Antibodies and antibody derivatives against equine IL-5

Abstract

The present invention provides an isolated antibody or antibody derivative that specifically binds to equine interleukin-5 (eqIL-5), comprising at least one member selected from the group consisting of equine light chain constant, equine heavy chain constant, and fragments thereof. Additionally, provided are isolated nucleic acid molecules comprising nucleic acid sequences encoding the isolated antibody or antibody derivative, vectors comprising the respective nucleic acid sequences, and host cells comprising the isolated nucleic acid molecule. The present invention also provides pharmaceutical compositions comprising the isolated antibody or antibody derivative and a pharmaceutically acceptable excipient. Furthermore, provided are uses of the isolated antibody or antibody derivative or pharmaceutical composition as a medicine, particularly for treating allergic conditions in horses. The present invention also relates to in vitro methods for diagnosing allergic conditions in horses, as well as methods for producing the isolated antibody or antibody derivative.

Description

[Technical Field]

[0001] Allergic conditions affect approximately 10% of equines (including horses, ponies, donkeys, gerbils, and mules) worldwide. Among these, seasonal allergies are the most common and primarily belong to the groups of cutaneous and respiratory allergies. The most prominent examples of cutaneous and respiratory allergies are insect sting hypersensitivity and asthma. [Background technology]

[0002] Insect bite hypersensitivity (IBH, also known as Culicoides hypersensitivity (CH), sweet itch, summer eczema, summer rash, Queensland itch, summer dermatitis, or equine dermatitis) is an allergic reaction to bites, primarily percutaneous, by mosquitoes and Culicoides flies. This most common allergic dermatitis can affect up to 72% of allergic horses (including ponies), particularly in warmer climates, depending on the species and region. It is the animal's reaction to the saliva of Culicoides and other insects. Bites result in an allergic reaction accompanied by a massive infiltration of eosinophils into the affected skin area. Horses suffer from itching, skin lesions, hair loss, and secondary infections that can lead to chronic dermatitis. These horses experience itching (pruritus) associated with insect bites, and in some cases the animals injure themselves by scratching vigorously, resulting in open skin lesions with hair loss and crusting. These lesions can then promote secondary infections. Horses severely affected by summer eczema are therefore unable to lead a normal herd life.

[0003] Horses with asthma suffer from chronic airway inflammation that causes a decreased ability to cough, nasal discharge, or obvious respiratory distress. Asthma ("equine asthma syndrome") encompasses a range of conditions from mild asthma, also known as inflammatory airway disease (IAD) in young horses, to severe asthma commonly referred to as pulmonary emphysema (chronic obstructive pulmonary disease (COPD) or recurrent airway obstruction (RAO)) and grazing-associated or summer-associated airway disease. Clinical signs develop after exposure to aerosolized particles, which may primarily be particles derived from endotoxins produced by certain bacteria, mold, fungi, β-D-glucans, microorganisms, plant matter, inorganic dust, and noxious gases such as ammonia from urine and dead mites. Horses with severe asthma are typically managed through antigen avoidance and the use of corticosteroids and bronchodilators to reduce airway inflammation, bronchoconstriction, and improve lung function (Simoes, J. Equine Vet. Sci. 2020, 87, 102937). However, some horses do not respond to corticosteroid treatment, and effective treatments remain needed. As with other allergic conditions, eosinophilic airway inflammation is observed in asthma.

[0004] Interleukin-5 (IL-5) is associated with a variety of chronic inflammatory conditions and is thought to play a role in allergic conditions, including equine allergic asthma and insect sting hypersensitivity, the most common allergic condition in horses affecting the skin (Janssen et al., Frontiers in Immunology 2022, 13, 921077; Roufosse, Front. Med., 5, 49; Fettelschoss-Gabriel et al., The Veterinary Journal 2021, 276, 105741).

[0005] As reported by Fettelschoss-Gabriel et al. (2021), equine IBH is a type of allergen-derived CD4 +They exhibit a type I allergic phenotype, including type 2 T helper (Th2) polarization and IL-4 / IL-13 dominance. This has been described as resulting in Culicoides allergen-specific IgE and corresponding degranulation of mast cells and basophils. Eosinophilia has been suggested to play an increasingly dominant role in the chronic allergic disease stage, but type I IgE-mediated responses predominate in the early stages (Fettelschoss-Gabriel et al., The Veterinary Journal 2021, 276, 105741). Chronic allergen exposure leads to a shift from conventional Th2 (cTh2) cells to pathogenic effector Th2 (peTh2) cells. The latter secrete high levels of IL-5, resulting in eosinophilia (Mitson-Salazar and Prussin, Frontiers in Medicine 2017, 4, 165).

[0006] IL-5 is the most potent activator of eosinophils and is produced by Th2 cells and ILC2s in mammals. IL-5 has also been reported to play a role in eosinophil extracellular trap cell death (Nagase et al., Allergology International 2020, 69, 178-186). IL-5 binds to the interleukin-5 receptor and is therefore involved in B cell proliferation and immunoglobulin secretion. As a key mediator in eosinophil activation, the present inventors identified IL-5 as a target for addressing allergic conditions such as IBH, atopic dermatitis, and asthma in horses. The important role of eosinophils in the molecular mechanisms of equine atopic dermatitis can be seen, for example, in Fettelschoss-Gabriel et al. (2021).

[0007] IL-5 has also been shown to be upregulated in other allergic horses, particularly those with asthma (Janssen et al., Frontiers in Immunology 2022, 13, 921077). Dewachi et al. (2006) found that horses with pulmonary emphysema had significantly increased numbers of neutrophils expressing the IL-5 receptor compared to controls while grazing, and that this increased further in horses with pulmonary emphysema but not in control animals while in the stable (Dewachi et al., Vet Immunol Immunopathol 2006, 109(1-2), 31-6). Using immunohistochemistry and in situ hybridization, expression of IL-5 was observed in BALF lymphocytes of horses with sEA (Cordeau et al., Vet. Immunol. Immunopathol. 2004, 97, 87-96; Lavoie et al., Am. J. Respir. Crit. Care Med. 2001, 164, 1410-1413).

[0008] Bond et al. (2019) demonstrated downregulation of IL-5 in response to dexamethasone administration in horses with mild asthma (Bond et al., BMC Vet Res. 2019, 15, 397). Other researchers have reported that IL-5 is upregulated in horses with mild equine asthma in both mast cell and neutrophil phenotypes (Beekman et al., J Vet Intern Med. 2012, 26(1), 153-161). This appears to differ from findings in humans where IL-5 is highly specific to eosinophilic inflammation. Although eosinophils are not commonly detected in equine BALF, except in a subgroup of mild equine asthma (MEA), which has been reported primarily in young horses associated with dust exposure (Riihimaki et al., Can J Vet Res. 2008, 72(5), 432; Ivester et al., J Vet Intern Med. 2014, 28(3), 918-924), environmental allergens appear to be associated with both the clinical signs and lower airway inflammatory pathology observed in horses with MEA (Bond et al., J Vet Intern Med. 2018, 32(6), 2088-2098).

[0009] Fettelschoss-Gabriel et al. (2021) suggested the use of a therapeutic equine IL-5 vaccine based on virus-like particles (VLPs) to treat IBH. The vaccine was tested in horses with IBH in a placebo-controlled, randomized, double-blind clinical trial. Both trials demonstrated a reduction in IBH lesion scores throughout the entire IBH season after vaccination. However, these virus-based approaches have the disadvantage of potentially eliciting excessive immune responses due to polyclonal glycosylated antibodies produced in the horse's body after vaccination. Furthermore, because endogenous IL-5 protein is used for vaccination, there is a risk of lifelong autoimmune antibody development. Fettelschoss-Gabriel et al. (2021) explicitly advise against the use of therapeutic antibodies in horses. On page 7, right column, at the end of the second paragraph, it states, "However, the size and weight of horses currently preclude the use of monoclonal antibodies in this species, as such therapies based on passive vaccination generally require frequent injections of large amounts of antibody per kg of patient body weight, making the costs of treatment excessively high. Therefore, the benefits of cytokine-blocking antibodies used in humans can be transferred to large companion animals such as horses by active vaccination."

[0010] Although polyclonal, serum-purified diagnostic antibodies against equine IL-5 are commercially available, they cannot be used as pharmaceuticals because they do not contain at least a partially equine-derived backbone, meaning that the constant region of the diagnostic antibody is at least partially non-equine. "At least partially" refers to a portion of the entity to which the term refers, but perhaps not the entirety. By indicating "at least," everything between a portion and the entire entity is constituted. It means that, in relation to an equine-derived backbone, at least a portion of the antibody backbone up to the complete amino acid sequence is of equine origin or has at least 95% high sequence identity to the respective equine amino acid sequence. The backbone typically includes the constant portions of the antibody, i.e., the heavy and light chain constant regions. Thus, "at least partially equine" in relation to an equine-derived backbone includes the complete constant regions of the antibody heavy and / or light chain, as well as portions thereof, such as truncated forms. It also includes the possibility that portions of the backbone may be derived from organisms other than horses. However, it is preferred that the entire backbone is equine, i.e., of equine origin. More preferably, the backbone is of equine origin, but glycosylation sites are removed by amino acid exchange or chemical modification so that glycosyl residues cannot be attached.

[0011] In contrast, the diagnostic antibodies of the prior art are primarily derived from goats or rabbits, which may not be used as medicines because they provoke an immune response from the horse's immune system against the foreign antibodies. The prior art antibodies are at least partially non-equine and do not contain at least one member selected from the group consisting of equine constant light chains, equine constant heavy chains, and fragments thereof. The diagnostic antibodies also contain naturally occurring glycosylation sites.

[0012] Thus, to date, no effective treatment for horses suffering from allergic conditions has been available. Contrary to suggestions in the art, the present inventors have developed antibodies and antibody derivatives that specifically bind to IL-5 in horses. These antibodies have demonstrated high binding activity and high neutralization efficiency in in vitro tests. Furthermore, these antibodies have also demonstrated high safety and tolerability in targeted animal studies, supporting the efficacy of the antibodies in treating allergic conditions in horses, particularly IBH. Due to their ability to neutralize IL-5 activity in equine allergic conditions, these antibodies provide effective and specific treatment for horses suffering from allergic conditions. The present invention provides an isolated antibody or antibody derivative that specifically binds to equine IL-5 and comprises at least one member selected from the group consisting of equine light chain constant, equine heavy chain constant, and fragments thereof. The presence of at least one member selected from the group consisting of equine light chain constant, equine heavy chain constant, and fragments thereof reduces the activation of the horse's immune system against the administered antibody or antibody derivative, thereby increasing the efficacy of the antibody or antibody derivative treatment. In contrast to VLP-based vaccines, the present invention specifically and preferably provides aglycosylated antibodies and antibody derivatives that specifically avoid triggering the equine immune system, i.e., do not further enhance the equine immune response. To further reduce interaction with the endogenous immune system, the IgG subclass, more preferably the IgG6 subclass, can be used. This subclass is known not to interact with cells of the innate and adaptive immune systems. This prevents the horse from overreacting to the antibodies or antibody derivatives of the present invention and from developing autoimmune reactions. Furthermore, antibodies and antibody derivatives of the IgG and IgG6 subclasses have a circulating half-life of only about 21 days. This allows for very controlled and specific administration of the antibodies or antibody derivatives, minimizing side effects in the horse.

[0013] The basic vaccination regimen using a VLP-based vaccine consists of three vaccinations in the first year and annual boosters thereafter. Efficacy was comparable to the higher, more persistent antibodies in the second treatment. Vaccinated horses did not have IL-5-specific antibodies immediately before the second and third year boosters, indicating the reversibility of vaccine-induced anti-IL-5 antibodies. However, whether repeated vaccinations over many years can ultimately permanently alter the immune system cannot be inferred from the available experimental data. The advantage of monoclonal antibodies is that they do not affect the immune system itself but directly capture IL-5 (Fettelschoss-Gabriel et al., Allergy 2019, 74(3), 572-582).

[0014] Since IBH is an overreaction of the endogenous immune system, preventing further enhancement of this immune response makes antibodies or antibody derivatives superior to prior art VLP-based therapeutic vaccines. Summary of the Invention

[0015] As mentioned above, no effective treatments have yet been found for the allergic conditions discussed. Furthermore, there is a need for highly sensitive diagnostic methods, and the antibodies and antibody derivatives of the present invention provide specific diagnostic tools targeting IL-5 activity in horses that can be used as a marker for allergic conditions. Therefore, it is an object of the present invention to provide efficient treatments for allergic conditions in horses and diagnostic tools for determining the allergic condition of horses. To this end, the present invention provides isolated antibodies or antibody derivatives that specifically bind to equine IL-5, comprising at least one member selected from the group consisting of equine light chain constant, equine heavy chain constant, and fragments thereof. Preferably, the isolated antibody or antibody derivative comprises at least one equine light chain constant or fragment thereof and / or at least one equine heavy chain constant or fragment thereof, optionally set forth in SEQ ID NO: 56 (amino acid sequence of the light chain constant region), SEQ ID NO: 57 (amino acid sequence of the heavy chain constant region), or SEQ ID NO: 151 (amino acid sequence of the heavy chain constant region CH1), respectively, or having at least 75%, at least 80%, at least 90%, preferably at least 95% or 97%, more preferably 98%, and particularly preferably 99% sequence identity thereto. Fragments of SEQ ID NOs: 56, 57, and / or 151 can also be used. In another preferred embodiment, the isolated antibody or antibody derivative comprises at least two equine light chain constants and at least two equine heavy chain constants or fragments thereof, optionally set forth in SEQ ID NO: 56 (amino acid sequence of the light chain constant region), SEQ ID NO: 57 (amino acid sequence of the heavy chain constant region), or SEQ ID NO: 151 (amino acid sequence of the heavy chain constant region CH1), respectively, or has at least 75%, at least 80%, at least 90%, preferably at least 95% or 97%, more preferably 98%, and particularly preferably 99% sequence identity thereto. More preferably, the isolated antibody or antibody derivative is a monoclonal antibody or antibody derivative. Furthermore, particularly preferably, the (monoclonal) isolated antibody or antibody derivative is aglycosylated.

[0016] Preferably, the isolated antibody or antibody derivative comprises at least one complementarity determining region (CDR) amino acid sequence selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 1, 155, 156, 157, 158, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21. Also preferably, the isolated antibody or antibody derivative comprises at least one CDR amino acid sequence having at least 99% sequence identity to any of the sequences set forth in any one of SEQ ID NOs: 1, 155, 156, 157, 158, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21.

[0017] More preferably, the isolated antibody or antibody derivative comprises the amino acid sequence of the light chain CDR1 set forth in SEQ ID NO: 1, the amino acid sequence of the light chain CDR2 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 155, 156, 157 and 158, the amino acid sequence of the light chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 2, 3, 4 and 5, the amino acid sequence of the heavy chain CDR1 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 6, 7, 8 and 9, the amino acid sequence of the heavy chain CDR2 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 10, 11, 12, 13 and 14, and the amino acid sequence of the heavy chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 15, 16, 17, 18, 19, 20 and 21.

[0018] Even more preferably, the isolated antibody or antibody derivative according to the invention comprises a light chain variable region comprising an amino acid sequence identical to or with at least 90%, 95%, 98% or 99% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 35, 36 or 37, and / or comprises a heavy chain variable region comprising an amino acid sequence identical to or with at least 90%, 95%, 98% or 99% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 38, 39, 40, 41, 42, 43, 45, 49, 50, 51, 52 or 53.

[0019] In another preferred embodiment of the invention, the isolated antibody or antibody derivative according to the invention comprises a light chain amino acid sequence that is identical to or has at least 90%, 95%, 98% or 99% sequence homology to the amino acid sequence set forth in SEQ ID NO: 54, and / or comprises a heavy chain amino acid sequence that is identical to or has at least 90%, 95%, 98% or 99% sequence homology to the amino acid sequence set forth in SEQ ID NO: 55 or 153, more preferably to the amino acid sequence set forth in SEQ ID NO: 55.

[0020] In another preferred embodiment, the isolated antibody or antibody derivative is an isolated IgG antibody or antibody derivative. More preferably, the isolated antibody or antibody derivative is an isolated IgG6 antibody or antibody derivative.

[0021] Optionally, the isolated antibody or antibody derivative according to the invention has the ability to neutralize IL-5, particularly equine IL-5. Preferably, the antibody does not bind, or binds only to a very small extent, to bovine serum albumin (BSA).

[0022] Further optionally, the isolated antibody or antibody derivative according to the present invention is equine.

[0023] The present invention also provides an isolated nucleic acid molecule comprising at least one nucleic acid sequence encoding an isolated antibody or antibody derivative according to the invention.

[0024] Further provided is a vector comprising at least one nucleic acid sequence encoding an isolated antibody or antibody derivative according to the invention. In a preferred embodiment, the vector is an expression vector.

[0025] Also provided is a host cell comprising at least one nucleic acid sequence encoding a vector of the invention, or an isolated antibody or antibody derivative according to the invention and described herein. Preferably, the host cell is a eukaryotic host cell.

[0026] In another embodiment, the invention provides a pharmaceutical composition comprising an isolated antibody or antibody derivative according to the invention and a pharmaceutically acceptable excipient.

[0027] In one embodiment, the isolated antibody or antibody derivative or pharmaceutical composition according to the present invention and described herein is for use as a medicament. Preferably, the isolated antibody or antibody derivative or pharmaceutical composition of the present invention is provided for use in treating an allergic condition in an equine. More preferably, the allergic condition is selected from the group consisting of equine allergic skin disease, equine allergic respiratory disease, and inflammatory disease. In another preferred embodiment, the equine allergic skin disease is selected from the group consisting of IBH, atopic dermatitis, food hypersensitivity, allergic and irritant contact dermatitis, and urticaria. More preferably, the equine allergic skin disease is IBH or atopic dermatitis, and most preferably, the equine allergic skin disease is IBH. The equine allergic respiratory disease is preferably equine asthma. Also preferably, the allergic condition is IBH or equine asthma.

[0028] Further provided is an in vitro method for the diagnosis of an allergic condition in a horse, comprising contacting an isolated antibody or antibody derivative according to the invention with a biological sample, preferably obtained from a horse suspected of suffering from an allergic condition.

[0029] In another aspect of the invention, there is provided a method of producing an isolated antibody or antibody derivative according to the invention, comprising expressing the isolated antibody or antibody derivative in a host cell. Preferably, the isolated antibody or antibody derivative is expressed in a host cell according to the invention, such as a eukaryotic cell.

[0030] The term "antibody" refers to an intact immunoglobulin having two light chains and two heavy chains. The isolated antibody or antibody derivative may be a polyclonal antibody, a monoclonal antibody, a synthetic or artificial antibody, a recombinant antibody, a bi-, tri-, or multispecific antibody, a chimeric antibody, and / or an equine-derived antibody. Combinations of these are also possible; for example, an antibody may be a monoclonal antibody and an equine-derived antibody. An "anti-IL5" or "α-IL5" antibody, as an antibody of the present invention, is an antibody that binds to IL-5, particularly equine IL-5. Preferably, the antibody of the present invention specifically binds to equine IL-5. The antibodies of the present invention are further defined in the claims.

[0031] Currently, there are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, some of which can be further divided into subclasses (isotypes) (Wagner, Dev Comp Immunol. 2006, 30(1-2), 155-64). Seven IgG subclasses exist in horses. For the antibodies and antibody derivatives of the present invention, subclass IgG6 is preferred because it has the lowest effector function. IgG has the advantage of a half-life of approximately 21 days in horses. Furthermore, even if side effects ultimately occur, the antibodies do not persist in the horse's body for long periods, effectively suppressing the side effects. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known in multiple species. The prevalence of individual isotypes and functional activities associated with these constant domains is species-specific. The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (κ) and lambda (λ), based on the amino acid sequences of their constant domains. Immunoglobulins can be assigned to different classes, depending on the amino acid sequences of the constant domains of their heavy chains.

[0032] "Intact immunoglobulins" or "native immunoglobulins" of the IgG subclass are typically heterotetrameric glycoproteins with a molecular weight of approximately 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide bonds varies among the heavy chains of various immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has a variable domain (VH, heavy chain variable region) at one end followed by several constant domains (heavy chain constant region). Each light chain has a variable domain (VL, light chain variable region) at one end and a constant domain (light chain constant region) at the other end, with the light chain constant domain aligned with the first constant domain of the heavy chain and the variable light chain domain aligned with the variable heavy chain domain. Particular amino acid residues are believed to form an interface between the light chain variable domain (region) and the heavy chain variable domain (region). The variable domain (region) of the isolated antibody and antibody derivative of the present invention binds to an antigen, i.e., equine IL-5. As noted above, in contrast to the usual appearance of natural immunoglobulins of the IgG subclass, the isolated antibody or antibody derivative of the present invention is preferably aglycosylated.

[0033] The term "antibody derivative" includes all shorter or truncated forms of the antibodies described herein, as well as antibody fragments (i.e., non-intact immunoglobulins). Antibody derivatives contain the antigen-binding portion of an antibody that specifically binds, and preferably neutralizes, equine IL-5. Antibody derivatives may be truncated in the Fc region of the antibody or may not contain the Fc region at all. The term includes isolated single (heavy or light) antibody chains, Fv constructs, F(ab')2 fragments, Fab constructs, Fc constructs, and light or variable heavy chain regions or complementarity-determining region (CDR) sequences. Furthermore, the term "antibody derivative" includes antibody conjugates in which an antibody is conjugated to another functional molecular entity, optionally via a linker, such as a short peptide (1-10 amino acids) or another organic linker. Conjugated refers to the covalent bond between an antibody and another molecular entity, optionally an organic or inorganic molecular moiety that may confer additional properties and / or functionality to the antibody. This facilitates purification, detection, and may include at least one moiety for increasing bioavailability and / or biocompatibility. Such molecular entities may also be used to localize antibodies and antibody derivatives to desired regions within the horse's body. The linker may be cleavable by chemical means or by the application of heat, light, or other. Fragments of equine light chain constant or equine heavy chain constant include any truncated, i.e., shortened, form of equine light chain constant or equine heavy chain constant and may contain a small number (at least 10 amino acids).

[0034] As used herein, the term "hypervariable region" refers to amino acid residues of an antibody or antibody derivative that are involved in antigen binding, e.g., binding to equine IL-5. Hypervariable regions include amino acid residues from the "complementarity-determining regions" (CDRs) and / or residues from the "hypervariable loops." "Framework" (FR) residues are variable domain residues other than the hypervariable region residues. Papain digestion of an antibody produces two identical antigen-binding fragments, called "Fab" (fragment antigen-binding) fragments, each of which contains a single antigen-binding site and a remaining "Fc" fragment, named for its ability to crystallize. Pepsin treatment of an antibody yields an F(ab')2 fragment, which contains two antigen-binding sites and is still capable of cross-linking antigen. "Fv" is the minimum antibody fragment that contains a complete antigen recognition and binding site. This region consists of a dimer of one heavy-chain variable domain and one light-chain variable domain in tight, noncovalent association. In this configuration, the three hypervariable regions of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. The six hypervariable regions collectively confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv containing only three antigen-specific hypervariable regions) can recognize and bind antigen with neutralizing activity, albeit at a lower avidity than the entire binding site. Fab fragments also contain the light-chain constant domain and the first heavy-chain constant domain (CH1). Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy-chain CH1 domain, including one or more cysteines from the antibody hinge region. Fab'-SH is the designation for Fab' in which the cysteine ​​residues in the constant domains bear a free thiol group. F(ab')2 antibody fragments were originally produced as pairs of Fab' fragments, which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

[0035] The term "specifically" in the context of antibody or antibody derivative binding refers to high avidity and / or high avidity of the antibody / derivative for a specific antigen, i.e., polypeptide or epitope. The avidity of a protein-protein interaction can be described as the strength of the interaction between a receptor and its respective ligand. An example of this is the epitope of an antibody or antibody derivative and an antigen (here, specifically IL-5). In this interaction, the antigen binds to the epitope through a variety of different types of bonds, such as hydrogen bonds, ionic bonds, van der Waals interactions, and electrostatic forces. The term "specifically" also includes the antibody or antibody derivative binding to equine IL-5 to a much greater extent than to other targets, including BSA.

[0036] The term "isolated" means that the antibody, antibody derivative, or nucleic acid molecule is separated and / or recovered from components of its natural environment. Contaminant components of natural environment are materials that would interfere with diagnostic or therapeutic uses for the material, and may include enzymes and other proteinaceous solutes. With respect to nucleic acids, isolated nucleic acids may include those separated from the 5' to 3' sequences with which they are normally associated in chromosomes. In preferred embodiments, the material is purified to greater than 95%, and most preferably greater than 99%, by weight of the material. Isolated material includes material in situ within recombinant cells, since at least one component of the material's natural environment will be absent. Ordinarily, however, isolated material will be prepared by at least one purification step.

[0037] "IL-5" (interleukin-5) is the most potent activator of eosinophils and is produced by Th2 cells and ILC2 in mammals. IL-5 also plays a role in eosinophil extracellular trap cell death and has been reported to bind to the IL-5 receptor. IL-5 is also involved in B cell proliferation and immunoglobulin secretion. Furthermore, IL-5 has also been shown to be upregulated in horses with other allergies, particularly those with asthma. The antibodies and antibody derivatives of the present invention specifically bind to equine IL-5, i.e., IL-5 derived from horses.

[0038] As defined herein, a "monoclonal antibody or antibody derivative" is a single antibody or antibody derivative generated by hybridoma technology or selected by phage display approaches and cloned into an immunoglobulin, preferably an equine IgG backbone (i.e., the constant region is equine and belongs to the IgG or IgG6 immunoglobulin class). This construct can then be transferred on a DNA basis into a single cloned eukaryotic cell for production.

[0039] "Chimeric" antibodies (immunoglobulins) are antibodies in which portions of the heavy and / or light chains are identical or homologous to corresponding sequences in antibodies derived from a particular species, while the remainder of the chains are identical or homologous to corresponding sequences in antibodies derived from another species or engineered, as well as fragments of such antibodies, so long as they exhibit the desired biological activity. Typically, chimeric antibodies are antibodies whose light and heavy chain genes are constructed or engineered, typically by genetic engineering, from antibody variable and constant region genes belonging to different species. For example, variable segments from genes derived from a non-equine monoclonal antibody can be linked to equine constant segments. In this embodiment, the variable domains containing the antigen-binding sites are derived from a human antibody library, while the constant domains are of equine origin. In one embodiment, the isolated antibody or antibody derivative of the present invention is an isolated chimeric antibody or antibody derivative, preferably an isolated chimeric antibody or antibody derivative comprising at least one member selected from the group consisting of a non-equine light chain variable region, a non-equine heavy chain variable region, at least one non-equine CDR, and combinations thereof. "Non-equine" includes all organisms other than horses, i.e., animals belonging to the family Equidae. An example of a non-equine is a human. "Equine" in the sense of the present invention should be understood as "derived from a horse" or "of equine origin." The antibodies and antibody derivatives of the present invention may also bind to IL-5 from donkeys, hindties, and mules.

[0040] "Homologous" or having a certain percentage of sequence identity with respect to an amino acid or nucleic acid sequence means that the sequences or antibody chains share at least 80% sequence identity, preferably at least 85% or at least 90%, more preferably at least 95% or 97%, and even more preferably at least 98% or 99% sequence identity or homology. Most preferred is 100% sequence identity. In this case, the included amino acid or nucleic acid sequence is 100% identical to the respective SEQ ID NO. Thus, "identical" means 100% sequence identity or homology. "Identity" or "homology" with respect to an amino acid or nucleic acid sequence is defined herein as the percentage of amino acid or nucleic acid residues in a different sequence that are identical to the parent or original amino acid or nucleic acid residues after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Neither N-terminal, C-terminal, nor internal extensions, deletions, nor insertions into the antibody sequence shall be construed as affecting sequence identity or homology. Sequence identity or homology can be determined by standard computational tools available to those skilled in the art, such as BLAST or similar.

[0041] "Equined" forms of non-equine (e.g., murine) antibodies are genetically engineered antibodies that contain sequences derived from non-equine immunoglobulins. Equined antibodies are equine immunoglobulin sequences (recipient antibody) in which hypervariable region residues of the recipient are replaced by hypervariable region residues from a non-equine species (donor antibody), such as human or artificial, with the desired specificity, avidity, and capacity. In some instances, framework region (FR) residues of the equine immunoglobulin sequence are replaced by corresponding non-equine residues. Furthermore, equine-enhanced antibodies may contain residues that are not found in the recipient or donor antibody. These modifications are made to further improve antibody performance. Generally, equine-enhanced antibodies contain substantially all or at least one, typically two, variable domains, in which all or substantially all of the hypervariable regions correspond to those of the non-equine immunoglobulin sequence and all or substantially all of the FRs are those of the equine immunoglobulin sequence. The equine antibody also comprises all or at least a portion of an immunoglobulin constant region (Fc), typically that of an equine immunoglobulin sequence.

[0042] The term "neutralizing potency against IL-5" refers to the ability of an antibody or antibody derivative to neutralize IL-5 at an IC of 0.3 to 1 molar ratio of antibody to monomeric antigen. 50 This means that the IC 50 The values ​​are the antibody or antibody derivative concentrations required to reduce binding of equine IL-5 (eqIL-5) to its receptor by 50% when preincubated with the antigen and then added to Expi293F cells displaying the eqIL-5 receptor on their surface. Binding of the antigen to the cells is detected in a flow cytometer by fluorescent labeling via a His tag and fluorescently labeled antibody. To obtain relative binding, the measured fluorescent signal (median) is related to the signal in the presence of only antigen and cells, but no inhibitory antibody.

[0043] "Aglycosylated" indicates that the antibody or antibody derivative is not glycosylated due to mutations in the heavy chain constant region when compared to the amino acid sequence of a native equine heavy chain constant region. Aglycosylated antibodies or antibody derivatives are comparable in terms of antigen binding, pharmacokinetics, and biodistribution, but have the advantage of avoiding the disadvantages of glycosylated antibodies, including glycan heterogeneity and the need for large capital investments in biomanufacturing. For example, glycosylated antibodies or glycosylated antibody derivatives may play an unfavorable role in recruiting innate immune effector cells. The antibodies and antibody derivatives of the present invention are preferably aglycosylated, i.e., not glycosylated, thereby overcoming this disadvantage.

[0044] The terms "nucleic acid," "polynucleotide," "nucleic acid molecule," and the like can be used interchangeably and refer to a sequence of nucleotide bases (also referred to as "nucleotides") in DNA and RNA. The nucleic acid molecules of the present invention can contain deoxyribonucleotides, ribonucleotides, and / or their natural or artificial analogs. The term "nucleic acid molecule" includes single-stranded and double-stranded molecules. The nucleic acid molecule may be a gene or gene fragment, an exon, an intron, a DNA molecule such as cDNA, an RNA molecule such as mRNA, a recombinant nucleic acid molecule, a plasmid, and other vectors, primers, and probes. Both 5' to 3' (sense) and 3' to 5' (antisense) polynucleotides are included. The nucleic acid molecules of the present invention are preferably isolated as defined above. "At least partially encoding" means that the nucleic acid sequence can encode the complete amino acid sequence of the heavy and / or light chain of the antibody or antibody derivative of the present invention, or can encode only a portion of the amino acid sequence of the heavy and / or light chain, i.e., only the heavy chain or only the light chain, only the heavy or light chain variable region, or only the heavy or light chain constant region. Different combinations are possible, and only portions of the heavy and light chains may be encoded by a single nucleic acid sequence or single nucleic acid molecule. Different host cells, (isolated) nucleic acid molecules, or vectors can be used to produce isolated antibodies or antibody derivatives. For example, the heavy and light chains of antibodies and antibody derivatives can be produced separately or in parallel in any order using different host cells, isolated nucleic acid molecules, and / or vectors. For antibody derivatives, the complete amino acid sequence of the heavy and / or light chains is not required; the nucleic acid sequences disclosed herein can be used in truncated form, i.e., not full-length as described herein, to produce, for example, truncated antibody derivatives. Thus, depending on the needs of the practitioner, the amino acid and nucleic acid sequences described herein can be truncated.

[0045] The term "host cell" refers to a prokaryotic or eukaryotic cell (e.g., a bacterial cell or a mammalian cell), whether in vitro or in vivo. For example, a host cell may reside in a transgenic animal. A host cell may include any transformable organism that can be used as a recipient for a vector, replicate the vector, and / or express a heterologous nucleic acid encoded by the vector. This allows for the production of large quantities of the antibodies or antibody derivatives of the present invention with reproducible quality. Those skilled in the art are well aware of standard techniques for the expression of proteins, particularly antibodies or antibody derivatives, as well as techniques for protein purification. In this context, "protein" includes the antibodies and antibody derivatives of the present invention. An (expression) vector carrying a nucleic acid sequence encoding an antibody or antibody derivative of the present invention can be introduced into a suitable host cell by any of a variety of suitable means, including transformation, transfection, conjugation, protoplast fusion, calcium phosphate precipitation, and application of polycations such as diethylaminoethyl (DEAE) dextran, as well as mechanical means such as electroporation, direct microinjection, and particle bombardment.

[0046] The term "allergic condition" is defined herein as a disorder or disease caused by the interaction between the immune system and an entity foreign to the body, i.e., an allergen. The body's reaction to the foreign entity is often too strong, causing problems for the subject who comes into contact with the allergen. Preferably, the allergic condition is IBH or equine asthma. Most preferably, the allergic condition is IBH.

[0047] The term includes allergic skin diseases, allergic respiratory diseases, and inflammatory diseases. The term "equine allergic skin disease" includes diseases that manifest with symptoms related to the skin of the horse, such as IBH, atopic dermatitis, food hypersensitivity, allergic and irritant contact dermatitis, and urticaria, preferably the equine allergic skin disease is IBH or atopic dermatitis, and most preferably the equine allergic skin disease is IBH. Combinations thereof are also possible.

[0048] The terms "insect bite hypersensitivity" (IBH), "Culicoides hypersensitivity" (CH), "sweet itch," "kasen," "Queensland itch," "summer dermatitis," "equine dermatitis," and "summer eczema" refer to allergic reactions to mosquito and Culicoides bites as well as allergic reactions (percutaneous) to other insects. These terms may be used interchangeably herein. The disease is characterized by pruritus and secondary lesions of alopecia and crusting. Distribution on the horse's body depends on the Culicoides species feeding on the horse. The traditional distribution is a dorsal distribution of the disease (predominantly referred to as kasen), with lesions found on the face, mane, withers, rump, and tail. Ventral blood-feeding flies (Culicoides) cause lesions in the intermandibular space and the abdominal body wall. A combination of both is also possible. To date, no effective treatment exists, so minimizing insect exposure is the only option for horse owners. In acute cases, glucocorticoids, with their many side effects, are the only available treatment, but are not suitable for sustained treatment. Additionally, stabilizing affected horses from dusk to dawn and using insect repellents, ventilation fans in the stall, fly masks, and fly sheets are helpful. Diagnosis of IBH is generally based on history, clinical signs, improvement with insect control, and intradermal and / or ELISA testing (based on serology) (Fadok, Vet. Clin. Equine 2013, 29, 541-550).

[0049] "Atopic dermatitis" is a pruritic, inflammatory disease of the skin in mammals, primarily caused by contact with a variety of antigens (e.g., pollen, mold, food, mites, and dust, both inhaled and percutaneous), which may be followed by inflammatory respiratory disease later in the disease progression (Misery and Stander, edt. 2010. Pruritus. London, Springer, Marsella, Vet Sci. 2021, 8(7), 124). Clinical signs of equine atopic dermatitis are pruritus and skin inflammation, typically affecting the face, ears, and hairless areas. Many atopic horses are also allergic to insects.

[0050] "Food intolerance" is any allergic condition caused by a food allergen, such as a grain, grass, supplement, or food additive.

[0051] "Allergic and irritant contact dermatitis," including allergic eczema, is an allergic condition that affects the skin of horses and other mammals, resulting in epidermal destruction associated with an itchy, inflammatory response due to allergic sensitization. Allergens include lotions, shampoos, etc., and nickel, copper, and zinc (transdermally). Allergic contact dermatitis can occur as a single event or chronically (Nedorost, Dermatologic Clinics 2020, 38(3) 301-308).

[0052] "Urticaria" (including "hives") is a skin condition characterized by the formation of itchy, red or white, raised patches, usually caused by an allergen (Misery and StanderPruritus 2010, London, Springer).

[0053] "Equine allergic respiratory disease" is an allergic condition in horses that manifests as symptoms in the horse's respiratory system.

[0054] An "inflammatory disease" is a condition characterized by inflammation.

[0055] The term "equine asthma" (according to the ACVIM Consensus Statement 2016) includes all respiratory diseases from inflammatory airway disease (IAD), pulmonary emphysema, and recurrent airway obstruction (RAO) of moderate to high severity. RAO was formerly known as chronic obstructive pulmonary disease (COPD), and in German-speaking countries, it is still called chronic obstructive bronchitis (COB). COB is a chronic, inflammatory, and non-infectious disease of the lungs. Therefore, the term "equine asthma" includes IAD, pulmonary emphysema, RAO, COPD, and COB.

[0056] A "pharmaceutical composition" within the meaning of the present invention means a combination of an active agent, here an antibody or antibody derivative of the present invention, with another compound or composition, which may be inert (such as water or a buffer) or active, e.g., an adjuvant.

[0057] A "therapeutically effective amount" (or "effective amount") refers to an amount of the active ingredient, i.e., an antibody or antibody derivative according to the present invention, sufficient to produce a beneficial or desired result when administered to a subject or patient, in this case a horse suffering from an allergic condition. An effective amount can be administered by one or more routes of administration, application or administration. Administration may be weekly, every two or three weeks, monthly, every two, three or six months, or yearly, depending on the disease state and condition of the affected horse and depending on the veterinarian's decision. Administration may be by any route of administration (see below). A therapeutically effective amount of a composition according to the present invention can be readily determined by one skilled in the art or, if trained by a veterinarian, by the horse owner. In the context of the present invention, a "therapeutically effective amount" is an amount that results in an objectively measurable change in one or more parameters associated with the treatment of an allergic condition, including clinical improvement of symptoms or prevention of worsening of symptoms. Of course, a therapeutically effective amount will vary depending on the particular horse / subject and condition being treated, the species, sex, weight and age of the horse, the severity of the disease state, the time of year in the case of seasonal allergies, the particular compound and composition selected, the horse's stable, any additional medications the horse may be taking, feeding, the dosing regimen followed and the timing of administration.

[0058] "Treatment," "treating," and the like refer to both therapeutic treatment and prophylactic or preventative measures. Animals in need of treatment include animals already having an allergic condition, as well as animals in which an allergic condition is to be prevented, such as horses suspected of being predisposed to developing an allergic condition due to their breed or species. The term "treatment" or "treating" an allergic condition includes preventing or protecting against an allergic condition (i.e., not developing clinical symptoms), inhibiting an allergic condition (i.e., preventing or suppressing the development of clinical symptoms), and / or alleviating an allergic condition (i.e., causing regression of clinical symptoms). As will be appreciated, it is not always possible to distinguish between "preventing" and "suppressing" an allergic condition, as the final inducing event may be unknown or latent. Thus, the term "prevention" is understood to constitute a species of "treatment," encompassing both "preventing" and "suppressing." Thus, the term "treatment" can include "prevention."

[0059] The antibodies and antibody derivatives of the present invention provide specific diagnostic tools targeting IL-5 activity in horses that can be used as a marker for allergic conditions. As demonstrated by Fettelschoss-Gabriel et al., 2021, there is a need to develop diagnostic tools with high sensitivity and specificity. This need is answered by the present invention, which provides isolated antibodies or antibody derivatives that specifically bind to equine IL-5. Preferably, the isolated antibodies or antibody derivatives are monoclonal, chimeric, and / or equine-derived.

[0060] The antibodies and antibody derivatives of the present invention can be produced by standard means in standard expression hosts using standard expression vectors. Information can be found, for example, in "Recombinant Protein Expression in Mammalian Cells" (2018, Springer, Ed. DL Hacker, MIMB, vol. 1850), "Textbook on Cloning, Expression and Purification of Recombinant Proteins" (2022, 1 st ed., Ed. Kakoli Bose, Springer) and Gene Expression Systems - Using Nature for the Art of Expression (1998, Academic Press, 1 st ed., Ed. J. Fernandez, J. Hoeffler). Typical expression hosts include bacterial or eukaryotic cells, and preferably the expression or host cells are eukaryotic cells. Cloning techniques are also well known to those skilled in the art.

[0061] The pharmaceutical composition provided by the present invention comprises an antibody or antibody derivative of the present invention and a pharmaceutically acceptable excipient. The antibody or antibody derivative is administered in a therapeutically effective amount. The amount or concentration in the pharmaceutical composition depends on the stability that the pharmaceutical composition can provide to the antibody or antibody derivative. The stability must be adequate enough to ensure storage for a reasonable period of time, i.e., degradation must be within a regulatory acceptable range.

[0062] Pharmaceutically acceptable excipients suitable for use in the present invention are well known to those skilled in the art. Such carriers include, but are not limited to, water, saline, particularly normal saline (i.e., a solution containing 0.90% w / v NaCl), buffered saline, phosphate buffer, phosphate-buffered saline, alcoholic and aqueous solutions, emulsions, or suspensions. Other conventionally used diluents, adjuvants, and excipients can be added according to conventional techniques. Examples of such carriers include ethanol, polyols, and suitable mixtures thereof, vegetable oils, and injectable organic esters. Buffers and pH adjusters can also be used. Buffers include salts prepared from organic acids or bases. Representative buffers include salts of citric acid, such as citrate; ascorbic acid, gluconic acid, histidine-HCl; salts of organic acids, such as carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid; tris(hydroxymethyl)aminomethane (Tris) or phosphate buffers. Parenteral carriers can include sodium chloride solution, Ringer's dextrose, dextrose, trehalose, sucrose, and sodium chloride, lactated Ringer's, or fixed oils. Intravenous carriers include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and others. Preservatives and other additives, such as antibacterial agents, antioxidants, chelating agents (e.g., EDTA), inert gases, and the like, can also be included in the pharmaceutical carrier. The preparation of these pharmaceutically acceptable compositions from the above components with appropriate pH, isotonicity, stability, and other conventional characteristics is within the skill of the art.

[0063] In a preferred embodiment, the pharmaceutically acceptable excipient is phosphate-buffered saline (PBS). The concentration of the antibody in the pharmaceutical composition is typically in the range of 0.1 to 20 mg / mL, more preferably in the range of 2 to 10 mg / mL, and even more preferably in the range of 5 to 10 mg / mL.

[0064] The pharmaceutical composition according to the present invention can be administered via any possible route of administration, such as parenteral, oral, subcutaneous, transdermal, inhalation or pulmonary, nasal, sublingual / buccal, mucosal, topical, rectal and / or intravenous routes, etc. Preferably, the pharmaceutical composition of the present invention is administered via the subcutaneous route of administration.

[0065] The present invention also provides an in vitro method for diagnosing an allergic condition in a horse. This method involves detecting IL-5 in a companion animal known or suspected to have pruritus and / or an allergic condition. The presence of IL-5 can be determined by contacting an antibody or antibody derivative of the present invention with a biological sample, preferably a liquid sample, obtained from the horse, which may be a fluid obtained from the body, including a blood or serum sample, tissue sample, etc. Increased levels of IL-5 can be determined, for example, through comparison with a reference sample obtained from a non-allergic horse. The contacting may be performed by mixing. An increased level or concentration of IL-5, optionally in combination with further testing by a veterinarian, may indicate an allergic condition in the horse. Methods for detecting and comparing antibody or antibody derivative concentrations in a sample include enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot (ELISPOT), Western blot (WB), immunoprecipitation (IP), and the like, and are well known to those skilled in the art. Information is available, for example, in "Molekularbiologische Methoden 2.0" (2018, utb, 2 nded., Thomas Reinard). Immunoassays such as ELISAs for detecting or quantifying IL-5 or anti-IL-5 antibodies in samples obtained from horses are particularly useful. For this purpose, the antibodies or antibody derivatives of the present invention can be covalently or noncovalently linked to a detectable molecular entity (such as a polypeptide or small molecule), including fluorescent, radioactive, or other detectable molecular entities. Immunoassays for IL-5 typically involve incubating a clinical or biological sample from an horse in the presence of a detectably labeled antibody or antibody derivative of the present invention capable of selectively binding to IL-5, and detecting the bound antibody or antibody derivative in the sample by standard means depending on the detectable molecular entity used. The biological sample can be any body fluid, including serum, plasma, tissue and cell lysates, saliva, sputum, and bronchoalveolar lavage fluid.

[0066] Amino acid and nucleic acid sequences: SEQ ID NO: 1 Light chain CDR1 (NOL1-13): NIGSKS. SEQ ID NO: 1 is the amino acid sequence of the most preferred light chain CDR1. SEQ ID NO: 2 Light chain CDR3 (NOL9-13): QVWDSSSDPVV. SEQ ID NO: 2 is the amino acid sequence of the most preferred light chain CDR3. SEQ ID NO: 3 Light chain CDR3 (NOL1 to 8): QVWDSGDGX2PRV, where X2 may be H or N. SEQ ID NO: 4 Light chain CDR3 (NOL1, 2, 3, 4, 6, 8): QVWDSGDGHPRV. SEQ ID NO: 5 CDR3 of light chain (NOL5 and NOL7): QVWDSGDGNPRV. SEQ ID NO: 6 Heavy chain CDR1 (NOL1-13): GFTFX3SYG, wherein X3 may be S, G or R, and preferably X3 is S. SEQ ID NO: 7 Heavy chain CDR1 (NOL1-11): GFTFSSYG. SEQ ID NO: 7 is the amino acid sequence of the most preferred heavy chain CDR1. SEQ ID NO: 8 CDR1 of heavy chain (NOL12): GFTFGSYG. SEQ ID NO: 9 CDR1 of heavy chain (NOL13): GFTFRSYG. SEQ ID NO: 10 Heavy chain CDR2 (NOL1-13): IX4X5DGX6NK, wherein X4 may be S or W, X5 may be Y or N, and X6 may be S or R, preferably X4 is S, X5 is Y, and X6 is S. SEQ ID NO: 11 Heavy chain CDR2 (NOL9-12): ISYDGSNK. SEQ ID NO: 11 is the most preferred amino acid sequence of CDR2 of the heavy chain. SEQ ID NO: 12 CDR2 of heavy chain (NOL13): ISNDGSNK. SEQ ID NO: 13 CDR2 of heavy chain (NOL1, 3, 4, 5, 6, 7, 8): IWYDGSNK. SEQ ID NO: 14 CDR2 of heavy chain (NOL2): IWYDGRNK. SEQ ID NO: 15 Heavy chain CDR3 (NOL9-13): X7KGX8KIQLWFAAFDI, wherein X7 may be V or A, and X8 may be F or L, and preferably X7 is V and X8 is L. SEQ ID NO: 16 CDR3 of heavy chain (NOL11): VKGLKIQLWFAAFDI. SEQ ID NO: 16 is the most preferred amino acid sequence of the CDR3 of the heavy chain. SEQ ID NO: 17 CDR3 of heavy chain (NOL9, 12, 13): AKGFKIQLWFAAFDI. SEQ ID NO: 18 CDR3 of heavy chain (NOL10): VKGFKIQLWFAAFDI. SEQ ID NO: 19 Heavy chain CDR3 (NOL1-8): ARGLX9GRSYFDY, where X9 may be F or Y. SEQ ID NO: 20 Heavy chain CDR3 (NOL1, NOL3-7): ARGLYGRSYFDY. SEQ ID NO: 21 CDR3 of heavy chain (NOL2 and NOL8): ARGLFGRSYFDY. SEQ ID NO: 22 Light chain variable region - complete sequence (NOL1-13):

[0067] [ka] where X 71 may be S or Q, and X 72 may be Y or S, and X 73 may be E or V, and X 74 may be V, M or I, and X 75 may be K or R, and X 76 may be A, V or T, and X 77 may be E or G, and X 78 may be D or N, and X 79 may be Q or H, and X 80 may be R or K, and X 81 may be F or Y, and X 82 may be T, A or S, and X 83 may be P or T, and X 84 may be D or E, and X 85 may be F or L, and X 86 may be S or T, and X 87 may be T or A, and X 88 may be S or G, and X 89 may be V, I, A or S, and X 90 may be G or S, and X 91 may be D or S, and X 92 may be G or D, and X 93 may be H, N or P, and X 94 may be P or V, and X 95 may be R or V, and X 96 may be V or F, and X 97 may be F or G, and X 98 may be G or T, and X 99 may be T, S or K, and X 100 may be K or L, and X 101 may be L or T, and X 102 may be T or V, and X 103may be V or L. SEQ ID NO: 23: Light chain variable region - complete sequence (NOL9-13):

[0068] [ka] where X 10 may be V or I, and X 11 may be Q or H, and X 12 may be S or T, and X 13 may be S or G, and X 14 may be A or S, and preferably X 10 is V and X 11 is Q and X 12 is S and X 13 is S and X 14 is A. SEQ ID NO: 24. Light chain variable region - complete sequence (NOL11, NOL9):

[0069] [ka] SEQ ID NO: 24 is the complete sequence of the most preferred light chain variable region. SEQ ID NO: 25 Light chain variable region - complete sequence (NOL1-8):

[0070] [ka] where X 15 may be M or V, and X 16 may be K or R, and X 17 may be A, V or T, and X 18 may be F or Y, and X 19 may be T or A, and X 20 may be T or P, and X 21 may be L or F, and X 22 may be T or A, and X 23 may be V or I, and X 24 may be H or N, and X25 may be T or S. SEQ ID NO: 26. Variable region of light chain - complete sequence (NOL1):

[0071] [ka] SEQ ID NO: 27 Variable region of light chain - complete sequence (NOL2):

[0072] [ka] SEQ ID NO: 28 Variable region of light chain - complete sequence (NOL3):

[0073] [ka] SEQ ID NO: 29 Light chain variable region - complete sequence (NOL4):

[0074] [ka] SEQ ID NO: 30 Variable region of light chain - complete sequence (NOL5):

[0075] [ka] SEQ ID NO: 31 Light chain variable region - complete sequence (NOL6):

[0076] [ka] SEQ ID NO: 32 Light chain variable region - complete sequence (NOL7):

[0077] [ka] SEQ ID NO: 33 Light chain variable region - complete sequence (NOL8):

[0078] [ka] SEQ ID NO: 35. Light chain variable region - complete sequence (NOL10):

[0079] [ka] SEQ ID NO: 36. Light chain variable region - complete sequence (NOL12):

[0080] [ka] SEQ ID NO: 37. Light chain variable region - complete sequence (NOL13):

[0081] [ka] SEQ ID NO: 38 Heavy chain variable region - complete sequence (NOL1-13):

[0082] [ka] where X 38 may be E or Q, and X 39 may be Q, E or V, and X 40 may be Q or E, and X 41 may be S or T, and X 42 may be G or E, and X 43 may be Q or R, and X 44 may be S, G or R, and X 45 may be V or L, and X 46 may be W or S, and X 47 may be Y or N, and X 48 may be R or S, and X 49 may be M or I, and X 50 may be A or V, and X 51 may be R or K, and X 52 may be L or F, and X 53 may be F, Y or K, and X 54 may be G or I, and X55 may be R or Q, and X 56 may be S or L, and X 57 may be Y or W, and X 58 may be D or A, and X 59 may be Y or A, and X 60 may be W or F, and X 61 may be G or D, and X 62 may be Q or I, and X 63 may be G or W, and X 64 may be T or G, and X 65 may be L or Q, and X 66 may be V or G, and X 67 may be T or A, and X 68 may be V or M, and X 69 may be S or V, and X 70 may be S or T. SEQ ID NO: 39 Heavy chain variable region - complete sequence (NOL9-13):

[0083] [ka] where X 26 may be E or V, and X 27 may be Q or R, and X 28 may be S, G or R, and X 29 may be Y or N, and X 30 may be V or A, and X 31 may be F or L, and X 32 may be T or A, and preferably X 26 is V and X 27 is Q and X 28 is S and X 29 is Y and X 30 is V and X 31 is L and X 32 is T. SEQ ID NO: 40 Heavy chain variable region - complete sequence (NOL11):

[0084] [ka] SEQ ID NO: 40 is the complete sequence of the most preferred heavy chain variable region. SEQ ID NO: 41 Heavy chain variable region - complete sequence (NOL1-8):

[0085] [ka] where X 33 may be E or G, and X 34 may be L or V, and X 35 may be S or R, and X 36 may be M or I, and X 37 may be Y or F. SEQ ID NO: 42 Heavy chain variable region - complete sequence (NOL1, NOL3, NOL5, NOL6, NOL7):

[0086] [ka] SEQ ID NO: 43 Variable region of heavy chain - complete sequence (NOL2):

[0087] [ka] SEQ ID NO: 45 Heavy chain variable region - complete sequence (NOL4):

[0088] [ka] SEQ ID NO: 49 Heavy chain variable region - complete sequence (NOL8):

[0089] [ka] SEQ ID NO: 50 Heavy chain variable region - complete sequence (NOL9):

[0090] [ka] SEQ ID NO: 51 Heavy chain variable region - complete sequence (NOL10):

[0091] [ka] SEQ ID NO: 52 Variable region of heavy chain - complete sequence (NOL12):

[0092] [ka] SEQ ID NO: 53 Heavy chain variable region - complete sequence (NOL13):

[0093] [ka] SEQ ID NO: 54 Light chain - complete sequence (NOL11):

[0094] [ka] SEQ ID NO: 54 is the most preferred complete light chain sequence. SEQ ID NO: 55 Heavy chain - complete sequence (NOL11):

[0095] [ka] SEQ ID NO: 55 is the most preferred complete heavy chain sequence. SEQ ID NO: 56 Light chain constant region - complete sequence:

[0096] [ka] SEQ ID NO: 57 Heavy chain constant region - complete sequence:

[0097] [ka] SEQ ID NO: 58 Heavy chain CDR1 NOL11, NOL1, NOL3, NOL4, NOL5, NOL6, NOL7, NOL8, NOL9, NOL10 nucleic acid sequences: GGATTCACCTTCAGTAGCTATGGC SEQ ID NO: 59 Nucleic acid sequence of CDR1 NOL2 of the heavy chain: GGATTCACTTTCAGTAGCTATGGC SEQ ID NO: 69 Heavy chain CDR1 nucleic acid sequence of NOL12: GGATTCACCTTCGGTAGCTATGGC SEQ ID NO: 70 Heavy chain CDR1 nucleic acid sequence of NOL13: GGATTCACCTTCAGAAGCTATGGC SEQ ID NO: 71 Heavy chain CDR2 nucleic acid sequences of NOL1, NOL3, NOL4, NOL5, NOL6, NOL7, NOL8: ATATGGTATGATGGAAGTAATAAA SEQ ID NO: 72 Nucleic acid sequence of CDR2 NOL2 of the heavy chain: ATATGGTATGATGGAAGAAATAAA SEQ ID NO: 79 Heavy chain CDR2 nucleic acid sequences of NOL11, NOL9, NOL10, NOL12: ATATCATATGATGGAAGTAATAAA SEQ ID NO: 83 Heavy chain CDR2 nucleic acid sequence of NOL13: ATATCAAATGATGGAAGTAATAAA SEQ ID NO: 84 Nucleic acid sequences of CDR3 NOL1, NOL3, NOL4, NOL5, NOL6, NOL7 of the heavy chain: GCGAGAGGACTCTATGGGCGATCCTACTTTGACTAC SEQ ID NO: 85 Nucleic acid sequence of CDR3 NOL2 of the heavy chain: GCGAGAGGTCTCTTTGGGCGATCCTACTTTGACTAC SEQ ID NO: 91 Nucleic acid sequence of CDR3 of heavy chain NOL8: GCGAGAGGACTCTTTGGGCGATCCTACTTTGACTAC SEQ ID NO: 92 Heavy chain CDR3 nucleic acid sequences of NOL9, NOL12, NOL13: GCGAAAGGGTTCAAGATACAGCTATGGTTTGCTGCTTTTGATATC SEQ ID NO: 93 Nucleic acid sequence of CDR3 of heavy chain NOL10: GTGAAAGGGTTCAAGATACAGCTATGGTTTGCTGCTTTTGATATC SEQ ID NO: 94 Heavy chain CDR3 nucleic acid sequence of NOL11: GTGAAAGGGTTAAAGATACAGCTATGGTTTGCTGCTTTTGATATC SEQ ID NO: 97 Light chain CDR1 NOL1, NOL2, NOL3, NOL4, NOL5, NOL6, NOL8, NOL10 nucleic acid sequence: AACATAGGAAGTAAAAGT SEQ ID NO: 103 Light chain CDR1 nucleic acid sequence of NOL7: AACATAGGAAGTAAGAGT SEQ ID NO: 105 Light chain CDR1 nucleic acid sequence of NOL11, NOL9, NOL12: AACATTGGAAGTAAAAGT SEQ ID NO: 109 Light chain CDR1 nucleic acid sequence of NOL13: AACATTGGTAGTAAAAGT SEQ ID NO: 110 Nucleic acid sequence of CDR3 NOL1, NOL3, NOL4, NOL8 of the variable light chain: CAGGTGTGGGATAGTGGTGATGGTCATCCGAGGGTG SEQ ID NO: 111 Nucleic acid sequence of CDR3 NOL2 of the variable light chain: CAGGTGTGGGATAGTGGTGATGGTCATCCTAGGGTG SEQ ID NO: 114 Nucleic acid sequence of CDR3 NOL5 of the variable light chain: CAGGTGTGGGATAGTGGTGATGGTAATCCGAGAGTG SEQ ID NO: 115 Nucleic acid sequence of CDR3 NOL6 of the variable light chain: CAGGTGTGGGATAGTGGTGATGGTCATCCAAGGGTG SEQ ID NO: 116 Nucleic acid sequence of CDR3 of variable light chain NOL7: CAGGTGTGGGATAGTGGTGATGGTAATCCGAGGGTG SEQ ID NO: 118 Nucleic acid sequences of CDR3 of variable light chain NOL11, NOL9, NOL10, NOL12, NOL13: CAGGTGTGGGATAGTAGTAGTGATCCTGTGGTA SEQ ID NO: 123 Nucleic acid sequence of variable heavy chain NOL1, NOL5:

[0098] [ka] SEQ ID NO: 124 Nucleic acid sequence of NOL2 variable heavy chain:

[0099] [ka] SEQ ID NO: 125 Nucleic acid sequence of variable heavy chain NOL3, NOL7:

[0100] [ka] SEQ ID NO: 126 Nucleic acid sequence of NOL4 variable heavy chain:

[0101] [ka] SEQ ID NO: 128 Nucleic acid sequence of NOL6 variable heavy chain:

[0102] [ka] SEQ ID NO: 130 Nucleic acid sequence of NOL8 variable heavy chain:

[0103] [ka] SEQ ID NO: 131 Nucleic acid sequence of NOL9 variable heavy chain:

[0104] [ka] SEQ ID NO: 132 Nucleic acid sequence of NOL10 variable heavy chain:

[0105] [ka] SEQ ID NO: 133 Nucleic acid sequence of NOL11 variable heavy chain:

[0106] [ka] SEQ ID NO: 134 Nucleic acid sequence of NOL12 variable heavy chain:

[0107] [ka] SEQ ID NO: 135 Nucleic acid sequence of NOL13 variable heavy chain:

[0108] [ka] SEQ ID NO: 136 Nucleic acid sequence of NOL1 of variable light chain:

[0109] [ka] SEQ ID NO: 137 Nucleic acid sequence of variable light chain NOL2:

[0110] [ka] SEQ ID NO: 138 Nucleic acid sequence of variable light chain NOL3:

[0111] [ka] SEQ ID NO: 139 Nucleic acid sequence of NOL4 variable light chain:

[0112] [ka] SEQ ID NO: 140 Nucleic acid sequence of variable light chain NOL5:

[0113] [ka] SEQ ID NO: 141 Nucleic acid sequence of variable light chain NOL6:

[0114] [ka] SEQ ID NO: 142 Nucleic acid sequence of variable light chain NOL7:

[0115] [ka] SEQ ID NO: 143 Nucleic acid sequence of NOL8 variable light chain:

[0116] [ka] SEQ ID NO: 144 Nucleic acid sequence of variable light chain NOL9:

[0117] [ka] SEQ ID NO: 145 Nucleic acid sequence of NOL10 variable light chain:

[0118] [ka] SEQ ID NO: 146 Nucleic acid sequence of NOL11 variable light chain:

[0119] [ka] SEQ ID NO: 147 Nucleic acid sequence of NOL12 variable light chain:

[0120] [ka] SEQ ID NO: 148 Nucleic acid sequence of NOL13 variable light chain:

[0121] [ka] SEQ ID NO: 149 Heavy chain constant nucleic acid sequence:

[0122] [ka] SEQ ID NO: 150 Light chain constant nucleic acid sequence:

[0123] [ka] SEQ ID NO: 151 Amino acid sequence of the CH1 constant region of the heavy chain:

[0124] [ka] SEQ ID NO: 152 nucleic acid sequence of the CH1 constant region of the heavy chain:

[0125] [ka] SEQ ID NO: 153 Amino acid sequence of the heavy chain Fab fragment NOL11:

[0126] [ka] SEQ ID NO: 154 Nucleic acid sequence of the heavy chain Fab fragment NOL11:

[0127] [ka] SEQ ID NO: 155 Light chain CDR2 (NOL1 to NOL13): DDX1, wherein X1 may be S, T or A, and preferably X1 is S. SEQ ID NO: 156 CDR2 of light chain (NOL11, NOL9, NOL10, NOL12, NOL13): DDS. SEQ ID NO: 156 is the most preferred light chain CDR2. SEQ ID NO: 157 CDR2 of heavy chain (NOL1, 2, 3, 4, 6, 7, 8): DDT. SEQ ID NO: 158 CDR2 of light chain (NOL5): DDA. SEQ ID NO: 159: Nucleic acid sequence of CDR2 (NOL1, NOL2, NOL3, NOL4, NOL6, NOL7, NOL8) of the variable region of the light chain: GATGACACC SEQ ID NO: 163 Nucleic acid sequence of CDR2 NOL5 of the variable region of the light chain: GATGACGCC SEQ ID NO: 167 Nucleic acid sequence of CDR2 of the variable region of the light chain (NOL11, NOL9, NOL10, NOL12, NOL13): GATGATAGC.

[0128] The isolated antibody or antibody derivative may comprise an amino acid sequence of at least one complementarity determining region (CDR) selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 1, 155, 156, 157, 158, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21. Preferably, the isolated antibody or antibody derivative comprises an amino acid sequence of at least one complementarity determining region (CDR) selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 1, 155, 156, 2, 6, 7, 10, 11, 15, and 16. In another preferred embodiment, the isolated antibody or antibody derivative comprises an amino acid sequence of at least one complementarity determining region (CDR) selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 1, 155, 2, 6, 10, and 15. In another preferred embodiment, the isolated antibody or antibody derivative comprises the amino acid sequence of all of the complementarity determining regions (CDRs) set forth in any one of SEQ ID NOs: 1, 155, 2, 6, 10, and 15. In a particularly preferred embodiment, the isolated antibody or antibody derivative comprises the amino acid sequence of at least one complementarity determining region (CDR) selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 1, 156, 2, 7, 11, and 16. In a very preferred embodiment, the isolated antibody or antibody derivative comprises the amino acid sequence of all of the complementarity determining regions (CDRs) set forth in any one of SEQ ID NOs: 1, 156, 2, 7, 11, and 16.

[0129] In another preferred embodiment of the present invention, the isolated antibody or antibody derivative comprises the amino acid sequence of the light chain CDR1 set forth in SEQ ID NO: 1, the amino acid sequence of the light chain CDR2 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 155, 156, 157 and 158, the amino acid sequence of the light chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 2, 3, 4 and 5, the amino acid sequence of the heavy chain CDR1 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 6, 7, 8 and 9, the amino acid sequence of the heavy chain CDR2 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 10, 11, 12, 13 and 14, and the amino acid sequence of the heavy chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 15, 16, 17, 18, 19, 20 and 21. More preferably, the isolated antibody or antibody derivative comprises the amino acid sequence of the light chain CDR1 set forth in SEQ ID NO: 1, the amino acid sequence of the light chain CDR2 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 155, 156 and 157, the amino acid sequence of the light chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 2, 3 and 4, the amino acid sequence of the heavy chain CDR1 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 6 and 7, the amino acid sequence of the heavy chain CDR2 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 10, 11 and 13, and the amino acid sequence of the heavy chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 15, 16, 17, 19 and 20.Even more preferably, the isolated antibody or antibody derivative comprises the amino acid sequence of the light chain CDR1 set forth in SEQ ID NO: 1, the amino acid sequence of the light chain CDR2 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 156 and 157, the amino acid sequence of the light chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 2 and 4, the amino acid sequence of the heavy chain CDR1 selected from the group consisting of the amino acid sequences set forth in SEQ ID NO: 7, the amino acid sequence of the heavy chain CDR2 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 11 and 13, and the amino acid sequence of the heavy chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 16, 17 and 20. Even more preferably, the isolated antibody or antibody derivative comprises the amino acid sequence of the light chain CDR1 set forth in SEQ ID NO: 1, the amino acid sequence of the light chain CDR2 set forth in SEQ ID NO: 155, the amino acid sequence of the light chain CDR3 set forth in SEQ ID NO: 2, the amino acid sequence of the heavy chain CDR1 set forth in SEQ ID NO: 6, the amino acid sequence of the heavy chain CDR2 set forth in SEQ ID NO: 10, and the amino acid sequence of the heavy chain CDR3 set forth in SEQ ID NO: 15. Most preferably, the isolated antibody or antibody derivative comprises the amino acid sequence of the light chain CDR1 set forth in SEQ ID NO: 1, the amino acid sequence of the light chain CDR2 set forth in SEQ ID NO: 156, the amino acid sequence of the light chain CDR3 set forth in SEQ ID NO: 2, the amino acid sequence of the heavy chain CDR1 set forth in SEQ ID NO: 6, the amino acid sequence of the heavy chain CDR2 set forth in SEQ ID NO: 11, and the amino acid sequence of the heavy chain CDR3 set forth in SEQ ID NO: 16.

[0130] The isolated antibody or antibody derivative optionally comprises a light chain variable region comprising an amino acid sequence identical to or having at least 90%, 95%, 98% or 99% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 35, 36 or 37, and / or a heavy chain variable region comprising an amino acid sequence identical to or having at least 90%, 95%, 98% or 99% sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs: 38, 39, 40, 41, 42, 43, 45, 49, 50, 51, 52 or 53. Preferably, the isolated antibody or antibody derivative comprises a light chain variable region comprising an amino acid sequence identical to, or with at least 90%, 95%, 98% or 99% sequence homology to, the amino acid sequence set forth in any one of SEQ ID NOs: 22, 23 or 24, and / or comprises a heavy chain variable region comprising an amino acid sequence identical to, or with at least 90%, 95%, 98% or 99% sequence homology to, the amino acid sequence set forth in any one of SEQ ID NOs: 38, 39 or 40. More preferably, the isolated antibody or antibody derivative comprises the amino acid sequence of a light chain variable region set forth in any one of SEQ ID NOs: 22, 23 or 24, and / or comprises the amino acid sequence of a heavy chain variable region set forth in any one of SEQ ID NOs: 38, 39 or 40. Even more preferably, the isolated antibody or antibody derivative comprises the amino acid sequence of a light chain variable region set forth in SEQ ID NO: 23 or 24, and / or comprises the amino acid sequence of a heavy chain variable region set forth in SEQ ID NO: 39 or 40. Most preferably, the isolated antibody or antibody derivative comprises the amino acid sequence of the light chain variable region shown in SEQ ID NO:24 and / or comprises the amino acid sequence of the heavy chain variable region shown in SEQ ID NO:40.

[0131] In a highly preferred embodiment, the isolated antibody or antibody derivative according to the invention comprises the amino acid sequence of the light chain as set forth in SEQ ID NO: 54 and / or comprises the amino acid sequence of the heavy chain as set forth in SEQ ID NO: 55 or 153, more preferably as set forth in SEQ ID NO: 55.

[0132] The present invention also provides isolated nucleic acid molecules, vectors, and host cells comprising at least one nucleic acid sequence at least partially encoding an isolated antibody or antibody derivative of the present invention, optionally wherein the at least one nucleic acid sequence is selected from the group consisting of the nucleic acid sequences set forth in any one of SEQ ID NOs: 58, 59, 69, 70, 71, 72, 79, 83, 84, 85, 91, 92, 93, 94, 97, 103, 105, 109, 110, 111, 114, 115, 116, 118, 123, 124, 125, 126, 128, 130-150, 152, 154, 159, 163, and 167. Preferably, the isolated nucleic acid molecule, vector and / or host cell of the invention comprises at least one nucleic acid sequence selected from the group consisting of the nucleic acid sequences set forth in any one of SEQ ID NOs: 58, 79, 94, 105, 118, 133, 146, 149, 150, 152, 154 and 167. More preferably, the isolated nucleic acid molecule, vector and / or host cell of the invention comprises at least one nucleic acid sequence selected from the group consisting of the nucleic acid sequences set forth in any one of SEQ ID NOs: 58, 79, 94, 105, 118 and 167. In another preferred embodiment, the isolated nucleic acid molecule, vector and / or host cell of the invention comprises at least one nucleic acid sequence selected from the group consisting of the nucleic acid sequences set forth in any one of SEQ ID NOs: 133, 146, 149, 150 and 152. In another preferred embodiment, all of SEQ ID NOs: 133, 146, 149, and 150 are used to produce the antibody or antibody derivative of the invention on one or more vectors or in one or more host cells. Most preferably, the nucleic acid sequences SEQ ID NO: 149 or 152 and 150 encode the heavy and light chain constant regions, respectively, of an antibody or antibody derivative according to the invention. In the case of antibody derivatives, truncated constant regions can be used, thus truncated forms of SEQ ID NO: 149, 150 and / or 152. NOL11 is the most preferred antibody.

[0133] As explained above, a method for producing an isolated antibody or antibody derivative according to the present invention is provided, which comprises expressing the isolated antibody or antibody derivative in a host cell. Preferably, the isolated antibody or antibody derivative is expressed in a host cell according to the present invention, such as a eukaryotic cell. The isolated nucleic acid molecule, vector, and host cell comprising at least one nucleic acid sequence at least partially encoding the isolated antibody or antibody derivative according to the present invention described above are particularly useful in the method for producing the isolated antibody or antibody derivative according to the present invention and can be used to express the antibody or antibody derivative. [Brief explanation of the drawings]

[0134] [Figure 1] FIG. 1 shows titration ELISA of affinity matured antibodies from wild-type NOL1 against eqIL-5. [Figure 2] FIG. 1 shows titration ELISA of affinity matured antibodies from wild-type NOL2 against eqIL-5. [Figure 3] Figure 1 shows the inhibitory effect of antibodies on the binding of eqIL-5 to its receptor. Antibodies were preincubated with antigen and then added to Expi293F cells, which display eqIL-5 receptors on their surface. Binding of the antigen to the cells was detected by fluorescent labeling via a His tag and fluorescently labeled antibody using a flow cytometer. To obtain relative binding, the measured fluorescent signal (median) was related to the signal in the presence of only antigen and cells, but without inhibitory antibodies. [Figure 4] FIG. 1 shows HPLC-SEC data for NOL11 after storage at 4° C., 21° C. and 37° C. for 2 or 4 weeks, respectively. [Figure 5] FIG. 1 shows ELISA results for NOL11 after storage at 4° C., 21° C., or 37° C. for 2 or 4 weeks. [Figure 6] FIG. 1 shows reducing (left) and non-reducing (right) SDS-PAGE of samples of NOL11 after storage at 4° C., 21° C., and 37° C. [Figure 7]Coomassie-stained SDS-Page (left) and streptavidin-HRP-stained Western blot (right) of NOL11 produced in Hi5 insect cells and Expi293F™ mammalian cells. Aglycosylated samples containing the N297A mutation and glycosylated samples were analyzed. [Figure 8] Figure 1 shows the timeline for target animal study D10POC-A. On days 0 and 14 of the study, three horses were administered antibody (42.62 μg antibody / kg body weight), and the other three horses were administered PBS. Blood samples were collected on days -1 (as background control), 2, 7, 14 prior to the second injection, 16, 21, 28, and 120. These samples were collected and used for analysis (ADA assay). [Figure 9] Comparison of anti-drug antibody (ADA) assays from target animal study D10POC-A: antibody vs. control groups for all six horses up to 120 days post-injection. Horse serum was titrated on NOL11 coated in eqFab format and detected with anti-horse IgG (Fc-) HRP. The OD values ​​for day -1 were subtracted from all other time points to analyze signal changes over time. The mean ΔOD signals for three horses in the antibody group were compared to the mean signals for three horses in the control group at a serum dilution of 1:100. [Figure 10] 1 shows the timeline of target animal studies D10POC-B and D10POC-C. Injections of NOL11 were performed on days 0, 30, and 60. [Figure 11] Figure 1 shows anti-drug antibody (ADA) assay from target animal study D10POC-B: Evaluation of anti-drug antibody formation in horses treated with NOL11. The two-center study D10POC-B was conducted in eastern and northern Germany. The study in eastern Germany is still ongoing, and therefore only data from the study in northern Germany is included. The antibody group consisted of two horses treated with NOL11. The control group consisted of two horses not treated with antibody. Injections of NOL11 were performed on days 0, 30, and 60. [Figure 12] Figure 1 shows the skin scores of horses affected by insect bite hypersensitivity (IBH) (Study D10POC-C, days -7 to 91). The severity of IBH was determined for each horse before the study (mild, moderate, or severe IBH). Data show skin scores between 0 (no abnormalities) and 3 (severe itching / skin lesions) assessed during the 91-day study period (starting 7 days before the first injection). Horses were scored for the first 5 days after each injection, then every 2 days. (a) Skin score of an untreated control horse (No. 329) classified as having mild to moderate IBH. (b) Skin score of a moderately affected horse (No. 344) treated with the anti-eqIL-5 antibody NOL11. (c) Skin score of a severely affected horse (No. 306) treated with NOL11. Antibody (0.05 mg / kg) was administered subcutaneously at three time points (days 0, 30, and 60). [Figure 13] 12 is a graph showing a linear regression analysis of the skin scores of the three study horses (FIG. 12) over the 91-day observation period. The severity of insect bite hypersensitivity (IBH) was determined for each horse prior to the study (low, moderate, or severe IBH). Antibody (0.05 mg / kg) was administered subcutaneously at three time points (days 0, 30, and 60). [Figure 14] Figure 1 shows the skin scores of horses affected by insect bite hypersensitivity (IBH) (Study D10POC-C, days 91-135). The severity of IBH was determined for each horse before the study (low, moderate, or severe IBH). Data show skin scores ranging from 0 (no abnormalities) to 3 (severe itching / skin lesions) assessed 91-135 days after the last injection of NOL11. Horses were scored every two days. Antibody (0.05 mg / kg) was administered subcutaneously at three time points (days 0, 30, and 60). (a) Skin scores of an untreated control horse (No. 329) classified as having mild to moderate IBH. (b) Skin scores of horse No. 344, a moderately affected horse treated with NOL11. (c) Skin score of severely affected horse No. 306 treated with NOL11. [Figure 15]Graph showing linear regression analysis of skin scores for three study horses evaluated between days 91 and 135 after the last injection of NOL11. Antibody (0.05 mg / kg) was administered subcutaneously at three time points (days 0, 30, and 60). The severity of IBH was determined for each horse prior to the study (mild, moderate, or severe IBH). [Figure 16] This figure shows scratching behavior in horses treated with NOL11 (0.05 mg / kg, n=2) or an untreated control (n=1) (Study D10POC-C). The severity of IBH was determined for each horse before the study (mild, moderate, or severe IBH). Scratching behavior was determined using the Equine Pruritus Visual Analog Scale (EPVAS). The scale ranges from 0 (normal horse; no itching) to 10 (very severe itching). Antibody (0.05 mg / kg) was administered subcutaneously at three time points (April, May, and June; 4 weeks between each injection). Observation began 21 days after the last injection of NOL11 (the theoretical half-life of the equine antibody). [Figure 17] FIG. 1 shows an overview of CDR1, CDR2 and CDR3 of the variable light chain of NOL1 to 13. [Figure 18] FIG. 1 shows an overview of CDR1, CDR2 and CDR3 of the variable heavy chain of NOL1 to 13. DETAILED DESCRIPTION OF THE INVENTION [Example]

[0135] Example 1: Monoclonal antibodies against equine summer eczema Monoclonal antibodies against eqIL-5 were generated via antibody phage display. The binder format was then changed from single-chain variable fragment (scFv) to full-length immunoglobulin G (IgG). Horse sequences were used for the constant domain. Of the seven equine IgG subclasses, subtype IgG6 was selected for its lowest effector function. The antibodies were produced in mammalian cells (Expi293F™) and validated by enzyme-linked immunosorbent assay (ELISA) and a self-established cellular inhibition assay using flow cytometry. Two final candidates that showed strong inhibition in the cellular assay were selected for further study. These two candidates were affinity matured in vitro. Mutants were tested and compared in ELISA and inhibition assays.

[0136] 1.1 Materials and Methods 1.1.1 Production of recombinant antibodies Antibody production was carried out in mammalian Expi293F™ cells (Thermo Fischer), which are cultured in F17 medium (supplemented with 8 mM L-glutamine and 0.1% Pluronic-F68) at 37° C., 110 rpm and 5% CO2.

[0137] Transient expression was used for production. Transfection of expression plasmids was performed using linear polyethyleneimine (PEI MAX, 40 kDa) (Polysciences Europe GmbH). The heavy and light chains of the antibodies were cloned into different expression plasmids and co-transfected at a 1:1 ratio.

[0138] The production scale was adjusted depending on the amount of protein required and ranged from 7.5 mL to 125 mL. Regardless of the scale, the yield was 1.5–2.0 × 10 6Cells / mL were used. They were transfected with plasmid DNA and PEI per milliliter of cell culture volume. DNA and PEI were first diluted separately and then mixed in F17 medium (10% of the culture volume) and incubated at room temperature for approximately 30 minutes. The DNA-PEI mixture was then added to the cells. Cells were cultured under the above conditions for a total of 7 days, including a step of feeding fresh medium after 48 hours. Cells were harvested by centrifugation. The supernatant was then sterile filtered for purification. Antibodies were purified from the culture supernatant using affinity chromatography via binding to protein A or protein G. Depending on the scale, different columns were installed using an Äkta or Profinia system or a 24-well filter plate, and compressed air was used.

[0139] 1.1.2 Titration ELISA Antibody binding to eqIL-5 was detected by ELISA. To this end, eqIL-5 was immobilized in a 96-well plate, the corresponding antibody was added, and then detected with an antibody against the equine Fc portion. As a negative control for nonspecific binding, the antibody was also added to BSA. Specifically, 100 ng of antigen or a 1% BSA solution was immobilized per well of a 96-well plate. Nonspecific binding sites were then blocked with milk powder before the antibody was added. MPBST (PBS containing 0.05% Tween and 2% milk powder) was used for blocking and dilution of all antibodies. After each step, each well was washed three times (ELISA Washer 405™ LS, BioTek™) to remove unbound components. A horseradish peroxidase (HRP)-conjugated antibody from Sigma-Aldrich (SAB3700145, diluted 1:5000) was used as the detection antibody. Binding was detected by adding TMB substrate followed by HRP-catalyzed blue staining of the corresponding wells. The reaction was stopped with sulfuric acid and the optical density was measured at 450 nm and 620 nm using an ELISA reader.

[0140] To obtain the binding curve of the antibody, a titration from 316 nM to 0.0036 nM was performed with a dilution factor of 1 / √10, followed by measuring the optical density (OD 450 nm~OD 620 The EC (nm) was plotted against the antibody concentration. Measurements were performed in triplicate. A fit with the "Logistic 5" function using the software OriginPro was used to calculate the EC 50 value was determined.

[0141] 1.1.3 Cellular inhibition assay A cellular inhibition assay was developed to test whether the selected antibodies could not only bind to the antigen but also inhibit the binding of interleukins to the receptor. The corresponding equine IL-5 receptor was displayed on the surface of cells, and antigen binding was detected via flow cytometry.

[0142] Equine eosinophil cells express the eqIL-5 receptor and are therefore considered suitable for this purpose. However, there are no equine eosinophil cell lines, and isolation is difficult to reproduce and impossible to achieve on a large scale. Therefore, Expi293F™ suspension cells were used instead and transiently transfected with receptor DNA. The receptor was not secreted due to fusion to a transmembrane domain but was displayed on the cell surface. The eqIL-5 receptor consists of two subunits, IL5RA and CSF2RB, which were co-transfected. Additionally, cells were co-transfected with eGFP to distinguish transfected cells from non-transfected cells. Transfection was performed as described for antibody production. The cells were then cultured at 37°C, 110 rpm, and 5% CO2 for 48 hours.

[0143] After 48 hours, the cells were used for the inhibition assay. Measurements were performed using a flow cytometer. The antigen was fluorescently labeled via an anti-His tag antibody and a fluorescently labeled secondary detection antibody. Therefore, antigen binding could be visualized by fluorescent cells. A decrease in fluorescence indicated inhibition of binding. Background measurements were performed without antigen or inhibitory antibody, as well as a reference measurement with antigen but without inhibitory antibody.

[0144] Specifically, all dilution and washing steps during cell preparation were performed in FACS buffer (1x PBS + 2% FCS + 5mM EDTA). The antibody to be tested was first diluted to a concentration of 2µM and titrated at a factor of 1 / √10 in a 96-well plate. In the same volume, antigen was added to the antibody at a concentration of 20nM, resulting in a final maximum antibody concentration of 1µM and a final antigen concentration of 10nM. The antibody and antigen were pre-incubated at room temperature for 45 minutes.

[0145] Meanwhile, pellet the cells transfected with receptor DNA and eGFP and disperse them in FACS buffer at 5 x 10 6 The cell density was adjusted to 5 x 10 cells / mL. 5 Cells per well were placed in a 96-deep-well plate and washed with FACS buffer. The cell pellet was resuspended in the antibody-antigen mixture and incubated on ice for approximately 1 hour. After another washing step, the cell pellet was taken up in primary antibody (Penta His antibody: Qiagen, 3460, 1:50 dilution) and again incubated on ice for approximately 1 hour. This was followed by another washing step and resuspension in secondary detection antibody (goat anti-mouse Fc-APC: dianova, 115-136-071, 1:50 dilution). After further incubation and two washing steps, the cells were resuspended in FACS buffer and measured on a flow cytometer (MACS Quant).

[0146] First, cells were gated. Single live cells were selected, and among these, only transfected cells (GFP-positive) were considered. The APC signal was measured from these cells, and the median value was used for evaluation. The background signal generated by nonspecific binding of the primary and secondary antibodies to the cells was subtracted from all measurements. The reference indicates the APC value resulting from the binding of the antigen (eqIL-5-His) to the cells without inhibition. In the evaluation, this value corresponds to 100% binding. In the case of an inhibitory antibody, this prevents the antigen from binding to the cells, thereby reducing the APC signal accordingly. These APC values ​​are related to the 100% APC value of the reference control and therefore represent the relative binding of the antigen to the cells in percentage. The more inhibitory the antibody, the lower the relative binding. Antibody titrations were performed to determine the relative binding as a function of antibody concentration. The IC characterizes the antibody concentration at 50% inhibition. 50 The value is a good benchmark.

[0147] 1.2 Results 1.2.1 Titration ELISA Figures 1 and 2 show the results of the titration ELISA. Two different antibodies against eqIL-5 (NOL1 and NOL9), which behaved differently in the ELISA, were selected for in vitro affinity maturation. The two graphs below show the affinity-matured antibodies compared to their respective wild-type counterparts.

[0148] All selected antibodies specifically bind to eqIL-5 and do not bind to BSA. Both antibodies based on NOL1 (Figure 1) and NOL9 (Figure 2) showed good binding activity. Affinity maturation successfully identified antibodies with further improved binding activity compared to the wild type. Table 1 below shows the corresponding EC 50 values ​​are shown, all of which may be considered suitable for the purposes of the present invention and for the therapeutic use of the antibodies of the present invention. These values ​​were determined with OriginPro software using a "logistic 5" fit.

[0149] [Table 1]

[0150] All values ​​are in the similar nanomolar range. The lowest value is 0.44 nM and the highest value is 8.99 nM. For the NOL1 antibody, affinity maturation resulted in an EC 50 The EC value was improved by 2.2-fold, and for the NOL9 antibody, 50 The value improved by 1.4 times.

[0151] 1.2.2 Cellular inhibition assay Because titration ELISA only provides information about antibody binding to the antigen, an additional assay was performed to test inhibition. The goal was to analyze the ability of antibodies to inhibit antigen binding to receptors on the cell surface. Figure 3 shows the inhibitory effect of antibodies on eqIL-5. The y-axis indicates the relative binding of interleukins to their receptors.

[0152] The antibodies partially or completely inhibit binding, depending on their concentration. The curves for the different antibodies are very similar. Both wild-type and affinity-matured antibodies are equally effective in inhibition, despite slightly different affinities in the titration ELISA (Figures 1 and 2). This may be explained by the fact that the antibodies recognize different epitopes. The curves were determined with a "logistic 5" fit using OriginPro software.

[0153] Table 2 shows the IC, the antibody concentration required to reduce binding by 50%. 50 The IC values ​​are shown. A 50% reduction in binding is achieved at concentrations between 3.0 nM and 9.4 nM. For the NOL1 antibody, affinity maturation resulted in an IC 50 The IC value was improved by 2.0-fold, and for the NOL9 antibody, 50 The value improved by 1.9 times.

[0154] [Table 2]

[0155] Example 2: Characterization of chimeric equine anti-IL5 antibodies Further experiments were carried out using the preferred antibody, NOL11.

[0156] 2.1 Materials and Methods 2.1.1 Stability testing To determine the long-term stability of antibody NOL11, different aliquots were stored at 4°C, 21°C, and 37°C. After 2 weeks of storage, a new aliquot was added. After an additional 2 weeks, samples were analyzed by HPLC-SEC, ELISA, and SDS-PAGE compared to freshly thawed material to obtain data for 2 and 4 weeks of storage at the indicated temperatures.

[0157] 2.1.1.1 HPLC-SEC For HPLC-SEC, antibodies were diluted to a concentration of 50 μg / mL in PBS-NaN3 and analyzed on an Agilent AdvanceBio SEC.

[0158] 2.1.1.2 ELISA To determine the effect on binding to the antigen eqIL-5 after storage at 4°C, 21°C, and 37°C, a titration ELISA was performed as previously described. Briefly, eqIL-5 was coated onto a 96-well plate. After blocking and washing, samples of NOL11 were titrated against eqIL-5. Unbound antibody was washed away, and anti-horse antibody was added for detection.

[0159] 2.1.1.3 SDS-PAGE Samples were also analyzed by SDS-PAGE under reducing and non-reducing conditions. Reduced samples were mixed with Laemmli buffer containing β-mercaptoethanol and heated at 56°C for 5 minutes, while non-reduced samples were mixed with Laemmli buffer without β-mercaptoethanol and heated at 56°C for 10 minutes. Electrophoresis was performed at 150–200 V for approximately 1 hour.

[0160] 2.1.2 Biotinylation for verification of aglycosylation Antibodies typically contain an N-glycosylation site in the Fc portion. The present inventors introduced an aglycosylation mutation into their anti-IL5 antibody to remove the glycosylation site. Substituting an asparagine (N) at the glycosylation site with an alanine (A) prevents glycosylation in the Fc portion of the antibody. The aglycosylation mutation is called N297A, based on the fact that human antibodies are glycosylated at position 297.

[0161] To demonstrate that mutagenesis was successful and that NOL11 was not glycosylated, a biotinylation experiment was performed. A glycosylated version of NOL11 was used as a positive control. This experiment was performed using recombinantly produced NOL11 in Expi293F™ cells and Hi5 cells (described below), as previously described.

[0162] The antibody was first prepared by changing the buffer to 100 mM NaAc / 150 mM NaCl, pH 5.5, via gel filtration. The sample was then incubated in sodium periodate solution to oxidize sialic acid, a common sugar component of protein polysaccharides. The buffer was then exchanged again via gel filtration. In the next step, hydrazide-PEG4-biotin was added to the sample (final concentration 5 mM) and incubated. Excess biotin was removed by gel filtration, and the sample was used for Western blot analysis.

[0163] 2.1.2.1 Western blot analysis Biotin was specifically detected by Western blot analysis. After reducing SDS-PAGE, proteins were blotted onto a membrane. Nonspecific binding sites were blocked, and streptavidin-HRP was used for chemiluminescence detection.

[0164] 2.1.2.2 Production of recombinant antibodies in Hi5 cells Cells were cultured at 27°C and 120 rpm. Transient expression was used for production. Transfection of expression plasmids was performed using linear polyethyleneimine (PEI MAX, 40 kDa) (Polysciences Europe GmbH). The heavy and light chains of the antibodies were cloned into different expression plasmids and co-transfected at a 1:1 ratio.

[0165] Transfections were performed in a volume of 15 mL. 6 1.0 x 10 cells / mL were used. They were transfected with plasmid DNA and PEI per milliliter of cell culture volume. DNA and PEI were added directly to the cells. 1.0 x 10 cells were transfected with plasmid DNA and PEI per milliliter of cell culture volume. 6 The cells were diluted to a concentration of 1000 cells / mL and cultured under the above conditions for a total of 4 days, including a step of feeding fresh medium after 48 hours. Cells were harvested by centrifugation. The supernatant was then sterile filtered for purification. Antibodies were purified from the culture supernatant using affinity chromatography via binding to Protein A or Protein G. Depending on the scale, different columns were installed using an Äkta or Profinia system or a 24-well filter plate, and compressed air was used.

[0166] 2.2 Results 2.2.1 Stability testing To analyze the stability of NOL11, HPLC-SEC, SDS-PAGE and ELISA experiments were performed with samples stored at 4°C, 21°C and 37°C.

[0167] 2.2.1.1 HPLC-SEC Only one peak can be observed for each sample by HPLC-SEC. Despite slight height differences, all peaks appear nearly identical and have a maximum at a retention time of approximately 12.5 minutes. No additional peaks at shorter or longer elution times are observed. This leads to the conclusion that no aggregates or fragments are present in the samples after 4 weeks of storage at the respective temperatures (Figure 4).

[0168] 2.2.1.2 ELISA In ELISA, all samples show curves comparable to those of fresh antibody. Only the two samples stored at 21°C have a slightly higher maximum at 100 nM. The ability of NOL11 to bind eqIL-5 does not change over a 4-week period when stored at either 4°C, 21°C, or 37°C (Figure 5).

[0169] 2.2.1.3 SDS-PAGE All samples were analyzed by SDS-PAGE under non-reducing conditions, and samples after 4 weeks of storage were further analyzed by reducing SDS-PAGE. Under non-reducing conditions, all samples exhibited two distinct bands of 150-250 kDa, consistent with the size of intact IgG. Additionally, a smaller band was visible above the main band, likely representing aggregated antibody. Aggregates were also present in fresh samples. When the antibody was stored at 37°C, slight antibody aggregation could be detected.

[0170] Under reducing conditions, two bands at 25 kDa and 50 kDa are observed in all samples analyzed. The disulfide bond between the antibody's heavy and light chains is disrupted, resulting in one band for the heavy chain (50 kDa) and one band for the light chain (25 kDa). Samples stored at 37°C show two faint additional bands at approximately 100 kDa and 150 kDa.

[0171] No significant differences were observed between samples, leading to the conclusion that the antibody was stable under all test conditions (Figure 6).

[0172] 2.2.2 Biotinylation for verification of aglycosylation Our antibody was modified to have no N-glycosylation in the Fc portion by the N297A mutation, called aglycosylation. Biotinylation experiments were performed to demonstrate that antibody NOL11, the antibody used in the two in vivo studies, had no sugars attached.

[0173] For this experiment, NOL11 from two different expression systems was used. In addition to Expi297F™ cells, the antibody was produced in Hi5 insect cells. As a positive control, a glycosylated form of NOL11 containing no mutations was used.

[0174] Sialic acids of latent protein polysaccharides were oxidized and conjugated to hydrazide-PEG4-biotin, which was detected by streptavidin-HRP on reducing SDS-PAGE and Western blot.

[0175] The results are shown in Figure 7. In Coomassie-stained SDS-PAGE, all four antibodies showed two bands, corresponding to the sizes of the heavy chain (50 kDa) and light chain (25 kDa). In Western blot, only two of these bands were visible. The heavy chains of the glycosylated proteins were stained with streptavidin-HRP, demonstrating that the N297A mutation successfully led to aglycosylation of the antibodies (Figure 7).

[0176] [Example 3] Targeted animal studies using NOL11 Due to promising in vitro results in inhibition assays and productivity and stability data, the anti-eqIL-5 antibody NOL11 was tested in vivo in horses (healthy and with IBH).

[0177] NOL11 has been tested for safety and tolerability in two targeted animal studies to date (D10POC-A and D10POC-B). In a second study, the efficacy of the antibody was further tested in a small number of animals suffering from IBH (D10POC-C). A summary of each study and relevant information about the animals involved are shown in Table 3. Two healthy control animals that received a placebo or were untreated are not included in Table 3.

[0178] [Table 3-1]

[0179] [Table 3-2]

[0180] 3.1 D10POC-A, Single-Center Safety Study (Northern Germany) / Preliminary Study A For the in vivo pilot study D10POC-A, six horses kept at the WDT serum plant in Memsen, Germany were used. The primary objective of this study was to evaluate the safety of antibody NOL11. Therefore, four healthy horses and two horses affected by IBH were used. They were divided into an antibody group and a control group, each containing two healthy horses and one affected horse. The control group received 1x PBS instead of the antibody. An overview of the horses studied is shown in Table 3.

[0181] 3.1.1 History of horses with summer eczema Horse 306 arrived at the WDT already diagnosed with summer eczema. Information on the onset of illness at arrival was not available for Horse 329. Horse 306's summer eczema was classified as severe, while Horse 329 had low-grade (mild to moderate) summer eczema.

[0182] During the main mosquito season, both horses were housed in stables to avoid exposure to Culicoides flies. Both horses with summer eczema were treated with the repellent Wellcare™ three times a week during mosquito season (April / May to October). In addition, affected skin areas (mane, rump, and midline of abdomen) were rubbed with Ballistol animal to soothe the skin and repel insects.

[0183] Two years ago, mare No. 306, who had suffered from severe summer eczema, was kept in an open stall and, despite the treatment described above, her condition worsened significantly. A marked increase in itching led to complete hair loss in the tail end and midline area of ​​the abdomen. In addition, inflammatory swelling and chafed, inflamed skin developed in the base of the tail, mane, and the entire underside of the abdomen. Most of the mane was worn away, and the remainder was broken off. Consequently, the horse was returned to the stall with daily exercise.

[0184] Gelding No. 329, who developed a mild case of summer eczema, was always kept in a stable and grazed daily. The lesions were most noticeable at the base of the tail and in the midline of the abdomen. The skin in this area was largely intact, with only a small portion of the mane broken off. For ethical reasons, this horse served as a control; mare No. 306 was not used.

[0185] 3.1.2 Design of Preliminary Test D10POC-A Six horses were tested in this in vivo pilot study. Three horses (Horse Nos. 306, 365, and 376) were in the antibody group, receiving NOL11 antibody (antibody concentration 1.86 mg / mL) dissolved in 1x PBS buffer. The other three horses (Horse Nos. 329, 312, and 383) were in the control group, receiving 1x PBS instead of antibody. The antibody dose (42.62 μg / kg) was calculated as a 1000x molar excess relative to the mean eqIL-5 level (100 pg / mL, measured by self-administered serum ELISA). The antibody or 1x PBS was injected subcutaneously twice, on days 0 and 14 of the study. The study began in April, before the start of the IBH season. For analysis, blood samples were taken on days −1 (as background control), 2, 7, 14 before the second injection, 16, 21, 28, and 120. In addition, score sheets monitoring the horses' health and behavior were completed on days 0, 1, 2, 3, 5, 7, 9, 11, 13, 14, 15, 16, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, and 120.

[0186] During the study, horses were housed in open stalls with other horses. Additionally, horses with IBH were not treated with Wellcare™ Repellent and Ballistol Animal-Oil from the previous mosquito season and during the study. Figure 8 visualizes the timeline of the study.

[0187] 3.1.3 Safety Assessment 3.1.3.1 Scoresheet On the above dates, a score sheet was completed by the attending veterinarian. The following parameters were assessed: 1) known adverse reactions to Cytopoint™ (anaphylaxis, urticaria, facial edema, diarrhea, ataxia, central nervous system disorders, and convulsions), 2) increase in body temperature after injection, 3) swelling at the injection site, 4) pain at the injection site, 5) abscess formation at the injection site, 6) appetite, 7) habits, 8) locomotion, 9) fur, 10) body condition score, and 11) manifestation of summer eczema. All parameters were monitored for three days after injection, after which only parameters 6–11 were considered. Each parameter was scored between 0 (no abnormalities) and 3 (severe signs).

[0188] Table 4 shows a summary of the total scores for each horse on each observation day.

[0189] [Table 4]

[0190] The only abnormality was the onset of urticaria in Horse No. 312 immediately after the injection of 1x PBS. However, no reasonable correlation was found, except for the immediate postinjection appearance. Furthermore, because the animals were grazing at the time of onset, the possibility of insect bites being a causative factor cannot be ruled out. Furthermore, at score 1, this was a minor effect lasting only 2 days. Antibody NOL11 showed no adverse effects at the dose and volume administered. The symptoms of summer eczema did not exceed score 1 (mild itching with occasional scratching, hair loss, minimal impact on health, feed intake and group behavior normal) in either of the two horses with summer eczema until day 41. Horse No. 306 had a score of 1 for 6 days (days 13-19), while Horse No. 329 had a score of 1 for 4 days (days 14-16 and day 23). The results indicate that both horses with summer eczema had a comparable range of symptoms. This is a positive result considering that Horse No. 306 typically had much more severe symptoms than Horse No. 329, indicating good efficacy of the antibody. At day 120, Horse No. 306 had a total score of 3 and Horse No. 329 had a total score of 1, which is outside the period when antibodies have an effect on symptoms. Horse No. 306 is now, as in other years, more affected by summer eczema.

[0191] Table 5 shows a comparison of summer eczema scores and symptoms in a typical year with symptoms in the study year (after treatment).

[0192] [Table 5-1]

[0193] [Table 5-2]

[0194] In summary, no adverse side effects of the NOL11 antibody were observed. Therefore, this product is expected to be highly safe and tolerable. Regarding efficacy, it must be noted that the incidence of symptoms in horses with summer eczema generally appeared to decrease during the study year. Furthermore, the number of horses with summer eczema used in this study was insufficient to allow for a statistically significant evaluation of efficacy. Nevertheless, considering the fact that horse 306 had more severe symptoms over the years compared to horse 329, it is possible to state a trend in the effectiveness of NOL11 treatment, as the symptoms in both horses were similarly low during the study period.

[0195] 3.1.3.2 Anti-Drug Antibody (ADA) Assay In targeted animal studies, chimeric antibodies with human variable domains and equine constant domains were injected. The human domains may be recognized as foreign by the horse's immune system. To test whether antibodies against NOL11 were produced and thus triggered undesired immune responses in the treated horses, an ADA assay was performed using horse serum.

[0196] The ADA assay was performed by ELISA. Here, 100 ng of NOL11 in Fab format (the Fab format was chosen to avoid nonspecific binding of the detection antibody to the Fc portion in the ELISA assay. Since the Fc portion is a constant region that is part of the horse immune system, binding of serum antibodies to the Fc portion of the antibody is not expected) was coated overnight at 4°C in one well of a high-binding 96-well plate. As a control, another eqFab antigen and 2% BSA were also used. The wells were then blocked with 2% BSA in PBS-T for 1 hour at room temperature and washed three times using an ELISA washer (BioTek™ 405™ LS). In the next step, horse serum was diluted with 1 / 10 starting dilution and 2% BSA in PBS-T.

[0197]

number

[0198] For comparison between antibody and control groups, the mean ΔOD 450nm~620nm The signals were compared at a serum dilution of 1:100 (Figure 9), where no significant difference was detected between the two groups. For the antibody group, ΔOD 450nm~620nm The signal increased to approximately 0.06, while the control signal fluctuated near 0. This is still within the expected range of variation and does not indicate the development of ADA. If the horse developed ADA, it would occur after the second dose, with some time delay. Up to 120 days, no significant increase in signal was detected in the antibody group compared to the control group. The slight signal in the antibody group after day 14 is still within the expected range of variation. Furthermore, ADA would not be expected before the second dose, indicating that the increased signal on day 14 is not relevant.

[0199] 3.2 D10POC-B; Two-site safety study (North Germany and East Germany) 3.2.1 Study Design Five horses received NOL11 dissolved in 1x PBS buffer at a dose of 0.05 mg / kg body weight. One horse served as an untreated control. All horses were historically known to have IBH. Horses were group-housed in open stables. Antibody was administered subcutaneously at three time points (days 0, 30, and 60). Horses received the first injection in mid-April, followed by a second injection in May and a final third injection in June (30 days between injections). Score sheets monitoring the horses' general health and behavior were completed regularly by the supervising veterinarian. At Center 1 (northern Germany), horses were scored for the first 5 days after each injection, then every 2 days. At Center 2 (eastern Germany), horses were scored for the first 3 days after injection, then once a week. Safety was evaluated according to the parameters described in Section 3.1.3 for Study D10 POC-A. The final score sheet for safety evaluation was completed on day 90, i.e., 30 days after the last injection. Blood samples were collected on days 0, 2, 3, 30, 32, 33, 60, 62, 63, 90, 91, 120, and 121. ADA assays were performed by ELISA as described for Preliminary Study A (D10POC-A, Section 3.1.3.2). Horse No. 306 was part of Studies D10POC-A and D10POC-B and -C and therefore received antibodies for two consecutive years. Because the likelihood of ADA formation may increase with the number of injections, Horse No. 306 was carefully screened for adverse immune reactions. The study in eastern Germany is still ongoing; therefore, only samples from horses in northern Germany have been analyzed so far.

[0200] 3.2.2 Results 3.2.2.1 Scoring The parameters evaluated (anaphylaxis, urticaria, facial edema, diarrhea, ataxia, central nervous system disorders, convulsions, increased body temperature after injection, swelling at the injection site, pain at the injection site, swelling formation at the injection site, appetite, habit, gait, fur, body condition score) were scored in five horses over the entire study period. Only one of these horses showed swelling at the injection site for 3 days, 5 days after the third injection (score of 2 on the 5th day after injection, and score of 1 on the following 2 days). The other horses showed no side effects.

[0201] 3.2.2.2 Determination of Anti-Drug Antibodies (ADA) ADA assays (as previously described in section 3.1.3.2) were performed to test whether antibodies against NOL11 were produced and therefore elicited an undesired immune response in treated horses.

[0202] To compare the NOL11 group with the control group, the mean ΔOD 450nm~620nm Signal (ΔOD as the deviation value from the sample before application of NOL11) 450nm~620nm To obtain the OD 450nm~620nm The OD of each sample 450nm~620nm The ΔOD (subtracted from ΔOD) was compared at a serum dilution of 1:100 (Figure 11). Here, no significant difference was detected between the two groups. For the antibody group, the ΔOD 450nm~620nm The signal increases to approximately 0.09 and 0.10, while the control signal fluctuates around 0. This is still within the expected range of variation and does not indicate the development of ADA. For example, on days 3 and 32, the antibody signal decreases in the same range to approximately -0.09, indicating a normal range of variation.

[0203] Horse No. 306 did not develop an immune response to NOL11 despite receiving a total of five injections (two at D10POC-A and three at D10POC-B) over two consecutive years, indicating that the antibody is safe for repeated treatment in horses.

[0204] 3.3 D10POC-C; Single-center efficacy study (Northern Germany) 3.3.1 Study Design During Study D10POC-B, two horses treated with NOL11 and an untreated control horse were thoroughly monitored for the development of symptoms (referred to as Study D10POC-C). Evaluations were performed by a veterinarian who had cared for the horses for several years and was familiar with their medical history. Before the study began, the severity of IBH in the test horses was assessed based on their annual clinical manifestations. One horse (Alma, No. 306) was classified as having severe summer fever (high IBH), one horse (Wescana, No. 344) was classified as having moderate IBH, and the untreated control horse (Tamino, No. 329) was classified as having mild to moderate IBH symptoms. The study began in April, shortly after the first symptoms appeared. All horses were housed in the same group in an open stable without special chironomid protection.

[0205] Skin score sheets monitoring the horses' scratching behavior and skin condition were completed by a veterinarian starting one week before the first injection and then periodically as described in Section 3.2.2.1. The final score sheet for efficacy evaluation was completed on Day 135, thus 75 days after the last injection. Evaluations were divided into two observation periods: Day 7 to Day 91 (i.e., up to Day 31 after the last injection) and Day 91 to Day 135 (a period following the expected duration of action of NOL11 based on the theoretical half-life of the equine antibody (Lewis et al., Molecular Immunology, 2008, 45, 818-827)). Anti-human IL-5 antibodies such as resilizumab or mepolizumab exhibit prolonged pharmacodynamic effects in asthmatic patients after treatment with the antibody, far exceeding the serum half-life of the antibody (Ghassemian et al., Allergy, Asthma and Clinical Immunology 2021, 17, 1-7; Smith et al., Clinical Pharmacokinetics 2011, 50, 215-227; Wang et al., CPT: Pharmacometrics and Systems Pharmacology 2017, 6, 249-257). Therefore, the period after the last injection was of great interest.

[0206] Horses were scored between 0 (no signs of pruritus / skin lesions) and 3 (severe signs of pruritus / skin lesions). As a control, a healthy horse without IBH was scored in parallel for signs of IBH. This horse was scored "0" at all time points (data not shown).

[0207] Additionally, 21 days after the last injection (the theoretical half-life of equine antibodies (Lewis et al., 2008)), the equine pruritus visual analog scale (EPVAS) was recorded to obtain a trend in the pharmacodynamic effects of NOL11. This score ranges from 0 (normal horse) to 10 (extremely severe pruritus) (Craig et al., Journal of the American Veterinary Medical Association 2023, 261, 75-85).

[0208] 3.3.2 Results (Skin Score and EPVAS) Figure 12 shows skin scores over the first 91-day observation period. The first score data was collected 7 days before the first injection of NOL11 (days -7 to -1). Figure 12a shows the scores for untreated control horses. At the start of the study in April (days -7 to -5), most of the mildly to moderately affected horses had scores of 0 (Figure 12a, mean score 0.1). Horse No. 306 (Figure 12c) was classified as having very severe IBH (high), with mild symptoms already presenting before the first injection in April (mean score 1). Horse No. 344 (Figure 12b) was classified as having moderate IBH, with mild symptoms presenting before the first injection of NOL11 (mean score 0.4). Comparing the mean scores of the untreated control horse and the two NOL11-treated horses between day 0 (the day of the first NOL11 injection at the end of April) and day 91 (31 days after the third and final dose of NOL11), the mean scores of the treated horses were lower than those of the untreated control horses. Horse No. 344 (Figure 12b) had a mean score of 0.1 between days 0 and 91, while the control horse (horse No. 329, Figure 12a) had a mean score of 1.0. The mean score of severely affected horse No. 306 was 0.7, thus lower than that of the control horses. Figure 13 shows the regression line of scores over the 91-day observation period. The increase in the untreated horses is most pronounced, while the line for the moderately affected horses shows little increase. The increase in the severely affected horses treated with NOL11 is lower than that of the untreated control animals.

[0209] Looking at the period from late July to early September, from days 91 to 135 (75 days after the last dose of NOL11), all horses showed signs of worsening (Figure 14). However, the mean scores for treated animals were still lower than those for control horses. The mean scores were 2 for the mildly to moderately affected control horses (Figure 14a), 1.8 for the severely and moderately affected horses treated with NOL11 (Figure 14c), and 0.4 for the severely affected horses treated with NOL11 (Figure 14b). Interestingly, the severely affected horse No. 306 treated with NOL11 showed a greater increase in symptoms than the control horses, which can be explained by the attenuating effect of the antibody. However, the treated horses still showed significantly less severe symptoms than usual, suggesting that blocking IL-5 at the start of the season has a sustained effect throughout the season (see also the case report in Chapter 3.4). Prolonged or vigorous scratching damages the skin, leading to an inflammatory process that in turn promotes pruritus. This creates a vicious cycle of scratching and mechanical irritation (the itch-scratch cycle). Interrupting this itch-scratch cycle early could significantly slow the maintenance and progression of the disease. During May, June, July, and August, when symptoms typically begin to appear, the mean score for severely affected horse No. 306 was 1.0, below the level of untreated control horses known to suffer from mild to moderate psoriasis (mean score of 1.4). Horse No. 344, treated with NOL11, showed few or only very mild symptoms throughout the study period. Only 33 days after the final dose of NOL11, this horse began to show prolonged symptoms (mean score of 0.3 from May to August).

[0210] Figure 15 shows the regression lines for skin scores from day 91 to the final score on day 140. All regression lines for treated horses show a similar trend of increase over the treatment period compared to control horses, with the lines rising sharply.

[0211] Figure 16 shows the incidence of scratching 21 days after the last injection of NOL11 (dose 3). Scratching behavior was scored from 0 to 10 using the EPVAS score. In untreated control horses and NOL11-treated horses with severe IBH, pruritus consistently increased 21 days after the final dose. However, the NOL11-treated horse with severe IBH (No. 306) showed less severe pruritus than untreated horses known to have mild to moderate disease, even 81 days after the last antibody injection. Horse No. 344 began scratching 39 days after the last NOL11 injection but exhibited only slight scratching behavior until the end of the study.

[0212] 3.4 Case reports At the end of the D10POC-A and C trials, the attending veterinarian prepared case reports of two horses treated with NOL11.

[0213] 3.4.1 Case 1: Horse with severe IBH Case study horse 1 ("Alma," No. 306), a 17-year-old Warmblood mare, had been suffering from IBH for over 10 years. Without protective measures (stabling most of the day, reduced grazing time, daily skin care oil applications, and regular permethrin repellent applications), the horse exhibited high levels of pruritus. Symptoms typically began in April and continued through November, depending on climatic conditions (warm weather and high humidity provide ideal conditions for midges). The horse developed numerous skin lesions, some of which had opened wounds, on various parts of its body due to intense scratching. The mane, head, base of the tail, and midline of the abdomen were particularly affected. Itchy lesions were also found on the udder, inner thighs, elbow creases, and chest. The affected area of ​​the skin at the base of the tail exhibited elastic changes ("elephant skin") due to continuous scratching. The horse required daily treatments with permethrin (Wellcare™ emulsion 10.5 mg / ml) and skin oil several times a week. The horse suffers from severe pruritus requiring regular applications of glucocorticoid ointment and systemic dexamethasone injections during the summer eczema season.

[0214] During the study, the horses were kept in open stalls and had free access to pasture every day. The horses were not treated with repellents, skin oils or glucocorticoids.

[0215] In Study D10 POC-A, horses received two injections of NOL11 (0.04 mg / kg body weight) two weeks apart (April and May) before the onset of the first symptoms. The first, but only mild, symptoms appeared in early May. The horse exhibited mild rubbing around the mane ridge and hair loss in the rump. There were no skin lesions or open wounds. In early July, approximately 80 days after the last NOL11 injection, the onset of symptoms became somewhat more pronounced, and the horse exhibited more pronounced rubbing in the mane and tail area, as well as a hairless area in the midline of the abdomen. However, there were still no visible skin lesions or wounds. During the study period, the horses did not require any further protective or therapeutic measures (no repellents, stabling, restricted grazing, regular stabling, skin oils or glucocorticoids) and showed a significant reduction in summer eczema symptoms compared to previous years.

[0216] In Study D10POC-C, horses were injected with NOL11 (0.05 mg / kg body weight; 30-day intervals in April, May, and June) three times after the onset of symptoms. This was done to determine whether it would be possible to suppress existing symptoms. The horse showed only mild symptoms until mid-June. At this point, the horse exhibited more pronounced rubbing and was treated with dermal oil for two consecutive days. After the third NOL11 injection, symptoms again subsided. In mid-July, symptoms worsened again. The horse exhibited moderate itching caused by rubbing its long hair. Itchy skin swelling was observed in the midline of the abdomen. However, no obvious skin lesions or open wounds were ever observed. Aside from two days of dermal oil application, no further measures were required between NOL11 treatments. Overall, IBH was significantly less pronounced than in years without NOL11 treatment.

[0217] 3.4.2 Case 2: Horse with moderate IBH Case study horse 2 ("Wescana," No. 344), a 19-year-old Warmblood mare, has been suffering from IBH for over 10 years. Without protective measures (stabling most of the day, reduced grazing time, daily skin care oil applications, and regular permethrin repellent applications), the horse is moderately affected by IBH. The horse exhibits increased chafing throughout the season, especially in the mane ridge and tail area. Treatment consists of weekly applications of permethrin (Wellcare™ emulsion 10.5 mg / ml) and skin oil treatment of the affected areas. Glucocorticoid treatment is not required.

[0218] Horse 2 participated only in Study D10 POC-B and C. Similar to Horse 1 (Section 3.4.1), Horse 2 received three injections of NOL11 (0.05 mg / kg body weight; 30-day intervals in April, May, and June) after the onset of symptoms. The horse was housed in an open stall and allowed to graze daily. The horse was not treated with repellents or skin oils throughout the study. During the entire treatment period (three injections), Horse 2 showed no signs of IBH, except for a few days before the third injection at the end of June. Approximately 40 days after the last injection, pruritic symptoms were observed again, but were minor, with slight rubbing of the mane and tail causing hair breakage.

[0219] In contrast, the untreated control horse ("Tamino," No. 329) showed more pronounced symptoms than usual during trials C and B. It is known that the onset of symptoms can vary from year to year, depending on climatic conditions and the insect flight of each year. In summary, NOL11 significantly reduced the severity of symptoms over a 10-year period in two case-test horses affected by IBH.

Claims

1. An isolated antibody or antibody derivative that specifically binds to equine interleukin-5 (IL-5), comprising at least one member selected from the group consisting of equine light chain constant, equine heavy chain constant, and fragments thereof.

2. 2. The isolated antibody or antibody derivative of claim 1, wherein the isolated antibody or antibody derivative is an isolated monoclonal antibody or antibody derivative.

3. 3. The isolated antibody or antibody derivative of claim 1 or 2, wherein the isolated antibody or antibody derivative is aglycosylated.

4. 4. The isolated antibody or antibody derivative of claim 1, wherein the isolated antibody or antibody derivative comprises an amino acid sequence of at least one complementarity determining region (CDR) selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 1, 155, 156, 157, 158, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 and 21.

5. 5. The isolated antibody or antibody derivative of claim 1, wherein the isolated antibody or antibody derivative comprises an amino acid sequence of a light chain CDR1 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 155, 156, 157, and 158, an amino acid sequence of a light chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 2, 3, 4, and 5, an amino acid sequence of a heavy chain CDR1 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 6, 7, 8, and 9, an amino acid sequence of a heavy chain CDR2 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 10, 11, 12, 13, and 14, and an amino acid sequence of a heavy chain CDR3 selected from the group consisting of the amino acid sequences set forth in any one of SEQ ID NOs: 15, 16, 17, 18, 19, 20, and 21.

6. 6. The isolated antibody or antibody derivative of any one of claims 1 to 5, comprising a light chain variable region comprising an amino acid sequence identical to, or with at least 90%, 95%, 98% or 99% sequence identity with, the amino acid sequence set forth in any one of SEQ ID NOs: 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 35, 36 or 37, and / or a heavy chain variable region comprising an amino acid sequence identical to, or with at least 90%, 95%, 98% or 99% sequence identity with, the amino acid sequence set forth in any one of SEQ ID NOs: 38, 39, 40, 41, 42, 43, 45, 49, 50, 51, 52 or 53.

7. 7. An isolated antibody or antibody derivative according to any one of claims 1 to 6, comprising a light chain amino acid sequence identical to or having at least 90%, 95%, 98% or 99% sequence homology with the amino acid sequence set forth in SEQ ID NO: 54, and / or a heavy chain amino acid sequence identical to or having at least 90%, 95%, 98% or 99% sequence homology with the amino acid sequence set forth in SEQ ID NO: 55 or 153.

8. 8. The isolated antibody or antibody derivative of any one of claims 1 to 7, wherein the isolated antibody or antibody derivative is an isolated IgG antibody or antibody derivative, preferably, the isolated antibody or antibody derivative is an isolated IgG6 antibody or antibody derivative.

9. The isolated antibody or antibody derivative of any one of claims 1 to 8, wherein the isolated antibody or antibody derivative has the ability to neutralize equine IL-5.

10. 10. An isolated nucleic acid molecule comprising at least one nucleic acid sequence that at least partially encodes the isolated antibody or antibody derivative of any one of claims 1 to 9.

11. A vector, preferably an expression vector, comprising at least one nucleic acid sequence at least partially encoding the isolated antibody or antibody derivative of any one of claims 1 to 9.

12. A host cell comprising at least one nucleic acid sequence that at least partially encodes a vector described in claim 11 or an isolated antibody or antibody derivative described in any one of claims 1 to 9, wherein the host cell is preferably a eukaryotic host cell.

13. 10. A pharmaceutical composition comprising the isolated antibody or antibody derivative of any one of claims 1 to 9 and a pharmaceutically acceptable excipient.

14. 14. An isolated antibody or antibody derivative according to any one of claims 1 to 9 or a pharmaceutical composition according to claim 13 for use as a medicament.

15. 14. An isolated antibody or antibody derivative according to any one of claims 1 to 9 or a pharmaceutical composition according to claim 13 for use in the treatment of an allergic condition in a horse.

16. 16. The isolated antibody or antibody derivative for use according to claim 15 or the pharmaceutical composition for use according to claim 15, wherein the allergic condition is selected from the group consisting of equine allergic skin disease, equine allergic respiratory disease and inflammatory disease.

17. 17. The isolated antibody or antibody derivative for use according to claim 16, or the pharmaceutical composition for use according to claim 16, wherein the equine allergic skin disease is selected from the group consisting of insect bite hypersensitivity, atopic dermatitis, food hypersensitivity, allergic and irritant contact dermatitis, and urticaria, preferably the equine allergic skin disease is insect bite hypersensitivity or atopic dermatitis, most preferably the equine allergic skin disease is insect bite hypersensitivity.

18. 17. The isolated antibody or antibody derivative for use according to claim 16, or the pharmaceutical composition for use according to claim 16, wherein the equine allergic respiratory disease is equine asthma.

19. 10. An in vitro method for diagnosing an allergic condition in a horse comprising contacting an isolated antibody or antibody derivative of any one of claims 1 to 9 with a biological sample.

20. A method for producing an isolated antibody or antibody derivative according to any one of claims 1 to 9, comprising expressing said isolated antibody or antibody derivative in a host cell, preferably a host cell according to claim 12.

Images