Maltabody constructs, compositions and methods for targeting sarbecoviruses
Self-assembled polypeptide complexes with sarbecovirus binding moieties linked to nanocage monomers address the challenge of broad-spectrum neutralization against sarbecoviruses, maintaining efficacy despite viral mutations, by using specific sarbecovirus antibodies or their fragments.
Patent Information
- Application Number
- JP2025522579
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-14
- Filing Date
- 2023-10-20
- Publication Date
- 2025-11-05
AI Technical Summary
Existing monoclonal antibody (mAb)-based treatments struggle to provide broad-spectrum neutralization against sarbecoviruses without sacrificing efficacy, as evidenced by the revocation of FDA-approved treatments due to viral escape mutations, particularly with variants like Omicron BA.1, BQ.1.1, and XBB.1.
Development of self-assembled polypeptide complexes comprising fusion polypeptides with sarbecovirus binding moieties linked to nanocage monomers, utilizing specific sarbecovirus antibodies or their fragments, such as scFab, to achieve broad-spectrum neutralization against SARS-CoV-2 and other sarbecoviruses.
The self-assembled polypeptide complexes maintain efficacy against multiple sarbecoviruses, including SARS-CoV-2, GD-Pangolin, and others, with neutralizing activity at 200 ng/mL, despite viral diversity and mutations.
Smart Images

Figure 2025536337000063 
Figure 2025536337000064 
Figure 2025536337000065
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 380,540, filed October 21, 2022, and U.S. Provisional Application No. 63 / 496,136, filed April 14, 2023, the entire contents of which are incorporated herein by reference in their entirety for all purposes.
[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format, which is incorporated herein by reference in its entirety. The XML file, created on October 20, 2023, is named 3206-5126_.xml and is 288.8 kilobytes in size. [Background technology]
[0003] Emerging infectious agents, including viruses such as SARS-CoV-2 (Sarbecovirus coronaviruses), pose significant challenges to global public health. The relatively short-lived vaccine-mediated protection, coupled with the emergence of new viral variants, further emphasizes the need for effective prevention and treatment options. Monoclonal antibodies (mAbs) offer promising options, but mAb-based treatments struggle to overcome viral diversity. Indeed, a two-mAb combination previously approved by the U.S. Food and Drug Administration (FDA) to treat COVID-19 was revoked following the emergence of the Variant of Concern (VOC) Omicron BA.1, which harbors 37 mutations in the spike domain and 15 mutations in the receptor-binding domain (RBD), the target of most clinical antibodies against SARS-CoV-2. Furthermore, with the emergence of the Omicron BQ.1.1 and XBB.1 subvariants, mAbs that were able to neutralize the original Omicron VOC, including Bebtelovimab and the cocktail Tixagevimab and Cilgavimab, have also had their approval revoked due to viral escape.
[0004] Other therapeutics or potential therapeutics may exhibit increased breadth against subvariants and even other sarbecoviruses, but this increased breadth is often associated with reduced efficacy.
[0005] Improved therapeutic agents that combine increased breadth without sacrificing efficacy are needed. Summary of the Invention [Means for solving the problem]
[0006] Abstract The present invention addresses this need by providing self-assembled polypeptide complexes that exhibit broad-spectrum neutralization against sarbecoviruses and maintain efficacy. Related fusion polypeptides, compositions, and methods are also provided.
[0007] In one aspect, fusion polypeptides are provided that can be used within the self-assembled polypeptide complexes disclosed herein.
[0008] In certain embodiments, a fusion polypeptide is provided that includes a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is capable of binding to SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2.
[0009] In some embodiments, the first sarbecovirus-binding moiety comprises a sarbecovirus antibody or a sarbecovirus-binding fragment thereof, e.g., a Fab fragment of the sarbecovirus antibody. In some embodiments, the Fab fragment is a single-chain Fab (scFab).
[0010] In some embodiments, the sarbecovirus antibody is capable of neutralizing SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2, e.g., a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyra11, Rs7327, Rs4231, Rs4084, and combinations thereof. In some embodiments, the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV. In some embodiments, the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyra11, Rs7327, Rs4231, and Rs4084.
[0011] In certain embodiments, a fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus-binding fragment thereof, and wherein the sarbecovirus antibody has an IC of less than 1 μg / mL. 50 Fusion polypeptides are provided that exhibit neutralizing activity against SARS-CoV at 200 ng / mL.
[0012] In certain embodiments, a fusion polypeptide is provided comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus-binding fragment thereof, and the sarbecovirus antibody or sarbecovirus-binding fragment thereof comprises a heavy chain complementarity-determining region 3 (CDR-H3) having a sequence comprising YYDRSGY (SEQ ID NO: 70).
[0013] In some embodiments, the sarbecovirus antibody or sarbecovirus-binding fragment thereof comprises a CDR-H3 sequence selected from the group consisting of SEQ ID NO: 34, 40, 46, 75, 81, 87, 95, 101, 107, 115, 121, 127, 135, 141, 147, 155, 161, 167, 175, 181, 187, 195, 201, 207, 215, 221, 227, 235, 241, 247, 255, 261, 267, 275, 281, 287, 295, 301, 307, 315, 321, 327, 335, 341, or 347, or a variant of any of the foregoing sequences comprising no more than three, no more than two, or no more than one amino acid substitution therein.
[0014] In some embodiments, the sarbecovirus antibody or sarbecovirus-binding fragment thereof comprises a CDR-H3 sequence selected from the group consisting of SEQ ID NO: 34, 40, 46, 75, 81, 87, 95, 101, 107, 115, 121, 127, 135, 141, 147, 155, 161, 167, 175, 181, 187, 195, 201, 207, 215, 221, 227, 235, 241, 247, 255, 261, 267, 275, 281, 287, 295, 301, 307, 315, 321, 327, 335, 341, or 347.
[0015] In some embodiments, the sarbecovirus antibody or sarbecovirus-binding fragment thereof is
[0016] (a) SEQ ID NO: 34 and SEQ ID NO: 37, respectively;
[0017] (b) SEQ ID NO: 40 and SEQ ID NO: 43, respectively;
[0018] (c) SEQ ID NO: 46 and SEQ ID NO: 49, respectively;
[0019] (d) SEQ ID NO: 75 and SEQ ID NO: 78, respectively;
[0020] (e) SEQ ID NO: 81 and SEQ ID NO: 84, respectively;
[0021] (f) SEQ ID NO: 87 and SEQ ID NO: 90, respectively;
[0022] (g) SEQ ID NO: 95 and SEQ ID NO: 98, respectively;
[0023] (h) SEQ ID NO: 101 and SEQ ID NO: 104, respectively;
[0024] (i) SEQ ID NO: 107 and SEQ ID NO: 110, respectively;
[0025] (j) SEQ ID NO: 115 and SEQ ID NO: 118, respectively;
[0026] (k) SEQ ID NO: 121 and SEQ ID NO: 124, respectively;
[0027] (l) SEQ ID NO: 127 and SEQ ID NO: 130, respectively;
[0028] (m) SEQ ID NO: 135 and SEQ ID NO: 138, respectively;
[0029] (n) SEQ ID NO: 141 and SEQ ID NO: 144, respectively;
[0030] (o) SEQ ID NO: 147 and SEQ ID NO: 150, respectively;
[0031] (p) SEQ ID NO: 155 and SEQ ID NO: 158, respectively;
[0032] (q) SEQ ID NO: 161 and SEQ ID NO: 164, respectively;
[0033] (r) SEQ ID NO: 167 and SEQ ID NO: 170, respectively;
[0034] (s) SEQ ID NO: 175 and SEQ ID NO: 178, respectively;
[0035] (t) SEQ ID NO: 181 and SEQ ID NO: 184, respectively;
[0036] (u) SEQ ID NO: 187 and SEQ ID NO: 190, respectively;
[0037] (v) SEQ ID NO: 195 and SEQ ID NO: 198, respectively;
[0038] (w) SEQ ID NO: 201 and SEQ ID NO: 204, respectively;
[0039] (y) SEQ ID NO: 207 and SEQ ID NO: 210, respectively;
[0040] (z) SEQ ID NO: 215 and SEQ ID NO: 218, respectively;
[0041] (aa) SEQ ID NO: 221 and SEQ ID NO: 224, respectively;
[0042] (bb) SEQ ID NO: 227 and SEQ ID NO: 230, respectively;
[0043] (cc) SEQ ID NO: 235 and SEQ ID NO: 238, respectively;
[0044] (dd) SEQ ID NO: 241 and SEQ ID NO: 244, respectively;
[0045] (ee) SEQ ID NO: 247 and SEQ ID NO: 250, respectively;
[0046] (ff) SEQ ID NO: 255 and SEQ ID NO: 258, respectively;
[0047] (gg) SEQ ID NO: 261 and SEQ ID NO: 264, respectively;
[0048] (hh) SEQ ID NO: 267 and SEQ ID NO: 270, respectively;
[0049] (ii) SEQ ID NO: 275 and SEQ ID NO: 278, respectively;
[0050] (jj) SEQ ID NO: 281 and SEQ ID NO: 284, respectively;
[0051] (kk) SEQ ID NO: 287 and SEQ ID NO: 290, respectively;
[0052] (ll) SEQ ID NO: 295 and SEQ ID NO: 298, respectively;
[0053] (mm) SEQ ID NO: 301 and SEQ ID NO: 304, respectively;
[0054] (nn) SEQ ID NO: 307 and SEQ ID NO: 310, respectively;
[0055] (oo) SEQ ID NO: 315 and SEQ ID NO: 318, respectively;
[0056] (pp) SEQ ID NO: 321 and SEQ ID NO: 324, respectively;
[0057] (qq) SEQ ID NO: 327 and SEQ ID NO: 330, respectively;
[0058] (rr) SEQ ID NO: 335 and SEQ ID NO: 338, respectively;
[0059] (ss) SEQ ID NO: 341 and SEQ ID NO: 344, respectively; or
[0060] (tt) SEQ ID NO: 347 and SEQ ID NO: 350, respectively or the CDR-H3 and CDR-L3 sequences of
[0061] (uu) CDR-H3 and CDR-L3 sequences that collectively differ by no more than three, no more than two, or no more than one amino acid substitution across both the CDR-H3 and CDR-L3 sequences of any of (a) to (tt) above. Includes:
[0062] In some embodiments, the sarbecovirus antibody or sarbecovirus-binding fragment thereof is
[0063] (a) SEQ ID NO: 34 and SEQ ID NO: 37, respectively;
[0064] (b) SEQ ID NO: 40 and SEQ ID NO: 43, respectively;
[0065] (c) SEQ ID NO: 46 and SEQ ID NO: 49, respectively;
[0066] (d) SEQ ID NO: 75 and SEQ ID NO: 78, respectively;
[0067] (e) SEQ ID NO: 81 and SEQ ID NO: 84, respectively;
[0068] (f) SEQ ID NO: 87 and SEQ ID NO: 90, respectively;
[0069] (g) SEQ ID NO: 95 and SEQ ID NO: 98, respectively;
[0070] (h) SEQ ID NO: 101 and SEQ ID NO: 104, respectively;
[0071] (i) SEQ ID NO: 107 and SEQ ID NO: 110, respectively;
[0072] (j) SEQ ID NO: 115 and SEQ ID NO: 118, respectively;
[0073] (k) SEQ ID NO: 121 and SEQ ID NO: 124, respectively;
[0074] (l) SEQ ID NO: 127 and SEQ ID NO: 130, respectively;
[0075] (m) SEQ ID NO: 135 and SEQ ID NO: 138, respectively;
[0076] (n) SEQ ID NO: 141 and SEQ ID NO: 144, respectively;
[0077] (o) SEQ ID NO: 147 and SEQ ID NO: 150, respectively;
[0078] (p) SEQ ID NO: 155 and SEQ ID NO: 158, respectively;
[0079] (q) SEQ ID NO: 161 and SEQ ID NO: 164, respectively;
[0080] (r) SEQ ID NO: 167 and SEQ ID NO: 170, respectively;
[0081] (s) SEQ ID NO: 175 and SEQ ID NO: 178, respectively;
[0082] (t) SEQ ID NO: 181 and SEQ ID NO: 184, respectively;
[0083] (u) SEQ ID NO: 187 and SEQ ID NO: 190, respectively;
[0084] (v) SEQ ID NO: 195 and SEQ ID NO: 198, respectively;
[0085] (w) SEQ ID NO: 201 and SEQ ID NO: 204, respectively;
[0086] (y) SEQ ID NO: 207 and SEQ ID NO: 210, respectively;
[0087] (z) SEQ ID NO: 215 and SEQ ID NO: 218, respectively;
[0088] (aa) SEQ ID NO: 221 and SEQ ID NO: 224, respectively;
[0089] (bb) SEQ ID NO: 227 and SEQ ID NO: 230, respectively;
[0090] (cc) SEQ ID NO: 235 and SEQ ID NO: 238, respectively;
[0091] (dd) SEQ ID NO: 241 and SEQ ID NO: 244, respectively;
[0092] (ee) SEQ ID NO: 247 and SEQ ID NO: 250, respectively;
[0093] (ff) SEQ ID NO: 255 and SEQ ID NO: 258, respectively;
[0094] (gg) SEQ ID NO: 261 and SEQ ID NO: 264, respectively;
[0095] (hh) SEQ ID NO: 267 and SEQ ID NO: 270, respectively;
[0096] (ii) SEQ ID NO: 275 and SEQ ID NO: 278, respectively;
[0097] (jj) SEQ ID NO: 281 and SEQ ID NO: 284, respectively;
[0098] (kk) SEQ ID NO: 287 and SEQ ID NO: 290, respectively;
[0099] (ll) SEQ ID NO: 295 and SEQ ID NO: 298, respectively;
[0100] (mm) SEQ ID NO: 301 and SEQ ID NO: 304, respectively;
[0101] (nn) SEQ ID NO: 307 and SEQ ID NO: 310, respectively;
[0102] (oo) SEQ ID NO: 315 and SEQ ID NO: 318, respectively;
[0103] (pp) SEQ ID NO: 321 and SEQ ID NO: 324, respectively;
[0104] (qq) SEQ ID NO: 327 and SEQ ID NO: 330, respectively;
[0105] (rr) SEQ ID NO: 335 and SEQ ID NO: 338, respectively;
[0106] (ss) SEQ ID NO: 341 and SEQ ID NO: 344, respectively; or
[0107] (tt) SEQ ID NO: 347 and SEQ ID NO: 350, respectively The CDR-H3 and CDR-L3 sequences are as follows:
[0108] In some embodiments, the sarbecovirus antibody or sarbecovirus-binding fragment thereof is
[0109] (a) SEQ ID NO: 34 and SEQ ID NO: 37, respectively;
[0110] (b) SEQ ID NO: 40 and SEQ ID NO: 43, respectively; or
[0111] (c) SEQ ID NO: 46 and SEQ ID NO: 49, respectively The CDR-H3 and CDR-L3 sequences are as follows:
[0112] In some embodiments, the sarbecovirus antibody or sarbecovirus-binding fragment thereof is
[0113] (a) SEQ ID NOs: 32, 33 and 34 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 35, 36 and 37 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0114] (b) SEQ ID NOs: 38, 39 and 40 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 41, 42 and 43 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0115] (c) SEQ ID NOs: 44, 45 and 46 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 47, 48 and 49 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0116] (d) SEQ ID NOs: 73, 74 and 75 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 76, 77 and 78 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0117] (e) SEQ ID NOs: 79, 80 and 81 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 82, 83 and 84 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0118] (f) SEQ ID NOs: 85, 86 and 87 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 88, 89 and 90 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0119] (g) SEQ ID NOs: 93, 94 and 95 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 96, 97 and 98 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0120] (h) SEQ ID NOs: 99, 100 and 101 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 102, 103 and 104 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0121] (i) SEQ ID NOs: 105, 106 and 107 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 108, 109 and 110 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0122] (j) SEQ ID NOs: 113, 114 and 115 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 116, 117 and 118 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0123] (k) SEQ ID NOs: 119, 120 and 121 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 122, 123 and 124 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0124] (l) SEQ ID NOs: 125, 126 and 127 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 128, 129 and 130 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0125] (m) SEQ ID NOs: 133, 134 and 135 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 136, 137 and 138 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0126] (n) SEQ ID NOs: 139, 140 and 141 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 142, 143 and 144 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0127] (o) SEQ ID NOs: 145, 146 and 147 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 148, 149 and 150 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0128] (p) SEQ ID NOs: 153, 154 and 155 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 156, 157 and 158 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0129] (q) SEQ ID NOs: 159, 160 and 161 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 162, 163 and 164 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0130] (r) SEQ ID NOs: 165, 166 and 167 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 168, 169 and 170 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0131] (s) SEQ ID NOs: 173, 174 and 175 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 176, 177 and 178 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0132] (t) SEQ ID NOs: 179, 180 and 181 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 182, 183 and 184 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0133] (u) SEQ ID NOs: 185, 186 and 187 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 188, 189 and 190 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0134] (v) SEQ ID NOs: 193, 194, and 195 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 196, 197, and 198 for CDR-L1, CDR-L2, and CDR-H3, respectively;
[0135] (x) SEQ ID NOs: 199, 200, and 201 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 202, 203, and 204 for CDR-L1, CDR-L2, and CDR-H3, respectively;
[0136] (y) SEQ ID NOs: 205, 206 and 207 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 208, 209 and 210 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0137] (z) SEQ ID NOs: 213, 214 and 215 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 216, 217 and 218 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0138] (aa) SEQ ID NOs: 219, 220 and 221 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 222, 223 and 224 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0139] (bb) SEQ ID NOs: 225, 226 and 227 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 228, 229 and 230 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0140] (cc) SEQ ID NOs: 233, 234 and 235 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 236, 237 and 238 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0141] (dd) SEQ ID NOs: 239, 240 and 241 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 242, 243 and 244 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0142] (ee) SEQ ID NOs: 245, 246 and 247 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 248, 249 and 250 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0143] (ff) SEQ ID NOs: 253, 254 and 255 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 256, 257 and 258 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0144] (gg) SEQ ID NOs: 259, 260 and 261 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 262, 263 and 264 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0145] (hh) SEQ ID NOs: 265, 266 and 267 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 268, 269 and 270 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0146] (ii) SEQ ID NOs: 273, 274, and 275 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 276, 277, and 278 for CDR-L1, CDR-L2, and CDR-H3, respectively;
[0147] (jj) SEQ ID NOs: 279, 280 and 281 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 282, 283 and 284 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0148] (kk) SEQ ID NOs: 285, 286 and 287 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 288, 289 and 290 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0149] (ll) SEQ ID NOs: 293, 294, and 295 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 296, 297, and 298 for CDR-L1, CDR-L2, and CDR-H3, respectively;
[0150] (mm) SEQ ID NOs: 299, 300 and 301 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 302, 303 and 304 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0151] (nn) SEQ ID NOs: 305, 306 and 307 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 308, 309 and 310 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0152] (oo) SEQ ID NOs: 313, 314 and 315 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 316, 317 and 318 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0153] (pp) SEQ ID NOs: 319, 320 and 321 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 322, 323 and 324 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0154] (qq) SEQ ID NOs: 325, 326 and 327 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 328, 329 and 330 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0155] (rr) SEQ ID NOs: 333, 334 and 335 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 336, 337 and 338 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0156] (ss) SEQ ID NOs: 339, 340, 341 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 342, 343 and 344 for CDR-L1, CDR-L2 and CDR-H3, respectively; or
[0157] (tt) SEQ ID NOs: 345, 346 and 347 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 348, 349 and 350 for CDR-L1, CDR-L2 and CDR-H3, respectively or
[0158] (uu) CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 sequences that collectively differ by no more than three, no more than two, or one amino acid substitution across all six CDRs from any of the above sequences in (a) through (tt). and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2 and CDR-L3, having the following structure:
[0159] In some embodiments, the sarbecovirus antibody or sarbecovirus-binding fragment thereof is
[0160] (a) SEQ ID NOs: 32, 33 and 34 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 35, 36 and 37 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0161] (b) SEQ ID NOs: 38, 39 and 40 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 41, 42 and 43 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0162] (c) SEQ ID NOs: 44, 45 and 46 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 47, 48 and 49 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0163] (d) SEQ ID NOs: 73, 74 and 75 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 76, 77 and 78 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0164] (e) SEQ ID NOs: 79, 80 and 81 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 82, 83 and 84 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0165] (f) SEQ ID NOs: 85, 86 and 87 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 88, 89 and 90 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0166] (g) SEQ ID NOs: 93, 94 and 95 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 96, 97 and 98 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0167] (h) SEQ ID NOs: 99, 100 and 101 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 102, 103 and 104 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0168] (i) SEQ ID NOs: 105, 106 and 107 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 108, 109 and 110 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0169] (j) SEQ ID NOs: 113, 114 and 115 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 116, 117 and 118 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0170] (k) SEQ ID NOs: 119, 120 and 121 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 122, 123 and 124 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0171] (l) SEQ ID NOs: 125, 126 and 127 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 128, 129 and 130 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0172] (m) SEQ ID NOs: 133, 134 and 135 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 136, 137 and 138 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0173] (n) SEQ ID NOs: 139, 140 and 141 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 142, 143 and 144 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0174] (o) SEQ ID NOs: 145, 146 and 147 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 148, 149 and 150 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0175] (p) SEQ ID NOs: 153, 154 and 155 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 156, 157 and 158 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0176] (q) SEQ ID NOs: 159, 160 and 161 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 162, 163 and 164 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0177] (r) SEQ ID NOs: 165, 166 and 167 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 168, 169 and 170 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0178] (s) SEQ ID NOs: 173, 174 and 175 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 176, 177 and 178 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0179] (t) SEQ ID NOs: 179, 180 and 181 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 182, 183 and 184 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0180] (u) SEQ ID NOs: 185, 186 and 187 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 188, 189 and 190 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0181] (v) SEQ ID NOs: 193, 194, and 195 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 196, 197, and 198 for CDR-L1, CDR-L2, and CDR-H3, respectively;
[0182] (x) SEQ ID NOs: 199, 200, and 201 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 202, 203, and 204 for CDR-L1, CDR-L2, and CDR-H3, respectively;
[0183] (y) SEQ ID NOs: 205, 206 and 207 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 208, 209 and 210 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0184] (z) SEQ ID NOs: 213, 214 and 215 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 216, 217 and 218 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0185] (aa) SEQ ID NOs: 219, 220 and 221 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 222, 223 and 224 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0186] (bb) SEQ ID NOs: 225, 226 and 227 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 228, 229 and 230 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0187] (cc) SEQ ID NOs: 233, 234 and 235 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 236, 237 and 238 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0188] (dd) SEQ ID NOs: 239, 240 and 241 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 242, 243 and 244 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0189] (ee) SEQ ID NOs: 245, 246 and 247 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 248, 249 and 250 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0190] (ff) SEQ ID NOs: 253, 254 and 255 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 256, 257 and 258 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0191] (gg) SEQ ID NOs: 259, 260 and 261 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 262, 263 and 264 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0192] (hh) SEQ ID NOs: 265, 266 and 267 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 268, 269 and 270 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0193] (ii) SEQ ID NOs: 273, 274, and 275 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 276, 277, and 278 for CDR-L1, CDR-L2, and CDR-H3, respectively;
[0194] (jj) SEQ ID NOs: 279, 280 and 281 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 282, 283 and 284 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0195] (kk) SEQ ID NOs: 285, 286 and 287 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 288, 289 and 290 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0196] (ll) SEQ ID NOs: 293, 294, and 295 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 296, 297, and 298 for CDR-L1, CDR-L2, and CDR-H3, respectively;
[0197] (mm) SEQ ID NOs: 299, 300 and 301 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 302, 303 and 304 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0198] (nn) SEQ ID NOs: 305, 306 and 307 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 308, 309 and 310 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0199] (oo) SEQ ID NOs: 313, 314 and 315 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 316, 317 and 318 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0200] (pp) SEQ ID NOs: 319, 320 and 321 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 322, 323 and 324 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0201] (qq) SEQ ID NOs: 325, 326 and 327 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 328, 329 and 330 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0202] (rr) SEQ ID NOs: 333, 334 and 335 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 336, 337 and 338 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0203] (ss) SEQ ID NOs: 339, 340, 341 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 342, 343 and 344 for CDR-L1, CDR-L2 and CDR-H3, respectively; or
[0204] (tt) SEQ ID NOs: 345, 346 and 347 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 348, 349 and 350 for CDR-L1, CDR-L2 and CDR-H3, respectively and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2 and CDR-L3, each of which has an amino acid sequence of:
[0205] In certain embodiments, a fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus-binding fragment thereof, wherein the sarbecovirus antibody or a sarbecovirus-binding fragment thereof is
[0206] (a) SEQ ID NOs: 12, 13 and 14 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 15, 16 and 17 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0207] (b) SEQ ID NOs: 18, 19 and 20 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 21, 22 and 23 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0208] (c) SEQ ID NOs: 24, 25 and 26 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 27, 28 and 29 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0209] (d) SEQ ID NOs: 52, 53 and 54 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 55, 56 and 57 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0210] (e) SEQ ID NOs: 58, 59, and 60 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 61, 62, and 63 for CDR-L1, CDR-L2, and CDR-H3, respectively; or
[0211] (f) SEQ ID NOs: 64, 65, and 66 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 67, 68, and 69 for CDR-L1, CDR-L2, and CDR-H3, respectively The amino acid sequence of
[0212] or
[0213] (g) CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 sequences that collectively differ by no more than three, no more than two, or no more than one amino acid substitution across all six CDRs from any of the above sequences in (a) through (f). and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2 and CDR-L3, having the following structure:
[0214] In some embodiments, the sarbecovirus antibody or sarbecovirus-binding fragment thereof is
[0215] (a) SEQ ID NOs: 12, 13 and 14 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 15, 16 and 17 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0216] (b) SEQ ID NOs: 18, 19 and 20 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 21, 22 and 23 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0217] (c) SEQ ID NOs: 24, 25 and 26 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 27, 28 and 29 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0218] (d) SEQ ID NOs: 52, 53 and 54 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 55, 56 and 57 for CDR-L1, CDR-L2 and CDR-H3, respectively;
[0219] (e) SEQ ID NOs: 58, 59, and 60 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 61, 62, and 63 for CDR-L1, CDR-L2, and CDR-H3, respectively; or
[0220] (f) SEQ ID NOs: 64, 65, and 66 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 67, 68, and 69 for CDR-L1, CDR-L2, and CDR-H3, respectively and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2 and CDR-L3, each of which has an amino acid sequence of:
[0221] In some embodiments, the sarbecovirus binding moiety is a Fab fragment of a sarbecovirus antibody. In some embodiments, the Fab fragment is a single-chain Fab (scFab).
[0222] In some embodiments, the sarbecovirus antibody is capable of binding to the receptor binding domain (RBD) of SARS-CoV-2. In some embodiments, the sarbecovirus antibody is capable of binding only to the RBD in its up conformation.
[0223] In some embodiments, the sarbecovirus antibody is capable of inhibiting binding of SARS-CoV-2 to ACE2.
[0224] In some embodiments, the nanocage monomer or subunit thereof is a ferritin monomer or subunit thereof, for example, a ferritin light chain or subunit thereof and / or human ferritin or subunit thereof.
[0225] In some embodiments, the ferritin monomer or subunit thereof is a ferritin monomer subunit, e.g., a C-half ferritin. In some embodiments, the sarbecovirus binding moiety is fused to the N-terminus of the ferritin monomer or subunit thereof. In some such ... an amino acid linker, e.g., (G n S) m Linkers, e.g., (GGGGS) m It is linked to the N-terminus of the ferritin monomer or of the ferritin monomer subunit via an amino acid linker containing the linker.
[0226] In one aspect, a self-assembled polypeptide complex is provided comprising a plurality of first fusion polypeptides, each first fusion polypeptide comprising a first sarbecovirus binding moiety, and each first fusion polypeptide is a fusion polypeptide disclosed herein.
[0227] In some embodiments, the self-assembled polypeptide complex further comprises a plurality of second fusion polypeptides, each second fusion polypeptide comprising a second sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, the second sarbecovirus binding moiety being distinct from the first sarbecovirus binding moiety. In some embodiments, each second fusion polypeptide is a fusion polypeptide disclosed herein.
[0228] In some embodiments, the self-assembled polypeptide complex further comprises a plurality of third fusion polypeptides, each third fusion polypeptide comprising a third sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the third sarbecovirus binding moiety is distinct from the first and second sarbecovirus binding moieties. In some embodiments, each third fusion polypeptide is a fusion polypeptide disclosed herein.
[0229] In some embodiments, the self-assembled polypeptide complex further comprises a plurality of Fc-containing fusion polypeptides, each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a nanocage monomer or subunit thereof. In some embodiments, the nanocage monomer or subunit thereof of the Fc-containing fusion polypeptide is a ferritin monomer or subunit thereof, such as a ferritin light chain or subunit thereof and / or a human ferritin or subunit thereof.
[0230] In some embodiments, the ferritin monomer or subunit thereof is a ferritin monomer subunit, for example, an N-half ferritin.
[0231] In some embodiments, the Fc polypeptide is fused to the N-terminus of a ferritin monomer or subunit thereof.
[0232] In some embodiments, the Fc polypeptide may comprise an amino acid linker, e.g., (G n S) mLinkers, e.g., (GGGGS) m It is linked to the N-terminus of the ferritin monomer or ferritin monomer subunit via a linker containing a linker.
[0233] In some embodiments, the Fc polypeptide comprises a single chain Fc (scFc) comprising two Fc chains, wherein the two Fc chains are separated by an amino acid linker, e.g., (G n S) m Linkers, e.g., (GGGGS) m The linker is linked via a linker comprising a linker.
[0234] In some embodiments, the Fc polypeptide comprises an IgG1 Fc chain or an IgG4 Fc chain, hi some embodiments, the Fc polypeptide comprises an IgG4 Fc chain comprising a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof.
[0235] In some embodiments, the IgG4 Fc chain is
[0236] 1)S228P, F234A and L235A
[0237] 2) S228P, F234A, L235A, G237A and P238S, or
[0238] 3) F234A, L235A, G237A and P238S The set of mutations includes a set of mutations selected from the group consisting of:
[0239] In one aspect, a self-assembled polypeptide complex is provided, comprising:
[0240] (a) a plurality of first fusion polypeptides, each first fusion polypeptide comprising a first sarbecovirus antibody or a sarbecovirus-binding fragment thereof linked to a ferritin monomer or a subunit thereof;
[0241] (b) a plurality of second fusion polypeptides, each second fusion polypeptide comprising a second sarbecovirus antibody or sarbecovirus-binding fragment thereof linked to a ferritin monomer or subunit thereof;
[0242] (c) a plurality of third fusion polypeptides, each third fusion polypeptide comprising a third sarbecovirus antibody or sarbecovirus-binding fragment thereof linked to a ferritin monomer or subunit thereof; and
[0243] (d) a plurality of Fc-containing fusion polypeptides, each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a ferritin monomer or subunit thereof;
[0244] wherein the first, second, and third sarbecovirus antibodies or sarbecovirus-binding fragments thereof are distinct from one another, and at least the first and second sarbecovirus antibodies are capable of neutralizing SARS-CoV and SARS-CoV-2.
[0245] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing the SARS-CoV-2 virus.
[0246] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing omicron variants of the SARS-CoV-2 virus, e.g., two or more omicron variants, or three or more omicron variants, hi some embodiments, the omicron variants are selected from the group consisting of BA.1, BA.2, BA.5, XBB.1, and BQ.1.1.
[0247] In some embodiments, the self-assembled polypeptide complex has an IC of, for example, 0.01 μg / mL or less. 50and is capable of neutralizing the BA.1 variant of the SARS-CoV-2 virus.
[0248] In some embodiments, the self-assembled polypeptide complex has an IC of, for example, 0.02 μg / mL or less. 50 and is capable of neutralizing the BA.2 variant of the SARS-CoV-2 virus.
[0249] In some embodiments, the self-assembled polypeptide complex has an IC of, for example, less than 0.001 μg / mL. 50 and is capable of neutralizing the BA.5 variant of the SARS-CoV-2 virus.
[0250] In some embodiments, the self-assembled polypeptide complex has an IC of, for example, 0.5 μg / mL or less. 50 values, and is capable of neutralizing the BQ.1.1 variant of the SARS-CoV-2 virus.
[0251] In some embodiments, the self-assembled polypeptide complex has an IC of, for example, 0.5 μg / mL or less, or 0.1 μg / mL or less. 50 values and are capable of neutralizing the XBB.1 variant of the SARS-CoV-2 virus.
[0252] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing WT SARS-CoV-2 and at least one or a combination of alpha, beta, gamma, delta, and omicron variants of SARS-CoV-2.
[0253] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing WT SARS-CoV-2 and the alpha, beta, gamma, delta, and omicron variants of SARS-CoV-2.
[0254] In some embodiments, the self-assembled polypeptide complex has an IC of 0.01 μg / mL or less. 50 It is possible to neutralize WT SARS-CoV-2 and each of the alpha, beta, gamma, delta, and omicron variants of SARS-CoV-2 at these values.
[0255] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing at least one sarbecovirus other than SARS-CoV-2, for example, a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyra11, Rs7327, Rs4231, Rs4084, and combinations thereof.
[0256] In some embodiments, the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
[0257] In another aspect, there is provided a pharmaceutical composition comprising a self-assembled polypeptide complex disclosed herein and a pharmaceutically acceptable excipient.
[0258] In yet another aspect, methods are provided for treating and / or preventing a sarbecovirus infection and / or a sarbecovirus-associated condition, comprising administering a self-assembled polypeptide complex disclosed herein or a pharmaceutical composition disclosed herein to a subject in need thereof.
[0259] In some embodiments, the subject is a mammal, for example, a human.
[0260] In some embodiments, the administering step comprises systemic administration, for example, by routes such as intranasal, intravascular, or intramuscular administration.
[0261] In one aspect, there is provided a use of a self-assembled polypeptide complex disclosed herein or a pharmaceutical composition disclosed herein for treating and / or preventing a sarbecovirus infection and / or a sarbecovirus-associated condition.
[0262] In one aspect, provided is a self-assembled polypeptide complex or pharmaceutical composition disclosed herein for use in treating and / or preventing a sarbecovirus infection and / or a sarbecovirus-associated condition.
[0263] In some embodiments, the sarbecovirus infection is a SARS-CoV-2 infection, or the sarbecovirus-associated condition is a SARS-CoV-2-associated condition.
[0264] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief explanation of the drawings]
[0265] [Figure 1A] Figures 1A-1C show a series of plots demonstrating the potency and breadth of anti-SARS-CoV-2 neutralizing maltabodies (MBs). IgG neutralization potency (left panel) and breadth against a panel of six PsVs using a cutoff IC50 value of 5 μg / mL (light gray bars in the right panel) or 0.01 μg / mL (dark gray bars in the right panel) (Figure 1A). Heatmap showing the neutralization potency of monospecific MBs showing Fab specificity from (Figure 1A) against each PsV variant in the panel (Figure 1B). Individual IC50 values are shown. Neutralization potency and breadth of monospecific MBs similar to (A). PsV panel: WT, alpha, beta, gamma, delta, and omicron BA.1 (Figure 1C). Data from three biological replicates are shown, and bars indicate the mean. [Figure 1B] Same as above. [Figure 1C] Same as above.
[0266] [Figure 2A] 2A-22VV show the SARS-CoV-2 WT (Fig. 2A, 2G, 2M, 2S, 2Y, 2EE, 2KK, 2QQ), alpha (Fig. 2B, 2H, 2N, 2T, 2Z, 2FF, 2LL, 2RR), beta (Fig. 2C, 2I, 2O, 2U, 2AA, 2GG, 2MM, 2SS), gamma (Fig. 2D, 2J, 2P, 2V, 2BB, 2HH, 2NN, 2TT), delta (Fig. 2E, 2K, 2Q, 2W, 2CC, 2II, 2OO, 2UU) and omicron (Fig. 2F, 2L, 2R, 2X ... A series of neutralization curves are shown for mAbs including 298 (Figures 2A-2F), 52 (Figures 2G-2L), 80 (Figures 2M-2R), 2-7 (Figures 2S-2X), 2-36 (Figures 2Y-2DD), 2-38 (Figures 2EE-2JJ), 10-40 (Figures 2KK-2PP), and 11-11 (Figures 2QQ-2VV) and corresponding receptor-binding domain (RBD)-directed IgGs against the pseudoviruses (PsVs) 2DD, 2JJ, 2PP, and 2VV. The mean values ± SD for two technical replicates are shown in each plot. The mean IC50 values from three biological replicates are shown. [Figure 2B] Same as above. [Figure 2C] Same as above. [Figure 2D] Same as above. [Figure 2E] Same as above. [Figure 2F] Same as above. [Figure 2G] Same as above. [Figure 2H] Same as above. [Figure 2I] Same as above. [Figure 2J] Same as above. [Figure 2K] Same as above. [Figure 2L] Same as above. [Figure 2M] Same as above. [Figure 2N] Same as above. [Figure 2O] Same as above. [Figure 2P] Same as above. [Figure 2Q] Same as above. [Figure 2R] Same as above. [Figure 2S] Same as above. [Figure 2T] Same as above. [Figure 2U] Same as above. [Figure 2V] Same as above. [Figure 2W] Same as above. [Figure 2X] Same as above. [Figure 2Y] Same as above. [Figure 2Z] Same as above. [Figure 2AA] Same as above. [Figure 2BB] Same as above. [Figure 2CC] Same as above. [Figure 2DD] Same as above. [Figure 2EE] Same as above. [Figure 2FF] Same as above. [Figure 2GG] Same as above. [Figure 2HH] Same as above. [Figure 2II] Same as above. [Figure 2JJ] Same as above. [Figure 2KK] Same as above. [Figure 2LL] Same as above. [Figure 2MM] Same as above. [Figure 2NN] Same as above. [Figure 2OO] Same as above. [Figure 2PP] Same as above. [Figure 2QQ] Same as above. [Figure 2RR] Same as above. [Figure 2SS] Same as above. [Figure 2TT] Same as above. [Figure 2UU] Same as above. [Figure 2VV] Same as above.
[0267] [Figure 3A]Figures 3A-3D show a series of plots demonstrating the potent and broad-spectrum neutralization of sarbecoviruses by the trispecific MBs of the present disclosure. PsV virus neutralization by 2-7 IgG (solid line) and MB (dashed line) against WT (light gray) and Omicron (BA.1, dark gray) (Figure 3A). The mean ± SD for two technical replicates is shown in each neutralization plot. Neutralization potency (gray bars) and breadth of the 2-7-10-40-11-11 trispecific MB against SARS-CoV-2 PsV and six VOCS (Figure 3B). *Dashed line indicates the IC50 of the REGN IgG mix against WT SARS-CoV-2 PsV. Phylogenetic tree with branch lengths indicating branching (Figure 3C). Heatmap showing the neutralization potency of the 2-7-10-40-11-11 trispecific MB and its corresponding monospecific MBs against Omicron (BA.2) live virus and three SARS-CoV-1-related bat coronaviruses (LYRa11, Rs4084, and Rs7327). Individual IC50 values are shown. Bar graph (Figure 3D) showing the percentage of accessible surface area on the RBD (light gray) covered by the trispecific MB (2-7-10-40-11-11) and its respective components 2-7 (PDB ID: 7LSS), 10-40 (PDB ID: 7SD5), and 11-11 (EMD: 25167). Mutations found in the SARS-CoV-2 VOCs (alpha, beta, gamma, delta, and Omicron (BA.1, BA.2)) that are part of each antibody-binding interface are shown in dark gray. [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above.
[0268] [Figure 4A]Figures 4A-4E are a series of plots showing broad-spectrum SARS-CoV-2 and sarbecovirus neutralization by the trispecific MBs of the present disclosure. PsV neutralization of the 2-7-10-40-11-11 trispecific MB against SARS-CoV-2 wild-type, alpha, beta, gamma, delta, Omicron BA.1, and Omicron BA.5 (Figure 4A). The mean ± SEM for three biological replicates is shown in each neutralization plot. Live virus neutralization of the 2-7-10-40-11-11 trispecific MB and the 2-7, 10-40, and 11-11 monospecific MBs against Omicron (BA.2) authentic virus (Figure 4B). The mean ± SD for two technical replicates is shown in each neutralization plot. PsV neutralization of 2-7-10-40-11-11 trispecific MBs and 2-7, 10-40, and 11-11 monospecific MBs against Rs4084, Rs7327, and LYRa11 SARS-CoV-1-related bat coronaviruses (Figures 4C–4E, respectively). [Figure 4B] Same as above. [Figure 4C] Same as above. [Figure 4D] Same as above. [Figure 4E] Same as above.
[0269] [Figure 5A] Figures 5A and 5B show a schematic representation of the elements that drive the assembly of a trispecific MB, e.g., 298-52-80 MB ("T10 MB"). Figure 5A shows a 3D schematic of the MB quaternary structure. The red arrow indicates the split site between the first half (N-Ferr) and the second half (C-Ferr) of the human apoferritin light chain. Figure 5B shows a simplified schematic of the fusion proteins that self-assemble into the trispecific MB of the present disclosure. [Figure 5B] Same as above.
[0270] [Figure 6]Figure 6 shows a plot of the neutralization potency of 289-52-80 MB* ("T10 MB*") and the corresponding IgG1 and IgG4 cocktails. * indicates the use of IgG4*Fc carrying the specified mutations (S228P, F234A, L235A, G237A, P238S) to eliminate Fcγ receptor binding. Shown are the mean values ± SD for at least three independent experiments.
[0271] [Figure 7A] Figure 7A shows the sensorgrams of samples of cocktail IgG1, cocktail IgG4*, or T10 M* binding to human and mouse FcRn (association at pH 5.6, dissociation at pH 7.4). The red line shows the raw data, and the black line shows the global fit. Representative data from at least three independent experiments are shown.
[0272] [Figure 7B] Figure 7B shows the binding (apparent KD) of cocktail IgG1, cocktail IgG4*, and T10 MB* particles to human (FcγRI, IIa, IIb, and FcRn) and mouse (FcγRI, IIb, IV, and FcRn) receptors. NB and LOD indicate no binding and limit of detection, respectively. Mean values ± SD for at least three independent experiments are shown.
[0273] [Figure 7C] Figures 7C and 7D show sensorgrams of T10 MB* and cocktail IgG1 and IgG4* binding to human (Figure 7C) and mouse (Figure 7D) Fc receptors. * indicates use of IgG4* Fc bearing identified mutations (PAAAS; see Example 3) to eliminate Fcγ receptor binding. Red lines show raw data, and black lines show global fits. Representative data from 2-3 independent experiments are shown. [Figure 7D] Same as above.
[0274] [Figure 7E]Figures 7E-7H show flow cytometry plots illustrating the gating strategy followed in the antibody-dependent cellular phagocytosis (ADCP) assay. THP-1 cells were gated by size and viability, and cells positive for internalization of SARS-CoV-2 spike-coated fluorescent beads were quantified as a percentage of viable THP-1 cells. [Figure 7F] Same as above. [Figure 7G] Same as above. [Figure 7H] Same as above.
[0275] [Figure 7I] Figure 7I shows a bar graph depicting % internalization (ADCP shown) determined as the percentage of THP-1 cells with internalized SARS-CoV-2 spike-coated fluorescent microspheres. Mean values ± SD for at least three independent experiments are shown. *** indicates significance (p<0.001) compared to no-antibody control by ANOVA.
[0276] [Figure 8A-B]Figures 8A-8G show results from an in vivo challenge experiment (see Example 3). Figure 8A shows survival over a 12-day period post-challenge. ****p<0.0001, **p<0.01, *p<0.05 by Gehan Breslow Wilcoxon test. Figure 8B shows lung virus titers at the end of the experiment (open symbols) or at the time of death for animals that died (filled symbols), as measured by viral growth assay. TCID50 per gram of tissue is shown. ****p<0.0001, **p<0.01, Kruskall Wallis test. Figures 8C and 8D show disease scores and weight loss, respectively, over a 12-day period post-challenge. For Figures 8A-8D, n=33 for T10 MB*, n=30 for control IgG, and n=10 for cocktail IgG4* from two to six independent experiments. Figure 8E shows SARS-CoV-2 genome copy numbers quantified by qPCR from oropharyngeal swab samples collected on D-1 (pre-challenge) and D2 post-challenge following intranasal SARS-CoV-2 administration.
[0277] [Figure 8C-E] Same as above.
[0278] [Figure 8F-G] Survival (Figure 8F) and day 2 serum IgG or MB concentrations (Figure 8G) after administration of low-dose trispecific MB* (3 μg [1.4 pmol]; 0.15 mg / kg) compared with high-dose (90 μg [600 pmol]; 4.5 mg / kg) cocktail IgG4*. In Figure 8G: ****p<0.001 compared with all other groups by ANOVA. For Figures 8F and 8G, n=24 for T10 MB*, n=10 for cocktail IgG4* mix and control IgG, from two to five independent experiments.
[0279] [Figure 9]Figures 9A-9B show composite omit map electron density stereo images of the 80 Fab-RBD interaction sites. Figure 9A shows maps for heavy chain complementarity-determining regions (HCDRs) 2 and 3 (light and dark green, respectively) and the RBD (gray). Figure 9B shows maps for kappa light chain CDR (KCDR) 3 (orange) and the RBD (gray).
[0280] [Figure 10A] Figure 10A shows the three-dimensional structure of the 80 Fab-RBD complex. The heavy and light chains of 80 Fab are colored dark and light purple, respectively. The RBD is shown as a surface representation (gray), and the ACE2 footprint is shown in salmon.
[0281] [Figure 10B] Figure 10B shows the binding interactions within the 80 Fab-RBD complex. Binding to the RBD (gray) involves interactions mediated by heavy chain complementarity-determining regions (HCDRs) 2 and 3 (light and dark green, respectively) and kappa light chain CDRs (KCDRs) 2 and 3 (yellow and orange).
[0282] [Figure 10C] Figure 10C shows a detailed view of the hydrogen bond network (dashed lines) formed between key residues in the binding interface of the 80-RBD complex.
[0283] [Figure 10D] Figure 10D shows a detailed view of the interactions between RBD residues upon binding to antibody 80. Rearrangement of RBD aromatic residues (gray) to form a pi-stacking interaction network (shown by dashed cyan lines) upon 80 binding (green). Left panel: unbound RBD, and right panel: 80-RBD complex.
[0284] [Figure 10E]Figure 10E is a schematic representation of the secondary structure of the RBD, with the mutated residues in the different variants of concern highlighted as red spheres. Inset: Close-up view of the RBD area recognized by 80. Residues important for binding are colored pink according to their buried surface area (BSA). Mutated residues in the VOC are shown in red in the BSA plot.
[0285] [Figure 10F] Figure 10F. Molecular modeling shows the possible conformations adopted by the side chains of mutated residues T478K and S477N upon binding of 80. Hydrogen bonds are shown as dashed black lines.
[0286] [Figure 11A] Figure 11A shows sensorgrams of 80 Fab, IgG, and MB binding to WT and Omicron BA.1 RBD. The red line shows the raw data, and the black line shows the global fit.
[0287] [Figure 11B] Figure 11B shows the binding kinetic parameters (KD, k, and k) of 80 as Fab, IgG, and MB for binding to WT and Omicron BA.1 RBD. Data shown are the average from two independent experiments.
[0288] [Figure 11C] Figure 11C is a plot of percentage of authentic virus neutralization versus concentration for 80 IgG and MB against wild-type and Omicron BA.2, shown in gray and red, respectively. The mean ± SD for two technical replicates is shown in each neutralization plot.
[0289] [Figure 12A]Figures 12A-12M relate to experiments analyzing a trispecific MB (298-52-80; "T10 MB") by cryo-electron microscopy (cryoEM). Figure 12A illustrates the processing workflow for the cryoEM data. Figure 12B shows a representative cryoEM micrograph of a trispecific MB; the white circle highlights the whole particle, while the pink and green circles highlight the scFab and scFc fragments, respectively. Figure 12C illustrates representative 2D classes of the scFab (top panel), trispecific MB (middle panel), and Fc domain (bottom panel). Figure 12D illustrates a 3D reconstruction of the components of a maltabody of the present disclosure. The images on the left are cryoEM maps of the scFab (top) at 6.7 Å resolution, the apoferritin nanocage scaffold (middle) at 2.4 Å resolution, and the scFc (bottom) at 7.1 Å resolution. The image on the right shows the fitting of a human apoferritin light chain model (PDB ID: 6WX6) to a 2.4 Å map, focusing on features such as the N-terminus of the apoferritin scaffold (top), which shows weak density beyond Ser5 due to linker flexibility; the four-fold axis formed by four adjacent subunits (center); and residues 87–109 of the human apoferritin light chain (bottom; red arrows indicate the split site between residues Trp93 and Gly94 in some subunits). All cryoEM maps were refined without applying symmetry. The scale bar is 10 nm. Figure 12E shows a representative cryoEM micrograph with Fab and Fc molecules highlighted by white circles. The scale bar is 50 nm. Figure 12F shows a representative 2D class average of the Fab. Figure 12G shows the atomic model of Fab 298 (PDB ID: 7K9Z) fitted to the Fab cryoEM map. Figure 12H shows the gold standard Fourier shell correlation (GSFSC) curve of the final 3D non-uniform refinement of Fab in cryoSPARC v3. Figure 12I shows the view direction distribution of Fab data. Figure 12J shows selected 2D class means of Fc.Figure 12K shows the atomic model of human IgG1 Fc (PDB ID: 6CJX) fitted to the cryoEM map of Fc. Figure 12L shows the GSFSC curve of the final 3D non-uniform refinement of Fc in cryoSPARC v3. Figure 12M shows the view direction distribution of Fc data. [Figure 12B] Same as above. [Figure 12C] Same as above. [Figure 12D] Same as above. [Figure 12E] Same as above. [Figure 12F] Same as above. [Figure 12G] Same as above. [Figure 12H] Same as above. [Figure 12I] Same as above. [Figure 12J] Same as above. [Figure 12K] Same as above. [Figure 12L] Same as above. [Figure 12M] Same as above.
[0290] [Figure 13A]Figures 13A-13I relate to experiments analyzing trispecific MB (298-52-80) by cryoEM. Figure 13A shows a representative cryoEM micrograph of a trispecific MB particle (highlighted by a white circle). The scale bar is 50 nm. Figure 13B shows selected 2D class averages of trispecific MB particles. Figure 13C shows a comparison of trispecific MB (298-52-80) cryoEM reconstructions at two threshold levels (upper - 0.7 and lower - 2.0), revealing weak fragmentation density for antibody fragments fused to the apoferritin scaffold. Figure 13D shows the gold standard Fourier shell correlation (GSFSC) curve of the final 3D nonuniform refinement of the trispecific MB in cryoSPARC v3 without imposing symmetry. Figure 13E shows the view direction distribution of the trispecific MB dataset refined without imposing symmetry. Figure 13F shows the GSFSC curve of the final 3D non-uniform refinement of the trispecific MB in cryoSPARC v3 with imposed octahedral symmetry. Figure 13G shows the view distribution of the trispecific MB dataset refined with imposed octahedral symmetry. Figures 13H and 13I show details of the atomic model of the human apoferritin light chain (PDB ID: 6WX6) fitted to the trispecific MB (298-52-80) map refined with imposed octahedral symmetry. The cryoEM density of the trispecific MB is shown as a black mesh, and models of neighboring apoferritin protomers are shown as white, gray, or black bars. [Figure 13B] Same as above. [Figure 13C] Same as above. [Figure 13D] Same as above. [Figure 13E] Same as above. [Figure 13F] Same as above. [Figure 13G] Same as above. [Figure 13H] Same as above. [Figure 13I] Same as above.
[0291] [Figure 14A]Figures 14A-14F relate to experiments analyzing the molecular basis for 2-7 RBD recognition and the tolerance of MBs to mutations. Figure 14A shows plots of the neutralization potency of 2-7 and 80 monospecific MBs (red bars) and the corresponding IgG (blue bars) against Omicron BA.5. Figures 14B and 14C are structural representations showing commonly mutated residues in variants of concern (VOCs) (shown as red spheres on the WT RBD (gray)). The inset image shows a surface representation of the RBD, with the footprint of 2-7 (PDB ID: 7LSS) colored according to its BSA. Mutated residues in the VOC that fall into the antibody footprint are annotated. Right panel - Graphical representation of the buried surface area (BSA) of residues involved in RBD binding. Residues colored red are mutated in the VOC. Figure 14D is a schematic representation of molecular modeling of the N440K mutation in the RBD-2-7 complex, showing sufficient space to accommodate the mutated side chain. Hydrogen bonds and van der Waals interactions are indicated by black and red dashed lines, respectively. Figure 14E shows sensorgrams of 2-7 IgG and MB binding to WT and Omicron BA.1 RBD. The red line shows the raw data, and the black line shows the global fit. Figure 14F shows a comparison of the binding kinetic parameters of 2-7 as an IgG and MB for binding to WT and Omicron BA.1 RBD. Data shown are averages from two independent experiments. [Figure 14B] Same as above. [Figure 14C] Same as above. [Figure 14D] Same as above. [Figure 14E] Same as above. [Figure 14F] Same as above.
[0292] [Figure 15A]Figures 15A and 15B relate to experiments analyzing the neutralization of SARS-CoV-2 subvariants XBB.1 and BQ.1.1 by a trispecific MB (2-7-10-40-11-11). Figure 15A is a plot showing PsV neutralization of the 2-7-10-40-11-11 trispecific MB and the corresponding IgG cocktail, shown in red and blue, against the Omicron subvariants XBB.1 and BQ.1.1, respectively. The mean ± SD for two technical replicates is shown in each neutralization plot. Figure 15B, left panel, is a plot showing the neutralization potency of the 2-7-10-40-11-11 trispecific MB (red bars) and the corresponding IgG cocktail (blue bars) against the Omicron subvariants XBB.1 and BQ.1.1. The shaded gray indicates the IC50 of sotrovimab and REGN IgG mix against WT SARS-CoV-2 PsV. Figure 15B, right panel, is a molecular representation of the percentage of accessible surface area on the RBD (gray) covered by the trispecific MB (green). Mutations found in the SARS-CoV-2 VOCs (alpha, beta, gamma, delta, omicron (BA.1, BA.2)) that are part of each antibody-binding interface are shown in red. Additional mutations specific to the XBB.1 and BQ.1.1 omicron subvariants are shown in orange. [Figure 15B] Same as above.
[0293] [Figure 16] Figure 16 is a bar graph showing the lack of binding of trispecific MB 298-52-80 to autoantigens in a polyreactive assay. Binding of trispecific 298-52-80 MB and its corresponding subcomponent IgGs to cardiolipin (blue), insulin (green), dsDNA (red), and KLH (orange) is shown. Polyreactive IgG 4E10 against the HIV envelope was used as a positive control. DETAILED DESCRIPTION OF THE INVENTION
[0294] Detailed Description of Certain Embodiments of the Invention definition The terms "about" and "approximately," when used herein in reference to a value, are used interchangeably and refer to values similar to the referenced value. Generally, a person skilled in the art familiar with the context will understand the appropriate degree of variation encompassed by "about" or "approximately" in that context. For example, in some embodiments, the terms "about" and "approximately" can encompass a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the referenced value.
[0295] As used herein, the terms "alter," "altered," "decreasing," "reduced," "increasing," or "reduced" (e.g., with respect to a particular outcome or effect) have a meaning relative to a reference level. In some embodiments, in the context of discussing mutations in an Fc chain or Fc polypeptide, the reference level is a known level or a level determined using an IgG that does not contain the referenced mutation(s) in the Fc region.
[0296] As used herein, the term "binding" refers to a non-covalent association between two or more entities, unless otherwise specified. "Direct" binding involves physical contact between entities or moieties; indirect binding involves physical interaction through physical contact with one or more intermediate entities. Binding between two or more entities can typically be assessed in any of a variety of contexts, including when the interacting entities or moieties are studied separately or in the context of a more complex system (e.g., covalently or otherwise associated with a carrier entity and / or in a biological system or cell). As used herein, the phrase "unbound" or "no binding" between two entities or similar phrases refers to 1) the absence of detectable binding, or 2) binding below a set threshold corresponding to no binding in an appropriate assay, such as an in vitro binding assay, e.g., biolayer interferometry. For example, in some embodiments, in an in vitro biolayer interferometry assay, a maximum association binding response of less than 0.1 nm after 180 seconds to a biosensor loaded with 0.8 nm target when the test article is present at a concentration of 20 nM is classified as "unbound."
[0297] The terms "ferritin" and "apoferritin" are used interchangeably herein and generally refer to a polypeptide (e.g., a ferritin chain) that can be assembled into a ferritin complex, which typically contains 24 protein subunits. In some embodiments, the ferritin is human ferritin, e.g., a human ferritin light chain, e.g., a human ferritin light chain having at least 85% sequence identity to SEQ ID NO: 1 or UniProt P02792. In some embodiments, the ferritin is wild-type ferritin. For example, the ferritin can be wild-type human ferritin.
[0298] The term "ferritin monomer" is used herein to refer to a single chain of ferritin that is capable of self-assembling in the presence of other ferritin chains into a polypeptide complex containing multiple ferritin chains, e.g., 24 or more ferritin chains.
[0299] As used herein, the term "linker" is used to refer to an entity that connects two or more elements to form a multi-element factor. For example, those skilled in the art will understand that polypeptides whose structure includes two or more functional or organizational domains (e.g., fusion polypeptides) often include a stretch of amino acids between such domains that connects them to one another. In some embodiments, polypeptides that include linker elements have an overall structure of the general form S1-L-S2, where S1 and S2 can be the same or different and represent two domains connected to one another by a linker (L). In some embodiments, the linker is an "amino acid linker," i.e., it comprises amino acid residues, e.g., the amino acid linker can comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more amino acid residues. In some embodiments, the linker is characterized in that it does not tend to adopt a rigid three-dimensional structure, but rather provides flexibility to the polypeptide.
[0300] The term "multispecificity," as used herein, refers to the characteristic of having at least two binding sites to which at least two different binding partners, e.g., antigens or receptors (e.g., Fc receptors), can bind. For example, a polypeptide complex comprising at least two Fab fragments, each capable of binding to a different antigen, is "multispecific." As a further example, a polypeptide complex comprising an Fc fragment (which is capable of binding to an Fc receptor) and a Fab fragment (which is capable of binding to an antigen) is "multispecific."
[0301] The term "multivalent," as used herein, refers to the characteristic of having at least two binding sites to which a binding partner, e.g., an antigen or receptor (e.g., an Fc receptor), can bind. The binding partners capable of binding to the at least two binding sites can be the same or different.
[0302] The term "nanocage monomer," as used herein, refers to a single chain of a polypeptide that can self-assemble with other nanocage monomers to form a self-assembled polypeptide complex comprising multiple nanocage monomers. In some embodiments, the nanocage monomer is selected from monomers of ferritin, apoferritin, encapsulin, sulfur oxygenase reductase (SOR), lumazine synthase, pyruvate dehydrogenase, carboxysome, vault protein, GroEL, heat shock proteins, E2P coat protein, MS2 coat protein, fragments thereof, and variants thereof.
[0303] The term "polypeptide," as used herein, generally has its art-recognized meaning: a polymer of at least three amino acids linked together by, for example, peptide bonds. Those of skill in the art will understand that the term "polypeptide" is intended to encompass not only polypeptides having the complete sequences recited herein, but also polypeptides representing functional fragments of such complete polypeptides (i.e., fragments that retain at least one activity). Furthermore, those of skill in the art will understand that protein sequences generally tolerate some substitutions that do not destroy activity. Thus, any polypeptide that retains activity and shares at least about 30-40% overall sequence identity, often greater than about 50%, 60%, 70%, or 80%, and more usually much higher identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99%, with another polypeptide of the same class in one or more highly conserved regions, usually encompassing at least 3-4 and often up to 20 or more amino acids, is encompassed within the related term "polypeptide" as used herein. Polypeptides may contain L-amino acids, D-amino acids, or both, and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, glycosylation, and the like. In some embodiments, proteins may contain natural amino acids, unnatural amino acids, synthetic amino acids, and combinations thereof.
[0304] The term "self-assembled," when used in reference to a macromolecular complex (e.g., a polypeptide complex), refers to the spontaneous formation of a complex (e.g., a fusion polypeptide) when sufficient of its components are present for the complex to form. In some embodiments, the complex self-assembles in physiological conditions or in a buffer (e.g., a solution) that corresponds to physiological conditions.
[0305] As used herein, the term "subject" refers to an organism, typically a mammal (e.g., a human). In some embodiments, the subject is suffering from or susceptible to the relevant disease, disorder, or condition. In some embodiments, the subject exhibits one or more symptoms or characteristics of the disease, disorder, or condition. In some embodiments, the subject is one who has one or more features that characterize a susceptibility to or risk for the disease, disorder, or condition. In some embodiments, the subject is a patient. In some embodiments, the subject is one to whom and / or to whom a diagnosis and / or treatment is administered.
[0306] As used herein, the term "treatment" (also "treat" or "treating") refers to any administration of a therapy that partially or completely alleviates, ameliorates, relieves, inhibits, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms, features, and / or causes of a particular disease, disorder, and / or condition. In some embodiments, such treatment may be treatment of subjects who do not exhibit signs of the associated disease, disorder, and / or condition and / or subjects who exhibit only early signs of the disease, disorder, and / or condition. Alternatively, or in addition, such treatment may be treatment of subjects who exhibit one or more established signs of the associated disease, disorder, and / or condition. In some embodiments, treatment may be treatment of subjects who have been diagnosed with the associated disease, disorder, and / or condition. In some embodiments, treatment may be treatment of subjects known to have one or more susceptibility factors that statistically correlate with an increased risk of developing the associated disease, disorder, and / or condition. A. Fusion Polypeptides
[0307] In many embodiments, fusion polypeptides compatible with the compositions and methods disclosed herein generally comprise a nanocage monomer or subunit thereof linked to either (1) a sarbecovirus antibody or sarbecovirus-binding antibody fragment or (2) an Fc polypeptide. Within the fusion polypeptide, the sarbecovirus antibody, sarbecovirus-binding antibody fragment, or Fc polypeptide can be linked to the nanocage monomer or subunit thereof at a specific terminus, e.g., the N-terminus or C-terminus, of the nanocage monomer or subunit. In some embodiments, the sarbecovirus antibody, sarbecovirus-binding antibody fragment, or Fc polypeptide is linked to the nanocage monomer or subunit thereof via an amino acid linker, e.g., a linker described herein. 1. Nanocage Monomer and Its Subunits
[0308] In some embodiments, the nanocage monomer is a ferritin monomer.
[0309] The term "ferritin monomer" is used herein to refer to a single chain of ferritin that can self-assemble into a polypeptide complex containing multiple ferritin chains, e.g., 24 or more ferritin chains, in the presence of other ferritin chains. In some embodiments, the ferritin monomer is a ferritin light chain. In some embodiments, the ferritin monomer does not contain a ferritin heavy chain or other ferritin components capable of iron binding or ferroxidase activity.
[0310] In some embodiments, each fusion polypeptide in the self-assembled polypeptide complex comprises a ferritin light chain or a subunit of a ferritin light chain, and in these embodiments, the self-assembled polypeptide complex does not comprise any ferritin heavy chain or subunit of a ferritin heavy chain.
[0311] In some embodiments, the ferritin monomer is a human ferritin chain, eg, a human ferritin light chain, eg, a human ferritin light chain having the sequence of at least residues 2-175 of SEQ ID NO:1.
[0312] A "subunit" of a ferritin monomer refers to a portion of a ferritin monomer that can spontaneously associate with another separate subunit of the ferritin monomer, such that these subunits come together to form a ferritin monomer, which can then self-assemble with other ferritin monomers to form a polypeptide complex.
[0313] In some embodiments, a ferritin monomer subunit comprises approximately half of a ferritin monomer. As used herein, the term "N-half ferritin" refers to approximately half of a ferritin chain, including the N-terminus of the ferritin chain. As used herein, the term "C-half ferritin" refers to approximately half of a ferritin chain, including the C-terminus of the ferritin chain. The exact point at which a ferritin chain can be split to form N-half ferritin and C-half ferritin can vary depending on the embodiment. In the context of a ferritin monomer subunit based on the human ferritin light chain, for example, these halves can be split at a point corresponding to between about 75 and about 100 of SEQ ID NO: 1 (or a substantial portion thereof). For example, in some embodiments, an N-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 1-95 of SEQ ID NO:1 (or a substantial portion thereof, e.g., residues 2-95 of SEQ ID NO:1), and a C-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 96-175 of SEQ ID NO:1 (or a substantial portion thereof).
[0314] In some embodiments, the halves are split at a point corresponding to between about positions 85 and about 92 of SEQ ID NO: 1. For example, in some embodiments, the N-half ferritin based on the human ferritin light chain has an amino acid sequence corresponding to residues 1-90 of SEQ ID NO: 1 (or a substantial portion thereof, e.g., residues 2-90 of SEQ ID NO: 1), and the C-half ferritin based on the human ferritin light chain has an amino acid sequence corresponding to residues 91-175 of SEQ ID NO: 1 (or a substantial portion thereof). 2. Fc polypeptide
[0315] Immunoglobulin molecules typically contain a fragment crystallizable (Fc) region composed of two chains, each part of an immunoglobulin heavy chain. In particular, each chain (hereinafter "Fc chain") contains a constant heavy 2 (CH2) region and a constant heavy 3 (CH3) region.
[0316] Fc polypeptides suitable for use in the present invention generally comprise one or more Fc chains. In some embodiments, the Fc chain is, for example, a wild-type Fc chain having the same amino acid sequence as the Fc portion of a wild-type immunoglobulin molecule (e.g., IgG1 or IgG4). In some embodiments, the Fc chain has one or more mutations compared to a reference Fc chain of the same Ig class. As further exemplified herein below, the reference Fc chain may be, for example, of the IgG1 or IgG4 class.
[0317] Unless otherwise specified, the numbering of residues within antibody fragments, e.g., the Fc chain, is according to EU numbering throughout this disclosure.
[0318] In some embodiments, the Fc polypeptide comprises one or more human IgG1 Fc chains; i.e., except for any mutations noted herein, the Fc polypeptide comprises an Fc chain substantially similar to that of an Fc chain in wild-type human IgG1.
[0319] In some embodiments, the Fc polypeptide comprises one or more human IgG4 Fc chains; i.e., except for any mutations noted herein, the Fc polypeptide comprises an Fc chain substantially similar to that of an Fc chain in wild-type human IgG4.
[0320] In some embodiments, the wild-type IgG1 Fc is a human IgG1 Fc, and each Fc chain has the amino acid sequence of SEQ ID NO: 4. In some embodiments, the wild-type IgG4 Fc is a human IgG4 Fc, and each Fc chain has the amino acid sequence of SEQ ID NO: 6. For example, an Fc polypeptide can comprise an Fc chain having an amino acid sequence at least 85%, at least 87.5%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 4 or SEQ ID NO: 6. In some embodiments, an Fc polypeptide comprises an Fc chain that includes particular residue(s) at certain position(s) specifically described for that Fc chain, but has an amino acid sequence that is otherwise 100% identical to the corresponding Fc chain in a wild-type Fc chain, e.g., a wild-type IgG1 Fc chain or a wild-type IgG4 Fc chain. In some embodiments, the Fc polypeptide comprises an Fc chain having an amino acid sequence that differs by at least one, at least two, at least three, or at least four amino acid residues from the sequence of SEQ ID NO: 4 or from the sequence of SEQ ID NO: 6. In some embodiments, the Fc polypeptide comprises an Fc chain having an amino acid sequence that differs by no more than 10, no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, or no more than 4 amino acid residues from the sequence of SEQ ID NO: 4 or from the sequence of SEQ ID NO: 6.
[0321] In some embodiments, the Fc polypeptide is a single-chain Fc (scFc) comprising two Fc chains linked together by a covalent linker, e.g., via an amino acid linker. A non-limiting example of an scFc using a human IgG1-derived Fc chain and an amino acid linker is shown as SEQ ID NO:5.
[0322] In certain embodiments, the Fc chain comprises an alanine at position 234. In certain embodiments, the Fc chain comprises an alanine at position 235. In some embodiments, the Fc chain comprises an alanine at position 237. In some embodiments, the Fc chain comprises a serine at position 238.
[0323] In some embodiments, the Fc chain is an IgG4 Fc chain and comprises a proline at position 228.
[0324] In some embodiments, the Fc chain is an IgG4 Fc chain and comprises a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof.
[0325] For example, in some embodiments, the Fc chain is an IgG4 Fc chain and comprises one of the following sets of mutations: 1)S228P, F234A and L235A 2) S228P, F234A, L235A, G237A and P238S, or 3) F234A, L235A, G237A and P238S.
[0326] In some embodiments, the Fc chain comprises a mutation or set of mutations (compared to the corresponding wild-type Fc chain) associated with an altered characteristic, as further described herein. "Associated with" means that the mutation or set of mutations has been previously characterized as conferring an altered characteristic (e.g., altered binding to FcRn, altered effector function, etc.) in the context of an antibody, e.g., an IgG antibody. "Altered" means that the characteristic (e.g., binding to an Fc receptor (e.g., Fcγ receptor or FcRn)) is different from that observed without the mutation or set of mutations.
[0327] For example, in some embodiments, the altered characteristic comprises altered binding to an Fc receptor.
[0328] In some embodiments, the altered characteristic comprises altered binding to an Fcγ receptor, e.g., a human FcγR. In some embodiments, the FcγR is a human FcγR selected from the group consisting of hFcγRI, hFcγRIIa, hFcγRIIb, hFcγRIIIa, hFcγRIIIb, and combinations thereof.
[0329] In some embodiments, altered binding includes no binding or significantly reduced binding in an assay, e.g., an in vitro assay, compared to a corresponding control (e.g., the level of binding typically observed under similar circumstances with the corresponding wild-type strand). 3. Sarbecovirus binding moiety
[0330] A "sarbecovirus binding moiety," as used herein, is a moiety capable of binding to an epitope on at least one sarbecovirus, or, if more than one variant of a given sarbecovirus has been characterized, on at least one variant of the sarbecovirus or at least a wild-type version of the sarbecovirus.
[0331] Examples of sarbecoviruses characterized to date include viruses known to cause human disease, e.g., SARS-CoV and SARS-CoV-2, as well as isolates from animals, e.g., bats and pangolins, e.g., GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyra11, Rs7327, Rs4231, Rs4084, and combinations thereof.
[0332] SARS-CoV-2 variants include, for example, variants designated by public health organizations as variants of concern (VOC), variants of interest (VOI), and variants under surveillance (VBM). Variant designations may change over time, and new variants may arise over time. Examples of SARS-CoV-2 variants characterized to date include alpha lineages (e.g., B.1.1.7 and Q lineages), beta lineages (e.g., B.1.351 and descendant lineages), gamma lineages (e.g., P1 and descendant lineages), delta lineages (e.g., B.1.617.2 and AY lineages), eta lineages (e.g., B.1.525 lineage), iota lineages (e.g., B.1.526 lineage), kappa lineages (e.g., B.1.617.1 lineage), and the like. These include variants of the 1.617.3 lineage, the Mu lineage (e.g., the B.1.621 and B.1.621.1 lineages), the Omicron lineage (e.g., B.1.1.529, BA.1, BA1.1, BA.2, BA.2.75, BA.3, BA.4, BA.5, BQ.1, BQ.1.1, the XBB lineage (e.g., XBB.1), and subvariants (including recombinant variants) of any of the foregoing), and the Zeta lineage (P.2 lineage). As used herein, the term "Omicron variant" refers to the original Omicron variant of SARS-CoV-2 or any progeny or subvariant (including recombinant variants) thereof.
[0333] In some embodiments, the sarbecovirus binding moiety is capable of binding to SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2, e.g., SARS-CoV.
[0334] In some embodiments, the sarbecovirus binding moiety is capable of binding to at least one omicron variant of SARS-CoV-2, such as BA.1, BA.2, BA.5, XBB.1, or BQ.1.1.
[0335] In certain embodiments, the sarbecovirus binding moiety comprises a sarbecovirus antibody (an antibody capable of binding to an epitope on a sarbecovirus) or a sarbecovirus-binding fragment thereof (a fragment capable of binding to an epitope on a sarbecovirus, interchangeably referred to as a "sarbecovirus antibody fragment").
[0336] In some embodiments, the sarbecovirus-binding moiety is an antibody fragment, e.g., a Fab. In some embodiments, the antibody fragment is a single-chain Fab (scFab); for example, a fusion polypeptide is used that includes both the heavy and light chains of a Fab, optionally linked by a linker (e.g., an amino acid linker disclosed herein).
[0337] In certain embodiments, the antibody fragment comprises a heavy chain variable region (e.g., V H In certain embodiments, the antibody fragment comprises a heavy chain variable domain (e.g., V H ) and a light chain variable domain (e.g., V L or V K In certain embodiments, the antibody fragment comprises a heavy chain variable domain (e.g., V H ) and a light chain variable domain (e.g., V L or V K ) containing Fab.
[0338] In certain embodiments, the antibody fragment does not include any domains from the Fc region, e.g., does not include any CH2 or CH3 domains. In certain embodiments, the antibody fragment is or is derived from any of a variety of sarbecovirus antibodies, including, for example, fully human, humanized, or chimeric sarbecovirus antibodies. The sarbecovirus antibody from which the antibody fragment is obtained or derived can be of any of a variety of antibody classes, including, for example, IgG1, IgG2, or IgG4 antibodies.
[0339] In some embodiments, the sarbecovirus antibody or fragment is a neutralizing sarbecovirus antibody, e.g., a neutralizing humanized sarbecovirus antibody, or fragment thereof. In some embodiments, the sarbecovirus antibody has an IC of less than 10 μg / mL, less than 2 μg / mL, or less than 1 μg / mL. 50 In some embodiments, the sarbecovirus antibody is capable of neutralizing SARS-CoV-2, e.g., an IC of less than 10 μg / mL, less than 2 μg / mL, or less than 1 μg / mL. 50 and is capable of neutralizing a sarbecovirus other than SARS-CoV-2 (e.g., SARS-Co-V). In some embodiments, the sarbecovirus binding moiety is capable of neutralizing both SARS-CoV-2 and another sarbecovirus (e.g., SARS-Co-V). Antibody neutralizing capacity can be determined, for example, using an in vitro assay, such as one using a pseudovirus panel, or an in vitro assay using live virus.
[0340] In some embodiments, the sarbecovirus antibody or fragment is capable of inhibiting binding of a sarbecovirus (e.g., SARS-CoV-2 and / or SARS-CoV) to ACE2. In some embodiments, "inhibiting" binding means inhibiting binding by, for example, at most 2-fold, at most 5-fold, at most 10-fold, at most 20-fold, at most 30-fold, at most 40-fold, at most 50-fold, at most 60-fold, at most 70-fold, at most 80-fold, at most 90-fold, at most 100-fold, at most 150-fold, at most 200-fold, at most 250-fold, at most 300-fold, at most 350-fold, This means a reduction of up to 1:400, up to 1:450, up to 1:500, up to 1:550, up to 1:600, up to 1:650, up to 1:700, up to 1:550, up to 1:600, up to 1:650, up to 1:700, up to 1:750, up to 1:800, up to 1:850, up to 1:900, up to 1:950 or up to 1,000.
[0341] Non-limiting examples of sarbecovirus antibodies include, for example, those antibodies set forth in Table 1, below. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12] [Table 1-13] [Table 1-14] [Table 1-15] [Table 1-16] [Table 1-17]
[0342] In some embodiments, the sarbecovirus antibody or sarbecovirus-binding fragment thereof comprises a heavy chain complementarity-determining region 3 (CDR-H3) having a sequence comprising YYDRSGY (SEQ ID NO: 70).
[0343] In some embodiments, the sarbecovirus antibody fragment comprises heavy and light chain CDRs (e.g., each CDR is identical or has one or two amino acid substitutions) having sequences similar to those of the heavy and light chain CDRs of a sarbecovirus antibody (e.g., a sarbecovirus antibody referenced in Table 1).
[0344] In some embodiments, a sarbecovirus antibody fragment comprises heavy and light chain CDRs having sequences identical to those of the heavy and light chain CDRs of a sarbecovirus antibody (e.g., a sarbecovirus antibody referenced in Table 1), except for a total of one, two, or three amino acid substitutions across all six CDRs.
[0345] In some embodiments, a sarbecovirus antibody fragment comprises heavy and light chain complementarity determining regions (CDRs) having the same sequences as the CDRs of a sarbecovirus antibody, for example, a sarbecovirus antibody referenced in Table 1.
[0346] In some embodiments, a sarbecovirus antibody fragment comprises heavy and light chain variable regions (e.g., each V) having sequences similar to those of the heavy and light chain variable regions of a sarbecovirus antibody (e.g., a sarbecovirus antibody referenced in Table 1). H and V L or V K are identical to or have at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity).
[0347] In embodiments in which multiple types of fusion polypeptides with antibody fragments are used (e.g., within the same self-assembled polypeptide complex), the antibody fragments in the various types of fusion polypeptides may be capable of binding to the same epitope on a sarbecovirus, may be capable of binding to distinct, non-overlapping epitopes on a sarbecovirus (e.g., distinct epitopes on the same sarbecovirus and / or distinct epitopes on different sarbecoviruses or different variants of sarbecovirus), or may be capable of binding to distinct but overlapping epitopes on a sarbecovirus. 4. Linker
[0348] In certain embodiments, linkers are used within fusion polypeptides and / or single-chain molecules, e.g., scFcs. In some embodiments, the linker is an amino acid linker. For example, a linker used herein can contain about 1 to about 100 amino acid residues, e.g., about 1 to about 70, about 2 to about 70, about 1 to about 30, or about 2 to about 30 amino acid residues. In some embodiments, the linker contains at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 amino acid residues.
[0349] In certain embodiments, the linker comprises a glycine-serine sequence, e.g., present in at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 copies within the linker (G n S) m sequences (e.g., GGS, GGGS (SEQ ID NO: 55) or GGGGS (SEQ ID NO: 54) sequences). B. Self-assembled polypeptide complex
[0350] In one embodiment, a self-assembled polypeptide complex is provided, comprising a plurality of fusion polypeptides disclosed herein. Generally, the self-assembled polypeptide complex provided comprises: (a) a plurality of first fusion polypeptides, each comprising (1) an Fc polypeptide linked to (2) nanocage monomers or subunits thereof, wherein the Fc polypeptide comprises an Fc chain having one or more mutations compared to a reference Fc chain of the same Ig class; and (b) a plurality of second fusion polypeptides, each comprising (1) an antigen-binding antibody fragment linked to (2) nanocage monomers or subunits thereof.
[0351] In some embodiments, the nanocage monomers are ferritin monomers, and each fusion polypeptide in the self-assembled polypeptide complex comprises a ferritin light chain or a subunit of a ferritin light chain. In these embodiments, the self-assembled polypeptide complex does not comprise any ferritin heavy chains, subunits of a ferritin heavy chain, or other ferritin components capable of binding iron or capable of ferroxidase activity.
[0352] In some embodiments, the nanocage monomers or subunits thereof are ferritin monomer subunits, and (a) each first fusion polypeptide comprises a ferritin monomer subunit that is a C-side half ferritin, and each second fusion polypeptide comprises a ferritin monomer subunit that is an N-side half ferritin; or (b) each first fusion polypeptide comprises a ferritin monomer subunit that is an N-side half ferritin, and each second fusion polypeptide comprises a ferritin monomer subunit that is a C-side half ferritin.
[0353] In some embodiments, the self-assembled polypeptide complex comprises between 24 and 48 total fusion polypeptides. In some embodiments, the self-assembled polypeptide complex comprises 24 total fusion polypeptides. In some embodiments, the self-assembled polypeptide complex comprises more than 24 total fusion polypeptides, for example, at least 26, at least 28, at least 30, at least 32 fusion polypeptides, at least 34 fusion polypeptides, at least 36 fusion polypeptides, at least 38 fusion polypeptides, at least 40 fusion polypeptides, at least 42 fusion polypeptides, at least 44 fusion polypeptides, at least 46 fusion polypeptides, or at least 48 fusion polypeptides. In some embodiments, the self-assembled polypeptide complex comprises about 32 fusion polypeptides.
[0354] In some embodiments, the self-assembled polypeptide complex comprises at least four, at least five, at least six, at least seven, or at least eight first fusion polypeptides.
[0355] In some embodiments, the self-assembled polypeptide complex comprises at least four, at least five, at least six, at least seven, or at least eight second fusion polypeptides.
[0356] In some embodiments, the self-assembled polypeptide complex further comprises at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 third fusion polypeptides.
[0357] In some embodiments, the self-assembled polypeptide complex comprises a ratio of the first fusion polypeptide to all other fusion polypeptides of approximately 1:1, 11:13, 3:5, 1:2, 7:17, 1:3, 2:7, 5:19, 1:4, 1:5, 1:6, 1:7, 1:8, 1:12, 1:24. Efficacy and width
[0358] In certain embodiments, the self-assembled polypeptide complexes provided are capable of neutralizing one or more sarbecoviruses, e.g., SARS-CoV-2.
[0359] In some embodiments, the provided self-assembled polypeptide complexes are capable of neutralizing WT SARS-CoV-2 or at least one variant of SARS-CoV-2 (e.g., the alpha, beta, gamma, delta, and omicron variants of SARS-CoV-2, or a combination thereof). In some embodiments, the provided self-assembled polypeptide complexes are capable of neutralizing both WT SARS-CoV-2 and the alpha, beta, gamma, delta, and omicron variants of SARS-CoV-2.
[0360] In some embodiments, the provided self-assembled polypeptide complexes are capable of neutralizing one or more variants of SARS-CoV-2, e.g., Omicron lineage variants, e.g., BA.1, BA.2, BA.5, XBB.1, and / or BQ.1.1.
[0361] In some embodiments, the provided self-assembled polypeptide complexes are capable of neutralizing one or more sarbecoviruses other than SARS-CoV-2, such as a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyra11, Rs7327, Rs4231, Rs4084, and combinations thereof. In some embodiments, the provided self-assembled polypeptide complexes are capable of neutralizing SARS-CoV, etc.
[0362] In some embodiments, provided self-assembled polypeptide complexes are capable of neutralizing both SARS-CoV-2 and one or more sarbecoviruses other than SARS-CoV-2, e.g., SARS-CoV-2 and a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyra11, Rs7327, Rs4231, Rs4084, and combinations thereof. In some embodiments, provided self-assembled polypeptide complexes are capable of neutralizing both SARS-CoV and SARS-CoV-2.
[0363] For example, in some embodiments, the self-assembled polypeptide complex has an IC of less than 0.01 μg / mL, 0.005 μg / mL, 0.001 μg / mL, 0.0005 μg / mL, or 0.0002 μg / mL. 50 In some embodiments, the self-assembled polypeptide complex has an IC of less than 0.5 μg / mL, 0.1 μg / mL, 0.01 μg / mL, 0.005 μg / mL, 0.001 μg / mL, 0.0005 μg / mL, or 0.0002 μg / mL. 50In some embodiments, the self-assembled polypeptide complex has an IC of less than 0.01 μg / mL, 0.005 μg / mL, 0.001 μg / mL, 0.0005 μg / mL, or 0.0002 μg / mL. 50 In some embodiments, the self-assembled polypeptide complex has an IC of less than 0.5 μg / mL. 50 In some embodiments, the self-assembled polypeptide complex is capable of neutralizing the BQ.1.1 and / or XBB.1 (Omicron) variants of SARS-CoV-2 with an IC of about 0.1 μg / mL. 50 In some embodiments, the self-assembled polypeptide complex has an IC of less than 0.1 μg / mL. 50 It is possible to neutralize the XBB.1 (omicron) variant of SARS-CoV-2. C. Treatment Method
[0364] In one aspect, methods are provided that may be useful for treating, ameliorating, or preventing a sarbecovirus infection or a sarbecovirus-associated condition, generally comprising administering to a subject a composition comprising a self-assembled polypeptide complex of the present disclosure.
[0365] In some embodiments, the subject is a mammal, for example, a human.
[0366] Compositions for administration to a subject generally comprise the self-assembled polypeptide complexes disclosed herein. In some embodiments, such compositions further comprise a pharmaceutically acceptable excipient.
[0367] The compositions can be formulated for administration by any of a variety of routes, including systemic routes (e.g., oral, inhalation, intranasal, intravenous, intraperitoneal, subcutaneous, or intramuscular administration).
[0368] In some embodiments, the administering step results in an improvement in one or more clinical outcomes or metrics in the subject.
[0369] For example, in a subject infected with a sarbecovirus, administration of a self-assembled polypeptide complex can, in some embodiments, result in a reduced viral load, hi some embodiments, administration of a self-assembled polypeptide complex described herein results in a reduced chance of infection by a sarbecovirus and / or reduced forward spread of the sarbecovirus.
[0370] Alternatively or additionally, administration, in some embodiments, may prevent, delay, reduce the severity of, alleviate the symptoms of, and / or reduce the incidence of one or more sarbecovirus-associated conditions.
[0371] Sarbecovirus-associated conditions include, for example, respiratory distress, fever, ground-glass opacities in the lungs, pneumonia, lymphopenia, cerebrovascular disease, dysrhythmias, ischemic and non-ischemic heart disease, pericarditis, myocarditis, and heart failure, and thromboembolic disease. [Example]
[0372] The following examples are presented to provide one of ordinary skill in the art with a description of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be purely exemplary of the disclosure and are not intended to limit the scope of what the inventors regard as their invention. Methods and Materials
[0373] The following description of methods and materials applies to Examples 1-5. Cell lines and viruses
[0374] HEK 293T-ACE2 cells (BEI NR2511), HEK 293T (ATCC), and Vero E6 (green monkey kidney cell line, ATCC) cells were grown in Dulbecco's modified Eagle's medium (DMEM; Thermo Fisher Scientific, Waltham, MA). For HEK 293T and 293T-ACE2 cells, DMEM was supplemented with 10% heat-inactivated fetal bovine serum (FBS), 5% 1 M HEPES, and 1% gentamicin (Thermo Fisher Scientific, Waltham, MA). For Vero E6 cells, DMEM was supplemented with 10% FBS (Hyclone, Logan, UT) and 1% penicillin-streptomycin (Invitrogen, Thermo Fisher Scientific, Waltham, MA). HEK 293F and HEK 293S cells (Thermo Fisher Scientific, Waltham, MA) were cultured in Freestyle 293 Expression Medium (Thermo Fisher Scientific, Waltham, MA) at 37°C and 8% CO with 125 rpm shaking. SARS-CoV-2 / SB2-P4-PB clone 1 (Banerjee et al. Emerg Infect Dis 26:2054-63, 2020) titers were determined by 50% tissue culture infectious dose (TCID50 / mL) using cell supernatants using published methods. Protein expression and purification
[0375] Genes encoding human apoferritin fusions, antigen-binding fragments (Fab), fragment crystallizable regions (Fc), and IgG were synthesized by GeneArt (Thermo Fisher Scientific, Waltham, MA), cloned into the pcDNA3.4 expression vector, and transiently expressed in HEK 293F cells. *The version of Fc used was IgG4 Fc, and the asterisk indicates the inclusion of the following mutations in the IgG4 Fc to eliminate Fcγ receptor binding: S228P, F234A, L235A, G237A, and P238S. Cells were cultured at 0.8×10 6 Cells were cultured at a density of 1000 cells / mL and transfected with 50 μg of DNA per 200 mL of cells using FectoPRO (Polyplus Transfections, Strasbourg, France) using known methods. After 6-7 days of incubation with shaking (Multitron Pro shaker, Infors HT, 125 rpm shaking, 37°C, 8% CO2, 70% humidity), cells were harvested by centrifugation at 5000 rpm for 20 minutes, and the supernatant was filtered through a 0.22 μm Steritop filter (EMD Millipore, Burlington, MA). Fab and IgG were transiently expressed by cotransfecting 90 μg of heavy and light chains at a 2:1 ratio and purified using KappaSelect affinity and HiTrap Protein A HP columns (both GE Healthcare, Chicago, IL), respectively, eluted with 100 mM glycine (pH 2.2), and neutralized with 1 M Tris-HCl (pH 9.0). The IgG fraction was further purified by size-exclusion chromatography (SEC; Superdex 200 Increase, GE Healthcare, Chicago, IL), and the Fab fraction was further purified by cation-exchange chromatography (MonoS, GE Healthcare, Chicago, IL). His-tagged WT RBD (BEI NR52309), human (h) and mouse (m) Fc receptors (hFcγRI, hFcγRIIa, hFcγRIIb, hFcRn, mFcγRI, mFcγRIIb, mFcγRIV, and mFcRn) were purified using a HisTrap Ni NTA column followed by SEC (Superdex 200 Increase column; both GE Healthcare, Chicago, IL) using 20 mM phosphate (pH 8.0) and 150 mM NaCl buffer. Expression and purification of Maltabodies
[0376] Maltabodies (MBs) were designed, expressed, and purified as follows. Briefly, genes encoding single-chain (sc) Fab and scFc linked to human apoferritin light chain monomers were synthesized by GeneArt (Thermo Fisher Scientific, Waltham, MA) and cloned into the pcDNA3.4 expression vector. MBs were expressed by transient transfection of 66 μg of plasmid (2:1:1 ratio of scFab-apoferritin:scFc-N-Ferr:scFab-C-Ferr for monospecific MBs; or 4:2:1:1 ratio of scFab1-apoferritin:scFc-N-Ferr:scFab2-C-Ferr:scFab3-C-Ferr for trispecific MBs) into HEK 293F cells using FectoPRO (Polyplus Transfections, Strasbourg, France). MB was purified by affinity chromatography using a HiTrap Protein A HP column (GE Healthcare, Chicago, IL) and eluted with 20 mM Tris (pH 8.0), 3 M MgCl2, and 10% glycerol. Fractions were concentrated and further purified by gel filtration (Superose 6 10 / 300 GL column, GE Healthcare, Chicago, IL). For trispecific MB (298-52-80), IgG1 or IgG4 * scFc was used, and the asterisk indicates the use of IgG4 with the Fcγ receptor binding mutations specified above. For in vivo studies, all IgGs and MBs were quality controlled to ensure endotoxin levels below 3.5 EU / mL at a protein concentration of 1 mg / mL. Pseudovirus production
[0377] Pseudoviruses (PsVs) were produced using lentiviral vector backbones using known methods. Briefly, SARS-CoV-2 PsVs were generated by transient cotransfection of 293T cells with a lentiviral backbone encoding a luciferase reporter gene (BEI NR52516), a plasmid encoding Gag-Pol (BEI NR52517), a plasmid encoding Tat (BEI NR52518), a plasmid encoding Rev (BEI NR52519), and a plasmid expressing the SARS-CoV-2 spike (BEI NR52310) using BioT transfection reagent (Bioland Scientific, Paramount, CA) according to the manufacturer's instructions. Cells were incubated at 37°C for 24 hours, after which 5 mM sodium butyrate was added. Cells were further incubated at 30°C for an additional 24–30 hours. Omicron (BA.1) variant PsVs were generated using the Omicron (BA.1) spike plasmid (DR Burton; The Scripps Research Institute). Genes encoding the Omicron (BA.5, BQ.1.1, and XBB.1) spikes were synthesized by GeneArt (Thermo Fisher Scientific, Waltham, MA) and cloned into the pcDNA3.4 expression vector. Alpha, beta, gamma, delta, and Omicron SARS-CoV-2 PsV variants were generated by substituting the wild-type spike plasmid. PsVs were collected, filtered through a 0.45 μm sterile filter, and concentrated using a 100K Amicon filter (Merck Millipore Amicon - Ultra 2.0 Centrifugal Filter Units, MilliporeSigma, Burlington, MA). PsV neutralization assay
[0378] Neutralization was assessed using a single-cycle neutralization assay using 293T-ACE2 cells (BEI NR52511) using a known method. Briefly, 96-well plates were coated with poly-L-lysine (Sigma-Aldrich, St. Louis, MO), and cells were seeded at a density of 10,000 cells / well in 100 μL. The following day, IgG or MB were serially diluted in duplicate and incubated with PsV at 37°C for 1 hour. The cell culture medium was then replaced with a PsV-IgG or PsV-MB mixture supplemented with 10 μg / mL polybrene (Sigma-Aldrich, St. Louis, MO). The cells were incubated at 37°C for 48 hours, after which 50 μL of Britelite plus reagent (PerkinElmer, Waltham, MA) was added for 2 minutes. Supernatants were transferred to 96-well white plates (Sigma Aldrich, St. Louis, MO), and luminescence in relative light units (RLU) was measured using a Synergy Neo2 Multi Mode Assay Microplate Reader (Biotek Instruments, Winooski, VT). Three biological replicates were performed for each antibody or MB. IC 50 Values were calculated using nonlinear regression in GraphPad Prism 9.3.1. Sarbecovirus pseudovirus production
[0379] The spike gene, the sarbecovirus S gene, was codon-optimized for mammalian expression, synthesized by Twist Biosciences, and cloned into the same expression vector by Gibson Assembly (New England Biolabs). Sarbecovirus sequences were retrieved from GenBank for Rs4084, Rs7327, and LYRa11, as shown in Table 2. [Table 2] Recombinant VSV pseudoviruses in which the native glycoprotein was replaced with the sarbecovirus S protein were generated using known methods. Briefly, HEK 293T cells (ATCC) at 80% confluency were transfected with an S protein-encoding expression vector using poly(ethyleneimine) (PEI; 1 mg / mL) and cultured overnight at 37°C under 5% CO2. After 24 hours, cells were transfected with VSV-G pseudotyped ΔG-luciferase (G) at a multiplicity of infection (MOI) of 3. * ΔG-luciferase (Kerafast) for 2 h. After infection, cells were washed three times with 1x PBS, replaced with fresh medium, and cultured at 37°C for another 24 h. Then, the supernatant was collected and clarified by centrifugation at 300 g for 10 min. Sarbecovirus neutralization assay
[0380] Pseudoviruses were titrated to normalize infectivity levels on target cells before setting up neutralization assays. Neutralization assays were performed by incubating pseudoviruses with 5-fold serial dilutions of MB versus their corresponding IgG in triplicate in 96-well plates for 1 hour at 37°C. Briefly, 293T-hACE2 cells were cultured at 1 x 10 5 Cells were seeded at a density of 1000 cells / well. Luciferase activity was measured using the Luciferase Assay System (Promega) according to the manufacturer's instructions. 24 hours later, cells were added to the pseudovirus and serum. Neutralization curves and IC 50 Values were generated by fitting a non-linear five-parameter dose-response curve in GraphPad Prism 9.3. Virus expansion and titer determination
[0381] The SARS-CoV-2 Omicron isolate hCoV-19 / USA / MD-HP24556 / 2022 (BA.2) was obtained from BEI Resources (NIAID, NIH). The virus was propagated using Vero E6 cells. Viral infectious titers were determined by endpoint dilution and cytopathic effect (CPE) assays on Vero E6 cells using known methods. Endpoint dilution microplate neutralization assays were performed to measure the neutralizing activity of IgG and MB. Triplicate dilutions were incubated with SARS-CoV-2 at an MOI of 0.1 in DMEM with 7.5% inactivated fetal calf serum (FCS) for 1 hour at 37°C. After incubation, the virus-antibody mixture was transferred onto a monolayer of overnight-grown Vero E6 cells. The cells were incubated with the mixture for approximately 70 hours. CPE was visually scored for each well by two independent observers in a blinded manner. Results were then converted to percentage neutralization at a given sample dilution and the mean ± SEM was plotted using a 5-parameter dose-response curve using GraphPad Prism v.9.3 to determine the ID of each sample. 50 obtained. Biolayer Interferometry
[0382] Binding kinetics were measured using an Octet RED96 Biolayer Interferometer (Sartorius ForteBio, Freemont, CA). His-tagged Omicron RBD (SinoBiological, China), WT RBD, and human or mouse Fc gamma receptors (hFcγRI, hFcγRIIa, hFcγRIIb, mFcγRI, mFcγRIIb, mFcγRIV) were loaded onto Ni-NTA biosensors (Sartorius ForteBio, Freemont, CA) to reach a signal response of 0.8 nM. Association rates were measured by transferring the loaded sensors to wells containing either Fab (gradients increased from 150 nM to 4.7 nM), IgG (gradients increased from 150 nM to 4.7 nM), or MB (gradients increased from 20 nM to 0.6 nM) for 180 seconds. Dissociation rates were measured by immersing the sensors in buffer-containing wells for 180 seconds. All steps were performed at 25°C in a buffer containing PBS (pH 7.4), 0.01% BSA, and 0.0002% Tween®-20. To estimate the potential for endosomal recycling, binding of IgG or MB to mouse and human neonatal Fc receptors (FcRn) was assessed. IgG and MB were titrated at the concentrations listed above using, for example, a buffer containing PBS, pH 5.5, and 0.0002% Tween, and a buffer containing PBS, pH 7.4, and 0.0002% Tween-20. All binding and incubation steps, except for dissociation, were performed in a buffer containing PBS pH 5.6 and 0.0002% Tween. The dissociation step was measured using PBS pH 7.4 and 0.0002% Tween-20. Analysis was performed using Octet software with a 1:1 fit model. Preparation of SARS-CoV-2 spiked microspheres
[0383] SARS-CoV-2 spike protein (Sino Biological, Beijing, China) was biotinylated using the EZ-link Sulfo-NHS Biotinylation Kit (Thermo Scientific, 2143) according to the provided protocol. Red fluorescent Neutravidin microspheres (Invitrogen, F8775) were washed twice with PBS + 0.1% BSA, and then 5 μL was incubated with 10 μg of biotinylated protein, bringing the total volume to 200 μL with PBS / 0.1% BSA. The beads were incubated overnight at 4°C and washed twice before use to remove unbound protein. The beads were resuspended in 200 μL per 5 μL bead volume. Antibody-dependent cell-mediated phagocytosis assay
[0384] Immune complexes were formed by incubating SARS-CoV-2 spike-coated fluorescent beads with diluted MB or IgG preparations (10 μL of beads and 10 μL of 1 mg / mL antibody sample) for 2 hours at 37°C + 5% CO. THP-1 cells (ATCC, TIB-202) were incubated at 5 × 10 5 Maintain cells / mL below 5 x 10 in 200 µL 4 Cells / well were added to the immune complexes for 1 hour at 37°C + 5% CO2. Cells were washed and stained with Live Dead Fixable Violet stain (Invitrogen, L34995) according to the provided protocol, then washed and fixed with 1% PFA for 20 minutes at room temperature. Fixed cells were washed with FACS buffer (PBS + 10% FBS, 0.5 mM EDTA) and collected on an LSRII Flow Cytometer (BD Biosciences). Data were analyzed in FlowJo (BD Biosciences, Ashland, OR), and phagocytosis was quantified as the percentage of live THP-1 cells that engulfed red fluorescent SARS-CoV-2 spiked beads. Mice and ethics statement
[0385] Age-matched female human ACE2- and human FcRn-expressing mice (JAX strain #034902, B6.Cg-Tg(FCGRT)32Dcr Tg(K18-ACE2)2Prlmn Fcgrttm1Dc) were purchased from Jackson Laboratory (JAX, Bar Harbor, ME) and housed in individually ventilated cages under specific pathogen-free conditions. All procedures were approved by the University of Toronto Local Animal Care Committee, AUP#20012628. Studies with replication-competent SARS-CoV-2 were conducted in accordance with the University of Toronto Containment Level 3 guidelines under Biosafety Permit EXT-J06-3. SARS-CoV-2 Challenge
[0386] Pre-challenge oropharyngeal swab (Good Care nasopharyngeal swab, Goodwood Medical Care, Dalian, China) samples were collected, and female B6.Cg-Tg(FCGRT)32Dcr Tg(K18-ACE2)2Prlmn Fcgrttm1Dc mice were challenged with 3 μg (0.15 mg / kg), 30 μg (1.5 mg / kg), or 90 μg (4.5 mg / kg) of cocktail IgG4 as specified. * ;T10 MB * Mice were treated intraperitoneally (ip) with either 298-52-80 or a negative control (PGDM1400 IgG) and then transferred to the Combined Containment Level 3 in vivo facility at the University of Toronto for SARS-CoV-2 challenge. Mice were anesthetized with inhaled isoflurane and administered a lethal dose of 1 × 10 5 Mice were inoculated intranasally with 100 pfu / mouse of SARS-CoV-2 (SB2-P4-PB clone 1). Mice were then challenged with a second dose of T10 MB 1 day after challenge. * or IgG4 *The mice received the cocktail; negative control recipient animals also received a second 30 μg dose of PGDM in a dose-finding study. Oropharyngeal swabs were collected two days after challenge and subjected to qPCR quantification to verify infection. Mice were weighed and monitored daily and scored according to weight loss and disease progression. Clinical disease was scored as follows: 0) no signs of disease; 1) 5-10% weight loss without further symptoms; 2) slightly reduced movement and 10-20% weight loss; 3) reduced or limited uninduced movement with <20% weight loss; 4) absence of induced movement, rapid breathing, hunching, and reduced grooming; or 20% or greater weight loss; or 5) death. Mice were sacrificed at a score of 4 and given a score of 5 the following day. Virus proliferation in lung tissue
[0387] At the time of sacrifice, or for surviving animals, 12 days after challenge, lung tissue was collected and flash-frozen. Lung virus titers at the time of sacrifice were determined by homogenizing lung tissue in 0.5 mL of DMEM (Invitrogen, Carlsbad, CA) without additives and calculating the TCID50 against Vero E6 cells by performing 10-fold serial dilutions and monitoring cytopathic effect (CPE). Enzyme-linked immunosorbent assay
[0388] PK assay: Serum collected at D2 after molecule administration was diluted 1:100 and assessed for MB or antibody concentrations by ELISA. Briefly, nickel-coated 96-well plates (Pierce, Thermo Fisher Scientific, Waltham, MA) were filled with 50 μL per well of His-tagged SARS-CoV-2 RBD protein or, for PGDM1400, BG505 D368R SOSIP.664 trimer. 3Plates were coated overnight with TBS + 5% BSA. Plates were blocked for 1 hour at room temperature and incubated with diluted serum or a standard curve of each administered molecule. MB and antibodies were detected using an anti-human Fab secondary antibody (Abcam, 87422) and developed using the BD TMB substrate reagent set (BD Biosciences, Franklin Lakes, NJ). Data were collected using a Synergy Neo2 Multi-Mode Assay Microplate Reader (Biotek Instruments, Winooski, VT).
[0389] Multireactivity assay: Microtiter plates (Costar) were coated with 10 μg / mL dsDNA, 10 μg / mL KLH, 10 μg / mL cardiolipin, and 5 μg / mL insulin. The microtiter plates were incubated at 37°C for 2 hours and then at 4°C overnight. The insulin and KLH plates were washed with PBST and blocked with PBST for 1 hour. The dsDNA and cardiolipin plates were blocked with 1.5% BSA for 1 hour. MB / IgG samples were diluted to 1 μg / mL in triplicate 1:4 dilutions and added to the antigen plate for 2 hours. 50 μL of HRP-conjugated goat anti-human IgG antibody was added to the antigen plate for 1 hour. 100 μL of ABTS substrate was added, incubated for 15 minutes, and absorbance was read at 405 nm using a Spectrostar nanoplate reader (BMG Labtech). qPCR for oropharyngeal swab titers
[0390] Viral RNA from swab samples was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany). Primers targeting env (forward primer: ACAGGTACGTTAATAGTTAATAGCGT, reverse primer: ATATTGCAGCAGTACGCACACA) were used for RT-qPCR with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswitch, MA) and the CFX384 Touch Real-Time System (Bio-Rad). Nuclease-free water was used as a no-template control. Reverse transcription was performed by incubation at 55°C for 10 min, and PCR cycling conditions consisted of 95°C for 1 min for initial denaturation, followed by 45 cycles of denaturation (95°C for 10 s) and extension (58°C for 30 s). Melting curves were generated by performing 5-s cycles between 65°C and 95°C at 0.5°C intervals. A reference copy number plasmid for the env gene was used to generate a standard curve. Data were analyzed using CFX Maestro Software (Bio-Rad). Crystallization and structure determination
[0391] Purified 80 Fab-RBD binary complexes were obtained by mixing Fab:RBD at a 2:1 molar ratio. After 30 min of incubation at 4 °C, the complexes were purified by size-exclusion chromatography (Superdex 200 Increase size-exclusion column, GE Healthcare, Chicago, IL) in 20 mM Tris pH 8.0, 150 mM NaCl buffer. The desired fractions were then concentrated to 10 mg / mL, and crystallization trials were set up using the sitting-drop vapor diffusion method with a JCSG Top 96 screen at a 1:1 protein:reservoir ratio. Crystals appeared on day 70 in conditions containing 0.2 M diammonium tartrate and 20% (w / v) PEG 3350. Crystals were cryoprotected in 10% (v / v) ethylene glycol and flash-frozen in liquid nitrogen. X-ray diffraction data were collected at the 23-ID-D beamline at the Argonne National Laboratory Advanced Photon Source. Datasets were processed using XD and XPREP. Phases were determined using Phaser, using the 80 Fab predicted by ABodyBuilder and the SARS-CoV-2 RBD (PDB ID: 7LM8) as search models. Iterative refinement was performed using Phenix Refine, and manual building was performed in Coot. All software was accessed via SBGrid. Modeling of 2-7 Fab binding to Omicron (BA.1, BA.2) was performed in Pymol using the published RBD structure (PDB ID: 7LSS). Footprint analysis was performed using the 2-7 spike complex (PDB ID: 7LSS), 10-40 RBD complex, and 11-11 spike complex structures (PDB IDs: 7SD5 and EMD-25167).Interface residues were identified by PISA (E, K. & K., H. Inference of macromolecular assemblies from crystalline state. J Mol Biol. (2007)) using default parameters, and images were generated using Pymol (Schrodinger. The PyMOL Molecular Graphics System. (2015)). statistical analysis
[0392] Statistical analysis was performed using Graphpad Prism version 9.3.1 software (Graphpad Software Inc., San Diego, CA). A P value of p≦0.05 was considered statistically significant unless adjusted for multiple testing using the Bonferroni correction. Survival curves were compared using the Gehan-Breslow-Wilcoxon test; data are presented as mean±SEM unless otherwise indicated. Example 1 Maltabodies demonstrate potent and broad-spectrum responses against SARS-CoV-2 variants of concern
[0393] The rapid emergence of new SARS-CoV-2 variants of concern (VOCs) has hindered mAb therapeutics and driven antibody discovery efforts focused on expanding the breadth of viral sequences recognized by a single antibody. Increasing antibody valency is a potentially promising approach for enhancing apparent binding affinity. We have discovered that the disclosed maltabodies (MBs) offer multiple advantages as next-generation multivalent biologics, including high stability, efficient assembly, ease of production and purification, and plug-and-play genetic fusion of selected antibodies. Using this platform, enhanced affinity can be combined with multispecificity—the inclusion of several antibody fragments recognizing different epitopes—to produce antigen recognition that is more resistant to viral mutations. To assess whether the neutralizing properties of the previously characterized anti-SARS-COV-2 mAbs 2-7, 2-36, 2-38, 10-40, and 11-11 could be improved, monospecific mAbs were expressed and evaluated for their neutralizing potency and breadth compared to their corresponding mAbs against SARS-CoV-2 wild-type (WT) and five VOCs (alpha, beta, gamma, delta, and omicron BA.1). Five of the eight mAbs (52, 80, 2-36, 11-11, and 10-40) had IC values of 5 μg / mL or higher. 50 The cutoff value showed a 100% range, but an IC of 0.01 μg / mL was used to mimic the efficacy of REGEN-COV (Weinreich et al. New Engl J Med 384:238-51, 2020). 50 When a cutoff value was used, only two mAbs (11-11 and 10-40) showed neutralization of two of the five VOCs tested (Figure 1A, Figures 2A-2V). In contrast, when presented as monospecific mAbs, three specificities (2-7, 80, and 52) showed an IC of 0.01 μg / mL. 50A cutoff value was used to reach 100% neutralization breadth. The remaining MBs lose potency against Omicron BA.1, but apart from 298 and 2-38 MBs, have IC<0.3 μg / mL, indicating pseudovirus (PsV) neutralization potency of sotrovimab (VanBlargan et al. Nat Med 28:490-5, 2022) against WT SARS-CoV-2. 50 and still neutralize (Figures 1B-1C, 2A-2VV). The superior ability of these molecules to overcome viral sequence diversity is likely due to their enhanced potency against WT SARS-CoV-2 in the range of 0.005–0.0002 μg / mL (Figure 1B). These increases in potency and breadth were not associated with increases in binding to antigens commonly used as measures of polyreactivity, namely, cardiolipin, insulin, dsDNA, and keyhole limpet antigen (KLH) (Figure 16). Example 2 Broad spectrum sarbecovirus neutralization achieved by trispecific maltabodies
[0394] Although monospecific MBs exhibit potent neutralization and can rescue losses in potency compared to their mAb counterparts, monospecifics still carry the risk of viral escape if sufficient mutations emerge to overcome the benefit conferred by binding avidity. Indeed, 80 monospecific MBs lost neutralization against omicron BA.5 (Figure 14A), highlighting the need for improved approaches to address evolving viral variants and achieve adequate neutralization breadth that could potentially extend beyond SARS-CoV-2 to other sarbecoviruses. Thus, trispecific MBs, targeting three distinct epitopes while retaining avidity, have the potential to offer adequate resistance to evolving variants. mAbs 10-40 and 11-11 are known to target conserved epitopes, thereby conferring broad-spectrum neutralization that extends to other sarbecoviruses (Liu et al. Sci Transl Med 14:eabn6859, 2022). Based on this and the results from the monospecific MB screening (Figure 1B), mAb specificities 2-7, 10-40, and 11-11 were selected to design trispecific molecules to explore the neutralization gains achieved by combining next-generation mAbs with different epitope specificities on MBs. Similar to mAb 80, structural data on mAb 2-7 revealed that RBD mutations found in VOCs constitute part of its binding interface (Cerutti et al. Struct Lond Engl 29:655-63, 2021), resulting in the loss of neutralization potency observed for this IgG against Omicron BA.1. However, 2-7 had rescued neutralizing potency in the MB format (Fig. 3A), similar to that observed for mAb 80, demonstrating the benefit of avidity in overcoming viral escape.
[0395] The resulting trispecific (2-7-10-40-11-11) MB had an average IC of 0.002 μg / mL. 50In PsV neutralization assays, the 2-7 MB potently neutralized all tested VOCs, including WT and SARS-CoV-2 (Figures 3B and 4A). These experiments were extended to PsV neutralization assays using other viruses that rely on ACE2 as an entry receptor, including live Omicron BA.2 virus and a panel of SARS-CoV-1-related bat sarbecoviruses. To better evaluate the benefits of combining multiple specificities, monospecific MB components were also tested. The monospecific 2-7 MB showed no neutralization against the sarbecovirus panel, while the 10-40 and 11-11 MBs failed to block infection of live Omicron BA.2 (Figures 3C and 4B-4E). In contrast, a trispecific MB of these specificities combined on a single molecule showed both potent SARS-CoV-2 neutralization across VOCs, including live Omicron BA.2, as well as pan-sarbecovirus neutralization of this panel (Figures 3B-3C and 4A-4E).
[0396] Furthermore, the 2-7-10-40-11-11 trispecific MB and corresponding IgG cocktail were tested against recent BQ.1.1 and XBB.1 omicron subvariants to assess neutralization potency in a pseudovirus assay. The potency of the IgG cocktail was compared with the IC of clinically approved antibodies. 50 The neutralization potencies were below the range (0.3 μg / mL for sotrovimab and 0.01 μg / mL for REGEN-COV against WT SARS-CoV-2 PsV) and did not reach 100% neutralization even at 100 μg / mL (Figures 15A and 15B). In contrast, the trispecific Mb neutralized the BQ-1.1 and XBB.1 subvariants with potencies of 0.06 μg / mL and 0.18 μg / mL, respectively, corresponding to doses that fall within the dosing range of FDA-approved therapeutics (Figures 15A and 15B).
[0397] To assess the molecular coverage of the trispecific 2-7-10-40-11-11 MBs, the individual and combined receptor binding domain (RBD) buried surface area (BSA) of each antibody specificity was analyzed based on their previously published three-dimensional structures. While binding of mAbs 2-7, 10-40, and 11-11 to the RBD covers approximately 8%, 9%, and 11% of the RBD-accessible BSA, respectively, in the case of the 2-7-10-40-11-11 trispecific MB, 23% of the RBD-accessible BSA is covered by a single molecule (Figure 3D). Correspondingly, the trispecific 2-7-10-40-11-11 MB contains 62 contact residues in the RBD, compared to 23, 27, and 37 residues for the individual mAbs 2-7, 10-40, and 11-11, respectively. Thus, by targeting three partially overlapping functional epitopes on the RBD and through the gain in potency provided by avidity, the trispecific 2-7-10-40-11-11 MB provides proof-of-concept for potent, broad-spectrum, and durable neutralization across sarbecoviruses with a single MB molecule. Example 3 Neutralizing efficacy correlates with in vivo protection from SARS-CoV-2
[0398] We previously reported the generation of a trispecific MB molecule targeting SARS-CoV-2 ("298-52-80 MB," containing Fab fragments from antibodies 298, 52, and 80, each targeting the RBD of SARS-CoV-2). The 298-52-80 MB was constructed using an engineered apoferritin split design (Figures 5A and 5B) (Rujas, E. et al. Multivalency transforms SARS-CoV-2 antibodies into ultrapotent neutralizers. Nat. Commun. 12, 3661 (2021) and Rujas, E. et al. Engineering pan-HIV-1 neutralization potency through multispecific antibody avidity. Proc. Nat. Acad. Sci. 119, e2112887119 (2022)). In this engineered apoferritin split design, the human apoferritin protomer was split into two halves based on its four-helix bundle folding: two N-terminal α-helices (N-Ferr) and two C-terminal α-helices (C-Ferr).
[0399] In this example, the ability of the trispecific 298-52-80 MB to confer in vivo protection against a lethal SARS-CoV-2 challenge was evaluated. For comparison, versions of the trispecific 298-52-80 MB with an IgG4 Fc and a corresponding IgG cocktail were generated; both the MB and IgG cocktail contained mutations (S228P, F234A, L235A, G237A, P238S) to ablate binding to Fcγ receptors; these are hereafter referred to as T10 MB, respectively. * and IgG4 * IgG1 to IgG4 * Substitution of the Fc subtype with T10 MB did not affect the neutralization potency of either IgG or MB. * has an IC of 0.0002 μg / mL, approximately 1000-fold more potent than its corresponding cocktail IgG. 50The binding kinetics study demonstrated that T10 MB * and IgG4 * Both antibody cocktails were found to exhibit pH-dependent binding to mouse and human FcRn (Figures 7A-7B) and no binding to human or mouse Fcγ receptors (FcγRs). This contrasted with the FcγR binding observed for the corresponding IgG1 antibody cocktail controls (Figures 7B-7D). * and IgG4 * The antibody cocktail also showed no binding to mouse and human FcRn at physiological pH, and binding at acidic pH with no detectable off-rate (FIGS. 7C and 7D).
[0400] Antibody-dependent cell-mediated phagocytosis (ADCP) experiments using fluorescently labeled beads coated with SARS-CoV-2 spike protein were performed using flow cytometry. The gating strategy was based on gating THP-1 cells by size and viability; cells positive for internalization of SARS-CoV-2 spike-coated fluorescent beads were quantified as a percentage of viable THP-1 cells (Figures 7E-7H). These experiments demonstrated that T10 MB * and IgG4 * The IgG1 antibody cocktail showed substantial uptake of SARS-CoV-2 spike-coated beads, further confirming the inability of the cocktail to bind to Fc receptors (Figure 7I).
[0401] To assess whether the increased neutralization potency achieved with MB resulted in improved in vivo protection against SARS-CoV-2, hACE2 and hFcRn double transgenic mice were treated with 30 μg (1.5 mg / kg) of FcγR-binding deficient IgG4 * and T10 MB * Treated with the molecule at a high dose (1 × 10 5 The mice were challenged intranasally with TCID50 of SARS-CoV-2. * IgG4 *The T10 MB provided significantly better protection (60% survival) compared to the cocktail, with all cocktail recipient animals succumbing to challenge by D6-7 (Figure 8A). Improved protection was associated with fewer clinical signs of disease throughout the course of infection (Figure 8C), reduced weight loss and weight rebound after challenge (Figure 8D), and significantly lower lung virus titers (Figure 8B), particularly in animals that survived challenge. Infection was confirmed by qPCR using oropharyngeal swabs collected on D-1 (prechallenge) and D2 after challenge (Figure 8E). In a subsequent study, we used T10 MB as a marker for the T10 MB virus. * delivered at 3 μg (1.4 pmol; 0.15 mg / kg) and IgG4 * We found that comparable in vivo protection was achieved when the cocktail was delivered at 90 μg (600 pmol; 4.5 mg / kg) (Figure 8F). The difference in dose can be observed in the circulating serum concentrations of the administered molecules at D2 post-challenge (Figure 8G).
[0402] This data not only provides the first evidence of in vivo protection from lethal challenge mediated by MB, but also demonstrates that the increased neutralization potency conferred by the trispecific MB format provides enhanced protection against SARS-CoV-2 challenge in vivo compared to the corresponding IgG mixture. Indeed, comparable in vivo efficacy was obtained with a roughly 430-fold lower molar amount of MB compared to IgG, corresponding to a roughly 540-fold lower molar amount of Fab arm. Example 4 Molecular basis of Fab 80 and 2-7 binding to the SARS-CoV-2 RBD
[0403] To understand the molecular basis of binding of mAb 80 (Fab to the receptor-binding domain (RBD) of SARS-CoV-2), the crystal structure of 80 Fab in complex with the RBD was solved at 3.1 Å resolution (Figures 9A-9B). Epitope recognition is mediated by 20 residues that form an interface with the RBD, 14 of which are involved in ACE2 binding (Table 3).
[0404] [Table 3]
[0405] These data demonstrate how mAb 80 inhibits SARS-CoV-2 infection through receptor blockade, preventing the interaction of ACE2 with the receptor-binding motif (Figure 10A). The heavy chain of mAb 80 is primarily responsible for interacting with the RBD, providing 10 of the 11 hydrogen bonds found at the binding interface (Figures 10B and 10C; Table 3). Furthermore, the interaction of F54 of the antibody heavy chain with Y489 from the RBD results in the formation of a novel triple pi-stacking within the RBD structure between residues Y473, F456, and Y421 (Figure 10D).
[0406] Detailed analysis of the RBD-80 Fab interface reveals that residues S477 and T478 of the RBD form hydrogen bonds with Y92 and D100D of the antibody, accounting for 124 Å of its surface area. 2 These residues were found to cover the RBD, accounting for 15% of the total buried surface area (BSA) of the RBD (Figures 10E and 10F, Table 3). These residues are mutated in several variants of concern (VOCs), including Omicron (BA.1, BA.2), significantly reducing the antibody's binding affinity to the Omicron BA.1 RBD (Figures 11A and 11B); however, the increased avidity achieved with the MB format offsets this weaker binding. As a result, the interaction of 80 MB with the mutated Omicron BA.1 RBD had a high apparent binding affinity without a detectable off-rate (Figures 11A and 11B), which likely contributes to its durable neutralization potency against Omicron BA.1 (Figure 1B). The potency of 80 MB against Omicron BA.2 was further confirmed using replication-competent virus. For 80 mAb, a significantly reduced potency against Omicron BA.2 live virus was observed, while in the MB format, high neutralization potency was retained (FIG. 11C).
[0407] Related analyses were performed on 2-7 Fab to assess its binding to the RBD of SARS-CoV-2. Similar to Fab 80 (see Example 4), Fab 2-7 revealed that RBD mutations found in VOC constitute part of its binding interface (Figures 14B-14D), resulting in the loss of neutralizing potency observed for this IgG against Omicron BA.1. Neutralizing potency, including potent neutralization against Omicron BA.5 (Figure 14A), was rescued in the MB format (Figure 3A), clearly demonstrating the benefit of avidity in overcoming viral escape.
[0408] Thus, this example provides structural insight into antibody binding to the receptor binding domain (RBD) of SARS-CoV-2 within an epitope containing some of the residues mutated in variants of concern. Example 5 Cryo-electron microscopic characterization of the trispecific MB 298-52-80 Methods and Materials
[0409] The trispecific MB(298-52-80) sample was concentrated to 2.0 mg / mL, and 3.0 μl of the sample was deposited onto a homemade holey gold grid, which was glow-discharged in air for 15 seconds before use. The sample was blotted for 3.0 seconds and subsequently plunge-frozen in liquid ethane using a Leica EM GP2 Automatic Plunge Freezer (maintained at 4°C and 100% humidity). Data collection was performed on a Thermo Fisher Scientific Titan Krios G3 operated at 300 kV and equipped with a Falcon 4i camera, automated with EPU software. A nominal magnification of 75,000' and a defocus range between 0.5 μm and 2.0 μm were used for data collection. Exposures were performed at a camera exposure speed of approximately 6.3 e- / pixel / sec and 49.6 electrons / Å. 2The images were collected as a 30-frame movie for 8.3 seconds, with a total exposure of 100 Å. A total of 4,385 raw movies were obtained. Image processing was performed in cryoSPARC v374. Initial specimen movement correction, exposure weighting, and CTF parameter estimation were performed using a patch-based algorithm. Micrographs were sorted based on CTF fit resolution, and only micrographs with a fit better than 5.0 Å were accepted for further processing. Manual picking was performed to create templates for template-based picking, resulting in a selection of 955,995 particle images. Particle images were sorted through several rounds of 2D classification, resulting in a selection of 358,036 particle images. A preliminary 3D model was obtained ab initio without enforcing symmetry. To further select the highest quality particle images, 151,443 particle images with a CTF fit resolution better than 3.0 Å were re-extracted from the micrographs and subjected to non-uniform refinement without applying symmetry, resulting in a 2.4 Å resolution map of the trispecific MB. 65,478 particle images with a CTF fit better than 2.7 Å were extracted from the micrographs and subjected to non-uniform refinement with octahedral symmetry applied, resulting in a 2.1 Å resolution map. Non-uniform refinement was performed using defocus refinement and optimization of CTF parameters per group. The pixel size was calibrated at 1.04 Å per pixel by fitting the structure of the human apoferritin light chain (PDB ID: 2FFX).
[0410] To obtain 3D reconstructions of Fab and Fc molecules on the surface of trispecific MBs, manual picking was performed and templates were created for template-based picking, resulting in a selection of 6,692,141 particle images. Particle images were sorted through several rounds of 2D classification, resulting in a selection of 668,214 particle images. Preliminary 3D maps were obtained ab-initio without applying symmetry. Further cleaning of the dataset was performed through several rounds of heterogeneous refinement, resulting in 73,163 Fab particle images and 13,328 Fc particle images. Final cryoEM maps at 6.7 Å resolution for Fab and 7.1 Å resolution for Fc were obtained using a local refinement job with a custom soft mask. To assess the quality of the resulting map, models of human apoferritin light chain (PDB ID: 6WX6), human IgG1 Fc (PDB ID: 6CJX), and Fab 298 (PDB ID: 7K9Z) were manually docked in the cryoEM map using UCSF Chimera 79. Images were prepared using Pymol 80, UCSF Chimera, and UCSF ChimeraX. result
[0411] As discussed in Example 3 above, a trispecific MB incorporating antibody specificities 298, 52, and 80 ("T10 MB") increased neutralization potency by approximately 1000-fold compared to the corresponding IgG cocktail. To gain molecular insight into the assembly of the MB design, the T10 MB was analyzed by cryo-electron microscopy (cryoEM). Figure 12A shows the processing workflow for the cryoEM data.
[0412] Analysis of cryoEM micrographs revealed the formation of highly decorated, uniform nanocage-like particles (Figure 12B). Consistent with the presence of flexible (GGS)x linkers connecting the scFab and scFc components to the apoferritin scaffold, the density of these antibody fragments is poorly resolved in the 2D clumps (Figure 12C) and 3D reconstructions of the trispecific MBs (Figure 12D). However, manual picking of scFab and scFc particles, followed by template-based particle picking and subsequent refinement of these molecules, confirmed the proper assembly of the Fab and Fc components on the MBs to a resolution of approximately 7 Å (Figures 12B-12M). When neither C1 symmetry (Figure 12E, Figures 13A-13D) nor octahedral symmetry (O; Figures 13A-13I) was applied, the 3D reconstructions of the apoferritin scaffolds of the MBs reached resolutions of 2.4 Å and 2.1 Å, respectively. The apoferritin scaffold in the trispecific MB was virtually identical to that of the human apoferritin light chain (PDB ID: 6WX6), with cross-correlation (cc) coefficients of 0.97 (C1) and 0.92 (O) measured between the maps. The N- and C-termini of the core MB scaffold were similarly arranged on three- and four-fold symmetry axes as in the native human apoferritin light chain (Figure (Figure12E),12E),12E, ... In summary, our cryoEM analysis of the trispecific 298-52-80 MB provided atomic-level details demonstrating that MBs constructed on the apoferritin split-design scaffold adopted their intended structural properties. Sequence Listing - The underlined parts in the fusion sequences indicate linker sequences. - Bold text within the fusion sequence indicates ferritin or ferritin subunit sequences. Within antibody variable region sequences, underlined and bold letters together indicate complementarity determining region sequences according to Kabat. - Boxed bold residues indicate residues that are mutated compared to the reference molecule, e.g., compared to wild-type IgG1 Fc or wild-type IgG4 Fc. [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9] [Table 4-10] [Table 4-11] [Table 4-12] [Table 4-13] [Table 4-14] [Table 4-15] Table 4-16 Table 4-17 Table 4-18 Table 4-19 Table 4-20 Table 4-21 Table 4-22 Table 4-23 Table 4-24 Table 4-25 Table 4-26 Table 4-27 Table 4-28 Table 4-29 Table 4-30 Table 4-31 Table 4-32 [Table 4-33] [Table 4-34] [Table 4-35] [Table 4-36] [Table 4-37] [Table 4-38] [Table 4-39] [Table 4-40] [Table 4-41] [Table 4-42] [Table 4-43]
[0413] Equivalents / Alternative Embodiments While the invention has been described in connection with specific embodiments thereof, it will be understood that the invention is capable of further modifications, and that this application is intended to cover any variations, uses, or adaptations of the invention which generally follow the principles of the invention and which come within known or customary practice within the art to which this invention pertains, including such departures from the present disclosure as may be applicable to the essential features set forth hereinabove.
Claims
1. A fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is capable of binding to SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2.
2. The fusion polypeptide of claim 1 , wherein the first sarbecovirus-binding moiety comprises a sarbecovirus antibody or a sarbecovirus-binding fragment thereof.
3. The fusion polypeptide of claim 2 , wherein the sarbecovirus-binding portion is a Fab fragment of a sarbecovirus antibody.
4. The fusion polypeptide of claim 3 , wherein the Fab fragment is a single-chain Fab (scFab).
5. The fusion polypeptide of any one of claims 2 to 4, wherein the sarbecovirus antibody is capable of neutralizing SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2.
6. 6. The fusion polypeptide of any one of claims 1 to 5, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyra11, Rs7327, Rs4231, Rs4084, and combinations thereof.
7. 7. The fusion polypeptide of claim 6, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
8. 8. The fusion polypeptide of claim 7, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyra11, Rs7327, Rs4231, and Rs4084.
9. 1. A fusion polypeptide comprising a sarbecovirus-binding moiety linked to a nanocage monomer or subunit thereof, the sarbecovirus-binding moiety is a sarbecovirus antibody or a sarbecovirus-binding fragment thereof; The sarbecovirus antibody has an IC of less than 1 μg / mL. 50 exhibits neutralizing activity against SARS-CoV, Fusion polypeptides.
10. 1. A fusion polypeptide comprising a sarbecovirus-binding moiety linked to a nanocage monomer or subunit thereof, the sarbecovirus-binding moiety is a sarbecovirus antibody or a sarbecovirus-binding fragment thereof; A fusion polypeptide, wherein the sarbecovirus antibody or sarbecovirus-binding fragment thereof comprises a heavy chain complementarity-determining region 3 (CDR-H3) having a sequence comprising YYDRSGY (SEQ ID NO: 70).
11. 11. The fusion polypeptide of claim 10, wherein the sarbecovirus antibody or sarbecovirus-binding fragment thereof comprises a CDR-H3 sequence selected from the group consisting of SEQ ID NOs: 34, 40, 46, 75, 81, 87, 95, 101, 107, 115, 121, 127, 135, 141, 147, 155, 161, 167, 175, 181, 187, 195, 201, 207, 215, 221, 227, 235, 241, 247, 255, 261, 267, 275, 281, 287, 295, 301, 307, 315, 321, 327, 335, 341, or 347, or a variant of any of the foregoing sequences containing no more than three, no more than two, or no more than one amino acid substitution therein.
12. 12. The fusion polypeptide of claim 11, wherein the sarbecovirus antibody or sarbecovirus-binding fragment thereof comprises a CDR-H3 sequence selected from the group consisting of SEQ ID NOs: 34, 40, 46, 75, 81, 87, 95, 101, 107, 115, 121, 127, 135, 141, 147, 155, 161, 167, 175, 181, 187, 195, 201, 207, 215, 221, 227, 235, 241, 247, 255, 261, 267, 275, 281, 287, 295, 301, 307, 315, 321, 327, 335, 341, or 347.
13. the sarbecovirus antibody or sarbecovirus-binding fragment thereof, (a) SEQ ID NO: 34 and SEQ ID NO: 37, respectively; (b) SEQ ID NO: 40 and SEQ ID NO: 43, respectively; (c) SEQ ID NO: 46 and SEQ ID NO: 49, respectively; (d) SEQ ID NO: 75 and SEQ ID NO: 78, respectively; (e) SEQ ID NO: 81 and SEQ ID NO: 84, respectively; (f) SEQ ID NO: 87 and SEQ ID NO: 90, respectively; (g) SEQ ID NO: 95 and SEQ ID NO: 98, respectively; (h) SEQ ID NO: 101 and SEQ ID NO: 104, respectively; (i) SEQ ID NO: 107 and SEQ ID NO: 110, respectively; (j) SEQ ID NO: 115 and SEQ ID NO: 118, respectively; (k) SEQ ID NO: 121 and SEQ ID NO: 124, respectively; (l) SEQ ID NO: 127 and SEQ ID NO: 130, respectively; (m) SEQ ID NO: 135 and SEQ ID NO: 138, respectively; (n) SEQ ID NO: 141 and SEQ ID NO: 144, respectively; (o) SEQ ID NO: 147 and SEQ ID NO: 150, respectively; (p) SEQ ID NO: 155 and SEQ ID NO: 158, respectively; (q) SEQ ID NO: 161 and SEQ ID NO: 164, respectively; (r) SEQ ID NO: 167 and SEQ ID NO: 170, respectively; (s) SEQ ID NO: 175 and SEQ ID NO: 178, respectively; (t) SEQ ID NO: 181 and SEQ ID NO: 184, respectively; (u) SEQ ID NO: 187 and SEQ ID NO: 190, respectively; (v) SEQ ID NO: 195 and SEQ ID NO: 198, respectively; (w) SEQ ID NO: 201 and SEQ ID NO: 204, respectively; (y) SEQ ID NO: 207 and SEQ ID NO: 210, respectively; (z) SEQ ID NO: 215 and SEQ ID NO: 218, respectively; (aa) SEQ ID NO: 221 and SEQ ID NO: 224, respectively; (bb) SEQ ID NO: 227 and SEQ ID NO: 230, respectively; (cc) SEQ ID NO: 235 and SEQ ID NO: 238, respectively; (dd) SEQ ID NO: 241 and SEQ ID NO: 244, respectively; (ee) SEQ ID NO: 247 and SEQ ID NO: 250, respectively; (ff) SEQ ID NO: 255 and SEQ ID NO: 258, respectively; (gg) SEQ ID NO: 261 and SEQ ID NO: 264, respectively; (hh) SEQ ID NO: 267 and SEQ ID NO: 270, respectively; (ii) SEQ ID NO: 275 and SEQ ID NO: 278, respectively; (jj) SEQ ID NO: 281 and SEQ ID NO: 284, respectively; (kk) SEQ ID NO: 287 and SEQ ID NO: 290, respectively; (ll) SEQ ID NO: 295 and SEQ ID NO: 298, respectively; (mm) SEQ ID NO: 301 and SEQ ID NO: 304, respectively; (nn) SEQ ID NO: 307 and SEQ ID NO: 310, respectively; (oo) SEQ ID NO: 315 and SEQ ID NO: 318, respectively; (pp) SEQ ID NO: 321 and SEQ ID NO: 324, respectively; (qq) SEQ ID NO: 327 and SEQ ID NO: 330, respectively; (rr) SEQ ID NO: 335 and SEQ ID NO: 338, respectively; (ss) SEQ ID NO: 341 and SEQ ID NO: 344, respectively; or (tt) SEQ ID NO: 347 and SEQ ID NO: 350, respectively or the CDR-H3 and CDR-L3 sequences of (uu) CDR-H3 and CDR-L3 sequences that collectively differ by no more than three, no more than two, or one amino acid substitution across both the CDR-H3 and CDR-L3 sequences of any of (a) to (tt) above.
13. The fusion polypeptide of claim 11 or 12, comprising:
14. the sarbecovirus antibody or sarbecovirus-binding fragment thereof, (a) SEQ ID NO: 34 and SEQ ID NO: 37, respectively; (b) SEQ ID NO: 40 and SEQ ID NO: 43, respectively; (c) SEQ ID NO: 46 and SEQ ID NO: 49, respectively; (d) SEQ ID NO: 75 and SEQ ID NO: 78, respectively; (e) SEQ ID NO: 81 and SEQ ID NO: 84, respectively; (f) SEQ ID NO: 87 and SEQ ID NO: 90, respectively; (g) SEQ ID NO: 95 and SEQ ID NO: 98, respectively; (h) SEQ ID NO: 101 and SEQ ID NO: 104, respectively; (i) SEQ ID NO: 107 and SEQ ID NO: 110, respectively; (j) SEQ ID NO: 115 and SEQ ID NO: 118, respectively; (k) SEQ ID NO: 121 and SEQ ID NO: 124, respectively; (l) SEQ ID NO: 127 and SEQ ID NO: 130, respectively; (m) SEQ ID NO: 135 and SEQ ID NO: 138, respectively; (n) SEQ ID NO: 141 and SEQ ID NO: 144, respectively; (o) SEQ ID NO: 147 and SEQ ID NO: 150, respectively; (p) SEQ ID NO: 155 and SEQ ID NO: 158, respectively; (q) SEQ ID NO: 161 and SEQ ID NO: 164, respectively; (r) SEQ ID NO: 167 and SEQ ID NO: 170, respectively; (s) SEQ ID NO: 175 and SEQ ID NO: 178, respectively; (t) SEQ ID NO: 181 and SEQ ID NO: 184, respectively; (u) SEQ ID NO: 187 and SEQ ID NO: 190, respectively; (v) SEQ ID NO: 195 and SEQ ID NO: 198, respectively; (w) SEQ ID NO: 201 and SEQ ID NO: 204, respectively; (y) SEQ ID NO: 207 and SEQ ID NO: 210, respectively; (z) SEQ ID NO: 215 and SEQ ID NO: 218, respectively; (aa) SEQ ID NO: 221 and SEQ ID NO: 224, respectively; (bb) SEQ ID NO: 227 and SEQ ID NO: 230, respectively; (cc) SEQ ID NO: 235 and SEQ ID NO: 238, respectively; (dd) SEQ ID NO: 241 and SEQ ID NO: 244, respectively; (ee) SEQ ID NO: 247 and SEQ ID NO: 250, respectively; (ff) SEQ ID NO: 255 and SEQ ID NO: 258, respectively; (gg) SEQ ID NO: 261 and SEQ ID NO: 264, respectively; (hh) SEQ ID NO: 267 and SEQ ID NO: 270, respectively; (ii) SEQ ID NO: 275 and SEQ ID NO: 278, respectively; (jj) SEQ ID NO: 281 and SEQ ID NO: 284, respectively; (kk) SEQ ID NO: 287 and SEQ ID NO: 290, respectively; (ll) SEQ ID NO: 295 and SEQ ID NO: 298, respectively; (mm) SEQ ID NO: 301 and SEQ ID NO: 304, respectively; (nn) SEQ ID NO: 307 and SEQ ID NO: 310, respectively; (oo) SEQ ID NO: 315 and SEQ ID NO: 318, respectively; (pp) SEQ ID NO: 321 and SEQ ID NO: 324, respectively; (qq) SEQ ID NO: 327 and SEQ ID NO: 330, respectively; (rr) SEQ ID NO: 335 and SEQ ID NO: 338, respectively; (ss) SEQ ID NO: 341 and SEQ ID NO: 344, respectively; or (tt) SEQ ID NO: 347 and SEQ ID NO: 350, respectively 14. The fusion polypeptide of claim 13, comprising the CDR-H3 and CDR-L3 sequences of:
15. the sarbecovirus antibody or sarbecovirus-binding fragment thereof, (a) SEQ ID NO: 34 and SEQ ID NO: 37, respectively; (b) SEQ ID NO: 40 and SEQ ID NO: 43, respectively; or (c) SEQ ID NO: 46 and SEQ ID NO: 49, respectively.
15. The fusion polypeptide of claim 14, comprising the CDR-H3 and CDR-L3 sequences of:
16. the sarbecovirus antibody or sarbecovirus-binding fragment thereof, (a) SEQ ID NOs: 32, 33, and 34 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 35, 36, and 37 for CDR-L1, CDR-L2, and CDR-H3, respectively; (b) SEQ ID NOs: 38, 39, and 40 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 41, 42, and 43 for CDR-L1, CDR-L2, and CDR-H3, respectively; (c) SEQ ID NOs: 44, 45, and 46 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 47, 48, and 49 for CDR-L1, CDR-L2, and CDR-H3, respectively; (d) SEQ ID NOs: 73, 74, and 75 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 76, 77, and 78 for CDR-L1, CDR-L2, and CDR-H3, respectively; (e) SEQ ID NOs: 79, 80, and 81 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 82, 83, and 84 for CDR-L1, CDR-L2, and CDR-H3, respectively; (f) SEQ ID NOs: 85, 86, and 87 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 88, 89, and 90 for CDR-L1, CDR-L2, and CDR-H3, respectively; (g) SEQ ID NOs: 93, 94, and 95 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 96, 97, and 98 for CDR-L1, CDR-L2, and CDR-H3, respectively; (h) SEQ ID NOs: 99, 100, and 101 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 102, 103, and 104 for CDR-L1, CDR-L2, and CDR-H3, respectively; (i) SEQ ID NOs: 105, 106, and 107 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 108, 109, and 110 for CDR-L1, CDR-L2, and CDR-H3, respectively; (j) SEQ ID NOs: 113, 114, and 115 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 116, 117, and 118 for CDR-L1, CDR-L2, and CDR-H3, respectively; (k) SEQ ID NOs: 119, 120, and 121 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 122, 123, and 124 for CDR-L1, CDR-L2, and CDR-H3, respectively; (l) SEQ ID NOs: 125, 126, and 127 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 128, 129, and 130 for CDR-L1, CDR-L2, and CDR-H3, respectively; (m) SEQ ID NOs: 133, 134, and 135 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 136, 137, and 138 for CDR-L1, CDR-L2, and CDR-H3, respectively; (n) SEQ ID NOs: 139, 140, and 141 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 142, 143, and 144 for CDR-L1, CDR-L2, and CDR-H3, respectively; (o) SEQ ID NOs: 145, 146, and 147 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 148, 149, and 150 for CDR-L1, CDR-L2, and CDR-H3, respectively; (p) SEQ ID NOs: 153, 154, and 155 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 156, 157, and 158 for CDR-L1, CDR-L2, and CDR-H3, respectively; (q) SEQ ID NOs: 159, 160, and 161 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 162, 163, and 164 for CDR-L1, CDR-L2, and CDR-H3, respectively; (r) SEQ ID NOs: 165, 166, and 167 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 168, 169, and 170 for CDR-L1, CDR-L2, and CDR-H3, respectively; (s) SEQ ID NOs: 173, 174, and 175 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 176, 177, and 178 for CDR-L1, CDR-L2, and CDR-H3, respectively; (t) SEQ ID NOs: 179, 180, and 181 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 182, 183, and 184 for CDR-L1, CDR-L2, and CDR-H3, respectively; (u) SEQ ID NOs: 185, 186, and 187 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 188, 189, and 190 for CDR-L1, CDR-L2, and CDR-H3, respectively; (v) SEQ ID NOs: 193, 194, and 195 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 196, 197, and 198 for CDR-L1, CDR-L2, and CDR-H3, respectively; (x) SEQ ID NOs: 199, 200, and 201 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 202, 203, and 204 for CDR-L1, CDR-L2, and CDR-H3, respectively; (y) SEQ ID NOs: 205, 206, and 207 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 208, 209, and 210 for CDR-L1, CDR-L2, and CDR-H3, respectively; (z) SEQ ID NOs: 213, 214, and 215 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 216, 217, and 218 for CDR-L1, CDR-L2, and CDR-H3, respectively; (aa) SEQ ID NOs: 219, 220, and 221 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 222, 223, and 224 for CDR-L1, CDR-L2, and CDR-H3, respectively; (bb) SEQ ID NOs: 225, 226 and 227 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 228, 229 and 230 for CDR-L1, CDR-L2 and CDR-H3, respectively; (cc) SEQ ID NOs: 233, 234 and 235 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 236, 237 and 238 for CDR-L1, CDR-L2 and CDR-H3, respectively; (dd) SEQ ID NOs: 239, 240, and 241 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 242, 243, and 244 for CDR-L1, CDR-L2, and CDR-H3, respectively; (ee) SEQ ID NOs: 245, 246, and 247 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 248, 249, and 250 for CDR-L1, CDR-L2, and CDR-H3, respectively; (ff) SEQ ID NOs: 253, 254, and 255 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 256, 257, and 258 for CDR-L1, CDR-L2, and CDR-H3, respectively; (gg) SEQ ID NOs: 259, 260 and 261 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 262, 263 and 264 for CDR-L1, CDR-L2 and CDR-H3, respectively; (hh) SEQ ID NOs: 265, 266, and 267 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 268, 269, and 270 for CDR-L1, CDR-L2, and CDR-H3, respectively; (ii) SEQ ID NOs: 273, 274, and 275 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 276, 277, and 278 for CDR-L1, CDR-L2, and CDR-H3, respectively; (jj) SEQ ID NOs: 279, 280, and 281 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 282, 283, and 284 for CDR-L1, CDR-L2, and CDR-H3, respectively; (kk) SEQ ID NOs: 285, 286 and 287 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 288, 289 and 290 for CDR-L1, CDR-L2 and CDR-H3, respectively; (ll) SEQ ID NOs: 293, 294, and 295 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 296, 297, and 298 for CDR-L1, CDR-L2, and CDR-H3, respectively; (mm) SEQ ID NOs: 299, 300 and 301 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 302, 303 and 304 for CDR-L1, CDR-L2 and CDR-H3, respectively; (nn) SEQ ID NOs: 305, 306, and 307 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 308, 309, and 310 for CDR-L1, CDR-L2, and CDR-H3, respectively; (oo) SEQ ID NOs: 313, 314, and 315 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 316, 317, and 318 for CDR-L1, CDR-L2, and CDR-H3, respectively; (pp) SEQ ID NOs: 319, 320 and 321 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 322, 323 and 324 for CDR-L1, CDR-L2 and CDR-H3, respectively; (qq) SEQ ID NOs: 325, 326, and 327 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 328, 329, and 330 for CDR-L1, CDR-L2, and CDR-H3, respectively; (rr) SEQ ID NOs: 333, 334, and 335 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 336, 337, and 338 for CDR-L1, CDR-L2, and CDR-H3, respectively; (ss) SEQ ID NOs: 339, 340, 341 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 342, 343 and 344 for CDR-L1, CDR-L2 and CDR-H3, respectively; or (tt) SEQ ID NOs: 345, 346, and 347 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 348, 349, and 350 for CDR-L1, CDR-L2, and CDR-H3, respectively or (uu) CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 sequences that collectively differ by no more than three, no more than two, or one amino acid substitution across all six CDRs from any of the above sequences in (a) through (tt).
12. The fusion polypeptide of claim 11, comprising a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2 and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2 and CDR-L3,
17. the sarbecovirus antibody or sarbecovirus-binding fragment thereof, (a) SEQ ID NOs: 32, 33, and 34 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 35, 36, and 37 for CDR-L1, CDR-L2, and CDR-H3, respectively; (b) SEQ ID NOs: 38, 39, and 40 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 41, 42, and 43 for CDR-L1, CDR-L2, and CDR-H3, respectively; (c) SEQ ID NOs: 44, 45, and 46 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 47, 48, and 49 for CDR-L1, CDR-L2, and CDR-H3, respectively; (d) SEQ ID NOs: 73, 74, and 75 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 76, 77, and 78 for CDR-L1, CDR-L2, and CDR-H3, respectively; (e) SEQ ID NOs: 79, 80, and 81 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 82, 83, and 84 for CDR-L1, CDR-L2, and CDR-H3, respectively; (f) SEQ ID NOs: 85, 86, and 87 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 88, 89, and 90 for CDR-L1, CDR-L2, and CDR-H3, respectively; (g) SEQ ID NOs: 93, 94, and 95 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 96, 97, and 98 for CDR-L1, CDR-L2, and CDR-H3, respectively; (h) SEQ ID NOs: 99, 100, and 101 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 102, 103, and 104 for CDR-L1, CDR-L2, and CDR-H3, respectively; (i) SEQ ID NOs: 105, 106, and 107 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 108, 109, and 110 for CDR-L1, CDR-L2, and CDR-H3, respectively; (j) SEQ ID NOs: 113, 114, and 115 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 116, 117, and 118 for CDR-L1, CDR-L2, and CDR-H3, respectively; (k) SEQ ID NOs: 119, 120, and 121 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 122, 123, and 124 for CDR-L1, CDR-L2, and CDR-H3, respectively; (l) SEQ ID NOs: 125, 126, and 127 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 128, 129, and 130 for CDR-L1, CDR-L2, and CDR-H3, respectively; (m) SEQ ID NOs: 133, 134, and 135 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 136, 137, and 138 for CDR-L1, CDR-L2, and CDR-H3, respectively; (n) SEQ ID NOs: 139, 140, and 141 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 142, 143, and 144 for CDR-L1, CDR-L2, and CDR-H3, respectively; (o) SEQ ID NOs: 145, 146, and 147 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 148, 149, and 150 for CDR-L1, CDR-L2, and CDR-H3, respectively; (p) SEQ ID NOs: 153, 154, and 155 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 156, 157, and 158 for CDR-L1, CDR-L2, and CDR-H3, respectively; (q) SEQ ID NOs: 159, 160, and 161 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 162, 163, and 164 for CDR-L1, CDR-L2, and CDR-H3, respectively; (r) SEQ ID NOs: 165, 166, and 167 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 168, 169, and 170 for CDR-L1, CDR-L2, and CDR-H3, respectively; (s) SEQ ID NOs: 173, 174, and 175 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 176, 177, and 178 for CDR-L1, CDR-L2, and CDR-H3, respectively; (t) SEQ ID NOs: 179, 180, and 181 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 182, 183, and 184 for CDR-L1, CDR-L2, and CDR-H3, respectively; (u) SEQ ID NOs: 185, 186, and 187 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 188, 189, and 190 for CDR-L1, CDR-L2, and CDR-H3, respectively; (v) SEQ ID NOs: 193, 194, and 195 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 196, 197, and 198 for CDR-L1, CDR-L2, and CDR-H3, respectively; (x) SEQ ID NOs: 199, 200, and 201 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 202, 203, and 204 for CDR-L1, CDR-L2, and CDR-H3, respectively; (y) SEQ ID NOs: 205, 206, and 207 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 208, 209, and 210 for CDR-L1, CDR-L2, and CDR-H3, respectively; (z) SEQ ID NOs: 213, 214, and 215 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 216, 217, and 218 for CDR-L1, CDR-L2, and CDR-H3, respectively; (aa) SEQ ID NOs: 219, 220, and 221 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 222, 223, and 224 for CDR-L1, CDR-L2, and CDR-H3, respectively; (bb) SEQ ID NOs: 225, 226 and 227 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 228, 229 and 230 for CDR-L1, CDR-L2 and CDR-H3, respectively; (cc) SEQ ID NOs: 233, 234 and 235 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 236, 237 and 238 for CDR-L1, CDR-L2 and CDR-H3, respectively; (dd) SEQ ID NOs: 239, 240, and 241 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 242, 243, and 244 for CDR-L1, CDR-L2, and CDR-H3, respectively; (ee) SEQ ID NOs: 245, 246, and 247 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 248, 249, and 250 for CDR-L1, CDR-L2, and CDR-H3, respectively; (ff) SEQ ID NOs: 253, 254, and 255 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 256, 257, and 258 for CDR-L1, CDR-L2, and CDR-H3, respectively; (gg) SEQ ID NOs: 259, 260 and 261 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 262, 263 and 264 for CDR-L1, CDR-L2 and CDR-H3, respectively; (hh) SEQ ID NOs: 265, 266, and 267 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 268, 269, and 270 for CDR-L1, CDR-L2, and CDR-H3, respectively; (ii) SEQ ID NOs: 273, 274, and 275 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 276, 277, and 278 for CDR-L1, CDR-L2, and CDR-H3, respectively; (jj) SEQ ID NOs: 279, 280, and 281 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 282, 283, and 284 for CDR-L1, CDR-L2, and CDR-H3, respectively; (kk) SEQ ID NOs: 285, 286 and 287 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 288, 289 and 290 for CDR-L1, CDR-L2 and CDR-H3, respectively; (ll) SEQ ID NOs: 293, 294, and 295 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 296, 297, and 298 for CDR-L1, CDR-L2, and CDR-H3, respectively; (mm) SEQ ID NOs: 299, 300 and 301 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 302, 303 and 304 for CDR-L1, CDR-L2 and CDR-H3, respectively; (nn) SEQ ID NOs: 305, 306, and 307 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 308, 309, and 310 for CDR-L1, CDR-L2, and CDR-H3, respectively; (oo) SEQ ID NOs: 313, 314, and 315 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 316, 317, and 318 for CDR-L1, CDR-L2, and CDR-H3, respectively; (pp) SEQ ID NOs: 319, 320 and 321 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 322, 323 and 324 for CDR-L1, CDR-L2 and CDR-H3, respectively; (qq) SEQ ID NOs: 325, 326, and 327 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 328, 329, and 330 for CDR-L1, CDR-L2, and CDR-H3, respectively; (rr) SEQ ID NOs: 333, 334, and 335 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 336, 337, and 338 for CDR-L1, CDR-L2, and CDR-H3, respectively; (ss) SEQ ID NOs: 339, 340, 341 for CDR-H1, CDR-H2 and CDR-H3, respectively, and SEQ ID NOs: 342, 343 and 344 for CDR-L1, CDR-L2 and CDR-H3, respectively; or (tt) SEQ ID NOs: 345, 346, and 347 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 348, 349, and 350 for CDR-L1, CDR-L2, and CDR-H3, respectively 17. The fusion polypeptide of claim 16, comprising a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2 and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2 and CDR-L3, having an amino acid sequence of:
18. 1. A fusion polypeptide comprising a sarbecovirus-binding moiety linked to a nanocage monomer or subunit thereof, the sarbecovirus-binding moiety is a sarbecovirus antibody or a sarbecovirus-binding fragment thereof; the sarbecovirus antibody or sarbecovirus-binding fragment thereof, (a) SEQ ID NOs: 12, 13, and 14 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 15, 16, and 17 for CDR-L1, CDR-L2, and CDR-H3, respectively; (b) SEQ ID NOs: 18, 19, and 20 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 21, 22, and 23 for CDR-L1, CDR-L2, and CDR-H3, respectively; (c) SEQ ID NOs: 24, 25, and 26 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 27, 28, and 29 for CDR-L1, CDR-L2, and CDR-H3, respectively; (d) SEQ ID NOs: 52, 53, and 54 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 55, 56, and 57 for CDR-L1, CDR-L2, and CDR-H3, respectively; (e) SEQ ID NOs: 58, 59, and 60 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 61, 62, and 63 for CDR-L1, CDR-L2, and CDR-H3, respectively; or (f) SEQ ID NOs: 64, 65, and 66 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 67, 68, and 69 for CDR-L1, CDR-L2, and CDR-H3, respectively. The amino acid sequence of or (g) CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 sequences that collectively differ by no more than three, no more than two, or one amino acid substitution across all six CDRs from any of the above sequences in (a) through (f). and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2 and CDR-L3, having the following structure:
19. the sarbecovirus antibody or sarbecovirus-binding fragment thereof, (a) SEQ ID NOs: 12, 13, and 14 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 15, 16, and 17 for CDR-L1, CDR-L2, and CDR-H3, respectively; (b) SEQ ID NOs: 18, 19, and 20 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 21, 22, and 23 for CDR-L1, CDR-L2, and CDR-H3, respectively; (c) SEQ ID NOs: 24, 25, and 26 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 27, 28, and 29 for CDR-L1, CDR-L2, and CDR-H3, respectively; (d) SEQ ID NOs: 52, 53, and 54 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 55, 56, and 57 for CDR-L1, CDR-L2, and CDR-H3, respectively; (e) SEQ ID NOs: 58, 59, and 60 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 61, 62, and 63 for CDR-L1, CDR-L2, and CDR-H3, respectively; or (f) SEQ ID NOs: 64, 65, and 66 for CDR-H1, CDR-H2, and CDR-H3, respectively, and SEQ ID NOs: 67, 68, and 69 for CDR-L1, CDR-L2, and CDR-H3, respectively.
19. The fusion polypeptide of claim 18, comprising a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2 and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2 and CDR-L3, having an amino acid sequence of:
20. 20. The fusion polypeptide of claim 9, wherein the sarbecovirus binding portion is a Fab fragment of a sarbecovirus antibody.
21. 21. The fusion polypeptide of claim 20, wherein the Fab fragment is a single-chain Fab (scFab).
22. 22. The fusion polypeptide of any one of claims 2 to 21, wherein the sarbecovirus antibody is capable of binding to the receptor binding domain (RBD) of SARS-CoV-2.
23. 23. The fusion polypeptide of claim 22, wherein the sarbecovirus antibody is capable of binding only to the RBD in its up conformation.
24. 24. The fusion polypeptide of any one of claims 2 to 23, wherein the sarbecovirus antibody is capable of inhibiting binding of SARS-CoV-2 to ACE2.
25. 25. The fusion polypeptide of any one of claims 1 to 24, wherein the nanocage monomer or subunit thereof is a ferritin monomer or subunit thereof.
26. 26. The fusion polypeptide of claim 25, wherein the ferritin monomer or subunit thereof is a ferritin light chain or subunit thereof.
27. 27. The fusion polypeptide of claim 25 or 26, wherein the ferritin monomer or subunit thereof is human ferritin or a subunit thereof.
28. 28. The fusion polypeptide of any one of claims 25 to 27, wherein the ferritin monomer or subunit thereof is a ferritin monomer subunit.
29. 29. The fusion polypeptide of claim 28, wherein the ferritin monomer subunit is a C-half ferritin.
30. 30. The fusion polypeptide of any one of claims 25 to 29, wherein the sarbecovirus binding moiety is fused to the N-terminus of the ferritin monomer or subunit thereof.
31. 31. The fusion polypeptide of claim 30, wherein the sarbecovirus binding moiety is linked to the N-terminus of the ferritin monomer or ferritin monomer subunit via an amino acid linker.
32. The amino acid linker is n S) m 32. The fusion polypeptide of claim 31, comprising a linker.
33. The above (G n S) m The linker is (GGGGS) m 33. The fusion polypeptide of claim 32, which is a linker.
34. 34. A self-assembled polypeptide complex comprising a plurality of first fusion polypeptides, each first fusion polypeptide comprising a first sarbecovirus binding moiety, wherein each first fusion polypeptide is a fusion polypeptide described in any one of claims 1 to 33.
35. 35. The self-assembled polypeptide complex of claim 34, further comprising a plurality of second fusion polypeptides, each second fusion polypeptide comprising a second sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the second sarbecovirus binding moiety is distinct from the first sarbecovirus binding moiety.
36. 36. The self-assembled polypeptide complex of claim 35, wherein each second fusion polypeptide is a fusion polypeptide of any one of claims 1 to 33.
37. The self-assembled polypeptide complex of claim 34, 35, or 36, further comprising a plurality of third fusion polypeptides, each third fusion polypeptide comprising a third sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, the third sarbecovirus binding moiety being separate from the first and second sarbecovirus binding moieties.
38. 38. The self-assembled polypeptide complex of claim 37, wherein each third fusion polypeptide is a fusion polypeptide of any one of claims 1 to 33.
39. 39. The self-assembled polypeptide complex of any one of claims 34 to 38, further comprising a plurality of Fc-containing fusion polypeptides, each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a nanocage monomer or a subunit thereof.
40. 40. The self-assembled polypeptide complex of claim 39, wherein the nanocage monomer or subunit thereof of the Fc-containing fusion polypeptide is a ferritin monomer or subunit thereof.
41. 41. The self-assembled polypeptide complex of claim 40, wherein the ferritin monomer or subunit thereof is a ferritin light chain or subunit thereof.
42. 42. The self-assembled polypeptide complex of claim 40 or 41, wherein the ferritin monomer or subunit thereof is human ferritin or a subunit thereof.
43. 43. The self-assembled polypeptide complex of any one of claims 40 to 42, wherein the ferritin monomer or subunit thereof is a ferritin monomer subunit.
44. 44. The self-assembled polypeptide complex of claim 43, wherein the ferritin monomer subunit is an N-half ferritin.
45. 45. The self-assembled polypeptide complex of any one of claims 40 to 44, wherein the Fc polypeptide is fused to the N-terminus of the ferritin monomer or subunit thereof.
46. 46. The self-assembled polypeptide complex of claim 45, wherein the Fc polypeptide is linked to the N-terminus of the ferritin monomer or ferritin monomer subunit via an amino acid linker.
47. The amino acid linker is n S) m 47. The self-assembled polypeptide complex of claim 46, comprising a linker.
48. The above (G n S) m The linker is (GGGGS) m 48. The self-assembled polypeptide complex of claim 47, which is a linker.
49. 49. The self-assembled polypeptide complex of any one of claims 39 to 48, wherein the Fc polypeptide comprises a single-chain Fc (scFc) comprising two Fc chains, the two Fc chains being linked via an amino acid linker.
50. the amino acid linker connecting the two Fc chains is n S) m 50. The self-assembled polypeptide complex of claim 49, comprising a linker.
51. The above (G n S) m The linker is (GGGGS) m 51. The self-assembled polypeptide complex of claim 50, which is a linker.
52. 52. The self-assembled polypeptide complex of any one of claims 39 to 51, wherein the Fc polypeptide comprises an IgGl Fc chain.
53. 52. The self-assembled polypeptide complex of any one of claims 39 to 51, wherein the Fc polypeptide comprises an IgG4 Fc chain.
54. 54. The self-assembled polypeptide complex of claim 53, wherein the Fc polypeptide comprises an IgG4 Fc chain comprising a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof.
55. the IgG4 Fc chain 1) S228P, F234A and L235A 2) S228P, F234A, L235A, G237A and P238S, or 3) F234A, L235A, G237A and P238S 55. The self-assembled polypeptide complex of claim 54, comprising a set of mutations selected from the group consisting of:
56. (a) a plurality of first fusion polypeptides, each first fusion polypeptide comprising a first sarbecovirus antibody or a sarbecovirus-binding fragment thereof linked to a ferritin monomer or a subunit thereof; (b) a plurality of second fusion polypeptides, each second fusion polypeptide comprising a second sarbecovirus antibody or sarbecovirus-binding fragment thereof linked to a ferritin monomer or subunit thereof; (c) a plurality of third fusion polypeptides, each third fusion polypeptide comprising a third sarbecovirus antibody or sarbecovirus-binding fragment thereof linked to a ferritin monomer or subunit thereof; and (d) a plurality of Fc-containing fusion polypeptides, each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a ferritin monomer or subunit thereof; A self-assembled polypeptide complex comprising: the first, second, and third sarbecovirus antibodies or sarbecovirus-binding fragments thereof are distinct from one another; A self-assembled polypeptide complex, wherein at least said first and second sarbecovirus antibodies are capable of neutralizing SARS-CoV and SARS-CoV-2.
57. 57. The self-assembled polypeptide complex of claim 56, which is capable of neutralizing the SARS-CoV-2 virus.
58. 58. The self-assembled polypeptide complex of claim 57, which is capable of neutralizing the omicron variant of the SARS-CoV-2 virus.
59. 59. The self-assembled polypeptide complex of claim 58, which is capable of neutralizing two or more omicron variants of the SARS-CoV-2 virus.
60. 60. The self-assembled polypeptide complex of claim 59, which is capable of neutralizing three or more omicron variants of the SARS-CoV-2 virus.
61. 68. The self-assembled polypeptide complex of claim 66 or 67, wherein the Omicron variant is selected from the group consisting of BA.1, BA.2, BA.5, XBB.1, and BQ.1.
1.
62. 62. The self-assembled polypeptide complex of any one of claims 58-61, which is capable of neutralizing the BA.1 variant of SARS-CoV-2 virus.
63. IC of 0.01 μg / mL or less 50 63. The self-assembled polypeptide complex of claim 62, wherein the self-assembled polypeptide complex is capable of neutralizing the BA.1 variant of SARS-CoV-2 virus with
64. 64. The self-assembled polypeptide complex of any one of claims 58-63, which is capable of neutralizing the BA.2 variant of SARS-CoV-2 virus.
65. IC of 0.02 μg / mL or less 50 65. The self-assembled polypeptide complex of claim 64, wherein the self-assembled polypeptide complex is capable of neutralizing the BA.2 variant of SARS-CoV-2 virus with
66. 66. The self-assembled polypeptide complex of any one of claims 58-65, which is capable of neutralizing the BA.5 variant of SARS-CoV-2 virus.
67. IC less than 0.001 μg / mL 50 67. The self-assembled polypeptide complex of claim 66, wherein the complex is capable of neutralizing the BA.5 variant of SARS-CoV-2 virus with
68. 68. The self-assembled polypeptide complex of any one of claims 58-67, which is capable of neutralizing the BQ.1.1 variant of the SARS-CoV-2 virus.
69. IC of 0.5 μg / mL or less 50 69. The self-assembled polypeptide complex of claim 68, which is capable of neutralizing the BQ.1.1 variant of the SARS-CoV-2 virus with a serotonin concentration of 1000 mg / mL or more.
70. 70. The self-assembled polypeptide complex of any one of claims 56-69, which is capable of neutralizing the XBB.1 variant of the SARS-CoV-2 virus.
71. IC of 0.5 μg / mL or less 50 71. The self-assembled polypeptide complex of claim 70, wherein the complex is capable of neutralizing the XBB.1 variant of the SARS-CoV-2 virus at a concentration of 1000 uA.
72. IC of 0.1 μg / mL or less 50 72. The self-assembled polypeptide complex of claim 71, wherein the complex is capable of neutralizing the XBB.1 variant of the SARS-CoV-2 virus at a concentration of 1000 uA.
73. 73. The self-assembled polypeptide complex of any one of claims 56-72, which is capable of neutralizing WT SARS-CoV-2 and at least one of, or a combination of, alpha, beta, gamma, delta, and omicron variants of SARS-CoV-2.
74. 74. The self-assembled polypeptide complex of claim 73, which is capable of neutralizing WT SARS-CoV-2 and alpha, beta, gamma, delta and omicron variants of SARS-CoV-2.
75. IC of 0.01 μg / mL or less 50 75. The self-assembled polypeptide complex of claim 74, wherein the complex is capable of neutralizing the WT SARS-CoV-2 and each of the alpha, beta, gamma, delta, and omicron variants of SARS-CoV-2 with an antibody titer of 100 or more.
76. 76. The self-assembled polypeptide complex of any one of claims 56 to 75, which is capable of neutralizing at least one sarbecovirus other than SARS-CoV-2.
77. 77. The self-assembled polypeptide complex of claim 76, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyra11, Rs7327, Rs4231, Rs4084, and combinations thereof.
78. 78. The self-assembled polypeptide complex of claim 77, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
79. 79. A pharmaceutical composition comprising the self-assembled polypeptide complex of any one of claims 34 to 78 and a pharmaceutically acceptable excipient.
80. A method for treating and / or preventing a sarbecovirus infection and / or a sarbecovirus-associated condition, comprising administering to a subject in need thereof a self-assembled polypeptide complex described in any one of claims 34 to 78 or a pharmaceutical composition described in claim 79.
81. 81. The method of claim 80, wherein the subject is a mammal.
82. 82. The method of claim 81, wherein the subject is a human.
83. 83. The method of any one of claims 80 to 82, wherein the administering step comprises systemic administration.
84. 84. The method of claim 83, wherein the systemic administration comprises intranasal, intravascular, or intramuscular administration.
85. Use of a self-assembled polypeptide complex described in any one of claims 34 to 78 or a pharmaceutical composition described in claim 79 for treating and / or preventing a sarbecovirus infection and / or a sarbecovirus-associated condition.
86. A self-assembled polypeptide complex of any one of claims 34 to 78 or a pharmaceutical composition of claim 79 for use in treating and / or preventing a sarbecovirus infection and / or a sarbecovirus-associated condition.
87. 87. The method of any one of claims 80 to 84, the use of claim 85, or the self-assembled polypeptide complex or pharmaceutical composition of claim 86, wherein the sarbecovirus infection is a SARS-CoV-2 infection or the sarbecovirus-associated condition is a SARS-CoV-2-associated condition.