Composition for preventing or treating Moyamoya disease

A composition of extracellular vesicles from three-dimensional spheroid cell aggregates, enriched with specific miRNAs, addresses the limitations of surgical treatments for Moyamoya disease by enhancing vascular anastomosis and cerebral blood flow, providing a non-surgical therapeutic option.

JP2025538982APending Publication Date: 2025-12-03S&E BIO CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025525631
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-03
Filing Date
2023-11-03
Publication Date
2025-12-03

AI Technical Summary

Technical Problem

Current treatments for Moyamoya disease, a cerebrovascular disorder characterized by narrowed arteries leading to reduced brain blood flow, are limited to surgical interventions with high risks and no effective non-surgical therapeutic agents, and there is a lack of methods for mass-producing stem cell-derived extracellular vesicles to enhance their efficacy.

Method used

A pharmaceutical composition comprising extracellular vesicles derived from three-dimensional spheroid cell aggregates, enriched with specific miRNAs (miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p), produced by culturing stem cells in microwells and isolating these vesicles, which can induce vascular anastomosis and increase cerebral blood flow.

Benefits of technology

The composition effectively increases the expression of downregulated miRNAs, promoting vascular anastomosis and cerebral blood flow, offering a novel non-surgical treatment for Moyamoya disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025538982000001_ABST
    Figure 2025538982000001_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for preventing or treating Moyamoya disease, which contains miRNA or extracellular vesicles containing the same as an active ingredient, and a composition for preventing or treating Moyamoya disease, which contains extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by a novel production method. The use of the miRNA of the present invention or extracellular vesicles containing the same can induce vascular anastomosis, an increase in cerebral vascular diameter, and an increase in cerebral blood flow in patients with Moyamoya disease or Moyamoya syndrome by increasing downregulated miRNA expression. Therefore, the miRNA of the present invention or extracellular vesicles containing the same can be used as a novel therapeutic agent for treating Moyamoya disease or Moyamoya syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a composition for preventing or treating Moyamoya disease, which contains miRNA or extracellular vesicles containing the same as an active ingredient, and a composition for preventing or treating Moyamoya disease, which contains extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by a novel production method. [Background technology]

[0002] Positive clinical results have been reported for the treatment of various diseases using stem cells, particularly mesenchymal stem cells (MSCs). However, stem cell therapy carries the risk of cell-related side effects such as vascular occlusion, tumor formation, and coagulation disorders, and efficacy verification through clinical trials is still required. The paracrine effect of stem cells is known to induce the regeneration of surrounding skin cells and enhance vascular regeneration, and extracellular vesicles (EVs) in particular are known to be the main efficacious factor for this paracrine effect.

[0003] Extracellular vesicles are classified into exosomes and microvesicles based on their size. Exosomes are 30-150 nm in diameter, while microvesicles are 100-1,000 nm in size. Extracellular vesicles are part of the cell membrane released into the bloodstream. They contain both proteins and nuclear components and are known to mediate intercellular communication. Using extracellular vesicles instead of stem cells not only minimizes side effects associated with stem cell use and increases stability, but also offers advantages in terms of biodistribution and production processes.

[0004] However, methods for mass production and harvesting of stem cell-derived extracellular vesicles have not yet been established, and there has been insufficient research into methods for further enhancing the efficacy of stem cell-derived extracellular vesicles while maintaining their properties.

[0005] Moyamoya disease, also known as internal carotid artery hypoplasia, is a unique cerebrovascular disease in which the arteries supplying the brain gradually narrow and shrink, resulting in a decrease in blood flow to the brain. It is a cerebrovascular disease of unknown cause in which stenosis or blockage progresses at the end of specific blood vessels in the brain, namely the internal carotid arteries, causing the large blood vessels to narrow while the small blood vessels become network-like. The name "moyamoya disease," which means "the rising of hazy cigarette smoke" in Japanese, was coined because the small blood vessels resemble smoke or clouds. Moyamoya disease is common in Japan, Korea, and China, with a particularly high incidence in Korea and Japan.

[0006] Although the exact pathogenesis and cause of moyamoya disease remain unknown, it has recently been revealed that the c.14429G>A (p.Arg4810Lys) mutation in the RNF213 gene is an important genetic factor. In Japanese patients with moyamoya disease, this mutation has been found in approximately 95% of familial cases and approximately 73% of sporadic cases, while it is found at an extremely low frequency of approximately 1.4% in normal subjects. This mutation has also been confirmed to be an important genetic cause of moyamoya disease in Korean patients with moyamoya disease.

[0007] The most important treatment for Moyamoya disease is to expand the narrowed blood vessels again and increase the blood flow to the brain through them, but until now, no drugs have been developed that have this effect, and the only treatment available is surgical.

[0008] The most common surgical treatment for moyamoya disease is anastomosis, which attempts to connect normal blood vessels outside the cranial cavity with abnormal blood vessels inside the cranial cavity to improve blood flow within the cranial cavity. These anastomoses can be divided into direct anastomosis, which directly connects blood vessels inside and outside the cranial cavity, and indirect anastomosis, which does not. In direct anastomosis, the extracranial blood vessels are dissected, the skull is removed, and the abnormal blood vessels inside the cranial cavity are located and connected. In indirect anastomosis, the same process is followed, but the blood vessels inside and outside the cranial cavity are not directly connected. Therefore, general anesthesia is required, the surgery is long, and the skilled technique of the surgeon is essential. Direct anastomosis, in particular, is highly dependent on the surgeon, with postoperative cerebral infarction occurring in approximately 21% of cases and mortality rates reaching 9%, even at reputable medical institutions. Indirect vascular anastomosis also has the advantage of being relatively simple compared to direct anastomosis, but it has the disadvantage that it can only be applied to pediatric patients, whose cerebral angiogenesis environment and conditions are believed to be better than those of adults, and cannot be applied to adult patients. Furthermore, although it is a relatively simple procedure compared to direct vascular anastomosis, it still has side effects, and approximately 15% of patients may experience problems such as cerebral infarction after surgery. For this reason, it has been difficult to even attempt to treat acute stroke.

[0009] Therefore, there is a need for a new non-surgical treatment method and agent that can effectively treat moyamoya disease by a non-surgical method. Summary of the Invention [Problem to be solved by the invention]

[0010] Therefore, the present inventors conducted research into the treatment of Moyamoya disease and found that the expression of one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p was specifically reduced in patients with Moyamoya disease. This finding confirmed that one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p, or extracellular vesicles enriched with such miRNAs, can be used as novel therapeutic agents for treating Moyamoya disease. In particular, the present inventors have newly devised extracellular vesicles derived from three-dimensional spheroid cell aggregates (3D-static-spheroids), which contain a high content of the miRNAs. It was confirmed that administration of these extracellular vesicles can effectively treat Moyamoya disease, leading to the completion of the present invention.

[0011] Therefore, an object of the present invention is to provide a composition for preventing or treating Moyamoya disease or Moyamoya syndrome, which comprises, as an active ingredient, one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p; or extracellular vesicles containing the miRNAs. [Means for solving the problem]

[0012] To achieve the above-mentioned object, the present invention provides a pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome, comprising extracellular vesicles containing one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p.

[0013] The present invention also provides a pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome, comprising extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by: (a) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

[0014] The present invention also provides a pharmaceutical composition for preventing or treating moyamoya disease or moyamoya syndrome, comprising one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p.

[0015] The present invention also provides an in vitro composition for promoting vascular anastomosis of vascular endothelial cells induced by a mutation or deletion of the RNF213 (Ring finger protein 213) gene, the composition comprising extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by: (a) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

[0016] The present invention also provides a method for producing a composition for preventing or treating Moyamoya disease or Moyamoya syndrome, which contains extracellular vesicles derived from three-dimensional spheroid cell aggregates, comprising: (a) statically culturing stem cells three-dimensionally (3D, 3 dimensions) in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

[0017] The present invention also provides a method for preventing or treating Moyamoya disease or Moyamoya syndrome, which comprises administering to an individual in need thereof extracellular vesicles containing one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p.

[0018] The present invention also provides a method for preventing or treating Moyamoya disease or Moyamoya syndrome, comprising the steps of: (a) three-dimensionally (3D, 3 dimension) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates; and administering the extracellular vesicles derived from the three-dimensional spheroid cell aggregates to an individual in need thereof. [Effects of the Invention]

[0019] By using the miRNA of the present invention or extracellular vesicles containing the same, it is possible to increase the expression of downregulated miRNAs in patients with Moyamoya disease or Moyamoya syndrome, thereby inducing vascular anastomosis, an increase in cerebral vascular diameter, and an increase in cerebral blood flow. Therefore, the miRNA of the present invention or extracellular vesicles containing the same can be used as a novel therapeutic agent for treating Moyamoya disease or Moyamoya syndrome. [Brief explanation of the drawings]

[0020] [Figure 1] This figure shows a schematic diagram of the process of producing 3D spheroid cell aggregates and isolating extracellular vesicles from them. [Figure 2]Figure 2A shows an image of a microwell containing a 3D-dynamic-PEG spheroid culture medium. Figure 2B shows an image of a microwell containing a 3D-static-spheroid culture medium. Figure 2C shows the change in aggregate area over the culture period for 3D-static-spheroids produced using 3D-dynamic-PEG spheroids and microwells. [Figure 3] FIG. 10 compares the size distribution of 3D-static and 3D-dynamic-PEG spheroids. [Figure 4] Electron microscopic observation of the morphology of 3D static spheroid EVs. [Figure 5] FIG. 1 shows the results of nanoparticle tracking analysis (NTA) to confirm the concentration and size distribution of 3D-static-spheroid EVs. [Figure 6] Figure 1 shows the results of ELISA and Western blot to confirm the expression markers of 3D-static-spheroid EVs. [Figure 7] Figure 1 shows a comparison of the production of 3D-static spheroid EVs, 3D-dynamic PEG spheroid EVs, and 2D-EVs per derived cell. [Figure 8] This figure shows the results of examining the size, roundness, and solidity of 3D spheroids produced after varying the diameter and depth of the microwells and the number of cells per well in the production of 3D static spheroid EVs. [Figure 9] This figure shows the results of comparing the expression levels of miRNA132 and miRNA210 in 3D-static spheroid EVs and 2D-EVs produced under various conditions. [Figure 10] The results show that miR-101-3p and miR-19b-3p expression was confirmed in normal control groups, intracranial arteriosclerosis (ICAS), and moyamoya disease (MMD). [Figure 11]The expression of miR-100-5p, miR-122-5p, and miR-99a-5p was confirmed by small RNA sequencing in normal control groups and moyamoya disease (MMD) patients. [Figure 12] The expression of miR-100-5p, miR-122-5p, and miR-99a-5p was confirmed by quantitative PCR in normal control groups and moyamoya disease (MMD) patients (*p<0.05, **p<0.01). [Figure 13] This figure shows the results of confirming the expression of miR-101-3p and miR-19b-3p in 2D-EVs and 3D static spheroid EVs (3D-EVs). [Figure 14] This figure shows the results of confirming the expression of miR-122-5p in 2D-EVs and 3D static spheroid EVs (3D-EVs). [Figure 15] This figure shows the results of confirming the angiogenic potential of 3D-static-spheroid EV (referred to as EV) treatment in a moyamoya disease model produced by RNF213 siRNA treatment. [Figure 16] This figure shows the results of confirming the proliferation ability of vascular endothelial cells by 3D-static-spheroid EV (referred to as EV) treatment in a moyamoya disease model produced by RNF213 siRNA treatment. [Figure 17] This figure shows the results of confirming changes in the expression of miR-101-3p and miR-19b-3p in vascular endothelial cells following treatment with 3D-static-spheroid EVs (referred to as EVs) in a moyamoya disease model produced by treatment with RNF213 siRNA. [Figure 18] FIG. 1 is a schematic diagram showing an experimental protocol using a pseudo-model of Moyamoya disease. [Figure 19a] This is an image of changes in cerebral blood flow using laser speckle imaging (3D-EV: 3D-static-spheroid EV administration group). [Figure 19b]This figure shows the results of quantifying the change in cerebral blood flow due to administration of 3D-static-spheroid EVs (BCAS EVs) using the average value of ROIs (Regions of interest) (*p<0.05). [Figure 20] This figure shows the results of confirming changes in cerebral blood vessels by staining in PBS-administered and 3D-static-spheroid EV-administered groups (BCAS EV) in a pseudo-moyamoya disease model. [Figure 21a] This figure shows the results of confirming changes in the diameter of the Circle of Willis (CoW) in a mock model of Moyamoya disease in the PBS-administered and 3D-static-spheroid EV-administered groups (EV) (*p<0.05, **p<0.01). [Figure 21b] This figure shows the number of vascular anastomoses in the PBS-administered and 3D-static-spheroid EV-administered groups (EV) in a mock model of Moyamoya disease (**p<0.01). DETAILED DESCRIPTION OF THE INVENTION

[0021] The present invention relates to a pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome, which comprises extracellular vesicles containing one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p, or a method for preventing or treating Moyamoya disease or Moyamoya syndrome using the same.

[0022] The present invention also relates to a pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome, comprising extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by (a) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates, and a method of treatment using the same.

[0023] The present invention will be described in detail below.

[0024] The present invention provides a composition for preventing, ameliorating, or treating Moyamoya disease or Moyamoya syndrome, comprising extracellular vesicles containing one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p; or a pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome, comprising extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by the steps of: (a) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

[0025] When produced by the above-described production method, extracellular vesicles containing one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p of the present invention can be used in the same sense as extracellular vesicles derived from three-dimensional spheroid cell aggregates, and in this case can be referred to as 3D-static-spheroid EVs.

[0026] In contrast, extracellular vesicles derived from spheroid-type cell aggregates cultured in three dimensions can be used interchangeably as "3D-dynamic-PEG-spheroid-EVs."

[0027] In the present invention, "extracellular vesicles derived from mesenchymal stem cells cultured in two dimensions" can include, without limitation, extracellular vesicles obtained by culturing stem cells in a conventional two-dimensional culture method and isolating them using a conventional method for isolating extracellular vesicles. In one embodiment of the present invention, the conventional two-dimensional culture method was performed by culturing stem cells in a cell stack for three days, washing them with PBS, exchanging the medium for serum-free medium, and further culturing them for two days.

[0028] It is found that the kurtosis of the size distribution of the three-dimensional spheroid cell aggregates of the present invention is higher than that of "spheroid cell aggregates obtained by three-dimensional dynamic culture of mesenchymal stem cells." Therefore, the size of the three-dimensional spheroid cell aggregates is smaller than that of "spheroid cell aggregates obtained by three-dimensional dynamic culture of mesenchymal stem cells," and can have a relatively uniform size distribution.

[0029] As used herein, the term "extracellular vesicles of the present invention" refers to both "extracellular vesicles containing one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p" and "extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by (a) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates."

[0030] The accession numbers and sequence information of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p of the present invention are shown in Table 4.

[0031] In the present invention, miRNA refers to a non-translated RNA of approximately 22 nt that acts as a repressor after transcription by binding to the 3' untranslated region (UTR) of mRNA.

[0032] The miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p are characterized by being significantly down-regulated in extracellular vesicles (exosomes and microvesicles) derived from the plasma of Moyamoya patients compared to normal subjects. When administered as a therapeutic agent to an individual in need of treatment for Moyamoya disease or Moyamoya syndrome, the expression levels of the miRNAs increase, thereby achieving a therapeutic effect for Moyamoya disease or Moyamoya syndrome.

[0033] The extracellular vesicles of the present invention can be characterized by highly expressing one or more miRNAs relative to naturally secreted extracellular vesicles or extracellular vesicles derived from two-dimensionally cultured stem cells.

[0034] Here, "spontaneously secreted extracellular vesicles" refer to extracellular vesicles that are naturally secreted by cells without any special treatment, and extracellular vesicles derived from 2D cultured stem cells include, without limitation, 2D culture methods commonly known in the art, but may be extracellular vesicles produced by the method of Example 7.

[0035] The extracellular vesicles of the present invention may preferably be extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by a method comprising the following steps: (a) producing three-dimensional spheroid cell aggregates by three-dimensional (3D, 3 dimension) static culturing of stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

[0036] The extracellular vesicles obtained from the three-dimensional spheroid cell aggregates may exhibit miRNA expression patterns and characteristics different from those of naturally secreted extracellular vesicles or extracellular vesicles derived from two-dimensionally cultured stem cells, and are particularly rich in miRNAs that are down-expressed in patients with Moyamoya disease or Moyamoya syndrome. Due to these characteristics, when the extracellular vesicles of the present invention are administered to an individual in need thereof, the down-expressed miRNAs can be increased, thereby effectively achieving the therapeutic effects of Moyamoya disease or Moyamoya syndrome.

[0037] The extracellular vesicles of the present invention may effectively deliver miRNA, which is an active ingredient contained in the extracellular vesicles, or may promote the synthesis of the miRNA upon administration of the extracellular vesicles. Furthermore, the extracellular vesicles of the present invention may be mixed into cells and internalized when treated with cells, and when mixed into cells and internalized, may effectively transport clinically significant substances that are highly expressed in the extracellular vesicles to cells and be highly expressed in the cells.

[0038] More specifically, the extracellular vesicles of the present invention can induce an increase in one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p in patients with Moyamoya disease or Moyamoya syndrome. The main genetic cause of Moyamoya disease or Moyamoya syndrome is the c.14429G>A (p.Arg4810Lys) mutation in the RNF213 (Ring finger protein 213) gene. This mutation is found at a very low frequency in healthy individuals but is expressed at a particularly high rate in Moyamoya patients. Improvement of the reduced angiogenic and cell proliferation abilities induced by the RNF213 gene mutation or deficiency can be effective in treating Moyamoya disease or Moyamoya syndrome.

[0039] Therefore, in one embodiment of the present invention, a moyamoya disease model in which the RNF213 gene was knocked out was prepared, and the therapeutic effect of treatment with extracellular vesicles of the present invention was confirmed. The extracellular vesicles of the present invention were shown to improve vascular contraction and reduction induced by RNF213 mutation, increase reduced blood vessels, and increase the number of vascular endothelial cells.

[0040] Therefore, the extracellular vesicles of the present invention may be used to improve the reduced angiogenic and proliferative abilities of vascular endothelial cells induced by mutations or deficiencies in the RNF213 (Ring finger protein 213) gene, or may be used to promote vascular anastomosis.

[0041] In particular, in the present invention, it has been confirmed that such effects are associated with miRNAs that are abundantly contained in the extracellular vesicles of the present invention and are down-expressed in Moyamoya patients, and that administration of the extracellular vesicles of the present invention can induce an increase in one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p in Moyamoya patients, thereby inducing an increase in so-called miR-19b-3p or miR-101-3p.

[0042] Furthermore, in the present invention, a moyamoya-mimicking animal model was prepared, and it was confirmed that administration of the extracellular vesicles of the present invention can improve the reduced cerebral perfusion and morphological changes of blood vessels, which are typical symptoms of moyamoya disease or moyamoya syndrome. Specifically, the extracellular vesicles of the present invention effectively improved the stenosis / occlusion of the internal carotid artery, the reduced diameter of major cerebral blood vessels, the reduced collateral circulation between major cerebral blood vessels, and the resulting reduced cerebral perfusion, which are exhibited in the moyamoya-mimicking animal model.

[0043] More specifically, the extracellular vesicles of the present invention can increase the diameter of the internal carotid artery (ICA), middle cerebral artery (MCA), posterior communicating artery (Pcom), anterior cerebral artery (ACA), and basilar artery (BA) in the Circle of Willis (CoW) and the number of vascular anastomoses between the middle cerebral artery and the anterior cerebral artery, thereby restoring the diameter of the Circle of Willis and restoring vascular perfusion to normal levels. Therefore, the extracellular vesicles of the present invention can be used to induce vascular anastomoses, increase cerebral vascular diameter, or increase cerebral blood flow, and can serve as a specific therapeutic agent for Moyamoya disease or Moyamoya syndrome.

[0044] Pharmaceutical compositions containing the extracellular vesicles of the present invention can be administered to mammals such as rats, mice, livestock, and humans by various routes using any method known in the art. Any mode of administration is contemplated, but administration can be by oral, rectal, intravenous, intramuscular, subcutaneous, intrauterine dura, or intracerebroventricular injection.

[0045] In the present invention, "moyamoya disease" includes all moyamoya diseases in which cerebral arterial stenosis and occlusion progress bilaterally or unilaterally, and may be categorized separately as moyamoya syndromes induced by causes of vascular occlusion, such as infection, vasculitis, autoimmune disease, Down's syndrome, neurofibromatosis, or radiation therapy for brain tumors, or may be collectively referred to as moyamoya disease. Therefore, the extracellular vesicles of the present invention can be used for the purpose of preventing, treating, or ameliorating moyamoya disease or moyamoya syndrome, and in this case, moyamoya syndrome can refer to moyamoya disease that develops secondarily due to infection, vasculitis, autoimmune disease, Down's syndrome, neurofibromatosis, or radiation therapy for brain tumors.

[0046] The composition containing the extracellular vesicles of the present invention can be administered alone or simultaneously or sequentially with existing methods used for the treatment and prevention of Moyamoya disease or Moyamoya syndrome. It can be administered before or after direct or indirect vascular anastomosis used in the treatment of Moyamoya disease or Moyamoya syndrome, thereby further promoting the improvement of angiogenesis and blood flow caused by the surgery.

[0047] The extracellular vesicles of the present invention are preferably extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by the steps of: (a) statically culturing stem cells three-dimensionally (3D, 3 dimension) in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

[0048] In the present invention, the term "3D culture" refers to culturing in a three-dimensional configuration in vitro. Unlike 2D culture, cell growth in 3D culture allows cells to grow in any direction in vitro, which may be more similar to the cellular environment in vivo.

[0049] In the present invention, the 3D static culture in step (a) may be performed by any 3D cell culture technique known in the art, such as microwell array culture, porous microparticle culture, hanging drop culture, low attachment plate culture, membrane-based cell-detachment culture, thermal lifting culture, centrifugation culture, semisolid medium culture, etc. In the present invention, when the 3D culture in step (a) is performed statically, it does not require equipment required for shaking culture, which makes the culture easier and has the advantage of enabling large-scale culture in GMP (Good Manufacturing Practices) manufacturing facilities.

[0050] In the present invention, the three-dimensional static culture in step (a) may be performed for 1 to 10 days, preferably 2 to 4 days. When the culture in step (a) is performed for 2 to 4 days, the viability of the cells present in the three-dimensional spheroid cell aggregates is maintained at a high level, and the culture time is relatively short compared to existing processes for producing three-dimensional spheroid cell aggregates, allowing for the rapid production of three-dimensional spheroid cell aggregates and extracellular vesicles derived therefrom.

[0051] In the present invention, the three-dimensional culture in step (a) may involve dispensing mesenchymal stem cells into microwells at a density of 100 to 1000 cells / well and culturing them, preferably at a density of 200 to 600 cells / well and culturing them, and more preferably at a density of 200 to 500 cells / well and culturing them.

[0052] In the present invention, the step (b) of isolating extracellular vesicles may be carried out by extruding a sample containing cells or cell aggregates and subjecting them to a method selected from the group consisting of sonication, cell lysis, homogenization, freeze-thaw, electroporation, chemical treatment, mechanical disintegration, and physical stimulation treatment by externally applying force to the cells. Preferably, the extracellular vesicles may be separated by a tangential flow filtration (TFF) method, but is not limited thereto.

[0053] In the present invention, the microwell contains TMSPMA (3-(Trimetoxysily)propylmethacrylate), HEA (Hydroxyethyl acrylate), GMA (Glycidyl methacrylate), EGDMA (diethyleneglycol dimethacrylate), THFA (Tetrahydrofurfuryl acrylate), HMAA (Hydroxymethul acrylamide), PEA (Phenyl epoxyacrylate), HOFHA (6-Hydroxy-2, 2,3,3,4,4,5,5-octafluoro), EOPT (Polyethoxylated(4)pentaerythritoltetraacrylate), HPA (Hydroxypropyl acrylate), BMA (Buthylmethacrylate), PETIA (Pentaerythritol triacrylate), HDDA (Hexan diol diacrylate), EGPEA (Ethylene glycol phenyletheracrylate), BM (Benzylmethacrylate), HPPA (Hydroxyphenoxypropyl The substrate may be coated with any one selected from the group consisting of BHPEA (2-(4-benzoyl-3-hydroxyphenoxy)ethyl acrylate), HEMA (hydroxyethyl methacrylate), HPMA (N-(2-hydroxypropyl)methacrylamide) and MPC (2-methacryloyloxyethyl phosphorylcholine polymer), and preferably may be coated with MPC (2-methacryloyloxyethyl phosphorylcholine polymer), but is not limited to these.

[0054] The microwell of the present invention may have a diameter of 200 to 800 μm, preferably 300 to 800 μm, and more preferably 400 to 800 μm.

[0055] Furthermore, the microwell may be a microwell having a flat structure with no depth, or in the case of a microwell having a depth, it may have a structure with a depth of 100 to 1000 μm, preferably 100 to 900 μm, and more preferably 200 to 900 μm.

[0056] The mesenchymal stem cells cultured using the structure may maintain a high level of viability even after the elapse of the culture period. Preferably, a microarray containing 1,000 to 100,000 of the microwells is fabricated, thereby increasing the production yield of cell aggregates.

[0057] When extracellular vesicles are produced by the "method for producing extracellular vesicles derived from three-dimensional spheroid cell aggregates" of the present invention, in addition to the advantages of production by static culture, extracellular vesicles with improved clinical applicability, particularly therapeutic potential for Moyamoya disease or Moyamoya syndrome, can be rapidly and efficiently mass-produced.

[0058] In the present invention, the cells may be any cells from which extracellular vesicles can be isolated, and may be cells isolated from natural organisms. The cells may be derived from any type of animal, including humans and non-human mammals, or plants, and may be various types of immune cells, tumor cells, or stem cells. Preferably, the stem cells may be mesenchymal stem cells, pluripotent stem cells, induced pluripotent stem cells, or embryonic stem cells.

[0059] The extracellular vesicles produced by the above-described production method can be characterized by high expression of one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p compared to naturally secreted extracellular vesicles or extracellular vesicles derived from 2D-cultured mesenchymal stem cells.

[0060] The present invention also relates to a pharmaceutical composition for preventing or treating moyamoya disease or moyamoya syndrome, comprising one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p.

[0061] To enhance delivery efficiency in vivo, miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p may be delivered in the form of a complex or contained in various nucleic acid transporters known in the art. In other words, the miRNAs may be contained in a plasmid, viral vector, or non-viral transporter. Examples of plasmids that can be used for this purpose include, but are not limited to, pSilencer (Ambion), pSiEx (Novagen), siXpress (Takara Bio), pBLOCK-iT™ (Invitrogen), pcDNA3.1 (Invitrogen), pCEP4 (Invitrogen), and SilenCircle™ (Allele). Viral transporters include, but are not limited to, retroviral vectors, adenoviral vectors, adeno-associated viral vectors, vaccinia virus vectors, lentiviral vectors, herpes virus vectors, alphavirus vectors, EB virus vectors, papilloma virus vectors, and foamy virus vectors. Non-viral transporters include, but are not limited to, Mirus TrasIT-TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, G-fectin, cationic phospholipid nanoparticles, cationic polymers, cationic micelles, cationic emulsions or liposomes, ligand-DNA complexes, and gene guns. Liposomes can be combined with an amphipathic agent, such as a lipid that exists as a micelle, an insoluble monolayer, a liquid crystal, or a lamellar layer in aqueous solution. Lipids for liposomal formulations include, but are not limited to, monoglycerides, diglycerides, sulfatides, lysolecithin, lecithin phospholipids, saponin, bile acids, lipopectin, and the like.

[0062] In the present invention, the miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p may be miRNAs in extracellular vesicles, which may be derived from a patient's blood, preferably plasma. Therefore, the miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, or miR-122-5p may be contained in an exosome, microvesicle, or extracellular vesicle and delivered in a pharmaceutical composition. In the present invention, "extracellular vesicles (EVs)" are classified into exosomes and microvesicles based on their size, with exosomes having a diameter of 30 to 150 nm and microvesicles having a diameter of 100 to 1,000 nm. Because miRNA contained in EVs is protected from RNases in the blood by a lipid bilayer, they exhibit consistently higher levels of miRNAs than cell-free miRNAs.

[0063] The miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p of the present invention can be preferably delivered to an individual in need of treatment in the form of extracellular vesicles, for example, but not limited to, extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by the production method of the present invention. The three-dimensional spheroid cell aggregate-derived extracellular vesicles can be produced by a production method including: (a) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1,000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

[0064] Furthermore, miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, or miR-122-5p of the present invention can be formulated using common ribonucleic acid intracellular delivery techniques known in the art, such as by conjugating them with biocompatible polymers such as polyethylene glycol to increase their stability in the body and their intracellular absorption.

[0065] The composition of the present invention can be used for the prevention or treatment of Moyamoya disease and Moyamoya syndrome. It can be used without limitation for bilateral or unilateral advanced Moyamoya disease and Moyamoya syndrome induced by vascular occlusion. Preferably, the Moyamoya syndrome may be Moyamoya syndrome secondary to infection, vasculitis, autoimmune disease, Down's syndrome, neurofibromatosis, or radiation therapy for brain tumors.

[0066] The pharmaceutical composition of the present invention may further contain suitable carriers, excipients, and diluents commonly used in the manufacture of pharmaceutical compositions in addition to the active ingredient, and may further contain other pharmaceutically active ingredients or active compounds.

[0067] The pharmaceutical compositions of the present invention can be formulated into oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, as well as topical preparations, suppositories, and sterile injection solutions according to conventional methods. Carriers, excipients, and diluents that can be included in the compositions include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulated, commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants are used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations are prepared by mixing the composition with at least one or more excipients, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

[0068] Oral liquid formulations include suspensions, oral solutions, emulsions, syrups, etc., and may contain various excipients, such as wetting agents, sweeteners, flavorings, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Examples of non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Examples of suppository bases include Witepsol, macrogol, Tween 61, cocoa butter, lauric butter, and glycerogelatin.

[0069] The preferred dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, the severity of the disease, the drug form, the route and duration of administration, and can be appropriately selected by those skilled in the art. Administration can be once a day or in several divided doses. The dosage does not limit the scope of the present invention in any way.

[0070] The pharmaceutical composition of the present invention can be administered to mammals such as rats, mice, livestock, humans, etc. by various routes, including oral, rectal, intravenous, intramuscular, subcutaneous, intrauterine, intradural, or intracerebroventricular injection.

[0071] The definitions of the terms for the excipient, binder, disintegrant, lubricant, flavoring agent, flavoring agent, etc. of the present invention are those described in documents known in the art, and include those having the same or similar functions.

[0072] The present invention also provides an in vitro composition for promoting vascular anastomosis of vascular endothelial cells induced by a mutation or deletion of the RNF213 (Ring finger protein 213) gene, the composition comprising extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by the steps of: (a) statically culturing stem cells three-dimensionally (3D, 3-dimensional) in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

[0073] The in vitro composition of the present invention can be used for experimental purposes and can be a target composition for processing isolated cells or tissues confirmed to exhibit characteristics of Moyamoya disease. The in vitro composition of the present invention can also be a medium composition containing the extracellular vesicles of the present invention. The medium can include, without limitation, media known to those of ordinary skill in the art, such as media containing serum (e.g., fetal bovine serum, horse serum, and human serum). Media that can be used in the present invention include, for example, RPMI series, EMEM, MEM, Iscove's MEM, 199 medium, CMRL 1066, RPMI 1640, F12, F10, DMEM, a mixture of DMEM and F12, Way-mo, McCoy's 5A, or media known in the art as suitable for culturing cells exhibiting characteristics of Moyamoya disease.

[0074] The present invention also provides a method for producing a composition for preventing or treating Moyamoya disease or Moyamoya syndrome, which contains extracellular vesicles derived from three-dimensional spheroid cell aggregates, comprising: (a) statically culturing stem cells three-dimensionally (3D, 3 dimensions) in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm to produce three-dimensional spheroid cell aggregates; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

[0075] According to the above-described production method, extracellular vesicles derived from three-dimensional spheroid cell aggregates for preventing, ameliorating, or treating Moyamoya disease or Moyamoya syndrome can be rapidly and mass-produced in accordance with GMP standards.

[0076] Duplicate content will be omitted in consideration of the complexity of this specification, and terms not specifically defined in this specification have the meanings commonly used in the technical field to which this invention belongs.

[0077] The present invention will be described in more detail below with reference to examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0078] [Mode for Carrying Out the Invention] Western blot Cells and extracellular vesicles were lysed in radioimmunoprecipitation assay (RIPA) buffer (25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.5% Triton X-100, 1% Na-deoxycholate, 0.1% sodium dodecyl sulfate (SDS), and protease inhibitors). A total of 20 μg of protein was separated by SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA, USA). The membrane was then incubated overnight at 4°C with primary antibodies against histone H2A.Z, histone H3, lamin A / C, flotillin-1 (1:1,000, Cell Signaling Technology, Beverly, MA, USA), or calreticulin (1:1,000, ThermoFisher Scientific, Inc., Rockford, IL, USA). After washing with Tris-buffered saline-Tween 20, the nitrocellulose membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (1:1,000, anti-rabbit, Cell Signaling Technology, Beverly, MA, USA) for 2 hours. Proteins were detected using a chemiluminescent substrate from ThermoFisher Scientific, Inc. (Waltham, MA, USA). Labeled proteins were visualized using X-ray film (Agfa, Mortsel, Belgium).

[0079] ELISA ELISA was performed using commercial kits according to the manufacturer's instructions. The following ELISA kits were used: gentamicin (5111GEN, EuroProxima, Arnhem, Netherlands), bovine albumin (8100, Alpha Diagnostic, San Antonio, TX, USA), Hsp70 (Abcam, Cambridge, UK), CD63, CD9, and CD81 (System Biosciences, Palo Alto, CA, USA), histone H2A.Z. (Mybiosource, San Diego, CA, USA), calreticulin (Mybiosource), and cytochrome C (ThermoFisher Scientific, Inc.). Each kit includes a standard protein; therefore, the amount of protein and extracellular vesicles was determined based on the standard curve provided by each kit.

[0080] qPCR RNA was extracted from EVs using Trizol™ according to the manufacturer's instructions, and RNA was quantified using Nanodrop. RNA was generated into cDNA via reverse transcription (RT), and real-time PCR was performed using Taqman probes appropriate for each miRNA and mRNA according to the manufacturer's instructions.

[0081] Example 1. Isolation of extracellular vesicles through 3D culture of mesenchymal stem cells 1.1 Mesenchymal stem cell preparation Human umbilical cord-derived mesenchymal stem cells (WJ-MSCs) at passage 5 (hereafter referred to as WJ-MSCs, Samsung Medical Center, Seoul, Korea) were obtained and cultured at 37°C in a 5% CO2 incubator. The growth medium used was α-modified Eagle's medium (α-MEM, GIBCO, NY, USA) containing 10% fetal bovine serum (FBS) (GIBCO, NY, USA) and 50 μg / mL gentamicin (GIBCO, NY, USA). WJ-MSCs at passage 6 (passage 6) were used to generate 3D spheroid-type cell aggregates.

[0082] 1.2 Preparation of 3D spheroid-type cell aggregate culture medium WJ-MSCs at passage 6 (as prepared in Example 1.1) were washed with PBS, treated with trypsin (TrypLE™ Express, GIBCO, NY, USA), and incubated in a CO2 incubator for 5 minutes. Fresh serum-free medium was then added to neutralize the trypsin, and the cells were harvested and centrifuged to obtain a cell pellet. Fresh serum-free medium was then added, a cell suspension was prepared, and the cells were counted. After cell counting, 60 ml of cell suspension was uniformly dispensed at a density of 400 cells / well into a microarray containing approximately 69,000 microwells coated with MPC (2-Methacryloyloxyethyl Phosphorylcholine Polymer), each 500 μm in diameter and 200 μm in depth. Spontaneous spheroid cell aggregate formation was induced by maintaining a static state, and the cells were cultured in a CO2 incubator at 37°C for a total of 4 days to produce a 3D spheroid cell aggregate culture medium (hereinafter referred to as 3D-static-spheroid culture medium).

[0083] 1.3 Isolation of extracellular vesicles from 3D spheroid-type cell aggregates The 3D static spheroid culture medium prepared in Example 1.2 was collected, centrifuged at 2,500 g for 10 minutes, and filtered through a 0.22 μm syringe filter to remove cellular impurities. The 3D static spheroid culture medium was then passed through a 300 kDa hollow fiber membrane (Pall, NY, USA) using a tangential flow filtration (TFF) system to remove proteins and primarily isolate extracellular vesicles. The 3D static spheroid culture medium was then pelleted again with saline to obtain highly purified extracellular vesicles derived from the 3D static spheroids of the present invention (hereinafter referred to as 3D static spheroid EVs).

[0084] The processes of Examples 1.1 to 1.3 are illustrated in FIG.

[0085] Example 2. Analysis of the properties of 3D spheroid-type cell aggregates The characteristics of the 3D spheroid cell aggregates (hereinafter referred to as 3D-static spheroids) present in the 3D-static spheroid culture medium prepared in Example 1.2 were analyzed. The 3D-static spheroid culture medium prepared in Example 1.2 was used as the experimental group. The control group used 3D mesenchymal stem cell spheroid cell aggregates (hereinafter referred to as 3D-dynamic PEG spheroids) culture medium prepared by culturing mesenchymal stem cells for 5 days according to the dynamic 3D cell culture method disclosed in a registered patent (Application No. 10-2016-0053026, "Method for Producing Stem Cell-Derived Extracellular Vesicles") was used. Microwells containing each culture medium were observed under an optical microscope, as shown in Figures 2a and 2b. The change in the area of ​​the spheroid cell aggregates after initial culture is shown in Figure 2c.

[0086] As shown in Figure 2, the area of ​​the experimental 3D-static spheroids was compared with that of the comparative 3D-dynamic-PEG spheroids. The results showed that the area of ​​the 3D-static spheroids was statistically significantly smaller than that of the spheroids in the early stages of culture compared to the 3D-dynamic-PEG spheroids, due to the dense condensation of cells and their characteristic of forming spheroids (p=0.0011).

[0087] Example 3. Size analysis of 3D spheroid cell aggregates The size distribution of the 3D-static spheroids prepared in Example 1.2 and the 3D-dynamic-PEG spheroids prepared in Example 3 was measured, and the coefficient of variation, skewness, and kurtosis were analyzed based on the measured size distribution data.

[0088] Skewness is a parameter that can tell the direction and degree of inclination of a distribution from the trend of the median, and the closer it is to 1, the longer the tail of the distribution is to the right, and the closer it is to -1, the longer the tail of the distribution is to the left. The skewness of a normal distribution is 0.

[0089] Kurtosis is a parameter that indicates the peakedness of a data distribution. A positive value indicates that a relatively large number of data points are piled up in the center, and a negative value indicates that a relatively small number of data points are piled up in the center. For a normal distribution, the kurtosis is 0.

[0090] The measured size distribution data is shown in FIG. 3, and the analysis results are shown in Table 1.

[0091] [Table 1]

[0092] As shown in Figure 3 and Table 1, the 3D-static spheroids were found to have an average size of 74.43 μm with a coefficient of variation (CV) of 9.59%. In contrast, the 3D-dynamic PEG spheroids were found to have an average size of 148.66 μm with a coefficient of variation (CV) of 14.1%.

[0093] To compare the measured coefficients of variation, Feltz and Miller's (1996) asymptomatic test was performed, yielding a p-value of 0.01765604, and Krishnamoorthy and Lee's (2014) modified signed-likelihood ratio test was performed, yielding a p-value of 0.01853969. Therefore, both tests confirmed that the size distributions of 3D-static spheroids and 3D-dynamic PEG spheroids differed significantly.

[0094] Comparing the size distributions of 3D-static spheroids and 3D-dynamic-PEG spheroids, it was confirmed that the kurtosis value of the size distribution of the 3D-static spheroids was relatively large, and that the size distribution of the 3D-static spheroids of the present invention exhibited a tendency to be concentrated around the median. These results confirmed that the production of 3D spheroids using the 3D-static spheroid production method of the present invention makes it possible to produce 3D spheroids with a relatively uniform size.

[0095] Example 4. Analysis of the morphology of extracellular vesicles derived from 3D spheroid-type cell aggregates To observe the morphology of the 3D static spheroid EVs isolated in Example 1.3, transmission electron microscopy (TEM) images were taken. Specifically, 3D static spheroid EVs were fixed in 1% OsO4 dissolved in 0.1 M phosphate buffer (PB) for 2 hours. An EM grid was placed face down on Formvar and allowed to adsorb the extracellular vesicle droplets for 1 minute. The grid was then blotted with filter paper and reacted with 2% uranyl acetate for 15 seconds. After removing excess uranyl acetate, the EM grid was observed using a TEM (JEM-1011, JEOL, Japan). The observed images are shown in Figure 4.

[0096] As shown in Figure 4, the 3D static spheroid EVs were confirmed to have a round shape, which is a typical morphology of extracellular vesicles.

[0097] Example 5. Analysis of the concentration and size of extracellular vesicles derived from 3D spheroid-type cell aggregates To confirm the concentration and size distribution of the 3D-static spheroid EVs isolated in Example 1.3, nanoparticle tracking analysis (NTA) was performed using a NanoSight NS300 (Malvern, Worcestershire, UK). For optimal analysis, the 3D-static spheroid EVs were pre-diluted in vesicle-free phosphate buffer solution (PBS). The average size and concentration (particles / mL) were calculated by integrating three recordings, and the results are shown in Figure 5.

[0098] As shown in Figure 5, the average particle size of the 3D static spheroid EVs was confirmed to be 182.5 nm, and the mode diameter was confirmed to be 106.1 nm.

[0099] Example 6. Analysis of extracellular vesicle expression markers derived from 3D spheroid-type cell aggregates Experiments were conducted to confirm the expression markers of EVs from the 3D static spheroids isolated in Example 1.3. Cell lysate and secretome were used as controls. Cell lysate was prepared by washing 3D static spheroids with PBS, trypsinizing them, and then harvesting the cells. The harvested cells were then centrifuged to obtain a cell pellet. Secretome was prepared by harvesting the cell pellet, separating EVs from the supernatant culture medium using the procedure in Example 1.3, and obtaining the remaining culture secretome. Marker analysis was performed using ELISA to quantify the positive markers specific for extracellular vesicles (EVs), CD9, CD63, CD81, and HSP70, as well as specific contaminating protein markers, calreticulin, histone H2A.Z, cytochrome C, albumin, and antibiotics. Western blot analysis was also used to quantify specific extracellular vesicle contaminating protein markers, histone H2A.Z, histone H3, lamin A / C, and calreticulin, as well as extracellular vesicle-positive marker flotillin-1. The results of the ELISA analysis and Western blot analysis are shown in Figure 6.

[0100] As shown in Figure 6, 3D-static spheroid EVs expressed all of the extracellular vesicle-specific positive markers CD9, CD63, CD81, and HSP70, while the contaminating protein markers highly expressed in cell lysates and secretomes, such as calreticulin, histone H2A.Z, histone H3, cytochrome C, bovine serum albumin (BSA), lamin A / C, and antibiotics, were barely expressed. In particular, flotilin-1, an extracellular vesicle-specific positive marker that is very lowly expressed in cell lysates, was found to be relatively highly expressed in 3D-static spheroid EVs.

[0101] Example 7. Analysis of extracellular vesicle production from 3D spheroid-type cell aggregates An experiment was conducted to compare the production yields of 3D-static spheroid EVs (extracellular vesicles) prepared by the manufacturing method in Example 1, extracellular vesicles isolated from 3D-dynamic PEG spheroids (3D-dynamic PEG spheroid EVs) prepared in Example 2, and extracellular vesicles isolated from stem cells cultured using a conventional 2D culture method (2D-EVs). 2D-EVs were prepared as follows: Stem cells cultured in a cell stack for 3 days were washed with PBS, replaced with serum-free medium, and cultured for an additional 2 days. The culture medium was collected and subsequently centrifuged and filtered to remove extracellular material. The culture medium was then passed through a hollow fiber membrane using a TFF system to remove proteins, and EVs were first isolated. These were then further purified with saline to obtain highly purified 2D-EVs. The per-cell production yields of the prepared 3D-static spheroid EVs, 3D-dynamic PEG spheroid EVs, and 2D-EVs were compared, and the results are shown in Table 2 and Figure 7.

[0102] [Table 2]

[0103] Example 8. Verification of the 3D-static-spheroid EV effect depending on manufacturing conditions 8.1 Experimental methods and conditions The above examples confirmed the excellent effects of the 3D static spheroid EVs of the present invention. To confirm whether EVs produced using the same manufacturing method as in Example 1 but with different microwell specifications and cell numbers would exhibit the same effects, cells were cultured in the microwells, changing the cell count from 400 cells / well to 200 cells / well, or changing the microwells from 500 μm x 200 μm in diameter and depth to 500 μm x 600 μm or 800 μm in diameter and flat, flat wells.

[0104] The experimental conditions changed in the manufacturing method of Example 1 are shown in Table 3 below.

[0105] [Table 3]

[0106] WJ-MSCs at passage 6 (as prepared in Example 1.1) were washed with PBS, treated with trypsin (TrypLE™ Express, GIBCO, NY, USA), and incubated in a CO2 incubator for 5 minutes. Fresh serum-free medium was then added to neutralize the trypsin, and the cells were harvested and centrifuged to obtain cell pellets. Fresh serum-free medium was then added to prepare a cell suspension, and the cells were counted. After cell counting, the cells were evenly distributed into microwells under the conditions shown in Table 3, maintained in a static state, and spontaneous spheroid cell aggregate formation was induced. The cells were then cultured in a CO2 incubator at 37°C for a total of 4 days to prepare 3D spheroid cell aggregate culture medium.

[0107] 8.2 Confirmation of 3D spheroid-type cell aggregate morphology Under the conditions of Experimental Examples 1 to 3, it was confirmed that spheroids were uniformly formed, as in Example 1. The 3D spheroid-type cell aggregate culture medium was collected, and spheroid-derived extracellular vesicles were obtained by the method of Example 1.3. The size distribution of the obtained extracellular vesicles was measured, and the roundness and solidity of the additional spheroids were confirmed, and the results are shown in Figure 8.

[0108] As shown in Figure 8, it was confirmed that the size of the 3D spheroid cell aggregates produced in Experimental Examples 1 to 3 was within the range of 55 to 131 μm, which is the size range of the cell aggregates produced in Example 1, and the average value of the size distribution was 70.34 to 99.51 μm. In addition, when the roundness and solidity were confirmed, it was confirmed that the spheroid cell aggregates in Experimental Examples 1 to 3 also showed average roundness values ​​of 0.8751, 0.8669, and 0.8601, respectively, which is similar to the average roundness value of 0.8697 (CV 2.64%) of the 3D spheroid cell aggregates in Example 1, and that the spheroid cell aggregates in Experimental Examples 1 to 3 also showed average values ​​of 0.9744, 0.8669, and 0.9752, respectively, which is similar to the average solidity value of 0.9488 (CV 2.64%) of the 3D spheroid cell aggregates in Example 1.

[0109] These results indicate that 3D spheroid cell aggregates with similar morphologies can be effectively formed by the method of Example 1, even when the number of cells per microwell is changed to 200 or 400 and the diameter of the microwell is changed to 400-800.

[0110] 8.3 Comparison of miRNA expression patterns of EVs derived from 3D spheroid types Since it was confirmed that spheroid cell aggregates with a morphology similar to that of Example 1 could be produced under the conditions of Experimental Examples 1 to 3, extracellular vesicles were isolated and obtained using the method of Examples 1 and 3 to confirm whether the isolated EVs also exhibited the same miRNA expression pattern. Comparison of miRNA expression patterns was performed using extracellular vesicles derived from spheroid cell aggregates produced by the methods of Experimental Examples 1 and 2, which differed in microwell conditions. Expression miRNA was analyzed using qPCR. The results are shown in Figure 9. The miRNA expression patterns were compared with those of 2D-EVs produced in Example 7.

[0111] As shown in Figure 9, even when the microwell diameter was changed to 500 or 800 μm, miR-132 and miR-210 showed significantly increased expression compared to existing 2D-EVs, as in the EVs produced in Example 1. These results indicate that EVs derived from 3D spheroid cell aggregates obtained by the method of the present invention using microwells with diameters of 200 to 800 μm exhibit common miRNA marker expression characteristics. Therefore, these can all be referred to as 3D-static-spheroid EVs.

[0112] Example 9. Identification of candidate miRNAs for treating Moyamoya With consent from participants in the clinical trial (Clinicaltrials.gov. Unique identifier: NCT02743052), plasma samples were obtained from 10 Moyamoya (MMD) patients, 10 healthy controls (Normal), and 10 patients with intracranial arteriosclerosis (ICAS).

[0113] Through microarray mRNA experiments, miRNA levels were confirmed in microvesicles isolated from pooled samples. Specifically, the miRNA profiles in the microvesicles were measured using a Human Whole-miRNome Array and the miScript SYBR green PCR kit. 4 μl of RNA was reverse transcribed to cDNA using the miScript II RT kit. A 1:20 dilution of the RT product was used as the PCR template. qRT-PCR was performed on an ABI 7900HT Real-Time PCR System in 384-well plates containing synthetic miRNAs (miRTC), a positive PCR control, and a housekeeping reference. Raw data were normalized to the reference miRNA included on the entire plate, and to calculate Cq values, normalized to the global Ct mean. The miRNA patterns in microvesicles derived from plasma from normal subjects, ICAS, and moyamoya patients were compared, and differentially up- or down-regulated miRNAs were identified in moyamoya patients compared to normal subjects and ICAS. Additionally, plasma was separated from the blood of four patients with Moyamoya disease (MMD) and four healthy controls (normal subjects), and extracellular vesicles were isolated by ultra-high-speed centrifugation. RNA was isolated from the isolated extracellular vesicles and small RNA sequencing was performed.

[0114] As a result, it was confirmed that miR-19b-3p (MIMAT0000074, UGUGCAAAUCCAUGCAAAACUGA (SEQ ID NO: 1)), miR-101-3p (MIMAT0000099, UACAGUACUGUGAUAACUGAA (SEQ ID NO: 2)), miR-100-5p (MIMAT0000098, AACCCGUAGAUCCGAACUUGUG (SEQ ID NO: 3)), miR-122-5p (MIMAT0000421, UGGAGUGUGACAAUGGUGUUUG (SEQ ID NO: 4)), and miR-99a-5p (MIMAT0000097, AACCCGUAGAUCCGAUCUUGUG (SEQ ID NO: 5)) were specifically down-regulated in moyamoya patients compared to normal subjects. The results are shown in Figures 10 and 11. Furthermore, quantitative PCR was performed using a Taqman probe for miR-100-5p, miR-122-5p, and miR-99a-5p, whose reduction was confirmed by Small RNA seq, and the results are shown in FIG.

[0115] As shown in Figures 10, 11, and 12, miR-101-3p, miR-19b-3p, miR-100-5p, miR-122-5p, and miR-99-5p were significantly down-expressed in plasma-derived microvesicles from Moyamoya patients, unlike normal controls. These results confirmed that plasma microvesicle-derived miR-101-3p, miR-19b-3p, miR-100-5p, miR-122-5p, and miR-99-5p could be potential therapeutic candidates for Moyamoya disease. The accession numbers and sequence information for miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p of the present invention are listed in Table 4.

[0116] [Table 4]

[0117] Example 10. Confirmation of Moyamoya-related miRNA expression in 3D-static-spheroid EVs The expression of miR-101-3p, miR-19b-3p, miR-100-5p, miR-122-5p, and miR-99-5p was confirmed in 3D static spheroid EVs, which are extracellular vesicles prepared by the method of Example 1, and this was compared with the expression of existing 2D-EVs obtained by the method of Example 7, and also compared using U6 snRNA as an internal control. The miRNA expression levels were measured by qPCR using a tagman probe, and the results are shown in Figures 13 and 14.

[0118] As a result, it was confirmed that the 3D-static-spheroid EVs of the present invention exhibited relatively low Ct values ​​and high miRNA expression. As shown in Figures 13 and 14, the qPCR results confirmed that the expression of miR-101-3p, miR-19b-3p, and miR-122-5p was significantly higher in the 3D-static-spheroid EVs of the present invention than in existing 2D-EVs.

[0119] In other words, these results confirmed that 3D-static-spheroid EVs have novel miRNA expression characteristics compared to conventional 2D-EVs. In particular, they contain high concentrations of miR-101-3p, miR-19b-3p, miR-100-5p, miR-122-5p, and miR-99-5p, all of which are down-expressed in the microvesicles of Moyamoya patients, confirming their potential as therapeutic agents for Moyamoya disease.

[0120] Example 11. Confirmation of the therapeutic effect of 3D-static-spheroid EV treatment on Moyamoya in vitro To confirm whether 3D-static-spheroid EVs containing a high proportion of miRNAs down-expressed in the microvesicles of Moyamoya patients are effective in treating Moyamoya, a Moyamoya disease model was created using vascular endothelial cells, and its effectiveness was confirmed.

[0121] The RNF213 gene, known to be the main genetic factor behind Moyamoya disease, was knocked out to create RNF213-silenced cells. After treating the model with 3D-static spheroid EVs, the therapeutic effect on Moyamoya disease was confirmed.

[0122] 1.5x10 to measure cell phenotype and gene expression induced by RNF213 siRNA 5 HUVECs were seeded into a 6-well culture plate. The next day, cells were transfected using Invitrogen's RNAimax according to the manufacturer's protocol. The cells were transfected for 6 hours in a CO2 humidified chamber. The siRNA used for transfection was a mixture of two siRNA sequences targeting RNF213. As a control, a negative control siRNA designed not to target the gene was used. After transfection of each siRNA at 60 nM, the medium was replaced with antibiotic-free medium. 4.5 x 10 8 They were treated with EV and used for phenotypic experiments 16 hours after EV treatment.

[0123] The siRNA and RNF213 siRNA sequences used for the control experiments are shown in Table 5 below.

[0124] [Table 5]

[0125] Specifically, to confirm the tube formation effect, HUVECs were cultured in M199 medium (Gibco) supplemented with 20% FBS, 5 U / mL heparin, and 3 ng / mL bFGF. 1.7 × 10 cells were cultured. 4Cells were seeded onto growth factor-reduced Matrigel Matrix (BD Bioscience, MA, USA) in μ-Slides Angiogenesis (ibidi, Graefelfing, Germany) at a density of 1000 μM and allowed to form tubes for 4 hours in a humidified chamber at 37°C and 5% CO2. Images were taken using a phase-contrast microscope (Olympus), and the number of tube-shaped structures was quantified in the microscopic field (4x magnification) using ImageJ software. Changes in the angiogenic and proliferative abilities of endothelial cells following treatment with RNF213 siRNA and 3D-static spheroid EVs were confirmed, and the results are shown in Figures 15 and 16. As shown in Figures 15 and 16, the RNF213 siRNA-treated group exhibited a decrease in blood vessels compared to the control group. Treatment with the 3D-static spheroid EVs of the present invention improved the morphological changes in blood vessels caused by the RNF213 mutation, restoring the decreased blood vessels and increasing the number of endothelial cells.

[0126] These results indicate that 3D-static-spheroid EVs can be utilized as a therapeutic agent for Moyamoya disease.

[0127] Example 12. Confirmation of changes in moyamoya-related miRNA expression by 3D-static-spheroid EV treatment In Example 11, we confirmed that 3D-static spheroid EVs improved vascular morphological changes and vascular hypovascularity caused by RNF213 mutations and restored cell proliferation in a Moyamoya disease model. Therefore, we conducted an experiment to confirm whether the above-mentioned effects of 3D-static spheroid EVs were achieved by upregulating the expression of miRNAs that were reduced in Moyamoya patients. Specifically, after treatment of vascular endothelial cells with the RNF213 siRNA listed in Table 5, changes in the expression of miR-101-3p and miR-19b-3p were observed. Furthermore, after siRNA treatment, the cells were treated with 3D-static spheroid EVs to determine whether the expression patterns of these miRNAs were altered. The relative expression levels were measured, and the results are shown in Figure 17.

[0128] As shown in Figure 17, treatment with 3D-static spheroid EVs significantly increased the expression of miR-101-3p and miR-19b-3p in vascular endothelial cells. This result indicates that the therapeutic effect of 3D-static spheroid EV treatment on Moyamoya disease is related to the increase in miRNAs abundantly expressed in 3D-static spheroid EVs. In other words, treatment with the 3D-static spheroid EVs of the present invention increased miRNAs that were down-regulated in Moyamoya patients compared to normal controls, thereby demonstrating a therapeutic effect on Moyamoya disease.

[0129] Example 13. Confirmation of the therapeutic effect of 3D-static-spheroid EV treatment on Moyamoya in vivo 13.1 Preparation of Moyamoya Disease-Mimicking Animal Model and Confirmation of Changes in Cerebral Blood Flow The therapeutic effect of 3D-static-spheroid EV treatment on Moyamoya was confirmed using a Moyamoya disease-mimicking animal model.

[0130] The moyamoya pseudo-model was created based on the method of Roberts JM et al. (Internal carotid artery stenosis: A novel surgical model for moyamoya syndrome. PLoS ONE 13(1):e0191312). Using a microcoil-based cerebral artery stenosis method, vasoconstriction of the distal internal carotid artery (ICA) and anterior cerebral artery (ACA) can be induced in the circle of Willis in an animal model. Furthermore, the number of anastomoses between the middle cerebral artery and anterior cerebral artery in the cortical region is significantly reduced, making this method known to be an effective model of moyamoya disease.

[0131] Surgery and monitoring were performed in accordance with the guidelines of the Laboratory Animal Research Center (LARC; AAALAC International, private institution) at Samsung Medical Center. Adult male C57BL / 6 mice (10-12 weeks old) weighing between 20 and 28 g were randomly assigned to sham-operated (n = 3), vehicle-treated (PBS-treated group, n = 7), and 3D-static-spheroid EV-treated groups (n = 8). Mice were maintained in a temperature-controlled facility with a 12-h light / dark cycle and had free access to food and water.

[0132] We created an animal model mimicking Moyamoya disease by using a 0.18 mm diameter coil to induce bilateral common carotid artery stenosis (BCAS) in C57BL6 mice. The 0.18 mm coil can induce cerebral hypoperfusion for 3 months without affecting blood pressure. Specifically, the experiment was performed as follows: Anesthesia was induced using 2% isoflurane and maintained at 1.5% isoflurane in 80% nitrous oxide and 20% oxygen. Rectal temperature was maintained between 36.5°C and 37.5°C. Bilateral common carotid arteries were exposed through a midline cervical incision, and microcoils with an internal diameter of 0.18 mm (Sawane Spring, Japan) were applied to both common carotid arteries. All animals were randomly assigned to either a vehicle experimental group or a 3D-static-spheroid EV-treated group (hereafter referred to as the EV-treated group). The EV-treated group received 6x10 8 3D-static spheroids were administered intravenously (iv) via the tail vein with 100 μl of DPBS containing EVs. The vehicle experimental group received 100 μl of DPBS intravenously via the tail vein every day for 5 days after BCAS surgery, in the same manner as the EV-treated group. On day 28 after BCAS, mice were sacrificed under anesthesia.

[0133] In a mock animal model of Moyamoya disease, cerebral blood flow was measured using laser speckle imaging equipment the day after model creation. Cerebral blood flow was measured before BCAS surgery and at 1 day, 1 week, 2 weeks, and 4 weeks after surgery. Cerebral blood flow values ​​are expressed as percentages of baseline values. For quantitative analysis, four or more regions of interest (ROIs) were analyzed in each mouse. The experimental protocol is briefly outlined in Figure 18, and images of cerebral blood flow measurements and quantitative results are shown in Figure 19.

[0134] As shown in Figure 19(a) and (b), a clear decrease in cerebral blood flow was confirmed after BCAS surgery. Subsequently, the PBS-treated group did not recover cerebral blood flow, but the 3D-static-spheroid EV-treated group showed a statistically significant increase in cerebral blood flow.

[0135] 13.2 Confirmation of the Effect of 3D-Static-Spheroid EV Treatment on Cerebral Vascular Anastomosis Currently, Moyamoya disease is only treated by surgical methods such as direct and indirect vascular anastomosis. Thus, vascular anastomoses are known to be extremely important in the treatment of Moyamoya disease.

[0136] To confirm whether the present invention's 3D static spheroid EVs could demonstrate the effect of vascular anastomosis in a pseudo-model of Moyamoya disease, we performed an experiment to stain cerebral blood vessels with Indian ink via cardiac perfusion on day 28 of model creation and measure the change in the number of vascular anastomoses. Prior to staining, black India ink concentrate (Winsor & Newton, London, UK) was filtered through an RC membrane filter (pore size: 0.2 μm). Mice were sacrificed on day 28 after BCAS for Indian ink staining. Mice were anesthetized with a mixture of ketamine (60 mg / kg, Yuhan Corporation, Korea) and xylazine (6 mg / kg, Rompun Inj., Bayer, Berlin, Germany). Under deep anesthesia, an aortic catheter (internal jugular 0.76 mm, Vasofix Braunuele, Braun, Melsungen, Germany) was inserted and a sublethal dose of 50 mg / kg papaverine hydrochloride was injected. After 60 seconds, the mice were perfused with 10 ml of DPBS, followed by perfusion with 10% Indian ink and 3% gelatin in PBS using a gear pump (Miniplus 3, Gilson) at 37°C and 85 mmHg under pressure-regulated fluid flow. The brains were then removed and fixed in 4% paraformaldehyde (PFA) in PBS at 4°C for 48 hours. They were then placed in 30% sucrose in PBS and stored at 4°C until completely sunk to the bottom. Coronal sections (40 μm) were collected from +0.5 mm to -0.5 mm around the bregma using a cryostat (cryotom FSE, Thermo Scientific). The sections were then mounted on gelatin-coated slides (Marienfeld GmbH, Lauda-Koenigshofen, Germany), dehydrated at room temperature for 30 minutes, and then mounted with a coverslip using mounting medium (H-5000, Vector Lab, Burlingame, CA, USA).In the sections, the diameters of the internal carotid artery (ICA), middle cerebral artery (MCA), posterior communicating artery (PCOM), anterior cerebral artery (ACA), and basilar artery (BA) in the Circle of Willis (CoW) were measured, as well as the number of vascular anastomoses between the middle cerebral artery and the anterior cerebral artery, to confirm the diameter of the Circle of Willis. The results of vascular staining are shown in Figure 20, and the changes in the diameter of the Circle of Willis and the number of vascular anastomoses are shown in Figure 21.

[0137] As shown in Figures 21a and 21b, in the vehicle experimental group administered only PBS after BCAS surgery, a decrease in vascular diameter due to stenosis and occlusion of the internal carotid artery, a characteristic phenomenon of Moyamoya disease, was clearly observed in the internal carotid artery, middle cerebral artery, and posterior communicating artery. In contrast, in the EV-treated group, not only was the diameter of the circle of Willis significantly restored, but the number of vascular anastomoses was also significantly increased. These results indicate that the extracellular vesicles of the present invention can effectively improve the typical symptoms of Moyamoya disease or syndrome, such as internal carotid artery stenosis and occlusion, a decrease in the diameter of major cerebral blood vessels, a decrease in lateral circulation between major cerebral blood vessels, and the resulting decrease in cerebral perfusion.

[0138] These results confirm that the 3D-static-spheroid EVs of the present invention can achieve vascular anastomosis without vascular anastomosis surgery, restore cerebral vascular diameter, restore cerebral blood flow to normal levels, and increase blood flow in a new direction, demonstrating that the EVs of the present invention have a direct therapeutic effect on Moyamoya.

[0139] While the specific details of the present invention have been described above, it is obvious to those skilled in the art that these specific techniques are merely preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the true scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome, comprising extracellular vesicles containing one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p.

2. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 1, wherein the extracellular vesicles highly express the one or more miRNAs compared to naturally secreted extracellular vesicles or extracellular vesicles derived from two-dimensionally cultured stem cells.

3. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 2, wherein the extracellular vesicles are extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by a method comprising the following steps: (a) producing a three-dimensional spheroid-type cell aggregate by three-dimensionally (3D) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

4. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 1, wherein the extracellular vesicles induce an increase in one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p in patients with Moyamoya disease or Moyamoya syndrome.

5. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 1, wherein the extracellular vesicles are for improving the decreased angiogenic and cell proliferation abilities of vascular endothelial cells induced by mutation or deficiency of the RNF213 (Ring finger protein 213) gene.

6. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 1, wherein the extracellular vesicles are for inducing vascular anastomosis, increasing cerebral vascular diameter, or increasing cerebral blood flow.

7. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 1, wherein the extracellular vesicles are for intravenous administration.

8. 2. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 1, wherein the Moyamoya syndrome is Moyamoya syndrome that develops secondarily due to infection, vasculitis, autoimmune disease, Down's syndrome, neurofibromatosis, or radiation therapy for brain tumors.

9. 2. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 1, wherein the composition is for administration before or after direct or indirect vascular anastomosis.

10. (a) producing a three-dimensional spheroid-type cell aggregate by three-dimensionally (3D) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm; and (b) separating extracellular vesicles from the three-dimensional spheroid cell aggregates; and a pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome, comprising extracellular vesicles derived from the three-dimensional spheroid cell aggregates.

11. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 10, wherein the stem cells are at least one selected from the group consisting of mesenchymal stem cells, pluripotent stem cells, induced pluripotent stem cells, and embryonic stem cells.

12. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 10, wherein the extracellular vesicles highly express one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p compared to naturally secreted extracellular vesicles or extracellular vesicles derived from two-dimensionally cultured mesenchymal stem cells.

13. A pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome, comprising one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p.

14. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 13, wherein the miRNA is contained in a plasmid, a viral vector, or a non-viral transporter.

15. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 13, wherein the miRNA is contained in an exosome, a microvesicle, or an extracellular vesicle.

16. The pharmaceutical composition for preventing or treating Moyamoya disease or Moyamoya syndrome according to claim 15, wherein the extracellular vesicles are extracellular vesicles derived from three-dimensional spheroid cell aggregates produced by a method comprising the following steps: (a) producing a three-dimensional spheroid-type cell aggregate by three-dimensionally (3D) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregates.

17. (a) producing a three-dimensional spheroid-type cell aggregate by three-dimensionally (3D) statically culturing stem cells in microwells having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm; and (b) separating extracellular vesicles from the three-dimensional spheroid cell aggregates; and an in vitro composition for vascular anastomosis of vascular endothelial cells induced by a mutation or deletion of the RNF213 (Ring finger protein 213) gene, comprising extracellular vesicles derived from the three-dimensional spheroid cell aggregates produced by the above step.

18. (a) producing a three-dimensional spheroid-type cell aggregate by three-dimensionally (3D, 3 dimension) statically culturing stem cells in a microwell having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm; and (b) a step of separating extracellular vesicles from the three-dimensional spheroid cell aggregate; A method for producing a composition for preventing or treating Moyamoya disease or Moyamoya syndrome, comprising:

19. A method for preventing or treating moyamoya disease or moyamoya syndrome, comprising the step of administering to an individual in need thereof extracellular vesicles containing one or more miRNAs selected from the group consisting of miR-19b-3p, miR-99a-5p, miR-100-5p, miR-101-3p, and miR-122-5p.

20. (a) producing a three-dimensional spheroid-type cell aggregate by three-dimensionally (3D, 3 dimension) statically culturing stem cells in a microwell having a diameter of 200 to 800 μm and a depth of 100 to 1000 μm; and (b) isolating extracellular vesicles from the three-dimensional spheroid cell aggregate; and administering the extracellular vesicles derived from the three-dimensional spheroid cell aggregate to an individual in need thereof.

Citation Information

Patent Citations

  • Method and appartus for trnamitting control signal in a wireless communication system

    KR1020230161242A