviruses (AVs) and adeno-associated viruses (AAVs), which do not bind to amphipathic or hydrophobic photosensitizers. Therefore, the use of amphipathic or hydrophobic photosensitizers allows for selective destruction of the producing cells by photochemical treatment without damaging the VVs. Amphipathic photosensitizers (e.g., TPCS) can be used to selectively destroy the producing cells by photochemical treatment without damaging the VVs. 2aExperiments have been performed with both photosensitizers (e.g., chlorin e6, verteporfin, temoporfin, and protoporphyrin IX) and hydrophobic photosensitizers (e.g., chlorin e6, verteporfin, temoporfin, and protoporphyrin IX) and found to have similar effects. Hydrophobic photosensitizers may localize to intracellular membranes other than the plasma membrane, but nuclear destruction is not observed even with such photosensitizers. Amphiphilic photosensitizers (e.g., disulfonated photosensitizers) include amphiphilic phthalocyanines, porphyrins, chlorins, and / or bacteriochlorins, particularly sulfonated (preferably disulfonated) mesotetraphenylchlorins, porphyrins, phthalocyanines, and bacteriochlorins. In preferred embodiments, the photosensitizer, preferably an amphiphilic or hydrophobic photosensitizer, is a porphyrin, phthalocyanine, purpurin, chlorin, benzoporphyrin, lysosomotropic weak base, naphthalocyanine, cationic dye, tetracycline, or a derivative of any of the foregoing agents, preferably TPPS4, TPPS 2a , AlPcS 2a , or TPCS 2a or pharmaceutically acceptable salts thereof. Particularly preferred photosensitizers are sulfonated aluminum phthalocyanines, sulfonated tetraphenylporphines, sulfonated tetraphenylchlorins, and sulfonated tetraphenylbacteriochlorins. Amphiphilic or hydrophobic chlorins (e.g., TPCS 2a , temoporfin, and chlorin e6), benzoporphyrins (e.g., verteporfin), porphyrins (e.g., protoporphyrin IX), and phthalocyanines (e.g., AlPcS 2a ) is also preferred. Particularly preferred is TPPS 2a (tetraphenylporphine disulfonate), AlPcS 2a (aluminum phthalocyanine disulfonate), TPPS4 (meso-tetraphenylporphine tetrasulfonate), TPCS 2a (tetraphenylchlorindisulfonate), and TPBS 2a(tetraphenylbacteriochlorin disulfonate), or a pharmaceutically acceptable salt thereof. Preferably, the photosensitizer is TPCS 2a (disulfonated tetraphenylchlorins, e.g. Ampinex®) and / or photosensitizers used in the examples. As used herein, "and / or" refers to one or both (or more) of the listed alternatives present; for example, A and / or B includes the alternatives i) A, ii) B, or iii) A and B. The structures of preferred photosensitizers are shown below. [ka] Arrows indicate the structural differences between the two molecules.

[0009] Contact process The cell is contacted with the photosensitizer so that the photosensitizer binds to the cell surface. Advantageously, as discussed above, localization to the plasma membrane is achieved. The photosensitizer is used at an appropriate concentration and for an appropriate length of time to achieve this goal. Although the method of the present invention refers to a method performed on a single cell, it will be understood that in reality, multiple cells will be present, and the description herein reflects this assumption. The timing and concentration can be readily determined by one skilled in the art using routine techniques and will depend on factors such as the particular photosensitizer used, the irradiation to be used, the cells being irradiated, and the configuration of these cells. Regarding the latter, the cells may be floating or adherent, layered, or in other culture configurations. Depending on the culture configuration and density of the cells, different timing and dosages may be required and can be varied or adjusted as desired. Advantageously, the contacting step a) is preferably carried out for 0.5 to 120 minutes. The contacting step refers to the total contact time between the cell(s) and the photosensitizer. The total contact time may consist of several non-contiguous separate contacting steps. As shown in the examples, in the method of the present invention, genomic DNA is not released from the treated cells. Without wishing to be bound by theory, it appears that the nucleus remains intact, i.e., activation of the photosensitizer does not disrupt the nuclear membrane sufficiently to release genomic DNA. This is advantageously achieved by a photosensitizer that localizes to the plasma membrane. Alternatively, the timing of the contacting step (and preferably also the concentration of the photosensitizer and the time of irradiation) is selected to preserve the integrity of the nucleus (i.e., avoid genomic DNA release) while disrupting the plasma membrane. The agent may be removed from contact with the cell(s) for a period of time prior to the irradiation / illumination step, however, conveniently, illumination is performed immediately after the contacting step is completed, preferably without an intervening step (e.g., washing). As referred to herein, "contacting" refers to the time when addition of the photosensitizing agent to the first cell (if multiple cells are present) begins. The end of the contacting step is the time when irradiation begins or the photosensitizing agent is removed (e.g., by removing the liquid containing the photosensitizing agent and / or by washing the cells). This may mean that not all cells are able to contact the photosensitizing agent for the entire duration of the contacting step, but the method is appropriately carried out to ensure that all cells are contacted as evenly as possible to ensure maximum effect. In preferred embodiments, the contacting step is for 2 to 30 minutes, e.g., 5 to 15 minutes (or 2 to 15, 5 to 30, 2 to 20, or 2 to 25 minutes). As noted above, to maximize efficacy, all cells should be contacted evenly and simultaneously with the photosensitizing agent. When using cells in culture, the cells are conveniently agitated to ensure mixing and substantially simultaneous contact of the photosensitizing agent with the cells. The concentration of the photosensitizer is preferably such that, once absorbed by the cells and activated by irradiation, the plasma membrane is dissolved or destroyed. The Examples illustrate how to achieve plasma membrane destruction and the creation of pores through which molecules or entities can pass. Similar experiments can be used to identify appropriate dosages for other systems containing different cells and / or photosensitizers. Advantageously, the photosensitizers described herein may be used in a concentration of, for example, 0.01 μg / ml to 10 mg / ml, for example, 0.1 to 500 μg / ml, such as 0.1 to 50 μg / ml, or 0.01 to 100 μg / ml, for example, 0.01 to 10 μg / ml or 0.5 to 10 μg / ml (such ranges are particularly applicable to each of the photosensitizers used in the examples, e.g., TPCS 2a , verteporfin, chlorin e6, protoporphyrin, and AlPcS 2a (For example, 0.1 to 500 μg / ml or 0.1 to 50 μg / ml for temoporfin, and / or 0.01 to 100 μg / ml or 0.01 to 10 μg / ml for temoporfin.) The choice of concentration is highly dependent on the system used, e.g., the photosensitizer, cell density, and the desired irradiation protocol, and should be chosen accordingly. Theoretically, the concentration of photosensitizer used is as low as possible to avoid even trace amounts of photosensitizer in the product and to avoid any damage to the VV. Furthermore, since most photosensitizers are inactivated by irradiation (so-called photobleaching), the ability of the photosensitizer to induce toxic photochemical reactions can be inactivated immediately after or even during the method. Thus, the concentration of the photosensitizer can be adjusted to a concentration that ensures that a radiation dose sufficient to activate the photosensitizer and disrupt the plasma membrane, allowing the release of VV, also photobleaches all of the photosensitizer at the end of the irradiation period. In this way, even if the photosensitizer remains in the final VV preparation, no photochemical reactions can occur in the recipient of the VV, thereby avoiding photosensitivity, even when exposed to the relevant light dose. Photobleaching properties can also be used to monitor the progress of the method and to determine whether activatable photosensitizers remain. Photosensitizers are typically fluorescent, which is lost upon photobleaching. Thus, fluorescence can be monitored throughout the method, for example, as a quality control analysis to ensure that activatable photosensitizers have been removed from the final VV preparation.

[0010] irradiation Once the photosensitizer is absorbed by the cell, the cell can be irradiated with light of a wavelength effective to activate the photosensitizer, at a light dose and for a time sufficient to disrupt the cell's plasma membrane, causing the cell to release the viral vector. "Irradiation" to activate a photosensitizing agent refers to the administration of direct or indirect light as described below. Irradiation may occur immediately after the contacting step, or may occur some time later, for example, when the photosensitizing agent is removed and the cells are washed and / or further cultured. If performed after the contacting step, the cells may remain in contact with the photosensitizing agent, but the contacting after irradiation is not considered part of the contacting step. The light irradiation step to activate the photosensitizer may be carried out by techniques and procedures known in the art. The dose, wavelength, and duration of illumination must be sufficient to activate the photosensitizer, i.e., to generate reactive species. The wavelength of light to be used is selected depending on the photosensitizing agent to be used. Conveniently, for ease of use, visible light (400-700 nm), such as ordinary indoor lighting, may be used. Alternatively, suitable artificial light sources, such as those using blue (400-475 nm) or red (620-750 nm) wavelength light, are well known in the art. TPCS 2aFor example, both blue and red light may be used. For example, wavelengths between 400 and 500 nm, more preferably between 400 and 450 nm, such as 410-430 nm or 430-440 nm, and even more preferably about 435 nm (or 425 nm), or 435 nm (or 425 nm) may be used. Alternatively, light having a wavelength between 630 and 675 nm, such as 645-660 nm, for example 652 nm, may be used. Where appropriate, photosensitizers, such as porphyrins or chlorins, may be activated by green light; for example, Killer Red (Evrogen, Moscow, Russia) photosensitizers may be activated by green light. Suitable light sources are well known in the art, such as PCI Biotech AS's LumiSource® lamps. Alternatively, an LED-based illumination device with an adjustable output power up to 60 mW and an emission spectrum of 430-435 nm (or 410-430 nm) can be used. For red light, a suitable illumination source is the PCI Biotech AS 652 nm Laser System SN576003 diode laser, although any suitable red light source may be used. During photochemical treatment, cells may be contained in a variety of vessels (or containers), ranging from small tubes to plastic vessels, bags, glass containers, and large metal tanks. Generally, cells will be contained in aqueous solutions (cell culture media, buffers, etc.) that are transparent to most wavelengths of light. For very large bioreactors, dark vessels, or strongly colored solutions, blue light can be applied, and the blue light penetrates very well throughout the aqueous solution. The vessels or containers used to handle the production cells may be made of plastic, glass, or metal. Relatively small plastic and glass vessels may be used, preferably translucent, so that illumination can be achieved by placing a light source nearby. Larger vessels, such as bioreactor tanks, may be made of metal. In these cases, the light source may be conveniently located inside the vessel for closed processes or on the exterior / top surface of the vessel for open processes. Given the limited size of these vessels, one or a few light sources should be sufficient. In addition, an additional cover made of reflective material may be used to ensure uniform illumination. The time for which cells are exposed to light in the methods of the invention may vary, and in theory, the methods of the invention will disrupt the host cells (producer cells) sufficiently to release VV, while avoiding damage beyond that necessary for this purpose. The preferred length of time for the irradiation step depends on factors such as the target cells, the photosensitizer, the amount of photosensitizer accumulated in the target cells, the overlap between the absorption spectrum of the photosensitizer and the emission spectrum of the light source, and cell density. Generally, the length of time for the irradiation step will be on the order of seconds to minutes or ranges to several hours (up to 12 hours), e.g., preferably 180 minutes, e.g., 30 seconds to 120 minutes, preferably 1 to 30 minutes, preferably 2 to 10 minutes. Advantageously, when suspension cells are used, the cells are agitated during the irradiation step to ensure that the photosensitizing agent mixes with and contacts each cell. Mixing can be achieved by any suitable means, including vibration, stirring, shaking, and rotation. The appropriate light dose can be selected by one skilled in the art and will again depend on the photosensitizer used and its concentration and the amount of photosensitizer accumulated in the target cell(s), which will also depend on the arrangement, density, and total amount of cells to be irradiated. VV-producing cells may be grown on a surface (adherent) or in suspension. Adherent cells may also be grown in stacks. As a result, cells may be exposed to different light doses, even when a single light source is used. The light dose is selected to ensure that the majority of cells are exposed to a sufficient light dose to achieve the desired effect, i.e., plasma membrane disruption. Higher density and total cell mass may require a higher light dose to achieve the same effect. The following description is given for adherent cells forming a monolayer of cells, but can be adjusted accordingly for different cell arrangements. When a photosensitizer with a higher extinction coefficient in the visible spectrum is used (e.g., a higher extinction coefficient in the red region, or in the blue region if blue light is used, depending on the photosensitizer used), the light dose is generally lower, e.g., 0.1 to 20 mW / cm when a LumiSource® lamp (blue light) is used. 2 Flux range of 1-6 J / cm 2 Light doses in the range of 13 as supplied by Lumisource® may be suitable. As mentioned above, the irradiation process is used to destroy the plasma membrane.As referred to herein, the "destruction" of the plasma membrane refers to the destruction of the integrity of the plasma membrane, so as to allow the flow of molecules or substances into or out of the cell, which cannot occur when the plasma membrane is intact.The flow into or out of the cell refers to the flow between the outside and the inside of the cell (and / or vice versa), that is, it is not restricted by the plasma membrane or other intracellular or extracellular membranes derived from the cell.Therefore, the destruction of the plasma membrane does not lead to the formation of blebs (bulges in the plasma membrane) that can be peeled off and become extracellular vesicles. According to the method of the present invention, the plasma membrane is disrupted to the extent that VV can pass from the inside to the outside of the cell. The cell may have a disrupted membrane that only allows VV and smaller molecules / entities to be released, for example, through pores, or may be more extensively disrupted, for example, the cell may be lysed. A "pore" refers to a hole in the plasma membrane that connects the inside of the cell with the external environment in which the cell resides and through which molecules / entities can pass. Preferably, substantially all or a large majority of the cells (e.g., at least 40%, e.g., at least 50, 60, 70, or 75%, more preferably at least 80, 85, 90, or 95%) are killed (of the cells subjected to treatment). Cell viability after treatment can be measured by standard techniques known in the art, such as the MTS assay, as exemplified in the Examples. As described above, the method of the present invention disrupts the plasma membrane of a cell, allowing the release of a viral vector, for example, through pores. As exemplified in Example 6, the method of the present invention does not form extracellular vesicles. Furthermore, blebbing on the cell surface is not observed. Therefore, the method of the present invention is preferably a method in which extracellular vesicles are not formed.

[0011] Release of cellular DNA As discussed above, the method of the present invention has the advantage that, after illumination, the viral vectors are released while cellular DNA can be retained within the cells. The photochemical lysis conditions are preferably selected appropriately to achieve this result. Thus, in a preferred embodiment, cellular DNA, particularly genomic DNA, remains within the cells after disruption of the plasma membrane. Preferably, substantially all of the cellular DNA (particularly genomic DNA), or a significant majority (e.g., at least 30%, e.g., at least 40, 50, 60, 70, or 75%, more preferably at least 80, 85, 90, or 95%) of the cellular DNA remains within the cells. Genomic DNA remains within the cells after release of the viral vectors, and is conveniently assessed or determined after 0 to 360 minutes, e.g., 10 to 180 or 30 to 120 minutes. Thus, in a preferred embodiment, at least 30% (or more, as described above) of the genomic DNA present within the cells prior to illumination remains within the cells after release of the viral vectors. DNA retention is achieved when the plasma membrane is disrupted by creating pores in the membrane that do not allow the cellular DNA to be released.

[0012] Other reagents used during the lysis process As shown in the Examples, the methods described herein disrupt the plasma membrane so that the viral vector can be released from the producer cell. While this can be used as the sole means for releasing the viral vector, additional methods for achieving release can also be used. Thus, for example, a lysing agent can be added to the cells in steps a), b), and / or c). (However, in some embodiments, in the methods of the present invention, plasma membrane disruption is achieved solely by the photochemical lysis method of the present invention, and / or no lysing agent is used.) A "lysing agent" is any agent capable of lysing the cells used in the method under the conditions used. Such a lysing agent can be a detergent or hypotonic buffer, or an enzyme for that purpose. Alternatively, other physical processes of lysis, such as freeze-thaw or sonication, can be used. To facilitate the disruption of the plasma membrane by the photosensitizer, a lysis agent may be added before, during, and / or after the contact and irradiation steps. Advantageously, these steps are combined, e.g., photochemical treatment is performed simultaneously with the addition of the lysis agent, e.g., the photosensitizer is added to a detergent-based lysis buffer. The simultaneous use of lysis / plasma cell disruption methods is expected to simplify downstream purification steps or to result in improved VV preparations because these methods result in higher initial VV purity. However, as described above, the method of the present invention allows for the release of VV without any additional lysis method. This scenario avoids DNA leakage. While additional lysis methods may result in superior VV release, DNA leakage may occur. Therefore, the method to be used should be selected appropriately depending on the importance of VV release relative to DNA leakage.

[0013] Collection and purification Once released from the cells, the VV can be harvested. This can be timed to coincide with the release, as discussed above, and then conveniently performed after 0-360 minutes, e.g., 10-180 or 30-120 minutes. As referred to herein, "harvesting" refers to separation from other components of the source (producing) cells. While the harvesting process can increase the purity of the VV, harvesting does not necessarily involve purification. Further purification steps may be performed after harvesting. Depending on how the irradiation step is carried out, any convenient collection method can be used.However, conveniently, collection is achieved by removing cell debris.Such cell debris includes whole cells (which may occur if the irradiation step does not cause cell lysis) or lysed cells, and debris released from such cells.Depending on the mixture that VV is collected, different collection techniques can be used. Although irradiation process can be carried out in various ways, cells are likely to be surrounded by at least some aqueous medium.As will be discussed in more detail below, in some cases, for example, when most of the culture medium is removed after culturing and before irradiation, and / or when cells are washed after irradiation, only minimal aqueous medium can exist.However, in other cases, irradiation can be carried out when there is a large amount of aqueous medium, for example, containing photosensitizer and / or dissolving agent. Thus, in a preferred embodiment, the cell(s) are in an aqueous medium throughout steps a) and b). The aqueous medium is preferably a cell culture medium and / or a solution containing a photosensitizer and / or a lysing agent, if present. In this case, collection is carried out by separating the aqueous medium from cell debris that is not suspended in the aqueous medium. Conveniently, this separation can be carried out by centrifugation or filtration. However, depending on the degree of lysis of the production cells, it is also possible to collect the VV by collecting the aqueous medium into which the VV is released, which is the supernatant for substantially intact production cells. When cell culture medium is used as the aqueous medium, the medium may be serum-free or serum-supplemented. Once collected, the VV can be further purified. Conveniently, techniques known in the art for this purpose can be used. Thus, in preferred embodiments, at least one of the following methods is used: centrifugation (e.g., density centrifugation), sonication, freeze-thaw, enzymatic digestion, and liquid chromatography. Greiger et al., 2016, supra, and Ehrke-Schulz et al., 2016, supra, describe suitable purification techniques for AAV and adenovirus, respectively. Conveniently, a purity of at least 50% (w / w, dry weight), preferably at least 60, 70, 80, 90, 95, or 99% w / w (dry weight), is achieved. The yield of VV can be assessed in several ways, including OD titer or qPCR, which can be used to identify and quantify infectious particles. Preferably, the yield is at least 1 x 105 containing vector genome-containing particles (vg) / cell, or at least 1 x 10 10 vg / l, 2 × 10 10 vg / l, 1×10 11 vg / l, or 1 × 10 12 Yields of vg / l cell culture are achieved.

[0014] Cultivation and release methods The method of the present invention can also be carried out by carrying out a step in which the viral vector is produced in cells before the contacting step a). Preferably, the viral vector is produced by culturing cells to produce the viral vector, and optionally, the culture supernatant is removed before step a). When a VV production step is included as part of the method, the present invention also provides a method for releasing a viral vector from a cell in which the viral vector is produced, comprising the steps of: a) producing the viral vector in the cells, preferably by culturing the cells so that the viral vector is produced by the cells, and optionally removing the culture supernatant prior to step b); b) contacting the cells in which the viral vector is present (produced) with a photosensitizing agent; c) irradiating the cells with light of a wavelength effective to activate the photosensitizing agent, the irradiation being carried out at a light dose and for a time sufficient to disrupt the plasma membrane of the cells, thereby releasing the viral vector; d) optionally collecting and / or purifying the released viral vectors. and All of the above definitions and preferred embodiments apply equally to the present method. In the production step a), the viral vector is produced in cells. Thus, the cells are infected or transfected with the relevant components necessary for producing the viral vector, and the viral vector is amplified or produced in the cells. Advantageously, this is achieved by culturing host cells under conditions that allow the production of VV. Suitable conditions for this purpose are well known and depend on the cells to be used as producer cells (or hosts) and the VV to be produced. The cell culture may be in suspension or, in the case of growing adherent cells, on a plate or other solid support. The production process involves inducing VVs to a suitable number in cells, e.g., at least 1 x 10 5 The incubation is continued until vector genome-containing particles (vg) / cells are present. This can take anywhere from 24 hours to 7 days, e.g., 2-5 days. Cells showing aggregation are generally ready for harvest. Once the production process is complete, the producer cells containing the VV are ready for application of a photosensitizing agent and irradiation. Advantageously, the medium (e.g., supernatant) in which the cells are present may be removed. The cells may be washed. A photosensitizer and optionally a lysing agent may be added. Alternatively, the photosensitizer and optionally a lysing agent may be added to the medium in which the cells were grown. If the photosensitizer is absorbed before irradiation, the cells may be washed after this contacting step, or irradiation may be performed without a washing step. Thus, in another aspect of the invention, the cells are washed after completion of the contacting step with the photosensitizer and before irradiation, or the cells are not washed at that time.

[0015] Transfection / infection, culture, and release methods The method of the present invention can also be carried out by carrying out, prior to the production step a), a step of infecting cells with one or more viral vectors or transfecting cells with one or more polynucleotides that enable the production of viral vectors in the cells. In this step, competent production cells are prepared. This can be carried out by techniques known in the art (see, for example, Greiger et al., 2016, supra, and Ehrke-Schulz et al., 2016, supra). In some other cases, cells are transfected or infected with one or more polynucleotides and / or viral vectors that enable the production of viral vectors. These polynucleotides may be plasmids or other polynucleotides. If necessary, a viral vector, for example, in the form of a helper virus, may be prepared. This is generally carried out as a pre-amplification step for cell infection to obtain viral vectors. However, in either case, the method of the present invention can be used to release VVs. When the steps of infecting / transfecting cells and producing VV are included as part of the method, the present invention also provides a method for releasing a viral vector from a cell in which the viral vector is produced, comprising the steps of: a) infecting cells with one or more viral vectors and / or transfecting said cells with one or more polynucleotides that allow the production of said viral vectors in said cells; b) producing the viral vector in the cells, preferably by culturing the cells so that the viral vector is produced by the cells, and optionally removing the culture supernatant before step c); c) contacting the cells in which the viral vector is present (produced) with a photosensitizing agent; d) irradiating the cells with light of a wavelength effective to activate the photosensitizing agent, the irradiation being carried out at a light dose and for a time sufficient to disrupt the plasma membrane of the cells, thereby releasing the viral vector; e) optionally collecting and / or purifying the released viral vectors and All of the above definitions and preferred embodiments apply equally to this method. As used herein, "infection" refers to the viral vector being introduced into cells through normal transport.Generally, viral vectors replicate in cells to provide multiple copies of themselves.However, this may require the assistance of, for example, helper virus vectors.Transfection refers to the incorporation of polynucleotides by non-viral methods. The methods of the present invention and their various steps may be carried out in a variety of different ways, some of which are described above. For example, after the production / culture step, the cells are harvested and centrifuged. The supernatant is discarded. The photosensitizer is added to the cells in solution. Other lysing agents, such as surfactants, may also be added. The cells are allowed to absorb the photosensitizer during mixing. The solution is then irradiated. Conveniently, the cells are contained in a translucent container to allow light to easily pass into the container and to the cells. Natural light may also be used. After release from the cells, the VV may be purified by conventional downstream processing steps, such as centrifugation, sonication, freeze-thaw, enzymatic digestion (e.g., with DNase), and / or liquid chromatography. Two or more of the steps may be performed in the same container. For example, the production step and the photochemical treatment step may be performed in the same container (e.g., the culture vessel), or they may be performed in separate containers. In such a scenario, the photochemical treatment step may be considered "upstream." Similarly, the photochemical treatment step may be performed in the same container as the subsequent purification step, e.g., a sonication bath or tube. This can be considered a "downstream" photochemical treatment, i.e., after the cells have been harvested from the culture vessel. Preparations of VV obtainable or obtained by the methods of the invention constitute a further aspect of the invention.

[0016] Furthermore, the present invention provides kits for use in the methods of the present invention. Thus, in a further aspect, the present invention provides a cell harvesting kit or device for releasing viral vectors from cells, comprising: a) a photosensitizing agent; b) a light source for illuminating the cells and a kit or device comprising: The photosensitizer is as described above. The light source is suitable for such irradiation. The light source to be prepared is selected based on its intended use, and in particular the morphology in which the cells are present, the photosensitizer to be used, and its concentration. The kit or device may additionally comprise a container into which the cells can be placed. This container may be used solely for the purposes of the irradiation step and subsequent steps, and / or may be used for the initial culturing step. Thus, in a preferred embodiment, the container is suitable for cell culturing and / or cell purification. As mentioned above, the culturing and irradiation steps can be carried out in a wide variety of vessels or containers. By way of example, the container may be a plate (e.g., a multi-layer plate / cell factory), a tank, or a bag (e.g., a bioreactor bag), and is preferably translucent. However, conveniently, the container is a bag or a tank, and / or a light source is coupled to the container. To aid in uniformity throughout the method, the kit or device may additionally include means for agitating the cells. This may be provided as part of the vessel, or may be provided separately, located inside or outside the vessel, to agitate the cells directly or indirectly, respectively. By way of example, an in-vessel cell culture shaker or agitator may be provided. Additional components may also be provided, such as culture media, and lysis reagents, washing buffers and solutions. Optionally, the kit may also include a package insert describing how the method of the invention should be performed. The kits and devices of the present invention can be used in the methods of the present invention. The methods described in the Examples constitute further preferred aspects of the present invention. All combinations of the preferred features described above are contemplated, as specifically described in the Examples. The present invention will now be described in more detail in the following non-limiting Examples and in light of the following Figures: [Brief explanation of the drawings]

[0017] [Figure 1] Figure 1 shows the results of an MTS assay performed on Jurkat cells treated with 0.1 μg / mL or 1 μg / mL TPCS2a for 10 minutes, then irradiated for the indicated times and incubated for 48 hours. A) Absorbance as a function of time of irradiation, and B) corresponding cell viability. [Figure 2] Figure 1 shows the results of cell counting experiments on Jurkat cells treated with 0.1 μg / mL or 1 μg / mL TPCS2a for 10 minutes, followed by irradiation for the indicated times and incubation for 48 hours. A) Cell density as a function of irradiation time, B) shows the corresponding relative cell proliferation for the same irradiation times. [Figure 3] Figure 1 shows cell death (based on Hoechst 33258 staining and flow cytometry) of Jurkat cells treated with 0.1 ug / mL (A) or 1 ug / mL (B) TPCS2a for 10 minutes, followed by irradiation for the indicated times and incubation for 48 hours. [Figure 4] Figure 1 shows the cellular localization of TPCS2a at the plasma membrane of Jurkat cells treated with 1 μg / mL TPCS2a in complete RPMI 1640 and HEK293 cells treated with 5 μg / mL TPCS2a in DMEM medium for 10 minutes. White arrows indicate the presence of TPCS2a at the plasma membrane. [Figure 5](A) LDH assay results assessing leakage of cytosolic material from HEK293 cells treated for 10 minutes with 0.5 μg / mL TPCS2a or 0.5% Tween 20 in serum-free DMEM (A), or 50 μg / mL TPCS2a in 10% serum DMEM (B), followed by 5 minutes of illumination (with light) or no illumination (without light). LDH release was assessed after 2 hours. (C) Background absorbance values ​​for the LDH assay at 1%, 5%, and 10% FBS concentrations. [Figure 6] This figure shows changes to cell morphology in HEK293 cells treated with 5 μg / mL TPCS2a in complete DMEM for 10 minutes followed by 5 minutes of illumination. The figure shows cells imaged by optical (Nomarski) and fluorescence microscopy before and 2 hours after illumination. White arrows point to cell corpses remaining after illumination, and black arrows point to cell debris after illumination. [Figure 7] Figure 1 shows the effect of photochemical treatment or detergent lysis on cell morphology and DNA leakage in HEK293 cells treated with 5 μg / mL TPCS2a or 0.5% Tween 20 in complete DMEM for 10 minutes, followed by irradiation for 5 minutes. Hoechst 33258 was added to the samples 2 minutes before imaging. The figure shows cells imaged by light (Nomarski) and fluorescence microscopy before and 2 hours after illumination. [Figure 8] FIG. 1 is a schematic diagram showing how photochemical treatment can be used to selectively permeabilize the plasma membrane of producer cells to release viral vectors without DNA contamination or leakage (referred to herein as photochemical lysis, PCL). [Figure 9]This figure shows the use of photochemical lysis to release viral vectors (AAV serotype 2 / AAV2) from producer cells (adherent HEK293T cells). The figure shows untransfected cells (No Trf.), transfected cells not treated with a photosensitizer (Neg.Ctrl), and transfected cells treated with a photosensitizer (Fimaporfin, TPCS2a). Cells were irradiated with the indicated blue light. The figure is representative of three independent experiments. [Figure 10] This figure shows the effect of photochemical lysis on HEK293T suspension cells. HEK293T suspension cells were treated with fimaporfin or fimaporfin solvent without a photosensitizer ("Neg.Ctrl") and then illuminated with blue light. Hoechst 33258 DNA dye was used to stain free DNA or DNA in cells with plasma membranes. After 10 minutes (i.e., before illumination) and 2 hours after illumination, cells were imaged by light (Nomarski) microscopy, and fimaporfin and Hoechst fluorescence were imaged by fluorescence microscopy. Arrows indicate plasma membrane localization of fimaporfin. Asterisks indicate areas where the plasma membrane is disrupted and the corresponding absence of fimaporfin staining. Plus signs indicate Hoechst-positive DNA in lysed cell corpses and the corresponding DNA localization. [Figure 11] This figure shows the effect of photochemical lysis on genomic DNA leakage in HEK293T cells. HEK293T cells were treated with 5 μg / mL TPCS2a (fimaporfin) or 0.5% Tween 20 in complete DMEM for 10 minutes, followed by 5 minutes of blue light illumination (with light) or without (without light). "Neg.Ctrl" refers to cells receiving fimaporfin solvent without the photosensitizer to confirm the effect of the solvent on cell lysis. After 2 hours of incubation at 37°C and 5% CO2, supernatants from all samples were collected. Genomic DNA in the supernatants was analyzed by ddPCR using primers targeting the human albumin gene. Values ​​were normalized to "Neg.Ctrl." [Figure 12A] Figure 12 shows the effect of photochemical treatment on cell morphology and DNA leakage in HEK293T cells treated with 5 μg / mL verteporfin (Figure 12A), 0.03 μg / mL temoporfin (Figure 12B), 3 μg / mL chlorin E6 (Figure 12C), 30 μg / mL protoporphyrin IX (Figure 12D), or 10 μg / mL AlPcS2a (Figure 12E) in complete DMEM for 10 min and then illuminated for 5 min. Hoechst 33258 was added to the samples 2 min before imaging. The figure shows cells imaged by light (Nomarski) microscopy, as well as Hoechst and photosensitizer fluorescence imaged by fluorescence microscopy before and 2 h after illumination. [Figure 12B] Same as above [Figure 12C] Same as above [Figure 12D] Same as above [Figure 12E] Same as above [Example]

[0018] Example 1: TPCS 2a Pore ​​formation in Jurkat cells by post-treatment irradiation. material and method Jurkat cells were cultured in complete RPMI 1640 medium with 0.1 ug / mL or 1 ug / mL fimaporfin (TPCS 2a The cells were incubated with blue light for 10 minutes, as indicated in the figure. After illumination, the cells were incubated at 37°C and 5% CO for 48 hours, after which several analyses of cell health were performed. Blue light irradiation / illumination was performed using a LumiSource according to the manufacturer's protocol (PCI Biotech). MTS metabolism was performed as a measure of metabolic activity and was performed according to the manufacturer's protocol (Promega). Cell counts were performed as a measure of cell proliferation using a Coulter Counter from Beckman Coulter according to the manufacturer's protocol. Counts were performed 48 hours after irradiation. Entry of Hoechst 33258 (Thermo Fisher Scientific) into cells was performed as a measure of cell death. Upon entry into cells, Hoechst 33258 binds to double-stranded DNA, which generates a strong fluorescent signal. Entry of this dye into cells requires the presence of pores in the plasma membrane, and this entry is a measure of cell health, i.e., the terminal stage of cell death. Hoechst 33258 staining and flow cytometry were performed according to the manufacturer's protocol (Thermo Fisher Scientific). result MTS provides an assay based on the reduction of an MTS tetrazolium compound by cells to produce a detectable dye. This production decreases as the cells' metabolic activity decreases and is an indicator of viability. Figure 1 shows that upon illumination, absorbance decreases (Figure 1A). This correlates with a decrease in viability, shown in Figure 1B relative to a starting level of 100%. Illumination for 2-5 minutes showed a decrease in viability. TPCS 2a Increasing the concentration of TPCS from 0.1 μg / ml to 1 μg / ml reduced absorbance and cell viability at shorter irradiation times, leading to a complete loss of viability at 4-5 minutes of irradiation. 2a It is clear that activation of β-glucan resulted in a reduction in metabolic activity and viability of treated cells. Figure 2 shows the cell density (determined by cell counting) of treated cells 48 hours after irradiation (Figure 2A). 2a At higher irradiation times, the cell density decreased at the corresponding irradiation time. At higher irradiation times, the cell density decreased. Figure 2B shows the cell density compared to the starting cell density, i.e., the relative cell proliferation. Figure 3 shows cell death based on Hoechst 33258 staining after irradiation for cells treated with 0.1 μg / ml (Figure 3A) or 1 μg / ml (Figure 3B) and various irradiation times. 2a Higher doses of TPCS resulted in some cell death, but only at longer irradiation times. 2a In the case of erythrocytes treated with erythrocyte-derived β-glucan, significant cell death occurred 2 minutes after irradiation. These results indicate that the Hoechst dye crossed the plasma membrane. Hoechst 33258 is hydrophilic and does not readily cross the plasma membrane. Therefore, for Hoechst 33258 to enter cells, pores must be present in the plasma membrane, and the ability of Hoechst 33258 to enter cells serves as a measure of plasma membrane pore formation. The presence of such pores would allow the escape of molecules for the release of an entity, such as a packaged viral vector.

[0019] Example 2: Plasma membrane photosensitizer (TPCS) in suspension and adherent cells 2a ) localization material and method Jurkat cells (floating cancer cells derived from T cells) were cultured in complete RPMI 1640 with 1 μg / mL fimaporfin (TPCS) 2a HEK293 cells (adherent embryonic kidney cells) were incubated with 5 μg / mL of TPCS in DMEM medium for 10 min. 2a The cells were then washed with PBS / 1% FBS to remove unbound TPCS prior to imaging. 2a The cells were then imaged by light (Nomarski) and fluorescence microscopy to identify TPCS. 2a The cellular localization of was determined. For imaging, cells were seeded onto poly-D-lysine-coated coverslips in 24-well plates the day before treatment. Coverslips were coated with poly-D-lysine to enhance cell adhesion. The coating procedure was performed according to the manufacturer's protocol (Thermo Fisher Scientific). Light microscopy (Nomarski) and fluorescence microscopy were performed using a Zeiss Imager.Z1. Images were processed using AxioVision. To remove unbound photosensitizer and thereby visualize cell-bound photosensitizer, samples were washed three times with PBS / 1% FBS before image acquisition. result TPCS after incubation with cells 2a The localization of TPCS is shown in Figure 4. Fluorescence imaging revealed that TPCS 2a These results demonstrate that TPCS was localized to the plasma membrane of both Jurkat and HEK293 cells (see white arrows). 2a It has been shown that after short-term incubation, photosensitizers localize to the plasma membrane of two very different cell types (Jurkat and HEK293) and localize to the same location in both adherent and suspension cells. When activated by irradiation, photosensitizers (as shown in other examples) are able to incorporate into the plasma membrane and permeabilize it in a cell-type-independent manner.

[0020] Example 3: Leakage of the cytosolic protein lactate dehydrogenase (LDH) after photochemical treatment Plasma membrane permeabilization was assessed using a lactate dehydrogenase (LDH) assay. Such an assay is a commonly used method that indirectly measures cell lysis, as LDH is a cytosolic enzyme released from lysed cells. material and method HEK293 cells were cultured in serum-free DMEM with 0.5 μg / mL of TPCS. 2a or 0.5% Tween 20. Alternatively, HEK293 cells were incubated with 50 μg / mL of TPCS in DMEM supplemented with 10% serum.2a The cells were then incubated with TPCS for 10 minutes. Subsequently, the cells were illuminated or not with blue light for 5 minutes. Blue light illumination / illumination was performed using a LumiSource according to the manufacturer's protocol (PCI Biotech). A negative control (Neg.Ctrl) was used to confirm the effect of the solvent on LDH leakage. 2a The background absorbance values ​​for the LDH assay were assessed using either serum-free DMEM containing vehicle or DMEM supplemented with 10% fetal bovine serum (FBS). LDH release, a measure of cell lysis and release of cytosolic material, was performed using the CyQUANT LDH Cytotoxicity Assay according to the manufacturer's protocol (Thermo Fisher Scientific). Cells were seeded in 400 μL of solution into 48-well plates the day before treatment. The following day, treatment was performed for 10 minutes at 37°C and 5% CO2, followed by illumination for 5 minutes. The plates were then incubated in an incubator (37°C, 5% CO2) for 2 hours and then centrifuged at 400 × g for 5 minutes. Afterwards, 50 μL of supernatant from each sample was transferred to a 96-well plate, and absorbance was measured according to the kit instructions. Absorbance at 490 nm reflects LDH, while absorbance at 680 nm reflects background absorbance from the instrument. Absorbance at 490 nm minus absorbance at 680 nm is directly proportional to the amount of LDH released into the medium. result Figure 5 shows the results of 0.5 μg / mL TPCS. 2a or Tween 20 (Figure 5A), or 50 μg / mL TPCS. 2a (Figure 5B) shows LDH release from HEK293 cells treated with TPCS in both serum-free and 10% FBS DMEM in the absence of irradiation. 2aHEK293 cells treated with Tween 20 showed levels of LDH release comparable to those treated with the negative control. In the presence of irradiation, LDH release was significantly increased in both serum-free and serum-supplemented media. In contrast, HEK293 cells treated with Tween 20, a commonly used detergent that causes cell lysis, showed elevated levels of LDH release in both the absence and presence of irradiation. From these results, TPCS 2a It is clear that treatment with 10% FBS DMEM allows light-dependent LDH release, and thus cell permeabilization (and potential lysis), in both serum-free and 10% FBS DMEM. The results in Figure 5C further demonstrate that increasing the FBS concentration in DMEM serum results in increased absorbance values ​​in the LDH assay. This therefore demonstrates that the generally higher absorbance values ​​seen in Figure 5B compared to Figure 5A can be attributed to the presence of 10% FBS in Figure 5B.

[0021] Example 4: Evaluation of morphology after photochemical treatment material and method HEK293 cells were cultured in 5 μg / mL TPCS 2a The cells were incubated with complete DMEM for 10 minutes, followed by blue light illumination for 5 minutes. Blue light illumination / illumination was performed using a LumiSource according to the manufacturer's protocol (PCI Biotech). Cells were imaged by optical (Nomarski) and fluorescence microscopy before and 2 hours after illumination. Imaging was performed as described in Example 2. result TPCS 2a The effect of photochemical lysis on HEK293 cells treated with 5 μg / mL TPCS can be seen in Figure 6, which shows that in the absence of irradiation, 2a The results demonstrate that HEK293 cells treated with 5 μg / mL TPCS showed no changes in their cell morphology. 2aTreated HEK293 cells exhibited dramatically altered cell morphology, converting to a lytic phenotype and scattering cellular material outside of remaining cellular structures (cell corpses).

[0022] Example 5: Photosensitizer TPCS 2a Selective permeabilization of the plasma membrane of HEK293 cells by irradiation after treatment with The relative effects of photochemical treatment and detergent lysis on the release of cellular components were evaluated. material and method HEK293 cells were cultured in complete DMEM with 5 μg / mL TPCS 2a or 0.5% Tween 20 for 10 min followed by 5 min of illumination. Blue light illumination / illumination was performed using a LumiSource according to the manufacturer's protocol (PCI Biotech). 2a A negative control of complete DMEM containing solvent was used to confirm the effect of the solvent on cell morphology and lysis. Hoechst 33258 dye was added to the samples 2 minutes before imaging. Hoechst 33258 staining was performed according to the manufacturer's protocol (Thermo Fisher Scientific). Cells were imaged by optical (Nomarski) and fluorescence microscopy before and 2 hours after irradiation. Imaging was performed as described in Example 2. Changes to cell morphology were analyzed visually. result DNA leakage from cells is a major problem in viral vector production, specifically the leakage of genomic DNA from producer cells. 2a To understand how the treatment and established lysis method (Tween 20) affected DNA leakage, cells lysed by both approaches were examined by microscopy. Hoechst 33258 staining was used to stain free DNA or DNA in cells with plasma membrane pores. The results in Figure 7 demonstrate that TPCS 2aAfter treatment and irradiation, DNA remains within the boundaries of the cell corpses, whereas detergent lysis with Tween 20 results in DNA leakage from the cells after 10 minutes, with the DNA released into solution after 2 hours. From these results, TPCS 2a It is clear that the treatment, in contrast to detergent lysis, can be used to selectively lyse cells without resulting in DNA leakage and contamination.

[0023] Example 6: Photosensitizer TPCS 2a Release of viral vectors from producer cells by irradiation after treatment Photochemical lysis was used to release AAV2 viral vectors from adherent HEK293T cells producing AAV2 viral vectors. material and method AAV2 was produced by triplicate transfection of 75-80% confluent HEK293T cells in 12-well plates with adeno-associated virus serotype 2 (AAV)-encoding plasmids (pHelper, AAV2 RepCap, and pscAAV-GFP plasmid) using polyethyleneimine (PEI). For each transfection, the plasmids and PEI were added to a total volume of 640 μL in complete DMEM, vortexed for 10 seconds, and incubated at room temperature for 15 minutes. The medium was removed from HEK293T cells in the 12-well plates and replaced with the DMEM-plasmid-PEI mixture. The cells were incubated at 37°C and 5% CO2 for 3 days. Three days after transfection, the cells were treated in complete DMEM for 10 minutes (as described below). The processing was as follows: a) Untransfected cells, no further treatment. b) Transfected cells with photosensitizer solvent but without photosensitizer (to determine the effect of the solvent on cell lysis). c) Transfected cells. 5 μg / mL TPCS 2a (fimaporfin) for 10 minutes. Samples from treatment b) or c) were previously split (on the day of seeding) into two 12-well plates and exposed to either 5 min of blue light illumination or no light illumination. Blue light illumination / illumination was performed using a LumiSource according to the manufacturer's protocol (PCI Biotech). After 2 hours, the supernatant was collected and cell debris (if present) was removed by centrifugation. DNase-resistant viral genomes (vg) from all samples were quantified by digital droplet PCR amplification (Bio-Rad QX600) of DNase-resistant (i.e., viral capsid-encapsulated) DNA using inverted terminal primers. Viral vector yields were expressed as "vg / mL" (AAV vector genomes per milliliter). The sequences of the ITR primers are as follows: ITR forward: CGGCCTCAGTGAGCGA (SEQ ID NO: 1) ITR reverse: GGAACCCCTAGTGATGGAGTT (SEQ ID NO: 2) result The results are shown in Figure 9. "No Trf" indicates the supernatant from untransfected cells. "Neg.Ctrl" indicates the supernatant from transfected cells that received the photosensitizer solvent but not the photosensitizer. "Fimaporfin" indicates the supernatant from transfected cells that received the photosensitizer solvent but not the photosensitizer. 2a Shown are supernatants from transfected cells incubated for 10 minutes with No light indicates unilluminated samples, and With light indicates illuminated samples. This figure shows that non-enveloped viral vectors are released from producer cells (here, HEK293T, the most common cell type) by photochemical lysis. While this experiment uses AAV2, this virus is representative of other non-enveloped vectors to which this method can be applied (e.g., other AAV serotypes and adenovirus (AV)).

[0024] Example 7: Photochemical lysis of HEK293T suspension cells The effects of photochemical treatment and detergent lysis on HEK293T suspension cells were examined by microscopy. material and method HEK293T suspension cells were cultured in complete DMEM with 5 μg / mL TPCS 2a (Fimaporfin) or Fimaporfin solvent without photosensitizer ("Neg.Ctrl") for 10 minutes, followed by 5 minutes of blue light illumination (as described in Example 6). Hoechst 33258 was added to the samples 2 minutes before imaging. Hoechst 33258 DNA dye does not readily penetrate cells, and therefore stains free DNA or DNA in cells with plasma membrane pores. Cells were washed with PBS / 1% FBS to remove unbound fimaporfin prior to imaging. After 10 minutes (i.e., before illumination) and 2 hours after illumination, cells were imaged by light microscopy (Nomarski), and fimaporfin and Hoechst fluorescence were imaged by fluorescence microscopy. Imaging was performed as described in Example 2. result The results are shown in Figure 10. Arrows indicate the plasma membrane localization of Fimaporfin (before illumination, i.e., after 10 minutes). Asterisks indicate areas where the plasma membrane is disrupted and the corresponding absence of Fimaporfin staining. Plus signs indicate Hoechst-positive DNA and the corresponding localization of DNA in lysed cell corpses. These results are consistent with those observed in Figure 4 (plasma membrane localization of fimaporfin in Jurkat and adherent HEK293), Figure 6 (plasma membrane disruption in adherent HEK293), and Figure 7 (DNA retention after photochemical lysis, adherent HEK293), but with HEK293T suspension cells, the most commonly used cell type for viral vector production performed in suspension culture. The key findings are: 1) fimaporfin localizes to the plasma membrane of HEK293T suspension cells; 2) photochemical lysis (fimaporfin + light) opens the plasma membrane of HEK293T suspension cells; and 3) after photochemical lysis, DNA is retained within the boundaries of the lysed cells ("cell corpses").

[0025] Example 8: Photosensitizer TPCS investigated by digital droplet PCR 2a Selective permeabilization of the plasma membrane of HEK293T cells by post-treatment irradiation The relative effects of photochemical treatment and detergent lysis on the release of cellular components were assessed by digital droplet PCR (ddPCR). material and method 75–80% confluent HEK293T cells were cultured in complete DMEM with 5 μg / mL TPCS. 2a or 10 min incubation with 0.5% Tween 20 followed by 5 min of illumination (where indicated). Blue light illumination / illumination was performed using a LumiSource according to the manufacturer's protocol (PCI Biotech). 2a A negative control of complete DMEM containing solvent was used to confirm the effect of the solvent on cell lysis. After irradiation, cells were incubated at 37°C and 5% CO2 for 2 hours, after which the supernatant was collected. Cell debris (if present) was removed by centrifugation. Genomic DNA from all samples was quantified by ddPCR (Bio-Rad QX600) using human albumin DNA-targeting primers. The primer sequences are as follows: Albumin forward: TGAAACATACGTTCCCAAAGAGTTT (SEQ ID NO: 3) Albumin reverse: CTCTCCTTCTCAGAAAGTGTGCATAT (SEQ ID NO: 4) Albumin DNA values ​​were normalized to the negative control. result The results in Figure 11 show that photochemical lysis conditions (Example 6), known to lyse cells and release viral vectors, do not cause leakage of genomic DNA from HEK293T cells. In contrast, Tween 20, an established lysis method, increased genomic DNA by approximately six-fold. The results reported in Figure 7 provide qualitative evidence that photochemical lysis, in contrast to water lysis, does not cause genomic leakage. The results here quantitatively confirm that photochemical lysis, unlike with Tween 20 and detergent lysis, does not open the nuclei of producer cells, preventing the potential leakage of genomic DNA. Therefore, TPCS 2a The treatment can be used to selectively lyse cells without resulting in DNA leakage and contamination, in contrast to detergent lysis.

[0026] Example 9: Evaluation of photochemical dissolution with alternative photosensitizers The effects of five photochemical treatments on morphology and release of cellular components were evaluated. material and method HEK293T cells were cultured in complete DMEM with 5 μg / mL verteporfin (benzoporphyrin), 0.03 μg / mL temoporfin (chlorin), 3 μg / mL chlorin E6 (chlorin), 30 μg / mL protoporphyrin IX (porphyrin), or 10 μg / mL AlPcS 2a (phthalocyanine) for 10 min followed by 5 min of illumination. Blue light illumination / illumination was performed using a LumiSource according to the manufacturer's protocol (PCI Biotech). To stain free DNA or DNA in cells with plasma membrane pores, Hoechst 33258 dye was added to the samples 2 minutes before imaging. Hoechst 33258 staining was performed according to the manufacturer's protocol (Thermo Fisher Scientific). 10 minutes (i.e., before irradiation) and 2 hours after irradiation, cells were imaged by light microscopy (Nomarski), and Hoechst and photosensitizer fluorescence was imaged by fluorescence microscopy. Imaging was performed as described in Example 2. result The effects of photochemical lysis on HEK293T cells treated with five different photosensitizers were investigated using TPCS in Examples 4 and 5. 2a Figure 12 shows that brief incubation with each of the test photosensitizers can lyse cells in a light-dependent manner (demonstrated by the morphological changes in Nomarski images before and after illumination) and that photochemical lysis prevents DNA leakage from lysed cells (demonstrated by the appearance of round, Hoechst 33258-positive nuclei or nucleus-like structures after illumination). These results, together with those in Examples 4 and 5, illustrate that numerous classes of photosensitizers (benzoporphyrins, porphyrins, phthalocyanines, chlorins) can effect photochemical lysis, demonstrating that photochemical lysis to achieve cellular release of viral vectors is a general principle and not specific to fimaporphins.

Claims

1. A method for releasing a viral vector from a cell in which the viral vector is produced, comprising the steps of: a) contacting cells in which the viral vector is present with a photosensitizing agent; b) irradiating the cells with light of a wavelength effective to activate the photosensitizing agent, the irradiation being carried out at a light dose and for a time sufficient to disrupt the plasma membrane of the cells, thereby releasing the viral vector; c) optionally collecting and / or purifying the released viral vectors. and a method comprising:

2. The method of claim 1 , wherein the cell is a mammalian cell, preferably a human cell.

3. 2. The method of claim 1, wherein the cells are selected from HEK293 cells, Vero cells, sf9 cells, and PER.C6 cells.

4. 4. The method according to any one of claims 1 to 3, wherein the viral vector is a virus lacking an envelope, preferably an adenovirus or an adeno-associated virus.

5. The photosensitizer is an amphipathic or hydrophobic photosensitizer, preferably TPCS. 2a or TPPS 2a 5. The method according to claim 1, wherein

6. 6. The method according to any one of claims 1 to 5, wherein the light has a wavelength of 400 to 700 nm (visible) or 400 to 475 nm (blue light).

7. 7. The method according to any one of claims 1 to 6, wherein the contacting step a) is carried out for 0.5 to 120 minutes, preferably 2 to 30 minutes.

8. 8. The method according to any one of claims 1 to 7, wherein the irradiation in step b) is carried out for 0.5 to 120 minutes.

9. 9. The method of claim 1, wherein a lysis agent is added to the cells in steps a), b), and / or c).

10. 10. The method of claim 1, wherein the cells are in an aqueous medium throughout steps a) and b).

11. 11. The method of any one of claims 1 to 10, wherein the plasma membrane is disrupted by the creation of pores in the membrane.

12. 12. The method of any one of claims 1 to 11, wherein at least 30% of the genomic DNA in the cells before illumination remains in the cells after release of the viral vector.

13. 13. The method of any one of claims 1 to 12, wherein the collecting is by removal of cellular debris.

14. 14. The method according to claim 13, wherein the cells are in an aqueous medium throughout steps a) and b) and the harvesting is carried out by separating the aqueous medium from cell debris not suspended in the medium, preferably by centrifugation.

15. 15. The method of any one of claims 1 to 14, wherein the viral vector is purified, preferably to a purity of at least 50% (w / w, dry weight), using at least one of the following methods selected from: centrifugation, sonication, freezing and thawing, enzymatic digestion, and liquid chromatography.

16. The method according to any one of claims 1 to 15, wherein the contacting step a) is preceded by a step of producing the viral vector in the cells.

17. 17. The method of claim 16, wherein the viral vector is produced by culturing the cells to allow the cells to produce the viral vector, and optionally the culture supernatant is removed before step a).

18. 18. The method of claim 17, wherein the cells produce the viral vectors after infection of the cells with one or more of the viral vectors and / or transfection with one or more polynucleotides that enable production of the viral vectors in the cells.

19. 19. The method of any one of claims 16 to 18, wherein prior to the step of producing the viral vectors, a step of infecting the cells with one or more of the viral vectors or transfecting the cells with one or more polynucleotides and / or viral vectors that enable the production of the viral vectors in the cells is carried out.

20. A cell collection kit or device for releasing a viral vector from a cell, comprising: a) a photosensitizing agent; and b) a light source for illuminating the cells and a kit or apparatus comprising:

21. 21. The kit or device of claim 20, wherein the kit or device additionally comprises a container into which the cells can be placed.

22. 22. The kit or device of claim 21, wherein the container is suitable for cell culture or purification of the cells.

23. 23. The kit or device of claim 21 or 22, wherein the container is a bag or tank, and / or the light source is coupled to the container.

24. 24. The kit of any one of claims 20 to 23, wherein the kit or device additionally comprises means for agitating the cells.

25. A viral vector preparation obtainable by a method as defined in any one of claims 1 to 19.

Images