Potency assay for CD34+ cells

Abstract

The present disclosure relates to methods for selecting CD34+ cells, cells selected by the methods, and therapeutic uses of these cells. More specifically, the present disclosure relates to CD34+ cells selected based on the level of VEGF expression and / or microRNA expression by cells and / or exosomes. The present disclosure therefore provides an in vitro method for selecting CD34+ cells based on determining the amount of VEGF and / or identifying the miRNA expressed by a CD34+ cell population and selecting the CD34+ cells accordingly.

Description

[Technical Field]

[0001] The present disclosure relates to methods for selecting CD34+ cells, cells selected by the methods, and therapeutic uses of these cells. More specifically, the present disclosure relates to CD34+ cells selected based on the level of VEGF expression and / or microRNA expression by cells and / or exosomes. [Background technology]

[0002] CD34 is a cell surface marker used to identify and isolate hematopoietic stem / progenitor cells (HSPCs). CD34+ cells are commonly isolated from blood samples using immunomagnetic techniques. CD34+ cells can differentiate into all types of blood cells and endothelial cells.

[0003] Intracardiac delivery of autologous peripheral blood-derived CD34+ stem cells (CD34+ cells) mobilized with granulocyte colony-stimulating factor (G-CSF) and recovered by leukapheresis after myocardial infarction has been shown to structurally and functionally repair damaged myocardial regions (Pasquet S, Sovalat H, Henon P, et al.). An automated device (StemXpand®) has been developed to enable stem cell expansion after G-CSF mobilization and has been shown to provide CD34+ cell numbers at least equivalent to those recovered during leukapheresis (Saucourt, Vogt, Merlin, et al.). The characteristics of the expanded cells (CD34+ cell number, purity / impurity profile, and viability) and safety (sterility, pyrogen, and mycoplasma content) have been evaluated, and the functionality of the expanded cells (eCD34+) has been demonstrated in preclinical in vivo studies in rats.

[0004] Advanced Therapy Medicinal Products (ATMPs) are gene-, tissue-, or cell-based medicines for human use. Such Advanced Therapy Medicinal Products must be evaluated for potency on a batch-by-batch basis, as required by law in both the United States and Europe. Potency assays should relate to the mechanism of action and correlate with the desired clinical outcome. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] US10676705B2 [Non-patent literature]

[0006] [Non-Patent Document 1] Sahoo et al., 2011: “Exosomes From Human CD34+ Stem Cells Mediate Their Proangiogenic Paracrine Activity” (Circ Res., 2011, September 16, 109(7):724-8) Summary of the Invention [Problem to be solved by the invention]

[0007] Therefore, there is a need for a simple in vitro potency assay for CD34+ cells that can support the therapeutic efficacy of CD34+ cells in clinical applications. [Means for solving the problem]

[0008] The present invention provides (i) determining the amount of VEGF expressed by the CD34+ cell population; and (ii) selecting CD34+ cells based on the amount of VEGF expressed by the population The present invention provides an in vitro method for selecting CD34+ cells, comprising:

[0009] CD34+ cells may be selected if the amount of VEGF expressed by the cells is at least about 1 fg / cell.

[0010] The present invention provides (i) detecting one or more microRNAs expressed by and / or contained in the exosomes of a CD34+ cell population; and (ii) selecting CD34+ cells based on one or more microRNAs expressed by the population and / or contained in their exosomes. Further provided is an in vitro method for selecting CD34+ cells, comprising:

[0011] The present invention provides (i) detecting one or more microRNAs expressed by and / or contained in the exosomes of a CD34+ cell population and determining the amount of VEGF expressed by the CD34+ cell population; and (ii) selecting CD34+ cells based on the amount of one or more detected microRNAs and VEGF expressed; Further provided is an in vitro method for selecting CD34+ cells, comprising:

[0012] CD34+ cells can be selected if expression of one or more or each of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR199a, miR590, and miR133a is detected.

[0013] CD34+ cells can be selected if expression of one or more or each of miR126, miR130a, miR21, miR26a, and miR378a is detected.

[0014] CD34+ cells can be selected if expression of one or more or each of miR21, miR26a, and miR378a is detected.

[0015] CD34+ cells can be selected if expression of miR146a and / or miR21 is detected.

[0016] CD34+ cells can be selected if expression of miR199a and / or miR590 is detected.

[0017] The CD34+ cells can be human CD34+ cells.

[0018] The CD34+ cells can be autologous or allogeneic CD34+ cells.

[0019] The method of the invention may further comprise the step of expanding the CD34+ cell population before and / or after step (i) or (ii).

[0020] Cells are allowed to grow for 9 days.

[0021] The proliferation may include one or more of the following: - growth at 37°C, - Growth in a controlled atmosphere of 5% CO2, and / or - Growth in culture medium containing cytokines such as interleukin 6 (IL6), interleukin 3 (IL3), stem cell factor, thrombopoietin, and / or Fms-like tyrosine kinase 3 ligand.

[0022] The amount of VEGF can be determined by ELISA or automated ELISA (ELLA).

[0023] The amount of VEGF can be determined by mass spectrometry.

[0024] The amount of VEGF can be determined by radioimmunoassay.

[0025] The amount of VEGF can be determined by a multiplex assay.

[0026] The methods of the invention can further comprise the step of harvesting, centrifuging, and / or purifying the selected cells, optionally wherein the purification is by immunoselection.

[0027] The cells may be for use in treatment.

[0028] The present invention further provides an isolated CD34+ cell population selected by the method of the present invention.

[0029] The present invention further provides an isolated population of CD34+ cells selected by the methods disclosed herein for use in therapy.

[0030] The present invention further provides an isolated population of CD34+ cells selected by the methods disclosed herein for use in the treatment of myocardial infarction. [Brief explanation of the drawings]

[0031] [Figure 1] FIG. 1 shows the plate layout for the VEGF concentration assay. [Figure 2A] FIG. 1 shows a VEGF standard curve. [Figure 2B] FIG. 1 shows a VEGF standard curve. [Figure 2C] FIG. 1 shows a VEGF standard curve. [Figure 3] FIG. 1 shows VEGF concentrations in supernatants after 9 days of CD34+ cell expansion (assay 1). [Figure 4] Figure 4A shows VEGF concentrations in supernatants after 9 days of expansion of patient CD34+ cells (Assay 1) and Figure 4B shows VEGF concentrations in supernatants after 9 days of expansion of healthy donor CD34+ cells (Assay 1). [Figure 5]Figure 5A shows VEGF concentrations and CD34+ cell counts after 9 days of expansion of CD34+ cells from patients with acute myocardial infarction (AMI). VEGF concentration curves obtained from supernatants (Assay 1). Figure 5B shows VEGF concentrations and CD34+ cell counts after 9 days of expansion of CD34+ cells from patients with AMI. Correlation graph (Assay 1). [Figure 6] FIG. 1 shows VEGF concentrations in supernatants after 9 days of CD34+ cell expansion (assay 2). [Figure 7] Figure 7A shows VEGF concentrations in supernatants after 9 days of expansion of patient CD34+ cells (Assay 2) and Figure 7B shows VEGF concentrations in supernatants after 9 days of expansion of healthy donor CD34+ cells (Assay 2). [Figure 8] Figure 8A shows VEGF concentrations and CD34+ cell counts after 9 days of expansion of CD34+ cells from an AMI patient. VEGF concentration curves obtained from supernatants (Assay 2). Figure 8B shows VEGF concentrations and CD34+ cell counts after 9 days of expansion of CD34+ cells from an AMI patient. Correlation graph (Assay 2). [Figure 9] FIG. 1 shows VEGF concentrations in supernatants after 9 days of CD34+ cell expansion (assay 3). [Figure 10] Figure 10A shows VEGF concentrations in supernatants after 9 days of expansion of patient CD34+ cells (Assay 3) and Figure 10B shows VEGF concentrations in supernatants after 9 days of expansion of healthy donor CD34+ cells (Assay 3). [Figure 11] Figure 11A shows VEGF concentrations and CD34+ cell numbers after 9 days of expansion of CD34+ cells from an AMI patient. VEGF concentration curves obtained from supernatants (Assay 3). Figure 11B shows VEGF concentrations and CD34+ cell numbers after 9 days of expansion of CD34+ cells from an AMI patient. Correlation graph (Assay 3). [Figure 12] FIG. 1 shows VEGF concentrations in supernatants after 9 days of CD34+ cell expansion (mean of assays 1, 2, and 3). [Figure 13]Figure 13A shows VEGF concentrations in supernatants after 9 days of expansion of patient CD34+ cells (mean of assays 1, 2, and 3). Figure 13B shows VEGF concentrations in supernatants after 9 days of expansion of healthy donor CD34+ cells (mean of assays 1, 2, and 3). [Figure 14] Figure 14A shows VEGF concentrations and CD34+ cell counts after 9 days of expansion of CD34+ cells from an AMI patient. VEGF concentration curves obtained from supernatants (average of assays 1, 2, and 3). Figure 14B shows VEGF concentrations and CD34+ cell counts after 9 days of expansion of CD34+ cells from an AMI patient. Correlation graph (average of assays 1, 2, and 3). [Figure 15] VEGF concentrations in supernatants collected after expansion of CD34+ cells from AMI patients (curves obtained for assays 1, 2, and 3). [Figure 16] Figure 16A shows the expression of CD63 / CD81 and CD34 in exosomes (positive fraction) derived from CD45+CD34+ (ProtheraCytes®) cells of various patients. From left to right, the bars correspond to FHD_4, FHD_5, FHD_6, FHD_8, and P_081. Figure 16B shows the expression of CD63 / CD81 and CD34 in exosomes (negative fraction) derived from CD45+CD34− cells of various patients. From left to right, the bars correspond to FHD_4, FHD_5, FHD_6, FHD_8, and P_081. [Figure 17] FIG. 1 shows housekeeping genes analyzed for stability (miR-103a, Iet7a-5p, and U6). [Figure 18] Figure 1 shows pro-angiogenic miRNAs (miRNA126, miRNA130a, miRNA378a) in ProtheraCytes® exosomes from an AMI patient (P081). Pt F+Cell = positive fraction_cells, Pt F+Exo = patient_positive fraction_exosomes, Pt F-Cell = patient_negative fraction_cells, Pt F-Exo = patient_negative fraction_exosomes. [Figure 19]Figure 19A shows pro-angiogenic miRNAs (miRNA126, miRNA130a, miRNA378a) in ProtheraCytes® exosomes from FHD (C4.1, microRNA study 4, assay_cytokine comparison-1-K0321-12120). Pt F+Cell = patient_positive_fraction_cells, Pt F+Exo = patient_positive_fraction_exosomes, Pt F-Cell = patient_negative_fraction_cells, Pt F-Exo = patient_negative_fraction_exosomes. Figure 19B shows pro-angiogenic miRNAs (miRNA126, miRNA130a, miRNA378a) in ProtheraCytes® exosomes from FHD (C5.1, microRNA study 5, assay_cytokine comparison-2-K0321-12120). Pt F+Cell = patient_positive_fraction_cells, Pt F+Exo = patient_positive_fraction_exosomes, Pt F-Cell = patient_negative_fraction_cells, Pt F-Exo = patient_negative_fraction_exosomes. Figure 19C shows pro-angiogenic miRNAs (miRNA126, miRNA130a, miRNA378a) in ProtheraCytes® exosomes from FHD (C6.1, MicroRNA Research 6, Assay_Cytokine Comparison-3-K0321-12120). Pt F+Cell = patient_positive_fraction_cells, Pt F+Exo = patient_positive_fraction_exosomes, Pt F-Cell = patient_negative_fraction_cells, Pt F-Exo = patient_negative_fraction_exosomes. Figure 19D shows pro-angiogenic miRNAs (miRNA126, miRNA130a, miRNA378a) in FHD ProtheraCytes® exosomes (C8.1, MicroRNA Research 8, Assay_Stability_SF 279511 TOM). Pt F+Cell = Patient_Positive_Cell, Pt F+Exo = Patient_Positive_Exosome, Pt F-Cell = Patient_Negative_Cell, Pt F-Exo = Patient_Negative_Exosome. [Figure 20]Figure showing pro-angiogenic miRNAs (miRNA126-3p, miRNA130a-3p, miRNA378a-3p) in ProtheraCytes® exosomes. RTqPCR_exosomes derived from ProtheraCytes® from FHD (n=5) and AMI patients (n=1). Pt F+Cell = patient_positive_fraction_cells, Pt F+Exo = patient_positive_fraction_exosomes, Pt F-Cell = patient_negative_fraction_cells, Pt F-Exo = patient_negative_fraction_exosomes. [Figure 21] Figure 1 shows miRNA expression analyzed in CD34+ cells (ProtheraCytes®) and ProtheraCytes®-derived exosomes (exosomes, nanovesicles produced by ProtheraCytes®) from seven patients (062, 065, 066, 068, 072, 079, 081) after 9 days of culture. Pro-angiogenic miRNAs: miR126, miR130a, miR21, miR26a, miR378a; anti-apoptotic effects of miRNAs: miR146a, miR21; miRNAs that increase cardiomyocyte proliferation: miR199a, miR590; anti-fibrotic miRNA: miR133a. [Figure 22] Figure 1 shows a comparison of the average miRNA expression obtained in exosomes produced by ProtheraCytes® with the average miRNA expression obtained in ProtheraCytes® for the seven patients analyzed (062, 065, 066, 068, 072, 079, 081). [Figure 23]Figure 23A shows VEGF (fg / cell) secreted by CD34+ cells isolated from selected patients in the EXCELLENT clinical trial. Figure 23B shows the absolute change (pg / mL) in N-terminal prohormone of brain natriuretic peptide (NT-proBNP) and the level of VEGF secretion / cell (fg / cell) in 13 patients after 6 months of CD34+ cell administration compared to baseline. The graph shows a negative correlation between VEGF secretion / cell (fg / cell) and N-terminal prohormone of brain natriuretic peptide (NT-proBNP) (pg / mL). DETAILED DESCRIPTION OF THE INVENTION

[0032] We have shown that CD34+ cells secrete vascular endothelial growth factor (VEGF) and that the level of VEGF present in the cell culture supernatant after expansion correlates closely with the total number of CD34+ cells. We have also shown that CD34+ cells and CD34+-derived exosomes contain proangiogenic miRNAs (miR126, miR130a, miR378a, miR26a), antiapoptotic miRNAs (miR21 and miR146a), miRNAs that promote myocardial regeneration (miR199a and miR590), and antifibrotic miRNA (miRNA133a).

[0033] Determination of the amount of VEGF expressed by a CD34+ cell population and / or the miRNAs expressed by a CD34+ cell population can therefore be used as part of a potency assay for selecting CD34+ cells. Such potency assays may form part of an approved process for advanced medical products such as the isolated CD34+ cells of the present invention.

[0034] Potency assays are important quality control measures required to determine whether the expanded cells have the characteristics that result in the desired effect. For example, the desired characteristic may be the ability to promote cardiac and vascular regeneration. Potency assays allow for rapid measurement of potency before release for injection in clinics.

[0035] definition "CD34+ cells" are progenitor cells that can differentiate into all types of blood cells and endothelial cells. CD34+ cells are mobilized from bone marrow to peripheral blood by administration of hematopoietic growth factors. Total CD34+ cells represent approximately 0.5-1% of all bone marrow-derived mononuclear cells. CD34+ cells include hematopoietic stem / progenitor cells (HSPCs) and endothelial progenitor cells (EPCs). HSPCs can differentiate into all blood cell types, and EPCs can differentiate into endothelial cells. CD34+ cells grow in suspension culture. CD34+ cells can also be obtained from umbilical cord blood.

[0036] "VEGF" (vascular endothelial growth factor) is a potent pro-angiogenic growth factor known to stimulate the formation of new blood vessels.

[0037] "ProtheraCytes®" is the Applicant's trade name for purified CD34+ cells for use in therapeutic applications. ProtheraCytes® are human autologous CD34+ cells expanded according to a GMP automated manufacturing process designed for large-scale clinical production. ProtheraCytes® is registered as an ATMP, or Advanced Therapeutic Medicinal Product, under the classification of a Tissue Engineered product by the European Medicines Agency.

[0038] "StemXpand®" is the trade name for an incubator system for the automated expansion of cells such as CD34+ cells. The StemXpand® system is described in US10676705B2.

[0039] "StemFeed®" (Eurobio, France) is the trade name of a proprietary medium for the expansion of CD34+ cells, containing basal IMDM medium, human plasma, and a cytokine mix.

[0040] "MicroRNAs" (miRNAs) are small non-coding RNAs that influence gene expression.

[0041] Isolation of CD34+ cells The CD34+ cells can be obtained from a whole blood sample. The whole blood sample can be obtained from a donor subject. The donor subject can be a human. The donor subject can be a human in need of treatment. The donor subject can be a human in need of treatment for myocardial infarction. The CD34+ cells can also be obtained from umbilical cord blood. The CD34+ cells can be autologous or allogeneic CD34+ cells.

[0042] The whole blood sample may be obtained after mobilization of granulocyte colony-stimulating factor (G-CSF). The whole blood sample may be subjected to erythrocyte sedimentation. The whole blood sample may be subjected to isolation of total nucleated cells. Isolation of total nucleated cells may follow the gelatin method, in which the whole blood sample is mixed with a gelatin solution and allowed to stand for a period of time to induce sedimentation of red blood cells. Red blood cells remaining in the pellet may be mixed with gelatin and allowed to stand for a second period of time. After sedimentation, the supernatant may be centrifuged to pellet all nucleated cells. After centrifugation, CD34+ cells may be purified by immunoselection. Immunoselection may be performed by any known method, for example, using the CliniMACS system (magnetic-activated cell sorting).

[0043] Cultivation or expansion of CD34+ cells The purified CD34+ cells can be cultured or expanded before and / or after determining the amount of VEGF expressed by the CD34+ cell population, detecting miRNAs expressed by the CD34+ cell population, and selecting the CD34+ cell population. The CD34+ cells can be cultured or expanded for 5 to 12 days. The CD34+ cells can be cultured or expanded for 5, 6, 7, 8, 9, 10, 11, or 12 days. The CD34+ cells can be cultured or expanded for 9 days. The CD34+ cells can be cultured or expanded at 37°C. The CD34+ cells can be cultured or expanded in a controlled atmosphere of 5% CO2. The CD34+ cells can be cultured or expanded in culture medium containing various concentrations of cytokines, such as interleukin 6 (IL6), interleukin 3 (IL3), stem cell factor, thrombopoietin, and Fms-like tyrosine kinase 3 ligand. The cells can be cultured or expanded at any suitable concentration, for example, 2.5 x 10 5 Can be cultured at 1000 cells / mL.

[0044] The methods of the invention can be performed with human autologous CD34+ cells, such as ProtheraCytes®, grown according to a GMP automated manufacturing process designed for large-scale clinical production.

[0045] Determination of VEGF expression The amount of VEGF expressed by the CD34+ cell population can be determined by any known means, such as Western blot, enzyme-linked immunosorbent assay (ELISA), ELLA system (Bio-Techne's automated immunoassay platform), fluorescence-linked immunosorbent assay (FLISA), competitive assay, radioimmunoassay, lateral flow immunoassay, flow-through immunoassay, electrochemiluminescence assay, nephelometry-based assay, nephelometry-based assay, or fluorescence-activated cell sorting (FACS)-based assay. Determining the amount of VEGF can be by mass spectrometry. Determining the amount of VEGF can be by radioimmunoassay. Preferably, determining the amount of VEGF is by ELISA. For example, determining the amount of VEGF expressed by the CD34+ cell population can involve one or more of the following: - collecting the supernatant from the CD34+ cell culture; - storing the supernatant; - measuring VEGF using an ELISA kit, such as the QuantiGlo ELISA Kit (R&D Systems, MN, USA), for example with SpectraMax L (Molecular Devices, San Jose, CA, USA), according to the manufacturer's instructions, or using a Simple Plex Cartridge Kit containing VEGF-A for use with Human Cell Supernatant, with the ELLA Protein Simple system (Bio-Techne).

[0046] A negative control, such as culture medium such as StemFeed® medium, may be used. A positive control, such as Immunoassay Control Set 732 for Human VEGF (R&D Systems), may be used. The amount of VEGF expressed by a CD34+ cell population can be determined by measuring the concentration of VEGF released by the cells into the cell culture medium. The amount of VEGF expressed by a CD34+ cell population can be determined by measuring the concentration of VEGF contained in CD34+ cell-derived exosomes. The CD34+ cell culture, or a portion thereof, may be centrifuged to determine the concentration of VEGF present in the supernatant. For example, approximately 50 ml of supernatant can be obtained and frozen in smaller aliquots. Typically, 50 μL of sample per well can be used in an ELISA assay.

[0047] CD34+ cells can be selected according to the present method if the amount of VEGF expressed by the cells in the culture medium is a quantitative indicator of biological and / or therapeutic activity or efficacy. For example, CD34+ cells can be selected according to the present method if the amount of VEGF expressed by the cells in the culture medium is at least about 1, 5, 10, 20, 25, 50, 75, 100, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 200 pg / ml. CD34+ cells can be selected according to the present method if the amount of VEGF present in the cell culture medium or supernatant of a CD34+ cell culture is at least 25 pg / ml. CD34+ cells can be selected according to the present method if the amount of VEGF present in the cell culture medium or supernatant of a CD34+ cell culture is at least 50 pg / ml. CD34+ cells can be selected according to this method if the amount of VEGF present in the cell culture medium or supernatant of the CD34+ cell culture is at least 150 pg / ml. When the concentration of VEGF contained in exosomes derived from CD34+ cells is measured, selection can be based on any threshold value disclosed herein.

[0048] The amount of VEGF expressed by a CD34+ cell population can be determined by measuring the amount of VEGF expressed per cell. A CD34+ cell culture, or a portion thereof, can be centrifuged, and the amount of VEGF present in the supernatant can be determined. The number of CD34+ cells can be counted by any known method, such as flow cytometry, and the amount of VEGF can be expressed per cell. CD34+ cells can be selected if the amount of VEGF expressed per cell is at least about 0.5 fg, at least about 1 fg, at least about 1.5 fg, at least about 2 fg, at least about 2.5 fg, or at least about 3 fg. CD34+ cells can be selected if the amount of VEGF expressed per cell is at least about 1 fg.

[0049] CD34+ cells can be selected for use in treatment.

[0050] Detection of miRNA expression A sample of CD34+ cells may be taken for miRNA analysis after culturing or expanding as described above.

[0051] Expression of miRNAs in CD34+ cell populations can be detected by measuring miRNA expression in CD34+ cells and / or exosomes derived from CD34+ cells. MiRNAs can be isolated from exosomes and / or cells and measured.

[0052] Exosomes can be purified by centrifuging CD34+ cells to remove cells and cell debris. The resulting supernatant can then be centrifuged again to pellet the exosomes. For example, 50 mL of culture supernatant can be collected and frozen into smaller aliquots. A smaller volume, e.g., 200 μL, can be used to extract miRNA from exosomes. miRNA can then be extracted from exosomes by any known method, e.g., using a commercially available miRNA extraction kit. miRNA can be extracted from CD34+ cells by any known method, e.g., using a commercially available miRNA extraction kit. An example of a commercially available miRNA extraction kit is the miRNeasy® kit from Qiagen®.

[0053] MiRNAs can be detected and / or quantified by any known method. For example, miRNAs can be detected and quantified by quantitative real-time PCR (RT-qPCR), digital PCR, microarrays, QuantiGene® miRNA (Affymetrix, Life-Technologies) luminescence, and / or high-throughput small RNA sequencing. An example of a commercially available kit for detecting and quantifying miRNAs is the miRCURY LNA miRNA PCR kit from Qiagen®. Suitable primers available from Qiagen® include YP00204230 (miR-21-5p), YP00206023 (miR-26a-5p), YP00204227 (miR-126-3p), YP002046658 (miR-130a-3p), YP00204788 (miR-133a-3p), YP00204688 (miR146a-5p), YP00204536 (miR-199a-3p), YP00205946 (miR-378a-3p), and YP00205448 (miR-590-3p). qPCR data can be normalized to the value of miR-let7a-5p (YP00205727). Relative miRNA expression is calculated as 2 -ΔΔCtIt can be calculated using the method.

[0054] The miRNAs disclosed herein can be detected, for example, by detecting either the 3p and / or 5p miRNA strands. For example, the miRNAs disclosed herein can be detected via either of the following strands: miR126-3p UCGUACCGUGAGUAAUAAUGCG (SEQ ID NO: 1) miR126-5p CAUUAUUACUUUUGGUACGCG (SEQ ID NO: 10) miR130a-3p CAGUGCAAUGUUAAAAGGGCAU (SEQ ID NO: 2) miR130a-5p GCUCUUUUCACAUUGUGCUACU (SEQ ID NO: 11) miR21-3p CAACACCAGUCGAUGGGCUGU (SEQ ID NO: 16) miR21-5p UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO: 3) miR26a-3p CCUAUUCUUGGUUACUUGCACG (SEQ ID NO: 17) miR26a-5p UUCAAGUAAUCCAGGAUAGGCU (SEQ ID NO: 4) miR378a-3p ACUGGACUUGGAGUCAGAAGGC (SEQ ID NO: 5) miR378a-5p CCUCCUGACUCCAGGUCCUGUGU (SEQ ID NO: 12) miR146a-3p CCUCUGAAAUUCAGUUCUUCAG (SEQ ID NO: 18) miR146a-5p UGAGAACUGAAUUCCAUGGGUU (SEQ ID NO: 6) miR199a-3p ACAGUAGUCUGCACAUUGGUUA (SEQ ID NO: 7) miR199a-5p CCCAGUGUUCAGACUACCUGUUC (SEQ ID NO: 13) miR590-3p UAAUUUUAUGUAUAAGCUAGU (SEQ ID NO: 8) miR590-5p GAGCUUAUUCAUAAAAGUGCAG (SEQ ID NO: 14) miR133a-3p UUUGGUCCCCUUCAACCAGCUG (SEQ ID NO: 9) miR133a-5p AGCUGGUAAAAUGGAACCAAAU (SEQ ID NO: 15)

[0055] Selection of CD34+ cells based on miRNA expression CD34+ cells can be selected if miRNAs indicative of biological and / or therapeutic activity or efficacy are detected. For example, CD34+ cells can be selected if expression of one or more or each of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR199a, miR590, and miR133a is detected.

[0056] CD34+ cells may be selected if expression of one or more or each of miR126, miR130a, miR21, miR26a, and miR378a is detected.

[0057] CD34+ cells may be selected if expression of one or more or each of miR21, miR26a, and miR378a is detected.

[0058] CD34+ cells can be selected if expression of miR146a and / or miR21 is detected.

[0059] CD34+ cells can be selected if expression of miR199a and / or miR590 is detected.

[0060] CD34+ cells can be selected if expression of miR133a is detected.

[0061] CD34+ cells can be selected for use in treatment.

[0062] Determination of VEGF expression and detection of miRNA expression The methods of the present invention may include both (a) detecting one or more microRNAs expressed by a CD34+ cell population and / or contained in their exosomes, and (b) determining the amount of VEGF expressed by the CD34+ cell population. In this embodiment, the selection of cells is based on the one or more microRNAs and the amount of VEGF expressed by the population. Steps (a) and (b) can be performed sequentially in any order or in parallel. In this embodiment, the amount of expressed VEGF can be determined as described elsewhere herein. In this embodiment, the microRNA can be detected as described elsewhere herein.

[0063] CD34+ cells can be selected if (i) miRNAs indicative of biological and / or therapeutic activity or efficacy are detected, and (ii) the amount of VEGF expressed by the cells is indicative of biological and / or therapeutic activity or efficacy.

[0064] CD34+ cells can be selected if the VEGF threshold disclosed herein is met and if the presence of one or more microRNAs (or any combination of microRNAs) disclosed herein is detected. CD34+ cells can be selected for use in treatment.

[0065] Additional processing steps After selection of the CD34+ cells as described above, the CD34+ cells can be subjected to further processing steps, such as purification and / or immunoselection.

[0066] CD34+ cells can be immunoselected, for example, using magnetically activated cell sorting. The immunoselected CD34+ cells can then be resuspended in a buffer. The buffer can be 4% albumin in saline. The buffer can be phosphate-buffered saline (PBS) / 2% human serum albumin (HSA).

[0067] The processing can be to form a product suitable for use in a method of treatment. For example, ProtheraCytes® are CD34+ cells that have been processed to form a product suitable for use in a method of treatment. ProtheraCytes® is registered as an ATMP (Advanced Therapeutic Medicinal Product) under the classification of tissue-engineered products by the European Medicines Agency.

[0068] Isolated cell populations The present invention further provides a population of isolated CD34+ cells selected by any of the methods disclosed herein. The selected cells may have any of the characteristics of CD34+ cells disclosed herein. For example, the cells may express a certain amount of VEGF as disclosed herein. The cells may express one or more microRNAs as disclosed herein. The population of cells may be provided as a composition containing a suitable excipient. The composition may include, for example, PBS and / or human serum albumin.

[0069] Treatment method The cells obtained by the method of the present invention can be used in therapy. For example, the cells can be used in the treatment of myocardial infarction. The cells can be administered by intracardiac injection. The cells can promote functional and structural cardiac regeneration of ischemic lesions after myocardial infarction. The administration of the cells of the present invention can reduce NT-proBNP in the treated subject.

[0070] Incorporation by Reference All documents cited herein are incorporated by reference to the fullest extent permitted by law. [Example]

[0071] Example 1 Obtaining CD34+ cells Patient Samples, Healthy Donors, and Cell Production Centers AMI patients and healthy male volunteers were enrolled in this study after approval by the French regulatory authority, the Agency for Medicines and Healthcare Products Safety (Agence Nationale de Sécurite du Medicament et des produits de sante), and the local ethics committee. All participants provided signed informed consent. Each participant initially received 10 μg / kg of G-CSF (lenograstim) subcutaneously (sc) once daily for 4 days. On the morning of the 5th day, a 440 ml ± 10 ml whole blood (WB) sample was drawn by simple venipuncture, collected in a blood bag, and rapidly transported to the cell production center at room temperature. After storing the WB sample overnight at 4°C–8°C, the manufacturing process began on the 6th day using the StemXpand automated integrated system and StemPack disposable kits developed by CellProthera.

[0072] Preparation of ProtheraCytes Starting with the initial WB sample, red blood cell (RBC) sedimentation was performed using the gelatin method to isolate total nucleated cells (TNC). Briefly, 440 ml of a 1:1 WB / phosphate-buffered saline solution (PBS, Macopharma, Mouveau, France) was mixed with 440 ml of 4% gelatin (Gelofsin, BBraun, Melsungen, Germany) in two 600 ml transfer bags, and the bags were left for 20 minutes to allow RBC sedimentation. The remaining RBCs in the pellet were mixed again with 4% gelatin for a second 20-minute sedimentation period. The two supernatants were pooled and centrifuged at 400 g for 10 minutes at room temperature to pellet TNC, from which basal (b)-CD34+ stem cells (SCs) were purified using the CliniMACS system (magnetic-activated cell sorting, Miltenyi Biotec, Bergisch Gladbach, Germany). Bags containing purified b-CD34+ SC suspensions or thawed frozen healthy donor (FHD) CD34+ cells (Lonza) were immediately connected to the machine kit and subjected to a 9-day culture period in our proprietary StemFeed medium in a StemXpand incubator, where the expansion process was automatically programmed and controlled as follows: First, a predetermined volume of StemFeed culture medium, a cytokine mix (composed of various concentrations of interleukin [IL]6, IL3, stem cell factor, thrombopoietin, and Fms-like tyrosine kinase 3 ligand), and CD34+ SCs were sequentially dispensed into a dedicated culture bag placed on a stirrer within the device incubator. The bag was then gently agitated for 30 seconds to disperse the cell mixture, which was then incubated at 37°C in a 5% CO2 controlled atmosphere for the 9-day cell expansion period without any further intervention. At the end of the incubation, the cell suspension was dispersed by gentle agitation, and then the agitator tray was adjusted to an 80° tilt so that the cell suspension was distributed in equal volumes into the two collection bags. After dispersing the cell suspension and tilting the agitator tray by 50°, samples were collected and analyzed for sterility on days 0 and 7.

[0073] At the end of the 9-day period, the culture product was harvested, centrifuged, and immunoselection was performed using the CliniMACS system to purify the expanded (e)CD34+ SC, which constituted the final product (ProtheraCytes®), resuspended once in 15 ml of PBS / 2% human serum albumin (HSA) and conditioned in three syringes of 5 ml each.

[0074] Example 2 Quantification of VEGF The concentration of vascular endothelial growth factor (VEGF) secreted by CD34+ cells from patients with myocardial infarction in the cell culture supernatant (EXCELLENT study) was measured after 9 days of cell growth.

[0075] In this assay, the following were tested: - 16 CD34+ cell culture supernatants from AMI patients in the EXCELLENT study - Cell culture supernatant from 4 CD34+ FHD (frozen healthy donors) - Three StemFeed® media as negative controls - One "Control Set 732 for Human VEGF" as a positive control

[0076] Materials and Methods Three assays were performed in triplicate according to MOP_PRD-047 quantification of VEGF concentrations using Bio-Techne's Human VEGF QuantiGlo ELISA kit.

[0077] [Table 1]

[0078] The plate layout was as follows: - Standard range samples made from human VEGF standards diluted to 0, 6.4, 32, 160, 800, 4000, 20000 pg / mL; - "0 Standard" value: using RD5L Calibration Diluent, - Blank: Use RD1-8 diluted solution of the test sample; - Negative Control StemFeed® Sample: Batch: - 166304 - 824938 - 230438 - Patient samples: supernatant samples collected immediately after expansion of CD34+ cells from patients 049, 052, 055, 056, 065, 066, 068, 072, 076, 078, 079 and 081; Healthy donor samples: Supernatant samples collected immediately after expansion of frozen healthy donor CD34+ cells (FHD_Lonza) in: - StemFeed® Batch 24938 Stability Control Assay at T12M - StemFeed® Batch 952451 Stability Control Assay at T14M - Three batches of cytokine mix comparison assay K0321 vs I2120_proliferation I2120 - Three batches of StemFeed® stability control assays at T0M 230438

[0079] The plate layout is shown in Figure 1.

[0080] result Assay 1 The table below shows the values ​​obtained in triplicate for each sample analyzed.

[0081] [Table 2]

[0082] The standard curve obtained from these values ​​is shown in Figure 2a. The value obtained for the coefficient R^2 (0.994) is a value >0.98, confirming the validity of the obtained standard curve.

[0083] [Table 3]

[0084] [Table 4]

[0085] [Table 5]

[0086] [Table 6]

[0087] [Table 7]

[0088] Assay 2 The table below shows the values ​​obtained in triplicate for each sample analyzed.

[0089] [Table 8]

[0090] The standard curve obtained from these values ​​is shown in Figure 2b. The value obtained for the coefficient R^2 (0.998) is a value >0.98, confirming the validity of the obtained standard curve.

[0091] [Table 9]

[0092] [Table 10]

[0093] [Table 11]

[0094] [Table 12]

[0095] Assay 3 The table below shows the values ​​obtained in triplicate for each sample analyzed.

[0096] [Table 13]

[0097] In Table 13 below, the CVs are recalculated.

[0098] [Table 14]

[0099] The standard curve obtained from these values ​​is shown in Figure 2c. The value obtained for the coefficient R^2 (0.996) is a value >0.98, confirming the validity of the obtained standard curve.

[0100] [Table 15]

[0101] [Table 16]

[0102] [Table 17]

[0103] [Table 18]

[0104] Analysis and findings Assay 1 VEGF concentration The mean of triplicate measurements of VEGF concentrations in 9-day culture supernatants obtained from frozen healthy donor CD34+ cells (FHD) and CD34+ cells from patients with myocardial infarction are shown in the table below.

[0105] [Table 19]

[0106] [Table 20]

[0107] These results are also shown in FIG. - The VEGF concentration (human VEGF) measured in the positive control is 2488.9 ± 208.1 pg / mL. This concentration is within the specifications provided by Bio&Techne for this control. The value should be between 1551 and 2838 pg / mL. - VEGF concentrations measured in the negative control (StemFeed® medium only) StemFeed® Lot 166304: 2.8±0.9 pg / mL; StemFeed® Lot 824938: 3.3 ± 0.0 pg / mL; - StemFeed® Lot 230438: 3.3 ± 0.0 pg / mL is. - VEGF concentrations measured in the supernatants after 9 days of expansion of the patients' CD34+ cells ranged from 190.1 ± 4.8 pg / mL (patient 061) to 891.1 ± 28.1 pg / mL (patient 065). - VEGF concentrations measured in supernatants after 9 days of expansion of CD34+ cells from healthy donors ranged from 329.6 ± 18.8 pg / mL (FHD_1) to 777.7 ± 35.1 pg / mL (FHD_2).

[0108] The mean VEGF concentrations obtained from CD34+ cell expansion in 4 healthy donors, 16 patients, and 3 culture media only (StemFeed® without cytokines) as a negative control are shown in Table 20 below.

[0109] [Table 21]

[0110] The mean VEGF concentration obtained from four healthy donors (FHD) was 562.3 ± 216.7 pg / mL, with the minimum being 329.6 pg / mL (FHD_1) and the maximum being 777.7 pg / mL (FHD_2). The mean VEGF concentration obtained from the 16 patients was 588.8±237.5 pg / mL, with a minimum of 190.1 pg / mL (patient 052) and a maximum of 891.1 pg / mL (patient 065). The mean VEGF concentration obtained from the three StemFeed® culture media (negative controls) was 3.1±0.3 pg / mL, with the lowest value being 2.8 pg / mL (StemFeed® Lot 166304) and the highest value being 3.3 pg / mL (StemFeed® Lot 824938 and Lot 230438), the values ​​assigned when the luminometer displays "Range?"

[0111] Finally, there is a significant difference between the VEGF concentrations in the patient's supernatant and the VEGF concentrations in StemFeed® culture medium alone (Mann-Whitney test, p=0.0021, Figure 4A), but no significant difference was observed when comparing the VEGF concentrations in the patient's supernatant with those in the healthy donor's supernatant (t-test, p=0.8420, Figure 4B).

[0112] Correlation between VEGF concentrations and the number of CD34+ cells obtained after expansion Table 21 below shows ProtheraCytes® production data from patients in the EXCELLENT trial.

[0113] [Table 22]

[0114] These results are also shown in FIG.

[0115] Figure 5A demonstrates that the curve obtained for VEGF concentration in the supernatant is similar to the curve for the number of CD34+ cells obtained after 9 days of cell expansion. Figure 5B shows that there is a significant positive correlation between VEGF concentration and CD34+ cell number after expansion (Pearson's correlation coefficient = 0.7902, p-value = 0.0003).

[0116] Assay 2 VEGF concentration The mean values ​​of triplicate measurements of VEGF concentrations in 9-day culture supernatants of CD34+ cells from patients with myocardial infarction and frozen healthy donor CD34+ cells (FHD) were determined and are shown in Tables 22 and 23 below.

[0117] [Table 23]

[0118] [Table 24]

[0119] These results are also shown in FIG. - The VEGF concentration (human VEGF) measured in the positive control is 2583.4 ± 51.0 pg / mL. This concentration is within the specifications provided by Bio&Techne for this control. The value should be between 1551 and 2838 pg / mL. - VEGF concentrations measured in the negative control (StemFeed® medium only) StemFeed® Lot 166304: 2.6 ± 2.4 pg / mL; StemFeed® Lot 824938: 2.2±1.8 pg / mL; - StemFeed® Lot 230438: 3.3 ± 0.0 pg / mL is. - VEGF concentrations measured in the supernatants after 9 days of expansion of the patients' CD34+ cells ranged from 165.7 ± 13.0 pg / mL (patient 061) to 1156.6 ± 151.9 pg / mL (patient 045). - VEGF concentrations measured in supernatants after 9 days of expansion of CD34+ cells from healthy donors ranged from 279.3 ± 12.1 pg / mL (FHD_1) to 670.4 ± 11.3 pg / mL (FHD_2).

[0120] The mean VEGF concentrations obtained from CD34+ cell expansion in 4 healthy donors, 16 patients, and 3 culture media only (StemFeed® without cytokines) as a negative control are shown in Table 24 below.

[0121] [Table 25]

[0122] The mean VEGF concentration obtained from four healthy donors (FHD) was 469.1 ± 213.0 pg / mL, with the minimum being 279.3 pg / mL (FHD_1) and the maximum being 670.4 pg / mL (FHD_2). The mean VEGF concentration obtained from the 16 patients was 577.6 ± 257.3 pg / mL, with a minimum of 165.7 pg / mL (patient 061) and a maximum of 1156.6 pg / mL (patient 045). The mean VEGF concentration obtained from the three StemFeed® culture media (negative controls) was 2.7±0.5 pg / mL, with the lowest value being 2.2 pg / mL (StemFeed® Lot 824938) and the highest value being 330 pg / mL (StemFeed® Lot 166304), the values ​​assigned when the luminometer displays "Range?"

[0123] Finally, there is a significant difference between the VEGF concentrations in the patient's supernatant and the StemFeed® culture medium alone (t-test, p=0.0015, see FIG. 7A), but no significant difference was observed when comparing the VEGF concentrations in the patient's supernatant with those in the healthy donor's supernatant (t-test, p=0.4484, see FIG. 7B).

[0124] Correlation between VEGF concentrations and the number of CD34+ cells obtained after expansion Table 25 below shows ProtheraCytes® production data from patients in the EXCELLENT trial.

[0125] [Table 26]

[0126] These results are also shown in FIG.

[0127] Figure 8A demonstrates that the curve obtained for VEGF concentration in the supernatant is similar to the curve for CD34+ cell numbers obtained after 9 days of cell expansion. Figure 8B shows that there is a significant positive correlation between VEGF concentration and CD34+ cell numbers after expansion (Pearson's correlation coefficient r = 0.6645, p value = 0.0050).

[0128] Assay 3 VEGF concentration The mean values ​​of triplicate measurements of VEGF concentrations in 9-day culture supernatants of CD34+ cells from patients with myocardial infarction and frozen healthy donor CD34+ cells (FHD) were determined and are shown in Tables 26 and 27 below.

[0129] [Table 27]

[0130] [Table 28]

[0131] These results are also shown in FIG. - The VEGF concentration (human VEGF) measured in the positive control is 2557.1 ± 76.1 pg / mL. This concentration is within the specifications provided by Bio&Techne for this control. The value should be between 1551 and 2838 pg / mL. - VEGF concentrations measured in the negative control (StemFeed® medium only) StemFeed® Lot 166304: 2.5±2.0 pg / mL; StemFeed® Lot 824938: 3.6±1.0 pg / mL; - StemFeed® Lot 230438: 1.7 ± 1.3 pg / mL is. - VEGF concentrations measured in the supernatants after 9 days of expansion of the patients' CD34+ cells ranged from 201.1 ± 7.6 pg / mL (patient 061) to 1127.0 ± 64.8 pg / mL (patient 045). - VEGF concentrations measured in supernatants after 9 days of expansion of CD34+ cells from healthy donors ranged from 337.1 ± 40.5 pg / mL (FHD_1) to 706.9 ± 43.1 pg / mL (FHD_2).

[0132] The mean VEGF concentrations obtained from CD34+ cell expansion in 4 healthy donors, 16 patients, and 3 culture media only (StemFeed® without cytokines) as a negative control are shown in Table 28 below.

[0133] [Table 29]

[0134] The mean VEGF concentration obtained from four healthy donors (FHD) was 517.4 ± 196.4 pg / mL, with the minimum being 337.1 pg / mL (FHD_1) and the maximum being 706.9 pg / mL (FHD_2). The mean VEGF concentration obtained from the 16 patients was 622.3±248.9 pg / mL, with a minimum of 201.1 pg / mL (patient 061) and a maximum of 1127.0 pg / mL (patient 045). The mean VEGF concentration obtained from the three StemFeed® samples was 2.6±1.0 pg / mL, with the lowest being 1.7 pg / mL (StemFeed® lot 230438) and the highest being 3.6 pg / mL (StemFeed® lot 824938).

[0135] Finally, there is a significant difference between the VEGF concentrations in the patient's supernatant and the StemFeed® culture medium alone (t-test, p=0.0006, see FIG. 10A), but no significant difference was observed when comparing the VEGF concentrations in the patient's supernatant with the VEGF concentrations in the supernatants of healthy donors (t-test, p=0.4458, see FIG. 10B).

[0136] Correlation between VEGF concentrations and the number of CD34+ cells obtained after expansion Table 29 below shows ProtheraCytes® production data from patients in the EXCELLENT trial.

[0137] [Table 30]

[0138] This data is also shown in FIG.

[0139] Figure 11A demonstrates that the curve obtained for VEGF concentration in the supernatant is similar to the curve for CD34+ cell numbers obtained after 9 days of cell expansion. Figure 11B shows that there is a significant positive correlation between VEGF concentration and CD34+ cell numbers after expansion (Pearson's correlation coefficient r=0.7448, p-value=0.0009).

[0140] Average results of three assays (1, 2, and 3) VEGF concentration

[0141] [Table 31]

[0142] [Table 32]

[0143] These results are also shown in FIG. - The VEGF concentration (human VEGF) measured in the positive control is 2543.0 ± 48.5 pg / mL. This concentration is within the specifications provided by Bio&Techne for this control. The value should be between 1551 and 2838 pg / mL. - VEGF concentrations measured in the negative control (StemFeed® medium only) StemFeed® Lot 166304: 2.6 ± 0.1 pg / mL; StemFeed® Lot 824938: 3.1±07 pg / mL; - StemFeed® Lot 230438: 2.8 ± 0.9 pg / mL is. - VEGF concentrations measured in the supernatants after 9 days of expansion of the patients' CD34+ cells ranged from 185.6 ± 18.1 pg / mL (patient 061) to 1032.4 ± 190.4 pg / mL (patient 045). - VEGF concentrations measured in supernatants after 9 days of expansion of CD34+ cells from healthy donors ranged from 315.3 ± 31.4 pg / mL (FHD_1) to 718.3 ± 54.6 pg / mL (FHD_2).

[0144] The mean VEGF concentrations obtained from CD34+ cell proliferation in 4 healthy donors, 16 patients, and 3 culture media only (StemFeed® without cytokines) as a negative control are shown in Table 32 below.

[0145] [Table 33]

[0146] The mean VEGF concentration obtained from four healthy donors (FHD) in three trials was 516.2 ± 208.1 pg / mL, with a minimum of 315.3 pg / mL (FHD_1) and a maximum of 718.3 pg / mL (FHD_2). The mean VEGF concentration obtained from the 16 patients was 596.2 ± 242.3 pg / mL, with a minimum of 185.6 pg / mL (patient 061) and a maximum of 1032.4 pg / mL (patient 045). The mean VEGF concentration obtained from the three StemFeed® samples was 2.8±0.2 pg / mL, with a minimum of 2.7 pg / mL and a maximum of 3.1 pg / mL.

[0147] Finally, there is a significant difference between the VEGF concentrations in the patient's supernatant and the StemFeed® culture medium alone (t-test, p=0.0007, FIG. 13A), but no significant difference was observed when comparing the VEGF concentrations in the patient's supernatant with those in the healthy donor's supernatant (t-test, p=0.5534, FIG. 13B).

[0148] Correlation between VEGF concentrations and the number of CD34+ cells obtained after expansion Table 33 below shows ProtheraCytes® production data from patients in the EXCELLENT trial.

[0149] [Table 34]

[0150] This data is also shown in FIG.

[0151] Figure 14A demonstrates that the curve obtained for VEGF concentration in the supernatant is similar to the curve for CD34+ cell number obtained after 9 days of cell expansion. Figure 14B shows that there is a significant positive correlation between VEGF concentration and CD34+ cell number after expansion (Pearson's correlation coefficient = 0.7484, p value = 0.0009).

[0152] Finally, statistical analysis shows that there is no significant difference when comparing the three assays (p=0.8686, ANOVA test). See Table 34. Shapiro-Wilk test results: Data in bold shown in Table 34 below represent p-values ​​<0.05 and do not follow a normal distribution.

[0153] Data were compared using the Shapiro-Wilk test followed by: - t-test if the data follow a normal distribution - Mann-Whitney test if the data do not follow a normal distribution.

[0154] [Table 35]

[0155] The data curves obtained from the three assays are shown in FIG.

[0156] conclusion Three experiments were performed under identical conditions with the same operator and facilitator to quantify the concentration of VEGF secreted by CD34+ cells in cell culture supernatants after 9 days of cell growth. The mean of these concentrations was calculated for each sample analyzed.

[0157] This quantification was performed using the following VEGF: - VEGF secreted by CD34+ cells: - 16 patients with myocardial infarction (EXCELLENT trial), - 4 healthy donors, - VEGF in Stemfeed® culture medium before expansion (as a negative control) Quantification of the concentration of: - The concentration of secreted VEGF in the culture supernatants of patients' CD34+ cells ranged from 185.6 pg / mL to 1032.4 pg / mL, with a mean of 596.2 ± 242.3 pg / mL. - The concentration of secreted VEGF in the culture supernatant of healthy donor cells ranged from 315.3 pg / mL to 718.3 pg / mL, with a mean of 526.2 ± 208.1 pg / mL. - VEGF concentrations found in StemFeed® culture medium (negative control) before expansion varied from 2.7 pg / mL to 3.0 pg / mL, with a mean value of 2.8 ± 0.2 pg / mL.

[0158] These results show that high VEGF concentrations (mean 596.2 ± 242.3 pg / mL) were found in the supernatants after expansion of patients' CD34+ cells: - When this concentration was compared with the VEGF concentration in the supernatant of CD34+ cells from healthy donors (mean 526.2 ± 208.1 pg / mL), no significant difference was observed. When this concentration was compared with the concentration determined in StemFeed® culture medium alone (2.8±0.2 pg / mL), a significant difference was found (t-test, p=0.0007).

[0159] Furthermore, the concentration of VEGF in the culture supernatant of the patients' CD34+ cells significantly correlated with the number of CD34+ cells obtained after expansion (Pearson's correlation coefficient r = 0.7484, p value = 0.0009), thus supporting the secretion of VEGF by these CD34+ cells.

[0160] Finally, when comparing the three assays, statistical analysis showed no significant differences (ANOVA test, p=0.8686).

[0161] Correlation of secreted VEGF amount per cell with clinical endpoints method The ongoing EXCELLENT trial (EUDRACT 2014-001476-63) is investigating the use of autologous peripheral blood (PB)-CD34+ cells isolated from patients with acute myocardial infarction (AMI), expanded using the automated StemXpand® device and StemPack® production kit developed by CellProthera, and then injected transendocardially.

[0162] The amount of VEGF secreted by CD34+ cells isolated from 13 patients in the study was measured (see Figure 23a). In the same 13 patients, the change in NT-proBNP after 6 months of CD34+ cell administration compared to baseline was measured.

[0163] Spearman rank correlation was performed between the amount of VEGF secreted per cell (fg / cell) and interim analyses of different clinical endpoints of the EXCELLENT clinical trial.

[0164] result A significant negative correlation was found between VEGF secretion per cell (fg / cell) and N-terminal prohormone of brain natriuretic peptide (NT-proBNP) (pg / mL), a predictor of death, cardiovascular events, and heart failure. Spearman correlation (95% Cl) = -0.69 (-0.90, -0.22), p-value = 0.0057 (see Figure 23b). These results indicate that increased VEGF secretion by CD34+ cells (ProtheraCytes) correlates with lower NT-proBNP levels and improvement in AMI patients. This indicates that VEGF is a useful indicator of CD34+ cell efficacy and can be used as a marker for selecting CD34+ cells for treatment. Furthermore, all patients receiving expanded autologous CD34+ cells secreting at least 1.3 fg / cell of VEGF showed improvement in NT-proBNP levels. For example, even the patient with the lowest VEGF secretion (1.3 fg / cell) had a 1066 pg / mL decrease in NT-proBNP at 6 months compared to baseline, suggesting that CD34+ cells secreting approximately 1 fg of VEGF per cell may be therapeutically advantageous.

[0165] Example 3 MicroRNA Research The aim of this technical example was to analyze the expression of the following miRNAs in CD34+ cells (ProtheraCytes®) and ProtheraCytes®-derived exosomes (exosomes: nanovesicles produced by ProtheraCytes®) from seven patients (062, 065, 066, 068, 072, 079, 081) from the EXCELLENT clinical trial after 9 days of culture: - Pro-angiogenic miRNAs, e.g., miR126, miR130a, miR21, miR26a, miR378a - Anti-apoptotic miRNAs, e.g., miR146a, miR21 - miRNAs that increase cardiomyocyte proliferation: miR199a, miR590 - Anti-fibrotic miRNAs, e.g., miR133a

[0166] Materials and Methods Exosome Production Protocol Cells were cultured in cytokine cocktail and conditioned medium of StemSpan-AOF (StemCell Technologies, BC, Canada, Reference No. 100-0130).

[0167] Cultivation of cells from frozen cells Under a laminar flow hood, 20 mL of StemSpan-AOF medium was prepared in a 50 mL tube. Cells were removed from liquid nitrogen, placed on ice, and then thawed in a 37°C water bath. Once the cells were thawed, the cell vial was disinfected with 70% alcohol and the cells were transferred to a 50 mL tube containing 20 mL of StemSpan-AOF medium. The tube was centrifuged at 300 g for 10 minutes.

[0168] Under a laminar flow hood, the supernatant was removed and the cell pellet was resuspended in 1 mL of conditioned medium. 6 The cells were cultured in 10 mL of conditioned medium in a T25 flask and incubated at 37°C, 5% CO2 for 40-48 hours.

[0169] Culturing cells from fresh cells The tube containing the fresh cells was centrifuged at 400 g for 10 min. Under a laminar flow hood, the supernatant was removed and the cell pellet was resuspended in 1 mL of conditioned medium. 2.5 x 10 cells were collected. 6 The cells were cultured in 10 mL of conditioned medium in a T25 flask and incubated at 37°C, 5% CO2 for 40-48 hours.

[0170] Exosome Purification Protocol by Precipitation Exosomes were purified by precipitation from ExoQuick-TC™ (System Biosciences, CA, USA, reference number: EXOTC50A-1). 1. Centrifuge 10 mL of cell suspension at 3000 g for 15 minutes (to remove cells and debris) 2. Transfer the supernatant to a new 15 mL tube and add 2 mL of ExoQuick-Tc solution. 3. Keep the pellet for microRNA extraction: Resuspend the pellet in 260 μL of RTL buffer from the miRNeasy Tissue / Cells Advanced Mini Kit (Qiagen, Reference Number: 217604). 4. Mix by inverting the tube 5. Incubate overnight (at least 12 hours) at +2-8°C (do not agitate / mix the tube during incubation; the tube must remain upright) 6. The next day, centrifuge the tube at 1500g for 30 minutes at room temperature (15-25°C). 7. After centrifugation, exosomes appear as a white / beige pellet. 8. Remove the supernatant (aspirate all traces of solution) 9. Extract microRNA from exosomes: Resuspend the pellet in 200 μL of resuspension buffer for Qiagen's miRNeasy Serum / Plasma or miRNeasy (Qiagen, Reference Number: 217204) protocols. 10. Resuspend the cell pellet in an appropriate volume of sterile PBS (300-500 µL) for flow cytometry analysis

[0171] Protocol for labeling exosomes for flow cytometry I. Control: Preparation of "standard exosome" sample Reconstitution of exosomes: It is recommended to reconstitute the standards with sterile water to a final concentration of 1 μg / μL. - For a 100 μg standard, add 100 μL of sterile water - Easy to vortex and centrifuge - Make 5-7 μL aliquots - Store at -80°C

[0172] II. Labeling of CD63+ / CD81+ / CD34+ exosomes - Day 1 1. Prepare the starting suspension of the standard exosome control: a) 5 μL of standard exosomes + 95 μL of water for injection, final concentration 0.05 μg / μL 2. Resuspend the CD63 capture beads by vortexing for approximately 20 seconds. 3. Add 50 μL of CD63 capture beads to: a) Tube 1 <<Background noise_CD63 capture beads>> b) Tube 2 <<Control - Exosome standard>> CD81 FITC (indirect labeling) c) Tube 3-1: <<Exosome ProtheraCytes>> CD81 FITC (indirect labeling) d) Tube 3-2: Exosome ProtheraCytes CD34 PE (direct labeling) e) Tube 3-3: <<Exosome ProtheraCytes>> CD81 FITC (indirect labeling) CD34 PE (direct labeling) f) Tube 4-1: <<Exosome fraction negative>> CD81 FITC (indirect labeling) g) Tube 4-2: <<Exosome fraction negative>> CD34 PE (directly labeled) h) Tube 4-3: <<Exosome fraction negative>> CD81 FITC (indirect labeling) CD34 PE (direct labeling) 4. Resuspend the IgG1 capture beads: by vortexing for approximately 20 seconds and adding 50 μL of "IgG1 capture beads" to the following two FACS tubes: a) Tube 5 → Exosome ProtheraCytes® IgG1-PE (direct labeling) b) Tube 6 → Exosome ProtheraCytes® IgG1-FITC (indirect labeling) 5. Prepare compensation tube: Add 50 µL of CD63 capture beads to: a) Tube 7 → (CD63 beads + exosomes ProtheraCytes®) b) Tube 8 → (CD63 beads + exosomes ProtheraCytes® + CD81 FITC) c) Tube 9 → (CD63 beads + exosomes ProtheraCytes® + 34 PE) 6. Add 100 μL of exosome suspension to: a) Tube 2 → Exosome standard b) Tube 3 → Exosomes ProtheraCytes® c) Tube 4 → Exosome fraction negative d) Tubes 5 and 6 → Exosomes ProtheraCytes® e) Tube 7 → Exosomes ProtheraCytes® f) Tube 8 → Add 100 μL of exosomes ProtheraCytes® g) Tube 9 → Add 100 μL of exosomes ProtheraCytes® 7. Mix the suspension by gently pipetting several times and vortexing for a few seconds. 8. Incubate overnight in the dark at room temperature (RT).

[0173] III. Labeling of CD63+ / CD81+ / CD34+ exosomes - Day 2 9. For identification, add antibodies as follows: a) Tube 2: Add 5 μL of CD81-biotin (exosome standard) (indirect labeling) b) Tube 3-1: Add 5 μL of CD81-biotin (exosome ProtheraCytes®) (indirect labeling) c) Tube 3-2: Add 5 μL of CD34-PE (Exosome ProtheraCytes®) (direct labeling) d) Tube 3-3: Add 5 μL of CD81-biotin and 5 μL of CD34-PE (Exosome ProtheraCytes®) (indirect and direct labeling) e) Tube 4-1: Add 5 μL of CD81-biotin (exosome fraction negative) (indirect labeling) f) Tube 4-2: Add 5 μL of CD34-PE (exosome fraction negative) (direct labeling) g) Tube 4-3: Add 5 μL of CD81-biotin and 5 μL of CD34-PE (exosome fraction negative) (indirect and direct labeling) h) Tube 5: Add 5 μL of IgG1-PE (direct labeling) i) Tube 6: Wait for secondary labeling (indirect IgG FITC labeling) j) Tube 8: Add 5 μL of CD81-biotin (Exosome ProtheraCytes®) (indirect labeling) k) Tube 9: Add 5 μL of CD34-PE (Exosome ProtheraCytes®) (direct labeling) 10. Mix by gently tapping the tube 11. Incubate at +2-8°C in the dark for 1 hour. 12. Wash with 1 mL of 1x Assay Buffer 13. Centrifuge the tube at 2500g for 5 minutes at +4°C. 14. Gently remove the supernatant, leaving approximately 100 µL at the bottom of the tube (use a p1000 pipette and gently remove 1 mL) 15. Resuspend the exosomes and beads by adding: i. In the directly labeled tube: 150 μL of Assay Buffer 1X (ImmunoStep, Spain) ii. Secondary signs: 1. Add 5 μL of Streptavidin-FITC to the following tubes: a.2 b. 3-1 c. 3-3 d. 4-1 e. 4-3 f.6 g.8 16. Incubate at +2-8°C in the dark for 30 minutes. 17. Wash by adding 1 mL of Assay Buffer 1x 18. Centrifuge the tubes at 2500g for 5 minutes at +4°C. 19. Gently remove the supernatant, leaving approximately 100 μL at the bottom of the tube (use a p1000 pipette and gently remove 1 mL) 20. Resuspend the exosomes and beads by adding 150 μL of 1x Assay Buffer. 21. Proceed with acquisition on a flow cytometer at medium speed (can wait up to 2 h at +2–8 °C before acquisition)

[0174] Protocol for microRNA analysis by RT-qPCR Exosomes produced by ProtheraCytes®: a) MicroRNA extraction (RNeasy Qiagen®) 1. Transfer 200 μL of serum or plasma to a 2 mL tube. 2. Add 60 μL of Buffer RPL. Close the tube cap and ultra-vortex for 5 seconds. Incubate at room temperature for 3 minutes. 3. Add 20 μL of Buffer RPP. Close the tube cap and mix vigorously by ultra-vortexing for 20 seconds. Incubate at room temperature for 3 minutes. 4. Centrifuge at 12,000 x g for 3 minutes at room temperature to pellet the precipitate. Note: The supernatant will be clear and colorless. 5. Transfer the supernatant (≈230 μL) to a new reaction tube. Add 1 volume of isopropanol. Mix well by vortexing. Transfer the entire sample to an RNeasy UCP MinElute column. Close the lid and centrifuge at ≥8000 x g for 15 seconds. Discard the flow-through. 6. Pipet 700 μL of Buffer RWT into the RNeasy UCP MinElute spin column. Close the lid and centrifuge at ≥8000 x g for 15 seconds. Discard the flow-through. 7. Pipet 500 μL of Buffer RPE into the RNeasy UCP MinElute spin column. Close the lid and centrifuge at ≥8000 x g for 15 seconds. Discard the flow-through. 8. Add 500 μL of 80% ethanol to the RNeasy UCP MinElute spin column. Close the lid and centrifuge at ≥8000 × g for 2 minutes. Discard the flow-through and collection tube. 9. Place the RNeasy UCP MinELute spin column into a new 2 mL collection tube. Open the lid of the spin column and centrifuge at full speed for 5 minutes to dry the membrane. Discard the flow-through and collection tube. 10. Place the RNeasy UCP MinElute spin column in a new 1.5 mL collection tube. Add 20 μL of RNase-free water directly to the center of the spin column membrane and incubate for 1 minute. Close the lid and centrifuge at full speed for 1 minute to elute the RNA. 11. Store the RNA at -80°C.

[0175] b) First-strand cDNA synthesis Rq: RNA spike-in tube for RT is an internal control for extraction and amplification Before you begin: - Thaw on ice - RNA samples - 5x miRCURY RT SYBR Green Reaction Buffer - Add to suspension - RNA spike-in: UnuSp6 spike in 80 μL of RNase-free water - Vortex briefly, centrifuge, and incubate on ice for 20-30 minutes. - Vortex and centrifuge briefly, aliquot, and store at -20°C - Remove the 10x miR CURY Rt Enzyme tube from the freezer. - Mix gently, place on ice, centrifuge briefly, and keep on ice

[0176] 1) Calculate the volume of the RNA sample RNA sample [μl] = elution volume [μl] / starting sample volume × 16 [μl] (1.6=20 / 200×16)

[0177] 2) Prepare the reverse transcription according to Table 35 below.

[0178] [Table 36]

[0179] RT program: - 42°C for 60 minutes - 95°C for 5 minutes - Unlimited at 4°C Freeze at -20°C

[0180] c) Quantitative real-time PCR - First, resuspend the following miRCURY LNA PCR Assays tubes: - UniSp6 Spike-in control PCR Assays - hsa-mi-103a-3p, - miR-130a-3p, - miR126-3p - Centrifuge before opening, add 220 μL of RNAse-free water, vortex and centrifuge for 20 minutes at room temperature - Thaw the following tubes: - 2x miRCURY SYBR Green Master Mix, - cDNA, - LNA PCR Assay tube (spike-in primer Sp6, miR103a-3p, miR130a-3p, miR126-3p, RNAse-free H2O)

[0181] 1. Dilute the cDNA 1:30 (add 290 µL of RNAse-free water to 10 µL of reverse transcription reaction) 2. Prepare the reaction mixture according to Table 36 below.

[0182] [Table 37]

[0183] 3. Addition: - 3 μL of RT product (1:30 dilution) in each well of one PCR plate, - 7 μL mix per well 4. Briefly centrifuge the tubes or plates at room temperature. 5. Program the CFX96 according to Table 37 below.

[0184] [Table 38]

[0185] 6. Place the PCR plate in the CFX96 and start the program. 7. Perform initial analysis using CFX96 software to obtain raw Cq values ​​(Cq or Ct depends on the PCR instrument)

[0186] ProtheraCytes® a) MicroRNA extraction miRNA cells

[0187] RLT buffer (Qiagen (registered trademark)) 260 μL pellet <5 x 10 6 cell Pellet ≥ 5 x 10 in 450 μL 6 cell

[0188] Homogenize by vortexing and pipetting several times and store at -80°C.

[0189] If necessary, thaw the sample and Homogenize by vortexing and pipetting several times.

[0190] QIAshredder column (Qiagen®) Depositing the melt Centrifuge at 12,000 g for 2 minutes at room temperature.

[0191] Add AL buffer 80 μL pellet <5 x 10 6 cell 140 μL pellet ≥ 5 x 10 6 cell Mix by vortexing vigorously and incubate for 3 min at 20 °C.

[0192] Place the eluate onto a gDNA Eliminator column with its 2 mL collection tube Centrifuge at 8000g for 30 seconds

[0193] Add 1 volume of isopropanol (340 μL or 590 μL) Mix by pipetting, do not rotate Place up to 700 µL of filtrate + ethanol onto the RNeasy column. Centrifuge at 8000g for 15 seconds at 20°C. Discard the eluate Repeat the operation as needed

[0194] Apply 700 μL of RWT buffer. Centrifuge at 8000g for 15 seconds at 20°C. Place the column in a new tube

[0195] Add 500 μL of RPE buffer Centrifuge at 8000g for 15 seconds at 20°C. Place the column in a new tube

[0196] Add 500 μL of 80% ethanol Centrifuge at 8000g for 2 minutes at 20°C. Place the column in a new tube Centrifuge at 12,000 g for 1 minute to elute the RNA.

[0197] Place the column in a new, sterile 1.5 mL microfuge tube. Add 35 μL of RNAse-free water Incubate at room temperature for 1 minute Centrifuge at 12,000 g for 1 minute to elute the RNA.

[0198] Reverse pass the eluate through the RNeasy column Centrifuge at 8000g and 80°C for 1 minute. Store RNA at -80°C

[0199] b) First-strand cDNA synthesis Optimized protocol for use with 20 ng of RNA in reverse transcription For highly expressed miRNAs: Use up to 10 pg of total RNA For lowly expressed miRNAs: Use up to 200 ng of total RNA.

[0200] Before you begin: - Thaw on ice - RNA samples - 5x miRCURY RT SYBR Green Reaction Buffer - Thaw RNAse-free water on ice at room temperature - Mix each solution by scraping the tube - Vortex briefly, centrifuge, and incubate on ice for 20-30 minutes. - Add to suspension - RNA spike-in: UniSp6 RNA spike in 80 μL of RNAse-free water - Vortex briefly, centrifuge, and incubate on ice for 20-30 minutes. - Vortex and centrifuge briefly, aliquot, and store at -20°C - Remove 10x miR CURY Rt Enzyme tubes from the freezer - Mix gently, place on ice, centrifuge briefly, and keep on ice

[0201] 1) Dilute the RNA sample to 5ng / µL in RNAase-free water. 2) Prepare RT according to Table 38 below.

[0202] [Table 39]

[0203] RT program: - 42°C for 60 minutes - 95°C for 5 minutes - Unlimited at 4°C

[0204] c) Quantitative real-time PCR - First, resuspend the miRCURY LNA PCR Assay tubes as follows: - UniSp6 spike-in control PCR assay - hsa-miR-103a-3p - miR130a-3p - miR126-3p - Before opening, centrifuge, add 220 μL of RNAse-free water, and leave at room temperature for 20 minutes. - Easy to vortex and centrifuge - Thaw the following tubes: - 2x miRCURY SYBR Green Master Mix - cDNA - LNA PCR assay - RNase-free H2O

[0205] 1) Dilute the cDNA 1:60 (add 590 µL of RNase-free water to 10 µL of RT reaction) 2) Prepare the reaction mixture according to Table 39 below.

[0206] [Table 40]

[0207] 3) Addition: - 3 μL of RT product (1:60 dilution) per well of one PCR plate - 7 μL mix per well 4) Briefly centrifuge the tube or plate at room temperature. 5) Program the CFX96 according to Table 40 below.

[0208] [Table 41]

[0209] 6. Place the PCR plate in the CFX96 and start the program. 7. Perform initial analysis using CFX96 software to obtain raw Cq values ​​(Cq or Ct depends on the PCR instrument)

[0210] Overview of the test conducted

[0211] [Table 42]

[0212] [Table 43]

[0213] result Flow cytometry analysis of exosomes from experimental studies 4, 5, 6, 7, and 8

[0214] [Table 44]

[0215] ProtheraCytes® exosomes (positive fraction) express exosome-specific membrane markers (CD63, CD81) and the CD34 marker of the cells from which they are derived (Figure 16A). As expected, exosomes in the negative fraction express low levels of the CD34 marker (Figure 16B).

[0216] Expression of pro-angiogenic microRNAs in CD34+ cell-derived exosomes and cells Housekeeping gene expression: Three housekeeping genes (miR-103a, Iet7a-5p, and U6) were analyzed to determine which would be best for analyzing the miRNA of interest. The results can be seen in Figure 17 and show that U6 is unstable; therefore, this housekeeping gene was not retained for this analysis.

[0217] Pro-angiogenic microRNA expression I. Results for Patient 081 of the EXCELLENT Study - Experimental Study 7: Three pro-angiogenic miRNAs were analyzed: - miRNA126 - miRNA130a - miRNA378a

[0218] The results of pro-angiogenic miRNAs in ProtheraCytes® exosomes from AMI patient 081 are shown in Figure 18, where the figure symbols are as follows: - Pt F+Cell=Patient_Positive Fraction_Cells - Pt F+Exo = Patient positive fraction exosomes - Pt F-Cell=Patient_Negative Fraction_Cells - Pt F-Exo = Patient Negative Fraction Exosomes

[0219] The pro-angiogenic miRNAs 126, 130a, and 378a are more highly expressed in ProtheraCytes® exosomes than in cells.

[0220] Analysis with the Iet7a-5p housekeeping gene showed better results for microRNA expression and was retained for analysis. For the same microRNA in the positive fraction, when its expression in exosomes (Pt F+Exo) is compared with the expression of this microRNA in cells (Pt F+Cell), the results are as follows: - miRNA 126 is 3.3 times more expressed in exosomes than in cells - miRNA 130a is 5.4 times more expressed in exosomes than in cells - miRNA 378a is 2.4 times more expressed in exosomes than in cells

[0221] These results are consistent with those previously published by Sahoo et al., 2011: "Exosomes From Human CD34+ Stem Cells Mediate Their Proangiogenic Paracrine Activity" (Circ Res., 2011, September 16, 109(7):724-8).

[0222] II. Results of healthy donors (FHD) in experimental studies 4, 5, 6, and 8 Pro-angiogenic miRNA results in ProtheraCytes® exosomes from healthy donors (FHD)—experimental studies 4, 5, 6, and 8 are shown in FIG. 19, where the figure symbols are as follows: - Pt F+Cell=Patient_Positive Fraction_Cells - Pt F+Exo = Patient positive fraction exosomes - Pt F-Cell=Patient_Negative Fraction_Cells - Pt F-Exo = Patient Negative Fraction Exosomes - C4.1- MicroRNA Research 4_FHD (Figure 19A) - Assay_Cytokine Comparison-1-K0321-12120 - C5.1- MicroRNA Research 5_FHD (Figure 19B) - Assay_Cytokine Comparison-2-K0321-12120 - C6.1- MicroRNA Research 6_FHD (Figure 19C) - Assay_Cytokine Comparison-3-K0321-12120 - C8.1- MicroRNA Research 8_FHD (Figure 19D) - Assay_Stability_SF 279511 TOM

[0223] Finally, analysis of the average microRNA expression (FHD+ patients) with the Iet7a-5p housekeeping gene showed that in the positive fraction for the same microRNA, when its expression in exosomes is compared with the expression of the microRNA in cells, the results were as follows: - No difference in miRNA 126 expression - miRNA 130a is 3.8 times more expressed in exosomes than in cells - miRNA 378a is 1.8 times more expressed in exosomes than in cells

[0224] This data for pro-angiogenic miRNAs in ProtheraCytes® exosomes, along with ProtheraCytes® RTqPCT_exosomes from FHD (n=5) and AMI patients (n=1), is shown in Figure 20 and Table 43 below.

[0225] The symbolic solution for Figure 20 is as follows: - Pt F+Cell=Patient_Positive Fraction_Cells - Pt F+Exo = Patient positive fraction exosomes - Pt F-Cell=Patient_Negative Fraction_Cells - Pt F-Exo = Patient Negative Fraction Exosomes

[0226] [Table 45]

[0227] III. MicroRNA Results for Patients 062, 065, 066, 068, 072, 079, and 081 (EXCELLENT Study) - Experimental Study 9 Previous studies have shown that human adult CD34+ cells secrete exosomes containing high levels of pro-angiogenic microRNAs, such as pro-angiogenic microRNAs 126 and 130a (Sahoo et al., 2011).

[0228] To investigate this, we analyzed the expression of the following miRNAs in CD34+ cells (ProtheraCytes®) and ProtheraCytes® exosomes (exosomes: nanovesicles produced by ProtheraCytes®) from seven patients (062, 065, 066, 068, 072, 079, 081) after 9 days of culture: - Pro-angiogenic miRNAs: miR126-3p, miR130a-3p, miR21, miR26a, miR378a - Anti-apoptotic effects of miRNAs: miR146a, miR21 - miRNAs that increase cardiomyocyte proliferation: miR199a, miR590 - Anti-fibrotic miRNA: miR133a

[0229] The results for microRNA are shown in Figures 21 and 22.

[0230] Comparison of the average miRNA expression obtained in these ProtheraCytes®-produced exosomes with the average miRNA expression obtained with ProtheraCytes® for the seven patients analyzed (Figure 22) shows the following: - miR-130a is 6.9 times more expressed in exosomes - miR-126 is 4.4 times more expressed in exosomes - miR-378a is 3.2 times more expressed in exosomes - miR-21 is 12.1 times more expressed in exosomes - miR-26a is 3.2 times more expressed in exosomes - miR-133a is 2.7 times more expressed in exosomes - miR-146a is 3.5 times more expressed in exosomes - miR-199a is 4.6 times more expressed in exosomes - miR-590 is 13.5 times more expressed in exosomes

[0231] conclusion Proangiogenic, antiapoptotic, and other miRNAs with roles in myocardial regeneration are expressed in exosomes derived from expanded CD34+ cells obtained from patients with acute myocardial infarction (AMI). Increasing evidence demonstrates that miRNAs play essential roles in myocardial regeneration.

[0232] miRNAs function in cardiac repair by regulating angiogenesis, proliferation, apoptosis, and metabolism. Previous studies have shown that exosomes secreted by human adult CD34+ stem cells contain high levels of pro-angiogenic microRNAs, such as pro-angiogenic microRNAs 126 and 130a (Sahoo et al., 2011).

[0233] To investigate this, we analyzed the expression of the following miRNAs in CD34+ cells (ProtheraCytes®) and ProtheraCytes® exosomes (exosomes: nanovesicles produced by ProtheraCytes®) from seven patients (062, 065, 066, 068, 072, 079, 081) from the EXCELLENT clinical trial after 9 days of culture: - Pro-angiogenic miRNAs, e.g., miR126, miR130a, miR21, miR26a, miR378a - Anti-apoptotic miRNAs, e.g., miR146a, miR21 - miRNAs that increase cardiomyocyte proliferation: miR199a, miR590 - Anti-fibrotic miRNAs, e.g., miR133a

[0234] Results showed that ProtheraCytes® exosomes had significantly higher expression of all analyzed miRNAs, except miR133a, than ProtheraCytes® cells. Expression of miR-126, miR-130a, miR-21, miR-26, and miR-378a supports the pro-angiogenic effect of ProtheraCytes®-derived exosomes.

[0235] These results indicate that ProtheraCytes® can secrete exosomes containing pro-angiogenic miRNAs, which can induce angiogenesis and contribute to the vascular repair process after AMI. These results further suggest that ProtheraCytes® can protect cardiomyocytes from apoptosis immediately after AMI through the secretion of exosomes containing multiple anti-apoptotic miRNAs.

[0236] (References)

[0237] Embodiments of the present invention are presented in the following numbered paragraphs:

[0238] 1. An in vitro method for selecting CD34+ cells, comprising: (i) determining the amount of VEGF expressed by the CD34+ cell population; and (ii) selecting CD34+ cells based on the amount of VEGF expressed by the population A method comprising:

[0239] 2. The method of paragraph 1, wherein the CD34+ cells are selected if the amount of VEGF expressed by the cells in the culture medium is at least about 150 pg / ml.

[0240] 3. The method of paragraph 1, wherein the CD34+ cells are selected if the amount of VEGF expressed by the cells is at least about 1 fg / cell.

[0241] 4. An in vitro method for selecting CD34+ cells, comprising: (i) detecting one or more microRNAs expressed by and / or contained in the exosomes of a CD34+ cell population; and (ii) selecting CD34+ cells based on one or more microRNAs expressed by the population A method comprising:

[0242] 5. An in vitro method for selecting CD34+ cells, comprising: (i) detecting one or more microRNAs expressed by and / or contained in the exosomes of a CD34+ cell population and determining the amount of VEGF expressed by the CD34+ cell population; and (ii) selecting CD34+ cells based on the amount of one or more detected microRNAs and VEGF expressed. A method comprising:

[0243] 6. The method of paragraph 4 or paragraph 5, wherein CD34+ cells are selected if expression of one or more or each of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR199a, miR590, and miR133a is detected.

[0244] 7. The method according to item 6, wherein CD34+ cells are selected if expression of one or more or each of miR126, miR130a, miR21, miR26a, and miR378a is detected.

[0245] 8. The method of paragraph 6 or paragraph 7, wherein CD34+ cells are selected if expression of one or more or each of miR21, miR26a, and miR378a is detected.

[0246] 9. The method according to item 6, wherein CD34+ cells are selected if expression of miR146a and / or miR21 is detected.

[0247] 10. The method according to item 6, wherein CD34+ cells are selected if expression of miR199a and / or miR590 is detected.

[0248] 11. The method of any one of paragraphs 1 to 10, wherein the CD34+ cells are human CD34+ cells.

[0249] 12. The method of any one of paragraphs 1 to 11, wherein the CD34+ cells are autologous or allogeneic CD34+ cells.

[0250] 13. The method of any one of paragraphs 1 to 12, further comprising expanding the CD34+ cell population before and / or after step (i) or (ii).

[0251] 14. The method of paragraph 13, wherein the cells are grown for 9 days.

[0252] 15. Multiplication - growth at 37°C, - Growth in a controlled atmosphere of 5% CO2, and / or - growth in culture medium containing cytokines such as interleukin 6 (IL6), interleukin 3 (IL3), stem cell factor, thrombopoietin, and / or Fms-like tyrosine kinase 3 ligand Item 15. The method of item 13 or 14, comprising one or more of:

[0253] 16. The method of any one of paragraphs 1 to 15, wherein the amount of VEGF is determined by ELISA or automated ELISA (ELLA).

[0254] 17. The method of any one of paragraphs 1 to 16, wherein the amount of VEGF is determined by mass spectrometry.

[0255] 18. The method of any one of paragraphs 1 to 16, wherein the amount of VEGF is determined by radioimmunoassay.

[0256] 19. The method of any one of paragraphs 1 to 16, wherein the amount of VEGF is determined by a multiplex assay.

[0257] 20. The method of any one of paragraphs 1 to 19, further comprising the step of harvesting, centrifuging, and / or purifying the selected cells, optionally wherein the purification is by immunoselection.

[0258] 21. The method of any one of paragraphs 1 to 20, wherein the cells are for use in treatment.

[0259] 22. An isolated population of CD34+ cells selected by the method of any one of paragraphs 1 to 21.

[0260] 23. An isolated population of CD34+ cells selected by the method of any one of paragraphs 1 to 21 for use in therapy.

[0261] 24. An isolated CD34+ cell population selected by the method of any one of paragraphs 1 to 21 for use in the treatment of myocardial infarction.

[0262] 25. The isolated population of CD34+ cells of paragraph 23 or 24, wherein administration of the CD34+ cells to a subject reduces NT-proBNP in the subject.

Claims

1. 1. An in vitro method for selecting CD34+ cells, comprising: (i) determining the amount of VEGF expressed by the CD34+ cell population; and (ii) selecting CD34+ cells based on the amount of VEGF expressed by the population A method comprising:

2. 2. The method of claim 1, wherein the CD34+ cells are selected if the amount of VEGF expressed by the cells is at least about 1 fg / cell.

3. 1. An in vitro method for selecting CD34+ cells, comprising: (i) detecting one or more microRNAs expressed by and / or contained in the exosomes of a CD34+ cell population; and (ii) selecting CD34+ cells based on one or more microRNAs expressed by the population A method comprising:

4. 1. An in vitro method for selecting CD34+ cells, comprising: (i) detecting one or more microRNAs expressed by and / or contained in the exosomes of a CD34+ cell population and determining the amount of VEGF expressed by the CD34+ cell population; and (ii) selecting CD34+ cells based on the amount of one or more detected microRNAs and VEGF expressed. A method comprising:

5. 5. The method of claim 3 or claim 4, wherein CD34+ cells are selected if expression of one or more or each of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR199a, miR590, and miR133a is detected.

6. 6. The method of any one of claims 1 to 5, wherein the CD34+ cells are human CD34+ cells and / or the CD34+ cells are autologous or allogeneic CD34+ cells.

7. 7. The method of any one of claims 1 to 6, further comprising expanding the CD34+ cell population before and / or after step (i) or (ii), optionally wherein the cells are expanded for 9 days.

8. The proliferation - growth at 37°C, - 5% CO 2 and / or - growth in culture medium containing cytokines such as interleukin 6 (IL6), interleukin 3 (IL3), stem cell factor, thrombopoietin, and / or Fms-like tyrosine kinase 3 ligand 8. The method of claim 7, comprising one or more of:

9. 9. The method of claim 1, wherein the amount of VEGF is determined by ELISA, automated ELISA (ELLA), mass spectrometry, radioimmunoassay, or multiplex assay.

10. 10. The method of any one of claims 1 to 9, further comprising the step of harvesting, centrifuging, and / or purifying the selected cells, optionally wherein the purification is by immunoselection.

11. 11. The method of any one of claims 1 to 10, wherein the cells are for use in treatment.

12. 12. An isolated population of CD34+ cells selected by the method of any one of claims 1 to 11.

13. 12. An isolated population of CD34+ cells selected by the method of any one of claims 1 to 11 for use in therapy.

14. 12. An isolated CD34+ cell population selected by the method of any one of claims 1 to 11 for use in the treatment of myocardial infarction.

15. 15. The isolated CD34+ cell population of claim 13 or 14, wherein administration of the CD34+ cells to a subject reduces NT-proBNP in the subject.

Images