Improving Cancer Immunotherapy
Combining UAP1 inhibitors with immunotherapy enhances T cell activation and tumor cell killing, addressing resistance mechanisms and improving cancer treatment efficacy.
Patent Information
- Application Number
- JP2025521540
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-11-29
- Filing Date
- 2023-11-27
- Publication Date
- 2025-11-28
AI Technical Summary
Current immunotherapies for cancer face challenges due to innate or acquired resistance mechanisms, leading to reduced efficacy and tumor recurrence, necessitating the development of more effective cancer immunotherapeutic agents.
Combining UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitors with immunotherapy, such as adoptive cell transfer or monoclonal antibody administration, to enhance T cell activation and tumor cell killing.
The synergistic effect of UAP1 inhibition with immunotherapy results in enhanced T cell activation and complete tumor regression, overcoming resistance mechanisms and improving treatment outcomes.
Smart Images

Figure 2025538347000012 
Figure 2025538347000013 
Figure 2025538347000014
Abstract
Description
[Technical Field]
[0001] The present invention relates to combination therapies employing T cell activation and UAP1 inhibitors and the use of these combination therapies for the treatment of cancer. [Background technology]
[0002] Harnessing a patient's own immune system against cancer is a promising, clinically proven approach to combat malignancies. Immunotherapies, such as immune checkpoint inhibitors, have been routinely used in clinical practice for the past decade and have provided significant patient benefits. However, many patients fail to respond or experience tumor recurrence after immunotherapy. This lack of efficacy is due to the development of innate or acquired resistance mechanisms, which pose a challenge to current immunotherapeutic treatments.
[0003] Therefore, there is a need to develop more effective cancer immunotherapeutic agents that improve patient response rates or overcome resistance mechanisms.
[0004] UAP1 is an enzyme involved in the hexosamine biosynthetic pathway (HBP). HBP integrates glucose and glutamine metabolism to generate UDP-GlucNAc and UDP-GalNAc, also known as UDP-HexNAc. These sugar nucleotides are used in several biological processes, including N- and O-linked protein glycosylation and the biosynthesis of glycosaminoglycans (GAGs) and glycosphingolipids (GSLs). Due to increased glucose uptake by tumor cells (the Warburg effect), HBP is often more active in malignant cells compared to healthy cells (Akella et al. BMC Biol. 2019 Jul 4;17(1):52). Furthermore, amplification and / or overexpression of various enzymes involved in this pathway is observed in cancer (Akella et al. BMC Biol. 2019 Jul 4;17(1):52). The role of HBP in regulating the immune system in general, and more specifically, T cell function, has not been extensively studied. Summary of the Invention
[0005] The present inventors have discovered that UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitors can be used to improve the efficacy of immunotherapy, particularly immunotherapy comprising adoptive cell transfer, administration of a monoclonal antibody, administration of a cytokine, administration of a cancer vaccine, T cell induction therapy, administration of a PD-1 axis binding antagonist, or any combination thereof.
[0006] To unbiasedly identify novel immunotherapy target candidates, a CRISPR / Cas9 knockout screen was performed in tumor cells using naive T cells and the CEA-CD3 T cell bispecific antibody (CEA-TCB), sibisatamab. The screen resulted in the discovery of genes with immunomodulatory functions. UAP1 was one of the most potent hits, and its role in regulating anticancer immune responses has been extensively evaluated and validated.
[0007] Using an in vitro model of human peripheral blood mononuclear cell (PBMC)-mediated cancer cell killing, we evaluated the effects of UAP1 reduction on T cell activation and target cell killing following treatment with three exemplary T cell bispecific (TCB) antibodies (CEA-TCB, Tyrp1-TCB, and EpCAM-TCB) as examples of tumor surface-targeted TCBs, and peptide (SIINFEKL)-pulsed target cells as an example of TCR-mediated therapy. These results were confirmed in an in vivo cancer model, demonstrating a synergistic effect of UAP1 gene knockout and CEA-TCB combination, resulting in complete tumor regression compared with incomplete tumor growth control in mice treated with CEA-TCB alone.
[0008] The data in this example demonstrate that UAP1 inhibition can act synergistically with immunotherapy to enhance T cell activation and tumor cell killing, and can be used in combination for the treatment or prevention of cancer.
[0009] Accordingly, in a first aspect, the present invention provides a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor for use in the treatment or prevention of cancer in an individual, said treatment comprising: (a) administering a UAP1 inhibitor to an individual; and (b) administering immunotherapy to an individual The present invention provides a UAP1 inhibitor comprising:
[0010] In a further aspect, the present invention provides a method for treating or preventing cancer in an individual, comprising: (a) administering to an individual a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor; and (b) administering immunotherapy to an individual The present invention provides a method comprising:
[0011] In a further aspect, the present invention provides the use of a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor in the manufacture of a medicament for the treatment of cancer in an individual, said treatment comprising: (a) administering a UAP1 inhibitor to an individual; and (b) administering immunotherapy to an individual Provide for use, including
[0012] In a further aspect, the present invention provides an immunotherapy for use in treating a disease in an individual, said treatment comprising: (a) administering an immunotherapy to an individual; and (b) administering a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor to an individual; The present invention provides immunotherapy comprising:
[0013] Unless otherwise defined herein, terms are used herein as commonly used in the art.
[0014] In some aspects, the immunotherapy comprises adoptive cell transfer, administration of a monoclonal antibody, administration of a cytokine, administration of a cancer vaccine, T cell induction therapy, administration of a PD-1 axis binding antagonist, or any combination thereof.
[0015] As used herein, the term "UAP1 inhibitor" refers to a compound that targets, decreases, or inhibits UAP1 activity, including, but not limited to, small molecule inhibitors. As used herein, the term UAP1 inhibitor also includes UAP1 degraders and regulators of UAP1 expression, resulting in decreased UAP1 activity (e.g., compared to UAP1 activity in the absence of administration of the UAP1 inhibitor).
[0016] Further provided is a UAP1 inhibitor for use in the methods described herein, the UAP1 inhibitor having a molecular weight of 200 to 900 daltons. Further provided is a UAP1 inhibitor for use in the methods described herein, the UAP1 inhibitor having an IC50 value of less than 5 μM, less than 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, less than 2 nM, or less than 1 nM. Further provided is a UAP1 inhibitor for use in the methods described herein, the UAP1 inhibitor comprising at least one heterocycle. Further provided is a UAP1 inhibitor for use in the methods described herein, the heterocycle comprising at least two heteroatoms. In certain aspects, inhibition of UAP1 (e.g., by administration of a UAP1 inhibitor) increases the activity of immunotherapy.
[0017] An exemplary UAP1 inhibitor used as a tool compound in the accompanying examples is Ac4Glc2Bz (Compound B of WO2016025790). TIFF2025538347000001.tif37170 The "activity" of an immunotherapy refers to the response elicited in an individual by the immunotherapy. Such activity can include cellular response(s) of T cells, particularly CD4+ and / or CD8+ T cells, such as proliferation, differentiation, cytokine secretion, release of cytotoxic effector molecules, cytotoxic activity, and expression of activation markers, and / or effects on target cells, particularly target cells (e.g., tumor cells) expressing the target cell antigen of the T cell bispecific antibody, such as lysis of the target cells.
[0018] In some embodiments, (administration of) a UAP1 inhibitor causes increased T cell activation (induced by immunotherapy).
[0019] As used herein, "T cell activation" or "T cell activation" refers to one or more cellular responses of T lymphocytes, particularly CD4+ or CD8+ T cells, selected from proliferation, differentiation, cytokine secretion, release of cytotoxic effector molecules, cytotoxic activity, and expression of activation markers. Suitable assays for measuring T cell activation are known in the art and described herein. In certain aspects, T cell activation is determined by measuring the expression of CD25 and / or CD69 on T cells, e.g., by flow cytometry.
[0020] In some embodiments, (administration of) a UAP1 inhibitor causes inhibition of T cell proliferation (induced by immunotherapy). In some embodiments, (administration of) a UAP1 inhibitor causes inhibition of T cell cytotoxic activity (induced by immunotherapy).
[0021] "Cytotoxic activity" of T cells refers to the induction of lysis (i.e., killing) of target cells by T lymphocytes, particularly CD4+ or CD8+ T cells. Cytotoxic activity typically involves degranulation of T lymphocytes, which is associated with the release of cytotoxic effector molecules such as granzyme B and / or perforin from the T lymphocytes.
[0022] In some embodiments, (administration of) a UAP1 inhibitor causes inhibition of T cell receptor signaling in T cells (induced by immunotherapy).
[0023] "T cell receptor signaling" refers to the activity of signaling pathways downstream of the T cell receptor (TCR) in T lymphocytes following engagement of the TCR (e.g., engagement of the CD3ε subunit of the TCR by a T cell bispecific antibody), including signaling molecules including tyrosine kinases such as Lck kinase.
[0024] In some embodiments, administration of a UAP1 inhibitor causes an increase in cytokine secretion by T cells (induced by immunotherapy). In some embodiments, the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α, IFN-γ, IL-6, and IL-1β. In some embodiments, the T cells are CD8+ T cells or CD4+ cells.
[0025] In some embodiments, administration of a UAP1 inhibitor causes an increase in the level of one or more cytokines in an individual (e.g., as measured in the individual's serum or in a tumor biopsy). In some embodiments, the one or more cytokines are selected from the group consisting of IL-2, TNF-α, and IFN-γ. In some embodiments, the increase persists after the UAP1 inhibitor has not been administered to the individual for a given period of time. In some embodiments, the amount of time is about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 16 hours, 20 hours, 24 hours, 36 hours, 48 hours, 72 hours, or 96 hours. In some embodiments, the increase persists after a subsequent administration of immunotherapy. Notably, the increase persists even after administration of the UAP1 inhibitor has stopped / no further administration of the UAP1 inhibitor is performed. The increase in cytokine levels is particularly when compared to serum levels in individuals (including the same individual) who have not been administered a UAP1 inhibitor (e.g., serum levels are increased compared to serum levels without / before administration of a UAP1 inhibitor). The increase in cytokine levels is particularly when compared to levels in individuals (including the same individual) who have been administered an immunotherapy (particularly the first administration) but not a UAP1 inhibitor (i.e., in such cases, cytokine levels are increased compared to cytokine levels with / after administration of an immunotherapy but without / before administration of a UAP1 inhibitor). Cytokine levels can also be measured in an individual's tumor biopsy to compare with cytokine levels in individuals (including the same individual) who have been administered an immunotherapy (particularly the first administration) but not a UAP1 inhibitor (i.e., in such cases, cytokine levels are increased compared to cytokine levels with / after administration of an immunotherapy but without / before administration of a UAP1 inhibitor). In some embodiments, the increase is clinically meaningful and / or statistically significant.
[0026] In some embodiments, the administration of the UAP1 inhibitor is prior to the administration of immunotherapy. In some embodiments, the administration of the UAP1 inhibitor is concurrent with the administration of immunotherapy. In some embodiments, the administration of the UAP1 inhibitor is subsequent to the administration of immunotherapy. When the administration of the UAP1 inhibitor is prior to or subsequent to the administration of immunotherapy, such administration of the UAP1 inhibitor can be, for example, within about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours before or after the administration of immunotherapy, respectively. The administration of the UAP1 inhibitor can be intermittent or continuous. In some embodiments, the administration of the UAP1 inhibitor is oral.
[0027] In some embodiments, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in the activity of immunotherapy. In some embodiments, the UAP1 inhibitor is administered at a dose insufficient to cause an increase in T cell activation (induced by immunotherapy). In some embodiments, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in T cell proliferation (induced by immunotherapy). In some embodiments, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in T cell cytotoxic activity (induced by immunotherapy). In some embodiments, the UAP1 inhibitor is administered at a dose insufficient to cause an increase in T cell receptor signaling in T cells (induced by immunotherapy). In some embodiments, the UAP1 inhibitor is administered at a dose sufficient to cause an increase in cytokine secretion by T cells (induced by immunotherapy). In some embodiments, the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α, and IFN-γ. In some embodiments, the T cells are CD8+ T cells or CD4+ cells. In some embodiments, the inhibition is clinically meaningful and / or statistically significant.
[0028] Said increase in cytokine levels or cytokine secretion is particularly when compared to the cytokine levels or cytokine secretion of an individual (including the same individual) who has not been administered a UAP1 inhibitor (i.e., in such cases, the cytokine levels are increased compared to levels without / before administration of a UAP1 inhibitor). Said increase in cytokine levels or cytokine secretion is particularly when compared to the cytokine levels or cytokine secretion of an individual (including the same individual) who has been administered an immunotherapy (particularly the first administration) but has not been administered a UAP1 inhibitor (i.e., in such cases, the cytokine levels are increased compared to cytokine levels with / after administration of immunotherapy but without / before administration of a UAP1 inhibitor). Without said increase, cytokine levels and / or cytokine secretion may be lower / decreased, particularly in association with (the administration of) immunotherapy. In some embodiments, said increase is clinically meaningful and / or statistically significant.
[0029] In some embodiments, the administration of the UAP1 inhibitor is at an effective dose.
[0030] An "effective amount" or "effective dose" of an agent, e.g., a UAP1 inhibitor or immunotherapy, refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result. As used herein, the terms IC50, IC80, IC90, and IC95 refer to inhibitory concentrations at which 50%, 80%, 90%, and 95% of UAP1 activity is inhibited. In one embodiment, an effective dose is IC50. In one embodiment, an effective dose is IC80. In one embodiment, an effective dose is IC90. In one embodiment, an effective dose is IC95.
[0031] In some embodiments, the UAP1 inhibitor has an IC50 value of less than 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, less than 2 nM, or less than 1 nM. In some embodiments, the UAP1 inhibitor has an IC80 value of less than 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, less than 2 nM, or less than 1 nM. In some embodiments, the UAP1 inhibitor has an IC90 value of less than 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, less than 2 nM, or less than 1 nM. In some embodiments, the UAP1 inhibitor has an IC95 value of less than 1 μM, less than 500 nM, less than 200 nM, less than 100 nM, less than 50 nM, less than 25 nM, less than 10 nM, less than 5 nM, less than 2 nM, or less than 1 nM. In some embodiments, the UAP1 inhibitor reduces UAP1 activity by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99%. IC50 values can be measured according to procedures and methods known in the art.
[0032] In some embodiments, the UAP1 inhibitor is administered at a dose of about 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1000 mg, or more.
[0033] In some embodiments, the administration of the UAP1 inhibitor is at a dose between about 1 mg and about 10 mg, between about 10 mg and about 5000 mg, between about 50 mg and about 2000 mg, or between about 100 mg and about 1000 mg.
[0034] In some embodiments, the UAP1 inhibitor is administered daily. In some embodiments, the UAP1 inhibitor is administered once a day. In some embodiments, the UAP1 inhibitor is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times, particularly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times during the course of an individual's immunotherapy. In some embodiments, the UAP1 inhibitor is administered for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days. In some embodiments, the UAP1 inhibitor is administered once a day for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days. In some embodiments, the administration of the UAP1 inhibitor is associated with the first administration of immunotherapy. The first administration is particularly the first administration of immunotherapy in the course of treating an individual with immunotherapy. In some embodiments, the administration of the UAP1 inhibitor is simultaneous with the first administration of immunotherapy. In some embodiments, the administration of the UAP1 inhibitor precedes the first administration of immunotherapy. In some embodiments, the administration of the UAP1 inhibitor follows the first administration of immunotherapy. In some embodiments, the administration of the UAP1 inhibitor follows the first administration of immunotherapy and precedes the second administration of immunotherapy. When the administration of the UAP1 inhibitor precedes or follows the (first) administration of immunotherapy, such administration of the UAP1 inhibitor can be, for example, within about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours before or after the administration of immunotherapy, respectively.
[0035] In some embodiments, the administration of the immunotherapy is for a longer period than the administration of the UAP1 inhibitor. In some embodiments, the administration of the immunotherapy continues after the administration of the UAP1 inhibitor is stopped. In some embodiments, the administration of the immunotherapy is a single dose or repeated doses. During the course of treating an individual with immunotherapy, the immunotherapy can be administered once or several times. For example, treating an individual with immunotherapy can include multiple treatment cycles, each comprising one or more administrations of the immunotherapy. In some embodiments, the administration of the immunotherapy includes a first and a second administration.
[0036] For use in the present invention, immunotherapies will be formulated, dosed, and administered in a manner consistent with good medical practice. Factors to consider in this regard include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of drug delivery, the method of administration, the administration schedule, and other factors known to medical practitioners.
[0037] In some embodiments, the immunotherapy is administered at an effective dose. For systemic administration, the effective dose can be initially estimated from in vitro assays, such as cell culture assays. The IC as determined in cell culture can then be used to estimate the effective dose. 50 Doses can be formulated in animal models to achieve a blood concentration range encompassing the range of 100 mg / kg / day to 150 mg / kg / day. Such information can be used to more accurately determine useful doses in humans. Initial dosages can also be estimated from in vivo data, e.g., animal models, using techniques well known in the art. Dosages and administration intervals can be individually adjusted to achieve plasma concentrations of the immunotherapy sufficient to maintain therapeutic efficacy. For example, for T cell bispecific antibodies, typical patient dosages for administration by injection range from about 0.1 to 50 mg / kg / day, typically about 0.5 to 1 mg / kg / day. Therapeutically effective plasma levels can be achieved by administering multiple doses each day. Plasma levels can be measured, for example, by HPLC.
[0038] An effective amount of immunotherapy can be administered to prevent or treat disease. The appropriate route of administration and dosage of immunotherapy can be determined based on the type of disease to be treated, the type of immunotherapy, the severity and course of the disease, the individual's clinical symptoms, the individual's clinical history and response to treatment, and the judgment of the attending physician. Dosing can be by any suitable route, for example, injection, such as intravenous or subcutaneous injection, depending in part on whether administration is brief or chronic. Various administration schedules are contemplated herein, including, but not limited to, single or multiple administrations, bolus administration, and pulse infusions over various time points.
[0039] The immunotherapy and the UAP1 inhibitor may be administered by any suitable route, and may be administered by the same or different routes of administration. In some embodiments, the immunotherapy is administered parenterally, particularly intravenously.
[0040] In some embodiments, the administration of immunotherapy is the first administration of recombinant immunotherapy to the individual, particularly the first administration of immunotherapy in the course of treatment of the individual with immunotherapy.
[0041] In some embodiments, the immunotherapy induces (i.e., causes or increases) T cell activation. In some embodiments, the immunotherapy induces T cell proliferation. In some embodiments, the immunotherapy induces T cell cytotoxic activity. In some embodiments, the immunotherapy induces T cell receptor signaling in T cells. In some embodiments, the immunotherapy induces cytokine secretion by T cells. In some embodiments, the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α, and IFN-γ. In some embodiments, the T cells are CD8+ T cells or CD4+ cells.
[0042] In some aspects, administration of immunotherapy results in activation of T cells, particularly cytotoxic T cells, particularly at the site of the cancer (e.g., within a solid tumor cancer). Activation can include T cell proliferation, T cell differentiation, cytokine secretion by the T cell, release of cytotoxic effector molecules from the T cell, cytotoxic activity of the T cell, and expression of activation markers by the T cell. In some aspects, administration of immunotherapy results in an increase in the number of T cells, particularly cytotoxic T cells, at the site of the cancer (e.g., within a solid tumor cancer).
[0043] In some aspects, the immunotherapy comprises adoptive cell transfer, administration of a monoclonal antibody, administration of a cytokine, administration of a cancer vaccine, T cell induction therapy, administration of a PD-1 axis binding antagonist, or any combination thereof.
[0044] The following further describes T cell induction therapy that can be used as immunotherapy in the present invention.
[0045] In one embodiment, the T cell induction therapy is a T cell bispecific antibody as described in more detail below. In one embodiment, the immunotherapy is a T cell bispecific antibody as described in more detail below.
[0046] By "T cell bispecific antibody" (abbreviated as "TCB") is meant an antibody that can bind, including simultaneously bind, to a T cell (usually via an antigenic determinant expressed on T cells, such as CD3) and to a target cell (usually via an antigenic determinant expressed on the target cell, such as CEA, TYRP1, or EpCAM).
[0047] In preferred embodiments according to the present invention, the T cell bispecific antibody is capable of simultaneously binding to an antigenic determinant on a T cell (i.e., a first antigen such as CD3) and an antigenic determinant on a target cell (i.e., a second antigen such as CEA, TYRP1, or EpCAM). In some embodiments, the T cell bispecific antibody is capable of crosslinking the T cell and the target cell by simultaneous binding to CD3 and the target cell antigen. In even more preferred embodiments, such simultaneous binding results in lysis of the target cell, particularly a target cell antigen (e.g., CEA, TYRP1, or EpCAM)-expressing tumor cell. In some embodiments, such simultaneous binding results in activation of the T cell. In some embodiments, such simultaneous binding results in a cellular response of the T cell selected from the group of proliferation, differentiation, cytokine secretion, cytotoxic effector molecule release, cytotoxic activity, and expression of activation markers. In some embodiments, binding of the T cell bispecific antibody to CD3 without simultaneous binding to the target cell antigen does not result in T cell activation. In some embodiments, the T cell bispecific antibody is capable of redirecting the cytotoxic activity of the T cell to the target cell. In preferred embodiments, the redirection is independent of MHC-mediated peptide antigen presentation by the target cell and / or T cell specificity.
[0048] The term "bispecific" means that an antibody can bind to at least two different antigenic determinants. Typically, a bispecific antibody contains two antigen-binding sites, each specific for a different antigenic determinant. In some embodiments, a bispecific antibody can bind to two antigenic determinants together, particularly two antigenic determinants expressed on two separate cells.
[0049] As used herein, the term "antigenic determinant" is synonymous with "antigen" and "epitope" and refers to a site on a polypeptide macromolecule (e.g., a contiguous stretch of amino acids or a three-dimensional structure composed of distinct stretches of non-contiguous amino acids) to which an antigen-binding moiety binds to form an antigen-binding moiety-antigen complex. Useful antigenic determinants can be found, for example, on the surface of tumor cells, on the surface of virally infected cells, on the surface of other diseased cells, on the surface of immune cells, free in serum, and / or in the extracellular matrix (ECM).
[0050] As used herein, the term "antigen-binding moiety" refers to a polypeptide molecule that binds (including specifically binds) to an antigenic determinant. In some embodiments, an antigen-binding moiety can target an entity to which it is attached (e.g., a second antigen-binding moiety) to a target site, e.g., a specific type of tumor cell bearing the antigenic determinant. In further embodiments, an antigen-binding moiety can activate signaling through its target antigen, e.g., a T cell receptor complex antigen. Antigen-binding moieties include antibodies and fragments thereof as further defined herein. Particular antigen-binding moieties comprise the antigen-binding domain of an antibody, comprising an antibody heavy chain variable region and an antibody light chain variable region. In some embodiments, an antigen-binding moiety can comprise an antibody constant region known in the art, as further defined herein. Useful heavy chain constant regions include any of the five isotypes: α, δ, ε, γ, or μ. Useful light chain constant regions include any of the two isotypes: κ and λ.
[0051] "Specific binding" means that the binding is selective for the antigen and can be distinguished from undesired or nonspecific interactions. As used herein, the terms "bind" or "binding" generally refer to "specific binding." The binding ability of an antigen-binding moiety to a specific antigenic determinant can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques well known to those skilled in the art, such as surface plasmon resonance (SPR) technology (analyzed on a BIAcore instrument) (Liljeblad et al., Glyco J 17, 323-329 (2000)) and conventional binding assays (Heeley, Endocr Res 28, 217-229 (2002)). In some embodiments, the binding of the antigen-binding moiety to an unrelated protein is less than about 10% of the binding of the antigen-binding moiety to the antigen, as measured, for example, by SPR. In some aspects, an antigen-binding portion, or an antibody comprising an antigen-binding portion, that binds to an antigen has a denaturing activity of ≦1 μM, ≦100 nM, ≦10 nM, ≦1 nM, ≦0.1 nM, ≦0.01 nM, or ≦0.001 nM (e.g., 10 -8 M or less, e.g. 10 -8 M to 10 -13 M, e.g. 10 -9 M to 10 -13 Dissociation constant (K D )
[0052] "Affinity" refers to the total strength of non-covalent interactions between a single binding site of a molecule (e.g., a receptor) and its binding partner (e.g., a ligand). Unless otherwise indicated, "binding affinity," as used herein, refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antigen-binding moiety and an antigen, or a receptor and its ligand). The affinity of molecule X for its binding partner Y is generally determined by the dissociation constant (K D ), and the dissociation rate constant and the association rate constant (k off and k on) is the ratio of the rate constants. Thus, equivalent affinities can involve different rate constants, as long as the ratio of the rate constants remains the same. Affinity can be measured by well-established methods known in the art, including those described herein. A particular method for measuring affinity is surface plasmon resonance (SPR).
[0053] Unless otherwise specified, "CD3" refers to any native CD3 from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats). The term encompasses "full-length," unprocessed CD3 and any form of CD3 resulting from intracellular processing. The term also encompasses naturally occurring variants of CD3, such as splice variants or allelic variants. In some embodiments, the CD3 is human CD3, particularly the epsilon subunit of human CD3 (CD3ε). The amino acid sequence of human CD3ε is set forth in UniProt (www.uniprot.org) Accession No. P07766 (Version 144) or NCBI (www.ncbi.nlm.nih.gov / ) RefSeq NP_000724.1. See also SEQ ID NO: 4.
[0054] As used herein, "target cell antigen" refers to an antigenic determinant displayed on the surface of a target cell, e.g., a cell in a tumor, such as a cancer cell or a cell of the tumor stroma (in which case it is a "tumor cell antigen"). Preferably, the target cell antigen is not CD3 and / or is expressed on a different cell than CD3. In some embodiments, the target cell antigen is CEA, particularly human CEA. In other embodiments, the target cell antigen is TYRP1, particularly human TYRP1. In some embodiments, the target cell antigen is EpCAM, particularly human EpCAM.
[0055] As used herein, the terms "first," "second," or "third," with respect to antigen-binding moieties, etc., are used for convenience to distinguish when more than one of each type of moiety is present. The use of these terms is not intended to confer a particular order or orientation of the bispecific antibody, unless otherwise specified.
[0056] The term "valency" as used herein refers to the presence of a specified number of antigen-binding sites in an antibody. Thus, the term "monovalent binding to an antigen" refers to the presence of one (and no more than one) antigen-binding site in the antibody that is specific for the antigen.
[0057] The term "antibody" as used herein is used in the broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments, so long as they exhibit the desired antigen-binding activity.
[0058] The terms "full-length antibody," "intact antibody," and "whole antibody" are used interchangeably herein and refer to an antibody having a structure substantially similar to that of a native antibody.
[0059] "Antibody fragment" refers to a molecule other than an intact antibody that contains a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2, diabodies, linear antibodies, single-chain antibody molecules (e.g., scFv), and single-domain antibodies. For a review of some antibody fragments, see Hudson et al., Nat Med 9, 129-134 (2003). For a review of scFv fragments, see, e.g., Pluckthun, The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994). See also WO 93 / 16185 and U.S. Patent Nos. 5,571,894 and 5,587,458. See U.S. Pat. No. 5,869,046 for a discussion of Fab and F(ab')2 fragments that contain salvage receptor-binding epitope residues and have increased in vivo half-lives. Diabodies are antibody fragments with two antigen-binding sites that may be bivalent or bispecific. See, e.g., EP 404,097; WO 1993 / 01161; Hudson et al., Nat Med 9, 129-134 (2003); and Hollinger et al., Proc Natl Acad Sci USA 90, 6444-6448 (1993). Triabodies and tetrabodies are also described in Hudson et al., Nat Med 9, 129-134 (2003). Single-domain antibodies are antibody fragments that contain all or part of the heavy chain variable domain or all or part of the light chain variable domain of an antibody. In some aspects, the single domain antibody is a human single domain antibody (Domantis, Inc., Waltham, MA; see, e.g., U.S. Patent No. 6,248,516 B1). Antibody fragments can be produced by a variety of techniques, including, but not limited to, proteolytic digestion of intact antibodies and production by recombinant host cells (e.g., E. coli or phage), as described herein.
[0060] The term "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. The variable domains of the heavy and light chains (VH and VL, respectively) of a natural antibody generally have a similar structure, each containing four conserved framework regions (FR) and three hypervariable regions (HVR). See, for example, Kindt et al., Kuby Immunology, 6 th ed., W.H. Freeman and Co., page 91 (2007). A single VH or VL domain is sufficient to confer antigen-binding specificity. As used herein with respect to variable region sequences, "Kabat numbering" refers to the numbering system established by Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (1991).
[0061] As used herein, amino acid positions of all heavy and light chain constant regions and domains are numbered according to the Kabat numbering system, referred to herein as "Kabat numbering" or "Kabat numbering," as set forth in Kabat, et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991). Specifically, the Kabat numbering system (see Kabat, et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD (1991) pp. 647-660) is used for the light chain constant domains CL of kappa and lambda isotypes, and the Kabat EU index numbering system (see pp. 661-723) is used for the heavy chain constant domains (CH1, hinge, CH2, and CH3), which is further clarified herein by reference to "Kabat EU index numbering."
[0062] As used herein, the term "hypervariable region" or "HVR" refers to each of the regions of an antibody variable domain that are hypervariable in sequence and that determine antigen-binding specificity, e.g., "complementarity-determining regions" ("CDRs"). Typically, antibodies contain six CDRs: three in the VH (HCDR1, HCDR2, HCDR3) and three in the VL (LCDR1, LCDR2, LCDR3). Exemplary CDRs include: (a) hypervariable loops occurring at amino acid residues 26-32 (L1), 50-52 (L2), 91-96 (L3), 26-32 (H1), 53-55 (H2), and 96-101 (H3) (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)); (b) CDRs occurring at amino acid residues 24-34 (L1), 50-56 (L2), 89-97 (L3), 31-35b (H1), 50-65 (H2), and 95-102 (H3) (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (1991)); and (c) Antigen contacts occurring at amino acid residues 27c-36 (L1), 46-55 (L2), 89-96 (L3), 30-35b (H1), 47-58 (H2), and 93-101 (H3) (MacCallum et al. J. Mol. Biol. 262:732-745 (1996)).
[0063] Unless otherwise specified, CDRs are determined according to Kabat et al., supra. Those skilled in the art will understand that CDR nomenclature may also be determined according to Chothia, supra, McCallum, supra, or any other scientifically accepted nomenclature.
[0064] "Framework" or "FR" refers to variable domain residues other than hypervariable region (HVR) residues. The FR of a variable domain generally consists of four FR domains: FR1, FR2, FR3, and FR4. Thus, the HVR and FR sequences are generally represented in VH (or VL) in the following order: FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.
[0065] The "class" of an antibody or immunoglobulin refers to the type of constant domain or constant region possessed by the antibody or immunoglobulin heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, several of which can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IGA1, and IgA2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively.
[0066] A "Fab molecule" refers to a protein consisting of the VH and CH1 domains of a heavy chain (a "Fab heavy chain") and the VL and CL domains of a light chain (a "Fab light chain") of an immunoglobulin.
[0067] A "crossover" Fab molecule (also referred to as "Crossfab") refers to a Fab molecule in which the variable or constant domains of the Fab heavy and light chains have been exchanged (i.e., replaced with each other), i.e., the crossover Fab molecule comprises a peptide chain consisting of a light chain variable domain VL and a heavy chain constant domain 1 CH1 (VL-CH1 from N-terminal to C-terminal), and a peptide chain consisting of a heavy chain variable domain VH and a light chain constant domain CL (VH-CL from N-terminal to C-terminal). For clarity, in a crossover Fab molecule in which the variable domains of the Fab light chain and the Fab heavy chain have been exchanged, the peptide chain comprising the heavy chain constant domain 1 CH1 is referred to herein as the "heavy chain" of the (crossover) Fab molecule. Conversely, in a crossover Fab molecule in which the constant domains of the Fab light chain and the Fab heavy chain have been exchanged, the peptide chain comprising the heavy chain variable domain VH is referred to herein as the "heavy chain" of the (crossover) Fab molecule.
[0068] In contrast, a "conventional" Fab molecule refers to a Fab molecule in its native format, i.e., a Fab molecule comprising a heavy chain (VH-CH1 from N- to C-terminal) composed of a heavy chain variable domain and a constant domain, and a light chain (VL-CL from N- to C-terminal) composed of a light chain variable domain and a constant domain.
[0069] The term "immunoglobulin molecule" refers to a protein having the structure of a naturally occurring antibody. For example, immunoglobulins of the IgG class are heterotetrameric glycoproteins of approximately 150,000 daltons composed of two disulfide-bonded light chains and two heavy chains. From the N-terminus to the C-terminus, each heavy chain has a variable domain (VH), also called a variable heavy chain domain or heavy chain variable region, followed by three constant domains (CH1, CH2, and CH3), also called a heavy chain constant region. Similarly, from the N-terminus to the C-terminus, each light chain has a variable domain (VL), also called a variable light chain domain or light chain variable region, followed by a constant light chain (CL) domain, also called a light chain constant region. Immunoglobulin heavy chains can be assigned to one of five types, called α (IgA), δ (IgD), ε (IgE), γ (IgG), or μ (IgM), some of which can be further classified into subtypes, e.g., γ1 (IgG1), γ2 (IgG2), γ3 (IgG3), γ4 (IgG4), α1 (IgA1), and α2 (IgA2). Immunoglobulin light chains may be assigned to one of two types, called kappa (κ) and lambda (λ), based on the amino acid sequence of their constant domain. Immunoglobulins essentially consist of two Fab molecules and an Fc domain connected via an immunoglobulin hinge region.
[0070] The term "Fc domain" or "Fc region" herein is used to define the C-terminal region of an immunoglobulin heavy chain containing at least a portion of the constant region. This term includes native-sequence Fc regions and variant Fc regions. Although the boundaries of the Fc region of an IgG heavy chain may vary slightly, the human IgG heavy chain Fc region is usually defined to stretch from Cys226, or from Pro230, to the carboxy-terminus of the heavy chain. However, antibodies produced by host cells may undergo post-translational cleavage of one or more, particularly one or two, amino acids from the C-terminus of the heavy chain. Thus, antibodies generated by host cells by expression of a particular nucleic acid molecule encoding a full-length heavy chain may contain a full-length heavy chain or a truncated variant of the full-length heavy chain. This is the case when the last two C-terminal amino acids of the heavy chain are glycine (G446) and lysine (K447, according to the Kabat EU index). Thus, the C-terminal lysine (Lys447) of the Fc region, or the C-terminal glycine (Gly446) and lysine (K447) may or may not be present. Unless otherwise specified herein, the numbering of amino acid residues within the Fc region or constant region is according to the EU numbering system, also known as the EU index, as described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991 (see also above). As used herein, a "subunit" of an Fc domain refers to one of the two polypeptides that form a dimeric Fc domain, i.e., the polypeptide comprising the C-terminal constant region of an immunoglobulin heavy chain capable of stable self-association. For example, a subunit of an IgG Fc domain comprises the IgG CH2 and IgG CH3 constant domains.
[0071] A "modification that promotes association of a first subunit and a second subunit of an Fc domain" refers to manipulation of the peptide backbone or post-translational modification of an Fc domain subunit that reduces or prevents the association of a polypeptide comprising the Fc domain subunit with an identical polypeptide to form homodimers. As used herein, a modification that promotes association specifically includes separate modifications made to each of the two Fc domain subunits (i.e., the first and second Fc domain subunits) that are desired to associate, which are complementary to each other to promote the association of the two Fc domain subunits. For example, a modification that promotes association can alter the structure or charge of one or both of the Fc domain subunits to sterically or electrostatically favor their association, respectively. Thus, (hetero)dimerization occurs between a polypeptide comprising a first Fc domain subunit and a polypeptide comprising a second Fc domain subunit, which may not be identical in the sense that the additional components (e.g., antigen-binding moieties) fused to each of the subunits are not the same. In some embodiments, a modification that promotes association includes an amino acid mutation, specifically an amino acid substitution, within the Fc domain. In particular embodiments, the association-promoting modifications comprise distinct amino acid mutations, specifically amino acid substitutions, in each of the two subunits of the Fc domain.
[0072] The term "effector function" refers to a biological activity attributable to the Fc region of an antibody, which varies depending on the antibody isotype. Examples of antibody effector functions include: C1q binding and complement-dependent cytotoxicity (CDC), Fc receptor binding, antibody-dependent cell-mediated cytotoxicity (ADCC); antibody-dependent cellular phagocytosis (ADCP), cytokine secretion, immune complex-mediated antigen uptake by antigen-presenting cells, down-regulation of cell surface receptors (e.g., B cell receptors), and B cell activation.
[0073] "Percent (%) amino acid sequence identity" with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical to those in the reference polypeptide sequence after sequence alignment and, if necessary, the introduction of gaps to achieve the maximum percent sequence identity, without considering any conservative substitutions as part of the sequence identity. Alignment to determine percent amino acid sequence identity can be accomplished in a variety of ways within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, Clustal W, Megalign (DNASTAR) software, or the FASTA program package. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms necessary to achieve maximum alignment over the entire length of the sequences being compared. However, for purposes herein, percent amino acid sequence identity values are generated using the ggsearch program in the FASTA package version 36.3.8c, followed by the BLOSUM50 comparison matrix. The FASTA program package was written by W.R. Pearson and D.J. Lipman (1988), "Improved Tools for Biological Sequence Analysis," PNAS 85:2444-2448; W.R. Pearson (1996), "Effective protein sequence comparison," Meth. Enzymol. 266:227-258; and Pearson et al. (1997) Genomics 46:24-36, and is publicly available at http: / / fasta.bioch.virginia.edu / fasta_www2 / fasta_down.shtml.Alternatively, these sequences can be compared by performing a global (rather than local) alignment using the ggsearch(global protein:protein) program and default options (BLOSUM50; open:-10; ext:-2; Ktup=2) on the public server accessible at http: / / fasta.bioch.virginia.edu / fasta_www2 / index.cgi. The percent amino acid identity is shown in the output alignment header.
[0074] An "activating Fc receptor" is an Fc receptor that, following binding of the Fc domain of an antibody, triggers signaling events that stimulate the receptor-bearing cell to carry out an effector function. Human activating Fc receptors include FcγRIIIa (CD16a), FcγRI (CD64), FcγRIIa (CD32), and FcαRI (CD89).
[0075] "Decreased binding," e.g., decreased binding to an Fc receptor, refers to a decrease in affinity for the respective interaction, as measured, e.g., by SPR. For clarity, the term also includes a decrease in affinity to zero (or below the detection limit of the analytical method), i.e., a complete loss of interaction. Conversely, "increased binding" refers to an increase in binding affinity for the respective interaction.
[0076] By "fused" is meant that the components (eg, a Fab molecule and an Fc domain subunit) are linked by a peptide bond, either directly or via one or more peptide linkers.
[0077] In certain embodiments, the T cell bispecific antibody binds to CD3 and a target cell antigen. Thus, in some embodiments, the T cell bispecific antibody comprises an antigen-binding portion that binds to CD3 and an antigen-binding portion that binds to the target cell antigen.
[0078] In some embodiments, the first and / or second antigen-binding moiety is a Fab molecule. In some embodiments, the first antigen-binding moiety is a crossover Fab molecule in which the variable or constant regions of the Fab light chain and Fab heavy chain have been swapped. In such embodiments, the second antigen-binding moiety is preferably a conventional Fab molecule.
[0079] In some aspects, wherein the first and second antigen-binding moieties of the T cell bispecific antibody are both Fab molecules and in one of the antigen-binding moieties (particularly the first antigen-binding moiety), the variable domains VL and VH of the Fab light chain and Fab heavy chain are substituted for each other; i) in the constant domain CL of said first antigen-binding moiety the amino acid at position 124 is substituted by a positively charged amino acid (Kabat numbering) and in the constant domain CH1 of said first antigen-binding moiety the amino acid at position 147 or the amino acid at position 213 is substituted by a negatively charged amino acid (Kabat EU index numbering); or ii) in the constant domain CL of the second antigen-binding moiety, the amino acid at position 124 is substituted by a positively charged amino acid (Kabat numbering) and in the constant domain CH1 of the second antigen-binding moiety, the amino acid at position 147 or the amino acid at position 213 is substituted by a negatively charged amino acid (Kabat EU index numbering).
[0080] The T-cell bispecific antibody does not comprise both of the modifications mentioned in i) and ii): the constant domains CL and CH1 of the antigen-binding part having a VH / VL exchange are not replaced by each other (i.e. remain unexchanged).
[0081] In a more specific aspect, i) in the constant domain CL of the first antigen-binding moiety the amino acid at position 124 is substituted independently by lysine (K), arginine (R), or histidine (H) (Kabat numbering), and in the constant domain CH1 of the first antigen-binding moiety the amino acid at position 147 or the amino acid at position 213 is substituted independently by glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering), or ii) in the constant domain CL of the second antigen-binding moiety, the amino acid at position 124 is substituted independently by lysine (K), arginine (R), or histidine (H) (Kabat numbering), and in the constant domain CH1 of the second antigen-binding moiety, the amino acid at position 147 or the amino acid at position 213 is substituted independently by glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering).
[0082] In some embodiments, in the constant domain CL of the second antigen-binding moiety, the amino acid at position 124 is substituted independently by lysine (K), arginine (R), or histidine (H) (Kabat numbering), and in the constant domain CH1 of the second antigen-binding moiety, the amino acid at position 147 or the amino acid at position 213 is substituted independently by glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering).
[0083] In a further aspect, in the constant domain CL of said second antigen-binding moiety the amino acid at position 124 is substituted independently by a lysine (K), an arginine (R) or a histidine (H) (Kabat numbering) and in the constant domain CH1 of said second antigen-binding moiety the amino acid at position 147 is substituted independently by a glutamic acid (E) or an aspartic acid (D) (Kabat EU index numbering).
[0084] In a preferred embodiment, in the constant domain CL of said second antigen-binding moiety the amino acid at position 124 is substituted independently by lysine (K), arginine (R) or histidine (H) (Kabat numbering), the amino acid at position 123 is substituted independently by lysine (K), arginine (R) or histidine (H) (Kabat numbering), and in the constant domain CH1 of said second antigen-binding moiety the amino acid at position 147 is substituted independently by glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering), and the amino acid at position 213 is substituted independently by glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering).
[0085] In some embodiments, in the constant domain CL of said second antigen-binding moiety the amino acid at position 124 is substituted by lysine (K) (Kabat numbering), and the amino acid at position 123 is substituted by lysine (K) (Kabat numbering), and in the constant domain CHI of said second antigen-binding moiety the amino acid at position 147 is substituted by glutamic acid (E) (Kabat EU index numbering), and the amino acid at position 213 is substituted by glutamic acid (E) (Kabat EU index numbering).
[0086] In some embodiments, in the constant domain CL of said second antigen-binding moiety the amino acid at position 124 is substituted by lysine (K) (Kabat numbering), and the amino acid at position 123 is substituted by arginine (R) (Kabat numbering), and in the constant domain CHI of said second antigen-binding moiety the amino acid at position 147 is substituted by glutamic acid (E) (Kabat EU index numbering), and the amino acid at position 213 is substituted by glutamic acid (E) (Kabat EU index numbering).
[0087] In a particular embodiment, when the amino acid substitutions according to the above embodiments are made in the constant domain CL and the constant domain CH1 of the second antigen binding moiety, the constant domain CL of the second antigen binding moiety is of the kappa isotype.
[0088] In some embodiments, the first antigen-binding moiety and the second antigen-binding moiety are fused to one another, optionally via a peptide linker.
[0089] In some embodiments, each of the first and second antigen-binding moieties is a Fab molecule, and (i) the second antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the first antigen-binding moiety, or (ii) the first antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the second antigen-binding moiety.
[0090] In some embodiments, the T cell bispecific antibody provides monovalent binding to CD3.
[0091] In certain embodiments, the T cell bispecific antibody comprises a single antigen-binding portion that binds to CD3 and two antigen-binding portions that bind to target cell antigens. Thus, in some embodiments, the T cell bispecific antibody comprises a third antigen-binding portion that binds to the target antigen, particularly a Fab molecule, more particularly a conventional Fab molecule. The third antigen-binding portion can incorporate all of the features described herein for the second antigen-binding portion (e.g., CDR sequences, variable region sequences, and / or amino acid substitutions in the constant region), alone or in combination. In some embodiments, the third antigen-binding portion is identical to the first antigen-binding portion (e.g., is also a conventional Fab molecule and comprises the same amino acid sequence).
[0092] In certain embodiments, the T cell bispecific antibody further comprises an Fc domain composed of a first subunit and a second subunit. In some embodiments, the Fc domain is an IgG Fc domain. In certain embodiments, the Fc domain is an IgG1 Fc domain. In other embodiments, the Fc domain is an IgG4 Fc domain. In even more particular embodiments, the Fc domain is an IgG4 Fc domain comprising an amino acid substitution at position S228 (Kabat EU index numbering), in particular the amino acid substitution S228P. This amino acid substitution reduces in vivo Fab arm exchange of IgG4 antibodies (see Stubenrauch et al., Drug Metabolism and Disposition 38, 8491 (2010)). In a further particular embodiment, the Fc domain is a human Fc domain. In a particularly preferred embodiment, the Fc domain is a human IgG1 Fc domain. An exemplary sequence of a human IgG1 Fc region is shown in SEQ ID NO: 27.
[0093] In some embodiments, wherein the first, second, and, if present, third antigen-binding moieties are each Fab molecules, (a) (i) the second antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the first antigen-binding moiety and the first antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the first subunit of the Fc domain, or (ii) the first antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the second antigen-binding moiety and the second antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and (b) if present, the third antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the second subunit of the Fc domain.
[0094] In some embodiments, the T cell bispecific antibody consists essentially of a first, second and third antigen-binding moiety (particularly a Fab molecule), an Fc domain composed of a first subunit and a second subunit, and optionally one or more peptide linkers.
[0095] The components of the T cell bispecific antibody can be fused to each other directly or, preferably, via one or more suitable peptide linkers. When the fusion of a Fab molecule is to the N-terminus of the Fc domain subunit, it is typically via the immunoglobulin hinge region.
[0096] The antigen-binding portions may be fused to the Fc domain or to each other, either directly or via a peptide linker comprising one or more amino acids, typically about 2-20 amino acids. Peptide linkers are known in the art and are described herein. Suitable non-immunogenic peptide linkers include, for example, (G4S) n , (SG4) n , (G4S) n , G4(SG4) n or (G4S) n G5 peptide linkers are included. "n" is generally an integer between 1 and 10, typically between 2 and 4. In some embodiments, the peptide linker has a length of at least 5 amino acids, in some embodiments between 5 and 100, and in further embodiments between 10 and 50 amino acids. In some embodiments, the peptide linker has a length of (GxS) n or (GxS) n G m wherein G=glycine, S=serine, and (x=3, n=3, 4, 5, or 6, and m=0, 1, 2, or 3) or (x=4, n=1, 2, 3, 4, or 5, and m=0, 1, 2, 3, 4, or 5); in some embodiments, x=4 and n=2 or 3; in further embodiments, x=4 and n=2; and in still further embodiments, x=4, n=1, and m=5. In some embodiments, the peptide linker is (G4S)2. In other embodiments, the peptide linker is G4SG5. Additionally, the linker may comprise (a portion of) an immunoglobulin hinge region. In particular, when a Fab molecule is fused to the N-terminus of an Fc domain subunit, it may be fused via an immunoglobulin hinge region or a portion thereof, with or without an additional peptide linker.
[0097] In certain embodiments, the Fc domain comprises a modification that promotes the association of the first subunit with the second subunit of the Fc domain. The most extensive site of protein-protein interaction between the two subunits of the human IgG Fc domain is in the CH3 domain. Thus, in some embodiments, the modification is in the CH3 domain of the Fc domain.
[0098] In certain embodiments, the modification that promotes the association of the first and second subunits of the Fc domain is a so-called "knob-into-hole" modification, which comprises a "knob" modification on one of the two subunits of the Fc domain and a "hole" modification on the other of the two subunits of the Fc domain. Knob-into-hole technology is described, for example, in U.S. Pat. No. 5,731,168, U.S. Pat. No. 7,695,936, Ridgway et al., Prot Eng 9, 617-621 (1996), and Carter, J Immunol Meth 248, 7-15 (2001). Generally, this method involves introducing a protrusion ("knob") on the interface of a first polypeptide and a corresponding cavity ("hole") on the interface of a second polypeptide, such that the protrusion can be positioned within the cavity to promote heterodimer formation and prevent homodimer formation. The protuberances are constructed by replacing small amino acid side chains from the interface of the first polypeptide with larger side chains (e.g., tyrosine or tryptophan). Complementary cavities of identical or similar size to the protuberances are created in the interface of the second polypeptide by replacing the large amino acid side chains with smaller amino acid side chains (e.g., alanine or threonine).
[0099] Thus, in some embodiments, amino acid residues in the CH3 domain of a first subunit of an Fc domain are replaced with amino acid residues having a larger side chain volume, thereby creating a protrusion in the CH3 domain of the first subunit that can be positioned within a cavity in the CH3 domain of a second subunit, and amino acid residues in the CH3 domain of a second subunit of an Fc domain are replaced with amino acid residues having a smaller side chain volume, thereby creating a cavity in the CH3 domain of the second subunit that can be positioned within the protrusion in the CH3 domain of the first subunit. Preferably, the amino acid residues having a larger side chain volume are selected from the group consisting of arginine (R), phenylalanine (F), tyrosine (Y), and tryptophan (W). Preferably, the amino acid residues having a smaller side chain volume are selected from the group consisting of alanine (A), serine (S), threonine (T), and valine (V). The protuberances and cavities can be created by altering the nucleic acid encoding the polypeptide, for example, by site-directed mutagenesis or by peptide synthesis.
[0100] In certain such embodiments, in the first subunit of the Fc domain, the threonine residue at position 366 is replaced with a tryptophan residue (T366W), and in the second subunit of the Fc domain, the tyrosine residue at position 407 is replaced with a valine residue (Y407V), and optionally the threonine residue at position 366 is replaced with a serine residue (T366S), and the leucine residue at position 368 is replaced with an alanine residue (L368A) (numbering according to the Kabat EU index). In a further embodiment, the first subunit of the Fc domain further comprises a replacement of the serine residue at position 354 with a cysteine residue (S354C) or a replacement of the glutamic acid residue at position 356 with a cysteine residue (E356C) (particularly the replacement of the serine residue at position 354 with a cysteine residue), and the second subunit of the Fc domain further comprises a replacement of the tyrosine residue at position 349 with a cysteine residue (Y349C) (numbering according to the Kabat EU index). In a preferred embodiment, the first subunit of the Fc domain comprises the amino acid substitutions S354C and T366W, and the second subunit of the Fc domain comprises the amino acid substitutions Y349C, T366S, L368A, and Y407V (numbering according to the Kabat EU index).
[0101] In some embodiments, the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or decrease effector function.
[0102] In certain embodiments, the Fc receptor is an Fcγ receptor. In some embodiments, the Fc receptor is a human Fc receptor. In some embodiments, the Fc receptor is an activating Fc receptor. In certain embodiments, the Fc receptor is an activating human Fcγ receptor, more particularly human FcγRIIIa, FcγRI, or FcγRIIa, most particularly human FcγRIIIa. In some embodiments, the effector function is one or more selected from the group consisting of complement-dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), and cytokine secretion. In certain embodiments, the effector function is ADCC.
[0103] Typically, the same amino acid substitution(s) are present in each of the two subunits of the Fc domain. In some embodiments, the amino acid substitution(s) reduce the binding affinity of the Fc domain to an Fc receptor. In some embodiments, the amino acid substitution(s) reduce the binding affinity of the Fc domain to an Fc receptor by at least 2-fold, at least 5-fold, or at least 10-fold.
[0104] In some embodiments, the Fc domain comprises an amino acid substitution at a position selected from the group of E233, L234, L235, N297, P331, and P329 (numbering according to Kabat EU index). In more specific embodiments, the Fc domain comprises an amino acid substitution at a position selected from the group of L234, L235, and P329 (numbering according to Kabat EU index). In some embodiments, the Fc domain comprises amino acid substitutions L234A and L235A (numbering according to Kabat EU index). In some such embodiments, the Fc domain is an IgG1 Fc domain, particularly a human IgG1 Fc domain. In some embodiments, the Fc domain comprises an amino acid substitution at position P329. In more specific embodiments, the amino acid substitution is P329A or P329G, particularly P329G (numbering according to Kabat EU index). In some embodiments, the Fc domain comprises an additional amino acid substitution at position P329 and at a position selected from E233, L234, L235, N297, and P331 (numbering according to the Kabat EU index). In more specific embodiments, the additional amino acid substitution is E233P, L234A, L235A, L235E, N297A, N297D, or P331S. In particular embodiments, the Fc domain comprises amino acid substitutions at positions P329, L234, and L235 (numbering according to the Kabat EU index). In more specific embodiments, the Fc domain comprises the amino acid mutations L234A, L235A, and P329G ("P329G LALA," "PGLALA," or "LALAPG"). Specifically, in a preferred embodiment, each subunit of the Fc domain contains the amino acid substitutions L234A, L235A, and P329G (Kabat EU index numbering), i.e., the leucine residue at position 234 is replaced with an alanine residue (L234A), the leucine residue at position 235 is replaced with an alanine residue (L235A), and the proline residue at position 329 is replaced with a glycine residue (P329G) in each of the first and second subunits of the Fc domain (Kabat EU index numbering).In some such embodiments, the Fc domain is an IgG1 Fc domain, particularly a human IgG1 Fc domain.
[0105] In some embodiments, the target cell antigen of the T cell bispecific antibody is carcinoembryonic antigen (CEA).
[0106] "Carcinoembryonic antigen" or "CEA" (also known as carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5)), unless otherwise specified, refers to any native CEA from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats). The term encompasses "full-length," unprocessed CEA, as well as any form of CEA resulting from intracellular processing. The term also encompasses naturally occurring variants of CEA, such as splice variants or allelic variants. In some embodiments, the CEA is human CEA. The amino acid sequence of human CEA is set forth in UniProt (www.uniprot.org) Accession No. P06731 or NCBI (www.ncbi.nlm.nih.gov / ) RefSeq NP_004354.2. See also SEQ ID NO: 5. In some embodiments, the CEA is cell membrane-bound CEA. In some embodiments, the CEA is CEA expressed on the surface of a cell, eg, on the surface of a cancer cell.
[0107] T cell bispecific antibodies useful in the invention that bind CEA are described, for example, in PCT Publication No. WO 2014 / 131712, which is incorporated by reference in its entirety.
[0108] In some embodiments, the T cell bispecific antibody comprises a first antigen-binding portion that binds CD3 and a second antigen-binding portion that binds CEA.
[0109] In some embodiments, the first antigen-binding portion comprises a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 12, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18.
[0110] In some embodiments, the second antigen-binding portion comprises a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 36, an HCDR2 of SEQ ID NO: 37, and an HCDR3 of SEQ ID NO: 38, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 39, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 41.
[0111] In some embodiments, the CEA CD3 bispecific antibody (i) a first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 12; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18; (ii) a second antigen-binding portion that binds to CEA, the second antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 36, an HCDR2 of SEQ ID NO: 37, and an HCDR3 of SEQ ID NO: 38; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 39, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 41. Includes:
[0112] In some embodiments, the first antigen-binding portion comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the first antigen-binding portion comprises a heavy chain variable region sequence of SEQ ID NO: 14 and a light chain variable region sequence of SEQ ID NO: 19.
[0113] In some embodiments, the second antigen-binding portion comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 42 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 43. In some embodiments, the second antigen-binding portion comprises a heavy chain variable region sequence of SEQ ID NO: 42 and a light chain variable region sequence of SEQ ID NO: 43.
[0114] In some embodiments, the T cell bispecific antibody comprises a third antigen-binding moiety that binds to CEA and / or an Fc domain composed of a first subunit and a second subunit, as described herein.
[0115] In a preferred embodiment, the T cell bispecific antibody comprises: (i) a first antigen-binding moiety that binds to CD3, the first antigen-binding moiety comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 12, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18, wherein the first antigen-binding moiety is a crossover Fab molecule in which either the variable or constant regions of the Fab light chain and the Fab heavy chain, particularly the constant regions, have been exchanged; (ii) a second antigen-binding portion and a third antigen-binding portion that bind to CEA, the second antigen-binding portion and the third antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 36, an HCDR2 of SEQ ID NO: 37, and an HCDR3 of SEQ ID NO: 38, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 39, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 41, wherein the second antigen-binding portion and the third antigen-binding portion are Fab molecules, particularly conventional Fab molecules; (iii) an Fc domain composed of a first subunit and a second subunit; wherein the second antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the first antigen-binding moiety, the first antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and the third antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the second subunit of the Fc domain.
[0116] In some embodiments, a first antigen-binding portion of a T cell bispecific antibody (that binds CEA and CD3) comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14, and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the first antigen-binding portion comprises the heavy chain variable region sequence of SEQ ID NO: 14 and the light chain variable region sequence of SEQ ID NO: 19.
[0117] In some embodiments, the second and (if present) third antigen-binding portions of the T cell bispecific antibody (which binds CEA and CD3) comprise a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 42 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 43. In some embodiments, the second and (if present) third antigen-binding portions comprise the heavy chain variable region of SEQ ID NO: 42 and the light chain variable region of SEQ ID NO: 43.
[0118] The Fc domain according to the above embodiment may comprise, either alone or in combination, all of the features described above in relation to the Fc domain.
[0119] In some embodiments, the Fc domain of the T cell bispecific antibody (which binds CEA and CD3) comprises a modification that promotes association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector function.
[0120] In some embodiments, the antigen binding portion and the Fc region are fused to each other by a peptide linker, particularly a peptide linker as described above.
[0121] In some embodiments, the T cell bispecific antibody (which binds CEA and CD3) comprises a polypeptide (particularly two polypeptides) comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:44; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:45; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:46; and a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO:47. In some embodiments, the T cell bispecific antibody (which binds CEA and CD3) comprises a polypeptide (particularly two polypeptides) comprising the sequence of SEQ ID NO: 44, a polypeptide comprising the sequence of SEQ ID NO: 45, a polypeptide comprising the sequence of SEQ ID NO: 46, and a polypeptide comprising the sequence of SEQ ID NO: 47.
[0122] In a preferred embodiment, the T-cell bispecific antibody is civisatamab (WHO Drug Information International Nonproprietary Names of Pharmaceutical Substances) Recommended INN: List, 2018, vol. 32, no. 3, p. 438).
[0123] The T cell bispecific antibody sivisatamab (RG7802, RO6958688, CEA-TCB) is a novel T cell-activating bispecific antibody that targets carcinoembryonic antigen (CEA) on tumor cells and CD3 on T cells, redirecting T cells to tumor cells expressing the CEA glycoprotein on their cell surface independently of their T cell receptor specificity (Bacac et al., Oncoimmunology. 2016;5(8):1-30). The main advantage of T cell-redirecting bispecific antibodies is that they mediate cancer cell recognition by T cells independently of neoantigen loading. Because CEA is overexpressed on the cell surface of many colorectal cancers (CRCs), sivisatamab is a promising immunotherapeutic agent for non-hypermutated, microsatellite-stable (MSS) CRCs.
[0124] Sivisatamab has a single binding site for the CD3 epsilon chain on T cells and two CEA-binding sites that adjust its binding avidity to cancer cells with moderate to high CEA cell surface expression (Bacac et al., Clin Cancer Res. 2016;22(13):3286-97). This avoids targeting healthy epithelial cells, which have physiologically low CEA expression levels present in some tissues. Binding of sivisatamab to CEA on the surface of cancer cells and CD3 on T cells induces T cell activation, cytokine secretion, and cytotoxic granule release. A phase I trial of civisatamab in patients with CEA-expressing metastatic CRC who had failed at least two prior chemotherapy regimens demonstrated antitumor activity, with radiological shrinkage in 11% (4 / 36) and 50% (5 / 10) of patients treated with monotherapy or in combination with a PD-L1 inhibitor, respectively (Argiles et al., Ann Oncol. 2017 Jun 1;28(suppl_3):mdx302.003-mdx302.003; Tabernero et al., J Clin Oncol. 2017 May 20;35(15_suppl):3002). Based on these results, CEA is one of the most promising target antigens for immunotherapy in MSS CRC. Although some patients in this dose-escalation trial were treated with doses below the final recommended dose, the response rate nonetheless indicates that a subgroup of tumors is resistant to treatment.
[0125] In some embodiments, the target cell antigen of the T cell bispecific antibody is EpCAM.
[0126] "EpCAM," also known as "epithelial cell adhesion molecule," refers to any native EpCAM from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats), unless otherwise specified. The term encompasses "full-length," unprocessed EpCAM and any form of EpCAM that results from processing in cells. The term also encompasses naturally occurring variants of EpCAM, such as splice variants or allelic variants. In some embodiments, the EpCAM is human EpCAM. Human EpCAM is described in UniProt (www.uniprot.org) under accession number P16422 (entry version 207), and the amino acid sequence of human EpCAM is also set forth in SEQ ID NO: 6.
[0127] In some embodiments, the T cell bispecific antibody comprises a first antigen-binding moiety that binds CD3 and a second antigen-binding moiety that binds EpCAM.
[0128] In some embodiments, the first antigen-binding portion comprises a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 12, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18.
[0129] In some embodiments, the second antigen-binding portion comprises a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 60, an HCDR2 of SEQ ID NO: 61, and an HCDR3 of SEQ ID NO: 62, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 63, an LCDR2 of SEQ ID NO: 64, and an LCDR3 of SEQ ID NO: 65.
[0130] In some embodiments, the T cell bispecific antibody comprises: (i) a first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 12; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18; (ii) a second antigen-binding portion that binds to EpCAM, the second antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 60, an HCDR2 of SEQ ID NO: 61, and an HCDR3 of SEQ ID NO: 62; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 63, an LCDR2 of SEQ ID NO: 64, and an LCDR3 of SEQ ID NO: 65. Includes:
[0131] In some embodiments, the first antigen-binding portion comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the first antigen-binding portion comprises a heavy chain variable region sequence of SEQ ID NO: 14 and a light chain variable region sequence of SEQ ID NO: 19.
[0132] In some embodiments, the second antigen-binding portion comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 66 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 67. In some embodiments, the second antigen-binding portion comprises a heavy chain variable region sequence of SEQ ID NO: 66 and a light chain variable region sequence of SEQ ID NO: 67.
[0133] In some embodiments, the T cell bispecific antibody comprises a third antigen-binding moiety that binds EpCAM and / or an Fc domain composed of a first subunit and a second subunit, as described herein.
[0134] In a preferred embodiment, the T cell bispecific antibody comprises: (i) a first antigen-binding moiety that binds to CD3, the first antigen-binding moiety comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 12, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18, wherein the first antigen-binding moiety is a crossover Fab molecule in which either the variable or constant regions of the Fab light chain and the Fab heavy chain, particularly the variable regions, have been exchanged; (ii) a second antigen-binding moiety and a third antigen-binding moiety that bind to EpCAM, wherein the second antigen-binding moiety and the third antigen-binding moiety comprise a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 60, an HCDR2 of SEQ ID NO: 61, and an HCDR3 of SEQ ID NO: 62, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 63, an LCDR2 of SEQ ID NO: 64, and an LCDR3 of SEQ ID NO: 65, wherein the second antigen-binding moiety and the third antigen-binding moiety are Fab molecules, particularly conventional Fab molecules; (iii) an Fc domain composed of a first subunit and a second subunit; wherein the second antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the first antigen-binding moiety, the first antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and the third antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the second subunit of the Fc domain.
[0135] In some embodiments, the first antigen-binding portion of the T cell bispecific antibody (which binds EpCAM and CD3) is a crossover Fab molecule in which the variable regions of the Fab light chain and the Fab heavy chain have been swapped, and the second and (if present) third antigen-binding portions of the T cell bispecific antibody are conventional Fab molecules in which, in the constant domain CL, the amino acid at position 124 is independently substituted by lysine (K), arginine (R), or histidine (H) (Kabat numbering), the amino acid at position 123 is independently substituted by lysine (K), arginine (R), or histidine (H) (Kabat numbering), and in the constant domain CHI, the amino acid at position 147 is independently substituted by glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering), and the amino acid at position 213 is independently substituted by glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering).
[0136] In particular, in the above embodiment, in the constant domain CL of the second and third Fab molecules of (ii) the amino acid at position 124 may be substituted by lysine (K) (Kabat numbering) and the amino acid at position 123 may be substituted by lysine (K) or arginine (R), in particular arginine (R) (Kabat numbering); and in the constant domain CHI of the second and third Fab molecules of (ii) the amino acid at position 147 may be substituted by glutamic acid (E) (Kabat EU index numbering) and the amino acid at position 213 may be substituted by glutamic acid (E) (Kabat EU index numbering).
[0137] In some embodiments, a first antigen-binding portion of a T cell bispecific antibody (that binds EpCAM and CD3) comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the first antigen-binding portion comprises the heavy chain variable region sequence of SEQ ID NO: 14 and the light chain variable region sequence of SEQ ID NO: 19.
[0138] In some embodiments, the second and (if present) third antigen-binding portions of the T cell bispecific antibody (which binds EpCAM and CD3) comprise a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 66 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 67. In some embodiments, the second and (if present) third antigen-binding portions comprise the heavy chain variable region of SEQ ID NO: 66 and the light chain variable region of SEQ ID NO: 67.
[0139] The Fc domain according to the above embodiment may comprise, either alone or in combination, all of the features described above in relation to the Fc domain.
[0140] In some aspects, the Fc domain of the T cell bispecific antibody (which binds EpCAM and CD3) comprises a modification that promotes association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to an Fc receptor and / or effector function.
[0141] In some embodiments, the antigen binding portion and the Fc region are fused to each other by a peptide linker, particularly a peptide linker as described above.
[0142] In some embodiments, the T cell bispecific antibody (which binds EpCAM and CD3) comprises a polypeptide (particularly two polypeptides) comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 68; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 69; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 70; and a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the sequence of SEQ ID NO: 71. In some embodiments, the T cell bispecific antibody (which binds EpCAM and CD3) comprises a polypeptide (particularly two polypeptides) comprising the sequence of SEQ ID NO: 68, a polypeptide comprising the sequence of SEQ ID NO: 69, a polypeptide comprising the sequence of SEQ ID NO: 70, and a polypeptide comprising the sequence of SEQ ID NO: 71.
[0143] In some embodiments, the target cell antigen of the T cell bispecific antibody is TYRP1.
[0144] "TYRP1," unless otherwise indicated, refers to any native TYRP1 from any vertebrate source, including mammals such as primates (e.g., humans), non-human primates (e.g., cynomolgus monkeys), and rodents (e.g., mice and rats). The term encompasses "full-length," unprocessed TYRP1 and any form of TYRP1 resulting from processing within a cell. The term also encompasses naturally occurring variants of TYRP1, such as splice variants or allelic variants. In some embodiments, TYRP1 is human TYRP1. See UniProt (www.uniprot.org) accession number P17643 (version 207) for the human protein. An exemplary sequence of human TYRP1 is given in SEQ ID NO:7.
[0145] In some embodiments, the T cell bispecific antibody comprises a first antigen-binding portion that binds CD3 and a second antigen-binding portion that binds TYRP1.
[0146] In some embodiments, the first antigen-binding portion comprises a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 12, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18.
[0147] In a preferred embodiment, the first antigen-binding portion comprises a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 10, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 13, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18.
[0148] In some embodiments, the second antigen-binding portion comprises a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 23, an HCDR2 of SEQ ID NO: 24, and an HCDR3 of SEQ ID NO: 25, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 27, an LCDR2 of SEQ ID NO: 28, and an LCDR3 of SEQ ID NO: 29.
[0149] In some embodiments, the T cell bispecific antibody comprises: (i) a first antigen-binding moiety that binds to CD3, the first antigen-binding moiety comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 12, or a heavy chain variable region comprising an HCDR1 of SEQ ID NO: 10, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 13; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18; (ii) a second antigen-binding portion that binds to TYRP1, the second antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 23, an HCDR2 of SEQ ID NO: 24, and an HCDR3 of SEQ ID NO: 25; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 27, an LCDR2 of SEQ ID NO: 28, and an LCDR3 of SEQ ID NO: 29. Includes:
[0150] In some embodiments, the first antigen-binding portion comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14, or a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 15, and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the first antigen-binding portion comprises the heavy chain variable region sequence of SEQ ID NO: 14 or the heavy chain variable region sequence of SEQ ID NO: 15, and the light chain variable region sequence of SEQ ID NO: 19.
[0151] In some embodiments, the second antigen-binding portion comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 26 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 30. In some embodiments, the second antigen-binding portion comprises a heavy chain variable region sequence of SEQ ID NO: 26 and a light chain variable region sequence of SEQ ID NO: 30.
[0152] In some aspects, the T cell bispecific antibody comprises a third antigen-binding moiety that binds to TYRP1 and / or an Fc domain composed of a first subunit and a second subunit, as described herein.
[0153] In a preferred embodiment, the T cell bispecific antibody comprises: (i) a first antigen-binding moiety that binds to CD3, the first antigen-binding moiety comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 12, or a heavy chain variable region comprising an HCDR1 of SEQ ID NO: 10, an HCDR2 of SEQ ID NO: 11, and an HCDR3 of SEQ ID NO: 13, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, an LCDR2 of SEQ ID NO: 17, and an LCDR3 of SEQ ID NO: 18, wherein the first antigen-binding moiety is a crossover Fab molecule in which either the variable or constant regions of the Fab light chain and the Fab heavy chain, particularly the variable regions, have been exchanged; (ii) a second antigen-binding portion and a third antigen-binding portion that bind to TYRP1, the second antigen-binding portion and the third antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 23, an HCDR2 of SEQ ID NO: 24, and an HCDR3 of SEQ ID NO: 25, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 27, an LCDR2 of SEQ ID NO: 28, and an LCDR3 of SEQ ID NO: 29, wherein the second antigen-binding portion and the third antigen-binding portion are Fab molecules, particularly conventional Fab molecules; (iii) an Fc domain composed of a first subunit and a second subunit; wherein the second antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the Fab heavy chain of the first antigen-binding moiety, the first antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the first subunit of the Fc domain, and the third antigen-binding moiety is fused at the C-terminus of the Fab heavy chain to the N-terminus of the second subunit of the Fc domain.
[0154] In some embodiments, the first antigen-binding portion of the T cell bispecific antibody (which binds TYRP1 and CD3) is a crossover Fab molecule in which the variable regions of the Fab light chain and the Fab heavy chain have been swapped, and the second and (if present) third antigen-binding portions of the T cell bispecific antibody are conventional Fab molecules in which, in the constant domain CL, the amino acid at position 124 is independently substituted by lysine (K), arginine (R) or histidine (H) (Kabat numbering), the amino acid at position 123 is independently substituted by lysine (K), arginine (R) or histidine (H) (Kabat numbering), and in the constant domain CHI, the amino acid at position 147 is independently substituted by glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering), and the amino acid at position 213 is independently substituted by glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering).
[0155] In particular, in the above embodiment, in the constant domain CL of the second and third Fab molecules of (ii) the amino acid at position 124 may be substituted by lysine (K) (Kabat numbering) and the amino acid at position 123 may be substituted by lysine (K) or arginine (R), in particular arginine (R) (Kabat numbering); and in the constant domain CHI of the second and third Fab molecules of (ii) the amino acid at position 147 may be substituted by glutamic acid (E) (Kabat EU index numbering) and the amino acid at position 213 may be substituted by glutamic acid (E) (Kabat EU index numbering).
[0156] In some embodiments, a first antigen-binding portion of a T cell bispecific antibody (which binds TYRP1 and CD3) comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14, or a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 15, and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the first antigen-binding portion comprises the heavy chain variable region sequence of SEQ ID NO: 14 or the heavy chain variable region sequence of SEQ ID NO: 15, and the light chain variable region sequence of SEQ ID NO: 19.
[0157] In some embodiments, the second and (if present) third antigen-binding portions of the T cell bispecific antibody (which binds TYRP1 and CD3) comprise a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 26 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 30. In some embodiments, the second and (if present) third antigen-binding portions comprise the heavy chain variable region of SEQ ID NO: 26 and the light chain variable region of SEQ ID NO: 30.
[0158] The Fc domain according to the above embodiment may comprise, either alone or in combination, all of the features described above in relation to the Fc domain.
[0159] In some aspects, the Fc domain of the T cell bispecific antibody (which binds TYRP1 and CD3) comprises a modification that promotes association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector function.
[0160] In some embodiments, the antigen binding portion and the Fc region are fused to each other by a peptide linker, particularly a peptide linker as described above.
[0161] In some embodiments, the T cell bispecific antibody (which binds TYRP1 and CD3) comprises a polypeptide (particularly two polypeptides) comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 33; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 31; a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 32; and a polypeptide comprising a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 34. In some embodiments, the T cell bispecific antibody (which binds TYRP1 and CD3) comprises a polypeptide (particularly two polypeptides) comprising the sequence of SEQ ID NO: 33, a polypeptide comprising the sequence of SEQ ID NO: 31, a polypeptide comprising the sequence of SEQ ID NO: 32, and a polypeptide comprising the sequence of SEQ ID NO: 34.
[0162] In a preferred embodiment, the T cell bispecific antibody (which binds TYRP1 and CD3) comprises a polypeptide (in particular two polypeptides) comprising a sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 33; a polypeptide comprising a sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 31; a polypeptide comprising a sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 32; and a polypeptide comprising a sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 35. In some embodiments, the T cell bispecific antibody (which binds TYRP1 and CD3) comprises a polypeptide (particularly two polypeptides) comprising the sequence of SEQ ID NO: 33, a polypeptide comprising the sequence of SEQ ID NO: 31, a polypeptide comprising the sequence of SEQ ID NO: 32, and a polypeptide comprising the sequence of SEQ ID NO: 35.
[0163] The following further describes PD-1 axis binding antagonists that can be used as immunotherapies in the present invention: In some embodiments, the immunotherapy comprises the administration of a PD-1 axis binding antagonist.
[0164] In some embodiments, the PD-1 axis binding antagonist is selected from the group consisting of a PD-1 binding antagonist, a PDL1 binding antagonist, and a PDL2 binding antagonist. In some embodiments, the PD-1 axis binding antagonist is a PD-1 binding antagonist. In some embodiments, the PD-1 binding antagonist inhibits the binding of PD-1 to its ligand binding partner. In some embodiments, the PD-1 binding antagonist inhibits the binding of PD-1 to PDL1. In some embodiments, the PD-1 binding antagonist inhibits the binding of PD-1 to PDL2. In some embodiments, the PD-1 binding antagonist inhibits the binding of PD-1 to both PDL1 and PDL2. In some embodiments, the PD-1 binding antagonist is an antibody. In some embodiments, the anti-PD-1 antibody is a monoclonal antibody. In some embodiments, the anti-PD-1 antibody is an antibody fragment selected from the group consisting of Fab, Fab'-SH, Fv, scFv, and (Fab')2 fragments. In some embodiments, the PD-1 binding antagonist is ipilimumab, nivolumab, pembrolizumab, pidilizumab, or AMP-224. In preferred embodiments, the PD-1 binding antagonist is ipilimumab, nivolumab, or pembrolizumab.
[0165] In some embodiments, the PD-1 axis binding antagonist is a PDL1 binding antagonist. In some embodiments, the PDL1 binding antagonist inhibits binding of PDL1 to PD-1. In some embodiments, the PDL1 binding antagonist inhibits binding of PDL1 to B7-1. In some embodiments, the PDL1 binding antagonist inhibits binding of PDL1 to both PD-1 and B7-1. In some embodiments, the PDL1 binding antagonist is an anti-PDL1 antibody. In some embodiments, the anti-PDL1 antibody is a monoclonal antibody. In some embodiments, the anti-PDL1 antibody is an antibody fragment selected from the group consisting of Fab, Fab'-SH, Fv, scFv, and (Fab')2 fragments. In some embodiments, the anti-PDL1 antibody is a humanized antibody or a human antibody. In some embodiments, the PDL1 binding antagonist is atezolizumab, durvalumab, or avelumab. In a preferred embodiment, the PDL1 binding antagonist is atezolizumab.
[0166] In some embodiments, the anti-PDL1 antibody comprises a heavy chain comprising the HVR-H1 sequence of SEQ ID NO: 72, the HVR-H2 sequence of SEQ ID NO: 73, and the HVR-H3 sequence of SEQ ID NO: 74; and a light chain comprising the HVR-L1 sequence of SEQ ID NO: 75, the HVR-L2 sequence of SEQ ID NO: 76, and the HVR-L3 sequence of SEQ ID NO: 77. In some embodiments, the anti-PDL1 antibody comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 78 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 79. In some embodiments, the anti-PDL1 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 80 and a light chain comprising the amino acid sequence of SEQ ID NO: 81.
[0167] In some embodiments, the PD-1 axis binding antagonist is a PDL2 binding antagonist. In some embodiments, the PDL2 binding antagonist is an antibody. In some embodiments, the anti-PDL2 antibody is a monoclonal antibody. In some embodiments, the anti-PDL2 antibody is an antibody fragment selected from the group consisting of Fab, Fab'-SH, Fv, scFv, and (Fab')2 fragments. In some embodiments, the PDL2 binding antagonist is an immunoadhesin.
[0168] In one embodiment, the cancer is selected from the group consisting of ovarian cancer, lung cancer, breast cancer, renal cancer, colorectal cancer, and endometrial cancer.
[0169] The following further describes adoptive cell transfer, which may be used as immunotherapy in the present invention: In some embodiments, immunotherapy comprises adoptive cell transfer.
[0170] In some embodiments, adoptive cell transfer involves administration of chimeric antigen receptor-expressing T cells (CAR T cells). Those skilled in the art will understand that a CAR is a type of antigen-targeting receptor composed of an intracellular T cell signaling domain fused to an extracellular tumor-binding moiety, most commonly a single-chain variable fragment (scFv) from a monoclonal antibody.
[0171] CARs directly recognize cell surface antigens independently of MHC-mediated presentation, enabling the use of a single receptor construct specific for any given antigen in every patient. Early CARs fused the antigen recognition domain to the CD3 activation chain of the T cell receptor (TCR) complex. While these first-generation CARs elicited T cell effector function in vitro, they were primarily limited by poor antitumor efficacy in vivo. Subsequent iterations of CARs included secondary costimulatory signals in parallel with CD3, including the intracellular domain derived from CD28 or various TNF receptor family molecules such as 4-1BB (CD137) and OX40 (CD134). Furthermore, third-generation receptors include two costimulatory signals in addition to CD3, most commonly those derived from CD28 and 4-1BB. Second- and third-generation CARs dramatically improved antitumor efficacy, in some cases inducing complete remissions in patients with advanced cancer. In one embodiment, a CAR T cell is an immunoresponsive cell that has been modified to express a CAR, which becomes activated upon binding of the CAR to its antigen.
[0172] In one embodiment, a CAR T cell is an immunoresponsive cell that comprises an antigen receptor, which is activated when the receptor binds to its antigen. In one embodiment, the CAR T cell used in the compositions and methods disclosed herein is a first generation CAR T cell. In another embodiment, the CAR T cell used in the compositions and methods disclosed herein is a second generation CAR T cell. In another embodiment, the CAR T cell used in the compositions and methods disclosed herein is a third generation CAR T cell. In another embodiment, the CAR T cell used in the compositions and methods disclosed herein is a fourth generation CAR T cell.
[0173] In some embodiments, adoptive cell transfer involves administering T cell receptor (TCR)-modified T cells. Those skilled in the art will appreciate that TCR-modified T cells can be produced by isolating T cells from tumor tissue and isolating their TCRα and TCRβ chains. These TCRα and TCRβ chains may then be cloned and transfected into T cells isolated from peripheral blood, resulting in tumor-recognizing T cells expressing TCRα and TCRβ. For example, T cells derived from OT-1 transgenic mice used in the Examples contain a transgenic T cell receptor engineered to recognize ovalbumin residues 257-264 in the context of H2Kb. Additional strategies aim to add or replace antigen specificity of the native TCR complex. Various approaches to accomplish this have been described. By adding an antibody variable domain to the CD3 epsilon domain of the TCR, a TCR complex with a second antigen specificity can be generated (Nolan et al., Clin. Cancer Res. (1999) 5:3928-3941; Baeuerle et al., Nat. Comms. (2019) 10:2087). This additional specificity can mediate peptide-human leukocyte antigen (pHLA)-independent T cell activation via the TCR complex. Another approach aims to replace the variable alpha and beta domains of the TCR with variable light and heavy domains from antibodies (Kuwana et al., Biochem. Biophys. Res. Commun. (1987) 149:960-968; Liu et al., Sci. Transl. Med. (2021) 13:1-16; Mansilla-Soto et al., Nat. Med. (2022) 28:345-352). This, combined with enzymatic knockout of the genes encoding the endogenous TCR alpha and beta chains, results in the loss of native T cell specificity and the acquisition of a desired new antigen specificity.
[0174] In some embodiments, adoptive cell transfer comprises administering tumor infiltrating lymphocytes (TILs). In some embodiments, adoptive cell transfer comprises administering chimeric antigen receptor (CAR)-modified NK cells. Those skilled in the art will understand that CAR-modified NK cells include NK cells isolated from a patient or commercially available NK cells engineered to express a CAR that recognizes a tumor-specific protein.
[0175] In some embodiments, adoptive cell transfer comprises administering dendritic cells.
[0176] Cancer vaccines that can be used as immunotherapies in the present invention are further described below.
[0177] In some embodiments, the immunotherapy comprises administration of a cancer vaccine.
[0178] Those skilled in the art will appreciate that a cancer vaccine exposes the immune system to cancer-specific antigens and adjuvants. In some embodiments, the cancer vaccine is selected from the group consisting of sipuleucel-T, GVAX, ADXS11-001, ADXS31-001, ADXS31-164, ALVAC-CEA vaccine, AC vaccine, talimogene laherparepvec, BiovaxID, Prostvac, CDX110, CDX1307, CDX1401, CimaVax-EGF, CV9104, DNDN, NeuVax, Ae-37, GRNVAC, tarmogens, GI-4000, GI-6207, GI-6301, Impact Therapy, IMA901, hepcortespenlisimut-L, Stimuvax, DCVax-L, DCVax-Direct, DCVax Prostate, CBLI, Cvac, RGSH4K, SCIB1, NCT01758328, and PVX-410.
[0179] As used herein, "treatment" (and its grammatical variants, e.g., "treat" or "treating") refers to clinical intervention in an attempt to alter the natural course of disease in the individual being treated, and can be carried out for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, attenuating the direct or indirect pathological consequences of disease, preventing metastasis, reducing the rate of disease progression, ameliorating or alleviating the condition, and remission or improved prognosis.
[0180] The term "cancer" refers to a physiological condition in mammals that is typically characterized by uncontrolled cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. Non-limiting examples of cancer include blood cancers such as leukemia, bladder cancer, brain cancer, head and neck cancer, pancreatic cancer, bile duct cancer, thyroid cancer, lung cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, endometrial cancer, esophageal cancer, colon cancer, colorectal cancer, rectal cancer, stomach cancer, prostate cancer, skin cancer, squamous cell carcinoma, sarcoma, bone cancer, and kidney cancer. Other cell proliferative disorders include, but are not limited to, neoplasms located in the abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal glands, parathyroid glands, pituitary gland, testes, ovaries, thymus, thyroid), eye, head and neck, nervous system (central and peripheral), lymphatic system, pelvis, skin, soft tissue, spleen, chest, and genitourinary system. Precancerous conditions or lesions and cancer metastases are also included.
[0181] In some embodiments, the cancer is a cancer that expresses a target cell antigen of the T cell bispecific antibody.
[0182] In some embodiments, the cancer is a carcinoembryonic antigen (CEA)-expressing cancer (particularly in embodiments where the target cell antigen of the T cell bispecific antibody is CEA). "CEA-positive cancer" or "CEA-expressing cancer" refers to a cancer characterized by expression or overexpression of CEA in cancer cells. CEA expression can be determined, for example, by immunohistochemistry (IHC) or flow cytometry assays. In some embodiments, the cancer expresses CEA. In some embodiments, the cancer expresses CEA in at least 20%, preferably at least 50% or at least 80% of tumor cells, as determined by immunohistochemistry (IHC) using an antibody specific for CEA.
[0183] In some aspects, the cancer is colon cancer, lung cancer, ovarian cancer, gastric cancer, bladder cancer, pancreatic cancer, endometrial cancer, breast cancer, kidney cancer, esophageal cancer, prostate cancer, or any other cancer described herein.
[0184] In certain embodiments, the cancer is a cancer selected from the group consisting of colorectal cancer, lung cancer, pancreatic cancer, breast cancer, and gastric cancer. In preferred embodiments, the cancer is colorectal cancer (CRC). In some embodiments, the colorectal cancer is metastatic colorectal cancer (mCRC). In some embodiments, the colorectal cancer is microsatellite stable (MSS) colorectal cancer. In some embodiments, the colorectal cancer is microsatellite stable metastatic colorectal cancer (MSS mCRC).
[0185] In some embodiments, the cancer is a Tyrp1-expressing cancer (particularly in embodiments in which the target cell antigen of the T cell bispecific antibody is Tyrp1). "Tyrp1-positive cancer" or "Tyrp1-expressing cancer" refers to a cancer characterized by expression or overexpression of Tyrp1 in cancer cells. Tyrp1 expression can be determined, for example, by quantitative real-time PCR (measuring Tyrp1 mRNA levels), flow cytometry, immunohistochemistry (IHC), or Western blot assay. In some embodiments, the cancer expresses Tyrp1. In some embodiments, the cancer expresses Tyrp1 in at least 20%, preferably at least 50% or at least 80% of tumor cells, as determined by immunohistochemistry (IHC) using an antibody specific for Tyrp1. In some embodiments, the cancer is selected from the group consisting of kidney cancer, bladder cancer, skin cancer, lung cancer, colorectal cancer, breast cancer, brain cancer, head and neck cancer, and prostate cancer.
[0186] In some embodiments, the cancer is an EpCAM-expressing cancer (particularly in embodiments in which the target cell antigen of the T cell bispecific antibody is EpCAM). "EpCAM-positive cancer" or "EpCAM-expressing cancer" refers to a cancer characterized by expression or overexpression of EpCAM in cancer cells. EpCAM expression can be determined, for example, by quantitative real-time PCR (measuring EpCAM mRNA levels), flow cytometry, immunohistochemistry (IHC), or Western blot assay. In some embodiments, the cancer expresses EpCAM. In some embodiments, the cancer expresses EpCAM in at least 20%, preferably at least 50% or at least 80% of tumor cells, as determined by immunohistochemistry (IHC) using an antibody specific for EpCAM. In some embodiments, the cancer is selected from the group consisting of colorectal cancer, breast cancer, gastric cancer, prostate cancer, ovarian cancer, and lung cancer.
[0187] In some embodiments, the cancer is a solid tumor cancer. "Solid tumor cancer" refers to a malignant tumor that forms a discrete tumor mass (including tumor metastases) in a specific location within a patient's body, such as a sarcoma or carcinoma (as opposed to, for example, blood cancers such as leukemia, which do not generally form solid tumors). Non-limiting examples of solid tumor cancers include bladder cancer, brain cancer, head and neck cancer, pancreatic cancer, lung cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, endometrial cancer, esophageal cancer, colon cancer, colorectal cancer, rectal cancer, stomach cancer, prostate cancer, skin cancer, squamous cell carcinoma, bone cancer, liver cancer, and kidney cancer. Other solid tumor cancers contemplated in the context of the present invention include, but are not limited to, tumors located in the abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal glands, parathyroid glands, pituitary gland, testes, ovaries, thymus, thyroid), eye, head and neck, nervous system (central and peripheral), lymphatic system, pelvis, skin, soft tissue, muscle, spleen, thoracic region, and genitourinary system. Precancerous conditions or lesions and cancer metastases are also included.
[0188] An "individual" or "subject" herein is a mammal. Mammals include, but are not limited to, livestock animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In some aspects, an individual or subject is human. In some aspects, an individual has a disease, particularly a disease that is treatable or to be treated by immunotherapy. In some aspects, an individual has cancer, particularly a cancer that is treatable or to be treated by immunotherapy. In particular, an individual herein is any single human subject who is experiencing or has experienced one or more signs, symptoms, or other indicators of cancer and is eligible for treatment. In some aspects, an individual has cancer or has been diagnosed with cancer, particularly any of the cancers listed above. In some aspects, an individual has locally advanced or metastatic cancer or has been diagnosed with locally advanced or metastatic cancer. The individual may or may not have been previously treated with immunotherapy or another drug. In certain embodiments, the patient has not been previously treated with immunotherapy. The patient may have been treated with a therapy including one or more drugs other than immunotherapy before immunotherapy is initiated.
[0189] Preferably, the T cells according to any of the embodiments of the present invention are cytotoxic T cells. In some embodiments, the T cells are CD4 + or CD8 + In some embodiments, the T cells are CD4 + T cells.
[0190] In some aspects, treatment with or administration of immunotherapy may result in a response in an individual. In some aspects, the response may be a complete remission. In some aspects, the response may be a sustained response after cessation of treatment. In some aspects, the response may be a complete remission that is sustained after cessation of treatment. In other aspects, the response may be a partial remission. In some aspects, the response may be a partial remission that is sustained after cessation of treatment. In some aspects, treatment or administration with immunotherapy and a UAP1 inhibitor may improve the response compared to treatment or administration with immunotherapy alone (i.e., without the UAP1 inhibitor). In some aspects, treatment or administration with immunotherapy and a UAP1 inhibitor may increase the response rate in a patient population compared to a corresponding patient population treated with immunotherapy alone (i.e., without the UAP1 inhibitor).
[0191] The combination of the present invention can be used alone or in combination with other drugs for treatment. For example, immunotherapy can be co-administered with at least one additional therapeutic agent. In some embodiments, the additional therapeutic agent is an anti-cancer agent, such as a chemotherapeutic agent, an inhibitor of tumor cell proliferation, or an activator of tumor cell apoptosis.
[0192] TIFF2025538347000002.tif248170TIFF2025538347000003.tif254170TIFF2025538347 000004.tif253170TIFF2025538347000005.tif253170TIFF2025538347000006.tif25417 0TIFF2025538347000007.tif253170TIFF2025538347000008.tif253170TIFF2025538347 000009.tif254170TIFF2025538347000010.tif254170TIFF2025538347000011.tif79170 [Brief explanation of the drawings]
[0193] [Figure 1A]CRISPR / Cas9 screening for novel immunomodulatory targets. Schematic of the screening process. [Figure 1B] CRISPR / Cas9 screening of novel immunomodulatory targets. Volcano plot showing enrichment (LogFC>1) and depletion (LogFC<-1) in CEA TCB versus DP47 control TCB. Significant hits: P-value <0.05. [Figure 2A-2B] Validation of UAP1 knockout. (2A) Western blot samples from MKN45 wt and UAP1 knockout cells were probed for UAP1 expression and vinculin as a loading control. (2B) LC-MS analysis of UDP-HExNAc levels in MKN45 wt and UAP1 knockout cells. Graphs show mean ± SEM. P values were calculated using a two-tailed unpaired Student's t-test. *P<0.05, **P<0.01. [Figure 3A-3B] Tumor-specific UAP1 regulates TCB-mediated cytotoxicity in vitro. T cell-mediated killing assay. (3A) MKN45 and CEA-TCB and (3B) MKN45 and EpCAM-TCB were used to measure the number of tumor cells in incucytes over time using UAP1 knockout and wild-type cells. Graphs show mean ± SEM. P values were calculated using a two-tailed Student's t-test. *P<0.05, **P<0.01. [Figure 3C-3D] Tumor-specific UAP1 regulates TCB-mediated cytotoxicity in vitro. T cell-mediated killing assay. (3C) A549 and CEA-TCB, and (3D) B16F10 and Tyrp1-TCB, were used to measure tumor cell numbers over time in incucytes using UAP1 knockout and wild-type cells. Graphs show mean ± SEM. P values were calculated using a two-tailed Student's t-test. *P<0.05, **P<0.01. [Figure 4]Tumor-specific UAP1 regulates antigen-specific T cell-mediated cytotoxicity in vitro. Antigen-specific T cell-mediated tumor cell killing. B16F10 wt cells and UAP1 KO cells were pulsed with SIINFEKL peptide and co-cultured with OT-1 T cells. The time course of tumor cell numbers acquired using an Incucyte instrument is shown. Graphs show mean ± SEM. P values were calculated using a two-tailed Student's t-test. *P<0.05, **P<0.01. [Figures 5A-5C] UAP1 expression in cancer cells affects T cell activation. Figure 5 shows the activation status of T cells after co-culture with tumor cells at a range of TCB concentrations. T cells co-cultured with (5A) MKN45 and CEA TCB, (5B) MKN45 and EPCAM TCB, and (5C) A549 and CEA TCB were analyzed by FACS for CD25 and CD69 expression. Graphs show mean ± SEM. P values were calculated using a two-tailed Student's t-test. *P<0.05, **P<0.01. [Figure 6] UAP1 expression in cancer cells affects T cell proliferation. T cell proliferation after co-culture of T cells with tumor cells in the presence of TCB. MKN45 wt cells and UAP1 KO cells were co-cultured with CFSE-labeled T cells in the presence of CEA TCB. CFSE fluorescence intensity was measured by FACS as a surrogate indicator of proliferation. [Figure 7A-7C] UAP1 deletion sensitizes B16F10 tumors to immunotherapy. (7A) Tumor volumes of B16F10 wt and UAP1-deficient cells treated with either vehicle control or Tyrp1 TCB in C57BL / 6 immunodeficient mice. Tumor volumes were measured every 2 days with a caliper. n = 10 mice per group. (7B) Ratio of tumor volume over time between TCB-treated and vehicle control groups for both B16F10 wt and UAP1 tumors. Two-way ANOVA statistical analysis was performed using Graphpad Prism software. [Figures 8A-8E]UAP1 deletion sensitizes MKN45 tumors to immunotherapy. (8A) Tumor growth curves of MKN45 wt and UAP1 KO cells in stem cell-humanized NSG mice (huNSG). Animals were administered either vehicle control, 0.2 mg / kg CEA-TCB, or 0.4 mg / kg CEA-TCB. The first administration was on day 15, as indicated. Tumor volumes were measured with calipers. Mice per group (n = 10). (8B) Tumor volume ratios between the TCB-treated and vehicle control groups at each time point after the first TCB treatment. (8C) Tumor growth curves for individual mice. Two-way ANOVA statistical analysis was performed using Graphpad Prism software. [Figure 9A] Inhibition of UAP1 by Ac4Glc2Bz in tumor cells ameliorates T cell-mediated killing and T cell activation. Detection of UDP-HexNAc in MKN45 cell lysates after 2 hours of treatment with Ac4Glc2Bz. [Figure 9B-9E] Inhibition of UAP1 by Ac4Glc2Bz in tumor cells improves T cell-mediated killing and T cell activation. (9B) MKN45 cells were pretreated with the indicated concentrations of Ac4Glc2Bz for 2 hours. The compound was then removed from the culture medium, and T cells were added with the indicated concentrations of TCB. The graph shows the survival rate of tumor cells after 105 hours of co-culture. DP47 TCB was used as a negative control. (9C) Flow cytometry of CD3+ T cells obtained from the experiment in (B). T cell activation was assessed by flow cytometry as previously described. [Figures 10A-10B]Rescue experiment. (10A) Real-time live cell microscopy for assessment of T cell-mediated killing. Three UAP1 isoforms were reintroduced into the A549-hCEA-NLR UAP1 KO clone. Tumor cells were then cocultured with PBMCs from healthy donors in the presence of the indicated concentrations of civisatamab and incubated in an Incucyte instrument. Specific lysis was calculated by counting the residual red fluorescence intensity from tumor cells and then normalizing it to the DP47 control TCB. Wild-type and UAP1 KO cells were used as reference controls. (10B) Coculture of tumor cells and T cells was performed as in (A). After 5 days of culture, T cell activation was assessed by FACS by measuring the percentage of CD25 and / or CD69 in CD3+ T cells. Graphs show mean ± SEM. P values were calculated using a two-tailed Student's t-test. *P<0.05, **P<0.01. [Figures 11A-11C] Cytokine detection assay. MKN45-NLR wt or UAP1 KO were co-cultured in the presence of different concentrations of civisatamab. After 72 hours, the indicated cytokines were measured by ELISA. [Figures 12A-12B] On day 32 after tumor injection, scouts were collected for analysis of intratumoral T cell activation markers. Increased expression of Tim3, a T cell activation / exhaustion marker, was observed in CD8+ and CD4+ T cells from UAP1 KO-implanted mice but not in wild-type mice. Data were obtained using flow cytometry. P values were calculated using a two-tailed Student's t-test. *P<0.05, **P<0.01. [Figure 13A] KPC WT or UAP1 KO tumor cells were implanted into the intramammary fat pad of immunocompetent C57BL / 6 mice. Tumor volume was measured three times weekly with a vernier caliper (n = 10 / group). [Figure 13B] Growth curve of a single mouse, compared with (13A). [Figures 13C-13D](13C) Statistical analysis for (13A). Bar graphs show TGI on day 38. P values were calculated using Dunn's test. (13D) 42 days after tumor injection, scouts were collected to measure intratumoral abundance of CD8+ and CD4+ T cells. Data were obtained using flow cytometry and normalized to tumor weight. [Figure 13E] Tumor growth curves of KPC wt cells or UAP1 KO tumor cells injected subcutaneously into the flank of NSG mice (n=6). Data show mean ± SEM. [Figure 14] Partial UAP1 KO results in massive hyaluronic acid (HA) depletion in tumor cells. HA levels in MKN45 wt cells or UAP1 KO tumor cells were measured by ELISA. Representative data from two independent experiments. Graphs show mean ± SEM. P values were calculated using a two-tailed Student's t-test. *P<0.05, **P<0.01. [Figures 15A-15B] UAP1 KO does not impair T cell function. (15A) T cells were polyclonally activated and subsequently electroporated with UAP1-specific gRNA:rCas9 RNP. KO efficiency was assessed by flow cytometry as previously described. (15B) Wild-type or UAP1 KO T cells were used as effectors in T cell-mediated killing assays using MKN45-NLR as target cells and different concentrations of civisatamab as indicated. Data were measured using real-time live cell imaging and normalized to the DP47 control TCB. [Figure 15C] UAP1 KO does not impair T cell function. Wt T cells or UAP1 KO T cells were cocultured as in (15A), and CD25 and CD69 expression was assessed by flow cytometry. [Figure 15D] UAP1 KO does not impair T cell function. Wild-type or UAP1 KO T cells were activated with Dynabeads at different bead:T cell ratios. T cell activation (CD25+ and / or CD69+) was then measured by flow cytometry. [Example]
[0194] The following are examples of methods and compositions of the present invention. Given the general description provided above, it will be understood that various other embodiments may be practiced.
[0195] Example 1. Method 1.1 CRISPR / Cas9 screening for novel cancer immunotherapy targets The human gastric adenocarcinoma cell line MKN45 was transduced with lentiviral particles (Cellecta- Cat. n. SVC9-PS) encoding the Staphylococcus aureus Cas9 gene and selected with 5 μg / ml blasticidin at a multiplicity of infection (MOI) of 3. After selection, the cells were transduced with a three-module single-guide (sg) RNA library (Cat. n. KOHGW-M1, KOHGW-M2, and KOHGW-M3) at an MOI of 0.3. The cells were selected with 0.5 μg / ml puromycin for one week. Next, tumor cells were co-cultured with three different PBMCs from healthy donors in the presence of either CEA TCB (final concentration = 400 pM), CEA TCB (final concentration = 10 pM), or DP47 negative control TCB (final concentration = 400 pM). Library coverage on the day of co-culture setup was 200x, and experiments were performed with biological replicates. After 72 hours of incubation at 37°C and 5% CO2, T cells were removed and tumor cells were harvested for DNA isolation. Genomic DNA was isolated using NucleoBond AXG 500 columns (Macherey-Nagel). Samples were then subjected to two rounds of PCR using the NGS Prep Kit for sgRNA Libraries for pRSG16 / 17 (KOHGW-Cellecta-Cat.n.LNGS 120). Samples were sequenced on an Illumina HiSeq4000 sequencer using dual indexing according to the manufacturer's instructions.
[0196] Data analysis was performed as follows. Demultiplexed reads were mapped to the gRNA library using STAR (v2.7.9a) with zero mismatches, and the number of sgRNAs was estimated from the bam file using Samtools. Counts were filtered and normalized using quantile normalization (using all sgRNAs, regardless of whether they were control or targeting). Count matrices were compared between conditions for three comparisons: CEA TCB vs. DP47 control TCB and CEA TCB vs. DP47 control TCB. Fold changes for each gene and gRNA were calculated using MAGeCK (Lit et al. 2015). Traditional differential gene expression analysis (voom-limma approach, Law et al. 2014) applied to sgRNA counts was performed in combination with enrichment tests (Ritchie et al. 2016) to aggregate gene-level p-values. Significantly depleted and enriched genes were reported at p-value thresholds of <0.05 and absolute logFC >1.
[0197] 1.2.1 Generation of UAP1 knockout (KO) cells: UAP1 knockout cells were generated by electroplating ribonucleoprotein (RNP) complexes of recombinant Cas9 and UAP1-specific gRNA using a 4D-Nucleofector (Lonza). For tumor cells, 200,000 MKN45 or A549hCEA cells were dissolved in 20 μl of SF solution (Lonza) and incubated with 10 μg of Cas9 (TrueCut - Thermo Scientific) and 300 pmol of RNP composed of a 1:1 UAP1-specific tracrRNA (Alt-R® CRISPR-Cas9 tracrRNA:crRNA(ACGAACCCTACAGAACCAGTTGG) complex. Cells were then nucleofected using the DS137 nucleofection program according to the manufacturer's instructions and incubated for at least 72 hours to ensure successful protein knockout. UAP1 knockout in T cells was achieved by preactivating healthy donor T cells with CD3 / 28 / 2 tetramer (Stemcell) for 24 hours, followed by transfection of 4 × 10 T cells with 20 μl of P3 solution (Lonza) and nucleofection program EO115. 6 The cells were nucleofected in the same manner as described above. B16 mouse melanoma cells were nucleofected using UAP1-mouse cRNA (GAAAAGGTGGACGCACGAA) and the nucleofection program EN138, just like human tumor cells.
[0198] 1.2.2 Generation of isoform-specific overexpressing cell lines Single-cell clones were obtained from A549hCEA UAP1 KO cells, and one complete UAP1 KO clone was then selected for reintroduction of different UAP1 isoforms: AGX1, AGX2, or isoform 3. Isoform reintroduction was achieved by viral transduction.
[0199] 1.3 Western blot 3×10 6MKN45 wt or UAP1 KO cells were harvested, and the cell pellet was lysed in one volume of RIPA buffer containing protease inhibitors (Roche, Cat. n. 04693132001) for 20 min at 4 °C. The cell lysate was then spun down at 10,000 × g for 15 min at 4 °C. The supernatant was collected in a new vial, and the protein concentration was measured by BCA assay (Thermo Scientific, Cat. n. 23225). 30 μg of protein lysate was loaded onto a 4-20% precast protein gel (Biorad, Cat. n. 4561094) and run by SDS-PAGE electrophoresis (Biorad). Proteins were then transferred to a PVDF membrane using a Trans-Blot Turbo Transfer System (Biorad, Cat. n. 17001919). The following primary antibodies were used for blotting: anti-human UAP1 antibody (Sigma-Aldrich, Cat. n. HPA0146459), anti-vinculin antibody (CST, Cat. n. 18799S), and anti-rabbit IgG, HRP-conjugated antibody (CST, Cat. n. 7074). Membranes were incubated with Clarity Western ECL Substrate (Biorad, Cat. n. 1705060) and imaged using a Gel Doc XR+ (Biorad).
[0200] 1.4 Detection of UDP-HexNAc by LC-MS Preparation of standard solutions: For the preparation of calibration samples, uridine-5'-diphospho-N-acetylglucosamine sodium salt was dissolved in an 80 / 20 mixture of water / methanol (v / v) to a concentration of 1.00 mg / ml. A stock solution for quality control (QC) sample preparation was prepared separately by weighing the reference material separately and diluting it with water. For calibration and quality control samples, phosphate-buffered saline (PBS) spiked with uridine-5'-diphospho-N-acetylglucosamine (UDP-HExNAc) at eight and three different concentrations, respectively, was used. Two different calibration ranges were applied. In the high calibration range, concentrations ranged from 100 to 50,000 ng / mL (calibration samples: 100, 200, 500, 2500, 12,500, 25,000, 37,500, and 50,000 ng / mL; QC samples: 300, 2500, and 37,500 ng / mL). In the low calibration range, concentrations ranged from 5.00 to 5,000 ng / mL (calibration samples: 5.00, 10.0, 25.0, 100, 500, 2500, 3750, and 5000 ng / mL; QC samples: 15.0, 2500, and 3750 ng / mL).
[0201] Sample preparation: The dried cell pellet was reconstituted by adding 500 L of PBS, followed by sonication for 5 min. After centrifugation at 4000 g and 8°C for 10 min, the supernatant was collected.
[0202] Sample processing in the high calibration range: To 20.0 L of supernatant or calibration / QC sample aliquots, 200 L of acetonitrile containing an internal standard (guanosine-5-diphosphoglucose, 250 ng / mL) was added. After vortex mixing for a few seconds, the samples were centrifuged at 30,000 g and 8°C for 10 minutes. A 200 L aliquot of the supernatant was transferred to an autosampler vial and diluted with 200 L of water. During analysis, the samples were stored in the autosampler tray at 8°C. A 5 L aliquot of the sample was injected into the HPLC-MS / MS system.
[0203] Sample processing in the low calibration range (Batch-4): To a 20.0 L aliquot of the supernatant or calibration / QC sample, 100 L of acetonitrile containing an internal standard (guanosine-5-diphosphoglucose, 10.0 ng / mL) was added. After vortex mixing for a few seconds, the sample was centrifuged at 30,000 g for 10 minutes at 8°C. A 100 L aliquot of the supernatant was transferred to an autosampler vial. The samples were stored in the autosampler tray at 8°C during analysis. A 50 L aliquot of the sample was injected into the HPLC-MS / MS system.
[0204] Liquid chromatography and column exchange: For the high calibration range, the method was as follows. HPLC was performed using a binary Agilent 1290 pump (Agilent Technologies Inc., Santa Clara, CA, USA) and a PAL autosampler (CTC Analytics, Zwingen, Switzerland) equipped with a cooling stack. The mobile phase used for analytical separation consisted of water containing 10 mM ammonium acetate and 0.5% formic acid (solvent A) and acetonitrile / 2-propanol 80 / 20 (v / v) containing 0.5% formic acid (solvent B). A HILIC column (HILICON iHilic Fusion, 5 m, 20 × 2.1 mm) maintained at 40 °C was equilibrated with 95% solvent B at a flow rate of 0.5 mL / min. The linear gradient increased from 95% B after 0.5 min to 25% B within 1.5 min and maintained at 25% B for 0.2 min. The linear gradient was increased to 5% B within 0.1 min and held for 1.7 min. The column was re-equilibrated with 95% solvent B from run time 4.1 min to 5 min.
[0205] In the low calibration range, the method was as follows. Two-dimensional HPLC was performed using binary Agilent 1200 and Agilent 1290 pumps (Agilent Technologies Inc., Santa Clara, CA, USA) and a PAL autosampler (CTC Analytics, Zwingen, Switzerland) equipped with a switching valve and cooling stack. The Agilent 1200 binary pump was used for trapping. The mobile phase used for trapping consisted of water containing 10 mM ammonium acetate and 0.5% formic acid (solvent A) and acetonitrile / 2-propanol 80 / 20 (v / v) containing 0.5% formic acid (solvent B). The sample was loaded onto the trapping column for 0.5 min using a flow rate of 1.0 mL / min and 100% solvent B. The trapping column was switched to analytical flow after 0.5 min. After 3 min, the trapping column was switched to trapping flow for cleaning.
[0206] The binary mobile phase used for analytical separation consisted of water containing 10 mM ammonium acetate and 0.5% formic acid (solvent A) and acetonitrile / 2-propanol 80 / 20 (v / v) containing 0.5% formic acid (solvent B). A HILIC column (HILICON iHilic Fusion, 5 m, 20 × 2.1 mm) maintained at 40 °C was equilibrated with 95% solvent B at a flow rate of 0.5 mL / min. The linear gradient increased from 95% B after 0.5 min to 25% B within 1.5 min and maintained at 25% B for 0.2 min. The linear gradient increased to 5% B within 0.1 min and held for 1.7 min. The column was re-equilibrated with 95% solvent B from 4.1 min to 5 min of run time.
[0207] Mass spectrometry: Quantitation was performed using a Sciex Triple Quad 6500+ instrument (AB Sciex, Concord, Canada) equipped with a Turbo V source operating in positive ion mode. The source temperature was set at 300 °C, and a spray voltage of 5500 V was used. The mass transitions were 608.1 m / z to 204.0 m / z for UDP-HexNAc and 606.1 m / z to 152.2 m / z for the internal standard GDP-glucose.
[0208] material: Acetonitrile, methanol, and 2-propanol were purchased from Fisher Scientific Ltd. (Loughborough, UK). Uridine-5'-diphospho-N-acetylglucosamine sodium salt, guanosine-5-diphosphoglucose, formic acid, and phosphate-buffered saline were purchased from Sigma-Aldrich GmbH, Buchs, Switzerland.
[0209] Protein concentration determination: Protein concentrations were quantified spectrophotometrically after staining with bicinchoninic acid (BCA). A calibration curve was constructed using bovine serum albumin (BSA, Pierce, Illinois, USA) in the range of 50.0 to 2000 μg / mL in PBS (Sigma-Aldrich GmbH, Buchs, Switzerland).
[0210] In a 96-well microtiter plate, 10 μL aliquots of supernatant or calibration / QC samples were mixed with 80 μL of BCA working reagent, prepared by mixing 50 parts reagent A and 1 part reagent B (BCA Kit, Pierce, Illinois, USA). After 30 minutes of incubation at 37°C, absorbance at 562 nm was measured using a Spectramax i3 (Molecular Devices, CA, USA). A standard curve was constructed by plotting calibrator absorbance versus concentration using a four-parameter fit. The concentrations of unknown samples were determined by interpolating the absorbance onto the calibration curve. Evaluation was performed using Softmax Pro GxP (Molecular Devices, CA, USA).
[0211] 1.5 T cell-mediated killing assay 25,000 MKN45-nuclight red (NLR), 20,000 A549-hCEA, and 10,000 B16F10-NLR tumor cells (wt or UAP1 ko) were seeded in one well of a 96-well plate. TCB or siinfekl was then administered at the indicated concentrations. Pan T cells, PBMCs, or mouse splenocytes (derived from C57 / BL6 or OT-I mice) were immediately added at the indicated E:T ratio. Cultures were incubated for the indicated times in an Incucye S3 instrument (Sartorius) at 37°C and 5% CO2. Images were acquired every 3 hours. For MKN45-NLR and B16F10-NLR, T cell-mediated killing was calculated based on the red fluorescent signal from the tumor cells. All values were first converted to fold change relative to time 0, and % specific lysis was calculated as follows: 100 - [(red fluorescence count TCB / red fluorescence count control TCB) x 100].
[0212] For A549-hCEA, Cytotox-Green reagent (Sartorius) was added to the coculture at a 1:16,000 dilution, and T cell-mediated killing was assessed by measuring the green fluorescence count in each well. All values were first converted to fold changes relative to time 0, and then the normalized green signal % was calculated as follows: [(green fluorescence count TCB / green fluorescence count control TCB) × 100]. For antigen-specific experiments, B16F10-NLR wt cells and UAP1 KO cells were pulsed with SIINFEKL peptide and cocultured with OT-1 T cells. T cell-mediated killing was measured as described above.
[0213] 1.6 Flow cytometry T cell-mediated killing assays were performed as described above. At the end of the experiment, T cells were harvested from the co-culture plates and subjected to immunofluorescence analysis for the following markers: CD3, CD8, CD25, CD69, and Near-IR live / dead staining (Thermo Scientific). Live cells were stained with CD3 + Gating was performed on cells, and the % activated cells was calculated as follows: 100 - (% CD25 + +% CD69 + For proliferation assays, T cells were prestained with CFSE (Biolegend) according to the manufacturer's instructions and then used in T cell-mediated killing assays with either MKN45-NLR wt cells or MKN45-NLR KO cells for 4 days. Cells were then harvested and CFSE was assessed by FACS.
[0214] 1.7 In vivo testing animal: Immunodeficient mice C57BL / 6J and NOD.Cg-PrkdcscidIL-2rgtm1Wjl / SzJ (NSG) were obtained from Charles River Laboratories. All animal experiments were conducted under Swiss government ethical approval and regulations (license ZH183 / 2020) in accordance with international FELASA and national GV-Solas and TierSchG guidelines, respectively. After arrival, animals were maintained for one week to acclimate to their new environment and for observation. Mice were maintained under specific pathogen-free conditions with a daily cycle of 12 h light / 12 h dark. Continuous health monitoring was performed daily. Mice were housed under standardized conditions with free access to water and food. For humanization, NSG mice were injected with busulfan (15 mg / kg), and 24 h later, human CD34+ cord blood cells (1 × 10 per mouse) were injected as previously described. 5 Prior to tumor cell inoculation, humanized mice were screened for human T cell frequency by flow cytometry, and only mice with >20% huCD45+ cells were randomly assigned to different treatment groups.
[0215] Study design: B16F10, MKN45 wtl, and UAP1 KO cells were trypsinized, washed, and resuspended in a total volume of 100 μl using a 1:1 mixture of tissue culture medium and Matrigel. B16F10 cells (0.5 × 10 6 ) and MKN45 (1 × 10 6) cells were injected subcutaneously into the flanks of mice. Tumors were measured twice weekly, and tumor volume (mm3) was calculated using the formula 0.5 × length × width. MKN45 tumor-bearing mice with tumor sizes of 100–200 mm3 were randomly assigned to four groups: 1) NSG (n = 6), 2) vehicle-injected intravenously (iv) humanized mouse huNSG (n = 11), and 3–4) weekly intravenously injected with 0.2 mg / kg and 0.4 mg / kg CEA-TCB (iv) huNSG (n = 12). B16F10 tumor-bearing mice with tumors measuring 100–150 mm3 were randomly assigned to three groups: 1) NSG (n = 6), 2) vehicle-injected intravenously (iv) C57BL / 6J (n = 10), and 3) Tyrp1-TCB 5 mg / kg intravenously injected weekly (iv) C57BL / 6J (n = 10).
[0216] All mice were injected intravenously with 200 μl of the appropriate solution: Mice in the vehicle group were injected iv with histidine buffer (20 mM histidine, 140 mM NaCl, pH 6.0), and mice in the treatment group were injected with antibody diluted in histidine buffer to a volume of 200 μl.
[0217] In some cases, KPC (0.3×10 6 ) wt and KO cells were injected into the intramammary fat pad of C57 / BL6 mice, similar to that described above for B16F10 and MKN45 cells.
[0218] Statistical analysis: Results were expressed as mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism software v.7.04 (GraphPad Software Inc.). Two-way analysis of variance was used. A P value of less than 0.05 was considered statistically significant.
[0219] The tumor growth inhibition rate (TGI) for each group and each time point was calculated as follows: 100 - Mean(TV Treatment [Day.x] - TV Treatment [Baseline]) / Mean(TV Reference [Day.x] - TV Reference [Baseline]).
[0220] Example 2. Cancer immunotherapy CRISPR screening in tumor cells To identify mechanisms underlying cancer cell resistance to immune cell attack, an immunotherapy-related knockout CRISPR screen was established (Figure 1). Briefly, the human gastric adenocarcinoma cell line MKN45 was transfected with Cas9 and a genome-wide library of sgRNAs. Selected cells were cocultured with isolated PBMCs from healthy donors for 4 days in the presence of a T cell-inducing antibody targeting the tumor antigen CEACAM5 or a mock control antibody. After this period, T cells were washed out, and the remaining tumor cells were harvested for DNA isolation. The composition of sgRNAs remaining in the cell pool was detected by next-generation sequencing. sgRNAs that were significantly reduced in the civisatamab (CEA TCB)-treated group compared to the control TCB antibody were followed in dedicated validation experiments. UAP1 was identified as one of the top hits from this screen.
[0221] Example 3. Creation and validation of knockout in vitro models To validate UAP1, MKN45-NLR cells were subjected to UAP1 KO as described above. Knockout was confirmed at the protein level (Figure 2A) and by a decrease in the enzyme product UDP-HexNAc in cell lysates (Figure 2B). The KO cell line was then subjected to the same killing assay conditions described for screening. MKN45 cells lacking UAP1 were killed more efficiently compared to wt cells, suggesting that they were more sensitive to TCB-mediated T cell cytotoxicity (Figure 3A). The same effect was observed when a TCB targeting EpCAM instead of CEACAM5 was used (Figure 3B). The same phenotype was obtained when the cell line was switched to the human lung adenocarcinoma cell line A549. A549 UAP1 KO cells were killed more efficiently than A549 wt cells in a CEA-TCB-dependent manner (Figure 3C). Consistent with this result, UAP1-deficient mouse B16F10 melanoma cells were more efficiently killed by T cells when engaged with Tyrp1-TCB compared to B16F10 wt cells (Figure 3D). The B16F10 model mimics the intrinsic immune response of T cells to immunogenic antigens in the context of MHC-I and can be used in an antigen-specific setting. B16F10 cells (UAP1-deficient or wt) were pulsed with the model antigen peptide SIINFEKL and cocultured with T cells from OT-1 transgenic mice. These T cells possess a transgenic T cell receptor that recognizes the H2kb-SIINFEKL complex. Similar to the TCB-mediated killing assay, UAP1-deficient cells were more susceptible to T cell cytotoxicity (Figure 4).
[0222] Next, we evaluated the activation status of T cells cocultured with wild-type or UAP1-KO cells. T cells cocultured with UAP1-KO cancer cells expressed higher levels of the early activation markers CD25 and CD69 compared with wild-type T cells at similar TCB concentrations in all three cell lines tested (Figure 5A-C). Consistent with these results, T cells cocultured with UAP1-KO cells showed higher proliferation rates than wild-type T cells (Figure 6).
[0223] Furthermore, T cells co-cultured with UAP1 KO were found to secrete greater amounts of IFN-γ, TNF-α, and granzyme B (FIG. 16).
[0224] These data suggest that UAP1 expression in cancer cells functions as a resistance mechanism to anti-cancer immune responses elicited by either T cell-induced antibodies or endogenous immune responses.
[0225] Example 4. Verification in tumor-bearing animal models Next, we investigated the role of UAP1 in the TCB-induced immune response in a tumor-bearing mouse model. First, we implanted wild-type or UAP1-deficient B16F10 melanoma cells into C57BL / 6 mice and administered either vehicle control or TCB targeting the melanoma antigen Tyrp1. Tumor volume was monitored over time. B16F10 UAP1 KO cells grew significantly slower than the vehicle group compared with wild-type cells (Figure 7A). The ratio of tumor volume treated with TCB to that treated with vehicle was significantly reduced in UAP1 KO cells compared with wild-type cells (Figure 7B).
[0226] Stem cell-humanized mouse models offer a clear way to mimic parts of the human immune system in a living model organism. Briefly, bone marrow-depleted NSG mice were transplanted with hematopoietic stem cells derived from umbilical cord blood. The transplanted stem cells reconstituted the bone marrow and developed into human T and B cells. Combining humanized mice with a xenograft of the human gastric adenocarcinoma cell line MKN45 provides a model to test the effect of UAP1 expression on tumor growth in vivo. MKN45 wt cells or UAP1 KO cells were transplanted into stem cell-humanized NSG mice and treated with either vehicle control, low-dose TCB treatment, or high-dose TCB targeting the tumor antigen CEACAM5. Long-term tumor volume measurements revealed that TCB treatment significantly improved tumor control of UAP1 KO cells compared to wt cells, compared to the vehicle group, in both the low-dose and high-dose groups (Figure 8A and Figure 8C). Quantifying the ratio of tumor volume in the high-dose treatment group to vehicle showed that tumor volume was significantly reduced when UAP1 was knocked out compared to the wt control group (Figure 8B). Figures 8D and 8E show individual tumor volume measurements over time within the treatment groups, corresponding to the mean values shown in Figures 8A and 8B.
[0227] Furthermore, increased expression of activation / efflux markers was observed in the UAP1 KO group but not in the wt cells in the presence of CEACAM5×CD5 TCB, indicating higher T cell activation in UAP1 KO tumors compared to controls (Figure 17). To demonstrate efficacy alone, UAP1 was knocked out in the KPC pancreatic ductal adenocarcinoma cell line and injected into the intramammary fat pad of C57 / BL6 mice without immunotherapy. The data showed a strong increase in tumor growth inhibition in the UAP1 KO group compared to the wt group (Figures 18A-18C). Furthermore, UAP1 KO tumors showed increased expression of CD8 + and CD4 + Both T cell infiltration and IL-16 increased (Figure 18D). To confirm that the observed effects were due to the involvement of the mouse's intrinsic immune system, we repeated the experiment in NSG immunodeficient mice. In this mouse model, UAP1 KO did not improve tumor growth suppression (Figure 18E).
[0228] These data, taken together, are consistent with the results of screening and in vitro validation experiments. The effect of increasing antitumor immunity when UAP1 was knocked out in tumor cells was also applied in vivo to both allograft and stem cell-humanized xenograft models.
[0229] Example 5. Pharmacological inhibition of UAP1 in tumor cells reproduced the effects observed with gene knockout. To evaluate the effect of UAP1 pharmacological inhibition on the regulation of T cell function, MKN45 cells were pretreated with the Ac4Glc2Bz tool compound for 2 hours. LC-MS for detection of UDP-HexNAc confirmed dose-dependent inhibition of UAP1 (Figure 9A). UAP1-inhibited MKN45 cells were then cocultured with T cells and TCB. Consistent with the UAP1 KO experiments, UAP1 inhibition increased both T cell-mediated killing (Figures 9B and 9C) and T cell activation (Figures 9D and 9E).
[0230] Example 6. UAP1 is a positive regulator of the immunosuppressive glycosaminoglycan (GAG), hyaluronic acid (HA). Given the crucial role of UAP1 in regulating several glycosylation-related processes in cells, and because this GAG has been reported to confer immune resistance to tumor cells, we assessed HA expression. UAP1 knockout significantly reduced HA in the supernatant and cell lysates of MKN45 tumor cells (Fig. 14).
[0231] Example 7. UAP1 depletion does not impair T cell function To demonstrate that potential UAP1 inhibitors only affect tumor cells and not T cell functionality, we depleted UAP1 in T cells and assessed its effect on functionality by various methods. Notably, UAP1 KO did not impair either T cell-mediated killing or T cell activation (Figures 15A-15D).
[0232] The foregoing invention has been described in some detail by way of illustration and example, for purposes of clarity of understanding, but the illustrations and examples should not be construed as limiting the scope of the invention. The disclosures of all patent and scientific literature cited herein are expressly incorporated by reference in their entireties.
Claims
1. 1. A UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor for use in the treatment or prevention of cancer in an individual, said treatment comprising: (a) administering a UAP1 inhibitor to an individual; and (b) administering immunotherapy to an individual A UAP1 inhibitor comprising:
2. 1. A method for treating or preventing cancer in an individual, comprising: (a) administering to an individual a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor; and (b) administering immunotherapy to an individual A method comprising:
3. 1. Use of a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor in the manufacture of a medicament for the treatment of cancer in an individual, said treatment comprising: (a) administering a UAP1 inhibitor to an individual; and (b) administering immunotherapy to an individual Including, use.
4. 1. An immunotherapy for use in the treatment of a disease in an individual, said treatment comprising: (a) administering an immunotherapy to an individual; and (b) administering to an individual a UDP-N-acetylhexosamine pyrophosphorylase (UAP1) inhibitor immunotherapy, including
5. 5. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 1 to 4, wherein the immunotherapy comprises adoptive cell transfer, administration of a monoclonal antibody, administration of a cytokine, administration of a cancer vaccine, T cell induction therapy, administration of a PD-1 axis binding antagonist, or any combination thereof.
6. (Administration of) a UAP1 inhibitor (i) increasing the activity of immunotherapy; (ii) increased T cell activation (induced by immunotherapy); (iii) increased T cell proliferation (induced by immunotherapy); (iv) increased T cell cytotoxic activity (induced by immunotherapy); (v) increased T cell receptor signaling in T cells (induced by immunotherapy); (vi) an increase in early activation markers (such as CD25 and / or CD69) in T cells (induced by immunotherapy); (vii) an increase in cytokine secretion by T cells (induced by immunotherapy), in particular an increase in cytokine secretion, wherein said cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α, and IFN-γ; and / or (viii) increased secretion of cytolytic effector molecules by T cells (induced by immunotherapy), in particular increased secretion of cytolytic effector molecules, where the cytolytic effector molecule is granzyme-B or perforin; causing Optionally, the T cells are CD8+ T cells or CD4+ cells.
6. A UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 5.
7. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 6, wherein (administration of) the UAP1 inhibitor causes an increase in the level of one or more cytokines in an individual, in particular, the one or more cytokines are selected from the group consisting of IL-2, TNF-α, and IFN-γ.
8. The UAP1 inhibitor, immunotherapy, use, or method described in any one of claims 1 to 7, wherein administration of the UAP1 inhibitor is (i) before, simultaneously with, or after administration of the immunotherapy, (ii) intermittently or continuously, and / or (iii) orally.
9. Administration of a UAP1 inhibitor (i) increasing the activity of immunotherapy; (ii) increased T cell activation (induced by immunotherapy); (iii) increased T cell proliferation (induced by immunotherapy); (iv) increased T cell cytotoxic activity (induced by immunotherapy); (v) increased T cell receptor signaling in T cells (induced by immunotherapy); (vi) an increase in early activation markers (such as CD25 and / or CD69) in T cells (induced by immunotherapy); (vii) an increase in cytokine secretion by T cells (induced by immunotherapy), in particular an increase in cytokine secretion, wherein said cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α, and IFN-γ; and / or (viii) increased secretion of cytolytic effector molecules by T cells (induced by immunotherapy), in particular increased secretion of cytolytic effector molecules, where the cytolytic effector molecule is granzyme-B or perforin; at a dose sufficient to cause Optionally, the T cells are CD8+ T cells or CD4+ cells.
9. A UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 8.
10. A UAP1 inhibitor, immunotherapy, use, or method described in any one of claims 1 to 9, wherein administration of the UAP1 inhibitor is at a dose sufficient to cause an increase in the level of one or more cytokines in the individual, and optionally the level of the one or more cytokines is measured in the individual's serum or tumor biopsy.
11. 11. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 10, wherein the administration of the UAP1 inhibitor is in an effective dose.
12. 12. The UAP1 inhibitor, immunotherapy, use, or method of claim 1, wherein the administration of the UAP1 inhibitor is at a dose of (i) about 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1000 mg or more, or (ii) between about 1 mg and about 10 mg, between about 10 mg and about 5000 mg, between about 50 mg and about 2000 mg, or between about 100 mg and about 1000 mg.
13. A UAP1 inhibitor, immunotherapy, use or method described in any one of claims 1 to 12, wherein administration of the UAP1 inhibitor is associated with the first administration of the immunotherapy, and optionally is before, simultaneously with or after the first administration of the immunotherapy.
14. The administration of immunotherapy (i) in an effective dose; and / or (ii) parenteral, particularly intravenous, administration; 14. A UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 13.
15. Immunotherapy (administration) (i) increased T cell activation; (ii) increased proliferation of T cells; (iii) increased cytotoxic activity of T cells; (iv) increased T cell receptor signaling in T cells; (v) an increase in early activation markers (such as CD25 and / or CD69) in T cells; (vi) increased cytokine secretion by T cells, in particular increased cytokine secretion, wherein the cytokine is one or more cytokines selected from the group consisting of IL-2, TNF-α, and IFN-γ; and / or (vii) increased secretion of cytolytic effector molecules by T cells, particularly increased secretion of cytolytic effector molecules, where the cytolytic effector molecule is granzyme-B or perforin; Inducing Optionally, the T cells are CD8+ T cells or CD4+ cells.
15. A UAP1 inhibitor, immunotherapy, use or method according to any one of claims 1 to 14.
16. 16. The UAP1 inhibitor, immunotherapy, use or method of any one of claims 1 to 15, wherein the immunotherapy is a T cell bispecific antibody, and the T cell bispecific antibody binds to CD3 and a target cell antigen.
17. 17. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 1 to 16, wherein the immunotherapy is a T cell bispecific antibody, and the T cell bispecific antibody comprises an antigen-binding portion that binds to CD3 and an antigen-binding portion that binds to a target cell antigen.
18. 18. The UAP1 inhibitor, immunotherapy, use or method of claim 16 or 17, wherein the target cell antigen is carcinoembryonic antigen (CEA).
19. T cell bispecific antibodies (i) a first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, a HCDR2 of SEQ ID NO: 11, and a HCDR3 of SEQ ID NO: 12; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, a LCDR2 of SEQ ID NO: 17, and a LCDR3 of SEQ ID NO: 18; (ii) a second antigen-binding portion that binds to CEA, the second antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 36, a HCDR2 of SEQ ID NO: 37, and a HCDR3 of SEQ ID NO: 38; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 39, a LCDR2 of SEQ ID NO: 40, and a LCDR3 of SEQ ID NO:
41.
19. The UAP1 inhibitor, immunotherapy, use or method of claim 18, comprising:
20. 20. The UAP1 inhibitor, immunotherapy, use, or method of claim 18 or 19, wherein the T cell bispecific antibody comprises a third antigen-binding moiety that binds to CEA and / or an Fc domain composed of the first subunit and the second subunit.
21. T cell bispecific antibodies (i) a first antigen-binding moiety that binds to CD3, the first antigen-binding moiety comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, a HCDR2 of SEQ ID NO: 11, and a HCDR3 of SEQ ID NO: 12, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, a LCDR2 of SEQ ID NO: 17, and a LCDR3 of SEQ ID NO: 18, wherein the first antigen-binding moiety is a crossover Fab molecule in which either the variable or constant regions of the Fab light chain and the Fab heavy chain have been exchanged; (ii) a second antigen-binding portion and a third antigen-binding portion that bind to CEA, the second antigen-binding portion and the third antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 36, a HCDR2 of SEQ ID NO: 37, and a HCDR3 of SEQ ID NO: 38, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 39, a LCDR2 of SEQ ID NO: 40, and a LCDR3 of SEQ ID NO: 41, wherein the second antigen-binding portion and the third antigen-binding portion are each Fab molecules, particularly conventional Fab molecules; (iii) an Fc domain composed of a first subunit and a second subunit; 21. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 18 to 20, comprising: a second antigen-binding portion fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain; a first antigen-binding portion fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain; and a third antigen-binding portion fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.
22. 22. The UAP1 inhibitor, immunotherapy, use or method of any one of claims 18 to 21, wherein the first antigen-binding portion of said T cell bispecific antibody comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19; and / or the second antigen-binding portion and (if present) the third antigen-binding portion of said T cell bispecific antibody comprise a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:
19.
23. 23. The UAP1 inhibitor, immunotherapy, use or method of any one of claims 18 to 22, wherein the Fc domain of the T cell bispecific antibody comprises a modification that promotes association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector function.
24. 24. The UAP1 inhibitor, immunotherapy, use or method of any one of claims 1 to 23, wherein the immunotherapy is cibisatamab.
25. 18. The UAP1 inhibitor, immunotherapy, use or method of claim 16 or 17, wherein the target cell antigen is epithelial cell adhesion molecule (EpCAM).
26. T cell bispecific antibodies (i) a first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, a HCDR2 of SEQ ID NO: 11, and a HCDR3 of SEQ ID NO: 12; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, a LCDR2 of SEQ ID NO: 17, and a LCDR3 of SEQ ID NO: 18; (ii) a second antigen-binding portion that binds to EpCAM, the second antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 60, a HCDR2 of SEQ ID NO: 61, and a HCDR3 of SEQ ID NO: 62; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 63, a LCDR2 of SEQ ID NO: 64, and a LCDR3 of SEQ ID NO:
65.
26. The UAP1 inhibitor, immunotherapy, use or method of claim 25, comprising:
27. The UAP1 inhibitor, immunotherapy, use, or method of claim 25 or 26, wherein the T cell bispecific antibody comprises a third antigen-binding portion that binds to EpCAM and / or the Fc domain composed of the first subunit and the second subunit.
28. T cell bispecific antibodies (i) a first antigen-binding moiety that binds to CD3, the first antigen-binding moiety comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 9, a HCDR2 of SEQ ID NO: 11, and a HCDR3 of SEQ ID NO: 12, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, a LCDR2 of SEQ ID NO: 17, and a LCDR3 of SEQ ID NO: 18, wherein the first antigen-binding moiety is a crossover Fab molecule in which either the variable or constant regions of the Fab light chain and the Fab heavy chain have been exchanged; (ii) a second antigen-binding portion and a third antigen-binding portion that bind to EpCAM, the second antigen-binding portion and the third antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 60, a HCDR2 of SEQ ID NO: 61, and a HCDR3 of SEQ ID NO: 62, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 63, a LCDR2 of SEQ ID NO: 64, and a LCDR3 of SEQ ID NO: 65, wherein the second antigen-binding portion and the third antigen-binding portion are each Fab molecules, particularly conventional Fab molecules; (iii) an Fc domain composed of a first subunit and a second subunit; 28. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 25 to 27, comprising: a second antigen-binding portion fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain; a first antigen-binding portion fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain; and a third antigen-binding portion fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.
29. 29. The UAP1 inhibitor, immunotherapy, use or method of any one of claims 25 to 28, wherein the first antigen-binding portion of said T cell bispecific antibody comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19; and / or the second antigen-binding portion and (if present) the third antigen-binding portion of said T cell bispecific antibody comprise a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 66 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:
67.
30. the first antigen-binding portion of the T cell bispecific antibody is a crossover Fab molecule in which the variable regions of the Fab light chain and the Fab heavy chain have been exchanged, and the second antigen-binding portion and, if present, the third antigen-binding portion of the T cell bispecific antibody have in the constant domain CL, the amino acid at position 124 independently substituted with lysine (K), arginine (R), or histidine (H) (Kabat numbering), and the amino acid at position 123 independently substituted with lysine (K), arginine (R), or histidine (H) (Kabat numbering), and in the constant domain CHI, the amino acid at position 147 independently substituted with glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering), and the amino acid at position 213 independently substituted with glutamic acid (E) or aspartic acid (D) (Kabat numbering).
30. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 25 to 29, which is a conventional Fab molecule (numbered according to the EU index).
31. 31. The UAP1 inhibitor, immunotherapy, use or method of any one of claims 25 to 30, wherein the Fc domain of the T cell bispecific antibody comprises a modification that promotes association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector function.
32. 18. The UAP1 inhibitor, immunotherapy, use or method of claim 16 or 17, wherein the target cell antigen is tyrosine-related protein 1 (TYRP1).
33. T cell bispecific antibodies (i) a first antigen-binding portion that binds to CD3, the first antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 10, a HCDR2 of SEQ ID NO: 11, and a HCDR3 of SEQ ID NO: 13; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, a LCDR2 of SEQ ID NO: 17, and a LCDR3 of SEQ ID NO: 18; (ii) a second antigen-binding portion that binds to TYRP1, the second antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 23, a HCDR2 of SEQ ID NO: 24, and a HCDR3 of SEQ ID NO: 25; and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 27, a LCDR2 of SEQ ID NO: 28, and a LCDR3 of SEQ ID NO:
29.
33. The UAP1 inhibitor, immunotherapy, use or method of claim 32, comprising:
34. 34. The UAP1 inhibitor, immunotherapy, use, or method of claim 32 or 33, wherein the T cell bispecific antibody comprises a third antigen-binding moiety that binds to TYRP1 and / or an Fc domain composed of the first subunit and the second subunit.
35. T cell bispecific antibodies (i) a first antigen-binding moiety that binds to CD3, the first antigen-binding moiety comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 10, a HCDR2 of SEQ ID NO: 11, and a HCDR3 of SEQ ID NO: 13, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 16, a LCDR2 of SEQ ID NO: 17, and a LCDR3 of SEQ ID NO: 18, wherein the first antigen-binding moiety is a crossover Fab molecule in which either the variable or constant regions of the Fab light chain and the Fab heavy chain have been exchanged; (ii) a second antigen-binding portion and a third antigen-binding portion that bind to TYRP1, the second antigen-binding portion and the third antigen-binding portion comprising a heavy chain variable region comprising a heavy chain CDR (HCDR)1 of SEQ ID NO: 23, a HCDR2 of SEQ ID NO: 24, and a HCDR3 of SEQ ID NO: 25, and a light chain variable region comprising a light chain CDR (LCDR)1 of SEQ ID NO: 27, a LCDR2 of SEQ ID NO: 28, and a LCDR3 of SEQ ID NO: 29, wherein the second antigen-binding portion and the third antigen-binding portion are Fab molecules, particularly conventional Fab molecules; (iii) an Fc domain composed of a first subunit and a second subunit; 35. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 32 to 34, comprising: a second antigen-binding portion fused to the N-terminus of the Fab heavy chain of the first antigen-binding portion at the C-terminus of the Fab heavy chain; a first antigen-binding portion fused to the N-terminus of the first subunit of the Fc domain at the C-terminus of the Fab heavy chain; and a third antigen-binding portion fused to the N-terminus of the second subunit of the Fc domain at the C-terminus of the Fab heavy chain.
36. 36. The UAP1 inhibitor, immunotherapy, use or method of any one of claims 32 to 35, wherein the first antigen-binding portion of said T cell bispecific antibody comprises a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 15 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 19; and / or the second antigen-binding portion and (if present) the third antigen-binding portion of said T cell bispecific antibody comprise a heavy chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 26 and a light chain variable region sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:
30.
37. the first antigen-binding portion of the T cell bispecific antibody is a crossover Fab molecule in which the variable regions of the Fab light chain and the Fab heavy chain have been exchanged, and the second antigen-binding portion and, if present, the third antigen-binding portion of the T cell bispecific antibody have in the constant domain CL, the amino acid at position 124 independently substituted with lysine (K), arginine (R), or histidine (H) (Kabat numbering), and the amino acid at position 123 independently substituted with lysine (K), arginine (R), or histidine (H) (Kabat numbering), and in the constant domain CHI, the amino acid at position 147 independently substituted with glutamic acid (E) or aspartic acid (D) (Kabat EU index numbering), and the amino acid at position 213 independently substituted with glutamic acid (E) or aspartic acid (D) (Kabat numbering).
37. The UAP1 inhibitor, immunotherapy, use or method according to any one of claims 32 to 36, which is a conventional Fab molecule (numbered according to the EU index).
38. 38. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 32 to 37, wherein the Fc domain of the T cell bispecific antibody comprises a modification that promotes association of the first and second subunits of the Fc domain, and / or the Fc domain comprises one or more amino acid substitutions that reduce binding to Fc receptors and / or effector function.
39. 18. The UAP1 inhibitor, immunotherapy, use or method of claim 16 or 17, wherein the target cell antigen is a peptide presented on an MHC class I molecule.
40. 16. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 1 to 15, wherein the immunotherapy is a PD-1 axis binding antagonist.
41. 41. The UAP1 inhibitor, immunotherapy, use, or method of claim 40, wherein the PD-1 axis binding antagonist is selected from the group consisting of a PD-1 binding antagonist, a PDL1 binding antagonist, and a PDL2 binding antagonist.
42. The PD-1 binding antagonist (i) inhibiting the binding of PD-1 to its ligand-binding partner; (ii) inhibiting the binding of PD-1 to PDL1; (iii) inhibiting the binding of PD-1 to PDL2; (iv) inhibiting the binding of PD-1 to both PDL1 and PDL2; and / or (v) an anti-PD-1 antibody, particularly a monoclonal anti-PD-1 antibody; 41. The UAP1 inhibitor, immunotherapy, use or method of claim 40.
43. 43. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 1 to 15, or 40 to 42, wherein the immunotherapy is selected from the group consisting of ipilimumab, nivolumab, and pembrolizumab.
44. The PD-1 axis binding antagonist is a PDL1 binding antagonist, and the PDL1 binding antagonist is (i) inhibiting the binding of PDL1 to PD-1; (ii) inhibiting the binding of PDL1 and B7-1; (iii) inhibiting the binding of PDL1 to both PD-1 and B7-1; and / or (iv) an anti-PDL1 antibody, in particular a monoclonal anti-PDL1 antibody; 41. The UAP1 inhibitor, immunotherapy, use or method of claim 40.
45. 45. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 1 to 15, 40, or 44, wherein the immunotherapy is selected from the group consisting of atezolizumab, durvalumab, or avelumab.
46. 16. The UAP1 inhibitor, immunotherapy, use or method of any one of claims 1 to 15, wherein the immunotherapy comprises adoptive cell transfer.
47. 47. The UAP1 inhibitor, immunotherapy, use, or method of any one of claims 1 to 15, or 46, wherein the immunotherapy comprises administering chimeric antigen receptor-expressing T cells (CAR T cells), T cell receptor (TCR)-modified T cells, tumor infiltrating lymphocytes (TILs), chimeric antigen receptor (CAR)-modified natural killer cells, T cell receptor (TCR)-transduced cells, or dendritic cells, or any combination thereof.
48. 16. The UAP1 inhibitor, immunotherapy, use or method of any one of claims 1 to 15, wherein the immunotherapy comprises administration of a cancer vaccine.
49. Cancer, (i) carcinoembryonic antigen (CEA)-expressing cancer, and / or (ii) selected from the group consisting of colorectal cancer, lung cancer, pancreatic cancer, breast cancer, and gastric cancer; 25. A UAP1 inhibitor, T cell-based therapy, use, or method according to any one of claims 1 to 24.
50. Cancer, (i) epithelial cell adhesion molecule (EpCAM)-expressing cancer; and / or (ii) selected from the group consisting of colorectal cancer, breast cancer, gastric cancer, prostate cancer, ovarian cancer, and lung cancer; 32. A UAP1 inhibitor, T cell-based therapy, use, or method according to any one of claims 1 to 17, or 25 to 31.
51. Cancer, (i) tyrosine-related protein 1 (TYRP1)-expressing cancer, and / or (ii) melanoma 39. The UAP1 inhibitor, T cell-based therapy, use, or method of any one of claims 1 to 17, or 32 to 38, wherein
52. 10. The invention as described above.