Novel CD19 binders, CAR-T constructs containing same, and methods of use thereof

A novel CAR design with defined CDR sequences and domain composition enhances the safety and efficacy of CAR-T cell therapy by addressing immunogenicity and toxicity issues, improving treatment outcomes for B cell malignancies.

JP2025536940APending Publication Date: 2025-11-12KITE PHARMA INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025522544
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-21
Filing Date
2023-10-18
Publication Date
2025-11-12

AI Technical Summary

Technical Problem

Existing CAR-T cell therapies for treating B cell malignancies face issues of immunogenicity, toxicity, and tumor recurrence, limiting their therapeutic index and efficacy.

Method used

Development of a chimeric antigen receptor (CAR) comprising a specific anti-CD19 binding domain, transmembrane domain, costimulatory domain, and intracellular signaling domain, utilizing defined CDR sequences and protein domains to enhance the safety and efficiency of CAR-T cell therapy.

Benefits of technology

The novel CAR design reduces adverse side effects and improves the therapeutic index of CAR-T cell therapy, making it more effective and safer for treating B cell malignancies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025536940000001_ABST
    Figure 2025536940000001_ABST
Patent Text Reader

Abstract

The present disclosure relates to a chimeric antigen receptor (CAR) specific for CD19, a vector encoding the same, and recombinant T cells comprising the CD19 CAR. The present disclosure also includes a method of administering genetically modified T cells expressing a CAR comprising a CD19 binding domain.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] cross reference This application claims priority to U.S. Provisional Application No. 63 / 417,220, filed October 18, 2022, and U.S. Provisional Application No. 63 / 426,967, filed November 21, 2022, the contents of which are incorporated herein by reference for all purposes.

[0002] Technical Field The present invention relates generally to T cells engineered to express chimeric antigen receptors (CARs) for the treatment of diseases associated with expression of cluster of differentiation 19 protein (CD19). [Background technology]

[0003] Recent developments using chimeric antigen receptor (CAR)-modified autologous T cell (CAR-T) therapy, which relies on redirecting T cells to appropriate cell surface molecules on cancer cells, such as B cell malignancies, have shown promising results in harnessing the power of the immune system to treat B cell malignancies and other cancers. Clinical results with murine-derived CAR-T19 (i.e., "CTL019") have shown promise in establishing complete remissions not only in pediatric acute lymphoblastic leukemia (ALL) patients but also in chronic lymphocytic leukemia (CLL) patients. Despite the clinical success of various CD19 CAR-T cell therapies, the therapeutic index of these therapies remains low due to issues of immunogenicity, toxicity associated with CAR-T cell infusion, and tumor recurrence. Summary of the Invention [Problem to be solved by the invention]

[0004] Thus, there is an urgent need in the art for novel approaches that overcome or mitigate the adverse side effects of CAR-T cell therapy and enable more effective, safe, and efficient adoptive immunotherapy. The present disclosure addresses this need. [Means for solving the problem]

[0005] One aspect of the present disclosure provides an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR) comprising, consisting of, or consisting essentially of a single chain antibody or single chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory, and an intracellular signaling domain. In some embodiments, the anti-CD19 binding domain comprises: (a) a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO:1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO:2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO:3; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO:4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO:5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:6; and a heavy chain variable domain consisting of SEQ ID NO.4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO:5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:6; or (b) a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO:193, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO:5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:6. (c) a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain consisting of heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198; or (c) a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2. A heavy chain variable domain containing CDR3).

[0006] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:7 or 199; or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO:7 or 199.

[0007] In some embodiments, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:8 or 200; or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO:8 or 200.

[0008] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:7 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:8. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:200. In some embodiments, the CD19 binding domain is an scFv.

[0009] In some embodiments, the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146.

[0010] In some embodiments, the anti-CD19 binding domain comprises: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO.216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:120 Sequences having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0011] In some embodiments, the anti-CD19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by: (a) SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or (b) SEQ ID NOs:19-24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO: A sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0012] In some embodiments, the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T-cell receptor, CD2, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.

[0013] In some embodiments, the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO:29, 31, or 33, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:29, 31, or 33.

[0014] In some embodiments, the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO:30, SEQ ID NO:32, or SEQ ID NO:34, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30, 32, or 34.

[0015] In some embodiments, the transmembrane domain comprises a CD8 transmembrane domain and / or the amino acid sequence of SEQ ID NO:29; or an amino acid sequence having about 90% to about 99% identity to SEQ ID NO:29. In some embodiments, the transmembrane domain comprises the nucleic acid sequence of SEQ ID NO:30, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30. In some embodiments, the anti-CD19 binding domain is linked to the transmembrane domain by a hinge region.

[0016] In some embodiments, the hinge region is derived from a protein selected from the group consisting of: (a) an antibody Fc fragment, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, an IgG hinge, a CD8 hinge, and any combination thereof; or (b) comprises the amino acid sequence of SEQ ID NO:27 or SEQ ID NO:35, or a sequence having about 90% to about 99% identity to SEQ ID NO:27 or 35.

[0017] In some embodiments, the hinge region comprises a CD8 hinge region and / or the amino acid sequence of SEQ ID NO:27, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:27.

[0018] In some embodiments, the hinge region comprises a nucleic acid sequence selected from SEQ ID NO:28, or SEQ ID NO:36, or a sequence having about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:28 or 36.

[0019] In some embodiments, the costimulatory domain is a functional signaling domain of a protein selected from the group consisting of a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137).

[0020] In some embodiments, the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, or SEQ ID NO:50, or a sequence having about 90% to about 99% identity to SEQ ID NO:37, 39, 41, 43, 46, 48, or 50.

[0021] In some embodiments, the costimulatory domain comprises a nucleic acid sequence selected from SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:49, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38, 40, 42, 44, 45, 47, or 49.

[0022] In some embodiments, the intracellular signaling domain comprises a signaling domain of a protein selected from the group consisting of CD3 zeta, FcyRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.

[0023] In some embodiments, the intracellular signaling domain comprises the intracellular signaling domain of CD3 zeta, the amino acid sequence of SEQ ID NO:52 or 54, or a sequence having about 90% to about 99% identity to SEQ ID NO:52 or 54.

[0024] In some embodiments, the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO:53 or 55, or a sequence with about 90% to about 99% identity to SEQ ID NO:53 or 55. In some embodiments, the CAR comprises a functional 4-1BB costimulatory domain and a functional CD3 zeta intracellular signaling domain. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54, or a sequence with about 90% to about 99% identity to the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54.

[0025] In some embodiments, the intracellular signaling domain comprises the sequence of SEQ ID NO:37 and the sequence of SEQ ID NO:52 or SEQ ID NO:54, or a sequence having about 90% to about 99% identity to SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54. In such embodiments, the sequences are expressed in the same frame as a single polypeptide chain.

[0026] In some embodiments of the isolated nucleic acid molecules disclosed herein, (a) the nucleic acid sequence comprises the sequence of SEQ ID NO:38, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38, and / or (b) the sequence of SEQ ID NO:53 or SEQ ID NO:55, or a sequence having about 90% to about 99% identity to SEQ ID NO:53 or 55.

[0027] In some embodiments of the isolated nucleic acid molecules disclosed herein, the CAR further comprises a leader sequence. In some embodiments, the leader sequence comprises the amino acids of SEQ ID NO:25.

[0028] Another aspect of the present disclosure provides an isolated nucleic acid molecule comprising: (a) an scFv comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain comprises: (i) an LC CDR1 of SEQ ID NO:1, an LC CDR2 of SEQ ID NO:2, and an LC CDR3, HC CDR1 of SEQ ID NO:4, an HC CDR2 of SEQ ID NO:5, and an HC CDR3 of SEQ ID NO:6; or (ii) an LC CDR1 of SEQ ID NO:193, an LC CDR2 of SEQ ID NO:194, an LC CDR3 of SEQ ID NO:195; an HC CDR2 of SEQ ID NO:196, an HC CDR2 of SEQ ID NO:197, and an HC CDR3 of SEQ ID NO:198; or (iii) any LC CDR1, LC CDR2, LC CDR3, HC CDR1, HC CDR2, and HC CDR disclosed in Table 2. CDR3; (b) a transmembrane domain selected from CD28 or a CD8 transmembrane domain; (c) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (d) an intracellular signaling domain comprising CD3-zeta or FcR gamma.

[0029] Another embodiment of the present disclosure provides an isolated nucleic acid molecule comprising: (a) an scFv comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain is selected from SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain selected from CD28 or a CD8 transmembrane domain; (c) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (d) an intracellular signaling domain comprising CD3-zeta or FcR gamma.

[0030] Another embodiment of the present disclosure provides an isolated nucleic acid molecule comprising: (a) an scFv comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain comprises the amino acid sequence of SEQ ID NO:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:29, 31, and 33; (c) a costimulatory domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, and SEQ ID NO:50; and (d) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO:52 or SEQ ID NO:54.

[0031] Another embodiment of the present disclosure provides an isolated nucleic acid molecule comprising: (a) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain comprising the amino acid sequence of SEQ ID NO:29; (c) a costimulatory domain comprising the amino acid sequence of SEQ ID NO:37; and (d) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO:52 or 54.

[0032] In some embodiments, the isolated nucleic acid comprises: (a) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23, and 20; and / or (b) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22, and 19.

[0033] Another aspect of the present disclosure provides isolated polypeptide molecules encoded by the nucleic acid molecules disclosed herein.

[0034] In some embodiments, the isolated polypeptide comprises a sequence selected from the group consisting of SEQ ID NOs: 63, 74, 85, 145, 167, 178, 200, 211, 156, 189, 17, 8, 62, 73, 84, 144, 166, 177, 199, 210, 155, 188, 16, and 7.

[0035] Other aspects of the present disclosure provide chimeric antigen receptors (CARs) comprising a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain, wherein the anti-CD19 binding domain comprises: (a) a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO:1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO:2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO:3; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO:4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO:5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:6; or (b) a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO:193, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO:2, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:6. a light chain variable domain comprising a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198; or (c) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2), and a heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0036] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:7 or 199, or an amino acid sequence having at least about 90% to about 99% identity to SEQ ID NO:7 or 199. In some embodiments, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:8 or 200, or an amino acid sequence having at least about 90% to about 99% identity to SEQ ID NO:8 or 200. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:7 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:8. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:200.

[0037] In some embodiments, the CD19 binding domain is an scFv. In some embodiments, the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146.

[0038] In some embodiments, the anti-CD19 binding domain comprises: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:225, and SEQ ID NO:216. A sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0039] In some embodiments, the anti-CD19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NOs:19-24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO: A sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0040] In some embodiments, the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T-cell receptor, CD2, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.

[0041] In some embodiments, the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO:29, 31, or 33, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:29, 31, or 33.

[0042] In some embodiments, the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO:30, SEQ ID NO:32, or SEQ ID NO:34, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30, 32, or 34.

[0043] In some embodiments, the transmembrane domain comprises a CD8 transmembrane domain and / or the amino acid sequence of SEQ ID NO:29, or an amino acid sequence having about 90% to about 99% identity to SEQ ID NO:29. In some embodiments, the transmembrane domain comprises the nucleic acid sequence of SEQ ID NO:30, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30.

[0044] In some embodiments, the anti-CD19 binding domain is linked to the transmembrane domain by a hinge region. In some embodiments of the CARs disclosed herein, the hinge region is from a protein selected from the group consisting of: (a) an Fc fragment of an antibody, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, an IgG hinge region, a CD8 hinge, and any combination thereof; or (b) comprises SEQ ID NO:27 or SEQ ID NO:35, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:27 or 35.

[0045] In some embodiments, the hinge region comprises a CD8 hinge region and / or the amino acid sequence of SEQ ID NO:27, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:27. In some embodiments, the hinge region comprises a nucleic acid sequence selected from SEQ ID NO:28, or SEQ ID NO:36, or a sequence having about 95%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:28 or 36.

[0046] In some embodiments of the CARs disclosed herein, the costimulatory domain is a functional signaling domain of a protein selected from the group consisting of a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137).

[0047] In some embodiments, the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, or SEQ ID NO:50, or a sequence having about 90% to about 99% identity to SEQ ID NO:37, 39, 41, 43, 46, 48, or 50.

[0048] In some embodiments, the costimulatory domain comprises a nucleic acid sequence selected from SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:47, SEQ ID NO:49, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38, 40, 42, 44, 45, 47, or 49.

[0049] In some embodiments, the intracellular signaling domain comprises a signaling domain of a protein selected from the group consisting of CD3 zeta, FcyRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.

[0050] In some embodiments, the intracellular signaling domain comprises a CD3 zeta intracellular domain, an amino acid sequence of SEQ ID NO:52 or 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:52 or 54.

[0051] In some embodiments, the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO:53 or 55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:53 or 55. In some embodiments, the CAR comprises a functional 4-1BB costimulatory domain and a functional CD3 zeta intracellular signaling domain. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54.

[0052] In some embodiments, the intracellular signaling domain comprises the sequence of SEQ ID NO:37 and the sequence of SEQ ID NO:52 or SEQ ID NO:54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54. In such embodiments, the sequences are expressed in the same frame and as a single polypeptide chain.

[0053] In some embodiments, the nucleic acid sequence comprises the sequence of SEQ ID NO:38, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38, and / or the sequence of SEQ ID NO:53 or SEQ ID NO:55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:53 or 55. In some embodiments, the CAR further comprises a leader sequence. In some embodiments, the leader sequence comprises SEQ ID NO:25.

[0054] One embodiment of the present disclosure provides a chimeric antigen receptor (CAR) comprising: (a) an scFv comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain is selected from the group consisting of (i) a LC CDR1 of SEQ ID NO:1, a LC CDR2 and a LC CDR3 of SEQ ID NO:2, a HC CDR1 of SEQ ID NO:4, a HC CDR2 of SEQ ID NO:5, and a HC CDR3 of SEQ ID NO:6; or (ii) a LC CDR1 of SEQ ID NO:193, a LC CDR2 of SEQ ID NO:194, and a LC CDR3 of SEQ ID NO:195; a HC CDR1 of SEQ ID NO:196, a HC CDR2 of SEQ ID NO:197, and a HC CDR3 of SEQ ID NO:198; any LC CDR1, LC CDR2, LC CDR3, HC CDR1, HC CDR2, and HC CDR3 disclosed in Table 2. CDR3; (b) a transmembrane domain selected from CD28 or a CD8 transmembrane domain; (c) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (d) an intracellular signaling domain comprising CD3-zeta or FcR gamma.

[0055] One embodiment of the present disclosure provides a chimeric antigen receptor (CAR) comprising: (a) SEQ ID NO:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain selected from CD28 or a CD8 transmembrane domain; (c) a costimulatory domain comprising an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (d) an intracellular signaling domain comprising CD3-zeta or FcR gamma.

[0056] One embodiment of the present disclosure discloses a chimeric antigen receptor (CAR) comprising: (a) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:29, 31, and 33; (c) a costimulatory domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, and SEQ ID NO:50; and (d) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO:52 or SEQ ID NO:54.

[0057] Another embodiment of the present disclosure provides a chimeric antigen receptor (CAR) comprising: (a) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain comprising the amino acid sequence of SEQ ID NO:29; (c) a costimulatory domain comprising the amino acid sequence of SEQ ID NO:37; and (d) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO:52 or 54.

[0058] Other aspects of the present disclosure provide chimeric antigen receptors comprising: (a) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23, and 20; and / or (b) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22, and 19.

[0059] Other aspects of the present disclosure provide chimeric antigen receptors comprising a sequence selected from the group consisting of SEQ ID NOs: 63, 74, 85, 145, 167, 178, 200, 211, 156, 189, 17, 8, 62, 73, 84, 144, 166, 177, 199, 210, 155, 188, 16, and 7.

[0060] Other embodiments of the present disclosure provide anti-CD19 binding domains comprising: (a) a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO:1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO:2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO:3; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO:4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO:5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:6; or (b) a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO:193, light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO:194, and SEQ ID NO:195; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (LC CDR1) of SEQ ID NO:196, SEQ ID NO:197, and SEQ ID NO:198; or (c) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2) and a light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2) and a heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0061] In some embodiments, the anti-CD19 binding domain is an scFv comprising: (a) a light chain variable region comprising the amino acid sequence of SEQ ID NO:7 or 199, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:7 or 199; and / or (b) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:8 or 200, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:8 or 200.

[0062] Another aspect of the present disclosure provides a vector comprising the nucleic acid molecule disclosed herein. In some embodiments, the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector. In some embodiments, the vector further comprises a promoter, a rebro-responsive element (RRE), a poly(A) tail, a 3'UTR, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); and / or a cPPT sequence.

[0063] In some embodiments of the vectors disclosed herein, the promoter: (a) is a constitutive promoter; (b) is selected from the group consisting of an EF-1 alpha promoter, a PGK-1 promoter, a truncated PGK-1 promoter, a UBC promoter, a CMV promoter, a CAGG promoter, and an SV40 promoter; (c) is an EF-1 promoter; or (d) comprises the sequence of SEQ ID NO:101.

[0064] In some embodiments, the WPRE comprises the sequence of SEQ ID NO: 100. In some embodiments, the vector is a lentiviral vector. In some embodiments, the vector is an in vitro transcription vector.

[0065] In some embodiments, the vector comprises an isolated nucleic acid molecule disclosed herein operably linked to a nucleic acid sequence encoding a switch receptor and / or a dominant-negative receptor via a linker peptide, wherein the linker peptide: (a) is selected from F2A, E2A, P2A, T2A, or furin-(G4S)2-T2A (F-GS2-T2A); (b) comprises the amino acid sequence of SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, or SEQ ID NO:99; or (c) comprises the nucleic acid sequence of SEQ ID NO:93, 95, 97, or 98.

[0066] Another aspect of the present disclosure provides a modified cell comprising: (a) an isolated nucleic acid molecule disclosed herein; (b) an isolated polypeptide disclosed herein; (c) a CAR disclosed herein; (d) an anti-CD19 binding domain disclosed herein; or (b) a vector disclosed herein. In some embodiments, the modified cell is a modified immune cell, a modified natural killer (NK) cell, a modified natural killer T (NKT) cell, or a modified T cell. In some embodiments, the modified cell is a modified T cell or a modified human T cell. In some embodiments, the modified T cell is a CD8 + In some embodiments, the modified cells are autologous, xenogeneic, or allogeneic cells.

[0067] In some embodiments, the modified cells disclosed herein further comprise: (a) a switch receptor comprising a first polypeptide comprising at least a portion of an inhibitory molecule selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA, bound to a second polypeptide comprising a positive signal from an intracellular signaling domain selected from the group consisting of OX40, CD27, CD28, IL-12R, ICOS, and 4-1BB; (b) a dominant polypeptide comprising a truncated mutant of a receptor selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA. and / or (c) a polypeptide that enhances the function of an immune cell selected from the group consisting of a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19, and combinations thereof, or a functional derivative thereof.

[0068] Another aspect of the present disclosure provides a composition comprising a modified cell or population of modified cells disclosed herein.

[0069] Other aspects of the present disclosure provide methods of making modified cells, comprising transfecting the cell with: (a) an isolated nucleic acid molecule disclosed herein; (b) a nucleic acid encoding a CAR disclosed herein; (c) a nucleic acid encoding an anti-CD19 binding domain disclosed herein; or (d) a vector disclosed herein.

[0070] Other aspects of the present disclosure provide methods of generating a population of RNA-modified cells, comprising transfecting cells with in vitro transcribed or synthetic RNA, wherein the RNA comprises: (a) an isolated nucleic acid molecule disclosed herein; (b) a nucleic acid encoding a CAR disclosed herein; or (c) a nucleic acid encoding an anti-CD19 binding domain disclosed herein.

[0071] Another aspect of the present disclosure provides a method of providing anti-tumor immunity in a mammal, comprising administering to the mammal an effective amount of: (a) a composition comprising modified cells expressing a CAR disclosed herein; (b) a modified cell disclosed herein; or (c) a composition disclosed herein.

[0072] Another aspect of the present disclosure provides a method of treating a mammal having a disease associated with expression of CD19, comprising administering to the mammal an effective amount of: (a) a composition comprising modified cells expressing a CAR disclosed herein; (b) a modified cell disclosed herein; or (c) a composition disclosed herein.

[0073] In some embodiments, the modified cells are autologous modified T cells. In some embodiments, the modified cells are allogeneic modified T cells. In some embodiments, the mammal is a human.

[0074] In some embodiments, the disease associated with expression of CD19 is selected from: (a) a proliferative disease, malignancy, precancerous condition, or non-cancer-related indication associated with expression of CD19; or (b) cancer, atypical cancer and / or non-classical cancer, myelodysplasia, myelodysplastic syndrome, or preleukemia.

[0075] In some embodiments, the disease is a hematological cancer selected from the group consisting of: (a) acute leukemia, chronic leukemia, hematological disorders, and combinations thereof; or (b) B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphoblastic leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell lymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large intestinal ... large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, ineffective production (or dysplasia) of myeloid blood cells, and combinations thereof.

[0076] In some embodiments of the methods of treatment disclosed herein, the modified cells or compositions are administered in combination with: (a) an agent that increases the efficacy of cells expressing a CAR molecule; (b) an agent that ameliorates one or more side effects associated with the administration of cells expressing a CAR molecule; or (c) an agent that treats a disease associated with CD19. [Brief explanation of the drawings]

[0077] [Figure 1] FIG. 1 is a schematic outlining the identification of unique CD19-specific antibody clones from a phage display library following biotinylated baculovirus binding, SIGLEC binding, and / or NALM6 tumor cell selection. [Figure 2A]FIG. 2A shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure. [Figure 2B] FIG. 2B shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure. [Figure 2C] FIG. 2C shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure. [Figure 2D] FIG. 2D shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure. [Figure 2E] FIG. 2E shows an alignment of the nucleic acid sequences of the novel CD19 binders of the present disclosure. [Figure 2F] FIG. 2F shows a percentile matrix showing the similarity of novel binders at the nucleic acid level. [Figure 3] Figures 3A-B are bar graphs quantifying the surface expression and tonic signaling induced by CD19 CARs comprising CD19 binders 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, and 53 (Figure 3A) or optimized CD19 binders 42OP, 43OP, 44OP, 45OP, 46OP, 51OP, and 52OP (Figure 3B). CD19 CARs were transfected into Jurkat-NFAT-GFP reporter cells. Tonic signaling was observed in more than 60% of the transduced cells. Notably, most of the expressed CD19 CARs induced some tonic signaling, except for the original clone 42, which, although highly expressed (74.6%), induced only a negligible tonic signal (1.50%). See also Tables 4 and 11. [Figure 4] Figures 4A-B are line graphs showing the expansion or growth curves (Figure 4A) and average cell size (i.e., shrinkage) (Figure 4B) of T cells from donor ND607 transduced with CARs containing the antigen-binding domains of any of clones 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, and 53 compared to untransduced cells on days 0 (D0), 5 (D5), 7 (D7), 9 (D9), and 11 (D11) post-transduction. [Figure 5]Figure 5A-B are bar graphs quantifying cytokine production (IL-2, TNF-α, IFN-γ) in ND607 CD19 CAR-T cells expressing CARs containing the original CD19 binders 42, 43, 44, 45, 46, and 52 (Figure 5A), and in ND518 CD19 CAR-T cells expressing CARs containing the optimized CD19 binders 42OP, 43OP, 44OP, 45OP, 46OP, and 52OP, after 4 hours of stimulation with Nalm6 9 days after transfection. See also Table 6, Table 14, and Table 24. [Figure 6] Figures 6A-D are graphs showing that the expansion profiles (Figures 6A-B) and mean CAR-T cell sizes (Figures 6C-D) of CAR-T cells expressing CARs containing CD19 binders 42, 43, 44, 45, 46, 50, 51, and 52 were substantially similar over time. CD19 CARs were transduced in ND539 and ND572 donor T cells. The CD19 CAR containing binder 42 (clone 42) showed slightly higher expansion and earlier contraction (e.g., restoring). [Figure 7] Figures 7A-C are bar graphs quantifying the manufacturing expansion of CD19 binder CAR-T cells over time and show that CD19 binder CAR-T cells exhibited similar T cell doublings during manufacturing expansion, with CD19 CAR-T cells expressing CARs containing 42 clones exhibiting the greatest expansion (Figure 7A). In addition, CD19 binder CAR-T cells exhibited a similar percent decrease in the CD4+ T cell population over time (Figures 7B-C). CD19 CAR binders were tested with two different donor T cells, ND539 (Figure 7B) and ND572 (Figure 7C). [Figure 8] Figures 8A-D are graphs showing the change during expansion in the percentage of CD19 CARs containing CD19 binders 42, 43, 44, 46, 50, 51, and 52 staining on T cells from two donors (Figures 8A-B) and in the percentage of CD19 CARs expressed in the CD4+ T cell population (Figures 8C-D). These figures show that the percentage of CD4+ T cells expressing the novel CD19 CAR binders was highest on day 6 but stabilized at subsequent time points. [Figure 9] Figure 9 is a schematic diagram showing the timing of T cell isolation, transduction, and expansion of ND539 donor T cells to evaluate CD19 CARs at the nucleic acid (e.g., RNA) and protein levels. In particular, ND539 donor CAR-T cells expressing CARs containing CD19 binders 42, 43, 44, 45, 46, and 52 were evaluated at the nucleic acid level (RNA) by RT PCR using a primer and probe set for the WPRE sequence, and at the protein level by Western blot, probed with an anti-CD3 zeta antibody. [Figure 10] Figures 10A-B are bar graphs showing the relative fold change over time in total RNA levels for each test CAR containing the disclosed CD19 binders. The RNA was analyzed by real-time PCR on days 6, 9, and 12. Individual "day-by-day" analyses (Figure 10A) and overall comparisons normalized to the positive control (Figure 10B) showed that the CD19 CARs were expressed at relatively similar RNA levels by real-time PCR. Total RNA levels for CARs containing CD19 binder 42 were consistently 1-fold higher than for CARs containing CD19 binders 43, 44, 45, 46, and 52. [Figure 11]Figures 11A-B show Western blot results showing total protein levels of CARs containing the original (Figure 11A) and optimized (Figure 11B) CD19 binders 42, 43, 44, 45, 46, and 52 expressed in T cells from donors ND539 (Figure 11A) and ND518 (Figure 11B). Table 9 shows the raw data of corresponding CAR surface expression on ND539 CD19 CAR-T cells (Figure 11A) analyzed by FACS. Surface and total protein expression levels of CD19 CARs containing the novel CD19 binders did not correlate with the RNA levels shown in Figures 10A-B. Expression levels and size profiles were assessed 6 days post-transduction. Comparing the total protein profiles of the original and optimized CD19 binders suggested that CAR optimization appeared to enhance the expression of CD19 CAR protein isoforms or species with higher molecular weights (e.g., larger bands dominate) for some of the CD19 binders in Figure 11B. [Figure 12] Figures 12A-B are bar graphs showing that anti-FMC63 antibody is not an anti-idiotypic antibody of the novel CD19 binder (Figure 12A) and that anti-FMC63 antibody did not block binding of CD19 CAR to recombinant CD19-GFP molecules (Figure 12B). See also Tables 9-10. Binding of anti-FMC63 antibody or CD19-GFP on ND539 CD19 CAR-T cells containing CD19 binders 42, 43, 44, 45, 46, or 52 is shown 9 days after transfer. [Figure 13]Figure 13 shows the activation kinetics of CARs containing the optimized CD19 binders 42OP, 43OP, 44OP, 45OP, 46OP, 51OP, and 52OP transfected into the Jurkat NFAT-GFP reporter cell line after coculture with Nalm6 cells. A transfection rate of 8-17% was selected for single integration event activation. Activation of the optimized CD19 CAR began approximately 2-3 hours and peaked at approximately 10 hours of coculture with Nalm6 cells. CARs containing the optimized CD19 binder 42 (42OP) exhibited the fastest activation kinetics and the highest level of NFAT induction. CARs containing the CD19 binders 45OP and 52OP exhibited similar, moderate NFAT induction kinetics. CARs containing the CD19 binders 44OP and 46OP exhibited low NFAT induction rates. CARs containing the CD19 binders 43OP and 51OP exhibited minimal NFAT induction. See also Table 12. [Figure 14] Figures 14A-B are bar graphs showing quantification of the percentage of CD4+ and CD8+ T cells that expressed the relevant CD19 CAR at day 11 during the expansion shown in Figure 15. Specifically, the percentages of CD4+ and CD8+ T cells were similar for all optimized CD19 CAR binders tested, regardless of donor. T cells were used from two donors: ND518 (Figure 14A) and ND528 (Figure 14B). See also Table 13. [Figure 15] Figures 15A-D show the expansion profiles of CARs containing optimized CD19 binders transduced in ND518 and ND528 donor T cells. ND518 donor T cells transduced with CARs containing the CD19 binders 42OP, 51OP, or 52OP exhibited the fastest and highest expansion doublings (Figure 15A). ND518 donor T cells transduced with CARs containing the CD19 binders 42OP, 51OP, or 52OP exhibited the fastest and highest doubling rates (Figure 15C). In both cases, expansion size peaked at approximately 7 days and then declined with similar kinetics (Figures 15B and D). [Figure 16]Figures 16A-B are schematic diagrams showing the timeline (Figure 16A) and gating strategy (Figure 16B) of the activation stress test used to evaluate the cytotoxic efficacy (e.g., killing) of CD19 CAR-T cells. A restimulation stress test of ND528 CAR-T cells expressing optimized CD19 binder T cells was performed using the optimized CD19 binders 42OP, 43OP, 44OP, 45OP, 46OP, 51OP, and 52OP. The killing targets were Nalm6 cells. At the end of each stimulation step, CD19 CAR-T cells were stained and viable cell counts were measured by flow cytometry. New cocultures were established, and the T cell phenotype (cytotoxicity) of CAR-T cells was evaluated by flow cytometry. Thawed ND528 cells were used for serial restimulation tests and evaluation of cytotoxicity. [Figure 17] Figures 17A-D show the killing profiles of optimized ND528 CAR-T cells expressing CARs containing the optimized CD19 binders 42OP (Figure 17A), 44OP (Figure 17B), 45OP (Figure 17C), and 52OP (Figure 17D) targeted to Nalm6 cells at CAR+:Nalm6 wt ratios of 3:1, 1:1, 1:3, and 1:10. All CD19 binders tested effectively killed Nalm6 cells within 45 minutes. See also Tables 15, 16, 17, 18, 19, and 20. [Figure 18] Figures 18A-B show the proliferation curves or expansion (Figure 18A) and cell size (shrinkage) graphs (Figure 18B) of ND608 donor CD19 CAR-T cells expressing CARs containing any of the original CD19 binders 42, 44, 45, and 52, or any of the optimized CD19 binders opt42 (also referred to as 42OP), opt44, opt45, and opt52. Each set of original and optimized CD19 binders showed similar proliferation and size profiles. [Figure 19]Figures 19A-B are graphs quantifying the surface expression of CD19 CARs, including original and optimized CD19 binders 42, 44, 45, and 52, on ND608 CAR-T cells (Figure 19A); and their tumor growth inhibition in the Jeko NSG mouse model (Figure 19B). Tumor growth was suppressed to the greatest extent by CD19 binder 42-original CAR-T cells. CD19 binder 42-optimized CAR-T cells, CD19 binder 52-original CAR-T cells, and CD19 binder 52-optimized CAR-T cells were also effective in suppressing tumor growth. [Figure 20] FIG. 20 shows the location of the non-overlapping epitopes of CD19 42 original (42og) scFv on the sequence of the extracellular domain of CD19 compared to the epitopes of three known anti-CD19 antibodies, FMC63, 4G7, and 3B10. [Figure 21] Figures 21A-B are graphs showing that the CD19 42og scFv selectively bound to CD19 when tested on a membrane proteome array (MPA) containing over 5,220 human membrane proteins. Figure 21A shows the results of an MPA screen highlighting binding to CD19 and the FCGR protein (FCGR1A), which served as a positive control. Figures 12B-C show validation of the titration results, in which 42og scFv-Fc strongly bound to Protein A (positive control) and CD19, exhibiting MFI signals 750- and 400-fold higher than the negative control (empty vector), respectively. Figure 21C shows that the isotype control did not bind to CD19 or any of the other targets tested, but strongly bound to Protein A and FCGR1A, exhibiting MFI signals 190- and 45-fold higher than the negative control, respectively. DETAILED DESCRIPTION OF THE INVENTION

[0078] Detailed explanation I. Overview The present disclosure provides a novel anti-CD19 chimeric antigen receptor with lower affinity and faster off-rate compared to prior art CD19 CARs and clinically approved CARs based on FMC63, an IgG2a murine monoclonal antibody specific for CD19, a target for immunotherapy of B-lineage leukemia and lymphoma.

[0079] Chimeric antigen receptor-modified T cells (CAR-T cells) directed against CD19 have shown promise as a novel treatment for hematological malignancies. Anti-CD19 CAR-T therapy has achieved remarkable antitumor responses in B-cell acute lymphoblastic leukemia (B-ALL) and other refractory B-cell malignancies. Complete remission (CR) has been achieved in as many as 70-90% of relapsed / refractory acute lymphoblastic leukemia (R / R B-ALL) cases. Based on these impressive experimental results, the U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA) approved tisagenlecleucel (KYMRIAH) for the treatment of large B-cell lymphoma. (R) , Novartis), axicabtagene ciloleucel (YESCAR-TA (R) , Kite Pharma-Gilead), lisocabtadiene maraleucel (BREYANZI (R) The U.S. has approved several CD19-directed CAR-T cell therapies, including BREXCAVA (TECAR-TUS), a CAR-T cell therapy developed by Juno Therapeutics-Celgene-BMS. The U.S. has also approved brexcabutadiene outrucel (TECAR-TUS) for the treatment of relapsed or refractory mantle cell lymphoma. (R) , Kite Pharma-Gilead) was approved.

[0080] Despite the wide variety of effective CAR-T cell therapies, the success of these approved CAR-T cell therapies has been limited. Approximately 40–50% of patients who respond to CD19 CAR-T cell therapy relapse within one year, and nearly half of these relapses contain CD19-positive leukemia cells. Recent evidence suggests that resistance to CD19 chimeric antigen receptor (CAR)-modified T-cell therapy may be due to the presence of CD19 isoforms that lose binding to currently used single-chain variable fragments (scFvs). Other resistance mechanisms limiting current CAR-T cell therapies include T-cell exhaustion, immunosuppression, antigen loss, cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome, and / or neurotoxicity.

[0081] A. Identification of novel CD19 binders To address these issues, the present disclosure relates to improved CD19 binders using an immune-independent antibody generation method based on a large-scale yeast-display human antibody library (see, e.g., AvantGen Inc., avantgen.com / therapeutic-antibodies).

[0082] Novel CD19 binders (e.g., antibodies, antibody fragments, or scFvs) were specifically screened for desired properties. In particular, novel CD19 binders were screened for low affinity and fast off-rates. While low affinity binding can be determined by either on-rate (K) or off-rate (K), the anti-CD19 binders (e.g., scFvs) disclosed herein were selected for fast off-rates. This fast off-rate allows the CD19 CAR to rapidly dissociate from CD19, resulting in a shorter interaction between the CAR-T cell and the tumor. This shortened interaction time can reduce cytokine release, thereby reducing toxicity. In one embodiment, the CD19 binders disclosed herein have a KD value of about 1 nM to about 50 nM. In another embodiment, the CD19 binders disclosed herein have a KD value of about 1.0 x 10 -3 s -1 ~Approx. 5.0×10 -3 s -1 It has a Koff value of

[0083] Furthermore, a short interaction time may reduce T cell exhaustion and enhance CAR-T cell persistence. Thus, novel binders have low binding affinity (e.g., KD of 1 nM to approximately 50 nM) and fast off-rates (e.g., Koff of approximately 1.0 × 10). -3 s -1 ~Approx. 5.0×10 -3 s -1 ) were identified by specifically screening a human antibody library for CD19-specific antibodies or antibody fragments. Figure 1 is a schematic outlining the general steps used to identify 12 unique CD19 binders, from phage display library and yeast display screening to selection by biotinylated baculovirus binding, SIGLEC binding, and / or NALM6 tumor cell binding.

[0084] This screening yielded approximately 13 novel binders, as shown in Table 3 and Figures 2A-2E. The nucleic acid sequences of the novel CD19 binders disclosed herein are about 58% to about 97% identical to each other, as shown in Figure 2F.

[0085] T cells expressing CD19 CARs containing the novel binders of the present disclosure can exhibit higher efficacy, enhanced in vivo persistence, and reduced toxicity compared to T cells expressing FMC63-based CARs. However, T cells expressing low-affinity CD19 CARs of the present disclosure can kill target cells similarly to T cells expressing high-affinity CD19 CARs. Furthermore, T cells expressing low-affinity CD19 CARs of the present disclosure can exhibit cytokine production (e.g., interferon-γ or IL-2 production) and proliferation similar to T cells expressing high-affinity CD19 CARs (e.g., FMC63-based CARs).

[0086] B. Characterization of Novel CD19 Binders The top selection of 12 novel CD19 binder candidates was ultimately based on the following functional characteristics in view of known CD19 binders: (1) low tonicity signal; (2) strong activation rate; (3) healthy spreading profile; (4) robust and stable surface expression; and (5) cytokine production. Based on these criteria, CD19 binders 42 (P1) and 52 (P11 and P13) appeared to be exemplary candidates.

[0087] Preliminary analysis showed that 12 novel CD19 binders produced similar transcriptional profiles. As described herein, these 12 novel CD19 binders exhibited unique and unusual functional, signal transduction, pharmacological, and tumor-suppressive properties. The novel properties described herein may address the problems of current CD19 CARs, such as T cell exhaustion, immunosuppression, antigen loss, cytokine release syndrome (CRS), immune effector cell-associated neurotoxicity syndrome, and / or neurotoxicity.

[0088] As described herein, CD19 binder 42 exhibited desirable, unique CD19 binder properties. For example, CAR-T cells expressing CARs containing CD19 binder 42 were able to maintain higher levels of CAR RNA transcripts. Using real-time PCR, the relative transcript levels of all CD19 binders were found to be comparable (Figure 10A-B). CD19 binder 42 had a transcript level twice that of all binders tested, yet its total protein level was similar to that of other CD19 binders. The mechanism for this higher transcript level is unknown. It was speculated that these cells either had a faster transcription rate or more stable (less degraded) RNA transcripts.

[0089] The translation products (e.g., total protein levels) of the CD19 binders were evaluated by Western blot. Western blot results revealed two protein bands of similar size but varying expression levels (Figure 11A-B). For example, CAR-T cells containing the CD19 binder 52 CAR expressed only the larger molecular weight band. On the other hand, two isoforms of CD19 binder 42 were identified, with the smaller isoform being more highly expressed. The two CAR isoforms were also detected in CAR-T cells expressing a control CAR. Thus far, no correlation has been observed between the ratio of the protein band sizes and cytokine production or tumor clearance.

[0090] Most CD19 binders were well expressed in Jurkat NFAT cells or human primary T cells (Table 4). However, most of the expressed CD19 CARs induced tonic signaling in these cells (Table 4 and Figures 3A-B). CD19 binder 42 was an exception, as expression of the CD19 binder 42 (original) CAR did not result in tonic signaling. CD19 binder 52 did produce some tonic signaling. Consistent with the expression patterns, the novel CD19 binders were also able to induce cytokine production when expressed in primary human T cells (Figures 5A-B; and Tables 6, 14, and 24).

[0091] The scFvs of CD19 binders 42, 43, 44, 45, 46, 50, 51, and 52 were also optimized based on codon usage and GC content. Codon optimization was performed to determine whether more stable and robust expression could be obtained. Codon optimization reduced the tonic signaling induced by the original CD19 binder 52 (Figure 3B).

[0092] Furthermore, CAR-T cells expressing CARs containing the original or optimized CD19 binders 42 and 52 effectively suppressed tumor growth in the Jeko NSG mouse model (Figure 19B). Tumor growth was suppressed to the greatest extent by CD19 binder 42 original CAR-T cells. CD19 binder 42opt CAR-T cells, CD19 binder 52 original CAR-T cells, and CD19 binder 52op CAR-T cells also suppressed tumor growth.

[0093] C. Epitope mapping of novel CD19 binders As shown in Figure 12 and Tables 9-10, we also performed an initial evaluation of the epitope-binding regions of the CD19 binders. Specifically, binding assays were performed to determine whether the novel CD19 binders bind to the anti-FMC63 antibody and whether they share the same binding site (e.g., epitope) or whether they bind to the same region. These data indicated that the anti-FMC63 antibody is not an idiotypic antibody to the novel CD19 binders. For example, the anti-FMC63 antibody did not bind to cells expressing CARs containing the novel CD19 binders described herein. Furthermore, the anti-FMC63 antibody did not inhibit the interaction between the tested novel CD19 binders and recombinant CD19 protein.

[0094] Furthermore, high-throughput shotgun mutagenesis analysis was performed to map the epitope of the novel CD19 binder onto the extracellular domain of the full-length CD19 protein (SEQ ID NO:217). High-throughput shotgun mutagenesis analysis of CD19 42 original (42og) showed that CD19 42og binds to a distinct epitope on the extracellular domain of CD19 (Figure 20, Table 28, and Table 29). CD19 42og scFv binds to the complete region of the extracellular domain of CD19 and does not overlap with the region bound by well-characterized CD19 antibodies such as FMC63, 4G7, or 3B10.

[0095] Klesmith et al. (Biochemistry 58:4869-4881 (2019)) characterized the conformational epitopes of FMC63, 4G7, and 3B10 (e.g., anti-CD19 clinical antibodies) using a high-throughput screening strategy to comprehensively map the binding sequences of these antibodies to the extracellular domain of the CD19 variant CD19.1. This extensive analysis of the conformational epitope maps of FMC63, 4G7, and 3B10 showed that all three antibodies possess epitopes that are close to and overlap with the known epitope of antibody B43, which co-crystallizes with CD19. As shown in Figure 20, two major regions were identified. The first region contains the amino acid sequence WAKDRPEIWEGEP (SEQ ID NO: 219), located at positions 159-171 of the full-length CD19 protein (SEQ ID NO: 217). The second region contained the amino acid sequence of PKGPKSLLSLE (SEQ ID NO: 220), located at positions 219 to 229 of SEQ ID NO: 217.

[0096] In contrast, CD19 42og scFv primarily bound to the amino acid sequence QPGPPSEKAWQP (SEQ ID NO:221) located at positions 98-109 of SEQ ID NO:217. CD19 42og scFv also interacted with another region containing the amino acid sequence VPPDSVSRGPL (SEQ ID NO:222) located at positions 202-212 of SEQ ID NO:217 (full-length CD19). Therefore, CD19 42og does not bind to the same epitope as FMC63, 4G7, 3B10, or B43 (e.g., anti-CD19 clinical antibodies).

[0097] These results further demonstrate the unique functional properties of the novel CD19 binders described herein, particularly CD19 42og. The novel binders disclosed herein reveal a new, clinically relevant CD19 epitope that does not overlap with the epitopes of at least three well-characterized, clinically relevant antibodies: FMC63, 4G7, and 3B10 (Table 29).

[0098] Finally, the specificity and selectivity of the novel CD19 disclosed herein was evaluated using a high-throughput membrane proteome array (Integral Molecular). These experiments demonstrated that CD19 42og selectively binds to CD19 when assessed for cross-reactivity against an array of 5,220 human membrane proteins representing over 94% of the human membrane proteome (Figures 21A-C). No binding to non-CD19 proteins was identified in the assay described in Example 13. These experiments were well controlled, as shown in the following examples (Figures 21B-C).

[0099] [Table 1]

[0100] Thus, one aspect of the present disclosure provides an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR) comprising a CD19 binder disclosed herein. In some embodiments, the CAR comprises an anti-CD19 binding domain selected from P1, P2, P3, P4, P5, P6, P7, P8, P9, P10, P11, P12, or P13. In some embodiments, the anti-CD19 binding domain comprises a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3) as disclosed in Table 2; and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1), a heavy chain complementarity determining region 2 (HC CDR2), and a heavy chain complementarity determining region 3 (HC CDR3) as disclosed in Table 2.

[0101] In some embodiments, the novel anti-CD19 binding domains disclosed herein (e.g., CD19 binders 42, 43, 44, 45, 46, or 52) bind to an epitope on human CD19 that is different from the epitope on human CD19 targeted by an antigen-binding domain comprising an scFv from a known CD19 antibody (e.g., FMC63, 4G7, 3B10, or B43). In some embodiments, the novel anti-CD19 binding domains disclosed herein (e.g., CD19 binders 42, 43, 44, 45, 46, or 52) bind to the same epitope on human CD19 as the epitope on human CD19 targeted by an antigen-binding domain comprising an scFv from a known CD19 antibody (e.g., FMC63, 4G7, 3B10, or B43).

[0102] In some embodiments, the novel anti-CD19 binding domains disclosed in Table 3 bind to an epitope on human CD19 that is different from the epitope on human CD19 targeted by an antigen-binding domain comprised of an scFv from a known CD19 antibody (e.g., FMC63, 4G7, 3B10, or B43). In some embodiments, the novel anti-CD19 binding domains disclosed in Table 3 bind to the same epitope on human CD19 as the epitope on human CD19 targeted by an antigen-binding domain comprising an scFv from a known CD19 antibody (e.g., FMC63, 4G7, 3B10, or B43).

[0103] In some embodiments, the novel anti-CD19 binding domains disclosed in Table 3 bind to a CD19 polypeptide comprising the amino acid sequence of SEQ ID NO:219, 220, 221, 222, 223, and / or 224. In some embodiments, the novel anti-CD19 binding domains disclosed herein do not bind to a CD19 polypeptide comprising the amino acid sequence of SEQ ID NO:219 and / or SEQ ID NO:220. In some embodiments, the novel anti-CD19 binding domains disclosed herein bind to residues located at positions 90-120, 95-115, or 95-110 of SEQ ID NO:217. In some embodiments, the epitope of the novel anti-CD19 binding domain disclosed herein comprises a sequence of amino acids selected from amino acids 41-120, 180-215, 90-120, 95-110, 98-106, 200-215, 200-208, 200-210, 205-210, 200-226, 200-230, or 200-240 of SEQ ID NO:217, or any combination thereof. In some embodiments, the epitope of the novel anti-CD19 binding domain disclosed herein comprises a sequence of amino acids selected from amino acids 41-120, 180-215, 90-120, 95-110, or 98-106, and a sequence of amino acids selected from amino acids 200-215, 200-208, 200-210, 205-210, 200-226, 200-230, or 200-240 of SEQ ID NO:217.

[0104] In some embodiments, the epitope of the novel anti-CD19 binding domain disclosed herein comprises a residue selected from Q98, E104, K105, A106, or V207, or any combination thereof. In one embodiment, the epitope of the novel anti-CD19 binding domain disclosed herein comprises a residue selected from Q98, E104, K105, or A106. In one embodiment, the epitope of the novel anti-CD19 binding domain disclosed herein comprises residues Q98, E104, K105, A106, and V207. In one embodiment, the epitope of the novel anti-CD19 binding domain disclosed herein comprises a residue selected from Q98 or K105. In one embodiment, the epitope of the novel anti-CD19 binding domain disclosed herein comprises residues Q98, E104, K105, and A106. In one embodiment, the epitope of the novel anti-CD19 binding domain disclosed herein comprises residues Q98 and K105.

[0105] Another aspect of the present disclosure provides an isolated polypeptide molecule encoded by a nucleic acid molecule disclosed in Table 3 or Table 1.

[0106] II. Chimeric Antigen Receptor (CARS) One aspect of the present disclosure provides compositions of matter and methods of use for the treatment of diseases such as cancer using anti-CD19 chimeric antigen receptors (CARs). In particular, the present disclosure provides a number of chimeric antigen receptors (CARs) comprising antibodies or antibody fragments engineered to have enhanced binding to the CD19 protein. In some embodiments, the CAR comprises the amino acid sequence of any one of SEQ ID NO:63, SEQ ID NO:74, SEQ ID NO:85, SEQ ID NO:145, SEQ ID NO:167, SEQ ID NO:178, SEQ ID NO:200, SEQ ID NO:211, SEQ ID NO:156, SEQ ID NO:189, SEQ ID NO:17, SEQ ID NO:8, SEQ ID NO:62, SEQ ID NO:73, SEQ ID NO:84, SEQ ID NO:144, SEQ ID NO:166, SEQ ID NO:177, SEQ ID NO:199, SEQ ID NO:210, SEQ ID NO:155, SEQ ID NO:188, SEQ ID NO:16, and SEQ ID NO:7.In some embodiments, the CAR is a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO.216; or a polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:21, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO: SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0107] In some embodiments, CARs of the present disclosure that comprise an anti-CD19 antigen binding domain described herein have lower affinity and faster off-rates compared to CARs that comprise anti-CD19 antigen binding domains known in the art.

[0108] Thus, the present disclosure provides cells (e.g., T cells) engineered to express a CAR, wherein the CAR-T cells ("CAR-T") exhibit anti-tumor properties. The cells are transformed with a CAR, and the CAR is expressed on the cell surface. The cells (e.g., T cells) are transformed with a viral vector encoding a CAR. The viral vector is a retroviral vector. In some embodiments, the viral vector is a lentiviral vector. The cells can stably express a CAR. The cells (e.g., T cells) may be transfected with a nucleic acid (e.g., mRNA, cDNA, DNA) encoding the CAR. In some embodiments, the cells may transiently express a CAR.

[0109] In some embodiments, the anti-CD19 protein binding portion of the CAR is an scFv antibody fragment. Such antibody fragments can be functional in that they retain the same binding affinity. For example, the antibody fragment binds to the same antigen with the same efficacy as the IgG antibody from which the antibody fragment is derived. As will be understood by those skilled in the art, such antibody fragments can be functional in that they provide biological responses, including, but not limited to, activating immune responses, inhibiting signal transduction from target antigens, inhibiting kinase activity, etc. In some embodiments, the anti-CD19 antigen binding domain of the CAR is a human-derived scFv antibody fragment.

[0110] The novel CD19 antigen-binding domain was designed to have low affinity and a fast off-rate. The CD19 antigen-binding domain was identified based on its binding to CD19 on HEK 293 cells followed by binding to NALM6, which expresses CD19 or lacks CD19 expression. In some embodiments, the novel anti-CD19 antigen-binding domain described herein may have binding affinity for human CD19 (hCD19) antigen. For example, the anti-CD19 antigen-binding domain described herein has a binding affinity of at least about 2 x 10 5 M -1 s 1 , at least about 5 × 10 5 M -1 s-1 , at least about 10 6 M -1 s -1 , at least about 5 × 10 6 M -1 s -1 , at least about 10 7 M -1 s -1 , or at least about 10 8 M -1 s -1 Association rate constant or K on Speed ​​(antibody (Ab) + antigen (Ag) ko →Ab-Ag).

[0111] A. Chimeric Antigen Receptor The present disclosure provides engineered immune effector cells (e.g., T cells or NK cells) that comprise one or more CARs that direct immune effector cells to cancer. In some embodiments, the CAR comprises an antigen binding domain, a transmembrane domain, a costimulatory domain, and an intracellular domain. The CAR can comprise any antigen binding domain, any hinge, any transmembrane domain, any costimulatory domain, and any intracellular signaling domain described herein.

[0112] The antigen-binding domain can be operably linked to another domain of the CAR, such as a transmembrane domain or an intracellular domain described herein, for expression in any of the immune cells described herein. In one embodiment, a first nucleic acid sequence encoding the antigen-binding domain is operably linked to a second nucleic acid encoding the transmembrane domain, which is further operably linked to a third nucleic acid sequence encoding the intracellular domain.

[0113] The antigen-binding domain described herein can be combined with any of the transmembrane domains described herein, the intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that can be included in the CAR of the present invention. The subject CAR of the present invention can also include a spacer domain described herein. In some embodiments, each of the antigen-binding domain, transmembrane domain, and intracellular domain is separated by a linker.

[0114] One embodiment of the present disclosure provides a chimeric antigen receptor (CAR) comprising a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. The anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6.

[0115] Alternatively, the anti-CD19 binding domain can comprise a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198.

[0116] In other embodiments, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0117] [Table 2-1]

[0118] [Table 2-2]

[0119] [Table 2-3]

[0120] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:7 or 199; or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:7 or 199. In some embodiments, the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:8 or 200; or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:8 or 200.

[0121] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:7, and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:8. In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO:199, and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:200. In some embodiments, the CD19-binding domain is an scFv.

[0122] In some embodiments, the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0123] In some embodiments, the anti-CD19 binding domain comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or SEQ ID NO:21, 24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO: SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216, including sequences having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0124] In some embodiments, the anti-CD19 binding domain comprises (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225 and SEQ ID NO:216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225 and SEQ ID NO:216. The present invention also includes light chain variable regions or heavy chain variable regions encoded by a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0125] In some embodiments, a novel anti-CD19 binding domain disclosed herein (e.g., CD19 binders 42, 43, 44, 45, 46, or 52) binds to an epitope of human CD19 that is different from the epitope of human CD19 targeted by the antigen-binding domain comprising an scFv from the FMC63 antibody.

[0126] In some embodiments, the novel anti-CD19 binding domains disclosed herein (e.g., CD19 binders 42, 43, 44, 45, 46, or 52) bind to the same epitope on human CD19 targeted by the antigen-binding domain comprised of the scFv from the FMC63 antibody.

[0127] In some embodiments, the novel anti-CD19 binding domains disclosed in Table 2 or Table 3 bind to an epitope of human CD19 that is different from the epitope of human CD19 targeted by the antigen binding domain comprising the scFv from the FMC63 antibody.

[0128] In some embodiments, the novel anti-CD19 binding domains disclosed in Table 2 or Table 3 bind to the same epitope on human CD19 targeted by the antigen binding domain comprising the scFv from the FMC63 antibody.

[0129] In some embodiments, the anti-CD19 binding domain comprises (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225 and SEQ ID NO:216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225 and SEQ ID NO:216. SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225 and SEQ ID NO:216; and binds to an epitope on the human CD19 protein that is different from the epitope of human CD19 targeted by the antigen-binding domain comprising the scFv from the FMC63 antibody.

[0130] In some embodiments, the anti-CD19 binding domain comprises (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NOs:19-24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO: and a light chain variable region or a heavy chain variable region encoded by a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216; and an antigen-binding domain consisting of an scFv from the FMC63 antibody binds to the same epitope on the human CD19 protein rather than the epitope of human CD19 targeted by the scFv.

[0131] In some embodiments, the novel anti-CD19 binding domains described herein compete for binding to human CD19 with an antigen-binding domain comprising a sequence from a known CD19 scFv binder (e.g., FMC63 binder), e.g., in a competition assay.

[0132] In some embodiments, the competitive assay can be an SPR-based assay. Briefly, an antigen, such as human CD19, can be immobilized on a surface. A reference antibody (e.g., FMC63) is injected onto the antigen layer through a microflow system. Upon binding of the reference antibody to the antigen, an increase in signal (e.g., reference signal), typically expressed in response units (RU), is detected. After a desired time, a novel CD19 binder described herein is injected onto the antigen layer. If the test antibody binds to a different region or epitope of the antigen, a further increase in signal is detected, and then a signal increase (e.g., RU) of 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more is detected compared to the highest signal, e.g., reference signal, detected upon binding of the reference antibody.

[0133] When the test antibody binds to the same region or epitope of the antigen, little or no increase in signal, e.g., RU, is detected, e.g., the increase in signal, e.g., RU, is less than 20%, less than 15%, less than 10%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1% compared to the highest signal, e.g., reference signal, detected upon binding of the reference antibody.

[0134] When using this SPR-based competition assay, an antibody is said to compete with a reference antibody if it detects an increase in signal, e.g., RU, of less than 20%, less than 15%, less than 10%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1% compared to the reference signal detected upon binding of the reference antibody to the antigen. An antibody is said to not compete, or to be poorly competitive, with a reference antibody if it detects an increase in signal, e.g., RU, of 5% or more, 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more.

[0135] The epitope bound by the novel CD19 antigen-binding domain described herein can be identified by various methods known in the art. For example, a crystal structure comprising the antigen-binding domain bound to or complexed with an antigen can be prepared. In another example, an assay, such as a protection assay, can be performed to identify the region of the antigen that contributes to the epitope or to identify the epitope. An exemplary protection assay can be hydrogen / deuterium exchange (HDX) mass spectrometry assay.

[0136] 1. Antigen-binding domain The antigen-binding domain of the CAR is the extracellular region of the CAR that binds to a specific target antigen, including proteins, carbohydrates, and glycolipids. In some embodiments, the CAR has affinity for a target antigen (e.g., a tumor-associated antigen) on a target cell (e.g., a cancer cell). The target antigen can include any type of protein associated with the target cell or its epitope. For example, the CAR can have affinity for a target antigen on a target cell that indicates a specific state of the target cell.

[0137] As described herein, a CAR of the present disclosure having affinity for a specific target antigen on a target cell can comprise a target-specific binding domain. In some embodiments, the target-specific binding domain is a mouse target-specific binding domain, e.g., the target-specific binding domain is derived from a mouse. In some embodiments, the target-specific binding domain is a human target-specific binding domain, e.g., the target-specific binding domain is derived from a human.

[0138] The antigen-binding domain can comprise any domain that binds to an antigen, including, but not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and fragments thereof. Thus, in one embodiment, the antigen-binding domain portion comprises a mammalian antibody or a fragment thereof. In certain embodiments, the antigen-binding domain comprises a full-length antibody. In some embodiments, the antigen-binding domain comprises an antigen-binding fragment (Fab), such as a Fab, Fab', F(ab')2, monospecific Fab2, bispecific Fab2, trispecific Fab2, single-chain variable fragment (scFv), dAb, tandem scFv, VhH, V-NAR, camelid body, diabody, minibody, triabody, or tetrabody. In some embodiments, the antigen-binding domain is selected from the group consisting of: (a) a full-length antibody or an antigen-binding fragment thereof, (b) a Fab, (c) a single-chain variable fragment (scFv), and (d) a single-domain antibody.

[0139] In some embodiments, the CAR of the present disclosure may have affinity for one or more target antigens on one or more target cells. In some embodiments, the CAR may have affinity for one or more target antigens on a single target cell. In such embodiments, the CAR is a bispecific or multispecific CAR. In some embodiments, the CAR comprises one or more target-specific binding domains that confer affinity for one or more target antigens. In some embodiments, the CAR comprises one or more target-specific binding domains that confer affinity for the same target antigen. For example, a CAR comprising one or more target-specific binding domains with affinity for the same target antigen may bind to different epitopes of the target antigen. When a CAR has multiple target-specific binding domains, the binding domains may be arranged in tandem or separated by a linker peptide. For example, in a CAR comprising two target-specific binding domains, the binding domains are covalently linked to each other on a single polypeptide chain via a polypeptide linker, an Fc hinge region, or a membrane hinge region.

[0140] In some cases, the antigen-binding domain may be derived from the same species that the CAR will ultimately be used in. For example, for human use, the antigen-binding domain of the CAR can comprise a human antibody or fragment thereof, as described elsewhere herein.

[0141] Thus, the CAR encoded by the lentiviral or retroviral vector of the present disclosure can target one of the following cancer-associated antigens (tumor antigens): CD19; CD20; CD22 (Siglec-2); CD37; CD123; CD22; CD30; CD171; CS-1 (CD2 subset 1, also known as CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33; CD133; epidermal growth factor receptor (EGFR); epidermal growth factor receptor variant III (EGFRvIII); human epidermal growth factor receptor (HER1); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(l-4)bDGlcp(ll)Cer); TNF receptor family member B-cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAca-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; calcynoembrionic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha 2 (IL-13Ra2 or CD213A2); mesothelin; interleukin-11 receptor alpha (IL-1 lRa); prostate stem cell antigen (PSCA); protease serine 21 (Testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-beta); stage-specific embryonic antigen-4 (SSEA-4); folate receptor alpha; receptor tyrosine protein kinase ERBB2 (Her2 / neu); mucin 1, cell surface associated (MUC1); GalNAca1-O-Ser / Thr(Tn)MUC1 (TnMUC1); neural cell adhesion molecule (NCAM); prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutant (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor);Carbonic anhydrase IX (CAIX); proteasome (prosome, macropein) subunit, beta type 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein consisting of the breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl GM1; sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDGalp (l-4)bDGlcp(ll)Cer); transglutaminase 5 (TGS5); high-molecular-weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); X chromosome open reading frame 61 (CX ORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide moiety of GloboH glycoceramide (GloboH); mammary differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); tyrosine protein kinase Met (c-Met); hepatitis A virus cellular receptor 1 (HAVCR1); adrenergic receptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, K9 locus (LY6K); olfactory receptor 51E2 (OR51E2); TCR gamma alternate reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-la); melanoma-associated antigen 1 (MAGE-A1); ETS translocation mutant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family, member 1A (XAGEl); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer-testis antigen 1 (MAD-CT-1); melanoma cancer-testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutants;prostein; survival; telomerase; prostate cancer tumor antigen-1 (PCTA-1 or galectin-8); melanoma antigen 1 recognized by T cells (MelanA or MARTI); rat sarcoma (Ras) mutant; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyltransferase V (NA17); paired-box protein Pax-3 (PAX3); androgen receptor; cyclin B l; v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 1B 1 (CYP1B 1); CCCTC-binding factor (zinc finger protein)-like (sibling of BORIS or regulator of imprinted sites), squamous cell carcinoma antigen 3 recognized by T cells (SART3); paired box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OY-TES l); lymphocyte-specific protein tyrosine kinase (LCK); A-kinase anchor protein 4 (AKAP-4); synovial sarcoma, X-breakpoint 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; heat shock protein 70-2 mutant (mut hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89); leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); glypican-2 (GPC2); glypican-3 (GPC3); NKG2D; KRAS;GDNF family receptor alpha-4 (GFRa4); IL13Ra2; Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1).

[0142] In some embodiments, the CAR targets CD19, CD20, CD22, BCMA, CD37, mesothelin, PSMA, PSCA, Tn-MUC1, EGFR, EGFRvIII, c-Met, HER1, HER2, CD33, CD133, GD2, GPC2, GPC3, NKG2D, KRAS, or WT1. In some embodiments, the antigen-binding domain specifically binds to a target antigen selected from the group consisting of CD4, CD19, CD20, CD22, BCMA, CD123, CD133, EGFR, EGFRvIII, mesothelin, Her2, PSMA, CEA, GD2, IL-13Ra2, glypican-3, GPC2, TnMuc1, CIAX, LI-CAM, CA125, CTAG1B, mucin 1, and folate receptor alpha. In some embodiments, the CAR targets CD19.

[0143] Thus, one aspect of the present invention provides an anti-CD19 binding domain comprising a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO:1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO:2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO:3; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO:4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO:5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:6. Alternatively, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 196, heavy chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 197, and heavy chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 198. In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0144] In some embodiments, the anti-CD19 binding domain is an scFv comprising a light chain variable region consisting of the amino acid sequence of SEQ ID NO:7 or 199, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:7 or 199; and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:8 or 200, or a scFv comprising a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:7 or 200.

[0145] One aspect of the disclosure provides an anti-CD19 binding domain (e.g., an scFv) comprising a light chain variable domain or a heavy variable domain encoded by a nucleic acid sequence selected from SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. In some embodiments, the nucleic acid sequence of the light chain variable domain or heavy chain variable domain of the anti-CD19 binding domain (e.g., scFv) is encoded by a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0146] The anti-CD19 antigen binding domain of the present disclosure is about 5×10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than k off Velocity((Ab-Ag) ko → antibody (Ab) + antigen (Ag). In another embodiment, the antibody of the invention may have a titer of about 5 x 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than 5 × 10 -1 s -1 Less than, about 10 -1 s -1 Less than or about 10 -1 s -1 Less than k off It has.

[0147] The anti-CD19 antigen binding domain of the present disclosure comprises at least about 10 2 M -1 , at least about 5 × 10 2 M -1 , at least about 10 3 M -1 , at least about 5 × 10 3 M -1 , at least about 10 4 M -1, at least about 5 × 10 4 M -1 , at least about 10 5 M -1 , at least about 5 × 10 5 M -1 , at least about 10 6 M -1 , at least about 5 × 10 6 M -1 , at least about 10 7 M -1 , at least about 5 × 10 7 M -1 , at least about 10 8 M -1 , at least about 5 × 10 8 M -1 , at least about 10 9 M -1 , at least about 5 × 10 9 M -1 , at least about 10 10 M -1 , at least about 5 × 10 10 M -1 , at least about 10 11 M -1 , at least about 5 × 10 11 M -1 , at least about 10 12 M -1 , at least about 5 × 10 12 M -1 , at least about 10 13 M -1 , at least about 5 × 10 13 M -1 , at least about 10 14 M -1 , at least about 5 × 10 14 M -1 , at least about 10 15 M -1 , or at least about 5 × 10 15 M -1 The affinity constant or K a (k on / k off ).

[0148] The anti-CD19 antigen binding domain of the present disclosure is about 5×10 -2 Less than M, about 10-2 Less than M, approximately 5 x 10 -3 Less than M, about 10 -3 Less than M, approximately 5 x 10 -4 Less than M, about 10 -4 Less than M, approximately 5 x 10 -5 Less than M, about 10 -5 Less than M, approximately 5 x 10 -6 Less than M, about 10 -6 Less than M, approximately 5 x 10 -7 Less than M, about 10 -7 Less than M, approximately 5 x 10 -8 Less than M, about 10 -8 Less than M, approximately 5 x 10 -9 Less than M, about 10 -9 Less than M, approximately 5 x 10 -10 Less than M, about 10 -10 Less than M, approximately 5 x 10 -11 Less than M, about 10 -11 Less than M, approximately 5 x 10 -12 Less than M, about 10 -12 Less than M, approximately 5 x 10 -13 Less than M, about 10 -13 Less than M, approximately 5 x 10 -14 Less than M, about 10 -14 Less than M, approximately 5 x 10 -15 Less than M or about 10 -15 A dissociation constant or K less than M D (k off / k on ).

[0149] When used with the methods described herein, the anti-CD19 antigen binding domains of the present disclosure have a dissociation constant (K ) as assessed using the methods described herein or methods known to those of skill in the art (e.g., BIAcore assay, ELISA) (Biacore International AB, Uppsala, Sweden). d ) can specifically bind to human CD19 at less than about 3000 nM, less than about 2500 nM, less than about 2000 nM, less than about 1500 nM, less than about 1000 nM, less than about 750 nM, less than about 500 nM, less than about 250 nM, less than about 200 nM, less than about 150 nM, less than about 100 nM, or less than about 75 nM.

[0150] In some embodiments, the anti-CD19 antigen binding domain of the present disclosure has a dissociation constant (K) of about 25 to about 3400 nM, about 25 to about 3000 nM, about 25 to about 2500 nM, about 25 to about 2000 nM, about 25 to about 1500 nM, about 25 to about 1000 nM, about 25 to about 750 nM, about 25 to about 500 nM, about 25 to about 250 nM, about 25 to about 100 nM, about 25 to about 75 nM, or about 25 to about 50 nM, as assessed using a method described herein or a method known to one of skill in the art (e.g., BIAcore assay, ELISA). d In other embodiments, the anti-CD19 antigen-binding domain may specifically bind to human CD19 antigen with a dissociation constant (K) of at least about 500 nM, at least about 100 nM, at least about 75 nM, or at least about 50 nM, as assessed using methods described herein or known to those of skill in the art (e.g., BIAcore assay, ELISA). d ) can specifically bind to hCD19 having the following structure:

[0151] 2. Transmembrane domain The encoded CAR of the present disclosure can be designed to include a transmembrane domain that connects the antigen binding domain of the CAR to the intracellular domain.The transmembrane domain of the target CAR is a region that can span the cell membrane of a cell (e.g., an immune cell or its precursor).The transmembrane domain is for insertion into a cell membrane, for example, a eukaryotic cell membrane.In some embodiments, the transmembrane domain is interposed between the antigen binding domain and the intracellular domain of the CAR.

[0152] In one embodiment, the transmembrane domain naturally binds to one or more domains of the CAR. In some embodiments, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, in order to minimize interaction with other members of the receptor complex.

[0153] In some embodiments, transmembrane domain can be derived from either natural or synthetic sources.When the source is natural, the domain can be derived from any membrane-binding protein or transmembrane protein, for example, type I transmembrane protein.When derived from synthetic sources, the transmembrane domain can be an artificial sequence, for example, an artificial hydrophobic sequence, that facilitates the insertion of CAR into cell membrane. In some embodiments, transmembrane domains of particular use in the present invention include, but are not limited to, transmembrane domains derived from the alpha, beta, or zeta chain of the T-cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, cd8, cd9, cd16, cd22, cd33, cd37, cd64, cd80, cd86, cd134(ox-40), cd137(4-1bb), cd154(cd40l), cd278(icos), cd357(gitr), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and killer immunoglobulin-like receptors (KIR).

[0154] In some embodiments, the transmembrane domain comprises at least the transmembrane region of a protein selected from the group consisting of the α, β, or ζ chain of the T-cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and killer immunoglobulin-like receptors (KIR).

[0155] In some embodiments, the transmembrane domain may be synthetic. In some embodiments, the synthetic transmembrane domain comprises primarily hydrophobic residues such as leucine and valine. In certain exemplary embodiments, a triplet of phenylalanine, tryptophan, and valine is found at each end of the synthetic transmembrane domain.

[0156] The transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains described herein, any of the intracellular signaling domains described herein, or any of the other domains described herein that may be included in a subject CAR.

[0157] In one embodiment, the transmembrane domain comprises a CD8α transmembrane domain. In some embodiments, the transmembrane domain comprises a CD8α transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO:29. In some embodiments, the transmembrane domain comprises the nucleotide sequence set forth in SEQ ID NO:30.

[0158] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain. In some embodiments, the CAR comprises a CD28 transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO:31. In some embodiments, the CD28 transmembrane domain comprises the nucleotide sequence set forth in SEQ ID NO:32.

[0159] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain. In some embodiments, the CAR comprises an ICOS transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 33. In some embodiments, the ICOS transmembrane domain comprises the nucleotide sequence set forth in SEQ ID NO: 34.

[0160] Acceptable mutations of the transmembrane domain and / or hinge domain while maintaining its intended function will be known to those of skill in the art. In some embodiments, the transmembrane domain comprises an amino acid sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs:29, 31, and / or 33. In some embodiments, the transmembrane domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 30, 32, and / or 34. The transmembrane domain may be combined with any hinge domain and / or may comprise one or more transmembrane domains described herein.

[0161] In some embodiments, a CAR comprises: a transmembrane domain of the alpha, beta, or zeta chain of the T cell receptor, any transmembrane domain selected from the group consisting of CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, killer immunoglobulin-like receptor (KIR); any costimulatory signaling domain, and an intracellular or cytoplasmic domain described herein or other domains described herein that may be included in a CAR, and optionally a hinge domain.

[0162] In some embodiments, the CAR further comprises a spacer domain between the extracellular domain and the transmembrane domain of the CAR, or between the intracellular domain and the transmembrane domain of the CAR. In some embodiments, the spacer domain may be a short oligopeptide or polypeptide linker, e.g., about 2 to about 10 amino acids in length. For example, a glycine-serine doublet provides a particularly suitable linker between the transmembrane domain and the intracellular signaling domain of a subject CAR. Thus, the CAR of the present disclosure can comprise any of the transmembrane domains, hinge domains, or spacer domains described herein.

[0163] 3. Hinge area In some embodiments, the CAR of the present disclosure further comprises a hinge region. The hinge region of the CAR is a hydrophilic region located between the antigen-binding domain and the transmembrane domain. In some embodiments, the hinge region promotes proper protein folding of the CAR. In some embodiments, the hinge domain is an optional component of the CAR. In some embodiments, the hinge domain comprises a domain selected from an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial hinge sequence, or a combination thereof. In some embodiments, the hinge domain is selected from, but is not limited to, a CD8a hinge, an artificial hinge consisting of a polypeptide that may be as small as three glycines (Gly). In some embodiments, the hinge region is a receptor-derived hinge region polypeptide. In certain embodiments, the hinge region is a hinge region derived from CD8. In one embodiment, the hinge region comprises an amino acid sequence derived from human CD8, or a variant thereof. In some embodiments, the subject CAR comprises a CD8α hinge domain and a CD8α transmembrane domain. In some embodiments, the CD8 alpha hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 27 or 35. In some embodiments, the CD8 alpha hinge domain comprises the nucleotide sequence set forth in SEQ ID NO: 28 or 36.

[0164] In some embodiments, the hinge domain comprises an amino acid sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NO:27 or 35.

[0165] In some embodiments, the hinge domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NO:28 or 36.

[0166] In some embodiments, the hinge region connects the antigen-binding domain to the transmembrane domain, which in turn connects to the intracellular domain. In exemplary embodiments, the hinge region can support the antigen-binding domain to recognize and bind to the target antigen on the target cell. In some embodiments, the hinge region is a flexible domain, thereby allowing the antigen-binding domain to have a structure that optimally recognizes the specific structure and density of the target antigen on a cell, such as a tumor cell. The flexibility of the hinge region allows the hinge region to adopt many different conformations.

[0167] In some embodiments, the hinge region has a length selected from about 4 to about 50, about 4 to about 10, about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 40, or about 40 to about 50 amino acids. A suitable hinge region can be readily selected and can be any of a number of suitable lengths, for example, from about 1 amino acid (e.g., glycine (Gly)) to about 20 amino acids, from about 2 amino acids to about 15 amino acids, from about 3 amino acids to about 12 amino acids, including about 4 amino acids to about 10 amino acids, from about 5 amino acids to about 9 amino acids, from about 6 amino acids to about 8 amino acids, or from about 7 amino acids to about 8 amino acids, and can be about 1 amino acid, about 2 amino acids, about 3 amino acids, about 4 amino acids, about 5 amino acids, about 6 amino acids, or about 7 amino acids.

[0168] In some embodiments, the amino acid is glycine (Gly). Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively amorphous and can therefore function as neutral tethers between components. Glycine polymers can be used; glycine has access to significantly more φ-Ψ space than alanine and is much less restrictive than residues with long side chains. In certain embodiments, the hinge region comprises a glycine polymer (G)n, a glycine-serine polymer. In some embodiments, the hinge region comprises a glycine-serine polymer selected from the group consisting of (GS)n, (GSGGS)n, and (GGGS)n, where n is an integer of at least 1. In some embodiments, the hinge region comprises an amino acid sequence including, but not limited to, GGSG (SEQ ID NO:121), GGSGG (SEQ ID NO:122), GSGSG (SEQ ID NO:123), GSGGG (SEQ ID NO:124), GGGSG (SEQ ID NO:125), GSSSG (SEQ ID NO:126). In some embodiments, the hinge region comprises a glycine-alanine polymer, an alanine-serine polymer, or other flexible linker known in the art.

[0169] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. Immunoglobulin hinge region amino acid sequences are known in the art. In some embodiments, the immunoglobulin hinge region comprises an amino acid sequence selected from the group consisting of DKTHT (SEQ ID NO:130); CPPC (SEQ ID NO:131); CPEPKSCDTPPPCPR (SEQ ID NO:132) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503); ELKTPLGDTTHT (SEQ ID NO:133); KSCDKTHTCP (SEQ ID NO:134); KCCVDCP (SEQ ID NO:135); KYGPPCP (SEQ ID NO:136); EPKSCDKTHTCPPCP (SEQ ID NO:137) (human IgG1 hinge); ERKCCVECPPCP (SEQ ID NO:138) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO:139) NO:139) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO:49) (human IgG4 hinge); and the like.

[0170] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge is selected from the CH1 and CH3 domains of IgG (such as human IgG4). In some embodiments, the hinge domain comprises the amino acid sequence of a human IgG1, IgG2, IgG3, or IgG4 hinge domain. In some embodiments, the hinge region may comprise one or more amino acid substitutions and / or insertions and / or deletions compared to a wild-type (naturally occurring) hinge region. In some embodiments, the histidine at position 229 (His229) of the human IgG1 hinge is substituted with tyrosine (Tyr). In some embodiments, the hinge domain comprises the amino acid sequence EPKSCDKTYTCPPCP (SEQ ID NO:137).

[0171] 4. Intracellular domain The encoded CAR of the present disclosure also comprises an intracellular domain. The intracellular domain of a CAR, or otherwise the cytoplasmic domain of a CAR, is responsible for activating the cell in which the CAR is expressed. Thus, the term "intracellular domain" is meant to include any portion of the intracellular domain sufficient to transmit an activation signal. In one embodiment, the intracellular domain comprises a domain responsible for effector function. The term "effector function" refers to a specialized function of a cell. For example, the effector function of a T cell may be cytolytic activity or helper activity, including cytokine secretion. In one embodiment, the intracellular domain of a CAR comprises a domain responsible for signal activation and / or transduction. The intracellular domain can transmit signal activation through protein-protein interactions, biochemical changes, or other responses to alter the cell's metabolism, shape, gene expression, or other cellular response to activation of the chimeric intracellular signaling molecule.

[0172] Examples of intracellular domains for use in the present invention include, but are not limited to, the cytoplasmic portion of the T cell receptor (TCR), a costimulatory molecule, or any molecule that acts in concert with the TCR to initiate signaling in the T cell following engagement with an antigen receptor, and any derivatives or variants of these elements, and any synthetic sequence having the same functional capability.

[0173] In certain embodiments, the intracellular domain comprises an intracellular signaling domain.Examples of intracellular domains include TCR, CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, CD86, common FcR gamma, FcR beta (Fc epsilon rib), CD79a, CD79b, Fc gamma R11a, DAP10, DAP12, T cell receptor (TCR), CD2, CD8, CD27, CD28, 4-1BB (CD137), OX9, OX40, CD30, CD40, PD-1, ICOS, KIR family proteins, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, CD5, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8 alpha, CD8 beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1Id, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD lib, ITGAX, CD11c, ITGBl, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244,2B4), CD84, CD96(Tactile), CEACAM1 , CRTAM, Ly9(CD229), CD160(BY55), PSGL1, CD100(SEMA4D), CD69, SLAMF6(NTB-A, Lyl08), SLAM(SLAMF1, CD150, IPO-3), BLAME(SLAMF8), SELPLG(CD162) , LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, syk family tyrosine kinases (Syk, ZAP70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.), other costimulatory molecules described herein, derivatives, variants, or fragments thereof, any synthetic sequence of a costimulatory molecule having the same functional capability, and any combination thereof.

[0174] In some embodiments, the intracellular signaling domain is selected from the group consisting of the cytoplasmic signaling domain of human CD2, CD3 zeta chain (CD3ζ), FcγRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCR zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d, or variants thereof. In some embodiments, the intracellular signaling domain comprises a CD3 zeta intracellular signaling domain.

[0175] Further examples of intracellular domains include the intracellular signaling domains of several types of other immune signaling receptors, including, but not limited to, first-, second-, and third-generation T cell signaling proteins, including CD3, costimulatory receptors of the B7 family, and tumor necrosis factor receptor (TNFR) superfamily receptors. Additionally, intracellular signaling domains can include signaling domains used by NK cells and NKT cells, such as the signaling domains of NKp30 (B7-H6), DAP12, NKG2D, NKp44, NKp46, DAP10, and CD3z.

[0176] Intracellular signaling domains suitable for use in the CARs of the present invention include any desired signaling domain that transmits a signal in response to CAR activation (i.e., activation by an antigen and a dimerization agent). In some embodiments, a clear and detectable signal includes, for example, an increase in the production of one or more cytokines by the cell; a change in the transcription of a target gene; a change in the activity of a protein; a change in cell behavior (e.g., cell death); cell proliferation; cell differentiation; cell survival; and / or modulation of a cell signaling response. For example, in some embodiments, the intracellular signaling domain comprises a DAP10 / CD28-type signaling chain. In some embodiments, the intracellular signaling domain is not covalently attached to the membrane-bound CAR, but instead is diffused within the cytoplasm.

[0177] Intracellular signaling domains suitable for use in the CARs of the invention include immunoreceptor tyrosine-based activation motif (ITAM)-containing intracellular signaling polypeptides. In some embodiments, the intracellular signaling domain contains at least one, at least two, at least three, at least four, at least five, or at least six ITAM motifs, as described below. In some embodiments, the ITAM motif is repeated twice in the intracellular signaling domain, wherein the first and second instances of the ITAM motif are separated from each other by 6 to 8 amino acids. In one embodiment, the intracellular signaling domain of a subject CAR contains three ITAM motifs. In some embodiments, the intracellular signaling domain comprises a signaling domain of a human immunoglobulin receptor containing an immunoreceptor tyrosine-based activation motif (ITAM), such as, but not limited to, Fc gamma RI, Fc gamma RIIA, Fc gamma RIIC, Fc gamma RIIIA, or FcRL5.

[0178] A suitable intracellular signaling domain can be an ITAM motif-containing portion derived from a polypeptide containing an ITAM motif. For example, a suitable intracellular signaling domain can be an ITAM motif-containing domain derived from any ITAM motif-containing protein. Thus, a suitable intracellular signaling domain does not need to contain the entire sequence of the protein from which it is derived. Examples of suitable ITAM motif-containing polypeptides include, but are not limited to, DAP12, FCER1G (Fc epsilon receptor I gamma chain), CD3D (CD3 delta), CD3E (CD3 epsilon), CD3G (CD3 gamma), CD3Z (CD3 zeta), and CD79A (antigen receptor complex-associated protein alpha chain).

[0179] In one embodiment, the intracellular signaling domain is derived from DAP12 (also known as TYROBP; TYRO protein tyrosine kinase-binding protein; KARAP; PLOSL; DNAX-activating protein 12; KAR-associated protein; TYRO protein tyrosine kinase-binding protein; killer activating receptor-associated protein; killer activating receptor-associated protein, etc.). In one embodiment, the intracellular signaling domain is derived from FCER1G (also known as FCRG; Fc epsilon receptor I gamma chain; Fc receptor gamma chain; fc epsilon RI gamma; fcR gamma; fceR1 gamma; high affinity immunoglobulin epsilon receptor subunit gamma; immunoglobulin E receptor, high affinity, gamma chain; etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 delta chain (also known as CD3D; CD3-DELTA; T3D; CD3 antigen, delta subunit; CD3 delta; CD3d antigen, delta polypeptide (TiT3 complex); OKT3, delta chain; T cell receptor T3 delta chain; T cell surface glycoprotein CD3 delta chain; etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 epsilon chain (also known as CD3e, T cell surface antigen T3 / Leu-4 epsilon chain, T cell surface glycoprotein CD3 epsilon chain, AI504783, CD3, CD3 epsilon, T3e, etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 gamma chain (also known as CD3G, T cell receptor T3 gamma chain, CD3-GAMMA, T3G, gamma polypeptide (TiT3 complex), etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 zeta chain (also known as CD3Z, T cell receptor T3 zeta chain, CD247, CD3-zeta, CD3H, CD3Q, T3Z, TCRZ, etc.).In one embodiment, the intracellular signaling domain is derived from CD79A (also known as B-cell antigen receptor complex-associated protein alpha chain; CD79a antigen (immunoglobulin-associated alpha); MB-1 membrane glycoprotein; Ig-alpha; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein, etc.). In one embodiment, an intracellular signaling domain suitable for use in a subject CAR of the present disclosure comprises a DAP10 / CD28-type signaling chain. In one embodiment, an intracellular signaling domain suitable for use in a subject CAR of the present disclosure comprises a ZAP70 polypeptide. In one embodiment, the intracellular signaling domain comprises the cytoplasmic signaling domain of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular signaling domain of a CAR comprises the cytoplasmic signaling domain of human CD3 zeta.

[0180] Typically, the entire intracellular signaling domain can be used, although in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion can be used in place of the intact chain, so long as it transmits the effector function signal. The intracellular signaling domain includes a truncated portion of the intracellular signaling domain sufficient to transmit the effector function signal.

[0181] The intracellular signaling domains described herein can be combined with any of the costimulatory signaling domains described herein, any of the antigen-binding domains described herein, any of the transmembrane domains described herein, or any of the other domains described herein that can be included in a CAR. In one embodiment, the intracellular domain of a CAR comprises a dual signaling domain. The dual signaling domain can include fragments or domains from any of the molecules described herein. In one embodiment, the intracellular domain comprises a 4-1BB costimulatory domain and a CD3 zeta signaling domain; a CD28 costimulatory domain and a CD3 zeta signaling domain; or a CD2 costimulatory domain and a CD3 zeta signaling domain. In some embodiments, the intracellular domain of a CAR comprises at least one signaling domain from any portion of a costimulatory molecule, such as CD3, CD27, CD28, ICOS, 4-1BB, PD-1, a T cell receptor (TCR), any derivative or variant thereof, any synthetic sequence thereof having the same functional capability, and any combination thereof.

[0182] Furthermore, mutant intracellular signaling domains suitable for use in the target CAR are known in the art.YMFM motif is found in ICOS, and is an SH2 binding motif that recruits both p85 and p50 alpha subunits of PI3K, thereby enhancing AKT signal transduction.In one embodiment, CD28 intracellular domain mutants can be generated to contain YMFM motif.

[0183] In one embodiment, the intracellular domain of a subject CAR comprises a CD3 zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO:52 or SEQ ID NO:54, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO:53 or SEQ ID NO:55, respectively.

[0184] Acceptable mutations of the intracellular domain, while maintaining specific activity, will be known to those of skill in the art. In one embodiment, the intracellular domain comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO:52 or 54. In one embodiment, the intracellular domain may be encoded by a nucleic acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NO:53 or 55.

[0185] 5. Costimulatory Domain In one embodiment, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. In one embodiment, the intracellular domain comprises a costimulatory signaling domain. In one embodiment, the intracellular domain of the CAR comprises a portion of a signaling domain from a protein of the TNFR superfamily, a costimulatory signaling domain selected from the group consisting of CD27, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and an intracellular domain derived from a killer immunoglobulin-like receptor (KIR, a derivative or variant thereof, a synthetic sequence thereof having the same functional capability, and any combination thereof).

[0186] In some embodiments, the costimulatory domain comprises one or more costimulatory domains of a protein selected from the group consisting of proteins of the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and an intracellular domain from a killer immunoglobulin-like receptor (KIR), or a variant thereof. In some embodiments, the costimulatory domain comprises one or more costimulatory domains of a protein selected from the group consisting of proteins of the CD28, 4-1BB (CD137), OX40 (CD134), CD27, CD2, or a combination thereof. In some embodiments, the costimulatory signaling domain comprises a 4-1BB costimulatory domain. In some embodiments, the costimulatory signaling domain comprises a CD2 costimulatory domain. In some embodiments, the costimulatory signaling domain comprises a CD28 costimulatory domain.

[0187] In some embodiments, the costimulatory domain has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NOs:37, 39, 41, 43, 46, 48, or 50. In some embodiments, the intracellular domain has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs:38, 40, 42, 44, 45, 47, 49, or 51.

[0188] In one embodiment, the intracellular domain of a subject CAR comprises an ICOS costimulatory domain and a CD3 zeta intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD28 costimulatory domain and a CD3 zeta intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD28YMFM mutant costimulatory domain and a CD3 zeta intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD27 costimulatory domain and a CD3 zeta intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises an OX40 costimulatory domain and a CD3 zeta intracellular signaling domain. In one exemplary embodiment, the intracellular domain of a subject CAR comprises a 4-1BB costimulatory domain and a CD3 zeta intracellular signaling domain. In one exemplary embodiment, the intracellular domain of a subject CAR comprises a CD2 costimulatory domain and a CD3 zeta intracellular signaling domain.

[0189] B. Additional Antigen-Binding Polypeptides In some embodiments, the modified T cells express an antigen-binding polypeptide, a cell surface receptor ligand, or a polypeptide that binds to a tumor antigen. In some cases, the antigen-binding domain comprises an antibody that recognizes a cell surface protein or a receptor expressed on a tumor cell. In some cases, the antigen-binding domain comprises an antibody that recognizes a tumor antigen. In some examples, the antigen-binding domain comprises a full-length antibody or an antigen-binding fragment thereof, Fab, F(ab)2, monospecific Fab2, bispecific Fab2, trispecific Fab2, single-chain variable fragment (scFv), diabody, triabody, minibody, V-NAR, or VhH.

[0190] C. Cell surface receptor ligands In some embodiments, the lentiviral or retroviral vector of the present disclosure further comprises a nucleic acid encoding a cell surface receptor ligand. Optionally, the ligand binds to a cell surface receptor expressed on tumor cells. Optionally, the ligand comprises a wild-type protein or a mutant thereof that binds to the cell surface receptor. In some examples, the ligand comprises a full-length protein or a functional fragment thereof that binds to the cell surface receptor. In some cases, the functional fragment comprises about 90%, about 80%, about 70%, about 60%, about 50%, or about 40% of the length of the full-length version of the protein, but retains binding to the cell surface receptor. Optionally, the ligand is a de novo engineered protein that binds to the cell surface receptor. Exemplary ligands include, but are not limited to, epidermal growth factor (EGF), platelet-derived growth factor (PDGF), or Wnt3A.

[0191] D. Tumor antigens In some embodiments, the lentiviral or retroviral vector of the present disclosure further comprises a nucleic acid encoding a polypeptide that binds to a tumor antigen. In some embodiments, the tumor antigen is associated with a hematological malignancy. Exemplary tumor antigens include, but are not limited to, CD19, CD20, CD22, CD33 / IL3Ra, ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFRvIII, GPC2, Tn-MUC1, GDNF family receptor alpha-4 (GFRa4), fibroblast activation protein (FAP), and IL13Ra2. In some cases, the tumor antigen comprises CD19, CD20, CD22, BCMA, CD37, mesothelin, PSMA, PSCA, Tn-MUC1, EGFR, EGFRvIII, c-Met, HER1, HER2, CD33, CD133, GD2, GPC2, GPC3, NKG2D, KRAS, or WT1. In some instances, the polypeptide is a ligand of a tumor antigen, e.g., a full-length protein that binds to the tumor antigen, a functional fragment thereof, or a de novo modified ligand that binds to the tumor antigen. In some instances, the polypeptide is an antibody that binds to the tumor antigen.

[0192] E. Artificial T Cell Receptor In some embodiments, the antigen-binding domain of a CAR described herein can be grafted onto one or more constant domains of a T cell receptor ("TCR") chain (e.g., a TCR alpha chain or a TCR beta chain) to create a chimeric TCR. The chimeric TCR can transmit a signal through the TCR complex upon antigen binding. For example, an scFv as disclosed herein can be grafted onto at least a portion of the constant domain, extracellular constant domain, or transmembrane domain of a TCR chain. As another example, an antibody fragment, such as a VL domain as described herein, can be grafted onto the constant domain of a TCR alpha chain. Such chimeric TCRs can be created, for example, by methods known in the art (e.g., Willemsen RA et al., Gene Therapy 2000;7:1369-1377; Zhang T et al., Cancer Gene Ther 2004;11:487-496; Aggen et al., Gene Ther. 2012 Apr;19(4):365-74).

[0193] F. Switch receptors and dominant-negative receptors In one aspect, the lentiviral or retroviral vector of the present disclosure further comprises a nucleic acid encoding a dominant-negative receptor, a switch receptor, or a combination thereof. In one embodiment, the lentiviral or retroviral vector described herein comprises a chimeric antigen receptor (CAR) and / or a dominant-negative receptor. In some embodiments, the lentiviral or retroviral vector comprises a CAR and / or a switch receptor. In some embodiments, the lentiviral or retroviral vector described herein comprises an artificial TCR and a switch receptor. In some embodiments, the lentiviral or retroviral vector described herein comprises an artificial TCR and a dominant-negative receptor. In one embodiment, the lentiviral or retroviral vector described herein comprises a KIR and a switch receptor. In one embodiment, the lentiviral or retroviral vector described herein further comprises a KIR and a dominant-negative receptor.

[0194] 1. Switch receptor The present disclosure provides a rapid and efficient manufacturing process for engineering modified immune cells containing a CAR or an exogenous TCR and / or switch receptor. In some embodiments, the CAR-TCR and / or switch receptor are encoded by one or more nucleic acids. In some embodiments, the lentiviral or retroviral vector disclosed herein comprises one or more nucleic acid sequences encoding the CAR-TCR and / or switch receptor. In some embodiments, the nucleic acid sequence encoding the CAR is operably linked to the nucleic acid sequence encoding the switch receptor. In some embodiments, the switch receptor can increase the efficiency of the CAR or CAR-expressing cells.

[0195] Tumor cells generate an immunosuppressive microenvironment that protects them from immune recognition and elimination. This immunosuppressive microenvironment can limit the effectiveness of immunosuppressive therapies, such as CAR-T or TCR-T cell therapy. For example, the secreted cytokine transforming growth factor β (TGFβ) directly inhibits the function of cytotoxic T cells and further suppresses the immune response by inducing the formation of regulatory T cells. TGFβ-mediated T cell immunosuppression in prostate cancer has previously been demonstrated. To mitigate the immunosuppressive effects of TGFβ, immune cells can be engineered to express an artificial TGFβR that contains the extracellular ligand-binding domain of the TGFβR and the intracellular signaling domain of, for example, the interleukin-12 receptor (IL12R; TGFβR-IL12R). Thus, engineered immune cells containing the switch receptor can bind to negative signaling molecules in the engineered immune cell microenvironment and convert the negative signaling signals exerted by inhibitory molecules into positive signals that stimulate the engineered immune cells. Receptors of the present disclosure can be designed to reduce the effect of negative signaling molecules or to transduce negative signals into positive signals by containing intracellular domains associated with positive signals.

[0196] As used herein, the term "switch receptor" refers to a molecule designed to reduce the effect of a negative signaling molecule on the engineered immune cells of the present invention. The switch receptor comprises a first domain derived from a first polypeptide associated with a negative signal (a signaling signal that suppresses or inhibits cell or T cell activation) and a second domain derived from a second polypeptide associated with a positive signal (a signaling signal that stimulates cells or T cells). In some embodiments, the protein associated with a negative signal is selected from the group consisting of CTLA4, PD-1, TGFβRII, BTLA, VSIG3, VSIG8, and TIM-3. In some embodiments, the protein associated with a positive signal is selected from the group consisting of CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0197] In some embodiments, the first domain comprises at least a portion of the extracellular domain of a first polypeptide associated with a negative signal, and the second domain comprises at least a portion of the intracellular domain of a second polypeptide associated with a positive signal. Thus, the switch receptor comprises a fusion of the extracellular domain associated with a negative signal and the intracellular domain associated with a positive signal. In some embodiments, the switch receptor comprises the extracellular domain, transmembrane domain, and intracellular domain of a signaling protein associated with a negative signal. In some embodiments, the transmembrane domain of the switch receptor is selected from the transmembrane domain of a protein associated with a negative signal or the transmembrane domain of a protein associated with a negative signal. In some embodiments, the transmembrane domain of the switch receptor is selected from the transmembrane domain of a protein selected from the group consisting of CTLA4, PD-1, VSIG3, VSIG8, TGFβRII, BTLA, TIM-3, CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0198] In some embodiments, the switch receptor is PD-1-CD28, PD-1A132L-CD28, PD-1-CD27, PD-1A132L-CD27, PD-1-4-1BB, PD-1A132L-4-1BB, PD-1-ICOS, PD-1A132L-ICOS, PD-1-IL12Rβ1, PD-1A132L-IL12Rβ1, PD-1-IL12Rβ2, PD-1A132L-IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-C D27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1, and TGFβRII-IL12Rβ2.

[0199] 2. Dominant-negative receptors The present disclosure provides a rapid and efficient manufacturing process for engineering CARs or modified immune cells comprising exogenous TCRs and dominant-negative receptors. In some embodiments, the CAR-TCR and / or switch receptor are encoded by one or more nucleic acids. In some embodiments, the lentiviral or retroviral vectors disclosed herein comprise one or more nucleic acid sequences encoding the CAR-TCR and / or dominant-negative receptor. In some embodiments, the nucleic acid sequence encoding the CAR is operably linked to a nucleic acid sequence encoding a dominant-negative receptor. In some embodiments, the dominant-negative receptor enhances the efficiency of the CAR or CAR-expressing cells.

[0200] A "dominant negative receptor" refers to a molecule designed to reduce the effect of a negative signaling molecule (e.g., the effect of a negative signaling molecule on an engineered immune cell of the present invention). A dominant negative receptor is a truncated mutant of a wild-type protein associated with a negative signal. In some embodiments, the protein associated with a negative signal is selected from the group consisting of CTLA4, PD-1, BTLA, TGFβRII, VSIG3, VSIG8, and TIM-3.

[0201] The dominant negative receptors of the present invention may bind to negative signaling molecules (e.g., CTLA4, PD-1, BTLA, TGFβRII, VSIG3, VSIG8, TIM-3) via their extracellular domains associated with negative signals, potentially reducing the effects of the negative signaling molecules. For example, modified immune cells containing dominant negative receptors may bind to negative signaling molecules in the microenvironment of the modified immune cells, but this binding does not transmit this signal intracellularly to modify the activity of the modified T cells. Rather, this binding sequesters the negative signaling molecules, preventing them from binding to endogenous receptors / ligands, thereby reducing the effect of the negative signaling molecules on the modified immune cells. Thus, immune cells can be modified to express dominant negative receptors to reduce the immunosuppressive effects of certain molecules.

[0202] In some embodiments, the dominant negative receptor comprises a truncated mutant of a wild-type protein associated with a negative signal. In some embodiments, the dominant negative receptor comprises a mutant of a wild-type protein associated with a negative signal, comprising an extracellular domain, a transmembrane domain, and substantially lacking an intracellular signaling domain. In some embodiments, the dominant negative receptor comprises the extracellular domain and transmembrane domain of a signaling protein associated with a negative signal. In some embodiments, the dominant negative receptor is a PD-1, CTLA4, BTLA, TGFβRII, VSIG3, VSIG8, or TIM-3 dominant negative receptor. In some embodiments, the dominant negative receptor is a PD-1 or TGFβRII dominant negative receptor. Acceptable variations of dominant negative receptors will be known to those of skill in the art while maintaining their intended biological activity (e.g., blocking a negative signal and / or sequestering a molecule that has a negative signal when expressed in a cell).

[0203] G. Improving Fitness by Chemokines and Cytokines as Immune Enhancers The present disclosure provides a rapid and efficient manufacturing process for engineering modified immune cells containing a CAR, or an exogenous TCR, and / or an immune-enhancing factor that improves the fitness of the modified immune cells. In some embodiments, the immune-enhancing factor or functional derivative thereof is a polypeptide that enhances the function of the immune cell.

[0204] In some embodiments, the immune cell function-enhancing polypeptide, or functional derivative thereof, is selected from a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19, or a combination thereof. In some embodiments, the chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, C-C motif chemokine ligand 21 (CCL21), or C-C motif chemokine ligand 19 (CCL19) is an immune function enhancer that improves the fitness of the claimed modified immune cells. Without wishing to be bound by theory, the addition of nucleic acids encoding a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CCL21, or CCL19 to the modified immune cells of the disclosure enhances the immune induction effect and anti-tumor activity of the modified immune cells.

[0205] 1.T cell infiltration Without wishing to be bound by theory, interleukins and chemokines may promote T cell priming and / or T cell infiltration in solid tumors. For example, in microsatellite-stable colorectal cancer (CRC), which has low T cell infiltration, IL-15 promotes T cell priming. In some embodiments, the combination of a CAR and a chemokine / interleukin receptor complex promotes T cell priming. Furthermore, IL-15 may induce NK cell infiltration. In some embodiments, the response to the IL-15 / IL-15RA complex can result in NK cell infiltration. In one embodiment, the modified immune cells described herein further comprise an IL-15 / IL-15Ra complex. In some embodiments, the IL-15 / IL-15Ra complex is selected from NIZ985 (Novartis), ATL-803 (Altor), or CYP0150 (Cytune). In some embodiments, the IL-15 / IL-15RA complex is NIZ985. In some embodiments, IL-15 stimulates natural killer cells to eliminate (e.g., kill) pancreatic cancer cells. In some embodiments, a therapeutic response to the engineered immune cells described herein further comprising IL-15 / IL15Ra is associated with natural killer cell infiltration in an animal model of colon cancer. In some embodiments, the IL-15 / IL-15Ra complex comprises human IL-15 complexed with a soluble form of human IL-15Ra. The complex may comprise IL-15 covalently or non-covalently bound to the soluble form of IL-15Ra. In one embodiment, human IL-15 is non-covalently bound to the soluble form of IL-15Ra.

[0206] The ineffectiveness of CAR-T cell therapy for solid tumors is partly due to the limited recruitment and accumulation of immune cells and CAR-T cells in solid tumors. One approach to address this issue is to engineer CAR-T cells that mimic the function of T-zone fibroblast reticular cells (FRCs). Lymph nodes are involved in the detection of pathogens and immunogens. The T-zone contains three types of cells: (1) innate immune cells such as dendritic cells, monocytes, macrophages, and granulocytes; (2) adaptive immune cells such as CD4 and CD8 lymphocytes; and (3) stromal cells (FRCs). These cells cooperate to mount effective immune responses against pathogens by promoting the activation, differentiation, and maturation of CD4 T cells. FRCs are particularly important because they form a network that allows dendritic cells and T cells to migrate within the lymph node and attract B cells. In particular, FRCs provide a network for: (i) recruitment of naive T cells, B cells, and dendritic cells to lymph nodes by releasing two chemokines (CCL21 and CCL19); (ii) T cell survival by secreting IL-7, a survival factor particularly for naive T cells; and (iii) trafficking of CD4 T cells to germinal centers (GCs; distinct parts of lymph nodes). Thus, CARs armed with exogenous CCL21 or CCL19 and IL-7 promote the recruitment of T cells, B cells, and dendritic cells to solid tumors. In some embodiments, modified immune cells engineered by the methods disclosed herein comprise a lentiviral or retroviral vector containing a nucleic acid encoding an immune function enhancer, and a CAR. In this embodiment, the nucleic acid encoding the immune function enhancer is a nucleic acid encoding interleukin-7 and a nucleic acid encoding CCL19 or CCL21.

[0207] In some embodiments, a nucleic acid of an immune function enhancer (i.e., a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21, or CCL19) is fused to the CAR. In some embodiments, the chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21, or CCL19 is fused to the CAR via a self-cleaving peptide such as P2A, T2A, E2A, or F2A.

[0208] 2. T cell priming (IL-18) The present disclosure provides a rapid and efficient manufacturing process for engineering CARs or modified immune cells comprising exogenous TCRs and / or polypeptides that enhance T cell priming (i.e., T cell priming polypeptides). In some embodiments, the polypeptide that enhances T cell priming (ETP) is selected from the group consisting of a costimulatory molecule, a soluble cytokine, a polypeptide involved in antigen presentation, a polypeptide involved in trafficking and / or migration, or a polypeptide involved in dendritic cell targeting, or a functional fragment or variant thereof. In one embodiment, the T cell priming costimulatory molecule is selected from the group consisting of CD70, CD83, CD80, CD86, CD40, CD154, CD137L (4-1BBL), CD252 (OX40L), CD275 (ICOS-L), CD54 (ICAM-1), CD49a, CD43, CD48, CD112 (PVRL2), CD150 (SLAM), CD155 (PVR), CD265 (RANK), CD270 (HVEM), TL1A, CD127, IL-4R, GITR-L, CD160, CD258, TIM-4, CD153 (CD30L), CD200R (OX2R), CD44, their ligands, functional fragments, and variants thereof. In one embodiment, the soluble cytokine is selected from the group consisting of IL-2, IL-12, IL-6, IL-7, IL-15, IL-18, IL-21, GM-CSF, IL-18, IL-21, IL-27, and functional fragments and variants thereof. In one embodiment, the polypeptide involved in antigen presentation is selected from the group consisting of CD64, MHC I, MHC II, and functional fragments and variants thereof. In one embodiment, the polypeptide involved in trafficking and / or migration is selected from the group consisting of CD183, CCR2, CCR6, CD50, CD197, CD58, CD62L, and functional fragments and variants thereof. In one embodiment, the polypeptide involved in targeting DCs is selected from the group consisting of TLR ligands, anti-DEC-205 antibodies, anti-DC-SIGN antibodies, and functional fragments and variants thereof.

[0209] In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 2 (IL-2) (e.g., GenBank Acc. No. AAB46833.1) or the nucleic acid sequence of IL-2 (e.g., GenBank Acc. No. S82692.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 12 (IL-12) (e.g., GenBank Acc. No. AAD16432.1) or the nucleic acid sequence of IL-12 (e.g., GenBank Acc. No. AF101062.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 6 (IL-6) (e.g., GenBank Acc. No. AAD13886.1 or NP_000591.1) or the nucleic acid sequence of IL-6 (e.g., GenBank Acc. No. S56892.1 or NM_000600.3). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 7 (IL-7) (e.g., GenBank Acc. No. AAH47698.1 or NP_000871.1) or the nucleic acid sequence of IL-7 (e.g., GenBank Acc. No. BC047698.1 or NM_000880.3). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 15 (IL-15) (e.g., GenBank Acc. No. AAU21241.1) or the nucleic acid sequence of IL-15 (e.g., GenBank Acc. No. AY720442.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin 18 (IL-18) (e.g., GenBank Acc. No. AAK95950.1) or the nucleic acid sequence of IL-18 (e.g., GenBank Acc. No. AY044641.1). In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of interleukin-21 (IL-21) (e.g., GenBank Acc. No. AAG29348.1) or the nucleic acid sequence of IL-21 (e.g., GenBank Acc. No. AF254069.1).In some embodiments, the T cell priming polypeptide comprises the amino acid sequence of GM-CSF (e.g., GenBank Acc. No. AAA52578.1) or the nucleic acid sequence of GM-CSF (e.g., GenBank Acc. No. M11220.1). In some embodiments, the T cell priming polypeptide is IL-18.

[0210] In some embodiments, the expression of the CAR or CAR does not substantially affect the expression level of a T cell priming polypeptide in armored CAR-T cells. In some embodiments, the CAR comprises an antigen-binding domain that binds an antigen, and the expression of the T cell priming polypeptide does not substantially affect the expression level or cell-killing function of the CAR or CAR in armored CAR-T cells.

[0211] In some embodiments, the lentiviral or retroviral vector disclosed herein comprises and delivers one or more T cell priming polypeptides. In one embodiment, the lentiviral or retroviral vector comprises two, three, four, five, six, or more nucleic acids encoding one or more T cell priming polypeptides; and further comprises a nucleic acid sequence encoding a CAR. In some embodiments, the co-delivery of one or more T cell priming polypeptides does not affect (e.g., substantially reduce or substantially inhibit) the expression or activity of the co-expressed CAR in armored CAR-T cells or armored CAR-expressing immune cells. In some embodiments, the CAR does not affect (e.g., substantially reduce or substantially inhibit) the expression or activity of the co-expressed T cell priming polypeptide.

[0212] III. Nucleic Acids and Expression Vectors A. Nucleic Acid Encoding a CAR The present disclosure provides a nucleic acid molecule encoding one or more CAR constructs described herein.The nucleic acid molecule can be a messenger RNA transcript.The nucleic acid molecule can also be a DNA construct.

[0213] In one aspect, the present disclosure provides an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR), which may comprise a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. In some embodiments, the anti-CD19 binding domain is encoded by a nucleic acid sequence selected from SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216. In some embodiments, the anti-CD19 binding domain is encoded by an isolated nucleic acid molecule having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:21. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:24. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 102. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 103. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 104. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO: 114.In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:115. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:116. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:117. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:118. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:119. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:120. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:216. In some embodiments, the anti-CD19 binding domain comprises the nucleotide sequence of SEQ ID NO:225.

[0214] In some embodiments, the CAR comprises an anti-CD19 binding domain comprising a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6.

[0215] In some embodiments, the CAR comprises an anti-CD19 binding domain comprising a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198. In one embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) as disclosed in Table 2; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) as disclosed in Table 2.

[0216] The light chain variable region may comprise the amino acid sequence of SEQ ID NO:7 or 199, or an amino acid sequence having at least about 90% to about 99% identity to the amino acid sequence of SEQ ID NO:7 or 199. The heavy chain variable region may comprise the amino acid sequence of SEQ ID NO:8 or 200, or an amino acid sequence having at least about 90% to about 99% identity to the amino acid sequence of SEQ ID NO:8 or 200.

[0217] In some embodiments, the anti-CD19 binding domain has a light chain variable region comprising the amino acid sequence of SEQ ID NO:7 and a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:8.

[0218] In some embodiments, the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 200. In some embodiments, the CD19 binding domain may be an scFv.

[0219] In some embodiments, the anti-CD19 binding domain comprises SEQ ID NOs:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0220] In some embodiments, the anti-CD19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. The anti-CD19 binding domain may comprise a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs:19-24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0221] In some embodiments of the isolated nucleic acid molecules described herein, the transmembrane domain of the CAR can comprise a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD2, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In some embodiments, the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO:29, 31, or 33, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:29, 31, or 33. In some embodiments, the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO:30, SEQ ID NO:32, or SEQ ID NO:34, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30, 32, or 34. In some embodiments, the transmembrane domain comprises a CD8 transmembrane domain and / or an amino acid sequence of SEQ ID NO:29; or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:29. In some embodiments, the transmembrane domain comprises a nucleic acid sequence of SEQ ID NO:30, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30.

[0222] In some embodiments of the isolated nucleic acid molecules described herein, the CAR further comprises a hinge domain as described herein. In some embodiments, the anti-CD19 binding domain is linked to the transmembrane domain by a hinge region. In some embodiments, the hinge region may be comprised of a protein selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, an IgG hinge, a CD8 hinge, and any combination thereof.

[0223] In some embodiments of the isolated nucleic acid molecules described herein, the CAR comprises a costimulatory domain, which may be a functional signaling domain of a protein selected from the group consisting of a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137). In some embodiments, the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, or SEQ ID NO:50, or a sequence having about 90% to about 99% identity to SEQ ID NO:37, 39, 41, 43, 46, 48, or 50. In some embodiments, the costimulatory domain comprises a nucleic acid sequence selected from SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:47, or SEQ ID NO:49, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38, 40, 42, 44, 45, 47, or 49.

[0224] In some embodiments of the isolated nucleic acid molecules described herein, the CAR can comprise an intracellular signaling domain. The signaling domain can be from a protein selected from the group consisting of CD3 zeta, FcyRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d. In some embodiments, the intracellular signaling domain comprises the intracellular signaling domain of CD3 zeta, the amino acid sequence of SEQ ID NO:52 or 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:52 or 54. Alternatively, the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO:53 or 55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:53 or 55.

[0225] In some embodiments, the CAR comprises a functional 4-1BB costimulatory domain and a functional CD3 zeta intracellular signaling domain. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54.

[0226] The intracellular signaling domain may comprise the sequence of SEQ ID NO:37 and the sequence of SEQ ID NO:52 or SEQ ID NO:54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:37, SEQ ID NO:52, or SEQ ID NO:54. These sequences may be expressed in frame as a single polypeptide chain. In some embodiments, the nucleic acid sequence comprises the sequence of SEQ ID NO:38, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38. In some embodiments, the nucleic acid sequence comprises the sequence of SEQ ID NO:53 or SEQ ID NO:55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:53 or 55.

[0227] In some embodiments of the isolated nucleic acid molecules described herein, the CAR further comprises a leader sequence. The leader sequence may comprise the amino acid sequence of SEQ ID NO:25.

[0228] One aspect of the present disclosure provides an isolated nucleic acid molecule comprising an scFv comprising an anti-CD19 binding domain described herein.One aspect of the present disclosure provides an isolated nucleic acid molecule comprising a CAR comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular domain described herein. In some embodiments, the anti-CD19 binding domain comprises a LC CDR1 of SEQ ID NO:1, a LC CDR2 and a LC CDR3 of SEQ ID NO:2, a HC CDR1 of SEQ ID NO:4, a HC CDR2 of SEQ ID NO:5, and a HC CDR3 of SEQ ID NO:6; or a LC CDR1 of SEQ ID NO:193, a LC CDR2 of SEQ ID NO:194, and a LC CDR3 of SEQ ID NO:195; a HC CDR1 of SEQ ID NO:196, a HC CDR2 of SEQ ID NO:197, and a HC CDR3 of SEQ ID NO:198; or any LC CDR1, LC CDR2, LC CDR3, HC CDR1, HC CDR2, and HC CDR3 disclosed in Table 2. The antibody comprises a CDR3, wherein the transmembrane domain is selected from a CD28 or CD8 transmembrane domain, the costimulatory domain comprises an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and the intracellular signaling domain comprises CD3-zeta or FcR gamma.

[0229] In another embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0230] One embodiment of the present disclosure provides an isolated nucleic acid molecule comprising a CAR comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular domain. The anti-CD19 binding domain comprises the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146. The transmembrane domain can be selected from a CD28 or CD8 transmembrane domain, and the costimulatory domain can comprise an intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and an intracellular signaling domain comprising CD3-zeta or FcR gamma.

[0231] One embodiment of the present disclosure provides an isolated nucleic acid molecule comprising an scFv comprising an anti-CD19 binding domain.One embodiment of the present disclosure provides an isolated nucleic acid molecule comprising a CAR comprising an anti-CD19 binding domain (e.g., scFv), a transmembrane domain, a costimulatory domain, and an intracellular domain. The anti-CD19 binding domain comprises the amino acid sequence of SEQ ID NO:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; the transmembrane domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:29, 31, and 33; the costimulatory domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO:37, SEQ ID NO:39, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:48, and SEQ ID NO:50; and the intracellular signaling domain comprises the amino acid sequence of SEQ ID NO:52 or SEQ ID NO:54.

[0232] One embodiment of the present disclosure provides an isolated nucleic acid molecule comprising: an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO:9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; a transmembrane domain comprising the amino acid sequence of SEQ ID NO:29; a costimulatory domain comprising the amino acid sequence of SEQ ID NO:37; and an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO:52 or 54.

[0233] One aspect of the present disclosure provides an isolated nucleic acid comprising an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23, and 20; and / or an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22, and 19.

[0234] One aspect of the present disclosure provides an isolated nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0235] One aspect of the present disclosure provides an isolated polypeptide molecule encoded by a nucleic acid molecule described herein, wherein the isolated polypeptide may comprise a sequence selected from the group consisting of SEQ ID NOs: 63, 74, 85, 145, 167, 178, 200, 211, 156, 189, 17, 8, 62, 73, 84, 144, 166, 177, 199, 210, 155, 188, 16, and 7.

[0236] B. Expression Vectors One aspect of the present disclosure provides a vector (e.g., an expression vector) comprising the described isolated nucleic acid. The vector may be selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector.

[0237] The lentiviral vector may be based on a virus selected from the group consisting of retrovirus, alpharetrovirus, betaretrovirus, gammaretrovirus, deltaretrovirus, and epsilonretrovirus.For example, the lentiviral vector may be based on human immunodeficiency virus (HIV), equine infectious anemia virus (EIAV), Visna-Medivirus (VMV), caprine arthritis-encephalitis virus (CAEV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), VISNA virus, and simian immunodeficiency virus (SIV). In some embodiments, the lentiviral vector may be pseudotyped with an envelope glycoprotein (Env) from a virus selected from the group consisting of murine leukemia virus (MLV), vesicular stomatitis virus (VSV) Indiana strain, VSV New Jersey strain, Cocal virus, Chandipura virus, Pirie virus, spring viral syndrome of carp virus (SVCV), Sigma virus, infectious hematopoietic necrosis virus (IHNV), Mokola virus, rabies virus CVS virus, Isfahan virus, Alagoas virus, Calchaqui virus, Jurona virus, La Joya virus, Maraba virus, feline endogenous retrovirus (RD114) envelope protein, Perinet virus, Yug Bugdanovac virus, prototype foamy virus (PFV), and gibbon ape leukemia virus (GaLV). In some embodiments, the lentiviral vector may be pseudotyped with an envelope glycoprotein (Env) selected from the group consisting of vesicular stomatitis virus (VSV) Indiana strain, VSV New Jersey strain, and Cocal virus.

[0238] In some embodiments of the lentiviral vectors described herein, the viral envelope protein (Env) comprises a VSV-G glycoprotein selected from the group consisting of Indiana strain VSV-G, New Jersey strain VSV-G, Kokar virus envelope protein, Isfahan virus envelope protein, Chandipura virus envelope protein, Pili virus envelope protein, murine leukemia virus (MLV) envelope glycoprotein, SVCV virus envelope protein, and mutants thereof. The lentiviral vector may also comprise a nucleotide sequence encoding a heterologous VSV-G envelope protein.

[0239] The heterologous VSV G envelope protein may be codon-optimized for human expression. Alternatively, the heterologous VSV G envelope protein may be a VSV G protein variant. In some embodiments, the lentiviral vector comprises a nucleotide sequence encoding a VSV-G envelope protein or a VSV G protein variant.

[0240] In some embodiments of the lentiviral vectors described herein, the heterologous envelope protein can be under the control of a transcriptional regulatory element, which can be a promoter selected from a eukaryotic promoter or a constitutive promoter.

[0241] The lentiviral vectors described herein may further comprise a transcriptional regulatory element, which may be located upstream of the heterologous envelope glycoprotein (i.e., in the 5' direction of the nucleotide sequence encoding the heterologous envelope glycoprotein). For example, the transcriptional regulatory element may control the expression (i.e., transcription and, accordingly, but optionally, translation) of the nucleic acid encoding the heterologous envelope glycoprotein. In some embodiments, the transcriptional regulatory element is constitutively active or is a constitutive promoter. In exemplary embodiments, the constitutively active transcriptional regulatory element or constitutive promoter is a cytomegalovirus (CMV) promoter, e.g., a CMV major immediate early promoter (CMV IE1), a murine stem cell virus promoter, an elongation factor-1 alpha promoter (EF-1 alpha), a viral simian virus 40 (SV40) (e.g., early or late), a Moloney murine leukemia virus (MoMLV), a ubiquitin C promoter, a phosphoglycerokinase (PGK) promoter, a Rous sarcoma virus (RSV), or a herpes simplex virus (HSV) (thymidine kinase) promoter.

[0242] In other embodiments, the activity of the transcriptional regulatory element may be inducible, or the promoter may be an inducible promoter. In some embodiments, the transcriptional regulatory element may be a eukaryotic promoter, such as a phosphoglycerate kinase promoter. Other transcriptional regulatory elements, including prokaryotic and eukaryotic, constitutive and inducible promoters, and origins of replication, are known in the art.

[0243] In some embodiments, the lentiviral vectors described herein can be structured and positioned such that expression of proteins, enzymes, and viral elements necessary to produce retroviral particles (i.e., cis- and trans-acting genes) is under the control of transcriptional regulatory elements. In preferred embodiments, the lentiviral vector further comprises a transcriptional regulatory element, which is upstream (i.e., in the 5' direction) of the proteins, enzymes, and viral elements necessary to produce retroviral particles (i.e., cis- and trans-acting genes), and optionally, the transcriptional regulatory element controls the expression (i.e., transcription or translation) of the protein-encoding nucleic acid and the expression (i.e., transcription or translation) of the enzymes and nucleic acids encoding the viral elements necessary to generate retroviral particles (i.e., cis- and trans-acting genes). In some embodiments, the transcriptional regulatory element can be constitutively active or a constitutive promoter.

[0244] In some embodiments, nucleic acids encoding the lentiviral vectors and heterologous envelope proteins described herein may be amplified or produced prior to introduction into producer cells and, accordingly, prior to production of viral particles. In some embodiments, nucleic acids encoding the lentiviral vectors and other proteins, enzymes, and elements required for retroviral particle production may be amplified or produced prior to introduction into producer cells and, accordingly, prior to production of retroviral proteins.

[0245] In some embodiments, the lentiviral vector and nucleic acid encoding the heterologous envelope protein can be structured and arranged such that the transcriptional control elements drive transcription, and thus translation, of the heterologous envelope protein in the producer cell, facilitating the production of lentiviral particles. In some embodiments, the lentiviral vector and nucleic acid encoding the proteins, enzymes, viral elements (i.e., cis- and trans-acting genes, including rev and gag / pol) necessary for the production of retroviral particles can be structured and arranged such that the transcriptional control elements can drive transcription, and thus translation, of the proteins, enzymes, viral elements (i.e., cis- and trans-acting genes, including rev and gag / pol).

[0246] In some embodiments, the vector comprises an isolated nucleic acid molecule comprising a CAR described herein operably linked via a linker peptide to a nucleic acid sequence encoding a switch receptor, a dominant negative receptor, or a polypeptide, or functional derivative, that can enhance immune cell function.

[0247] In some embodiments, the linker peptide is selected from F2A, E2A, P2A, T2A, or Furin-(G4S)2-T2A (F-GS2-T2A). Alternatively, the linker may comprise the amino acid sequence of SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, or SEQ ID NO:99. The linker may comprise the nucleic acid sequence of SEQ ID NO:93, 95, 97, or 98.

[0248] C. Methods for Introducing Nucleic Acids into Cells Methods for introducing nucleic acids into cells include physical methods, biological methods, chemical methods, and combinations thereof. An expression vector containing a nucleic acid of the present disclosure can be introduced into a host cell by any means known to those skilled in the art. The expression vector may optionally contain a viral sequence for transfection. Alternatively, the expression vector may be introduced by fusion, electroporation, biological (e.g., gene gun), transfection, lipofection (e.g., cationic liposome), polymer encapsulation, etc. Host cells (e.g., immune cells or CD4 + and CD8 + The host cells (e.g., immune cells) may be grown and expanded in culture before introduction of the expression vector, and then treated appropriately for vector introduction and integration. The host cells (e.g., immune cells) may then be grown and screened for markers present in the vector. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art.

[0249] In some embodiments, host cells (e.g., immune cells, CD4 + cells and CD8 + cells) or a population of host cells (e.g., immune cells, or CD4 + cells and CD8 + The host cells (e.g., immune cells, CD4 + and CD8 + cells) or a population of host cells (e.g., immune cells, CD4 + and CD8 +The exogenous cell population may be modified by the addition of cytokines, cross-linking of specific receptors, addition of antigens, introduction of nucleic acid molecules (DNA, RNA, and / or variants thereof), addition of protein agents, drugs or small molecules, or any combination thereof. In some embodiments, introduction of exogenous nucleic acid molecules includes viral transfection, non-viral transfection, electroporation, lipofection, cationic liposome-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, or biological particle delivery systems such as "gene guns."

[0250] Regardless of the method used to introduce the isolated nucleic acid molecule described herein into host cells or otherwise expose cells to the CD19 CAR of the present invention, various analytical methods can be performed to confirm the presence of the nucleic acid in host cells. Such analytical methods include, for example, molecular biological analytical methods well known to those skilled in the art, such as Southern blotting and Northern blotting, RT-PCR and PCR; biochemical analytical methods such as detecting the presence or absence of specific peptides (e.g., immunological means (ELISA and Western blot)), or analytical methods described herein for identifying agents within the scope of the present invention.

[0251] Furthermore, the nucleic acid can be introduced by any means, such as transducing the expanded host cells (e.g., immune cells), transfecting the expanded host cells (e.g., immune cells), electroporating the expanded host cells (e.g., immune cells), etc. One isolated nucleic acid molecule may be introduced by one method and another nucleic acid may be introduced into the host cells (e.g., immune cells) by another method.

[0252] 1. Biological methods Biological methods for introducing a polynucleotide of interest into host cells (e.g., immune cells) include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors (viral transfection), have become the most widely used method for inserting genes into mammalian (e.g., human) cells. Viral vectors are derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, etc.

[0253] In some embodiments, nucleic acids encoding a subject CAR, a subject artificial TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, a subject dominant-negative receptor, and / or a subject polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration) can be introduced into cells using an expression vector (viral transfection). Provided herein are expression vectors (e.g., lentiviral or retroviral vectors) containing nucleic acids encoding a subject CAR, a subject artificial TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, a subject dominant-negative receptor, and / or a subject polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration). Suitable expression vectors include lentiviral vectors, gammaretroviral vectors, foamy viral vectors, adeno-associated viral (AAV) vectors, adenoviral vectors, artificial hybrid viruses, and naked DNA (including, but not limited to, transposon-mediated vectors such as Sleeping Beauty and PiggyBac, and integrase vectors such as Phi31). Other suitable expression vectors include herpes simplex virus (HSV) and retroviral expression vectors.

[0254] In some embodiments, nucleic acids encoding a subject CAR (e.g., CD-19 CAR), a subject artificial TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, a subject dominant-negative receptor, and / or a subject polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration) are introduced into immune cells by viral transduction. In some embodiments, the viral vector is selected from the group consisting of a retroviral vector, a Sendai virus vector, an adenoviral vector, an adeno-associated virus vector, and a lentiviral vector. Various markers that can be used are known in the art and can include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc.

[0255] The modified immune cells of the present disclosure, CD4 + and CD8 + cells, or immune cells or CD4 + and CD8 + A population of cells (e.g., a subject CAR, a subject artificial TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, a subject dominant-negative receptor, and / or an immune function (e.g., T cell priming or T cell infiltration)) can be produced by stably transfecting host cells (e.g., immune cells) with an expression vector comprising a nucleic acid of the present disclosure.

[0256] Transfected cells (i.e., immune cells) expressing nucleic acids encoding a CAR, KIR, TCR, KIR, antigen-binding polypeptide, cell surface receptor ligand, tumor antigen, targeted switch receptor, targeted dominant-negative receptor, and / or a polypeptide of interest that enhances immune function (e.g., T cell priming or T cell infiltration) of the present disclosure can be grown in vitro. In some embodiments, transfected cells (i.e., immune cells) expressing nucleic acids encoding a CAR, KIR, TCR, KIR, antigen-binding polypeptide, cell surface receptor ligand, tumor antigen, targeted switch receptor, targeted dominant-negative receptor, and / or a polypeptide of interest that enhances immune function (e.g., T cell priming or T cell infiltration) of the present disclosure are not expanded in vitro.

[0257] Additional methods for generating modified cells of the present disclosure include, but are not limited to, chemical transformation methods (e.g., using calcium phosphate, dendrimers, liposomes, and / or cationic polymers), non-chemical transformation methods (e.g., electroporation, optical transformation, gene electrotransfer and / or hydrodynamic delivery), and / or particle-based methods (e.g., imparefection, using a gene gun, and / or magnetofection).

[0258] 2.Physical method Physical methods for introducing polynucleotides (RNA or DNA) or expression vectors into host cells (e.g., immune cells) include lipofection, particle bombardment, microinjection, electroporation, etc. Expression vectors or polynucleotides can be introduced into target cells using commercially available methods, including electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Massachusetts) or Gene Pulser II (BioRad, Denver, Colorado)), Multiporator (Eppendorf, Hamburg, Germany), etc.

[0259] IV.CAR-T cells One aspect of the present disclosure is a modified cell, modified immune cell, or modified CD4 + and CD8 + The modified cells are modified immune cells, modified natural killer (NK) cells, modified natural killer T (NKT) cells, or modified T cells. The modified cells are modified T cells or modified human T cells. The modified T cells are CD8 + The modified cells contemplated herein can be autologous, xenogeneic, or allogeneic cells.

[0260] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The CAR-like cells comprise a chimeric antigen receptor (CAR) containing a single-chain antibody or a single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

[0261] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 +The cells comprise an isolated nucleic acid molecule described herein. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, 24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0262] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The recombinant human ovarian cancer cell (e.g., a ovarian cancer cell) comprises an isolated polypeptide encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0263] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 +The CAR (cell) comprises a CAR comprising a single-chain antibody or single-chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. In that embodiment, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO:1, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO:2, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO:3; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO:4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO:5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO:6. In other embodiments, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 194, and light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198. In other embodiments, the anti-CD19 binding domain comprises a light chain variable domain comprising light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) disclosed in Table 2; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) disclosed in Table 2.

[0264] In some embodiments, the anti-CD19 binding domain comprises a light chain variable region comprising the amino acid sequence of SEQ ID NO:7 or 199; or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:7 or 199; and / or a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:8 or 200, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:8 or 200.

[0265] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + In some embodiments, the modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + The anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, and 146, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146.

[0266] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 +The CD19-binding domain (cell) comprises a CAR comprising an anti-CD19 binding domain encoded by the amino acid sequence of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. In some embodiments, the anti-CD19 binding domain is encoded by a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21 or 24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0267] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 +The antibody (cell) comprises a CAR containing an anti-CD19 binding domain, wherein the light chain variable region comprises a light or heavy chain variable region encoded by an amino acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216. Alternatively, the anti-CD19 binding domain comprises a light or heavy chain variable region encoded by a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs:19-24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0268] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 +cells) are identified as SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO: and a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD2, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In that embodiment, the transmembrane domain may comprise an amino acid sequence selected from SEQ ID NO:29, 31, or 33, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:29, 31, or 33. Alternatively, the transmembrane domain may comprise a nucleic acid sequence selected from SEQ ID NO:30, SEQ ID NO:32, or SEQ ID NO:34, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30, 32, or 34.The transmembrane domain may comprise the CD8 transmembrane domain, and / or the amino acid sequence of SEQ ID NO:29; or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:29. The transmembrane domain may comprise the nucleic acid sequence of SEQ ID NO:30, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:30.

[0269] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 +The cell) comprises a CAR comprising an anti-CD19 binding domain comprising a light chain variable region or a heavy chain variable region encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, and SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216; and the anti-CD19 binding domain may be linked to the transmembrane domain by a hinge region. The hinge region may be from a protein selected from the group consisting of an Fc fragment of an antibody, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, an IgG hinge region, a CD8 hinge, and any combination thereof, wherein the hinge comprises the amino acid sequence of SEQ ID NO:27 or SEQ ID NO:35, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:27 or 35. The hinge region can comprise a CD8 hinge region and / or the amino acid sequence of SEQ ID NO:27, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:27.In one embodiment thereof, the CAR further comprises a functional signaling domain (e.g., a costimulatory domain) of a protein selected from the group consisting of a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, 4-1BB (CD137).

[0270] In some embodiments, modified cells (e.g., modified immune cells, or modified CD4 + and CD8 + Cells) include CD194BBz CAR, CD19CD2z, CD19CD2z CAR, CD19CD27z CAR, CD19Ox40z CAR, CD1928z YMFM, CD19ICOSz, and CD19ICOS-1z.

[0271] One aspect of the present disclosure is a modified cell, modified immune cell, or modified CD4 receptor comprising a chimeric antigen receptor (CAR), a switch receptor, a dominant negative receptor, and / or a polypeptide that enhances immune cell function, comprising an anti-CD19 binding domain. + and CD8 +In some embodiments, the switch receptor comprises a first polypeptide comprising at least a portion of an inhibitory molecule selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA, bound to a second polypeptide comprising a positive signal from an intracellular signaling domain selected from the group consisting of OX40, CD27, CD28, IL-12R, ICOS, and 4-1BB. In some embodiments, the switch receptor comprises PD-1-CD28, PD-1A132L-CD28, PD-1-CD27, PD-1A132L-CD27, PD-1-4-1BB, PD-1A132L-4-1BB, PD-1-ICOS, PD-1A132L-ICOS, PD-1-IL12Rβ1, PD-1A132L-IL12Rβ1, PD-1-IL12Rβ2, PD-1A132L-IL12Rβ2, Selected from the group consisting of VSIG3-CD28, VSIG8-CD28, VSIG3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1, and TGFβRII-IL12Rβ2.

[0272] In some embodiments, the dominant negative receptor comprises a truncated variant of a receptor selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA, hi some embodiments, the dominant negative receptor is a PD-1, CTLA4, BTLA, TGFβRII, VSIG3, VSIG8, or TIM-3 dominant negative receptor.

[0273] In some embodiments, the immune cell function-enhancing polypeptide, or functional derivative thereof, is selected from a chemokine, chemokine receptor, cytokine, cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19, or a combination thereof. In some embodiments, the chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, C-C motif chemokine ligand 21 (CCL21), or C-C motif chemokine ligand 19 (CCL19) is an immune function enhancer that improves the fitness of the claimed modified immune cells. Without wishing to be bound by theory, the addition of a nucleic acid encoding a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CCL21, or CCL19 to the modified immune cells of the present disclosure enhances the immune inductive effect and anti-tumor activity of the modified immune cells.

[0274] In some embodiments, the polypeptide that enhances immune cell function, or a functional derivative thereof, is selected from the group consisting of a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptor (IL-18R), CCL21, CCL19, and combinations thereof.

[0275] In some embodiments, modified cells, modified immune cells, or modified CD4 + and CD8 +The cells comprise a CAR (e.g., a CD19 CAR), an artificial TCR (e.g., a CD19 TCR), a KIR (CD19 KIR), an antigen-binding polypeptide, a cell surface receptor ligand, a tumor antigen, a switch receptor, a dominant negative receptor, and / or a polypeptide that enhances immune function (e.g., T cell priming or T cell infiltration).

[0276] In some embodiments, the polypeptide that enhances immune function is selected from the group consisting of a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, IL-18R, CCL21, CCL19, or a combination thereof.

[0277] Another aspect of the present disclosure is a population of modified cells, a population of modified immune cells, or a modified CD4 + and CD8 + In some embodiments, a population of cells is provided, including a modified CD4 + and CD8 + The genetically modified cells are for use in producing a protein of interest (e.g., a CD19 CAR).

[0278] The engineered modified CD4 + and CD8 + In some embodiments of the cell, the protein of interest may be selected from the group consisting of an industrial protein or a therapeutic protein. In some embodiments, the protein of interest may be selected from the group consisting of an enzyme, a regulatory protein, a receptor, a peptide, a peptide hormone, a cytokine, a membrane protein or transport protein, a vaccine antigen, an antigen-binding protein, an immunostimulatory protein, an allergen, a full-length antibody or an antibody fragment or derivative; a single-chain antibody (scFv), a Fab fragment, an Fv fragment, a single-domain antibody (VH or VL fragment), a domain antibody, a camelid single-domain antibody (VHH), a nanobody, and combinations thereof.

[0279] One aspect of the present disclosure provides a method of producing a modified cell, comprising transfecting a cell with an isolated nucleic acid molecule described herein. In some embodiments, the isolated nucleic acid molecule encodes a CAR described herein. In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, and SEQ ID NO:216.

[0280] In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:225, or SEQ ID NO:216.

[0281] One aspect of the present disclosure provides a method of producing a modified cell, comprising transfecting a cell with a vector comprising a nucleic acid encoding an anti-CD19 binding domain described herein; or an isolated nucleic acid described herein.

[0282] V. Composition One aspect of the present disclosure is a modified cell, modified lymphocyte, modified immune cell, or modified CD4 + and CD8 +Other aspects of the present disclosure provide compositions comprising modified lymphocyte populations, modified cell populations, modified immune cell populations, or modified CD4 cells produced by the methods described herein. + and CD8 + A composition comprising a population of cells is provided. Another aspect of the present disclosure provides a composition comprising the lentiviral vector described herein. In some embodiments, the composition further comprises one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients.

[0283] In some embodiments, the compositions described herein are used in pharmaceuticals for use in treating a disease or a disorder described herein (e.g., cancer, any malignant tumor, autoimmune disease involving cells or tissues that express a tumor antigen described herein). In some embodiments, the compositions described herein are used in methods for treating, treating a disease or a disorder described herein (e.g., cancer, any malignant tumor, autoimmune disease involving cells or tissues that express a tumor antigen described herein). In some embodiments, provided herein are pharmaceutical compositions comprising a CAR-expressing cell, e.g., a plurality of CAR-expressing cells, made by a manufacturing process described herein (e.g., a cytokine process or an activation process described herein).

[0284] VI. Treatment Method In one aspect, the present disclosure provides a method of adoptive cell transfer therapy comprising administering to a subject in need thereof modified immune cells produced by the methods described herein. In some embodiments, disclosed herein is a method of treating a disease or condition in a subject comprising administering to the subject a population of modified T cells described herein, e.g., a population of modified unstimulated T cells or a population of modified stimulated T cells described herein. In some embodiments, the present invention includes a method of treating a disease or condition in a subject in need thereof, comprising administering to the subject a composition comprising the modified immune cells described herein.

[0285] One aspect of the present disclosure provides a method of treating a disease or condition in a subject, the method comprising administering modified cells, modified immune cells, or modified CD4 + and CD8 + The method of treating a disease or condition in a subject also includes administering a therapeutically effective amount of the cells to a subject in need thereof, thereby treating the disease or condition in the subject. ... + and CD8 + The method can include administering a therapeutically effective amount of the population of cells to a subject in need thereof. The method of treating a disease or condition in a subject can also include administering a therapeutically effective amount of the composition described herein to a subject in need thereof.

[0286] In some embodiments, modified immune cells or modified CD4 + and CD8 + In some embodiments, the modified immune cells or modified CD4 + and CD8 + The cells are allogeneic to the subject. In some embodiments, the modified immune cells or modified CD4 + and CD8 + The cells are xenogeneic to the subject. In some embodiments, the subject is human.

[0287] A. Diseases and Conditions One aspect of the present disclosure provides a method for providing anti-tumor immunity to a mammal, comprising administering to the mammal an effective amount of a composition or modified cells described herein. In some embodiments, the composition comprises modified cells expressing a CAR described herein. The composition can also comprise modified cells or a population of modified cells.

[0288] Another aspect of the present disclosure provides a method of treating a mammal having a disease associated with expression of CD19, comprising administering to the mammal an effective amount of a composition or modified cells described herein. In some embodiments, the composition comprises modified cells expressing a CAR described herein.

[0289] The modified cells can be autologous or allogeneic modified T cells. In some embodiments, the mammal is a human.

[0290] In some embodiments, the disease associated with CD19 expression is selected from a proliferative disease, malignancy, precancerous condition, or non-cancer-related indication associated with CD19 expression, hi some embodiments, the disease associated with CD19 expression is cancer, atypical cancer and / or atypical cancer, myelodysplasia, myelodysplastic syndrome, or preleukemia.

[0291] In some embodiments, the disease is a blood cancer selected from the group consisting of acute leukemia, chronic leukemia, blood diseases, and combinations thereof. The disease may also be B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell lymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell lymphoma or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, inefficient production (or dysplasia) of myeloid blood cells, and combinations thereof.

[0292] In some embodiments, the modified cells or compositions are administered in combination with an agent that enhances the efficacy of cells expressing a CAR molecule. In some embodiments, the modified cells or compositions are administered in combination with an agent that ameliorates one or more side effects associated with administration of cells expressing a CAR molecule. In some embodiments, the modified cells or compositions are administered in combination with an agent that treats a CD19-associated disease.

[0293] One aspect of the present disclosure provides adoptive cell transfer therapy for a disease or condition. In some embodiments, the disease or condition may be selected from the group consisting of cancer, autoimmune disease, lupus, neurodegenerative disease or condition, Alzheimer's disease, multiple sclerosis, infectious disease, fibrosis, liver fibrosis, pulmonary fibrosis, post-ischemic fibrosis, genetic disease, sickle cell anemia, hemophilia, and / or beta-thalassemia. In some embodiments, the disease or condition is selected from cancer, any malignant tumor, or an autoimmune disease involving cells or tissues expressing a tumor antigen described herein.

[0294] B. Combination Therapy In some embodiments, the method of treating a disease further comprises administering an additional therapeutic agent or therapy to the subject. In some aspects, the additional therapeutic agent disclosed herein comprises a chemotherapeutic agent, an immunotherapeutic agent, a targeted therapy, a radiation therapy, or a combination thereof. Exemplary additional therapeutic agents include alkylating agents such as altretamine, busulfan, carboplatin, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, lomustine, melphalan, oxalaplatin, temozolomide, or thiotepa; antimetabolites such as 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, or pemetrexed; daunorubicin, doxorubicin, or cyclosporin. Examples of additional therapeutic agents include, but are not limited to, anthracyclines such as fluvaccin, epirubicin, and idarubicin; topoisomerase I inhibitors such as topotecan and irinotecan (CPT-11); topoisomerase II inhibitors such as etoposide (VP-16), teniposide, and mitoxantrone; mitotic inhibitors such as docetaxel, estramustine, ixabepilone, paclitaxel, vinblastine, vincristine, or vinorelbine; or corticosteroids such as prednisone, methylprednisolone, or dexamethasone. In some cases, the additional therapeutic agent comprises a first-line therapy. As used herein, "first-line therapy" refers to a primary treatment for a subject with cancer. In some embodiments, the cancer is a primary cancer. In other embodiments, the cancer is a metastatic or recurrent cancer. In some cases, the first-line therapy comprises chemotherapy. In other examples, the first-line therapy comprises radiation therapy. Those skilled in the art will readily appreciate that different first-line treatments may be applicable to different types of cancer. In some cases, the additional therapeutic agent comprises an immune checkpoint inhibitor.In some cases, the immune checkpoint inhibitor comprises an inhibitor such as an antibody or fragment thereof (e.g., a monoclonal antibody, a human antibody, a humanized antibody, a chimeric antibody), an RNAi molecule, or a small molecule against PD-1, PD-L1, CTLA4, PD-L2, LAG3, B7-H3, KIR, CD137, PS, TFM3, CD52, CD30, CD20, CD33, CD27, OX40, GITR, ICOS, BTLA (CD272), CD160, 2B4, LAIR1, TIGHT, LIGHT, DR3, CD226, CD2, or SLAM. Exemplary checkpoint inhibitors include pembrolizumab, nivolumab, tremelimumab, or ipilimumab. In some embodiments, the additional therapy comprises radiation therapy.

[0295] In some embodiments, the additional treatment comprises surgery.

[0296] VII. Kit One aspect of the present disclosure is a population of modified immune cells, or a modified CD4 + and CD8 + Kits are provided that include a population of cells, or a population produced by the methods described herein. Another aspect of the present disclosure provides a kit that includes a lentiviral vector that includes a CAR described herein.

[0297] VIII.Definitions Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0298] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs.Although similar or equivalent methods and materials to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described herein.It should also be understood that the terms used herein are only for describing specific embodiments and are not intended to be limiting.

[0299] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology and recombinant DNA, which are within the skill of the art.

[0300] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" means one cell or more than one cell, including a plurality of cells, including mixtures thereof.

[0301] As used herein, the term "about" refers to a value that includes the standard deviation of error for the device or method employed to determine the value. When used before a numerical designation, such as temperature, time, amount, and concentration (including ranges), the term "about" indicates an approximation that may vary (+) or (-) (±) 20%, 15%, 10%, 5%, 3%, 2%, or 1%. Preferably, ±5%, more preferably ±1%, and even more preferably ±0.1%.

[0302] As used herein, the term "activated" refers to a state of T cells that have been sufficiently stimulated to induce detectable cell proliferation. Activation may also be associated with induced cytokine production and detectable effector function. The term "activated T cells" specifically refers to T cells that are undergoing cell division.

[0303] As used herein, the term "affinity" refers to the measure of binding strength between an antibody and a simple hapten or antigenic determinant. Without being bound by theory, affinity depends on the closeness of the stereochemical fit between the antibody binding site and the antigenic determinant, the size of the contact area between them, and the distribution of charged and hydrophobic groups. Affinity also includes the term "avidity," which refers to the strength of antigen-antibody binding after reversible complex formation. Methods for calculating the affinity of an antibody for an antigen are known in the art and include the use of binding experiments to calculate affinity. When an antibody (Ab) binds to an antigen (Ag), an affinity constant (expressed as the inverse dissociation constant) is used.

[0304] Ab+Ag=AbAgKa=i[AbAg][Ab][Ag]=1K a

[0305] The chemical equilibrium of antibody binding is determined by the on-rate constant (k forward ) and the off-rate constant (k back ) Two antibodies can have the same affinity, but one can have both a high on-rate constant and a high off-rate constant, while the other can have both a low on-rate constant and a low off-rate constant.

[0306] Antibody activity in functional assays (e.g., cytolytic assays) can also reflect antibody affinity. In some embodiments, the antigen-recognizing receptor has low affinity. Low affinity includes micromolar and nanomolar affinities. Low affinity is less than 10 -3 , 10 -4 , 10 -5 , 5×10 -5 , 5×10 -6 , 10 -6 , 5×10 -7 , 10 -7 , 5×10 -8 , 10 -8 , 5×10 -9 , or 10 -9The antibody and affinity can be characterized phenotypically and compared using functional assays (e.g., cytolytic assays). A wide variety of methods for determining binding affinity are known in the art. An exemplary method for determining binding affinity uses surface plasmon resonance. Surface plasmon resonance is an optical phenomenon that allows for the analysis of real-time biospecific interactions by detecting changes in protein concentration within a biosensor matrix, for example, using a BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden, Piscataway, NJ).

[0307] As used herein, the term "allogeneic" refers to material derived from a different animal of the same species as the individual to whom the material is introduced. Two or more individuals are said to be allogeneic to one another if their genes at one or more loci are not identical. In some embodiments, allogeneic material from individuals of the same species may be sufficiently genetically distinct to interact antigenically.

[0308] As used herein, the term "analog" in reference to a polypeptide or polynucleotide includes any mimetic, i.e., a chemical compound that has at least one of the endogenous functions of the polypeptide or polynucleotide it mimics. Typically, amino acid substitutions can be made, for example, from 1, 2, or 3 to 10 or 20 substitutions, provided that the modified sequence retains the desired activity or ability. Amino acid substitutions include the use of non-naturally occurring analogs.

[0309] Proteins used in the present disclosure may also have deletions, insertions, or substitutions of amino acid residues that result in static changes and result in functionally equivalent proteins. Deliberate amino acid substitutions may be made based on similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathicity of the residues, so long as the intrinsic function is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids with uncharged polar head groups with similar hydrophilicity values ​​include asparagine, glutamine, serine, threonine, and tyrosine. Conservative substitutions may also be made.

[0310] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. An antibody can be an intact immunoglobulin from natural or recombinant sources, or an immunoreactive portion of an intact immunoglobulin. An antibody is typically a tetramer of an immunoglobulin molecule. Antibodies in the present invention can exist in various forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab, and F(ab)2, as well as single-chain antibodies (scFv) and humanized antibodies. In some embodiments, an antibody refers to such an aggregate (e.g., an intact antibody molecule, an immunoadhesin, or a variant thereof) that has significant known specific immunoreactive activity against an antigen of interest (e.g., a tumor-associated antigen). Antibodies and immunoglobulins comprise light and heavy chains, with or without interchain covalent bonds between them. The basic structure of immunoglobulins in vertebrate systems is relatively well understood.

[0311] The term "antibody fragment" refers to a portion of an intact antibody and refers to the antigen-determining variable region of the intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, linear antibodies, scFv antibodies, multispecific antibodies formed from antibody fragments, and the like.

[0312] In some embodiments, the term "antibody fragment" refers to at least a portion of an intact antibody or a recombinant variant thereof, including an antigen-binding domain, e.g., the antigenic variable region of the intact antibody, sufficient to confer recognition and specific binding of the antibody fragment to a target, such as an antigen. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab'), Fv fragments, scFv antibody fragments, linear antibodies, single-domain antibodies such as sdAbs (either VL or VH), camelid VHH domains, and multispecific antibodies formed from antibody fragments. The term "scFv" refers to a fusion protein comprising at least one antibody fragment consisting of a light chain variable region and at least one antibody fragment consisting of a heavy chain variable region, wherein the light and heavy chain variable regions are contiguously linked via a short, flexible polypeptide linker, capable of being expressed as a single-chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. As used herein, an scFv may have the VL and VH variable regions in either order; for example, with respect to the N-terminus and C-terminus of the polypeptide, an scFv may comprise VL-linker-VH or VH-linker-VL.

[0313] The portion of the CAR composition of the invention comprising an antibody or antibody fragment thereof can exist in various forms in which the antigen-binding domain is expressed as part of a contiguous polypeptide chain, including, for example, single-domain antibody fragments (sdAbs), single-chain antibodies (scFvs), human-derived and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). In one embodiment, the antigen-binding domain of the CAR composition of the invention comprises an antibody fragment. In a further embodiment, the CAR comprises an antibody fragment comprising an scFv.

[0314] As used herein, the term "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformation.

[0315] As used herein, "antibody light chain" refers to the smaller of the two types of polypeptide chains naturally present in all antibody molecules. The α and β light chains refer to the two major antibody light chain isoforms. For example, the antigen-binding domain of a chimeric antigen receptor comprises an antibody variant. As used herein, the term "antibody variant" includes synthetic and engineered forms of antibodies that have been modified so as not to occur naturally, such as antibodies consisting of at least two heavy chain portions but not two complete heavy chains (e.g., domain-deleted antibodies or minibodies); multispecific forms of antibodies (e.g., bispecific, trispecific, etc.) that have been modified to bind to two or more different antigens or different epitopes on a single antigen; heavy chain molecules bound to scFv molecules; and the like. Furthermore, the term "antibody variant" includes multivalent antibodies (e.g., trivalent, tetravalent, etc., antibodies that bind to three, four, or more copies of the same antigen).

[0316] As used herein, the term "antigen" or "Ag" is defined as a molecule that elicits an immune response. This immune response can include either antibody production or activation of specific immunologically competent cells, or both. Those skilled in the art will understand that any macromolecule, including virtually all proteins and peptides, can function as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. Those skilled in the art will understand that DNA containing a nucleotide sequence or a partial nucleotide sequence that encodes a protein that elicits an immune response encodes an "antigen" as used herein. Furthermore, those skilled in the art will understand that an antigen need not be encoded solely by the full-length nucleotide sequence of a gene. It will be readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of one or more genes, and that these nucleotide sequences can be arranged in various combinations to elicit a desired immune response. Furthermore, those skilled in the art will understand that an antigen need not be encoded by a "gene" at all. It will be readily apparent that antigens can be synthetically produced or derived from biological samples. Such biological samples can include, but are not limited to, tissue samples, tumor samples, cells, or biological fluids.

[0317] As used herein, the term "antigen-presenting cell" or "APC" refers to a cell of the immune system, such as an accessory cell (e.g., B cell, dendritic cell, etc.), that presents foreign antigens on its surface complexed with major histocompatibility complexes (MHC). T cells can recognize these complexes using the T cell receptor (TCR). APCs process and present antigens to T cells.

[0318] As used herein, the term "anti-tumor effect" refers to a biological effect that can be manifested by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with a cancerous condition. In some embodiments, an "anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells, and antibodies of the present invention to prevent the development of tumors in the first place.

[0319] The term "autoimmune disease" as used herein is defined as a disease caused by an autoimmune reaction. Autoimmune diseases are the result of an inappropriate and excessive response to self-antigens. Examples of autoimmune diseases include, but are not limited to, Addison's disease, alopecia areata, tonic spondylitis, autoimmune hepatitis, autoimmune parotitis, cancer, Crohn's disease, diabetes mellitus (type 1), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis.

[0320] As used herein, the term "autologous" is meant to refer to any material derived from the same individual to which that material may later be reintroduced.

[0321] As used herein, the term "cancer" refers to a disease characterized by the rapid and uncontrollable growth of abnormal cells. Cancer cells can spread locally or to other parts of the body via the bloodstream or lymphatic system. As used herein, the term "cancer" refers to a disease characterized by the rapid and uncontrollable growth of abnormal cells. Cancer cells can spread locally or to other parts of the body via the bloodstream or lymphatic system. Examples of various cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain tumors, lymphoma, leukemia, lung cancer, metastatic castration-resistant prostate cancer, melanoma, synovial sarcoma, advanced TnMuc1-positive solid tumors, neuroblastoma, neuroendocrine tumors, and the like. In certain embodiments, the tumor is a CD19-positive tumor, and the cancer is medullary thyroid carcinoma. In certain embodiments, the cancer is prostate cancer. In certain embodiments, the cancer is mesothelioma or a mesothelin-expressing cancer. In some embodiments, the cancer is metastatic castration-resistant prostate cancer. The terms "cancer" and "tumor" are used interchangeably herein, and both terms encompass solid tumors and liquid tumors, diffuse tumors, or circulating tumors. In some embodiments, cancer or tumor includes pre-cancer and malignant cancers and tumors.

[0322] As used herein, the terms "cancer-associated antigen" or "tumor antigen" refer interchangeably to a molecule (typically a protein, carbohydrate, or lipid) that is expressed on the surface of cancer cells, either in whole or as a fragment (e.g., MHC / peptide), and that is useful for preferential targeting of pharmacological agents to cancer cells. In some embodiments, a tumor antigen is a marker expressed by both normal and cancer cells (e.g., a lineage marker such as CD19 on B cells). In some embodiments, a tumor antigen is a cell surface molecule that is overexpressed in cancer cells compared to normal cells, e.g., by 1-fold overexpression, 2-fold overexpression, 3-fold overexpression, or more, compared to normal cells. In some embodiments, a tumor antigen is a cell surface molecule that is inappropriately synthesized in cancer cells, e.g., a molecule that contains deletions, additions, or mutations compared to molecules expressed on normal cells. In some embodiments, a tumor antigen is expressed exclusively on the cell surface of cancer cells, either in whole or as a fragment (e.g., MHC / peptide), and is not synthesized or expressed on the surface of normal cells. In some embodiments, the CARs of the present invention include CARs that comprise an antigen-binding domain (e.g., an antibody or antibody fragment) that binds to an MHC-presented peptide. Typically, peptides derived from endogenous proteins fill the pocket of a major histocompatibility complex (MHC) class I molecule and are expressed by CD8 + MHC class I complexes are recognized by T cell receptors (TCRs) on T lymphocytes. MHC class I complexes are constitutively expressed by all nucleated cells. In cancer, virus-specific and / or tumor-specific peptide / MHC complexes represent a unique class of cell surface targets for immunotherapy. TCR-like antibodies that target peptides derived from viral or tumor antigens associated with human leukocyte antigen (HLA)-A1 or HLA-A2 have been reported. For example, TCR-like antibodies can be identified from screening libraries such as human scFv phage display libraries.

[0323] As used herein, the term "cancer-supporting antigen" or "tumor-supporting antigen" refers synonymously to a molecule (typically a protein, carbohydrate, or lipid) expressed on the surface of a cell that is not itself cancerous but supports cancer cells by promoting their growth or survival (e.g., resistance to immune cells). Exemplary cells of this type include stromal cells and myeloid-derived suppressor cells (MDSCs). As long as the antigen is present on a cell that supports cancer cells, the tumor-supporting antigen itself does not need to play a role in supporting tumor cells.

[0324] As used herein, "cell surface marker" refers to any molecule that is expressed on the surface of a cell. Cell surface expression usually requires that the molecule have a transmembrane domain. Many naturally occurring cell surface markers are referred to as "CD" or "cluster of differentiation" molecules. Cell surface markers often provide antigenic determinants to which antibodies can bind.

[0325] As used herein, the term "chimeric antigen receptor" or alternatively "CAR" refers to a recombinant polypeptide construct that includes at least an extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain") that comprises a functional signaling domain derived from a stimulatory molecule, as defined below.

[0326] In some embodiments, CAR refers to an artificial T cell receptor that is expressed on immune effector cells or their precursor cells and engineered to specifically bind to an antigen. CARs can be used in adoptive cell therapy involving adoptive cell transfer. In some embodiments, adoptive cell transfer (or therapy) involves removing T cells from a patient and modifying the T cells to express a receptor specific for a particular antigen. In some embodiments, the CAR has specificity for a selected target, such as CD19, ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFR, EGFRvIII, GPC2, GPC2, mucin 1 (MUC1), Tn antigen ((Tn Ag) or (GalNAca-Ser / Thr)), TnMUC1, GDNF family receptor alpha 4 (GFRa4), fibroblast activation protein (FAP), or interleukin-13 receptor subunit alpha 2 (IL-13Ra2 or CD213A2).

[0327] In some embodiments, the stimulatory molecule is a zeta chain associated with the T cell receptor complex. In some embodiments, the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one costimulatory molecule, as defined below. In some embodiments, the costimulatory molecule is selected from 4-1BB (i.e., CD137), CD27, and / or CD28. In some embodiments, the CAR comprises a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule. In one aspect, the CAR comprises a chimeric fusion protein comprising an extracellular antigen recognition domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a costimulatory molecule and a functional signaling domain derived from a stimulatory molecule.

[0328] As used herein, the term "signaling domain" refers to a functional portion of a protein that acts by transmitting intracellular information to regulate cellular activity through a defined signaling pathway, either by generating second messengers or by functioning as an effector by responding to such messengers.

[0329] As used herein, the term "CD19" refers to the cluster of differentiation 19 protein, an antigenic determinant detectable on leukemia precursor cells. Human and mouse amino acid and nucleic acid sequences can be found in public databases such as GenBank, UniProt, and Swiss-Prot. For example, the amino acid sequence of human CD19 can be found under UniProt / Swiss-Prot accession number P15391, and the nucleotide sequence code for human CD19 can be found under accession number NM_001178098. CD19 is expressed in most B-lineage cancers, such as acute lymphoblastic leukemia, chronic lymphocytic leukemia, and non-Hodgkin's lymphoma. Other cells that express CD19 are provided below in the definition of "diseases associated with CD19 expression." It is also an early marker for B-cell precursor cells. See, e.g., Nicholson et al. Mol. Immun. 34(16-17):1157-1165 (1997). In some embodiments, the antigen-binding portion of the CAR-T recognizes and binds to an antigen within the extracellular domain of the CD19 protein. In some embodiments, the CD19 protein is expressed on cancer cells.

[0330] As used herein, the term "conservative sequence modifications" refers to amino acid modifications that do not significantly affect or change the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies of the present invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are those in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues in the CDR regions of an antibody can be substituted with other amino acid residues from the same side chain family, and the resulting antibodies can be tested for antigen-binding ability using the functional assays described herein.

[0331] As used herein, the term "costimulatory ligand" includes molecules on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to cognate costimulatory molecules on T cells, thereby providing signals mediated through T cell responses, including, but not limited to, proliferation, activation, differentiation, etc., in addition to the primary signal provided, for example, by binding of the TCR / CD3 complex to a peptide-loaded MHC molecule. Costimulatory ligands include, but are not limited to, CD2, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Costimulatory ligands also include, inter alia, antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, ligands that specifically bind to CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and CD83.

[0332] As used herein, a "costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response by the T cell, including, but not limited to, mediating proliferation. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands, and contribute to an efficient immune response. Costimulatory molecules include, but are not limited to, intracellular domains derived from MHC class I molecules, BTLA, Toll ligand receptors, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and killer immunoglobulin-like receptors (KIRs). In some embodiments, costimulatory molecules include OX40, CD27, CD2, CD28, ICOS (CD278), and 4-1BB (CD137).Further examples of such costimulatory molecules include CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, CD4, CD8 alpha, CD8 beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE These include ligands that specifically bind to RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and CD83.

[0333] As used herein, the term "costimulatory signal" refers to a signal that, in combination with a primary signal such as TCR / CD3 ligation, causes T cell proliferation and / or up-regulation or down-regulation of key molecules. A costimulatory intracellular signaling domain can be the intracellular portion of a costimulatory molecule. Costimulatory molecules are represented by the following protein families: TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), activating NK cell receptors, etc. Examples of such molecules include CD27, CD28, 4-lBB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, CD287, LIGHT, NKG2C, NKG2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160, B7-H3, and ligands that specifically bind to CD83.

[0334] As used herein, the term "derived from" refers to the relationship between a first molecule and a second molecule. This generally refers to the structural similarity between the first molecule and the second molecule and does not imply or include a limitation on the process or source by which the first molecule is derived from the second molecule. For example, in the case of an intracellular signaling domain derived from a CD3 zeta molecule, the intracellular signaling domain retains sufficient CD3 zeta structure so that it has the required function, i.e., the ability to generate a signal under appropriate conditions. For example, this does not mean that, to provide an intracellular signaling domain, one must start with the sequence of CD3 zeta and delete or mutate unnecessary sequences to arrive at the intracellular signaling domain.

[0335] As used herein, the term "disease" refers to a state of health in an animal in which the animal is unable to maintain homeostasis and the animal's health will continue to deteriorate unless the disease is ameliorated. In contrast, the term "disorder" in an animal refers to a state of health in which the animal is able to maintain homeostasis, but the animal's health is not better than it would be in the absence of the disorder. A disorder left untreated does not necessarily result in a further decline in the animal's health.

[0336] As used herein, "diseases associated with tumor antigen expression" include, but are not limited to, diseases associated with tumor antigen expression or conditions associated with cells expressing tumor antigens, including, but not limited to, proliferative diseases such as cancer or malignant tumors, or precancerous conditions such as myelodysplasia, myelodysplastic syndrome, or leukemia; or non-cancer-related indications associated with cells expressing tumor antigens. In some embodiments, the cancer associated with tumor antigen expression is a hematological cancer. In some embodiments, the cancer associated with tumor antigen expression is a solid cancer. Additional diseases associated with tumor antigen expression include, but are not limited to, atypical and / or non-classical cancers, malignant tumors, precancerous conditions, or proliferative diseases associated with tumor antigen expression. Non-cancer-related indications associated with tumor antigen expression include, but are not limited to, autoimmune diseases (such as lupus), inflammatory diseases (allergies and asthma), and transplantation. In some embodiments, the tumor antigen-expressing cells express, or at any time express, mRNA encoding the tumor antigen. In some embodiments, tumor antigen-expressing cells produce tumor antigen proteins (e.g., wild-type or mutant), which may be present at normal or reduced levels. In certain embodiments, tumor antigen-expressing cells produce detectable levels of tumor antigen proteins at one point, and subsequently produce substantially no detectable tumor antigen proteins.

[0337] As used herein, the term "disease associated with CD19 expression" includes, but is not limited to, a proliferative disease, such as cancer or malignancy, or a precancerous condition, such as myelodysplasia, myelodysplastic syndrome, or preleukemia, associated with CD19-expressing cells, or a condition associated with CD19-expressing cells; or a non-cancer-related indication associated with CD19-expressing cells. In some embodiments, the cancer associated with CD19 expression is a blood cancer. In one aspect, the blood cancer is a leukemia or lymphoma. In one aspect, the cancer associated with CD19 expression includes, but is not limited to, one or more acute leukemias, including, but not limited to, B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphoblastic leukemia (ALL), and other cancers and malignancies; and one or more chronic leukemias, including, but not limited to, chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL). Additional cancers or hematological conditions associated with CD19 expression include, but are not limited to, a diverse collection of hematological disorders united by ineffective myeloid blood cell production (or dysplasia), such as B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplastic syndrome, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, and "preleukemia." Further diseases associated with CD19 expression include, but are not limited to, atypical and / or non-classical cancers, malignancies, precancerous conditions, or proliferative disorders associated with CD19 expression. Non-cancer related indications associated with CD19 expression include, but are not limited to, autoimmune diseases (eg, lupus), inflammatory diseases (allergies and asthma), and transplantation.

[0338] As used herein, the term "downregulation" refers to the reduction or elimination of gene expression of one or more genes.

[0339] As used herein, the term "encoding" refers to the inherent property of a particular sequence of nucleotides in a polynucleotide (such as a gene, cDNA, or mRNA) to serve as a template for the synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene, cDNA, or RNA encodes a protein when transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and usually provided in a sequence listing, and the non-coding strand used as a template for transcription of the gene or cDNA can be said to encode the protein or other product of that gene or cDNA. Unless otherwise specified, "nucleotide sequences encoding an amino acid sequence" include all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. The phrase "nucleotide sequence encoding a protein or RNA" may include introns, to the extent that a nucleotide sequence encoding a protein may, in some version, contain introns.

[0340] As used herein, the terms "effective amount" and "therapeutically effective amount" are used interchangeably herein and refer to an effective amount of a compound, formulation, material, pharmaceutical agent, or composition as described herein to achieve a desired physiological, therapeutic, or prophylactic result in a subject in need thereof. Such result can include, but is not limited to, an amount that, when administered to a mammal, elicits a detectable level of immune response compared to the immune response detected in the absence of the composition of the present invention. The immune response can be readily assessed by a number of art-recognized methods. One skilled in the art will understand that the amount of the composition administered herein will vary and can be readily determined based on numerous factors, such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the particular compound being administered, etc. The effective amount may vary from subject to subject, depending on the health and physical condition of the subject being treated, the taxonomic group of the subject being treated, the formulation of the composition, an evaluation of the subject's medical condition, and other relevant factors.

[0341] As used herein, the term "endogenous" refers to any substance that is derived from or produced within an organism, cell, tissue, or system.

[0342] As used herein, the term "expand" refers to an increase in number, such as an increase in the number of immune cells (e.g., T cells). In some embodiments, immune cells (e.g., T cells) expanded ex vivo are increased in number relative to the number originally present in the culture. In other embodiments, immune cells (e.g., T cells) expanded ex vivo are increased in number relative to other cell types in the culture.

[0343] As used herein, the term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.

[0344] As used herein, the term "exogenous" refers to any material introduced or produced from outside an organism, cell, tissue or system.

[0345] As used herein, the term "expression vector" refers to a vector containing a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression. Other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., Sendai virus, lentivirus, retrovirus, adenovirus, and adeno-associated virus) that incorporate a recombinant polynucleotide.

[0346] As used herein, the term "extended packaging signal" or "extended packaging sequence" refers to the use of sequences surrounding the psi sequence that further extend the gag gene. The inclusion of these additional packaging sequences may improve the efficiency of vector RNA insertion into viral particles. As an example, in the case of murine leukemia virus (MoMLV), the minimal core packaging signal is encoded by the sequence from approximately nucleotide 144 to the Pst I site (nucleotide 567) (counting from the 5' LTR cap site). The MoMLV extended packaging signal includes the sequence beyond nucleotide 567 to the start of the gag / pol gene (nucleotide 621) and beyond nucleotide 1040. These sequences comprise approximately one-third of the gag gene sequence.

[0347] As used herein, the term "in vitro" refers to cells removed from an organism (e.g., a human) and grown outside of the organism (e.g., in a culture dish, test tube, or bioreactor).

[0348] As used herein, the term "Fab" refers to the fragment of an antibody structure that binds to an antigen but is monovalent and does not have an Fc portion; for example, digestion of an antibody with the enzyme papain produces two Fab fragments and one Fc fragment (e.g., heavy (H) chain constant region; the Fc region that does not bind to antigen).

[0349] As used herein, the term "flexible polypeptide linker" or "linker" used in the context of scFvs refers to a peptide linker consisting of amino acids such as glycine and / or serine residues used alone or in combination to link the variable heavy and variable light chain regions together. In one embodiment, the flexible polypeptide linker is a Gly / Ser linker and comprises the amino acid sequence (Gly-Gly-Gly-Ser)n, where n is a positive integer greater than or equal to 1. For example, n=1, n=2, n=3, n=4, n=5, n=6, n=7, n=8, n=9, n=10. Exemplary linkers are shown in Table 1.

[0350] As used herein, a "fragment" is also a variant, and the term typically refers to a selected region of a polypeptide or polynucleotide that is of functional interest or, for example, in an assay. Thus, a "fragment" refers to an amino acid or nucleic acid sequence that is a portion of a full-length polypeptide or polynucleotide.

[0351] As used herein, a "functional variant" refers to a polypeptide that has substantially the same amino acid sequence as a reference amino acid sequence, or is encoded by a substantially identical nucleotide sequence, and that is capable of possessing one or more activities of the reference amino acid sequence.

[0352] As used herein, the term "host cell" includes cells transfected, infected, or transduced in vivo, ex vivo, or in vitro with a recombinant vector or polynucleotide of the present invention. Host cells may include packaging cells, producer cells, and cells infected with a viral vector. In some embodiments, host cells infected with a lentiviral vector of the present disclosure are administered to a subject in need of treatment. In some embodiments, the term "target cell" is used interchangeably with host cell and refers to a transfected, infected, or transduced cell of a desired cell type. In a preferred embodiment, the target cell is a T cell.

[0353] As used herein, the term "homologous" refers to the subunit sequence identity between two polymeric molecules (e.g., between two nucleic acid molecules such as two DNA molecules or two RNA molecules) or between two polypeptide molecules. Two molecules are homologous at a subunit position if both positions are occupied by the same monomer subunit. For example, two DNA molecules are homologous if a position in each of the two molecules is occupied by adenine. The homology between two sequences is a direct function of the number of matching or homologous positions. For example, if half of the positions in two sequences (e.g., five positions in a polymer 10 subunits in length) are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 out of 10) are matched or homologous, the two sequences are 90% homologous.

[0354] As used herein, the term "homologue" refers to an entity that has a certain degree of homology with a wild-type amino acid sequence and a wild-type nucleotide sequence. The term "homology" can be equated with "identity." As used herein, a homologous sequence is taken to include an amino acid sequence that may be at least 50%, 55%, 65%, 75%, 85%, or 90% identical, and preferably at least 95%, 97%, or 99% identical to the subject sequence. Typically, a homologue will contain the same active site, etc., as the subject amino acid sequence. Although homology can also be considered in terms of similarity (i.e., amino acid residues with similar chemical properties / functions), in the context of the present invention, it is preferred to express homology in terms of sequence identity.

[0355] Homologous sequences can be at least 50%, 55%, 65%, 75%, 85%, or 90% identical, and are preferably taken to include nucleotide sequences that are at least 95%, 97%, or 99% identical. Homology can also be considered in terms of similarity, but in the context of the present disclosure, it is preferred to express homology in terms of sequence identity. Homology comparisons can be performed visually or, more commonly, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the percentage of homology or identity between two or more sequences.

[0356] Percent homology can be directly compared for consecutive sequences, i.e., one sequence is aligned with the other, and each amino acid in one sequence is compared to the corresponding amino acid in the other, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues. While this is a very simple and consistent method, it does not take into account that, for example, in a pair of otherwise identical sequences, an insertion or deletion of one nucleotide sequence may cause the next codon to be out of alignment, thus significantly reducing the percent homology when a global alignment is performed. As a result, most sequence comparison methods are designed to produce an optimal alignment that takes into account possible insertions and deletions without unduly compromising the overall homology score. This is achieved by inserting "gaps" into the sequence alignment to maximize local homology.

[0357] However, these more complex methods assign a "gap penalty" to each gap in the alignment, so that sequence alignments with as few gaps as possible achieve a higher score than those with many gaps, reflecting a higher relatedness between the two compared sequences for the same number of identical amino acids. An "affine gap cost" is typically used, imposing a relatively high cost for the presence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. Of course, a larger gap penalty will produce an optimized alignment with fewer gaps. Most alignment programs allow for the modification of gap penalties; however, it is preferable to use the default values ​​when using such software for sequence comparison. For example, when using the GCG Wisconsin Bestfit package, the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

[0358] Therefore, calculating maximum percentage homology first requires generating an optimal alignment, taking gap penalties into account. A suitable computer program for performing such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, USA; Devereux et al. (1984) Nucleic Acids Research 12:387). Examples of other software capable of performing sequence comparisons include, but are not limited to, the BLAST package and the GENEWORKS comparison tool suite. Both BLAST and FASTA are available for both offline and online searches. However, for some applications, it is preferable to use the GCG Bestfit program. Another tool, called BLAST 2 Sequences, is also available for comparing protein and nucleotide sequences.

[0359] Although the final percentage of homology can be measured in terms of identity, the alignment process itself is not typically based on an all-or-nothing pairwise comparison. Instead, scaled similarity score matrices are commonly used, assigning scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix (the default matrix for the BLAST program suite). GCG Wisconsin programs typically use published default values ​​or, if provided, custom symbol comparison tables (see user manuals for details). For some applications, it is preferable to use the published default values ​​of the GCG package, or, for other software, a default matrix such as BLOSUM62. Once the software has generated an optimal alignment, the percentage of homology, preferably the percentage of sequence identity, can be calculated. The software typically does this as part of the sequence comparison, generating a numerical result.

[0360] As used herein, the term "hybrid vector" refers to a vector, LTR, or other nucleic acid that contains both retroviral (e.g., lentiviral) and non-retroviral (e.g., lentiviral) sequences. In one embodiment, a hybrid vector refers to a vector or transfer plasmid that contains retroviral (e.g., lentiviral) sequences for reverse transcription, replication, integration, and / or packaging.

[0361] Such variants may be prepared using standard recombinant DNA techniques, such as site-directed mutagenesis. When insertion is performed, synthetic DNA encoding the insertion may be created, along with 5' and 3' flanking regions corresponding to naturally occurring sequences on either side of the insertion site. The flanking regions contain convenient restriction sites corresponding to the naturally occurring sequence sites, allowing the sequence to be cleaved with the appropriate enzymes and the synthetic DNA to be ligated to the cleavage site. The DNA is then expressed in accordance with the present invention to produce the encoded protein. These methods are merely illustrative of the many standard techniques known in the art for manipulating DNA sequences; other known techniques may also be used.

[0362] As used herein, the term "identity" refers to the subunit sequence identity between two polymer molecules, particularly between two amino acid molecules, e.g., between two polypeptide molecules. Two amino acid sequences are identical at a position if they have the same residue at that position. For example, if each position in two polypeptide molecules is occupied by arginine, the two polypeptides are identical. The identity or degree to which two amino acid sequences have the same residue at the same position in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions. For example, if half of the positions in two sequences (e.g., five positions in a 10-amino acid polymer) are identical, the two sequences are 50% identical. If 90% of the positions (e.g., 9 out of 10) are matched or identical, the two amino acid sequences are 90% identical.

[0363] As used herein, the term "immunoglobulin" or "Ig" defines a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes called BCRs (B cell receptors) or antigen receptors. Five members of this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the primary antibody present in body secretions such as saliva, tears, breast milk, gastrointestinal secretions, and respiratory and genitourinary mucus. IgG is the most common circulating antibody. IgM is the major immunoglobulin produced in the primary immune response of most subjects. It is the most efficient immunoglobulin for agglutination, complement fixation, and other antibody responses and is important for defense against bacteria and viruses. IgD is an immunoglobulin with no known antibody function but may function as an antigen receptor. IgE is an immunoglobulin that mediates immediate hypersensitivity by inducing the release of mediators from mast cells and basophils upon exposure to allergens.

[0364] As used herein, the term "immune response" is defined as a cellular response to an antigen that occurs when lymphocytes recognize the antigenic molecule as foreign, induce the formation of antibodies, and / or activate lymphocytes to eliminate the antigen.

[0365] As used herein, the term "immune effector cell" refers to a cell that is involved in an immune response, e.g., a cell that is involved in promoting an immune effector response. Examples of immune effector cells include T cells (e.g., alpha / eta T cells and gamma / delta T cells), B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and bone marrow-derived phagocytes.

[0366] As used herein, the term "immune effector function or immune effector response" refers to a function or response that enhances or promotes immune attack of a target cell. In some embodiments, an immune effector function or response refers to a property of a T cell or NK cell that promotes the killing or inhibition of growth or proliferation of a target cell. In the case of T cells, primary stimulation and costimulation are examples of immune effector functions or responses.

[0367] As used herein, the term "inhibitory molecule" refers to a molecule that, when activated, causes or contributes to the inhibition of cell survival, activation, proliferation, and / or function, and refers to the gene encoding the molecule and its associated regulatory elements (e.g., promoter). In some embodiments, the inhibitory molecule is a molecule expressed on immune effector cells (e.g., T cells). Non-limiting examples of inhibitory molecules are PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), VISTA, TGFβIIR, VSIG3, VSIG8, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFbeta. It is understood that the term inhibitory molecule, when used in connection with a target sequence or gRNA molecule, refers to the gene (and its associated regulatory elements) encoding the inhibitory molecule protein. In some embodiments, the gene encoding the inhibitory molecule is BTLA, PD-1, TIM-3, VSIG3, VSIG8, CTLA4, or TGFβIIR. In some embodiments, the gene encoding the inhibitory molecule is VSIG3. In some embodiments, the gene encoding the inhibitory molecule is PD-1. In some embodiments, the gene encoding the inhibitory molecule is TGFβIIR.

[0368] As used herein, the term "induced pluripotent stem cells" or "iPS cells" refers to pluripotent stem cells generated from adult cells, such as immune cells (i.e., T cells). Expression of reprogramming factors, such as Klf4, Oct3 / 4, and Sox2, in adult cells causes them to proliferate and transform into pluripotent cells capable of differentiating into multiple cell types.

[0369] As used herein, the term "isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-native environment, such as a host cell.

[0370] As used herein, "in vitro transcribed RNA" refers to RNA synthesized in vitro. In some embodiments, the RNA is mRNA. Generally, in vitro transcribed RNA is generated from an in vitro transcription vector. The in vitro transcription vector contains a template used to generate the in vitro transcribed RNA.

[0371] As used herein, the term "knockout" refers to the ablation of gene expression of one or more genes.

[0372] "K D The term "K" refers to the equilibrium dissociation constant between an antibody and its antigen. D is the equilibrium dissociation constant between the antibody and its antigen, i.e., k off / k on It is the ratio of K D and affinity are inversely proportional. D The K value is related to the antibody concentration (the amount of antibody needed for a particular experiment) D The lower the value (lower the concentration), the higher the affinity of the antibody. D Values ​​are in the low micromolar range (10-6 ) to nanomoles (10 -7 ~10 -9 ) range. High affinity antibodies are generally in the low nanomolar range (10 -9 ), and very high affinity antibodies are thought to be in the picomolar (10 -12 ) range.

[0373] "K on ", or "association reaction," is the "on-rate," which is a constant used to characterize how quickly an antibody binds to its target.

[0374] "K off ", or "dissociation rate," is the "off rate," a constant used to characterize how quickly an antibody dissociates from its target. The experimentally measured ratio of the off rate to the on rate (K off / K on ) to find K D Calculate the value.

[0375] As used herein, the term "lentiviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements, or portions thereof, primarily comprising the LTR derived from a lentivirus. In some embodiments, the terms "lentiviral vector" and "lentiviral expression vector" can be used to refer to lentiviral transfer plasmids and / or infectious lentiviral particles. Elements such as cloning sites, promoters, regulatory elements, and heterologous nucleic acids are referred to herein. In some embodiments, the sequences of these elements are present in the form of RNA in the lentiviral particles of the present invention and in the form of DNA in the DNA plasmids of the present invention.

[0376] As used herein, the term "lentivirus" refers to a genus of the Retroviridae family.Lentivirus is unique among retroviruses in that it can infect non-dividing cells; it can deliver a significant amount of genetic information into the DNA of host cells, making it one of the most efficient gene delivery vectors.HIV, SIV, and FIV are all examples of lentivirus.Vector derived from lentivirus provides a means to achieve a significant level of gene transfer in vivo.

[0377] The lentivirus family differs from retroviruses in that lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis et al., 1992; Lewis and Emerman, 1994). In contrast, retroviruses such as MLV cannot infect non-dividing or slowly dividing cells, such as those that make up muscle, brain, lung, and liver tissue.

[0378] As used herein, a lentivirus or lentiviral vector refers to a vector containing at least one component derived from a lentivirus. Preferably, the component is involved in the biological mechanism by which the vector infects cells, expresses genes, or replicates. A lentiviral vector may be a "non-primate" vector, i.e., a vector derived from a virus that does not primarily infect primates, particularly humans. A non-primate lentivirus may be any member of the Lentiviridae family that does not naturally infect primates, and may include feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), caprine arthritis-encephalitis virus (CAEV), Maedi-Visna virus (MVV), or equine infectious anemia virus (EIAV).

[0379] As used herein, the term "modified" refers to an altered state or structure of a molecule or cell of the invention. The molecule can be modified in various ways, including chemically, structurally, or functionally. Cells may also be modified by the introduction of a nucleic acid.

[0380] As used herein, the term "modulate" means mediating a detectable increase or decrease in the level of a response in a subject compared to the level of the response in the subject in the absence of the treatment or compound, and / or compared to the level of the response in an otherwise identical but untreated subject. The term encompasses perturbing and / or influencing a natural signal or response by mediating a beneficial therapeutic response in a subject, preferably a human.

[0381] In the context of the present invention, the following abbreviations are used for commonly occurring nucleobases: "A" for adenosine, "C" for cytosine, "G" for guanosine, "T" for thymidine, and "U" for uridine.

[0382] As used herein, "naive T cells" refer to antigen-naive T cells. In some embodiments, antigen-naive T cells have encountered their cognate antigen in the thymus but not in the periphery. In some embodiments, naive T cells are precursors to memory cells. In some embodiments, naive T cells express both CD45RA and CCR7, but not CD45RO. In some embodiments, naive T cells may be characterized by expression of CD62L, CD27, CCR7, CD45RA, CD28, and CD127, and the absence of CD95 or CD45RO isoforms. In some embodiments, naive T cells express CD62L, IL-7 receptor-α, IL-6 receptor, and CD132, but do not express CD25, CD44, CD69, or CD45RO. In some embodiments, naive T cells express CD45RA, CCR7, and CD62L, but do not express CD95 or IL-2 receptor β. In some embodiments, the surface expression levels of the markers are assessed using flow cytometry.

[0383] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA may include introns to the extent that a nucleotide sequence encoding a protein may, in some versions, contain introns.

[0384] As used herein, the term "operably linked" refers to the functional linkage between a regulatory sequence and a heterologous nucleic acid sequence, resulting in the expression of the latter.For example, when a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence, the first nucleic acid sequence is operably linked to the second nucleic acid sequence.For example, if the promoter affects the transcription or expression of the coding sequence, the promoter is operably linked to the coding sequence.Generally, operably linked DNA sequences are contiguous and, where necessary to link two protein coding regions, are in the same reading frame.

[0385] As used herein, the term "overexpressed" tumor antigen or "overexpression" of a tumor antigen refers to an abnormal level of expression of the tumor antigen in cells from a diseased area, such as a solid tumor, within a particular tissue or organ of a patient relative to the expression level in normal cells from that tissue or organ. Patients with solid tumors or hematological malignancies characterized by overexpression of the tumor antigen can be determined by standard assays known in the art.

[0386] As used herein, the term "parenteral" administration of an immunogenic composition includes, for example, subcutaneous injection (sc), intravenous (iv), intramuscular (im), or intrapleural injection, or infusion techniques.

[0387] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds containing amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can comprise a protein or peptide sequence. Polypeptides include any peptide or protein containing two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to both short chains, e.g., also commonly referred to in the art as peptides, oligopeptides, and oligomers, and longer chains, of which there are many varieties, commonly referred to in the art as proteins. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and the like. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0388] As used herein, "poly(A)" is a series of adenosines attached to mRNA by polyadenylation. In some embodiments of constructs for transient expression, the poly(A) is between 50 and 5000. In some embodiments, the poly(A) is greater than 64. In some embodiments, the poly(A) is greater than 100. In some embodiments, the poly(A) is greater than 300. In some embodiments, the poly(A) is greater than 400. The poly(A) sequence can be chemically or enzymatically modified to modulate mRNA function, such as localization, stability, and translation efficiency.

[0389] As used herein, "polyadenylation" refers to the covalent attachment of a polyadenylated moiety or modified variants thereof to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at their 3' ends. The 3' poly(A) tail is a long sequence (often several hundred) of adenine nucleotides added to pre-mRNA by the action of the enzyme polyadenylate polymerase. In higher eukaryotes, poly(A) tails are added to transcripts containing a specific sequence known as a polyadenylation signal. The poly(A) tail and its associated proteins help protect mRNA from exonucleolytic degradation. Polyadenylation is also important for transcription termination, mRNA export from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after DNA is transcribed into RNA, but also occurs later in the cytoplasm. After transcription is completed, the mRNA strand is cleaved by the action of an endonuclease complex associated with RNA polymerase. The cleavage site is usually characterized by the presence of the sequence AAUAAA near the cleavage site. After the mRNA is cleaved, an adenosine residue is added to the free 3' end of the cleavage site.

[0390] As used herein, the term "transient" refers to expression of a non-integrated transgene over a period of hours, days, or weeks, which period of expression is shorter than the period of expression of the gene when integrated into the genome or contained within a stable plasmid replicon in the host cell.

[0391] As used herein, the term "polynucleotide" is defined as a chain of nucleotides. Furthermore, a nucleic acid is a polymer of nucleotides. Therefore, as used herein, nucleic acid and polynucleotide are interchangeable. Those skilled in the art have the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, those derived from recombinant means, i.e., conventional cloning techniques and PCR. TMThe term "nucleic acid sequences" includes all nucleic acid sequences obtained by any means available in the art, including cloning of nucleic acid sequences from recombinant libraries or cell genomes, using techniques such as those described above, and synthetic means.

[0392] As used herein, the term "promoter" is defined as a DNA sequence recognized by the synthetic machinery of a cell or introduced synthetic machinery necessary to initiate the specific transcription of a polynucleotide sequence.

[0393] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product operably linked to the promoter / regulatory sequence. In some cases, this sequence may be the core promoter sequence, and in other cases, this sequence may also include an enhancer sequence and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence may, for example, be one that expresses the gene product in a tissue-specific manner.

[0394] As used herein, the term "constitutive promoter" is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0395] As used herein, the term "inducible promoter" is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be substantially produced in a cell only when the corresponding derivative of the promoter is present in the cell.

[0396] As used herein, the term "tissue-specific promoter" is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes a gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0397] As used herein, the term "pseudotype" or "pseudotyping" refers to a virus in which a viral envelope protein has been replaced with a protein from another virus that has favorable properties. For example, HIV can be pseudotyped with the vesicular stomatitis virus G protein (VSV-G) envelope protein, and the HIV envelope protein (encoded by the env gene) normally converts the virus to CD4 + By targeting presentation cells, HIV can infect a wider range of cells. In a preferred embodiment of the present invention, the lentiviral envelope protein is pseudotyped with VSV-G. In one embodiment, the present invention provides packaging cells that produce recombinant retroviruses, e.g., lentiviruses, pseudotyped with VSV-G envelope glycoproteins.

[0398] As used herein, the term "recombinant antibody" refers to an antibody produced using recombinant DNA technology, e.g., an antibody expressed by a bacteriophage or yeast expression system. The term should also be interpreted to mean an antibody produced by synthesis of a DNA molecule encoding the antibody, which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence is obtained using recombinant DNA or amino acid sequence technology available and well known in the art.

[0399] As used herein, the term "recombinant viral vector" (RRV) refers to a vector that has sufficient viral genetic information to allow packaging of an RNA genome into viral particles capable of infecting target cells in the presence of packaging components. RRVs have non-viral coding sequences that are delivered to target cells by the vector. RRVs are incapable of independent replication to produce infectious viral particles in the final target cell. RRVs typically lack functional gag-pol and / or env genes and / or other genes essential for replication. Vectors of the present invention may be configured as split-intron vectors. Preferably, the RRV vectors of the present disclosure have a minimal viral genome.

[0400] As used herein, the term "retroviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or portions thereof derived primarily from a retrovirus.

[0401] In some embodiments, further safety improvements are provided by replacing the U3 region of the 5' LTR with a heterologous promoter to drive transcription of the viral genome during viral particle production. The heterologous promoter may be selected from the group consisting of the viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (CMV) (e.g., immediate-early), Moloney murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus (HSV) (thymidine kinase) promoters. Generic promoters can drive high levels of transcription in a Tat-independent manner. This replacement reduces the likelihood of recombination to generate replication-competent virus because the virus production system lacks the complete U3 sequence. In some embodiments, heterologous promoters have the added advantage of controlling how the viral genome is transcribed. For example, heterologous promoters can be inducible so that transcription of all or part of the viral genome occurs only in the presence of an inducer. Inducers include, but are not limited to, one or more compounds or physiological conditions, such as temperature and pH, under which the host cells are cultured.

[0402] As used herein, the term "Sendai virus" refers to a genus of the Paramyxoviridae family. Sendai virus is a negative single-stranded RNA virus that does not integrate into the host genome or alter the genetic information of the host cell. Sendai virus has a very broad host range and is not pathogenic to humans. Sendai virus used as a recombinant viral vector is capable of transient yet strong gene expression.

[0403] As used herein, the term "signal transduction pathway" refers to the biochemical relationship between various signaling molecules that play a role in transmitting a signal from one part of a cell to another part of the cell. The term "cell surface receptor" includes molecules and complexes of molecules that can receive a signal and transmit the signal across the plasma membrane of a cell.

[0404] As used herein, the term "single-chain antibody" refers to an antibody formed by recombinant DNA techniques in which heavy and light chain fragments of an immunoglobulin are linked to the Fv region via an artificial span of amino acids. Various methods for producing single-chain antibodies are known.

[0405] As used herein, the term "single-chain variable fragment" or "scFv" refers to a fusion protein of the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin (e.g., mouse or human), covalently linked to form a VH::VL heterodimer. The heavy (VH) and light (VL) chains are either directly linked or linked by a peptide-encoded linker or spacer, connecting the N-terminus of the VH to the C-terminus of the VL or the C-terminus of the VH to the N-terminus of the VL. The terms "linker" and "spacer" are used interchangeably herein. In some embodiments, an antigen-binding domain (e.g., a Tn-MUC1-binding domain, a PSMA-binding domain, or a mesothelin-binding domain) comprises an scFv with an N- to C-terminal configuration: VH-linker-VL. In some embodiments, the antigen-binding domain (e.g., the Tn-MUC1-binding domain, the PSMA-binding domain, or the mesothelin-binding domain) comprises an scFv having the following configuration: N-terminus to C-terminus, VL-linker-VH. One of skill in the art will be able to select an appropriate configuration for use in the present invention.

[0406] The linker is usually rich in glycine for flexibility and rich in serine or threonine for solubility. The linker can link the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. Various linker sequences are known in the art, including, but not limited to, glycine serine (GS) linkers such as (GS)n, (GSGGS)n, (GGGS)n, and (GGGGS)n, where n represents an integer of at least 1. Exemplary linker sequences can include amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 121), GGSGG (SEQ ID NO: 122), GSGSG (SEQ ID NO: 123), GSGGG (SEQ ID NO: 124), GGGSG (SEQ ID NO: 125), GSSSG (SEQ ID NO: 126), GGGGS (SEQ ID NO: 127), or GGGGSGGGSGGGGS (SEQ ID NO: 128). One of skill in the art would be able to select an appropriate linker sequence for use in the present invention. In one embodiment, an antigen-binding domain (e.g., a CD19-binding domain) of the present disclosure comprises a heavy chain variable region (VH) and a light chain variable region (VL). In some embodiments, the VH and VL are separated by a linker sequence having the amino acid sequence GGGGSGGGSGGGGS (SEQ ID NO: 128). In some embodiments, the linker nucleic acid sequence comprises the nucleotide sequence GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCT (SEQ ID NO:129).

[0407] Despite the removal of the constant region and the introduction of a linker, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be expressed from nucleic acids containing sequences encoding the VH and VL. Antagonistic scFvs with inhibitory activity have been described.

[0408] As used herein, the term "specificity" refers to the ability to specifically bind (e.g., immunoreact) with a given target antigen (e.g., a human target antigen). A chimeric antigen receptor may be monospecific and contain one or more binding sites that specifically bind to a target, or it may be multispecific and contain two or more binding sites that specifically bind to the same or different targets. In one embodiment, a chimeric antigen receptor is specific for two different (e.g., non-overlapping) portions of the same target. In one embodiment, a chimeric antigen receptor is specific for multiple targets.

[0409] As used herein, the term "spacer domain" generally refers to any oligopeptide or polypeptide that functions to link a transmembrane domain to either an extracellular or intracellular domain within a polypeptide chain. A spacer domain may contain up to about 300 amino acids, e.g., about 10 to about 100 amino acids, or about 25 to about 50 amino acids.

[0410] As used herein, the term "specifically binds" with respect to an antibody refers to an antibody or binding fragment thereof (e.g., scFv) that recognizes a specific antigen but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to antigens from one or more other species. However, such cross-species reactivity does not, in and of itself, alter the specific classification of the antibody. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross-reactivity does not, in and of itself, alter the specific classification of the antibody. In some cases, the terms "specific binding" or "specifically binds" are used in reference to the interaction of an antibody, protein, chimeric antigen receptor, or peptide with a second chemical species to mean that the interaction is dependent on the presence of a specific structure (e.g., an antigenic determinant or epitope) on the chemical species. For example, a chimeric antigen receptor recognizes and binds to a specific protein structure, rather than a general protein. If an antibody is specific for epitope "A," the presence of a molecule containing epitope A (or free, unlabeled A) in a reaction involving labeled "A" and the antibody will reduce the amount of labeled A that binds to the antibody.

[0411] As used herein, the term "stimulation" refers to a primary response induced by the binding of a stimulatory molecule (e.g., a TCR / CD3 complex) to its cognate ligand, thereby mediating a signal transduction event, such as, but not limited to, signal transduction through the TCR / CD3 complex. Stimulation can mediate changes in the expression of specific molecules, such as downregulation of TGF-beta and / or rearrangement of cytoskeletal structure, clonal expansion, differentiation into distinct subsets, etc.

[0412] As used herein, the term "stimulatory molecule" refers to a molecule on a T cell that specifically binds to a cognate stimulatory ligand present on an antigen-presenting cell. A stimulatory molecule can be expressed by a T cell to provide a primary cytoplasmic signaling sequence that regulates primary activation of the TCR complex in a stimulatory manner for at least some aspects of the T cell signaling pathway. For example, a primary signal is initiated, for example, by binding of the TCR / CD3 complex to a peptide-loaded MHC molecule, resulting in mediation of a T cell response, including, but not limited to, proliferation, activation, and differentiation. A stimulatory primary cytoplasmic signaling sequence (also referred to as a "primary signaling domain") can contain a signaling motif known as an immunoreceptor tyrosine-based activation motif or IT AM. Examples of ITAMs comprising primary cytoplasmic signaling sequences of particular use in the present invention include, but are not limited to, those derived from TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), and CD66d. In certain CARs of the present invention, the intracellular signaling domain in any one or more CARs of the present invention comprises an intracellular signaling sequence, for example, a primary signaling sequence of CD3-zeta. In certain CARs of the present invention, the primary signaling sequence of CD3-zeta is the sequence provided as SEQ ID NO: 52, or equivalent residues from a non-human species, such as mouse, rodent, monkey, ape, etc. In certain CARs of the present invention, the primary signaling sequence of CD3-zeta is the sequence set forth in SEQ ID NO: 54, or equivalent residues from a non-human species, such as mouse, rodent, monkey, ape, etc.

[0413] As used herein, the term "stimulatory ligand" means a ligand that, when present on an antigen-presenting cell (e.g., aAPC, dendritic cell, B cell, etc.), is capable of specifically binding to a cognate binding partner (herein referred to as a "stimulatory molecule") on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, etc. Stimulatory ligands are well known in the art and include, among others, peptide-loaded MHC class I molecules, anti-CD3 antibodies, superagonist anti-CD28 antibodies, and superagonist anti-CD2 antibodies.

[0414] As used herein, the term "subject" refers to a vertebrate. The vertebrate may be a mammal, such as a non-primate (e.g., cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., monkey and human). The mammal includes, but is not limited to, humans, non-human primates, wild animals, stray animals, livestock, sport animals, and pets. In some embodiments, the terms "subject" and "patient" are used interchangeably. Any organism in which an immune response can be elicited may be a subject or patient. In an exemplary embodiment, the subject is a human.

[0415] As used herein, the term "substantially identical" in the context of nucleotide sequences refers to a first nucleic acid sequence that contains a sufficient or minimum number of nucleotides that are identical to aligned nucleotides in a second nucleic acid sequence such that the first and second nucleotide sequences encode polypeptides having a common functional activity, or a common structural polypeptide domain or a common functional polypeptide activity, e.g., a nucleotide sequence having at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to a reference sequence, e.g., a sequence provided herein.

[0416] In some embodiments, the term "substantially identical" in the context of amino acid sequences refers to a first amino acid sequence that contains a sufficient or minimum number of amino acid residues that are i) identical to or ii) conservative substitutions for aligned amino acid residues in a second amino acid sequence, such that the first and second amino acid sequences can have a common structural domain and / or a common functional activity, e.g., an amino acid sequence that contains a common structural domain that has at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, ...

Claims

1. 1. An isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR), comprising: the CAR comprises a single chain antibody or a single chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain; The anti-CD19 binding domain comprises: (a) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6; or (b) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3), as disclosed in Table 2; and A heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2) and heavy chain complementarity determining region 3 (HC CDR3), as disclosed in Table 2.

2. 2. The isolated nucleic acid molecule of claim 1, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or 199; or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO: 7 or 199.

3. 3. The isolated nucleic acid molecule of claim 1 or 2, wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or 200; or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO: 8 or 200.

4. 4. The isolated nucleic acid molecule of claim 1, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:

8.

5. 5. The isolated nucleic acid molecule of claim 1, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199 and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:

200.

6. The isolated nucleic acid molecule of any one of claims 1 to 5, wherein the CD19 binding domain is an scFv.

7. 7. The isolated nucleic acid molecule of any one of claims 1 to 6, wherein the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 226, and 201, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 226, and 201.

8. 8. The isolated nucleic acid molecule of any one of claims 1 to 7, wherein the anti-CD19 binding domain comprises: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 116, SEQ ID NO: 225, and SEQ ID NO: 216; or (b) a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:116, SEQ ID NO:225, or SEQ ID NO.

216.

9. 9. The isolated nucleic acid molecule of any one of claims 1 to 8, wherein the anti-CD19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 116, SEQ ID NO: 203, SEQ ID NO: 202, SEQ ID NO: 225, and SEQ ID NO: 216; or (b) a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 116, SEQ ID NO: 203, SEQ ID NO: 202, SEQ ID NO: 225, or SEQ ID NO:

216.

10. 10. The isolated nucleic acid molecule of any one of claims 1 to 9, wherein the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T-cell receptor, CD2, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.

11. 11. The isolated nucleic acid molecule of any one of claims 1 to 10, wherein the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO: 29, 31, or 33, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 29, 31, or 33.

12. 12. The isolated nucleic acid molecule of any one of claims 1 to 11, wherein the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO: 30, SEQ ID NO: 32, or SEQ ID NO: 34, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 30, SEQ ID NO: 32, or SEQ ID NO:

34.

13. 12. The isolated nucleic acid molecule of any one of claims 1 to 11, wherein the transmembrane domain comprises the CD8 transmembrane domain and / or the amino acid sequence of SEQ ID NO:29; or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

29.

14. 14. The isolated nucleic acid molecule of any one of claims 1 to 13, wherein the transmembrane domain comprises the nucleic acid sequence of SEQ ID NO: 30 or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

30.

15. 15. The isolated nucleic acid molecule of any one of claims 1 to 14, wherein the anti-CD19 binding domain is linked to the transmembrane domain by a hinge region.

16. The hinge region comprises: (a) is derived from a protein selected from the group consisting of an antibody Fc fragment, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an IgG hinge, a CD8 hinge, and any combination thereof; or (b) comprises the amino acid sequence of SEQ ID NO: 27 or SEQ ID NO: 35, or a sequence having about 90% to about 99% identity to SEQ ID NO: 27 or 35; 16. The isolated nucleic acid molecule of claim 15.

17. 17. The isolated nucleic acid molecule of claim 15 or 16, wherein the hinge region comprises a CD8 hinge region and / or the amino acid sequence of SEQ ID NO:27, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

27.

18. 16. The isolated nucleic acid molecule of claim 15, wherein the hinge region comprises a nucleic acid sequence selected from SEQ ID NO: 28, or SEQ ID NO: 36, or a sequence having about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 28 or 36.

19. 19. The isolated nucleic acid molecule of any one of claims 1 to 18, wherein the costimulatory domain is a functional signaling domain of a protein selected from the group consisting of a TNFR superfamily member, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137).

20. 20. The isolated nucleic acid molecule of any one of claims 1 to 19, wherein the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 48, or SEQ ID NO: 50, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 37, 39, 41, 43, 46, 48, or 50.

21. 21. The isolated nucleic acid molecule of any one of claims 1 to 20, wherein the costimulatory domain is encoded by a nucleic acid sequence selected from SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 47, or SEQ ID NO: 49, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 38, 40, 42, 44, 45, 47, or 49.

22. 22. The isolated nucleic acid molecule of any one of claims 1 to 21, wherein the intracellular signaling domain comprises a signaling domain of a protein selected from the group consisting of CD3 zeta, FcyRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.

23. 23. The isolated nucleic acid molecule of any one of claims 1 to 22, wherein the intracellular signaling domain comprises the intracellular signaling domain of CD3 zeta, the amino acid sequence of SEQ ID NO: 52 or 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 52 or 54.

24. 24. The isolated nucleic acid molecule of any one of claims 1 to 23, wherein the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO: 53 or 55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 53 or 55.

25. The isolated nucleic acid molecule of any one of claims 1 to 24, wherein the CAR comprises a functional 4-1BB costimulatory domain and a functional CD3 zeta intracellular signaling domain.

26. 26. The isolated nucleic acid molecule of any one of claims 1 to 25, wherein the CAR comprises the amino acid sequence of SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO:

54.

27. the intracellular signaling domain comprises the sequence of SEQ ID NO: 37 and the sequence of SEQ ID NO: 52 or SEQ ID NO: 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54; 27. The isolated nucleic acid molecule of any one of claims 1 to 26, wherein the sequences are expressed in the same frame as a single polypeptide chain.

28. (a) the nucleic acid sequence is the sequence of SEQ ID NO:38, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:38, and / or (b) the isolated nucleic acid molecule of any one of claims 1 to 27, comprising the sequence of SEQ ID NO: 53 or SEQ ID NO: 55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 53 or 55.

29. The isolated nucleic acid molecule of any one of claims 1 to 28, wherein the CAR further comprises a leader sequence.

30. 30. The isolated nucleic acid molecule of claim 29, wherein the leader sequence comprises the amino acid sequence of SEQ ID NO:

25.

31. An isolated nucleic acid molecule comprising: (a) an scFv comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain comprises: (i) LC CDR1 of SEQ ID NO: 1, LC CDR2 of SEQ ID NO: 2, and LC CDR3, HC CDR1, HC CDR2 of SEQ ID NO: 5, and HC CDR3 of SEQ ID NO: 6; or (ii) any LC CDR1, LC CDR2, LC CDR3, HC CDR1, HC CDR2, and HC CDR3 disclosed in Table 2; (b) a transmembrane domain selected from a CD28 or CD8 transmembrane domain; (c) a costimulatory domain comprising the intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (d) an intracellular signaling domain comprising CD3-zeta or FcR gamma.

32. An isolated nucleic acid molecule comprising: (a) an scFv comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain is selected from the group consisting of SEQ ID NO: 9, 226, and 201; (b) a transmembrane domain selected from a CD28 or CD8 transmembrane domain; (c) a costimulatory domain comprising the intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (d) an intracellular signaling domain comprising CD3-zeta or FcR gamma.

33. An isolated nucleic acid molecule comprising: (a) an scFv comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain comprises the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 31, and 33; (c) a costimulatory domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 48, and SEQ ID NO: 50; and (d) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO:52 or SEQ ID NO:

54.

34. An isolated nucleic acid molecule comprising: (a) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 29; (c) a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 37; and (d) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO: 52 or 54.

35. 35. The isolated nucleic acid molecule of any one of claims 1 to 34, comprising: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 20 and 203, and / or (b) a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 19 and 202.

36. An isolated polypeptide molecule encoded by the nucleic acid molecule of any one of claims 1 to 35.

37. 36. The isolated polypeptide of claim 35, wherein the isolated polypeptide comprises a sequence selected from the group consisting of SEQ ID NOs: 7, 8, 199 and 200.

38. 1. A chimeric antigen receptor (CAR) comprising a single chain antibody or a single chain antibody fragment comprising an anti-CD19 binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain, wherein the anti-CD19 binding domain comprises: (a) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6; or (b) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3) as disclosed in Table 2; and A heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2) and heavy chain complementarity determining region 3 (HC CDR3) as disclosed in Table 2.

39. 39. The CAR of claim 38, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7 or 199; or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 7 or 199.

40. 40. The CAR of claim 38 or 39, wherein the heavy chain variable region comprises the amino acid sequence of SEQ ID NO: 8 or 200, or an amino acid sequence having at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 8 or 200.

41. The CAR according to any one of claims 38 to 40, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 7, and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:

8.

42. The CAR according to any one of claims 38 to 41, wherein the light chain variable region comprises the amino acid sequence of SEQ ID NO: 199, and the heavy chain variable region comprises the amino acid sequence of SEQ ID NO:

200.

43. The CAR according to any one of claims 38 to 42, wherein the CD19-binding domain is an scFv.

44. The CAR of any one of claims 38 to 43, wherein the anti-CD19 binding domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 9, 226, and 201, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 9, 226, and 201.

45. The CAR of any one of claims 38 to 44, wherein the anti-CD19 binding domain comprises: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 116, SEQ ID NO: 225, and SEQ ID NO: 216; or (b) a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:21, SEQ ID NO:116, SEQ ID NO:225, or SEQ ID NO:

216.

46. The CAR of any one of claims 38 to 45, wherein the anti-CD19 binding domain comprises a light chain variable region or a heavy chain variable region encoded by: (a) a nucleic acid sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 116, SEQ ID NO: 202, SEQ ID NO: 203, SEQ ID NO: 225, and SEQ ID NO: 216; or (b) a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NOs: 19-21, SEQ ID NO: 116, SEQ ID NO: 202, SEQ ID NO: 203, SEQ ID NO: 225, or SEQ ID NO:

216.

47. The CAR according to any one of claims 38 to 47, wherein the transmembrane domain comprises a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of a T-cell receptor, CD2, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.

48. The CAR of any one of claims 38 to 47, wherein the transmembrane domain comprises an amino acid sequence selected from SEQ ID NO: 29, 31, or 33, or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 29, 31, or 33.

49. The CAR of any one of claims 38 to 48, wherein the transmembrane domain comprises a nucleic acid sequence selected from SEQ ID NO: 30, SEQ ID NO: 32, or SEQ ID NO: 34, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 30, 32, or 34.

50. The CAR of any one of claims 38 to 49, wherein the transmembrane domain comprises a CD8 transmembrane domain, and / or the amino acid sequence of SEQ ID NO: 29; or an amino acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

29.

51. The CAR of any one of claims 38 to 50, wherein the transmembrane domain comprises the nucleic acid sequence of SEQ ID NO: 30, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

30.

52. The CAR of any one of claims 38 to 51, wherein the anti-CD19 binding domain is linked to the transmembrane domain by a hinge region.

53. The hinge region comprises: (a) is from a protein selected from the group consisting of an antibody Fc fragment, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, an IgG hinge region, a CD8 hinge, and any combination thereof; or (b) SEQ ID NO: 27 or SEQ ID NO: 35, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 27 or 35; The CAR described in claim 52.

54. 54. The isolated nucleic acid molecule of claim 52 or 53, wherein the hinge region comprises a CD8 hinge region and / or the amino acid sequence of SEQ ID NO:27, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO:

27.

55. 53. The CAR of claim 52, wherein the hinge region comprises a nucleic acid sequence selected from SEQ ID NO: 28, or SEQ ID NO: 36, or a sequence having about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 28 or 36.

56. The CAR according to any one of claims 1 to 55, wherein the costimulatory domain is a functional signaling domain of a protein selected from the group consisting of TNFR superfamily members, OX40 (CD134), CD2, CD5, CD7, CD27, CD28, CD30, CD40, PD-1, CD8, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD11a, CD18, ICOS (CD278), LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and 4-1BB (CD137).

57. The CAR of any one of claims 1 to 56, wherein the costimulatory domain comprises an amino acid sequence selected from SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 48, or SEQ ID NO: 50, or a sequence having about 90% to about 99% identity to SEQ ID NO: 37, 39, 41, 43, 46, 48, or 50.

58. The CAR of any one of claims 1 to 57, wherein the costimulatory domain comprises a nucleic acid sequence selected from SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, or a nucleic acid sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 38, 40, 42, 44, 45, 47, or 49.

59. The chimeric antigen receptor (CAR) according to any one of claims 38 to 58, wherein the intracellular signaling domain comprises a signaling domain of a protein selected from the group consisting of CD3 zeta, FcyRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.

60. The chimeric antigen receptor (CAR) of any one of claims 38 to 59, wherein the intracellular signaling domain comprises a CD3 zeta intracellular domain, an amino acid sequence of SEQ ID NO: 52 or 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 52 or 54.

61. The CAR of any one of claims 38 to 60, wherein the intracellular signaling domain comprises the nucleic acid sequence of SEQ ID NO: 53 or 55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 53 or 55.

62. The CAR of any one of claims 38 to 61, wherein the CAR comprises a functional 4-1BB costimulatory domain and a functional CD3 zeta intracellular signaling domain.

63. The CAR of any one of claims 38 to 62, wherein the CAR comprises the amino acid sequence of SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54, or a sequence having about 90% to about 99% identity to the amino acid sequence of SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO:

54.

64. the intracellular signaling domain comprises the sequence of SEQ ID NO: 37 and the sequence of SEQ ID NO: 52 or SEQ ID NO: 54, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to the amino acid sequence of SEQ ID NO: 37, SEQ ID NO: 52, or SEQ ID NO: 54; The CAR of any one of claims 38 to 63, wherein the sequences are expressed in the same frame as a single polypeptide chain.

65. The CAR of any one of claims 38 to 64, wherein the nucleic acid sequence comprises the sequence of SEQ ID NO: 38, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 38, and / or the sequence of SEQ ID NO: 53 or SEQ ID NO: 55, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 53 or 55.

66. The CAR according to any one of claims 38 to 65, further comprising a leader sequence.

67. 67. The CAR of claim 66, wherein the leader sequence comprises SEQ ID NO:

25.

68. A chimeric antigen receptor (CAR) comprising: (a) an scFv comprising an anti-CD19 binding domain, wherein the anti-CD19 binding domain is (i) LC CDR1 of SEQ ID NO: 1, LC CDR2 and LC CDR3 of SEQ ID NO: 2, HC CDR1 of SEQ ID NO: 4, HC CDR2 of SEQ ID NO: 5, and HC CDR3 of SEQ ID NO: 6; or (ii) any LC CDR1, LC CDR2, LC CDR3, HC CDR1, HC CDR2, and HC CDR3 disclosed in Table 2; (b) a transmembrane domain selected from a CD28 or CD8 transmembrane domain; (c) a costimulatory domain comprising the intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (d) an intracellular signaling domain comprising CD3-zeta or FcR gamma.

69. A chimeric antigen receptor (CAR) comprising: (a) SEQ ID NO: 9, 226 or 201; (b) a transmembrane domain selected from a CD28 or CD8 transmembrane domain; (c) a costimulatory domain comprising the intracellular signaling domain of a protein selected from the group consisting of OX40, CD27, CD2, CD28, ICOS, and 4-1BB; and (d) an intracellular signaling domain comprising CD3-zeta or FcR gamma.

70. A chimeric antigen receptor (CAR) comprising: (a) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 31, and 33; (c) a costimulatory domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 46, SEQ ID NO: 48, and SEQ ID NO: 50; and (d) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO:52 or SEQ ID NO:

54.

71. A chimeric antigen receptor (CAR) comprising: (a) an anti-CD19 binding domain comprising the amino acid sequence of SEQ ID NO: 9, 18, 64, 75, 86, 190, 157, 212, 201, 226, 179, 168, or 146; (b) a transmembrane domain comprising the amino acid sequence of SEQ ID NO: 29; (c) a costimulatory domain comprising the amino acid sequence of SEQ ID NO: 37; and (d) an intracellular signaling domain comprising the amino acid sequence of SEQ ID NO: 52 or 54.

72. A chimeric antigen receptor comprising: (a) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 66, 77, 88, 148, 170, 181, 203, 214, 159, 192, 23, and 20; and / or (b) an amino acid sequence encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 65, 76, 87, 147, 169, 180, 202, 213, 158, 191, 22, and 19.

73. A chimeric antigen receptor comprising a sequence selected from the group consisting of SEQ ID NOs: 63, 74, 85, 145, 167, 178, 200, 211, 156, 189, 17, 8, 62, 73, 84, 144, 166, 177, 199, 210, 155, 188, 16, and 7.

74. An anti-CD19 binding domain comprising: (a) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 1, a light chain complementarity determining region 2 (LC CDR2) of SEQ ID NO: 2, and a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 3; and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 4, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 5, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 6; or (b) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1) of SEQ ID NO: 193, a light chain complementarity determining region 3 (LC CDR3) of SEQ ID NO: 195; and a heavy chain variable domain comprising a heavy chain complementarity determining region 1 (HC CDR1) of SEQ ID NO: 196, a heavy chain complementarity determining region 2 (HC CDR2) of SEQ ID NO: 197, and a heavy chain complementarity determining region 3 (HC CDR3) of SEQ ID NO: 198; or (c) a light chain variable domain comprising a light chain complementarity determining region 1 (LC CDR1), a light chain complementarity determining region 2 (LC CDR2), and a light chain complementarity determining region 3 (LC CDR3) as disclosed in Table 2; and A heavy chain variable domain comprising heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2) and heavy chain complementarity determining region 3 (HC CDR3) as disclosed in Table 2.

75. 75. The anti-CD19 binding domain of claim 74, wherein the anti-CD19 binding domain is an scFv comprising: (a) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 7 or 199, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to SEQ ID NO: 7 or 199; and / or (b) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 8 or 200, or a sequence having about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identity to SEQ ID NO: 8 or 200.

76. A vector comprising the nucleic acid molecule of any one of claims 1 to 35.

77. 77. The vector of claim 76, wherein the vector is selected from the group consisting of DNA, RNA, a plasmid, a lentiviral vector, an adenoviral vector, or a retroviral vector.

78. 78. The vector of claim 76 or 77, wherein the vector further comprises a promoter, a rebro-responsive element (RRE), a poly(A) tail, a 3'UTR, a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); and / or a cPPT sequence.

79. 79. The vector of claim 78, wherein the promoter is: (a) a constitutive promoter; (b) is selected from the group consisting of an EF-1 alpha promoter, a PGK-1 promoter, a truncated PGK-1 promoter, a UBC promoter, a CMV promoter, a CAGG promoter, and an SV40 promoter; (c) the EF-1 promoter; or (d) comprising the sequence of SEQ ID NO:

101.

80. 80. The vector of claim 78 or 79, wherein the WPRE comprises the sequence of SEQ ID NO:

100.

81. The vector according to any one of claims 78 to 80, wherein the vector is a lentiviral vector.

82. The vector according to any one of claims 76 to 81, wherein the vector is an in vitro transcription vector.

83. 83. The vector of any one of claims 76 to 82, comprising the isolated nucleic acid molecule of any one of claims 1 to 37 operably linked via a linker peptide to a nucleic acid sequence encoding a switch receptor and / or a dominant negative receptor.

84. 84. The vector of claim 83, wherein the linker peptide is: (a) selected from F2A, E2A, P2A, T2A, or furin-(G4S)2-T2A (F-GS2-T2A); (b) comprising the amino acid sequence of SEQ ID NO:92, SEQ ID NO:94, SEQ ID NO:96, or SEQ ID NO:99; or (c) comprising the nucleic acid sequence of SEQ ID NO: 93, 95, 97, or 98.

85. Modified cells comprising: (a) an isolated nucleic acid molecule according to any one of claims 1 to 37; (b) an isolated polypeptide according to any one of claims 36 to 37; (c) the CAR according to any one of claims 38 to 73; (d) an anti-CD19 binding domain according to claim 75 or 76; or (b) A vector according to any one of claims 76 to 84.

86. 86. The modified cell of claim 85, wherein the modified cell is a modified immune cell, a modified natural killer (NK) cell, a modified natural killer T (NKT) cell, or a modified T cell.

87. 87. The modified cell of Claim 86, wherein the modified cell is a modified T cell or a modified human T cell.

88. The modified T cells are CD8 + 88. The modified cell of claim 87, which is a T cell.

89. 89. The modified cell of any one of claims 85 to 88, wherein the modified cell is an autologous cell, a xenogeneic cell, or an allogeneic cell.

90. 90. The modified cell of any one of claims 85-89, further comprising: (a) a switch receptor comprising a first polypeptide comprising at least a portion of an inhibitory molecule selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA, bound to a second polypeptide comprising a positive signal from an intracellular signaling domain selected from the group consisting of OX40, CD27, CD28, IL-12R, ICOS, and 4-1BB; (b) a dominant-negative receptor comprising a truncated mutant of a receptor selected from the group consisting of PD1, TGFβR, TIM-2, and BTLA; and / or (c) A polypeptide that enhances the function of an immune cell selected from the group consisting of chemokines, chemokine receptors, cytokines, cytokine receptors, interleukin-7 (IL-7), interleukin-7 receptors (IL-7R), interleukin-15 (IL-15), interleukin-15 receptors (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-18 receptors (IL-18R), CCL21, CCL19, and combinations thereof, or a functional derivative thereof.

91. A composition comprising the modified cell or population of modified cells of any one of claims 85 to 90.

92. A method for producing modified cells, comprising transfecting cells with: (a) an isolated nucleic acid molecule according to any one of claims 1 to 37; (b) a nucleic acid encoding the CAR according to any one of claims 38 to 73 (c) a nucleic acid encoding the anti-CD19 binding domain of any one of claims 74 to 45; or (d) A vector according to any one of claims 76 to 84.

93. 1. A method of generating a population of RNA modified cells comprising transfecting cells with in vitro transcribed or synthetic RNA, wherein the RNA comprises: (a) an isolated nucleic acid molecule according to any one of claims 1 to 37; (b) a nucleic acid encoding the CAR according to any one of claims 38 to 73; or (c) a nucleic acid encoding the anti-CD19 binding domain of any one of claims 74 to 75.

94. 1. A method of providing anti-tumor immunity in a mammal, comprising administering to the mammal an effective amount of: (a) a composition comprising a modified cell expressing the CAR according to any one of claims 38 to 73; (b) a modified cell according to any one of claims 85 to 90; or (c) The composition of claim 91.

95. 1. A method of treating a mammal having a disease associated with expression of CD19, comprising administering to the mammal an effective amount of: (a) a composition comprising a modified cell expressing the CAR according to any one of claims 38 to 73; (b) a modified cell according to any one of claims 85 to 90; or (c) The composition of claim 91.

96. 96. The method of claim 94 or 95, wherein the modified cells are autologous modified T cells.

97. The method of any one of claims 94 to 96, wherein the modified cells are allogeneic modified T cells.

98. The method of any one of claims 94 to 97, wherein the mammal is a human.

99. The method according to any one of claims 94 to 98, wherein the disease associated with expression of CD19 is selected from the following: (a) a proliferative disease, malignancy, precancerous condition, or non-cancer-related indication associated with expression of CD19; or (b) cancer, atypical and / or non-classical cancer, myelodysplasia, myelodysplastic syndrome, or preleukemia.

100. The method of any one of claims 94 to 99, wherein the disease is a blood cancer selected from the group consisting of: (a) acute leukemia, chronic leukemia, blood disorders, and combinations thereof; or (b) B-cell acute lymphoblastic leukemia ("BALL"), T-cell acute lymphoblastic leukemia ("TALL"), acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), B-cell lymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative disorders, MALT lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndromes, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, ineffective production (or dysplasia) of myeloid blood cells, and combinations thereof.

101. The method of any one of claims 94 to 100, wherein the modified cells or composition are administered in combination with: (a) an agent that increases the potency of a cell that expresses a CAR molecule; (b) an agent that ameliorates one or more side effects associated with the administration of cells expressing a CAR molecule; or (c) an agent for treating a disease associated with CD19;