Aptamers, containers and methods for cell transduction

Abstract

The present disclosure relates generally to nucleic acid aptamers that are particularly useful for cell transduction, as well as containers (such as bags) having a surface that includes one or more such aptamers, and transduction methods that use such aptamers and containers. One embodiment of the disclosure provides a DNA aptamer that includes multiple nucleotides and has at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).

Description

[Technical Field]

[0001] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 384,354, filed November 18, 2022, which is incorporated herein by reference in its entirety.

[0002] INCORPORATION-BY-REFERENCE OF SEQUENCE LISTINGS PROVIDED ELECTRONICALLY This application contains a Sequence Listing that has been submitted as an electronic text file entitled "22-1286-US_SequenceListing_ST26.xml" having a size of 2894 bytes and created on November 20, 2023. The information contained in this electronic file is incorporated herein by reference in its entirety. [Background technology]

[0003] FIELD OF THE INVENTION The present disclosure relates generally to nucleic acid aptamers that are particularly useful for cell transduction, as well as containers (such as bags) having surfaces that include one or more such aptamers, and transduction methods using such aptamers and containers.

[0004] (Technical background) Transduction, the process by which foreign DNA is introduced into target cells, for example, by viral vectors, is important in many applications. For example, CAR T cell therapy is a cancer treatment in which T cells taken from a patient are transduced with a gene encoding a chimeric antigen receptor (CAR). After expansion and reintroduction into the patient, the modified cells are able to bind to and kill cancer cells. Furthermore, viral transduction is commonly used in basic genetic research.

[0005] However, gene transfer from viral vectors can be inefficient for certain cell types, such as hematopoietic cells and other suspension cells. Traditionally, the transduction efficiency of such systems can be improved by using enhancers such as polybrene, protamine sulfate, or retronectin. Polybrene and protamine sulfate improve transduction efficiency by modifying the surface properties of target cells. However, these types of enhancers can negatively affect cell viability. Alternatively, retronectin, a polypeptide containing a heparin-binding domain with binding affinity for viral particles and two cell-binding domains with binding affinity for VLA-4 and VLA-5 surface receptors, can improve transduction efficiency by promoting colocalization of viral vectors and target cells.

[0006] Conventionally, transduction enhancers such as RetroNectin must be manually coated onto containers prior to the transduction process. Because coated containers require special refrigeration and have a short shelf life, the relatively expensive and time-consuming coating process typically needs to be performed immediately before the transduction process by the user.

[0007] Therefore, there remains a need for a simple, cost-effective, and / or time-efficient system for cell transduction. Summary of the Invention

[0008] In one aspect, the present disclosure provides a DNA aptamer, wherein the DNA aptamer has at least 80% sequence identity to the sequence of SEQ ID NO: 1 (ie, AAACTGCAGCGATTCATTAGTACGGCCTTT).

[0009] In another aspect, the present invention provides a DNA aptamer having at least 80% sequence identity to the sequence of SEQ ID NO: 2 (ie, CGAGGCTCTCGGGACGACAAACTGCAGCGATTCATTAGTACGGCCTTTGTCGTCCCGCCTTTAGGATTTACAG).

[0010] In one aspect, the present disclosure provides a surface for cell transduction, having a DNA aptamer described herein disposed thereon, eg, by covalent attachment.

[0011] In another aspect, the present disclosure provides a container (e.g., in the form of a bag) having an exterior surface and an interior surface, the interior surface comprising: polymers, such as fluoropolymers; a plurality of functional groups attached to the polymer; and A DNA aptamer as described herein attached to each of at least a portion of the functional groups. A container is provided, comprising:

[0012] In another aspect, the disclosure provides a method of transduction comprising contacting a viral vector and a target cell with a surface within a vessel described herein.

[0013] Other aspects of the present disclosure will be apparent to those skilled in the art in view of the disclosure herein. [Brief explanation of the drawings]

[0014] [Figure 1] 1A-1C are schematic top view (top) and cross-sectional view (bottom) of a bag according to one embodiment of the present disclosure. [Figure 2] FIG. 1 is a schematic top view of a bag according to one embodiment of the present disclosure. [Figure 3] FIG. 1 shows the process of elution aptamer selection. [Figure 4] 1 is a graph showing aptamer enrichment. [Figure 5] FIG. 10 illustrates a process of parallel evaluation. [Figure 6] FIG. 1 illustrates the process of bioinformatics and candidate selection. [Figure 7] Graph of the distribution of family frequencies from the P191(+)G11(P) library that are not represented in G11(C). [Figure 8] 1 is a set of graphs of SPR-based evaluation of SGO-P06701 against target and counter-target. DETAILED DESCRIPTION OF THE INVENTION

[0015] The inventors noted that cell transduction can be performed on surfaces carrying aptamers with binding affinity for the cellular receptor VLA-4, which is found on the surface of a variety of cell types, including stem cells, progenitor cells, T and B cells, monocytes, natural killer cells, and eosinophils.

[0016] The present inventors have now identified a set of DNA aptamers that can have high affinity for binding to the cellular VLA-4 surface receptor. Accordingly, one embodiment of the present disclosure is a DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (i.e., AAACTGCAGCGATTCATTAGTACGGCCTTT). In another embodiment, the present invention provides a DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 2 (i.e., CGAGGCTCTCGGGACGACAAACTGCAGCGATTCATTAGTACGGCCTTTGTCGTCCCGCCTTTAGGATTTACAG). Without intending to be bound by theory, the present inventors believe that it is the sequence of SEQ ID NO: 1 that drives the selectivity of binding to VLA-4. As described in the Examples below, various test sequences were placed between the PCR primer annealing regions in the structure (5'-CGA GGC TCT CGG GAC GAC-[sequence]-GTC GTC CCG CCT TTA GGA TTT ACA G-3'). Therefore, the sequence between the PCR primer annealing regions appears to be of primary importance. The sequence of SEQ ID NO: 1 was shown to have high selectivity when present in a molecule of the above structure (i.e., having the sequence of SEQ ID NO: 2). Other sequences placed between these PCR primer annealing regions provided much less selective binding.

[0017] As used herein, the term "DNA aptamer" (sometimes shortened to "aptamer") refers to a polydeoxyribonucleotide (i.e., having any number of nucleotides greater than or equal to two) that can bind (e.g., with high affinity and specificity) to a target molecule, typically a protein, peptide, or small molecule. Aptamers typically have a defined secondary or tertiary structure due to their tendency to form complementary base pairs and, therefore, can often fold into diverse and complex molecular structures. The three-dimensional structure is essential for aptamer binding affinity and specificity, and specific three-dimensional interactions drive the formation of the aptamer-target complex. Aptamers are typically selected in vitro from very large libraries of randomized sequences by the process of systematic evolution of ligands by exponential enrichment (SELEX as described in Ellington AD, Szostak JW (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346:818-822; Tuerk C, Gold L (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:505-510). However, certain DNA aptamers disclosed herein can be generated using DNA synthesis techniques familiar to those skilled in the art by modification of the sequences of SEQ ID NOs: 1 and 2. The Examples section provided below describes the development of the aptamers of SEQ ID NOs: 1 and 2.

[0018] As used herein, nucleotides having a particular % sequence identity to a particular SEQ ID NO have the % sequence identity of the nucleotides in the sequence of SEQ ID NO that are in the same relative positions relative to each other. Such nucleotides may have more or fewer nucleotides than the number of nucleotides recited in the SEQ ID NO (i.e., 30 or 73), so long as the recited specific sequence identity is met.

[0019] In various embodiments, the DNA aptamer has at least 80% (i.e., at least 24 / 30) sequence identity with the sequence of SEQ ID NO:1. In various embodiments, the DNA aptamer has at least 86.6% (i.e., at least 26 / 30) sequence identity with the sequence of SEQ ID NO:1. In various embodiments, the DNA aptamer has at least 90% (i.e., at least 27 / 30) sequence identity with the sequence of SEQ ID NO:1. In various embodiments, the DNA aptamer has at least 93.3% (i.e., at least 28 / 30) sequence identity with the sequence of SEQ ID NO:1. In various embodiments, the DNA aptamer has at least 96.6% (i.e., at least 29 / 30) sequence identity with the sequence of SEQ ID NO:1. In various embodiments, the DNA aptamer comprises the sequence of SEQ ID NO:1, i.e., has 100% (30 / 30) sequence identity with the sequence of SEQ ID NO:1. In some embodiments, additional nucleotides may be present in addition to the nucleotides listed in SEQ ID NO:1. However, in other such cases, the nucleotide of SEQ ID NO: 1 is the only nucleotide of the DNA aptamer.

[0020] Similarly, as used herein, nucleotides having a given percent sequence identity to SEQ ID NO:2 have at least 80% (i.e., at least 58 / 73) of the nucleotides in SEQ ID NO:2 in the same relative positions relative to each other. Such nucleotides may have more or fewer nucleotides than the 73 nucleotides listed in SEQ ID NO:2, so long as the specified sequence identity is met. In various embodiments, a DNA aptamer has at least 85% (i.e., at least 62 / 73) sequence identity with the sequence of SEQ ID NO:2. In various embodiments, a DNA aptamer has at least 90% (i.e., at least 66 / 73) sequence identity with the sequence of SEQ ID NO:2. In various embodiments, a DNA aptamer has at least 91.7% (i.e., at least 67 / 73) sequence identity with the sequence of SEQ ID NO:2. In various embodiments, a DNA aptamer has at least 93.1% (i.e., at least 68 / 73) sequence identity with the sequence of SEQ ID NO:1. In various embodiments, the DNA aptamer has at least 94.5% (i.e., at least 69 / 73) sequence identity with the sequence of SEQ ID NO:2. In various embodiments, the DNA aptamer has at least 95.8% (i.e., at least 70 / 73) sequence identity with the sequence of SEQ ID NO:2. In various embodiments, the DNA aptamer has at least 97.2% (i.e., at least 71 / 73) sequence identity with the sequence of SEQ ID NO:2. In various embodiments, the DNA aptamer has at least 98.6% (i.e., at least 72 / 73) sequence identity with the sequence of SEQ ID NO:2. In various embodiments, the DNA aptamer comprises the sequence of SEQ ID NO:2, i.e., has 100% (73 / 73) sequence identity with the sequence of SEQ ID NO:2. In some embodiments, additional nucleotides may be present in addition to the listed nucleotides. However, in other such cases, the nucleotides of SEQ ID NO:2 are the only nucleotides of the DNA aptamer.

[0021] It may be desirable for a relatively large section of the sequence of SEQ ID NO:1 or SEQ ID NO:2 to be present in a DNA aptamer as described elsewhere herein. For example, in various embodiments, the DNA aptamers described elsewhere herein have at least one span of 10 consecutive nucleotides in common with the sequence of SEQ ID NO:1, e.g., one such span, two such spans, or three such spans. In various embodiments, the DNA aptamers described elsewhere herein have at least one span of 15 consecutive nucleotides in common with the sequence of SEQ ID NO:1, e.g., one such span or two such spans. In various embodiments, the DNA aptamers described elsewhere herein have a span of 20 consecutive nucleotides in common with the sequence of SEQ ID NO:1. In various embodiments, the DNA aptamers described elsewhere herein have a span of 25 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0022] Similarly, in various embodiments, the DNA aptamers described elsewhere herein have at least one span of 10 contiguous nucleotides in common with the sequence of SEQ ID NO:2, e.g., one such span, or two such spans, or three such spans, or four such spans, or five such spans, or six such spans. In various embodiments, the DNA aptamers described elsewhere herein have at least one span of 20 contiguous nucleotides in common with the sequence of SEQ ID NO:2, e.g., one such span, or two such spans, or three such spans. In various embodiments, the DNA aptamers described elsewhere herein have at least one span of 30 contiguous nucleotides in common with the sequence of SEQ ID NO:2, e.g., one such span or two such spans. In various embodiments, the DNA aptamers described elsewhere herein have a span of 40 contiguous nucleotides in common with the sequence of SEQ ID NO:2. In various embodiments, the DNA aptamers described elsewhere herein have a span of 50 contiguous nucleotides in common with the sequence of SEQ ID NO:2. In various embodiments, the DNA aptamers described elsewhere herein have a span of 60 contiguous nucleotides in common with the sequence of SEQ ID NO: 2. In various embodiments, the DNA aptamers described elsewhere herein have a span of 70 contiguous nucleotides in common with the sequence of SEQ ID NO: 2.

[0023] The DNA aptamer described elsewhere herein can have various lengths.For example, in various embodiments, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 described elsewhere herein has at least 24 nucleotides, for example, at least 26 nucleotides, or at least 27 nucleotides, or at least 28 nucleotides, or at least 29 nucleotides, or at least 30 nucleotides.In various embodiments, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 described elsewhere herein has 200 nucleotides or less, for example, 100 nucleotides or less, or 75 nucleotides or less, or 50 nucleotides or less, or 40 nucleotides or less, or 35 nucleotides or less, or 30 nucleotides or less. In various embodiments, a DNA aptamer having at least 80% sequence identity to the sequence of SEQ ID NO: 1, as described elsewhere herein, is 24 to 200 nucleotides, e.g., 26 to 200, or 27 to 200, or 28 to 200, or 29 to 200, or 30 to 200, or 24 to 150, or 26 to 150, or 27 to 100, or 28 to 100, or 29 to 100, or 30 to 100, or 24 to 75, or 26 to 75, or 27 to 75, or 28 to 75, or 29 to 75, or 30 to 75, or 24 to 50, or 26 to 50, or 27 to 50, or 28 to 50, or 29 to 50, or 30 to 50, or 24 to 40, or 26 to 40, or 27 to 40, or 28 to 40, or 29 to 40, or 30 to 40 nucleotides. For example, in some embodiments, a DNA aptamer having at least 80% sequence identity to the sequence of SEQ ID NO: 1, described elsewhere herein, has a range of 24 to 36 nucleotides, e.g., 26 to 36, or 28 to 36, or 30 to 36, or 24 to 34, or 26 to 34, or 28 to 34, or 30 to 34, or 24 to 32, or 26 to 32, or 28 to 32, or 30 to 32, or 24 to 30, or 26 to 30, or 28 to 30, or 30 nucleotides.

[0024] Similarly, in various embodiments, a DNA aptamer having at least 80% sequence identity to the sequence of SEQ ID NO:2 described elsewhere herein has at least 60 nucleotides, e.g., at least 65 nucleotides, or at least 70 nucleotides, or at least 71 nucleotides, or at least 72 nucleotides, or at least 73 nucleotides. In various embodiments, a DNA aptamer having at least 80% sequence identity to the sequence of SEQ ID NO:2 described elsewhere herein has 200 nucleotides or less, e.g., 150 nucleotides or less, or 100 nucleotides or less, or 80 nucleotides or less, or 75 nucleotides or less, or 74 nucleotides or less, or 73 nucleotides or less. In various embodiments, a DNA aptamer having at least 80% sequence identity to the sequence of SEQ ID NO:2, as described elsewhere herein, is 60 to 200 nucleotides, e.g., 65 to 200, or 70 to 200, or 71 to 200, or 72 to 200, or 73 to 200, or 60 to 150, or 70 to 150, or 71 to 150, or 72 to 150, or 73 to 150, or The DNA aptamer has a range of 60 to 100, or 70 to 100, or 71 to 100, or 72 to 100, or 73 to 100, or 60 to 80, or 70 to 80, or 71 to 80, or 72 to 80, or 73 to 80, or 60 to 75, or 65 to 75, or 70 to 75, or 60 to 74, or 65 to 74, or 70 to 74, or 60 to 73, or 65 to 73, or 70 to 73 nucleotides. For example, in some embodiments, a DNA aptamer having at least 80% sequence identity to the sequence of SEQ ID NO: 2 described elsewhere herein has a range of 71 to 75 nucleotides, e.g., 72 to 75, or 73 to 75, or 71 to 74, or 72 to 74, or 73 to 74, or 71 to 73, or 72 to 73, or 73 nucleotides.

[0025] The DNA aptamers described herein may contain only a single instance of a sequence having a desired percent identity to a particular sequence described herein (i.e., of SEQ ID NO: 1 or SEQ ID NO: 2). However, in other embodiments, the DNA aptamer has multiple repeats of such a sequence, for example, at least 2, at least 5, at least 10, or at least 25, or at least 50, or at least 75, or at least 100, or at least 200, or at least 300, or at least 400, or at least 500, or at least 750, or at least 1000 repeats of the sequence. Polynucleotides containing multiple repeats of a given aptamer sequence can be generated via rolling circle amplification (RCA) of a template corresponding to the desired aptamer sequence.

[0026] In various embodiments described elsewhere herein, the DNA aptamer has a binding affinity for VLA-4 of at least 0.1 nM. For example, in certain such embodiments, the DNA aptamer has a binding affinity for VLA-4 of at least 0.25 nM, or at least 0.5 nM, 0.75 nM, or at least 1 nM, or at least 2.5 nM, or at least 5 nM, or at least 10 nM, or at least 25 nM, or at least 50 nM, or at least 75 nM, or at least 100 nM. As used herein, binding affinity is determined as described in the Examples below. Those skilled in the art can select a binding affinity that provides a desired degree of VLA-4 binding, for example, to enable a desired degree of binding of cells transduced onto the aptamer-functionalized surface.

[0027] As mentioned above, in various embodiments, the DNA aptamer of the present disclosure is covalently bonded to surface materials such as fluoropolymers.Therefore, another embodiment of the present disclosure is the DNA aptamer described elsewhere herein, which also comprises a reactive group terminal linker covalently bonded to multiple nucleotides.The reactive group of linker can be used to covalently bond aptamer to surface.

[0028] As one skilled in the art will appreciate, a variety of reactive groups can be used, particularly depending on the functional groups available for attachment on the surface to which the aptamer is to be attached. In various desirable embodiments, the reactive group is a primary amine. The inventors have determined that reductive amination of aldehydes and ketones, and amide coupling using agents such as N-hydroxysuccinimide, can be particularly desirable chemical reactions for attaching aptamers to surfaces. However, one skilled in the art will appreciate that a variety of other reactive groups are known for use in covalently attaching nucleotides to other species, including, for example: (a) carboxyl groups and various derivatives thereof, including, but not limited to, N-hydroxysuccinimide esters, N-hydroxybenzotriazole esters, acid halides, acylimidazoles, thioesters, p-nitrophenyl esters, alkyl, alkenyl, alkynyl, and aromatic esters; (b) hydroxyl groups that can be converted into esters, ethers, aldehydes, etc.; (c) haloalkyl groups, where the halide can be subsequently displaced with a nucleophilic group, such as an amine, a carboxylate anion, a thiol anion, a carbanion, or an alkoxide ion, thereby resulting in the covalent attachment of a new group at the halogen atom; (d) dienophile groups capable of participating in Diels-Alder reactions, such as maleimide groups; (e) aldehyde or ketone groups, which can be further derivatized via formation of carbonyl derivatives such as imines, hydrazones, semicarbazones or oximes, or via mechanisms such as Grignard addition or alkyllithium addition; (f) a sulfonyl halide group for subsequent reaction with an amine, e.g., to form a sulfonamide; (g) thiol groups, which can be converted to disulfides, reacted with acyl halides, or attached to metals such as gold; (h) alkenes that can undergo, for example, cycloaddition, acylation, Michael addition, etc.; (j) epoxides capable of reacting with, for example, amines and hydroxyl compounds; (j) phosphoramidites and other standard functional groups useful in nucleic acid synthesis; and (l) Reactive silanes that can bond to silicon oxide surfaces such as quartz and various glass surfaces.

[0029] However, those skilled in the art will appreciate that this is not an exhaustive list.

[0030] Similarly, various linkers can be used. As will be understood by those skilled in the art, various linking groups can be selected to provide the desired spacing from the surface and to be compatible with the chemistry used to covalently bond to the surface and to the nucleotides of the aptamer. For example, in some embodiments, the linker is a bifunctional hydrocarbon or a bifunctional polyether. However, many other options are possible.

[0031] The chemical compound used to link the linker to the nucleotide of the DNA aptamer is not particularly limited. For example, the linker can be connected to the nucleotide via a phosphodiester bond, for example, to the 5' end or the 3' end of the nucleotide. However, other linking chemistries are possible, for example, by acylation of the OH group of the sugar group of the deoxyribose of the aptamer backbone.

[0032] Overall, in various embodiments, the linker separates the reactive group from an atom of the nucleotide of the aptamer by 200 bonds or less, e.g., 150 bonds or less, or 100 bonds or less, or 50 bonds or less, or 25 bonds or less, hi various embodiments, the linker separates the reactive group from an atom of the nucleotide of the aptamer by at least 4 bonds, e.g., at least 6 bonds, or at least 8 bonds, or at least 10 bonds. In various embodiments, the linker separates the reactive group from an atom of the nucleotide of the aptamer by between 4 and 200 bonds, e.g., between 6 and 200, or between 8 and 200, or between 10 and 200, or between 4 and 150, or between 6 and 150, or between 8 and 150, or between 10 and 150, or between 4 and 100, or between 6 and 100, or between 8 and 100, or between 10 and 100, or between 4 and 50, or between 6 and 50, or between 8 and 50, or between 10 and 50, or between 4 and 25, or between 6 and 25, or between 8 and 25, or between 10 and 25 bonds.

[0033] For example, various primary amine-containing phosphoramidite linkers are available from ThermoFisher. Reagents such as 6-(4-monomethoxytritylamino)-hexyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite; 6-(N-trifluoroacetylamino)hexyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite; and 2-[2-(4,4-dimethoxytrityloxy)ethylsulfonyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite can be used to provide primary amine-terminated linkers attached to nucleotides via phosphodiester bonds. As will be appreciated by those skilled in the art, these can be used directly in the DNA synthesis process or added later.

[0034] In other embodiments, non-covalent bonds can be used to attach DNA aptamers to surfaces, for example, using non-covalent bonds such as (strep)avidin / biotin.

[0035] Another aspect of the present disclosure is a functionalized surface comprising a surface material and a DNA aptamer described herein covalently bound to the surface material. Advantageously, the DNA aptamer described herein may have high binding affinity for VLA-4, and the functionalized surface described herein may bind to VLA-4 and localize it to the surface, where it may be used for transduction.

[0036] As one skilled in the art will appreciate, various surface materials can be used. In various embodiments, the surface material is a fluoropolymer. As described herein, various fluoropolymers can be used for the interior surface of the container. In various embodiments described elsewhere herein, the interior surface of the container comprises a fluoropolymer selected from polytetrafluoroethylene (PTFE), perfluoroalkoxy (PFA), ethylene tetrafluoroethylene (ETFE), polyvinylidene fluoride (PVDF), polychlorotrifluoroethylene (PCTFE), ethylene chlorotrifluoroethylene (ECTFE), fluorinated ethylene propylene (FEP), ethylene fluorinated ethylene propylene (EFEP), perfluoropolyether (PFPE), modified polytetrafluoroethylene (TFM), polyvinyl fluoride (PVF), or any mixture thereof. For example, in various embodiments described elsewhere herein, the interior surface of the container comprises a fluorinated ethylene propylene polymer.

[0037] In various embodiments described elsewhere herein, the fluoropolymer material used as the facing material has a thickness of at least 0.0003 inches, at least 0.0004 inches, at least 0.0005 inches, at least 0.0006 inches, at least 0.001 inches, or at least 0.10 inches. For example, in certain such embodiments, the fluoropolymer material used as the facing material has a thickness in the range of 0.0003 inches to 0.2 inches, or 0.0003 inches to 0.1 inches, or 0.0005 inches to 0.08 inches, or 0.001 inches to 0.07 inches, or 0.001 inches to 0.05 inches, or 0.001 inches to 0.03 inches, or 0.001 inches to 0.018 inches, or 0.001 inches to 0.016 inches, or 0.001 inches to 0.014 inches, or 0.001 inches to 0.012 inches.

[0038] In various embodiments described elsewhere herein, the fluoropolymer material used as the surface material is a layer of a multi-layer material, with a layer of another polymer material (fluoropolymer or other) on the opposite side of the functionalized surface. In various embodiments described elsewhere herein, the material on the opposite side of the container's functionalized surface has a thickness of at least 0.0005 inches, or at least 0.001 inches, or at least 0.005 inches, or at least 0.0075 inches, or at least 0.01 inches, or at least 0.02 inches, or at least 0.03 inches, or at least 0.04 inches, or at least 0.05 inches, or at least 0.06 inches, or at least 0.07 inches, or at least 0.08 inches, or at least 0.09 inches, or at least 0.1 inches, or at least 0.11 inches. For example, in certain such embodiments, the material opposite the functionalized surface has a thickness in the range of 0.0005 inches to 0.2 inches, or 0.005 inches to 0.18 inches, or 0.01 inches to 0.16 inches, or 0.01 inches to 0.14 inches, or 0.01 inches to 0.12 inches, or 0.06 inches to 0.13 inches, or 0.09 inches to 0.126 inches.

[0039] In various embodiments described elsewhere herein, the material opposite the functionalized surface is a material other than a fluoropolymer. For example, in certain such embodiments, the material opposite the functionalized surface is a thermoplastic polymer, a thermoplastic elastomer, a silicone, a rubber, or any combination thereof.

[0040] A variety of other materials can be provided as surface materials. For example, glass or silicate surfaces such as silica can be used. Such materials can be functionalized with organosilanes to provide functional groups (e.g., epoxides, carboxylates, amines) that can react with the reactive groups of linker-containing aptamers. Other polymeric materials can also be used; for example, polymers based at least in part on one or more of acrylic acid, vinyl alcohol, and ethyleneimine can provide functional groups that can react with the reactive groups of linker-containing aptamers.

[0041] Although fluoropolymers are typically inert to reactions, the present inventors have noted that they can be functionalized to enable aptamer binding in a variety of ways. For example, multiple functional groups can be formed on the fluoropolymer surface, which can then react with reactive groups on the aptamer. For example, the inner surface of the fluoropolymer can be functionalized with carboxyl groups, hydroxyl groups, aldehyde groups, carbonyl groups, amine groups, imine groups, amide groups, ester groups, anhydride groups, thiol groups, disulfide groups, phenol groups, guanidine groups, thioether groups, indole groups, imidazole groups, aminoethylamide groups, alkyne groups, alkene groups, aziridine groups, epoxy groups, isonitrile groups, isocyanide groups, tetrazine groups, diazonium surface groups, alkyne groups, alkene groups, aziridine groups, epoxy groups, isonitrile groups, isocyanide groups, tetrazine groups, alkyl groups, aminoethylamide groups, ester groups, or any mixture thereof.

[0042] For example, in certain such embodiments, the functional group includes an aldehyde group, which can react with a primary amine to form an imine, which can then be reduced (e.g., with borohydride) to form an amine that attaches the aptamer to the surface.

[0043] In various embodiments, the functional groups include carboxylate groups, which can be coupled, for example, to primary amines using standard peptide coupling reactions (e.g., with N-hydroxysuccinimide) to form amide bonds that attach the aptamer to the surface.

[0044] In various embodiments described elsewhere herein, the functional group comprises a nitrogen-containing group. For example, in certain such embodiments, the interior surface of the container comprises a plurality of amine groups, which can bind to carboxylate-reactive groups (e.g., as described above) to form amide bonds that bind the aptamer to the surface.

[0045] However, as noted above, one skilled in the art will recognize that a variety of other chemistries are possible.

[0046] Those skilled in the art will appreciate that functional groups can be provided on the fluoropolymer surface in many ways. In various embodiments described elsewhere herein, the functional groups on the interior surface of the container are the product of etching the fluoropolymer. For example, in certain such embodiments, etching includes chemical etching, physical-mechanical etching, or plasma etching. For example, in various embodiments, the functional groups comprising the interior surface are the product of chemical etching of the fluoropolymer. In certain such embodiments, chemical etching includes etching with sodium ammonia or sodium naphthalene. In another example, in various embodiments, the functional groups comprising the interior surface are the product of physical-mechanical etching. In certain such embodiments, physical-mechanical etching includes sandblasting or air abrasion with silica. In another example, the functional groups comprising the interior surface are the product of plasma etching. In certain such embodiments, plasma etching includes etching with reactive plasmas such as hydrogen, oxygen, acetylene, methane, and mixtures thereof with nitrogen, argon, and helium.

[0047] In various embodiments described elsewhere herein, the functional groups on the interior surface of the container are the product of activation of the fluoropolymer in the presence of reactive species. For example, in certain such embodiments, the activation is plasma activation. In various embodiments, plasma activation involves the formation of reactive species on the fluoropolymer by treatment with a gas such as, for example, argon, hydrogen, nitrogen, carbon dioxide, oxygen, and mixtures thereof. In various embodiments, plasma activation produces radicals and / or peroxides on the fluoropolymer. In various embodiments, plasma activation can be carried out at a pressure in the range of 0.1 Torr to 0.6 Torr, or in the range of 700 Torr to 760 Torr. As another example, in certain such embodiments, the activation is corona activation. In various embodiments, corona activation involves activating the fluoropolymer under a gas such as, for example, argon, nitrogen, hydrogen, and mixtures thereof to form active sites (e.g., susceptible to reactive species or subsequent chemical treatment) on the fluoropolymer. In various embodiments, activation (e.g., plasma activation or corona activation) includes a reactive hydrocarbon vapor such as, for example, a ketone, an alcohol, p-chlorostyrene, acrylonitrile, propylene diamine, anhydrous ammonia, styrene sulfonic acid, carbon tetrachloride, tetraethylenepentamine, cyclohexylamine, tetraisopropyl titanate, decylamine, tetrahydrofuran, diethyltriamine, tertiary butylamine, ethylenediamine, toluene-2,4-diisocyanate, glycidyl methacrylate, triethylenetetramine, hexane, triethylamine, methyl alcohol, vinyl acetate, methyl isopropylamine, vinyl butyl ether, methyl methacrylate, 2-vinylpyrrolidone, methyl vinyl ketone, xylene, or a mixture thereof. In various embodiments described elsewhere herein, activation (e.g., plasma activation) including a polymerizable hydrocarbon vapor selected from, for example, butylene, ethylene, glutaraldehyde, and the like, provides a polymer (i.e., comprising functional groups as described elsewhere herein) coated on the fluoropolymer.Those skilled in the art will appreciate that, in various embodiments, plasma activation (i.e., plasma polymerization) involving polymerizable hydrocarbon vapors can provide relatively disordered, highly crosslinked polymer coatings.

[0048] In various embodiments described elsewhere herein, the functional groups on the interior surface of the container are the product of chemically treating an activated fluoropolymer. For example, in certain such embodiments, the activated fluoropolymer is the product of plasma or corona activation of the fluoropolymer. In certain such embodiments, the chemical treatment is a chemical reaction, such as, for example, graft polymerization, coupling, click chemistry, condensation, or addition. In various embodiments, the chemical treatment is graft polymerization in solution, comprising polymerizing a vinyl monomer via radical polymerization (e.g., initiated by radicals generated by plasma activation of the fluoropolymer). In certain such embodiments, the vinyl monomer is selected from, for example, acrylic acid, (meth)acrylates, (meth)alkyl acrylates, styrene, dienes, α-olefins, halogenated alkenes, (meth)acrylonitrile, acrylamide, N-vinylcarbazole, N-vinylpyrrolidone, and maleic anhydride. For example, radical polymerization of acrylic acid monomers on a fluoropolymer can provide a dense surface of carboxyl groups in various embodiments. In various embodiments, such polymerization products can be relatively organized (eg, compared to plasma polymerization products).

[0049] In various embodiments described elsewhere herein, the functional groups on the interior surface of the container are the product of a coating of an activated fluoropolymer. For example, in certain such embodiments, the activated fluoropolymer is the product of plasma activation or corona activation of the fluoropolymer. In certain such embodiments, the coating is a wet coating, a powder coating, or chemical vapor deposition. In various embodiments, the coating is plasma-enhanced chemical vapor deposition or initiated chemical vapor deposition.

[0050] Plasma polymerization of alkyl aldehydes, such as propionaldehyde, is a particularly desirable method for providing fluoropolymer surfaces bearing aldehydes.

[0051] As described above, the DNA aptamer can be covalently bound to the surface material. For example, in various embodiments described elsewhere herein, the DNA aptamer is covalently bound to the surface material through the reaction of a reactive group with a functional group of the surface material. In various embodiments, the reaction of the reactive group with the functional group of the surface material forms a phosphodiester, amide, or amine, which covalently binds the DNA aptamer to the surface material (e.g., via a linking group as described above).

[0052] As mentioned above, the functionalized surface of the present disclosure comprises the DNA aptamer of the present disclosure bound to the surface material.The present inventors have determined that the surface useful for cell transduction can also comprise a second DNA aptamer that has binding affinity for viral vectors bound to the surface material.Therefore, such a surface can co-localize the cells to be transduced (via the VLA-4 binding aptamer of the present disclosure) and the viral vector (via the second DNA aptamer that has binding affinity for it) on the surface, thereby improving the efficiency of cell transduction by viral vectors.

[0053] As used herein, a "viral vector" refers to a virus (e.g., a lentivirus, a retrovirus) that contains a polynucleotide and can introduce the nucleotide sequence into a target cell via transduction. Those skilled in the art will understand that the surface of such a virus can contain one or more molecules to which a second DNA aptamer can bind via non-covalent interactions (e.g., electrostatic interactions, hydrophobic interactions, shape complementarity), etc. In various embodiments described elsewhere herein, the second DNA aptamer has a binding affinity for the viral vector of at least 0.1 nM. For example, in certain such embodiments, the second aptamer has a binding affinity for the viral vector of at least 0.25 nM, or at least 0.5 nM, 0.75 nM, or at least 1 nM, or at least 2.5 nM, or at least 5 nM, or at least 10 nM, or at least 25 nM, or at least 50 nM, or at least 75 nM, or at least 100 nM. The methods described in the Examples for determining binding to VLA-4 can be adapted by those skilled in the art to determine binding affinity for viral vectors, and those skilled in the art can select a binding affinity that provides the desired degree of binding of the viral vector to the functionalized surface.

[0054] Those skilled in the art will understand that such aptamers (i.e., for both viral vectors) can be prepared according to generally known procedures, such as, for example, the SELEX process. Processes similar to those described in the examples below can be used. Those skilled in the art can select binding affinities that provide the desired degree of binding of the viral vector to the inner surface of the container.

[0055] The second DNA aptamer can have a variety of lengths depending on the sequence and identity of the viral vector. In some embodiments, on functionalized surfaces described elsewhere herein, the second DNA aptamer has at least 10 nucleotides, e.g., at least 20 nucleotides, or at least 30 nucleotides. In some embodiments, on functionalized surfaces described elsewhere herein, the second DNA aptamer has 200 or fewer nucleotides, e.g., 150 or fewer nucleotides, or 100 or fewer nucleotides. For example, in some embodiments, the second DNA aptamer has 10 to 200 nucleotides, e.g., 20 to 200, or 30 to 200, or 10 to 150, or 20 to 150, or 30 to 150, or 10 to 100, or 20 to 100, or 30 to 100 nucleotides.

[0056] The second DNA aptamer may comprise multiple repeat sequences, as described above for VLA-4 binding DNA aptamers.

[0057] In particular, the DNA aptamer and the second DNA aptamer can be attached to the surface separately in separate polynucleotides, or in other embodiments, they can be provided together in the same polynucleotide.This can be, for example, a series of alternating repeats of the VLA-4 binding DNA aptamer and the second DNA aptamer.Of course, in other embodiments, the polynucleotide comprises one or more blocks of two or more repeats of the VLA-4 binding aptamer in succession, and also comprises one or more blocks of two or more repeats of the second DNA aptamer in succession.

[0058] The second DNA aptamer can be bound (eg, covalently or non-covalently) to the surface in a manner similar to that described above for the VLA-4 binding DNA aptamer.

[0059] Advantageously, the functionalized surfaces described herein can be provided as the interior surface of a vessel for cell transduction. Accordingly, another aspect of the present disclosure is a vessel having a functionalized surface described herein as its interior surface. The vessel of the present disclosure can be provided in many forms. One particularly convenient form is, for example, a cell culture bag formed from one or more sheets of the polymeric material described herein. Those skilled in the art are familiar with bag structures such as those used in cell culture and will be able to adapt conventional bag structures for use with the bags and methods of the present disclosure based on the description herein. Of course, those skilled in the art will understand that the vessel of the present disclosure can be provided in many other forms, such as flasks, tubes, and dishes. Those skilled in the art will understand that in some embodiments, substantially the entire interior surface area of ​​the vessel can be provided as the functionalized surface described herein, while in other embodiments, only a portion of the interior surface area of ​​the vessel is provided as the functionalized surface described herein.

[0060] One embodiment of such a container in the form of a cell culture bag is shown in schematic top view (top) and cross-sectional view (bottom) in FIG. 1. Bag 100 of FIG. 1 includes a bag wall 110 having an exterior surface 112 and an interior surface 114, with interior surface 114 provided as a functionalized surface according to the present disclosure. In some embodiments, both major interior surfaces of the bag are provided as a functionalized surface. In other embodiments, only one major interior surface of the bag is provided as a functionalized surface. Bag 100 further includes ports 130 and 140 located at opposite ends of the bag for adding or removing medium from the bag. Those skilled in the art will understand that the number and location of the ports are not particularly limited and may therefore be arranged for convenience of use or manufacturing, for example. Bag 100 may be a product of two fluoropolymer-containing sheets (e.g., two sheets having a layer of fluorinated ethylene propylene on the inner surface) bonded together at their edges (e.g., by laser welding, corona discharge, radiation, heat or melt lamination, etching, plasma treatment, wetting, adhesives, or a combination thereof) to form compartment 120. Ports 130 and 140 may be sealable to provide sealed compartment 120.

[0061] The bag wall 110 may be uniform in composition or may include two or more distinct domains (e.g., two or more layers). For example, two fluoropolymer sheets may be bonded together and then coated to provide an outer surface 112 with a composition different from that of the inner surface 114. Similarly, two multi-layer sheets may be bonded together to provide an outer surface 112 with a composition different from that of the inner surface 114. The multi-layer sheets may be formed from both fluoropolymer and non-fluorinated polymer materials. In such cases, a fluoropolymer layer may be provided on the inner surface of one or more of the multi-layer sheets. The thickness of the bag wall 110, the volume of the compartment 120, and the shape of the bag 100 and / or the compartment 120 are not particularly limited and may be selected for convenience of use or manufacturing and / or to suit a particular application. For example, the thickness of the container wall may be in the range of 0.0003 inches to 0.2 inches in various embodiments, and the volume of the compartment may be in the range of 100 mL to 100 L in various embodiments.

[0062] 2 shows several exemplary embodiments of culture bag configurations suitable for use in the bags and methods of the present disclosure. Bag 200a has only a single port 230a, providing access to compartment 220a. Bag 200b is of a so-called "serpentine" configuration, which can provide a longer path length through the system. Ports 230b and 240b are connected by a serpentine path formed by serpentine-shaped compartment 220b, formed by appropriate welding of the sheets forming the bag. Finally, bag 200c has a non-rectangular shape and has a corresponding non-rectangular compartment 220c between ports 230c and 240c.

[0063] One or more of the walls of the container can be permeable to gases (e.g., O, CO) produced and consumed in cell culture, but impermeable to liquids (e.g., water), allowing passive exchange of gases with the atmosphere across the container wall, allowing respiration of the cells within the bag.

[0064] The containers of the present disclosure are desirably formed to substantially eliminate contamination of the fluid therein. Thus, the interior surface of the container is desirably formed from a material that does not leach organic matter into the fluid. For example, in various embodiments described elsewhere herein, the interior surface of the container wall is formed from a material that does not leach organic matter into the fluid. For example, in various embodiments described elsewhere herein, the interior surface of the container wall is formed from a material that does not leach organic matter into the fluid. 2 Less than (e.g., 0.05 mg / cm 2 Less than or equal to 0.05 mg / cm 2 The container is formed of a polymer (e.g., a fluoropolymer such as fluorinated ethylene propylene) having a molecular weight of less than 1000 MPa (less than 1000 MPa). Such containers are described, for example, in U.S. Patent Application Publication Nos. 2016 / 0178490 and 2016 / 0178491, each of which is incorporated herein by reference in its entirety. Based on the description herein, one of ordinary skill in the art will be able to adapt such containers for use in the containers and methods of the present disclosure.

[0065] As used herein, TOC is measured on the containers used in the systems of the present disclosure, such as by extraction from the interior surface area of ​​the container (mg / cm 2 (The results, reflected as TOC per square centimeter of internal area, are for TOC per square centimeter of internal area.) TOC is measured using an apparatus that utilizes a high-temperature wet oxidation reaction with UV-assisted chemical oxidation according to United States Pharmacopeia (USP) 643 (Ultra-Clean Technology Handbook: Volume 1: Ultra-Pure Water, Ohmi, Tadahiro; CRC Press, 1993, pp. 497-517). Purified water is poured into a 3 cm 2 The polymer is placed in contact with the polymer at a ratio of 1 mL of water per 1 mL of surface area of ​​the article for 24 hours at 70° C. The water is removed from contact with the polymer and tested in a TOC analyzer. A suitable instrument is a TEKMAR DOHRMANN Model Phoenix 8000 TOC analyzer.

[0066] The containers described herein can be advantageously used for cell transduction using viral vectors. Thus, in various embodiments, the container has an aqueous medium disposed therein. The aqueous medium can be, for example, a cell culture medium. Those skilled in the art can select a cell culture medium that is desirable for a given cell type to be transduced.

[0067] The containers described herein can be used for transduction and culturing of cells. Thus, in various embodiments, the container can have disposed therein a cell population having a VLA-4 surface moiety along with an aqueous medium. In various embodiments, the container can have disposed therein one or more viral vectors (e.g., lentivirus or retrovirus) along with an aqueous medium, e.g., along with the cell population.

[0068] Advantageously, the inventors have determined that the containers described herein can promote colocalization of the viral vectors and VLA-4-bearing target cells involved in the transduction process, desirably improving its efficiency without requiring a manual coating process by the user immediately prior to transduction. Accordingly, another aspect of the present disclosure is a method for transduction of a cell population, comprising incubating one or more viral vectors and a cell population bearing a VLA-4 surface moiety in an aqueous medium (e.g., cell culture medium) within a container described herein. In certain such embodiments, the viral vector comprises a lentivirus or a retrovirus.

[0069] In various embodiments described elsewhere herein, a transduction method includes including a suspension of a viral vector in a first aqueous medium (e.g., viral vector supernatant) in a container and then incubating the container containing the viral vector for a first period of time. The first period of time can be any length sufficient to allow association of at least a portion of the viral vector with a second aptamer sequence on the interior surface of the container. For example, in various embodiments, the container containing the viral vector is incubated, e.g., at a temperature in the range of 32-37°C, for at least 1 hour, or at least 2 hours, or at least 3 hours, or at least 4 hours, or at least 5 hours. After incubating for the first period of time, the method includes adding a cell population having a VLA-4 surface moiety to the container (e.g., as a suspension in a second aqueous medium, such as cell culture medium), and then incubating the cell population with the viral vector in the container for a second period of time. The second period of time can be any length of time sufficient to allow transduction of at least a portion of the cell population. For example, in various embodiments, the viral vector and cell population are incubated together for at least 6 hours, or at least 12 hours, or at least 18 hours, or at least 1 day, or at least 1.5 days, or at least 2 days, or at least 2.5 days, e.g., at a temperature in the range of 35-39° C. After incubating for the second period of time, the method includes harvesting the transduced cells from the container.

[0070] In certain such embodiments, the method further includes removing at least a portion of the first aqueous medium after incubating the container for a first period of time, then adding a wash medium to the container, and then removing at least a portion of the wash medium from the container (i.e., before adding the cell population to the container).

[0071] In other embodiments, the transduction method includes incubating a suspension of viral vectors and a population of cells bearing VLA-4 surface moieties in a first aqueous medium (e.g., a mixture of viral vector supernatant and cell culture medium) in a container for a first period of time. The first period of time can be any length sufficient to allow transduction of at least a portion of the target cells. For example, in various embodiments, the container containing the viral vector and target cells is incubated, e.g., at a temperature in the range of 35-39°C, for at least 6 hours, or at least 12 hours, or at least 18 hours, or at least 1 day, or at least 1.5 days, or at least 2 days, or at least 2.5 days. After incubation for the first period of time, the method further includes harvesting the transduced cells from the container.

[0072] In various embodiments described elsewhere herein, harvesting the transduced cells includes removing a suspension of transduced cells from the container. In various embodiments, harvesting the transduced cells includes adding a cell dissociation medium to the container (e.g., after removing at least a portion of the transduction medium from the container) and then removing the suspension of transduced cells in the cell dissociation medium from the container. The cell dissociation medium can include one or more dissociation agents capable of releasing target cells from the interior surface of the container. For example, in certain such embodiments, the cell dissociation medium includes one or more of a salt and a chelating agent (e.g., capable of disrupting binding of a DNA aptamer to a VLA-4 surface moiety of a cell population). In another example, the cell dissociation medium includes one or more restriction enzymes (e.g., capable of degrading a DNA aptamer). In another example, in certain such embodiments, the cell dissociation medium includes an oligonucleotide or polynucleotide comprising a nucleotide sequence complementary to a DNA aptamer (e.g., capable of displacing bound cells from the DNA aptamer). [Example]

[0073] 1. Introduction VLA-4 is a cell surface integrin found on most leukocytes, but not neutrophils, and plays a role in cell adhesion and leukocyte migration through tissues. DNA aptamers with high affinity and specificity for VLA-4 binding were developed using an aptamer enrichment strategy using recombinant VLA-4 as the target and BSA as the countertarget to generate high-affinity and high-specificity aptamers. The enriched library underwent sequencing and bioinformatics analysis to identify potential aptamers, which were synthesized on microarrays for high-throughput evaluation.

[0074] 2. SELEX Strategy 2.1 Material The aptamer library, PCR primers, and biotinylated capture probes were all synthesized and desalted and purified by Integrated DNA Technologies (Coralville, IA). MyOne T1 Dynabeads® (Life Technologies; Carlsbad, CA) streptavidin-coated magnetic beads were used for the partitioning step. VLA-4 (designated P191; R&D Systems; Minneapolis, MN) was used as the target. Bovine serum albumin (BSA; Thermo Fisher Scientific; Waltham, MA) was used as the counter-target. Jurkat cells (ATCC; Manassas, VA) were used as a representative target in the context of live cells. 1x PBS (pH 7.4) was used as the SELEX buffer.

[0075] 2.2 Elution SELEX Aptamers were selected against the target P191, and BSA was used to reduce the enrichment of nonspecific aptamers. Elution-based SELEX uses complementary capture probes to immobilize the library on magnetic beads. The introduction of a target, counter-target, or matrix can then be used to induce a conformational change in the library upon binding, separating responsive from nonresponsive sequences.

[0076] Figure 3 provides an illustration of elution aptamer selection. Selection begins by refolding and blocking the library (left). After refolding is complete, the refolded library is captured on magnetic beads (top center). The beads can then be washed with 1x SELEX buffer or incubated with a counter target (counter selection, top right). Species that change conformation in response to the counter target are discarded (center right). The beads are then washed with 1x SELEX buffer to ensure the sample contains no residual counter target before initiating positive selection (bottom center). Species that change conformation in response to the positive target are collected for further experiments (bottom left).

[0077] Figure 4 provides a bar graph illustrating library enrichment based on elution for P191(+). Library recovery is determined as the ratio between the material recovered from the selection or parallel evaluation step and the input amount of material. Specific selection conditions are indicated below the bar graph.

[0078] A typical selection round began with preincubating the library with twice the molar amount of capture oligos as the library for refolding in 1x SELEX buffer by heating the sample to 90°C for 1 minute, cooling to 60°C for 5 minutes, and then cooling to 23°C for 5 minutes. While the library was refolding, the Dynabeads® were washed three times each with 1x PBS containing 0.01% Tween-20. After refolding was complete, the library was captured on the washed Dynabeads®. The Dynabeads® were then washed twice with 1x SELEX buffer to remove nonspecifically bound library members. After the first wash, the library was incubated with a counter target (see Figure 4 for details) at 37°C. The unbound library was partitioned from the counter-bound or buffer-responsive library by magnetic separation, after which the supernatant was discarded. The Dynabeads® were then washed repeatedly or again (number of washes noted in Figure 4) to remove any remaining non-specific library members. The remaining Dynabead®-bound library was then incubated with the positive target for 30 minutes at 37°C. The recovered library was quantified before PCR amplification and amplification to the next round.

[0079] Library response was defined as the ratio of recovered material to the amount of input library (determined by spectrophotometric analysis at A260). In the first selection round, the counter target was omitted to maximize recovery of rare sequences from the starting library. 1 μM counter target was used throughout the selection. The target was used at 0.6 μM for the first seven rounds. If the library response appeared to decrease, the recombinant target was replaced with Jurkat cells to represent the target as it would appear in the client's end-use application. Once the library response appeared to recover to the response achieved in the low-stringency selection, parallel evaluation was performed. Responsive fractions from each sample were collected for sequencing and bioinformatics analysis. Detailed conditions for each selection round are provided in Figure 4.

[0080] 2.3 Parallel Evaluation Figure 5 provides an illustration of the parallel evaluation. The enriched library was divided into three equal portions for incubation under the following final conditions: buffer only, negative incubation (-), counter (x), and positive (+). Based on the strategy described in Figure 3, the condition-responsive species were released for recovery during the final incubation. The non-responsive sequences bound to the beads were then separated from the responsive sequences by magnetic separation, and the supernatant containing the responsive sequences was collected and prepared for sequencing. In an ideal scenario, only the positive sample would release the responsive sequences, while the counter target and negative samples would have minimal material. In practice, a library with significantly higher library recovery in the positive sample than in the counter target and negative samples would be considered sufficiently enriched to identify successful aptamer sequences (see Figure 4 for details).

[0081] Library enrichment was verified using the elution method (Figure 5). The final enriched library pool was divided into three equal portions: negative (-), counter (x), and positive (+). These portions underwent the same elution procedure but were exposed to their respective conditions in their final incubation. Responsive library material was recovered for sequencing and bioinformatics analysis.

[0082] 3.Results The results of 12 rounds of elution screening and parallel evaluation are summarized in Figure 4. The library recovery observed in round 1 was typical, resulting in the collection of sequences binding to a given target from over 10 possible species. The library responded at the expected level from rounds 2 through 6. When enrichment decreased in round 7, the target was changed from recombinant P191 to Jurkat cells, allowing the library to recognize the target in a cellular context. The library recovered from this change by round 11. At this point, the round 12 (G11) library was taken into parallel evaluation to collect material for sequencing and bioinformatics.

[0083] 4. Phase IIa: Sequencing The initial library was subjected to 12 rounds of elution selection and parallel evaluation. The SELEX process is designed to enrich for sequences that bind to a given target of interest, in this case, P191 protein, over multiple rounds of selection, while removing sequences that respond generally to the counter-target BSA. As a result, the sequenced population is expected to contain multiple copies of potential aptamer candidates.

[0084] An Illumina (San Diego, CA) MiniSeq system was implemented to sequence the aptamer library after post-parallel selection using single-end read technology. Deep sequencing and subsequent data analysis reduce the need for multiple screening rounds, which can introduce errors and biases into the screening process as in traditional approaches (Schutze et al., 2011). Hundreds of thousands of sequences were analyzed from the parallel-exposed final library. From these datasets, a library sequence family was constructed with 90% homology (sequence similarity taking into account mutations, deletions, and insertions).

[0085] [Table 1]

[0086] 5. Phase IIb: Bioinformatics and Aptamer Candidate Selection The construction of sequence families focused primarily on sequence similarity. This took into account the frequency of individual sequences in the positive target population, but the degree of variation between similar sequences was also important, meaning that 90% homology was a minimum requirement (100% identity across the entire sequence is not required to join a family; up to two bases can be mismatched, inserted, or deleted). Therefore, families with the largest number of members are expected to be highly ranked as aptamer candidates. While this is true to some extent, there are several other factors that moderate the importance of family size in determining which sequences are likely candidates.

[0087] The first factor is usually the presence of sequences in the population exposed to the non-positive target. Four libraries were collected for sequencing: a post-parallel evaluation library recovered from incubation with the positive target in 1x SELEX buffer (positive population G11(P)); a post-parallel evaluation library recovered after incubation with the counter target in 1x SELEX buffer (counter population G11(C)); a post-parallel evaluation library recovered after incubation with 1x SELEX buffer only (negative population G11(N)); and a pre-parallel evaluation library recovered from incubation with the positive target in 1x SELEX buffer in the previous round of parallel evaluation (pre-positive population G10(P)). The positive population was compared to the counter population to identify any sequences that were not removed during the counter selection step but still had some affinity for both the target and counter target. Families were constructed from the positive population G11(P) and then primarily selected from the nucleotide sequences. Sequences that appeared at comparable rates in both the positive and counter populations were ranked lower than sequences that could be found predominantly in the positive population. Using a similar process, candidates in the positive population (G11(P)) were compared to the buffer-only negative population (G11(N)). These libraries showed little overlap between the final positive population and either the counter-target or negative populations. Instead, sequences were evaluated based on their frequency in G11(P) that were absent from the counter-target population. Finally, the stability of the candidate's secondary structure was used as a "tiebreaker" parameter. Thus, although secondary structure is not a primary factor, it influences which of several candidates with similar occurrences is selected for further analysis. After considering these factors, 200 candidates were selected for further evaluation.

[0088] Figure 6 illustrates the bioinformatics and candidate selection process. (Step 1) Sequence data from the final (i.e., post-parallel) round of selection are organized into families with greater than 90% homology using the FASTAptamer algorithm. Characters of the same color in this figure represent members of the same sequence family. (Step 2) Families common to both the negative and positive final generation datasets are removed from the candidate pool. (Steps 3-4) The remaining sequence families are compared with the penultimate (i.e., parallel) generation families to determine enrichment rates—families with the highest enrichment rates are more highly ranked candidates for further analysis.

[0089] Figure 7 is a graph of the distribution of family frequencies from the P191(+)G11(P) library that do not appear in G11(C). Plot of the frequency of sequences found in the final generation positive target (G11(P)) that do not appear in the counter target (G11(C)) challenge library. The frequency of the G11(P) normalized sequence is on the x-axis. The number of unique sequences with a given frequency is shown on the y-axis.

[0090] 6. Phase III: Microarray Synthesis and Semi-quantitative Evaluation 6.1 Microarray method A Cy5-labeled reporter oligo (5'-GTC GTC CCG AGA GCC TCG / 3Cy5Sp / -3') complementary to the constant region of the library was synthesized by IDT (Coralville, IA) and purified by desalting. This oligo is displaced during target binding, providing an indication of binding capacity.

[0091] Selected full-length aptamer candidates were randomly arranged by name and then synthesized on replicate 4K microarray chips by LC Sciences (Houston, TX) using standard phosphoramidite chemistry and LC Sciences' proprietary masking technology. Each candidate cluster occupied 18 positions (3 × 6 colonies), and control sequences were semi-regularly distributed across each chip. Monoclonal colonies of each candidate were synthesized from 3' to 5', with the 3' end anchoring each individual candidate to the colony region on the chip. A colony is defined as an aptamer replicate in a single well, while a cluster is defined as a group of wells containing the same candidate. Candidate colonies and clusters are required to significantly enhance signal changes in response to a target or counter-target, since fluorescence changes of individual molecules can be overwhelmed by the signal of their neighbors. Additional sequences were synthesized as quality control standards.

[0092] Prior to use, the microarray chip was blocked with 0.1% BSA in 1x PBS solution to prevent nonspecific reporter binding to the chip. Because the microarray configuration cannot be heated above 60°C without damaging the microfluidic chip, reporter sequences were annealed to the candidates using a modified protocol. A solution of 100 nM Cy5-labeled reporter oligos in 1x SELEX buffer without BSA was introduced to the chip using an oscillating peristaltic pump to ensure uniform distribution across the colonies. During this process, the candidates were denatured by heating the chip and solution to 60°C for 20 minutes, and then cooled to 23°C for 20 minutes to allow reporter annealing. Fluorescence readings were obtained using a GenePix 4000B Microarray Scanner (Molecular Devices, LLC; Inc.; San Jose, CA) to establish the baseline response of each candidate. After taking a baseline image, 400 μL of either 1 μM positive target P191(+) in 1× SELEX buffer or 1 μM counter target BSA(X) in 1× SELEX buffer was circulated through the chip for 16 h at 37°C. After incubation, the chip was flushed twice with 500 μL of 1× SELEX buffer. The 1× SELEX buffer from the second wash was left in place during pre- and post-incubation fluorescence scanning.

[0093] Data analysis was performed as follows: The mean background fluorescence value (fbackground) was subtracted from the mean fluorescence value of each candidate before the addition of sample (fpretreatment) and after the addition of sample (fposttreatment). The amount of signal loss from the pretreatment condition to the posttreatment condition was then expressed as a percentage. This process was repeated for the target and counter-target assessments. The percent signal loss in the target assessment was then divided by the percent signal loss in the counter assessment to generate a score. A score greater than 1 indicates an increased response to the target condition compared to the counter condition. The percent signal loss from the target assessment minus the percent signal loss from the counter assessment is also displayed.

[0094]

number

[0095] 6.2 Microarray results Candidates were first tested against 1 μM of the positive target in 1× SELEX buffer. Some candidates interacted better with the reporter than others. After this readout, the candidates were incubated with the target at 37°C for 16 hours. The target sample was then washed from the microarray by replacing the solution at the inlet of the peristaltic pump with 1× SELEX buffer.

[0096] Fluorescence readings for each pixel were collected and averaged to obtain the mean fluorescence value and standard deviation per candidate (data available in a separate file). Candidate response to the target was then calculated as described in Equation 1. The same process was used to analyze candidate response to 1 μM counter target in 1× SELEX buffer.

[0097] The percent response of candidates to the target and counter-target samples was calculated as the average of 18 replicate positions before and after incubation, excluding colonies that did not successfully incorporate the fluorescent probe. Pre-incubation fluorescence was then divided by post-incubation fluorescence to obtain a signal ratio value, which was used to rank the extent to which the sequences were responsive to the evaluation conditions. Greater aptamer response indicates greater displacement of the fluorescent reporter and, therefore, a greater difference between the pre- and post-incubation readings. A signal ratio value of approximately 2 is typical, while values ​​below 1.5 are of concern. The top five candidates from the target-evaluated microarrays had signal ratio values ​​of at least 1.7 (data available in separate files), which is promising. The top five responsive sequences had signal ratio values ​​to the counter-target above 50 (data available in separate files), which are unusually high and merit further testing.

[0098] The response percentages were then compared to determine candidates that specifically responded to the target. Candidates were ranked according to the ratio of signal loss to the target condition relative to the counter condition. The higher the score, the greater the response to the target condition relative to the counter condition. As mentioned above, a score of more than 2 is preferable, and a score of less than 1.5 is of concern. Under this criterion, the top five candidates had scores above 25. The aptamer candidates identified for the P191(+) target (Figure 8) were then synthesized for Phase IV qualitative evaluation and then characterized by surface plasmon resonance (SPR).

[0099] A collection of candidate aptamers for P191(+), A to E, was developed in this manner. Notably, many of these overall structures contained PCR primer annealing regions at both the 5' and 3' ends, with a unique sequence between them (5'-CGA GGC TCT CGG GAC GAC-[sequence]-GTC GTC CCG CCT TTA GGA TTT ACA G-3').

[0100] 7. Phase V: Qualitative Verification 7.1 Evaluation Method Various candidates were synthesized with 5'-biotin and purified by desalting for binding to the SPR sensor chip. Evaluation followed a different method from that used in Phase I SELEX. Briefly, candidates were individually prepared by suspending 200 pmol of candidate or G0 naive DNA library (as a control) in 1x SELEX buffer in a total volume of 200 μL. The samples were thoroughly mixed and then refolded as described in Phase I before being injected for capture onto the SPR sensor chip. After a stable baseline was achieved after loading, increasing concentrations (0.03125 μM, 0.0625 μM, 0.125 μM, 0.25 μM, and 0.5 μM) of either the target P191(+) or the counter-target BSA were injected sequentially at room temperature to measure aptamer-target association, followed by switching to buffer alone to measure dissociation. Results from the target and counter-target for the control library were then subtracted from the corresponding candidate runs before kinetic analysis and binding affinity fitting (Figure 9). Specificity was then calculated as the ratio of counter-target binding affinity to target binding affinity.

[0101] 7.2 Evaluation results In addition to running each candidate against a full concentration series of counter-target and target, an unselected random library (negative control) was also evaluated. The response of the unselected library was taken as the background signal that was subtracted from the candidate response curves.

[0102] Figure 8 provides graphs of the SPR-based evaluation of SGO-P06701 against target and counter-target. (Top) Injection of various concentrations of target P191(+) against candidate SGO-P06701 immobilized on an SPR sensor surface. (Bottom) Response of candidate against counter-target at various concentrations.

[0103] Most candidates did not respond to the counter-target. The response to the target was more promising, with SGO-P06701 (i.e., having SEQ ID NO: 1) producing a raw signal change more than two-fold greater than that of the control DNA. After controlling for background and fitting to a 1:1 binding model, SGO-P06701 was found to have a binding affinity of 59.2 nM for VLA-4 and 1.74 μM for BSA. Based on these values, its specificity for the target was 29.4-fold.

[0104] 8. Conclusion The SELEX experiment provided a library of sequences. After the library responded to the target in a cellular context, parallel evaluation was performed to collect material for sequencing. The top 200 sequences identified after sequencing and bioinformatics were semi-quantitatively evaluated for binding, at which point the top five candidates were selected for analytical-scale synthesis using 5'-biotin for immobilization on an SPR sensor chip. Candidate and control DNAs were evaluated separately against concentrations of target P191(+) and counter-target BSA to determine association and dissociation rates, and thus binding affinity constants. Most candidates did not respond to the counter-target, but they also showed weak responses to the target. Candidate SGO-06701 appeared most promising, with a Kd value of 59.2 nM for the target VLA-4 and a Kd of 1.74 μM for the counter-target BSA (29.4-fold binding specificity relative to the target).

[0105] Additional aspects of the present disclosure are provided by the following numbered embodiments, which can be combined in any number and in any manner that is not technically or logically incompatible:

[0106] Embodiment 1. A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).

[0107] Embodiment 2. A DNA aptamer according to embodiment 1, having at least 86.6% sequence identity with the sequence of SEQ ID NO:1.

[0108] Embodiment 3. A DNA aptamer according to embodiment 1, having at least 90% sequence identity with the sequence of SEQ ID NO:1.

[0109] Embodiment 4. A DNA aptamer according to embodiment 1, having at least 93.3% sequence identity with the sequence of SEQ ID NO:1.

[0110] Embodiment 5. A DNA aptamer according to embodiment 1, having at least 96.6% sequence identity with the sequence of SEQ ID NO:1.

[0111] Embodiment 6. A DNA aptamer according to embodiment 1, having 100% sequence identity with the sequence of SEQ ID NO:1.

[0112] Embodiment 7. A DNA aptamer according to any one of embodiments 1 to 6, wherein an additional nucleotide not found in the sequence of SEQ ID NO:1 is present.

[0113] Embodiment 8. A DNA aptamer according to any one of embodiments 1 to 6, in which there are no additional nucleotides not found in the sequence of SEQ ID NO:1.

[0114] Embodiment 9. A DNA aptamer described in any of embodiments 1 to 8, having at least one span of 10 consecutive nucleotides in common with the sequence of SEQ ID NO: 1, for example, one such span, or two such spans, or three such spans.

[0115] Embodiment 10. A DNA aptamer described in any of embodiments 1 to 8, having at least one span of 15 consecutive nucleotides in common with the sequence of SEQ ID NO: 1, for example, one such span, or two such spans.

[0116] Embodiment 11. A DNA aptamer according to any one of embodiments 1 to 8, having a span of 20 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0117] Embodiment 12. A DNA aptamer according to any one of embodiments 1 to 8, having a span of 26 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0118] Embodiment 13. A DNA aptamer according to any one of embodiments 1 to 8, having a span of 50 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0119] Embodiment 14. A DNA aptamer according to any one of embodiments 1 to 8, having a span of 60 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0120] Embodiment 15. A DNA aptamer according to any one of embodiments 1 to 8, having a span of 70 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0121] Embodiment 16. A DNA aptamer according to any one of embodiments 1 to 15, having at least 24 nucleotides, for example, at least 26 nucleotides, or at least 27 nucleotides, or at least 28 nucleotides, or at least 29 nucleotides, or at least 30 nucleotides.

[0122] Embodiment 17. A DNA aptamer according to any one of embodiments 1 to 16, having 200 nucleotides or less, for example, 150 nucleotides or less, or 100 nucleotides or less, or 80 nucleotides or less, or 75 nucleotides or less, or 74 nucleotides or less, or 73 nucleotides or less.

[0123] Embodiment 18. The nucleotides are 24 to 200 nucleotides, for example, 26 to 200, or 27 to 200, or 28 to 200, or 29 to 200, or 30 to 200, or 24 to 150, or 26 to 150, or 27 to 100, or 28 to 100, or 29 to 100, or 30 to 100, or 24 to 75, or 26 to 75, or 27 to 75, or 2 A DNA aptamer according to any one of embodiments 1 to 15, having a length in the range of 8 to 75, or 29 to 75, or 30 to 75, or 24 to 50, or 26 to 50, or 27 to 50, or 28 to 50, or 29 to 50, or 30 to 50, or 24 to 40, or 26 to 40, or 27 to 40, or 28 to 40, or 29 to 40, or 30 to 40 nucleotides.

[0124] Embodiment 19. A DNA aptamer according to any one of embodiments 1 to 15, having 24 to 36 nucleotides, for example, 26 to 36, or 28 to 36, or 30 to 36, or 24 to 34, or 26 to 34, or 28 to 34, or 30 to 34, or 24 to 32, or 26 to 32, or 28 to 32, or 30 to 32, or 24 to 30, or 26 to 30, or 28 to 30, or 30 nucleotides.

[0125] Embodiment 20. A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 2 (CGAGGCTCTCGGGACGACAAACTGCAGCGATTCATTAGTACGGCCTTTGTCGTCCCGCCTTTAGGATTTACAG).

[0126] Embodiment 21. A DNA aptamer according to embodiment 20, having at least 85% sequence identity with the sequence of SEQ ID NO:2.

[0127] Embodiment 22. A DNA aptamer according to embodiment 20, having at least 90% sequence identity with the sequence of SEQ ID NO:2.

[0128] Embodiment 23. A DNA aptamer according to embodiment 20, having at least 91.7% (e.g., at least 93.1%, or at least 94.5%) sequence identity with the sequence of SEQ ID NO:2.

[0129] Embodiment 24. A DNA aptamer according to embodiment 20, having at least 95.8% (e.g., at least 97.2%, or at least 98.6%) sequence identity with the sequence of SEQ ID NO:2.

[0130] Embodiment 25. A DNA aptamer according to embodiment 20, having 100% sequence identity with the sequence of SEQ ID NO:2.

[0131] Embodiment 26. A DNA aptamer according to any one of embodiments 20 to 25, in which an additional nucleotide not found in the sequence of SEQ ID NO:2 is present.

[0132] Embodiment 27. A DNA aptamer according to any one of embodiments 1 to 6, in which there are no additional nucleotides not found in the sequence of SEQ ID NO:2.

[0133] Embodiment 28. A DNA aptamer described in any of embodiments 20 to 27, having at least one span of 10 consecutive nucleotides in common with the sequence of SEQ ID NO: 1, for example, one such span, or two such spans, or three such spans, or four such spans, or five such spans, or six such spans.

[0134] Embodiment 29. A DNA aptamer described in any of embodiments 20 to 27, having at least one span of 20 consecutive nucleotides in common with the sequence of SEQ ID NO: 1, for example, one such span, or two such spans, or three such spans.

[0135] Embodiment 30. A DNA aptamer described in any of embodiments 20 to 27, having at least one span of 30 consecutive nucleotides in common with the sequence of SEQ ID NO: 1, for example, one such span, or two such spans.

[0136] Embodiment 31. A DNA aptamer according to any one of embodiments 20 to 27, having a span of 40 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0137] Embodiment 32. A DNA aptamer according to any one of embodiments 20 to 27, having a span of 50 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0138] Embodiment 33. A DNA aptamer according to any one of embodiments 20 to 27, having a span of 60 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0139] Embodiment 34. A DNA aptamer according to any one of embodiments 20 to 27, having a span of 70 consecutive nucleotides in common with the sequence of SEQ ID NO:1.

[0140] Embodiment 35. A DNA aptamer according to any one of embodiments 20 to 34, having at least 60 nucleotides, for example, at least 65 nucleotides, or at least 70 nucleotides, or at least 71 nucleotides, or at least 72 nucleotides, or at least 73 nucleotides.

[0141] Embodiment 36. A DNA aptamer according to any of embodiments 20 to 34, having 200 nucleotides or less, for example, 150 nucleotides or less, or 100 nucleotides or less, or 80 nucleotides or less, or 75 nucleotides or less, or 74 nucleotides or less, or 73 nucleotides or less.

[0142] Embodiment 37. The nucleotides are 60 to 200 nucleotides, for example, 65 to 200, or 70 to 200, or 71 to 200, or 72 to 200, or 73 to 200, or 60 to 150, or 70 to 150, or 71 to 150, or 72 to 150, or 73 to 150, or 60 to 100, or 70 to 100, or 71 to 100, or 72 to 100, or A DNA aptamer according to any one of embodiments 20 to 34, having a length in the range of 73 to 100, or 60 to 80, or 70 to 80, or 71 to 80, or 72 to 80, or 73 to 80, or 60 to 75, or 65 to 75, or 70 to 75, or 60 to 74, or 65 to 74, or 70 to 74, or 60 to 73, or 65 to 73, or 70 to 73 nucleotides.

[0143] Embodiment 38. A DNA aptamer according to any one of embodiments 20 to 34, having 71 to 75 nucleotides, for example, 72 to 75, or 73 to 75, or 71 to 74, or 72 to 74, or 73 to 74, or 71 to 73, or 72 to 73, or having 73 nucleotides.

[0144] Embodiment 37. A DNA aptamer according to any one of embodiments 1 to 36, having a binding affinity for VLA-4 of at least 0.1 nM, for example at least 0.25 nM, or at least 0.5 nM, 0.75 nM, or at least 1 nM, or at least 2.5 nM, or at least 5 nM, or at least 10 nM, or at least 25 nM, or at least 50 nM, or at least 75 nM, or at least 100 nM.

[0145] Embodiment 38. A DNA aptamer according to any one of embodiments 1 to 37, further comprising a reactive group terminal linker attached to a plurality of nucleotides.

[0146] Embodiment 39. A DNA aptamer according to any of embodiments 38, wherein the reactive group is a primary amine.

[0147] Embodiment 40. The DNA aptamer of embodiment 38, wherein the reactive group is a carboxylate.

[0148] Embodiment 41. A DNA aptamer according to any one of aspects 38 to 40, wherein the linker is a bifunctional hydrocarbon or bifunctional polyether.

[0149] Embodiment 42. A DNA aptamer according to any one of embodiments 38 to 41, wherein the linker is covalently attached to the nucleotide via a phosphodiester bond.

[0150] Embodiment 43. A DNA aptamer described in any of embodiments 38 to 42, wherein the linker separates the reactive group from an atom of the nucleotide of the aptamer by 200 bonds or less, for example, 150 bonds or less, or 100 bonds or less, or 50 bonds or less, or 25 bonds or less.

[0151] Embodiment 44. A DNA aptamer described in any of embodiments 38 to 43, wherein the linker separates the reactive group from an atom of the nucleotide of the aptamer by at least four bonds, for example, at least six bonds, or at least eight bonds, or at least 10 bonds.

[0152] Embodiment 45. A DNA aptamer according to any one of embodiments 38 to 44, wherein the linker separates the reactive group from an atom of a nucleotide of the aptamer by 4 to 200 bonds, for example, 6 to 200, or 8 to 200, or 10 to 200, or 4 to 150, or 6 to 150, or 8 to 150, or 10 to 150, or 4 to 100, or 6 to 100, or 8 to 100, or 10 to 100, or 4 to 50, or 6 to 50, or 8 to 50, or 10 to 50, or 4 to 25, or 6 to 25, or 8 to 25, or 10 to 25 bonds.

[0153] Embodiment 46. A functionalized surface, comprising: Surface materials and; A DNA aptamer according to any one of embodiments 1 to 45, bound to a surface material; A functionalized surface comprising:

[0154] Embodiment 47. The functionalized surface of embodiment 46, wherein the surface material is a fluoropolymer.

[0155] Embodiment 48. The functionalized surface of embodiment 47, wherein the fluoropolymer is polytetrafluoroethylene (PTFE), perfluoroalkoxy (PFA), ethylene tetrafluoroethylene (ETFE), polyvinylidene fluoride (PVDF), polychlorotrifluoroethylene (PCTFE), ethylene chlorotrifluoroethylene (ECTFE), fluorinated ethylene propylene (FEP), ethylene fluorinated ethylene propylene (EFEP), perfluoropolyether (PFPE), modified polytetrafluoroethylene (TFM), polyvinyl fluoride (PVF), or any mixture thereof.

[0156] Embodiment 49. The functionalized surface of embodiment 47, wherein the fluoropolymer is a fluorinated ethylene propylene polymer.

[0157] Embodiment 50. A functionalized surface according to any one of embodiments 46 to 49, wherein the DNA aptamer is covalently bound to the surface material.

[0158] Embodiment 51. The functionalized surface of embodiment 50, wherein the DNA aptamer is covalently attached to the surface material via reaction of a reactive group with a functional group of the surface material.

[0159] Embodiment 52. The functionalized surface of embodiment 51, wherein reaction of the reactive group with the functional group of the surface material forms a phosphodiester, amide, or amine that covalently bonds the DNA aptamer to the surface material (e.g., via a linking group).

[0160] Embodiment 53. The functionalized surface of any of embodiments 46 to 52, further comprising a second DNA aptamer bound to the surface material, wherein the second DNA aptamer has binding affinity for the viral vector.

[0161] Embodiment 54. The functionalized surface of embodiment 53, wherein the second DNA aptamer has a binding affinity for the viral vector of at least 0.1 nM, for example, at least 0.25 nM, or at least 0.5 nM, 0.75 nM, or at least 1 nM, or at least 2.5 nM, or at least 5 nM, or at least 10 nM, or at least 25 nM, or at least 50 nM, or at least 75 nM, or at least 100 nM.

[0162] Embodiment 55. A functionalized surface according to embodiment 53 or embodiment 54, wherein the second DNA aptamer has at least 10 nucleotides, for example at least 20 nucleotides, or at least 30 nucleotides.

[0163] Embodiment 56. A functionalized surface according to any of embodiments 53 to 55, wherein the second DNA aptamer has 200 or fewer nucleotides, for example, 150 or fewer nucleotides, or 100 or fewer nucleotides.

[0164] Embodiment 57. The functionalized surface according to embodiment 53 or embodiment 54, wherein the second DNA aptamer has a nucleotide length in the range of 10 to 200 nucleotides, for example, 20 to 200, or 30 to 200, or 10 to 150, or 20 to 150, or 30 to 150, or 10 to 100, or 20 to 100, or 30 to 100 nucleotides.

[0165] Embodiment 58. A functionalized surface according to any one of embodiments 53 to 57, wherein the viral vector is a lentivirus or retrovirus.

[0166] Embodiment 59. A container comprising as an interior surface the functionalized surface described in any one of embodiments 46 to 58.

[0167] Embodiment 60. A container according to embodiment 59, in the form of a cell culture bag.

[0168] Embodiment 61. A container according to embodiment 59 or embodiment 60, having an aqueous medium, such as a cell culture medium, disposed therein.

[0169] Embodiment 62. A container according to embodiment 61 having disposed therein a population of cells having a VLA-4 surface moiety.

[0170] Embodiment 63. A container according to embodiment 61 or embodiment 62, having one or more viral vectors (e.g., lentivirus or retrovirus) disposed therein.

[0171] Embodiment 64. A method for transducing a cell population, comprising incubating one or more viral vectors with a cell population bearing a VLA-4 surface moiety in an aqueous medium (e.g., cell culture medium) in a container described in embodiment 59 or embodiment 60.

[0172] Embodiment 65. The method of claim 64, wherein the one or more viral vectors are lentiviruses or retroviruses.

[0173] Embodiment 66. providing a suspension of a viral vector in a first aqueous medium to a container; incubating the container containing the viral vector for a first period of time; adding a population of cells to the container (e.g., as a suspension in a second aqueous medium); incubating the cell population and the one or more viral vectors for a second period of time; and then Recovering the transduced cells from the vessel; 66. The method of embodiment 64 or embodiment 65, comprising:

[0174] Embodiment 67. After incubating the container for a first period of time, removing at least a portion of the first aqueous medium; and then adding a cleaning medium to the container; and then removing at least a portion of the cleaning medium from the container; and then adding the cell population to the container. 67. The method of embodiment 66.

[0175] Embodiment 68. providing a suspension of one or more viral vectors and a cell population in a first aqueous medium to a container; incubating the one or more viral vectors and the cell population in the container for a first period of time; and then harvesting the transduced cells from the vessel; 68. The method of embodiment 66 or embodiment 67, comprising:

[0176] Embodiment 69. Harvesting the transduced cells from the container comprises: adding cell dissociation medium to the vessel; and then and removing the suspension of transduced cells from the container. The method according to any one of embodiments 66 to 68.

[0177] Embodiment 70 The method of aspect 69, wherein the cell dissociation medium comprises one or more of a salt and a chelating agent.

[0178] Embodiment 71 The method of embodiment 69, wherein the cell dissociation medium comprises one or more restriction enzymes.

[0179] Embodiment 72 The method of embodiment 69, wherein the cell dissociation medium comprises an oligonucleotide or polynucleotide having a nucleotide sequence complementary to a DNA aptamer.

[0180] The details set forth herein are by way of example only and for purposes of illustrative description of preferred embodiments of the present invention, and are presented to provide what is believed to be the most useful and readily understood explanation of the principles and conceptual aspects of various embodiments of the present invention. In this regard, no attempt has been made to show structural details of the present invention in more detail than necessary for a fundamental understanding of the invention; the description, taken together with the figures and / or examples, will make apparent to those skilled in the art how several forms of the present invention may be embodied in practice. Therefore, before the disclosed processes and devices are described, it should be understood that the aspects described herein are not limited to specific embodiments, apparatus, or configurations, which may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting, unless specifically defined herein.

[0181] As used in the context of describing the present invention (particularly in the context of the claims that follow), the terms "a," "an," "the," and similar referents should be construed to encompass both the singular and the plural unless otherwise indicated herein or clearly contradicted by context. The recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated herein as if each were individually recited herein. It is further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.

[0182] All methods described herein can be performed in any suitable order of steps unless otherwise indicated herein or clearly contradicted by context. Any and all examples provided herein, or the use of exemplary language (e.g., "such as"), are intended merely to better illustrate the invention and do not impose limitations on the scope of the invention as otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0183] Unless the context clearly dictates otherwise, throughout this specification and claims, words like "comprise," "comprising," and the like are to be construed in an inclusive sense, i.e., "including, but not limited to," as opposed to an exclusive or exhaustive sense. Words using the singular or plural also include the plural and singular, respectively. Furthermore, the words "herein," "above," and "below," and words of similar import, when used in this application, shall refer to this application as a whole and not to any particular portions of this application.

[0184] As will be understood by one of ordinary skill in the art, each embodiment disclosed herein can comprise, consist essentially of, or consist of its specified recited elements, steps, ingredients, or components. As used herein, the transitional phrases "comprise" or "comprises" mean and take into account, without limitation, the inclusion of and consideration of any unspecified element, step, ingredient, or component, even if in large amounts. The transitional phrase "consisting of" excludes any unspecified element, step, ingredient, or component. The transitional phrase "consisting essentially of" limits the scope of the embodiment to the specified elements, steps, ingredients, or components and to those that do not materially affect the embodiment.

[0185] Unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0186] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values ​​set forth in the specific examples are reported as precisely as possible, however, any numerical value inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0187] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limiting. Each group member may be referred to and claimed individually or in any combination with other members of the group or other elements found herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion is made, the specification is deemed to include the modified group and thus fulfills the written description of all Markush groups used in the appended claims.

[0188] Several embodiments of the present invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those skilled in the art upon reading the foregoing description. The inventor anticipates that skilled artisans will employ such variations as appropriate, and the inventor intends that the invention may be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Furthermore, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0189] Throughout this specification, numerous references are made to patents and printed publications. Each of the cited references and printed publications is individually incorporated herein by reference in its entirety.

[0190] It is further to be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the invention. Other modifications that may be employed are within the scope of the invention. Thus, by way of example, and not of limitation, alternative configurations of the invention may be utilized in accordance with the teachings herein. Accordingly, the invention is not limited to that precisely as shown and described.

Claims

1. A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 1 (AAACTGCAGCGATTCATTAGTACGGCCTTT).

2. The DNA aptamer of claim 1, having at least 93.3% sequence identity with the sequence of SEQ ID NO:

1.

3. 2. The DNA aptamer of claim 1, which has a span of 20 consecutive nucleotides in common with the sequence of SEQ ID NO:

1.

4. A DNA aptamer comprising a plurality of nucleotides, the DNA aptamer having at least 80% sequence identity with the sequence of SEQ ID NO: 2 (CGAGGCTCTCGGGACGACAAACTGCAGCGATTCATTAGTACGGCCTTTGTCGTCCCGCCTTTAGGATTTACAG).

5. The DNA aptamer of claim 4, having at least 91.7% (e.g., at least 93.1%, or at least 94.5%) sequence identity with the sequence of SEQ ID NO:

2.

6. 5. The DNA aptamer of claim 4, which has a span of 30 consecutive nucleotides in common with the sequence of SEQ ID NO:

1.

7. The DNA aptamer of claim 1, further comprising a reactive group terminal linker attached to a plurality of nucleotides.

8. The DNA aptamer of claim 7 , wherein the reactive group is a primary amine or a carboxylate.

9. A functionalized surface comprising: a surface material; A DNA aptamer according to claim 1 bound to the surface material; A functionalized surface comprising:

10. The functionalized surface of claim 9 , wherein the surface material is a fluoropolymer.

11. The functionalized surface of claim 9 , wherein the DNA aptamer is covalently attached to the surface via reaction of a reactive group with a functional group of the surface material.

12. 12. The functionalized surface of claim 11, wherein the reaction of the reactive group with the functional group of the surface material forms a phosphodiester, amide, or amine that covalently bonds the DNA aptamer to the surface material.

13. 10. The functionalized surface of claim 9, further comprising a second DNA aptamer bound to the surface material, wherein the second DNA aptamer has a binding affinity for the viral vector, and wherein the second DNA aptamer has a binding affinity for the viral vector of at least 10 nM.

14. The functionalized surface of claim 13 , wherein the viral vector is a lentivirus or a retrovirus.

15. A container comprising the functionalized surface of claim 9 as an interior surface.

16. 16. The container of claim 15 in the form of a cell culture bag.

17. 61. The container of claim 59 or claim 60, having disposed therein cell culture medium and a population of cells having VLA-4 surface moieties.

18. 20. A method for transduction of a cell population, comprising incubating a cell population bearing one or more viral vectors and a VLA-4 surface moiety in an aqueous medium in a vessel according to claim 17.

19. 19. The method of claim 18, wherein the one or more viral vectors are lentivirus or retrovirus.

Images