Compositions and methods for the treatment of cancer and metabolic diseases

Abstract

Described herein are oligonucleotide compositions and their use in treating various diseases, such as cancer and metabolic disorders. The present disclosure is based at least in part on the insight that dysregulation of POLRMT and the OXPHOS system is involved in various pathologies, including cancer and metabolic disorders. The present disclosure provides, inter alia, the recognition that oligonucleotides that inhibit POLRMT are particularly useful as treatments for cancer and metabolic disorders associated with mitochondrial dysfunction.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 495,479, filed April 11, 2023, and U.S. Provisional Application No. 63 / 427,685, filed November 23, 2022, the contents of each of which are incorporated herein by reference in their entirety. [Background technology]

[0002] Human mitochondrial RNA polymerase (POLRMT) (also known as hmtRNAP) is a nuclear-encoded single-subunit DNA-dependent RNA polymerase. POLRMT's primary biological role is to transcribe the mitochondrial genome to produce the RNAs required for mitochondrial DNA (mtDNA) expression. The mitochondrial genome encodes various subunits of the electron transport chain (see, e.g., Shokolenko, IN, et al., Annu. Rev. Biochem., 85, 133-160, 2016). Specifically, transcription of the mitochondrial genome is required for the expression of 13 subunits of the oxidative phosphorylation (OXPHOS) system, as well as two rRNAs and 22 tRNAs (see, e.g., Shokolenko, IN, et al., Frontiers in Bioscience, Landmark, 22, 835-853, 2017). Therefore, POLRMT is essential for the biogenesis of the OXPHOS system, leading to ATP production. This, in turn, is crucial for energy homeostasis in the cell.

[0003] Dysregulation of POLRMT and the OXPHOS system has been implicated in a variety of pathologies, including cancer and metabolic diseases. High rates of OXPHOS have been shown to support proliferation in cancer cell lines, including a subset of diffuse large B-cell lymphoma cells (see, e.g., DeBeradinis, RJ, Cancer Cell, 22, 423-24, 2012). Cancer is currently the second leading cause of death in the United States, with projections indicating that nearly 2 million new cases will be diagnosed in 2022 and more than 600,000 deaths as a result of cancer (see Siegel, RLet et al., CA Cancer J. Clin. (72) 7-33, 2022). Thus, there is a need to develop new therapeutic strategies for treatment and prevention. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Shokolenko,IN,et al.,Annu.Rev.Biochem.,85,133-160,2016 [Non-patent document 2] Shokolenko,IN,et al.,Frontiers in Bioscience,Landmark,22,835-853,2017 [Non-patent document 3] DeBeradinis,RJ,Cancer Cell,22,423-24,2012 [Non-patent document 4] Siegel,RLet al.,CA Cancer J.Clin.(72)7-33,2022 Summary of the Invention [Means for solving the problem]

[0005] The present disclosure is based, at least in part, on the insight that dysregulation of POLRMT and the OXPHOS system is involved in various pathologies, including cancer and metabolic diseases. The present disclosure provides, inter alia, the recognition that oligonucleotides that inhibit POLRMT are particularly useful as treatments for cancer and metabolic diseases associated with mitochondrial dysfunction.

[0006] In one aspect, the disclosure provides an oligonucleotide comprising a sequence substantially complementary to 8-30 contiguous nucleotides of a POLRMT RNA transcript. In some embodiments, the oligonucleotide comprises a sequence that is at least 85%, at least 90%, or at least 95% complementary to 8-30 contiguous nucleotides of a POLRMT RNA transcript. In some embodiments, the oligonucleotide comprises a sequence that is completely complementary to 8-30 contiguous nucleotides of a POLRMT RNA transcript. In some embodiments, the 8-30 contiguous nucleotides are 15-25 contiguous nucleotides. In some embodiments, the oligonucleotide is 8-30 nucleotides in length. In some embodiments, the oligonucleotide is 18-22 nucleotides in length. In some embodiments, the oligonucleotide is 20 nucleotides in length.

[0007] In some embodiments, the POLRMT RNA transcript is a human PORLMT RNA transcript. In some embodiments, the human POLRMT RNA transcript comprises SEQ ID NO:205. In some embodiments, the 8 to 30 contiguous nucleotides are within or comprise an exon region of the POLRMT RNA transcript. In some embodiments, the exon comprises an exon identified in any one of Ensemble ID numbers: ENSE00000655271, ENSE00000655279, and ENSE00000655283. In some embodiments, the oligonucleotide is complementary to 16 to 20 contiguous nucleotides of a sequence corresponding to nucleotides 817-845, 2415-2446, or 2978-3008 of SEQ ID NO:205 (i.e., the nucleotide sequence represented in SEQ ID NO:725, 726, or 727).

[0008] In some embodiments, the 8 to 30 contiguous nucleotides comprise a sequence corresponding to nucleotides 2420-2439, 2422-2441, 2983-3002, 2984-3003, 822-839, 823-840, 2421-2438, 2422-2439, 2423-2440, 2424-2441, 2984-3001, 2985-3002, or 2986-3003 of SEQ ID NO:205.

[0009] In another aspect, the disclosure provides an oligonucleotide comprising a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634. In some embodiments, the oligonucleotide comprises SEQ ID NO: 594. In some embodiments, the oligonucleotide comprises SEQ ID NO: 612. In some embodiments, the oligonucleotide comprises SEQ ID NO:632.

[0010] In another aspect, the disclosure provides an oligonucleotide comprising a sequence substantially complementary to a sequence selected from the group consisting of SEQ ID NOs: 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703. In some embodiments, the oligonucleotide is at least 85%, at least 90%, or at least 95% complementary to a sequence selected from the group consisting of SEQ ID NOs: 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703. In some embodiments, the oligonucleotide is fully complementary to a sequence selected from the group consisting of SEQ ID NOs: 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703. In some embodiments, the oligonucleotide comprises a sequence complementary to SEQ ID NO: 663. In some embodiments, the oligonucleotide comprises a sequence complementary to SEQ ID NO: 681. In some embodiments, the oligonucleotide comprises a sequence complementary to SEQ ID NO: 701.

[0011] In some embodiments, the oligonucleotide is a chirally pure oligonucleotide.

[0012] In some embodiments, the oligonucleotide comprises at least one modified nucleotide, hi some embodiments, the modified nucleotide comprises a base modification, a sugar modification, a sugar phosphate modification, an internucleotide linkage modification, or a combination thereof.

[0013] In some embodiments, the internucleotide linkage modification comprises a phosphorothioate or phosphodithioate linkage modification.

[0014] In some embodiments, the sugar modification comprises a 2'-O-methoxyethyl (2'-MOE) modification, a 2'-fluoro (2'-F) modification, a 2'-O-methyl (2'-O-Me) modification, an unlocked nucleic acid (UNA), or a locked nucleic acid (LNA).

[0015] In some embodiments, the sugar phosphate modifications include phosphorodiamidate morpholino (PMO) modifications and / or peptide nucleic acid (PNA) modifications.

[0016] In some embodiments, the base modification comprises a 5'-methylcytosine modification or a G-clamp modification.

[0017] In some embodiments, each nucleotide comprises a phosphorothioate (PS) internucleotide linkage.

[0018] In some embodiments, the oligonucleotide comprises five nucleotides at the 5' end and five at the 3' end containing 2'-MOE modifications of the oligonucleotide sequence. In some embodiments, the oligonucleotide comprises any one of SEQ ID NOs: 728-740.

[0019] In some embodiments, each nucleotide contains a 2'-MOE modification.

[0020] In some embodiments, the oligonucleotide further comprises at least one ligand attached to the 5' and / or 3' end. In some embodiments, the ligand comprises at least one lipid, peptide, and / or sugar. In some embodiments, the sugar comprises one or more N-acetylgalactosamine (GalNAc) moieties.

[0021] In some embodiments, the GalNAc moiety is [ka] The structural formula includes:

[0022] In some embodiments, the GalNAc moiety is conjugated to the oligonucleotide via a linker. In some embodiments, the linker comprises Formula A: [ka]

[0023] In some embodiments, the GalNAc moiety is conjugated to the oligonucleotide via a linker, hi some embodiments, a 2' deoxyadenosine phosphodiester is inserted between the oligonucleotide and the one or more GalNAc moieties.

[0024] In some embodiments, the oligonucleotide, when administered to a cell, is capable of reducing the level of POLRMT mRNA expression, POLRMT protein, and / or PORLMT activity in the cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% compared to the level before administration. In some embodiments, the cell is a human cell.

[0025] In another aspect, the disclosure features an oligonucleotide sequence comprising a sequence complementary to a target region spanning 8-30 contiguous nucleotides of SEQ ID NO: 1 that differs by no more than 1, no more than 2, no more than 3, or no more than 4 nucleotides. In some embodiments, the oligonucleotide comprises a sequence complementary to a target region spanning 8-30 contiguous nucleotides of SEQ ID NO: 1. In some embodiments, the target region spans 15-25 contiguous nucleotides of SEQ ID NO: 1. In some embodiments, the target region spans 20 contiguous nucleotides of SEQ ID NO: 1. In some embodiments, the target region comprises an exon region of POLRMT. In some embodiments, the target region is selected from the group consisting of nucleotides 5696-5715, 8808-8827, 8809-8828, 8811-8830, 16221-16240, 17159-17178, 17314-17333, 17315-17334, 18082-18101, 18083-18102, 18084-18103, 18130-18149, 5680-5699, 8491-8510, 8529-854 of SEQ ID NO:1. Includes areas corresponding to 8, 8569-8588, 8570-8589, 8571-8590, 8572-8591, 8573-8592, 8574-8593, 13322-13341, 13719-13738, 14999-15018, 15092-15111, 15093-15112, 17304-17323, 19309-19328, 20041-20060, 20042-20061, or 21102-21121.

[0026] In some embodiments, the oligonucleotide comprises a sequence substantially complementary to 8 to 30 contiguous nucleotides of a POLRMT RNA transcript.

[0027] In another aspect, the disclosure provides an oligonucleotide comprising a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 3-14. In some embodiments, the oligonucleotide comprises SEQ ID NO: 11. In some embodiments, the oligonucleotide comprises SEQ ID NO: 12.

[0028] In another aspect, the disclosure provides an oligonucleotide comprising a sequence complementary to a sequence at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 15-26. In some embodiments, the oligonucleotide comprises a sequence complementary to a sequence at least 90% identical to any one of SEQ ID NOs: 15-26. In some embodiments, the oligonucleotide comprises a sequence complementary to a sequence selected from the group consisting of SEQ ID NOs: 15-26. In some embodiments, the oligonucleotide comprises a sequence complementary to SEQ ID NO: 23. In some embodiments, the oligonucleotide comprises a sequence complementary to SEQ ID NO: 24.

[0029] In another aspect, the present disclosure provides an oligonucleotide comprising a sequence complementary to a nucleotide sequence that differs from any one of SEQ ID NOs: 3-14 by no more than one, no more than two, no more than three, or no more than four nucleotides, and / or differs from any one of SEQ ID NOs: 15-26 by no more than one, no more than two, no more than three, or no more than four nucleotides.

[0030] In another aspect, the disclosure provides an oligonucleotide sequence comprising a sequence complementary to a target region spanning 8-30 contiguous nucleotides of SEQ ID NO: 581 that differs by no more than one, no more than two, no more than three, or no more than four nucleotides. In some embodiments, the oligonucleotide comprises a sequence complementary to a target region spanning 8-30 contiguous nucleotides of SEQ ID NO: 581. In some embodiments, the target region spans 15-25 contiguous nucleotides of SEQ ID NO: 581. In some embodiments, the target region spans 20 contiguous nucleotides of SEQ ID NO: 581. In some embodiments, the target region comprises an exon region of POLRMT. In some embodiments, the target region comprises a region corresponding to nucleotides 3348-3367 or 3198-3217 of SEQ ID NO: 581.

[0031] In another aspect, the disclosure provides an oligonucleotide comprising a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 393-486. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 393-486. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 393-486. In some embodiments, the oligonucleotide comprises SEQ ID NO: 434. In some embodiments, the oligonucleotide comprises SEQ ID NO: 442.

[0032] In another aspect, the disclosure provides an oligonucleotide comprising a sequence complementary to a sequence at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 487-580. In some embodiments, the oligonucleotide comprises a sequence complementary to a sequence at least 90% identical to any one of SEQ ID NOs: 487-580. In some embodiments, the oligonucleotide comprises a sequence complementary to a sequence selected from the group consisting of SEQ ID NOs: 487-580. In some embodiments, the oligonucleotide comprises a sequence complementary to SEQ ID NO: 528. In some embodiments, the oligonucleotide comprises a sequence complementary to SEQ ID NO: 536.

[0033] In another aspect, the present disclosure provides an oligonucleotide comprising a sequence complementary to a nucleotide sequence that differs from any one of SEQ ID NOs: 393-486 by no more than one, no more than two, no more than three, or no more than four nucleotides, and / or differs from any one of SEQ ID NOs: 487-580 by no more than one, no more than two, no more than three, or no more than four nucleotides.

[0034] In some embodiments, oligonucleotides according to various aspects of the present disclosure are chirally pure oligonucleotides.

[0035] In some embodiments, the oligonucleotide comprises at least one modified nucleotide. In some embodiments, the modified nucleotide comprises a base modification, a sugar modification or sugar phosphate modification, an internucleotide linkage modification, or a combination thereof. In some embodiments, the internucleotide linkage modification comprises a phosphorothioate linkage modification or a phosphodithioate linkage modification. In some embodiments, the sugar modification or sugar phosphate modification comprises a 2'-O-methoxyethyl (2'-MOE) modification, a 2'-fluoro (2'-F) modification, a 2'-O-methyl (2'-O-Me) modification, a phosphorodiamidate morpholino (PMO) modification, a peptide nucleic acid (PNA) modification, an unlocked nucleic acid (UNA), or a locked nucleic acid (LNA). In some embodiments, the base modification comprises a 5'-methylcytosine modification or a G-clamp modification. In some embodiments, each nucleotide comprises a phosphorothioate (PS) internucleotide linkage. In some embodiments, the oligonucleotide comprises five nucleotides containing 2'-MOE modifications at the 5' end and five at the 3' end of the oligonucleotide sequence. In some embodiments, each nucleotide contains a 2'-MOE modification.

[0036] In some embodiments, the oligonucleotide further comprises at least one ligand attached to the 5' and / or 3' end. In some embodiments, the ligand comprises at least one lipid, peptide, and / or sugar. In some embodiments, the sugar comprises an N-acetylgalactosamine (GalNAc) moiety.

[0037] In another aspect, the disclosure provides a composition comprising an oligonucleotide described herein and a carrier and / or excipient.

[0038] In another aspect, the disclosure provides expression vectors comprising one or more sequences encoding one or more of the oligonucleotides described herein.

[0039] In another aspect, the disclosure provides a method of treating a subject having or at risk of cancer or a metabolic disease, the method comprising administering to the subject a composition comprising an effective amount of an oligonucleotide described herein.

[0040] In some embodiments, the level of mitochondrial RNA polymerase (POLRMT) mRNA expression or POLRMT protein in a subject or a biological sample derived from the subject after administration of the composition is reduced compared to the level before administration of the composition. In some embodiments, the level of POLRMT mRNA expression or POLRMT protein is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% compared to the level before administration. In some embodiments, the composition is administered to the subject intravenously, intrathecally, intramuscularly, orally, intranasally, or subcutaneously. In some embodiments, the subject is a human.

[0041] In another aspect, the present disclosure provides a method for treating and / or preventing cancer or a metabolic disease in a subject, the method comprising administering to the subject an oligonucleotide complementary to a target region of a nucleic acid sequence encoding POLRMT.

[0042] In another aspect, the disclosure provides a method for reducing mitochondrial transcription in a subject susceptible to or suffering from cancer or a metabolic disease, the method comprising administering to the subject an oligonucleotide complementary to a target region of a nucleic acid sequence encoding POLRMT.

[0043] In some embodiments, the nucleic acid sequence encoding POLRMT comprises SEQ ID NO: 1. In some embodiments, the target region comprises a region spanning 8 to 30 contiguous nucleotides within SEQ ID NO: 1. In some embodiments, the target region comprises nucleotides 5696-5715, 8808-8827, 8809-8828, 8811-8830, 16221-16240, 17159-17178, 17314-17333, 17315-17334, 18082-18101, 18083-18102, 18084-18103, 18130-18149, 5680-5699, 8491-8510, 8529-854 of SEQ ID NO: 1. 8, 8569-8588, 8570-8589, 8571-8590, 8572-8591, 8573-8592, 8574-8593, 13322-13341, 13719-13738, 14999-15018, 15092-15111, 15093-15112, 17304-17323, 19309-19328, 20041-20060, 20042-20061, or 21102-21121. In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 3-14.

[0044] In some embodiments, upon administration of the oligonucleotide to a subject, the level of POLRMT mRNA expression in the subject is reduced. In some embodiments, upon administration of the oligonucleotide to a subject, the level of POLRMT protein or POLRMT activity in the subject is reduced. In some embodiments, the level of POLRMT mRNA expression, POLRMT protein, or POLRMT activity is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% compared to the level before administration.

[0045] In some embodiments, the subject is a human. In some embodiments, the metabolic disease comprises obesity, diabetes, non-alcoholic steatohepatitis (NASH), a disorder of amino acid metabolism (amino acidemia), a disorder of organic acid metabolism (organic aciduria, organic acidemia), a disorder of lipid metabolism (lipid storage disorder), a lysosomal storage disorder, a peroxisomal disease, phenylketonuria (PKU), a glycogen storage disease, or a urea cycle disorder.

[0046] In some embodiments, the composition is delivered to the liver, in some embodiments, the composition is delivered to the muscle, in some embodiments, the composition is delivered to the CNS, in some embodiments, the composition is delivered to the cerebrospinal fluid.

[0047] In another aspect, the present disclosure provides pharmaceutical compositions comprising the oligonucleotides described herein.In some embodiments, the pharmaceutical compositions comprise a pharmaceutically acceptable carrier.In some embodiments, the oligonucleotides are formulated in nanocarriers.In some embodiments, the oligonucleotides are formulated in lipid nanoparticles (LNPs).In some embodiments, the oligonucleotides are conjugated to at least one GalNAc moiety.

[0048] In some embodiments, the composition is formulated for systemic or local administration, hi some embodiments, the composition is formulated for a delivery route selected from intrathecal administration, intramuscular administration, or intravenous administration.

[0049] In another aspect, the disclosure provides methods for reducing or inhibiting POLRMT expression in a cell, the method comprising contacting the cell with an oligonucleotide described herein. In some embodiments, the level of POLRMT mRNA expression, POLRMT protein, or POLRMT activity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the level before the cell is contacted with the oligonucleotide.

[0050] In some embodiments, the cell is present in a subject. In some embodiments, the subject is a human. In some embodiments, the human is suffering from or susceptible to cancer or a metabolic disorder.

[0051] definition The compounds of the present invention include those generally described above, and are further exemplified by the classes, subclasses, and species disclosed herein. As used herein, the following definitions shall apply unless otherwise specified. For purposes of this invention, chemical elements are defined as defined in the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75 th Further, general principles of organic chemistry are identified in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5 thEd., Ed.: Smith, MB and March, J., John Wiley & Sons, New York: 2001, the entire contents of which are incorporated herein by reference.

[0052] Acyl: As used herein, the term “acyl” refers to —C(O)R, where R is C 1~20 It is aliphatic.

[0053] Aliphatic: As used herein, the terms "aliphatic" or "aliphatic group" refer to a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more units of unsaturation, or a monocyclic or bicyclic hydrocarbon (also referred to herein as "carbocycle," "alicyclic," or "cycloalkyl") that is fully saturated or contains one or more units of unsaturation, but is not aromatic, and has a single point of attachment to the remainder of the molecule. Unless otherwise specified, an aliphatic group contains 1-6 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-5 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-4 aliphatic carbon atoms. In still other embodiments, an aliphatic group contains 1-3 aliphatic carbon atoms, and in other embodiments, an aliphatic group contains 1-2 aliphatic carbon atoms. In some embodiments, "alicyclic" (or "carbocycle" or "cycloalkyl") refers to a monocyclic C3-C6 hydrocarbon that is fully saturated or contains one or more units of unsaturation, but is not aromatic, and has a single point of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, straight-chain or branched-chain, substituted or unsubstituted alkyl, alkenyl, alkynyl groups, and hybrids thereof, such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.

[0054] Alkyl: As used herein, the term "alkyl" means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated and has a single point of attachment to the rest of the molecule.

[0055] Alkenyl: As used herein, the term "alkenyl" means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain containing at least one carbon-carbon double bond and having a single point of attachment to the rest of the molecule.

[0056] Alkynyl: As used herein, the term "alkynyl" means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain containing at least one carbon-carbon triple bond and having a single point of attachment to the rest of the molecule.

[0057] Alkylene: As used herein, the term "alkylene" refers to a divalent alkyl group. An "alkylene chain" is a polymethylene group, i.e., -(CH) n -, where n is a positive integer, preferably 1 to 6, 1 to 4, 1 to 3, 1 to 2, or 2 to 3. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms in the chain have been replaced by a substituent. Suitable substituents include those described below for substituted aliphatic groups.

[0058] Alkenylene: As used herein, the term "alkenylene" refers to a divalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one carbon-carbon double bond in which one or more hydrogen atoms in the chain are replaced by a substituent. Suitable substituents include those described below for substituted aliphatic groups.

[0059] Alkynylene: As used herein, the term "alkynylene" refers to a divalent alkynyl group. A substituted alkynylene chain is a polymethylene group containing at least one carbon-carbon triple bond in which one or more hydrogen atoms in the chain are replaced by a substituent. Suitable substituents include those described below for substituted aliphatic groups.

[0060] Approximately: As used herein, unless otherwise stated or clear from the context, the term "approximately" or "about" in reference to a number is generally interpreted to include numbers that fall within 5%, 10%, 15%, or 20% of that number in either direction (more or less), except where such number would be less than 0% or more than 100% of a possible value.

[0061] Cancer: As used herein, the term "cancer" refers to a disease, disorder, or condition in which cells exhibit relatively abnormal, uncontrolled, and / or autonomous growth, resulting in an abnormally elevated growth rate and / or abnormal growth phenotype characterized by a marked loss of control of cell proliferation. In some embodiments, cancer may be characterized by one or more tumors. Those skilled in the art will recognize, for example, adrenocortical carcinoma, astrocytoma, basal cell carcinoma, carcinoid, cardiac cancer, cholangiocarcinoma, chordoma, chronic myeloproliferative neoplasm, craniopharyngioma, ductal carcinoma in situ, ependymoma, intraocular melanoma, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), gestational trophoblastic disease, glioma, histiocytosis, leukemia (e.g., acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), and / or leukemia-associated leukemia (LEU). ), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), hairy cell leukemia, myeloid leukemia, myeloid leukemia), lymphoma (e.g., Burkitt lymphoma [non-Hodgkin's lymphoma], cutaneous T-cell lymphoma, Hodgkin's lymphoma, mycosis fungoides, Sézary syndrome, AIDS-related lymphoma, follicular lymphoma, diffuse large B-cell lymphoma), melanoma, Merkel cell lymphoma, alveolar carcinoma, mesothelioma, myeloma (e.g., multiple myeloma), myelodysplastic syndrome, papilloma, paraganglioma, pheochromocytoma, pleuropulmonary blastoma, retinoblastoma, sarcoma (e.g., Ewing's sarcoma, Kaposi's sarcoma, osteosarcoma, rhabdomyosarcoma, uterine sarcoma, angiosarcoma), Wilms' tumor, and / or tumors of the adrenal cortex, anus, appendix, bile duct, bladder, bone, brain, breast, bronchus, central nervous system, cervix, colon, endometrium, esophagus We recognize various types of cancer, including cancer of the eye, fallopian tube, gallbladder, gastrointestinal tract, germ cell, head and neck, heart, intestine, kidney (e.g., Wilms tumor), larynx, liver, lung (e.g., non-small cell lung cancer, small cell lung cancer), mouth, nasal cavity, oral cavity, ovary, pancreas, rectum, skin, stomach, testicle, throat, thyroid, penis, pharynx, peritoneum, pituitary gland, prostate, rectum, salivary gland, ureter, urethra, uterus, vagina, or vulva.

[0062] Aryl: As used herein, the term "aryl" used alone or as part of a larger moiety, such as in "aralkyl," "aralkoxy," or "aryloxyalkyl," refers to monocyclic and bicyclic ring systems having a total of 5 to 14 ring members, wherein at least one ring in the system is aromatic and each ring in the system contains 3 to 7 ring members. The term "aryl" may be used interchangeably with the term "aryl ring." In certain embodiments of the present invention, "aryl" refers to an aromatic ring system that may bear one or more substituents, including, but not limited to, phenyl, biphenyl, naphthyl, anthracyl, and the like. Also included within the scope of the term "aryl," as used herein, are groups in which an aromatic ring is fused with one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthymidyl, phenanthridinyl, or tetrahydronaphthyl, and the like. In certain preferred embodiments, the term aryl refers to phenyl.

[0063] Carbocyclic: As used herein, the terms "alicyclic," "carbocycle," or "cycloalkyl" refer to a monocyclic C3-C6 hydrocarbon that is fully saturated or contains one or more units of unsaturation, but is not aromatic, and has a single point of attachment to the rest of the molecule.

[0064] Complementary: As used herein, "complementary," in accordance with its art-recognized meaning, refers to the ability to pair between specific bases, nucleosides, nucleotides, or nucleic acids. For example, adenine (A) and uracil (U) are complementary, adenine (A) and thymine (T) are complementary, and guanine (G) and cytosine (C) are complementary, a process known in the art as Watson-Crick base pairing. If an oligonucleotide, i.e., a molecule containing nucleotides, is complementary to a nucleotide in a second oligonucleotide at a particular position in its sequence (at a particular nucleotide in the oligonucleotide) when the oligonucleotides are aligned in an antiparallel orientation, the nucleotides of each oligonucleotide form complementary base pairs, and the oligonucleotides are said to be complementary at that particular position. Thus, two oligonucleotides can be characterized by their percentage of complementary base pairing of their nucleotides. For example, the percent complementarity between a first oligonucleotide having a first nucleic acid sequence and a second oligonucleotide having a longer nucleic acid sequence can be evaluated by aligning them in an antiparallel direction and maximizing their complementary base pairing. When an oligonucleotide is engineered against a target gene, the oligonucleotide can be evaluated for its complementarity to the pre-RNA or mRNA sequence of the target gene, and the alignment is said to be performed over an evaluation window along the RNA sequence. In this example, the percent complementarity of base pairs in the oligonucleotide with the RNA sequence window is determined by dividing the total number of nucleotides that form base pairs in the oligonucleotide and the RNA sequence window by the total number of nucleotides in the RNA sequence window and multiplying by 100. For example, if the RNA sequence is AATTTGTTATAAA, the evaluation window ("RNA sequence window") can be from the third nucleic acid (i.e., T) to the tenth nucleotide (also T) (counting from left to right). The RNA sequence window of this exemplary RNA sequence is 8 consecutive nucleotides long.When an AAAAAAAA oligonucleotide is aligned along the aforementioned RNA sequence window, six of the eight total nucleotides in the RNA sequence window undergo Watson-Crick base pairing, resulting in an optimized alignment resulting in up to 75% complementary base pairing. Positions occupied by two non-complementary nucleotides are mismatched, i.e., the position is occupied by a non-complementary base pair. In the above example, two of the eight nucleotides in the RNA sequence window are mismatched. When every nucleotide of an oligonucleotide base pairs with every nucleotide of a second sequence of equal length (which may be another oligonucleotide or an RNA sequence window), such sequences can be referred to as "fully complementary" (100% complementary) with respect to each other. Two nucleic acid sequences that are at least 80% complementary across the evaluation window are considered "substantially complementary" across that window. In certain embodiments, two nucleic acid sequences are at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% complementary across the evaluation window. When a first nucleic acid sequence is referred to herein as "substantially complementary" to a second nucleic acid sequence, it may contain one or more unmatched bases upon hybridization, for example, up to about 5%, 10%, 15%, or 20% unmatched bases upon hybridization, e.g., for a duplex of up to 30 base pairs, it may contain one, two, three, four, five, or six mismatched base pairs upon hybridization. It is understood that when two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs are not considered mismatched or unpaired nucleotides for purposes of determining percent complementarity. "Complementary" sequences, as used herein, may contain one or more non-Watson-Crick base pairs and / or base pairs formed from unnatural nucleobases, provided that the requirements for their hybridization ability are met.Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogsteen base pairing. Those skilled in the art recognize that, according to the so-called "wobble" rules, guanine, cytosine, adenine, thymine, and uracil can be substituted with other bases without substantially altering the base-pairing properties of polynucleotides containing nucleotides having such bases (see, e.g., Murphy, FV IV & V Ramakrishnan, V., Nature Structural and Molecular Biology 11:1251-1252 (2004)). For example, a nucleotide containing inosine as its base can base pair with a nucleotide containing adenine, cytosine, thymine, or uracil. Thus, for example, a nucleotide containing inosine can be substituted for a nucleotide containing uracil, guanine, thymine, or adenine in the nucleic acid sequences of the oligonucleotides described herein without decreasing the percent complementarity. If a pair of bases can form a base pair (e.g., via Watson-Crick base pairing or wobble base pairing), then such a base pair is considered complementary for the purposes of determining percent complementarity.

[0065] Corresponding to: As used herein, the term "corresponding to" may be used to designate the location / identity of a structural element in a compound or composition through comparison to an appropriate reference compound or composition. For example, in some embodiments, a monomeric residue in a polymer (e.g., an amino acid residue in a polypeptide, or a nucleotide residue in an oligonucleotide) may be identified as "corresponding to" a residue in an appropriate reference polymer. For example, for simplicity's sake, residues in a polypeptide are often designated using a standard numbering system based on the reference related polypeptide, such that one of skill in the art will understand that an amino acid "corresponding to" a residue at position 190, for example, need not actually be the 190th amino acid in a particular amino acid chain, but rather corresponds to the residue found at position 190 in the reference polypeptide. One of skill in the art will readily understand how to identify "corresponding" amino acids and "corresponding" nucleotides. For example, one of skill in the art will recognize various sequence alignment strategies. Such sequence alignment strategies include, for example, software programs such as BLAST, CS-BLAST, CUSASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / Hhsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE, which can be used, for example, to identify "corresponding" residues in polypeptide, oligonucleotide, and / or nucleic acid sequences according to the disclosure.

[0066] Halogen: As used herein, the term “halogen” means F, Cl, Br, or I.

[0067] Heteroaryl: As used herein, the terms "heteroaryl" and "heteroar-," used alone or as part of a larger moiety, for example, "heteroaralkyl" or "heteroaralkoxy" refer to a group having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms, having 6, 10, or 14 pi electrons shared in the cyclic array, and having 1 to 5 heteroatoms in addition to carbon atoms. The term "heteroatom" refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen. Heteroaryl groups include, but are not limited to, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. The terms "heteroaryl" and "heteroara," as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, alicyclic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzothiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. Heteroaryl groups can be monocyclic or bicyclic. The term "heteroaryl" can be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," all of which include optionally substituted rings. The term "heteroaralkyl" refers to an alkyl group substituted by a heteroaryl, where the alkyl and heteroaryl portions are independently optionally substituted.

[0068] Heteroatom: As used herein, the term "heteroatom" refers to oxygen, sulfur, nitrogen, phosphorus, or silicon (any oxidized form of nitrogen, sulfur, phosphorus, or silicon, the quaternized form of any basic nitrogen, or a substitutable nitrogen of a heterocyclic ring (e.g., N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR + (including those found in N-substituted pyrrolidinyl)).

[0069] Heterocycle: As used herein, the terms "heterocycle," "heterocyclyl," "heterocyclic radical," and "heterocyclic ring" are used interchangeably and refer to a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety, which is either saturated or partially saturated and has, in addition to carbon atoms, one or more, preferably one to four, heteroatoms as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. By way of example, in a saturated or partially unsaturated ring having 0 to 3 heteroatoms selected from oxygen, sulfur, or nitrogen, the nitrogen can be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or + It can be NR (as in N-substituted pyrrolidinyl).

[0070] A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure, and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenylpyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms "heterocycle," "heterocyclyl," "heterocyclyl ring," "heterocyclic group," "heterocyclic moiety," and "heterocyclic radical" are used interchangeably herein and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or alicyclic rings (such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl), where the radical or point of attachment is on the heterocyclyl ring. Heterocyclyl groups can be monocyclic or bicyclic. The term "heterocyclylalkyl" refers to an alkyl group substituted by a heteroaryl, where the alkyl and heterocyclyl portions, independently, are optionally substituted.

[0071] Host cell: As used herein, the term "host cell" refers to a cell into which exogenous DNA (recombinant or otherwise) has been introduced. Those skilled in the art will understand, upon reading this disclosure, that such terms refer not only to the particular subject cell, but also to the progeny of such a cell. Because certain modifications may occur in successive generations, either due to mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein. In some embodiments, host cells include prokaryotic and eukaryotic cells selected from any of the kingdoms of life that are suitable for expressing exogenous DNA (e.g., recombinant nucleic acid sequences). Exemplary cells include prokaryotic and eukaryotic cells (unicellular or multicellular), bacterial cells (e.g., strains of E. coli, Bacillus spp., Streptomyces spp., etc.), mycobacterial cells, fungal cells, yeast cells (e.g., S. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusions (e.g., hybridomas or quadromas, etc.). In some embodiments, the cells are human cells, monkey cells, ape cells, hamster cells, rat cells, or mouse cells. In some embodiments, the cell is a eukaryotic cell and is selected from the following cells: CHO (e.g., CHO K1, DXB-11 CHO, Veggie-CHO), COS (e.g., COS-7), retinal cells, Vero, CV1, kidney cells (e.g., HEK293, 293EBNA, MSR293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC5, Colo205, HB8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epidermal), CV-1, U937, 3T3, L cells, C127 cells, SP2 / 0, NS-0, MMT060562, Sertoli cells, BRL 3A cells, HT1080 cells, myeloma cells, tumor cells, and cell lines derived from the foregoing cells. In some embodiments, the cell comprises one or more viral genes.

[0072] Identity: As used herein, the term "identity" refers to the overall relatedness between multimeric molecules (e.g., between nucleic acid molecules (e.g., DNA molecules such as oligonucleotides and / or RNA molecules) and / or between polypeptide molecules). In some embodiments, multimeric molecules are considered to be "substantially identical" to one another if their sequences are at least 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences can be performed, for example, by aligning the two sequences for purposes of optimal comparison (e.g., gaps can be introduced in one or both of the first and second sequences to optimize alignment, and non-identical sequences can be ignored for comparison purposes). In certain embodiments, the length of the sequences aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. Nucleotides at corresponding positions are then compared. If a position in a first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in a second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced to optimally align the two sequences. Comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, percent identity between two nucleotide sequences can be determined using the Meyers and Miller algorithm (CABIOS, 1989, 4:11-17) incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons performed using the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.The percent identity between two nucleotide sequences can alternatively be determined using the GAP program in the GCG software package using the NWSgapdna.CMP matrix.

[0073] Linked: As used herein, the term "linked," when used in reference to two or more moieties, means that the moieties are physically associated or tethered to one another to form a sufficiently stable molecular structure so that the moieties remain associated under the conditions under which the bond is formed, and preferably under the conditions under which the new molecular structure will be used (e.g., physiological conditions). In certain preferred embodiments of the invention, the bond is covalent. In other embodiments, the bond is non-covalent. Moieties can be linked either directly or indirectly. When two moieties are directly linked, they are covalently bonded to one another or are in sufficient proximity that intermolecular forces between the two moieties maintain their association. When two moieties are indirectly linked, they are each linked, either covalently or non-covalently, to a third moiety that maintains the association between the two moieties. Generally, when two moieties are referred to as being linked by a "linker" or "linking moiety" or "linking portion," the bond between the two linking moieties is indirect, and typically the linking moieties are each covalently bonded to the linker. The linker can be any suitable moiety that will react with the two moieties to be linked in a reasonable amount of time, under conditions consistent with the stability of the moieties (which may be protected as necessary), and in amounts sufficient to give reasonable yields.

[0074] Operably linked: As used herein, the term "operably linked" refers to an arrangement wherein the components described are in a relationship permitting them to function in their intended manner. A control element "operably linked" to a functional element is associated in such a way that expression and / or activity of the functional element is achieved under conditions compatible with the control elements. In some embodiments, an "operably linked" control element is contiguous (e.g., covalently linked) with a coding element of interest; in some embodiments, the control element acts in trans with the functional element of interest or otherwise separate from the functional element of interest.

[0075] Optionally substituted or substituted: As described herein, compounds of the invention may contain "optionally substituted" moieties. In general, the term "substituted," whether preceded by the term "optionally," means that one or more hydrogens of the specified moiety have been replaced by a suitable substituent. Unless otherwise specified, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and if multiple positions in any given structure may be substituted with multiple substituents selected from a specified group, the substituents may be either the same or different at every position. Combinations of substituents envisioned by the present invention are preferably those that result in the formation of stable or chemically feasible compounds. The term "stable," as used herein, refers to a compound that remains substantially unchanged when subjected to conditions that allow for its production, detection, and, in certain embodiments, its recovery, purification, and use for one or more of the purposes disclosed herein.

[0076] Suitable monovalent substituents on a substitutable carbon atom of an "optionally substituted" group are independently: halogen; -(CH) 0~4 R°;-(CH2) 0~4 OR°;-O(CH2) 0~4 R o , -O-(CH2)0~4 C(O)OR°;-(CH2) 0~4 CH(OR°)2;-(CH2) 0~4 SR°;-(CH2) 0~4 Ph (which may be substituted by R°); —(CH2) 0~4 O(CH2) 0~1 Ph (which may be substituted by R°); -CH=CHPh (which may be substituted by R°); -(CH2) 0~4 O(CH2) 0~1 -pyridyl (possibly substituted by R°); -NO2; -CN; -N3; ​​-(CH2) 0~4 N(R°)2;-(CH2) 0~4 N(R°)C(O)R°;-N(R°)C(S)R°;-(CH2) 0~4 N(R°)C(O)NR°2;-N(R°)C(S)NR°2;-(CH2) 0~4 N(R°)C(O)OR°;-N(R°)N(R°)C(O)R°;-N(R°)N(R°)C(O)NR°2;-N(R°)N(R°)C(O)OR°;-(CH2) 0~4 C(O)R°;-C(S)R°;-(CH2) 0~4 C(O)OR°;-(CH2) 0~4 C(O)SR°;-(CH2) 0~4 C(O)OSiR°3;-(CH2) 0~4 OC(O)R°;-OC(O)(CH2) 0~4 SR°, SC(S)SR°;-(CH2) 0~4 SC(O)R°;-(CH2) 0~4 C(O)NR°2;-C(S)NR°2;-C(S)SR°;-SC(S)SR°, -(CH2) 0~4 OC(O)NR°2;-C(O)N(OR°)R°;-C(O)C(O)R°;-C(O)CH2C(O)R°;-C(NOR°)R°;-(CH2) 0~4 SSR°;-(CH2) 0~4 S(O)2R°;-(CH2) 0~4 S(O)2OR°;-(CH2) 0~4 OS(O)2R°;-S(O)2NR°2;-(CH2) 0~4S(O)R°;-N(R°)S(O)2NR°2;-N(R°)S(O)2R°;-N(OR°)R°;-C(NH)NR°2;-P(O)2R°;-P(O)R°2;-OP(O)R°2;-OP(O)(OR°)2;SiR°3;-(C 1~4 straight or branched chain alkylene)ON(R°)2; or -(C 1~4 straight or branched chain alkylene)C(O)ON(R°), where each R° may be substituted as defined below and independently represents hydrogen, C 1~6 Aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, -CH2- (a 5- to 6-membered heteroaryl ring), or a 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; or, notwithstanding the above definitions, two independently occurring R° together with their intervening atom(s) form a 3- to 12-membered saturated monocyclic or bicyclic ring, partially unsaturated monocyclic or bicyclic ring, or aryl monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below.

[0077] Suitable monovalent substituents on R° (or the ring formed by two independent R° together with their intervening atoms) are independently halogen, —(CH2), 0~2 R ● ,-(Halo R ● ), -(CH2) 0~2 OH, -(CH2) 0~2 OR ● , -(CH2) 0~2 CH(OR ● )2;-O(HaloR ● ), -CN, -N3, -(CH2) 0~2 C(O)R ● , -(CH2) 0~2 C(O)OH, -(CH2) 0~2 C(O)OR ● , -(CH2) 0~2 SR ● , -(CH2) 0~2SH, -(CH2) 0~2 NH2, -(CH2) 0~2 NHR ● , -(CH2) 0~2 NR ● 2, -NO2, -SiR ● 3. -OSiR ● 3. -C(O)SR ● , -(C 1~4 Straight or branched chain alkylene)C(O)OR ● , or -SSR ● where each R ● is unsubstituted or, if preceded by "halo", substituted only by one or more halogens, and C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1 or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R° include =0 and =S.

[0078] Suitable divalent substituents on a saturated carbon atom of an "optionally substituted" group include: ═O, ═S, ═NNR * 2, =NNHC(O)R * , =NNHC(O)OR * , =NNHS(O)2R * , =NR * , =NOR * , -O(C(R * 2)) 2~3 O-, or -S(C(R * 2)) 2~3 S-(wherein each independently occurring R * is hydrogen, which may be substituted as defined below. 1~6 (Optionally substituted groups are selected from unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having aliphatic or 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.) Suitable divalent substituents attached to adjacent substitutable carbon atoms of an "optionally substituted" group include -O(CR * 2) 2~3O—, wherein each independently occurring R * is hydrogen, which may be substituted as defined below. 1~6 It is selected from aliphatic or unsubstituted 5-6 membered saturated, partially unsaturated, or aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0079] R * Suitable substituents on the aliphatic group include halogen, -R ● ,-(Halo R ● ), -OH, -OR ● , -O(HaloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or -NO2, wherein each R ● is unsubstituted or, if preceded by "halo", is substituted only by one or more halogens, and independently represents C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0080] Suitable substituents on a substitutable nitrogen of an "optionally substituted" group include -R † , -NR † 2. -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CHC(O)R † , -S(O)2R † , -S(O)NR † 2. -C(S)NR † 2. -C(NH)NR † 2, or -N(R † )S(O)2R † wherein each R † are independently hydrogen, C which may be substituted as defined below 1~6aliphatic, unsubstituted -OPh, or an unsubstituted 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, regardless of the above definition, two independently occurring R † together with their intervening atom(s) form an unsubstituted 3-12 membered saturated monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a partially unsaturated monocyclic or bicyclic ring, or an aryl monocyclic or bicyclic ring.

[0081] R † Suitable substituents on the aliphatic group are independently halogen, -R ● ,-(Halo R ● ), -OH, -OR ● , -O(HaloR ● ), -CN, -C(O)OH, -C(O)OR ● , -NH2, -NHR ● , -NR ● 2, or NO2, where each R ● is unsubstituted or, if preceded by "halo", is substituted only by one or more halogens, and independently represents C 1~4 Aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or a 5-6 membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0082] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that contains at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings with multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties as defined herein.

[0083] Recombinant: As used herein, the term "recombinant" is intended to refer to a polypeptide, polynucleotide, or oligonucleotide that is designed, engineered, prepared, expressed, created, manufactured, and / or isolated by recombinant means, such as a polypeptide expressed using a recombinant expression vector transfected into a host cell; a polypeptide isolated from a recombinant combinatorial human polypeptide library; a polypeptide isolated from an animal (e.g., mouse, rabbit, sheep, fish, etc.) that is transgenic for or has otherwise been engineered to express the gene(s) or genetic component(s) encoding and / or directing the expression of the polypeptide or one or more component(s), portion(s), element(s), or domain(s) thereof, and / or a polypeptide prepared, expressed, created, or isolated by any other means involving splicing or ligating selected nucleic acid sequence elements together, chemically synthesizing selected sequence elements, and / or otherwise generating nucleic acids encoding and / or directing the expression of the polypeptide or one or more component(s), portion(s), element(s), or domain(s) thereof. In some embodiments, one or more of such selected sequence elements are found in nature. In some embodiments, one or more of such selected sequence elements are designed in silico. In some embodiments, one or more such selected sequence elements result from mutagenesis (e.g., in vivo or in vitro) of known sequence elements, such as those derived from natural or synthetic sources (e.g., in the germline of a source organism of interest (e.g., human, mouse, etc.)).

[0084] Subject: As used herein, the term "subject" or "test subject" refers to any organism to which a provided compound or composition is administered in accordance with the present invention, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans, insects, worms, etc.) and plants. In some embodiments, the subject may be suffering from and / or susceptible to a disease, disorder, and / or condition.

[0085] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting a desired characteristic or property to a complete or near-complete extent or degree. Those skilled in the biological arts will understand that biological and chemical phenomena rarely, if ever, proceed to completion and / or perfection, or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0086] Suffering from: An individual who is "suffering from" a disease, disorder, and / or condition has been diagnosed with and / or exhibits one or more symptoms of the disease, disorder, and / or condition.

[0087] Target gene: "Target gene," as used herein, refers to a gene whose expression is to be modulated (e.g., inhibited).

[0088] Target region: As used herein, the term "target region" refers to a region within an RNA transcript of a target gene where the RNA is to be degraded, translationally repressed, or otherwise inhibited using one or more oligonucleotides. In some embodiments, the oligonucleotides described herein are complementary (e.g., substantially or perfectly complementary) to the target region, such that the oligonucleotides are capable of hybridizing to the target region. A target region, as described herein, may be described by its location (i.e., the nucleotide coordinates of the target region) within the target RNA sequence or a corresponding region within the target gene sequence. The RNA may be a primary RNA transcript (e.g., pre-mRNA) transcribed from the target gene or a processed transcript (e.g., mRNA encoding a polypeptide). In some embodiments, the target region of an mRNA is at least long enough to serve as a substrate for RNase-mediated degradation within that portion in the presence of appropriate oligonucleotides. The target region may be about 8-36 nucleotides in length, e.g., about 8-30, 10-20, or about 15-30 nucleotides in length. The length of the target region can have a specific value or a subrange within the aforementioned ranges.

[0089] Therapeutic Agent: As used herein, the phrase "therapeutic agent" refers to any agent that has a therapeutic effect and / or induces a desired biological and / or pharmacological effect when administered to a subject. In some embodiments, a therapeutic agent is any substance that can be used to alleviate, ameliorate, mitigate, suppress, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. In some embodiments, a therapeutic agent is an oligonucleotide designed to target a specific region of a target gene.

[0090] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered as part of a treatment regimen. In some embodiments, a therapeutically effective amount of a substance is an amount that, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, is sufficient to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition. As will be understood by one of skill in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance to be delivered, the target cell, or the target tissue, etc. For example, an effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that relieves, ameliorates, alleviates, suppresses, prevents, delays the onset of, reduces the severity of, and / or reduces the incidence of, one or more symptoms or signs of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver the therapeutically effective amount.

[0091] Treating: As used herein, the term "treating" refers to providing therapy, i.e., providing any type of medical or surgical management of a subject. Treatment can be provided to ameliorate, alleviate, inhibit the progression of, prevent or reduce the likelihood of, or to ameliorate, alleviate, inhibit or prevent the progression of, or prevent or reduce the likelihood of, a disease, disorder, or condition. "Preventing" refers to preventing the occurrence of a disease, disorder, condition, or symptom or sign of such, at least for a period of time, in at least some individuals. Treating can include administering an agent to a subject after the onset of one or more symptoms or signs indicative of a cancer or metabolic-related condition, for example, to ameliorate, alleviate, reduce the severity of, and / or inhibit or prevent the progression of, the condition, and / or ameliorate, alleviate, reduce the severity of, and / or inhibit one or more symptoms or signs of the condition. The compositions of the present disclosure can be administered to subjects who have developed a cancer or metabolic-related disorder or who are at increased risk for developing such a disorder compared to members of the general population. The compositions of the present disclosure can be administered prophylactically, i.e., prior to the onset of any symptoms or signs of a condition, typically when the subject is at risk of developing the condition.

[0092] Nucleic Acid: The term "nucleic acid" includes any nucleotide, its analogs, and polymers thereof. The terms "polynucleotide" or "oligonucleotide," as used herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA). These terms refer to the primary structure of the molecule and thus include double-stranded and single-stranded DNA as well as double-stranded and single-stranded RNA. These terms include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs and modified polynucleotides (such as, but not limited to, methylated, protected, and / or capped nucleotides or polynucleotides). The terms encompass polyribonucleotides or oligoribonucleotides (RNA) and polydeoxyribonucleotides or oligodeoxyribonucleotides (DNA), RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases, nucleic acids derived from sugars and / or modified sugars, and nucleic acids derived from phosphate bridges and / or modified phosphorus atom bridges (also referred to herein as "internucleotide linkages"). The term further encompasses nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified phosphorus atom bridges. Examples include, but are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxyribose moieties, and nucleic acids containing both ribose and deoxyribose moieties, and nucleic acids containing ribose and modified ribose moieties. In some embodiments, the prefix "poly" refers to nucleic acids containing from 2 to about 10,000, from 2 to about 50,000, or from 2 to about 100,000 nucleotide monomer units. In some embodiments, the prefix "oligo" refers to nucleic acids containing from 2 to about 200 nucleotide monomer units.

[0093] Unsaturated: The term "unsaturated," as used herein, means that a moiety has one or more units of unsaturation.

[0094] Vector: As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, into which additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[0095] Standard techniques (e.g., electroporation, lipofection) may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation. Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications, or as commonly accomplished in the art, or as described herein. The foregoing techniques and procedures may generally be performed according to conventional methods well known in the art, as well as as described in various general and more specific references cited and discussed throughout this specification. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)), which is incorporated herein by reference for all purposes. [Brief explanation of the drawings]

[0096] [Figure 1]1 shows a schematic diagram of mitochondria in a cell, including the oxidative phosphorylation system (OXPHOS) and mitochondrial DNA (mtDNA), which is an exemplary target for the oligonucleotides described herein. [Figure 2] FIG. 1 shows a schematic diagram of the various POLRMT RNA transcripts targeted by the exemplary oligonucleotides described herein. [Figure 3] Two exemplary oligonucleotides described herein are shown, including their nucleotide sequences and specific modification patterns. In this figure, blue shaded circles indicate 2'-O-MOE groups, and red lines between nucleotides represent phosphorothioate (PS) linkages. [Figure 4] 1 shows relative POLRMT mRNA expression in HeLa cells transfected with exemplary oligonucleotides. [Figure 5] 1 shows relative CytB mRNA expression in HeLa cells transfected with exemplary oligonucleotides. [Figure 6] 1 shows relative POLRMT mRNA expression in 3T3 cells transfected with exemplary oligonucleotides at 100 nM. [Figure 7] 1 shows relative POLRMT mRNA expression in 3T3 cells transfected with exemplary oligonucleotides at 100 nM. [Figure 8] 1 shows relative POLRMT mRNA expression in 3T3 cells transfected with exemplary oligonucleotides at 100 nM. [Figure 9] 1 shows relative POLRMT mRNA expression in 3T3 cells transfected with exemplary oligonucleotides at 100 nM. [Figure 10] 1 shows relative POLRMT mRNA expression in 3T3 cells transfected with exemplary oligonucleotides at 30 nM. [Figure 11] 1 shows relative POLRMT mRNA expression in 3T3 cells transfected with exemplary oligonucleotides at 30 nM. [Figure 12] 1 shows a schematic diagram of the human POLRMT transcript and exemplary human-mouse compatible oligonucleotides arranged based on target regions on the POLRMT transcript, which also identifies three "hot spot" regions identified and described herein. [Figure 13] Figures 1A-1D show POLRMT expression and cell viability in human 143B cells and mouse 3T3 cells transfected with exemplary oligonucleotides (corresponding to the nucleotide sequences set forth in SEQ ID NOs: 612, 613, 623, 624, 632, 633, and 634) at various concentrations. Panel (A) shows POLRMT expression in human 143B cells transfected with exemplary oligonucleotides at various concentrations. Panel (B) shows the viability of human 143B cells transfected with exemplary oligonucleotides at various concentrations. Panel (C) shows POLRMT expression in mouse 3T3 cells transfected with exemplary oligonucleotides at various concentrations. Panel (D) shows the viability of mouse 3T3 cells transfected with exemplary oligonucleotides at various concentrations. [Figure 14] Figures 1A-1D show POLRMT expression and cell viability in human 143B cells and mouse 3T3 cells transfected with exemplary oligonucleotides (corresponding to the nucleotide sequences set forth in SEQ ID NOs: 592, 594, 597, 598, 625, and 626) at various concentrations. Panel (A) shows POLRMT expression in human 143B cells transfected with exemplary oligonucleotides at various concentrations. Panel (B) shows the viability of human 143B cells transfected with exemplary oligonucleotides at various concentrations. Panel (C) shows POLRMT expression in mouse 3T3 cells transfected with exemplary oligonucleotides at various concentrations. Panel (D) shows the viability of mouse 3T3 cells transfected with exemplary oligonucleotides at various concentrations. [Figure 15]1 shows the in vitro toxicity of HepG2 and 3T3 cells transfected with various exemplary oligonucleotides described herein at 100 nM, with toxicity expressed as a ratio to vehicle control. [Figure 16] Shown is the expression of POLRMT (relative to vehicle control) in HepG2 cells transfected with exemplary oligonucleotides described herein at a concentration of 100 nM (Panel A), and the viability of HepG2 cells transfected with exemplary oligonucleotides (expressed as a percentage (%) relative to vehicle control) (Panel B). DETAILED DESCRIPTION OF THE INVENTION

[0097] Mitochondrial RNA polymerase (POLRMT), cancer, and metabolic diseases The present disclosure provides, inter alia, compositions and methods for treating cancer and metabolic diseases through the inhibition of POLRMT.

[0098] Human mitochondrial RNA polymerase (POLRMT) (also called hmtRNAP) is a nuclear-encoded, single-subunit, DNA-dependent RNA polymerase. POLRMT is 1,230 amino acids long and consists of three distinct regions: (1) the C-terminal polymerase domain (CTD) (residues 648–1,230), (2) the N-terminal domain (NTD) (residues 369–647), and (3) the N-terminal extension (NTE) (residues 1–368) (see, e.g., Arnold, JJ, et al., Biochim. Biophys. Acta, 1819, 948–960, 2012). POLRMT is structurally related to the single-subunit RNA polymerase encoded by bacteriophage T7. The CTD is also known as the catalytic domain, named for its function in catalyzing nucleotide incorporation into growing RNA molecules during transcription. This domain is highly conserved across species; in contrast, the NTE shows remarkable sequence variability, suggesting an organism-specific role for this POLRMT domain. Structurally, the NTD of POLRMT is similar to the N-terminal domain (also called the promoter-binding domain) of T7 RNA polymerase. However, for promoter-specific transcription initiation, POLRMT requires the assistance of additional transcription factors, whereas T7 RNA polymerase does not.

[0099] The protein sequence of wild-type human POLRMT is as follows (1230 amino acids): [ka]

[0100] Eight known mRNA splice variants of the POLRMT gene are publicly available and are identified in ENSEMBL ID: ENST00000588649.7, ENST00000590573.4, ENST00000590336.2, ENST00000592863.2, ENST00000587057.5, ENST00000590709.3, ENST00000589961.2, and ENST00000592633.5. The POLRMT mRNA transcript encoding the full-length POLRMT protein (identified above in SEQ ID NO: 2) is identified in ENSEMBL ID: ENST00000588649.7 (corresponding to SEQ ID NO: 205).

[0101] The primary biological role of POLRMT is to transcribe the mitochondrial genome to produce the RNA required for mitochondrial DNA (mtDNA) expression. Initiation, elongation, and termination are the three steps of mitochondrial transcription. The light-strand promoter (LSP) and two heavy-strand promoters (HSP-1 and HSP-2) on mtDNA each contain a transcription start site (see, e.g., Basu, U. et al., J. Biol. Chem., 295(52), 18406-425, 2020). For promoter-specific transcription initiation, POLRMT requires two transcription factors, TFAM (mitochondrial transcription factor A) and TFB2M (mitochondrial transcription factor B). See also ibid. Various models have suggested different mechanisms by which the initiation complex, involving POLRMT, TFAM, and TFB2M, assembles and coats promoter DNA to initiate transcription. In one current model, TFAM recruits POLRMT to the promoter site to form a protein-protein preinitiation complex, which TFB2M binds to form the initiation complex, which coats the promoter DNA. See ibid. During initiation, the RNA is elongated to a length of approximately 8-10 nucleotides. At that point, a conformational change occurs involving promoter withdrawal and translocation of initiation factors, converting the initiation complex into an elongation complex, at which point transcription occurs. See ibid.

[0102] The mitochondrial genome encodes various subunits of the electron transport chain (see, e.g., Shokolenko, IN, et al., Annu. Rev. Biochem., 85, 133-160, 2016). Specifically, transcription of the mitochondrial genome is required for the expression of 13 subunits of the oxidative phosphorylation (OXPHOS) system, as well as two rRNAs and 22 tRNAs (see, e.g., Shokolenko, IN, et al., Frontiers in Bioscience, Landmark, 22, 835-853, 2017). POLRMT is therefore essential for the biogenesis of the OXPHOS system, leading to ATP production, which is, in turn, crucial for energy homeostasis in cells. Figure 1 shows a schematic diagram of a mitochondrion, including the OXPHOS system and the mtDNA genome.

[0103] Dysregulation of POLRMT and the OXPHOS system has been implicated in various pathologies, particularly cancer. Cancer is currently the second leading cause of death in the United States, with projections indicating that nearly 2 million new cases will be diagnosed in 2022 and more than 600,000 deaths as a result of cancer (see Siegel, R. Let al., CA Cancer J. Clin. (72) 7-33, 2022). Rapid OXPHOS has been shown to support proliferation in cancer cell lines, including in a subset of diffuse large B-cell lymphoma cells (see, e.g., DeBeradinis, R.J., Cancer Cell, 22, 423-24, 2012). Of note is the finding that metabolic heterogeneity exists not only between different types of cancer but also within tumors of the same type. Similarly, studies using melanoma cell lines that represent various stages of tumor progression and collectively mimic the mixture of cells found in tumors found that metastatic cells exhibit high OXPHOS capacity (Rodrigues, MF, et al., Biochem. J. 473:703-715, 2016). These data suggest that mitochondria play a role in cellular progression toward metastasis, possibly providing the energy required for tumor cell migration and invasion.

[0104] Relatedly, overexpression of POLRMT has been linked to multiple types of cancer, suggesting that POLRMT plays a role in tumor growth. This hypothesis is supported, for example, by studies using acute myeloid leukemia (AML) cells, which are known to have high oxidative phosphorylation and mitochondrial mass, as well as low respiratory chain spare capacity. Knockdown of POLRMT in AML cells demonstrated reduced POLRMT levels, decreased oxidative phosphorylation, and increased cell death compared to control AML cells (see Bralha, FN, et al., Oncotarget, 6(35), 37216-228, 2015). Other work has shown that injection of a POLRMT-overexpressing human breast cancer cell line into nude mice increases tumor growth independent of tumor angiogenesis, suggesting that POLRMT should be considered a tumor promoter or metabolic oncogene (Salem, AF, et al., Cell Cycle, 11(22), 4174-80, 2012). Recently, POLRMT expression has been investigated in non-small cell lung cancer (NSCLC) (see Zhou, T. et al., Cell Death and Disease, 12, 751, 2021).

[0105] The development of multidrug resistance (MDR) in many cancers is associated with poor prognosis and poses a significant challenge in treating this disease. Because such resistance encompasses drugs with different structures and mechanisms of action, identifying and targeting a single biochemical pathway that can resensitize MDR cancer cells to established chemotherapeutics would provide a promising therapeutic strategy (see Yu, H.-J., Front. Chem., 9:775226, 2021). The primary reason for MDR is increased drug efflux from MDR cells due to ATP-dependent protein transporters that export drugs out of the cell, resulting in reduced drug accumulation. Inhibiting POLRMT, and consequently inhibiting the production of proteins essential for the OXPHOS pathway, could reduce ATP production and, in turn, ATP-dependent efflux of chemotherapeutic agents from cancer cells.

[0106] Consistent with the finding that the OXPHOS system and POLRMT are involved in the pathogenesis of some cancers and may be overexpressed in some cases, small molecule inhibitors of POLRMT have been developed (see, e.g., EP3598972A1, WO2019 / 057821A1, and WO2020 / 188049A1, which are incorporated herein by reference in their entireties). Some of these inhibitors have been shown to be useful in inhibiting cancer cell growth without affecting control cells (see Bonekamp, ​​NA, et al., Nature, 588, 712-716, 2020). The resulting toxicity in cancer cells correlated with a significant increase in monophosphate and diphosphate nucleotide levels, accompanied by a decrease in nucleotide triphosphate levels, all of which were the result of exhaustion of the OXPHOS system. Similarly, treatment with POLRMT inhibitors caused a decrease in citric acid cycle intermediates and, ultimately, a decrease in cellular amino acid levels. The result was a state of severe energy and nutrient depletion. See Id. Such inhibitors also reduced tumor volume in mice without significant toxicity in control animals. Specifically, mtDNA transcript levels in tumor cells were reduced compared with transcript levels in differentiated tissues. These data highlight the importance of mtDNA expression in rapidly dividing cells as opposed to postmitotic tissues, a distinction that can be exploited using POLRMT inhibitors that can modulate mtDNA transcription and ultimately the OXPHOS system.

[0107] Mitochondria are emerging targets for cancer therapy, but the mechanisms of resistance induced by chronic inhibition of mitochondrial function are not fully understood. Given the challenges presented by drug resistance in cancer chemotherapy, the development of such resistance to small molecule inhibitors of POLRMT has been investigated (see Mennuni, M. et al., EMBO reports, 23:e53054 1-18, 2022). A CRISPR-Cas9 genome-wide screen identified loss of genes belonging to von Hippel-Lindau (VHL) and mammalian target of rapamycin complex 1 (mTORC1) as pathways causing resistance to acute treatment with POLRMT inhibitors. See pages 1-2 of this reference. Furthermore, prolonged treatment of cells with this molecule in increasing doses resulted in drug-resistant cells with increased levels of mtDNA and, thereby, mitochondrial transcripts and proteins. See page 5 of this reference. Drug-resistant cells maintained higher levels of nucleotides, tricarboxylic acid cycle intermediates, and amino acids. See page 7 of this reference. Notably, drug-resistant cells did not have mutations in POLRMT that impair inhibitor binding to the polymerase. See Id. The development of resistance to POLRMT inhibitors highlights the importance and necessity of developing other POLRMT inhibitors to understand and treat different types of cancer.

[0108] Alterations in the OXPHOS system have also been implicated in the development of metabolic diseases such as insulin resistance and ultimately type 2 diabetes. Studies involving apoptosis-inducing factor (AIF) knockout mice, in which primary OXPHOS defects resulting in OXPHOS deficiency, revealed increased insulin sensitivity and resistance to diabetes and obesity (see Pospisilik, JA, et al., Cell, 131, 476-91, 2007). These phenotypic changes correlated with metabolic changes, including increased glucose uptake and enhanced fuel utilization. Manipulation of the OXPHOS system using POLRMT modulators offers the potential for further understanding the physiological mechanisms involved in diseases such as diabetes and for the development of novel therapeutics for intervention in such metabolic disorders.

[0109] In addition to its crucial role in transcription, POLRMT is also involved in regulating mtDNA levels by acting as a primase for mtDNA replication. Human mtDNA is a circular, double-stranded DNA packaged into a DNA-protein structure called the mitochondrial nucleoid, for which TFAM is the most abundant structural component (see, for example, Filograna, R., et al., FEBS Letters, 595, 976-1002, 2021). TFAM promotes mtDNA compaction, thereby regulating DNA accessibility to cellular replication and transcription components. With regard to mtDNA replication, POLRMT is part of the mtDNA replisome, along with the hexameric helicase TWINKLE, heterotrimeric DNA polymerase gamma (POLγ), and tetrameric mitochondrial single-stranded DNA-binding protein (mtSSB). See ibid. Its function in the replisome is to synthesize RNA primers required for initiating synthesis of both strands of mtDNA. While there may be many mechanisms by which mtDNA levels may be regulated, including regulation of POLRMT, what is known so far is that mtDNA copy number can be manipulated through regulation of TFAM expression.

[0110] Although the correlation is not entirely simple, changes in mtDNA levels have been implicated in neurodegenerative disorders, cancer, and aging (see, for example, Filograna, R., et al., FEBS Letters, 595, 976-1002, 2021). A particular challenge is understanding the relationship between mtDNA copy number and cancer. It appears that such copy number can correlate with both increased and decreased disease burden. Therefore, tumor type and disease stage may be important factors in determining the role of mtDNA copy number in cancer diagnosis and / or prognosis. Regarding aging, most data indicate a decline in mtDNA levels in elderly populations. However, other studies have been inconsistent regarding the relationship between mtDNA copy number and longevity. In contrast, a clearer correlation appears to exist between neurodegeneration and decreased mtDNA levels in Alzheimer's disease. Complicating our understanding of the relationship between mtDNA levels and disease is the role of mtDNA mutations in various disorders. The accumulation of mtDNA mutations appears to occur in nearly all types of cancer, but it is unclear whether such mutations are the cause of cancer or simply a by-product of rapid replication in rapidly dividing cells. Nevertheless, because POLRMT plays a critical role in mtDNA replication, regulating POLMRT may be a useful mechanism for understanding various pathologies and how to slow or alter disease progression.

[0111] Mutations affecting POLRMT can also cause human disease (see Olahova, M., et al., Nat. Commun., 12, 1135, 2021). POLRMT variants have been identified in several unrelated families. Patients present with multiple phenotypes, including global developmental delay in childhood, hypotonia, short stature, and speech / intellectual disabilities. Modulation of POLRMT may be a mechanism for slowing or altering disease progression.

[0112] POLRMT is fundamentally important for both the expression and replication of the human mitochondrial genome. While aspects of POLRMT biochemistry are known, its complete physiological role in mitochondrial gene expression and homeostasis, as well as its fundamental impact in the pathogenesis of various disease states, remain unknown. Its dysfunction and / or dysregulation impacts mitochondrial metabolism, sometimes via the OXPHOS pathway, ultimately contributing to many metabolic, degenerative, and aging diseases (e.g., cancer, diabetes, obesity, and Alzheimer's disease). Inhibition of POLRMT is one avenue to gain a better understanding of the role of this polymerase in cellular physiology and disease development. Modulation of metabolic mechanisms, including oxidative phosphorylation, by POLRMT modulators offers opportunities for intervention in complex disorders. Given the numerous and diverse roles of POLRMT, there is a need for potent and specific modulators of POLRMT.

[0113] POLRMT oligonucleotide In some embodiments, the present disclosure provides oligonucleotides that bind to and inhibit expression of messenger RNA (mRNA) produced by a target gene (e.g., POLRMT). As used herein, the terms "oligonucleotide" and "antisense oligonucleotide" are used interchangeably.

[0114] In some embodiments, administration of the oligonucleotide can reduce or inhibit POLRMT mRNA expression in a subject or biological sample compared to the level before administration. In some embodiments, administration of the oligonucleotide can reduce or inhibit POLRMT protein level in a subject or biological sample compared to the level before administration. In some embodiments, administration of the oligonucleotide can reduce POLRMT activity in a subject or biological sample compared to the level before administration (thereby reducing mitochondrial transcription).

[0115] Signs of decreased POLRMT activity include decreased mitochondrial transcription levels. In some embodiments, decreased mitochondrial transcription levels can be measured by total mtDNA. Furthermore, decreased mitochondrial transcription can also be indicated by decreased mRNA expression of various mitochondrial proteins (e.g., decreased mRNA expression of cytochrome B). Other mitochondrial proteins include various subunits of the electron transport chain (see, e.g., Shokolenko, IN, et al., Annu. Rev. Biochem., 85, 133-160, 2016), more specifically, the 13 subunits of the oxidative phosphorylation (OXPHOS) system (see, e.g., Shokolenko, IN, et al., Frontiers in Bioscience, Landmark, 22, 835-853, 2017). Signs of decreased POLRMT activity also include decreased levels of ATP production.

[0116] In some embodiments, when an oligonucleotide described herein is administered to a cell, the levels of POLRMT mRNA expression, POLRMT protein, and / or POLRMT activity are reduced in the cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% compared to levels before administration. In some embodiments, administration of the oligonucleotide can lead to complete or substantially complete inhibition of POLRMT mRNA expression.

[0117] In some embodiments, the oligonucleotides described herein are RNase H-dependent oligonucleotides, and the oligonucleotides induce degradation of mRNA by RNase H. In some embodiments, the oligonucleotides inhibit expression of the target gene through steric blocking, and the oligonucleotides physically block or inhibit the progression of splicing or translation machinery. As described herein, the oligonucleotides are capable of hybridizing to a target region of a target nucleic acid to produce at least one antisense activity. In some embodiments, the antisense activity includes degradation of the target nucleic acid by RNase H. In some embodiments, the antisense activity includes an oligonucleotide that physically blocks or inhibits the progression of splicing or translation machinery.

[0118] In some embodiments, the oligonucleotides described herein specifically hybridize to one or more target regions on the RNA transcript of a target gene. In some embodiments, the target region comprises a region of an mRNA (e.g., a region within SEQ ID NO: 205). In some embodiments, the target region comprises a region of a pre-mRNA. In some embodiments, the target region comprises a region of a pre-mRNA spanning an exon / intron junction. In some embodiments, the target region comprises a region of a pre-mRNA spanning an intron region or comprising an intron region. In some embodiments, the target region corresponds to a region of a DNA sequence, i.e., the target gene sequence. In some embodiments, the target region comprises a region proximal to, including, or within the 5'-UTR region. In some embodiments, the target region comprises a region proximal to, including, or within the 3'-UTR region. In some embodiments, the target region includes a region near an exon region, includes a region that includes an exon region, or is within an exon region (e.g., those shown in the transcript of Figure 2).

[0119] Exemplary target regions described herein are illustrated in several POLRMT transcripts shown in Figure 2. The amino acid and nucleotide sequences of human POLRMT are known in the art and can be found in publicly available databases. For example, POLRMT transcript sequences are identified under accession numbers NM_005035.4, XM_005259580.5, XM_047438952.1, and XM_047438951.1, and the ENSEMBL IDs of the eight known mRNA transcripts are identified under ENST00000588649.7, ENST00000590573.4, ENST00000590336.2, ENST00000592863.2, ENST00000587057.5, ENST00000590709.3, ENST00000589961.2, and ENST00000592633.5. The POLRMT mRNA transcript encoding the full-length POLRMT protein (SEQ ID NO: 2) is identified in ENSEMBL ID: ENST00000588649.7 (corresponding to SEQ ID NO: 205). Additionally, the complete human POLRMT gene sequence is represented by reference number NG_023049.1 (SEQ ID NO: 1).

[0120] The POLRMT mRNA transcript sequence is set forth herein in SEQ ID NO: 205 (ENSEMBL ID: ENST00000588649.7), in which U residues are represented by T residues in the provided sequence. Those of skill in the art will understand that when referring to a sequence as "RNA" or "mRNA" or "pre-mRNA" or "transcript," the actual sequence contains U rather than T, but may be represented either way in the present disclosure.

[0121] In targeting regions within one or more POLRMT transcripts, strategies for targeting specific regions of the POLRMT transcript (corresponding to regions within the gene sequence (e.g., SEQ ID NO: 1, NCBI Reference No. NG_023049.1)) can be utilized. Figure 2 provides several exemplary POLRMT transcript sequences (e.g., those identified in Accession Nos. NM_005035.4 (ENST00000588649.7, corresponding to SEQ ID NO: 205), XM_005259580.5, XM_047438952.1, and XM_047438951.1) that can be targeted by the oligonucleotides described herein. Those skilled in the art will understand that oligonucleotides targeting a region within SEQ ID NO: 205 can also target corresponding regions in other POLRMT RNA transcripts, although the exact coordinates within the nucleic acid sequence of such other POLRMT RNA transcripts may vary slightly. Furthermore, one skilled in the art will appreciate that a target region within a POLRMT transcript (eg, SEQ ID NO: 205) can be characterized by its corresponding coordinates within the complete POLRMT gene sequence (SEQ ID NO: 1).

[0122] In some embodiments, the oligonucleotides can target POLRMT sequences of one or more non-human species (e.g., non-human primate POLRMT, e.g., Macaca fascicularis POLRMT, or e.g., Chlorocebus sabaeus) in addition to human POLRMT. Such sequences are known in the art and publicly available. In some embodiments, the oligonucleotides are complementary to target regions that are identical in human and Macaca fascicularis POLRMT transcripts. In some embodiments, the oligonucleotides are complementary to target regions of the human POLRMT transcript that differ by one, two, or three nucleotides from the sequence in the Macaca fascicularis POLRMT transcript. It will be understood that oligonucleotides that target human POLRMT and inhibit or reduce POLRMT expression levels may also have such an effect on non-primate POLRMT (e.g., rat or mouse POLRMT), particularly if a conserved region of the POLRMT transcript is targeted. Those skilled in the art will understand that an oligonucleotide target region within a mouse POLRMT RNA transcript (e.g., SEQ ID NO: 582) can target a corresponding region within a human POLRMT RNA transcript (e.g., SEQ ID NO: 205), particularly if the target region is present within a conserved region of the POLRMT RNA transcript.

[0123] In some embodiments, the oligonucleotide has a nucleotide sequence that includes a region that has sufficient complementarity with the target nucleic acid sequence to permit hybridization, but insufficient complementarity with any non-target nucleic acids, such that non-specific hybridization to any non-target nucleic acid sequences is avoided under conditions in which specific hybridization is desired (e.g., under physiological conditions for in vivo or therapeutic use, and, in the case of an in vitro assay, under conditions in which the assay is performed).

[0124] In some embodiments, the present disclosure provides oligonucleotides that are fully complementary to a nucleotide sequence over the entire length of the oligonucleotide. In some embodiments, the oligonucleotide is at least 95% complementary to the PORLMT nucleotide sequence over the entire length of the oligonucleotide. In some embodiments, the oligonucleotide is at least 90% complementary to the PORLMT nucleotide sequence over the entire length of the oligonucleotide. In some embodiments, the oligonucleotide is at least 85% complementary to the POLRMT nucleotide sequence over the entire length of the oligonucleotide. In some embodiments, the oligonucleotide is at least 80% complementary to the POLRMT nucleotide sequence over the entire length of the oligonucleotide. In some embodiments, the oligonucleotide is 80% to 100% complementary (i.e., substantially complementary) to the POLRMT nucleotide sequence over the entire length of the oligonucleotide. In some embodiments, the oligonucleotide comprises a region that is fully complementary to the POLRMT nucleotide sequence and is at least 80% complementary to the POLRMT nucleotide sequence over the entire length of the oligonucleotide. In some embodiments, the region of full complementarity is 6 to 30 nucleotides in length.

[0125] In some embodiments, the oligonucleotide comprises DNA. In some embodiments, the oligonucleotide comprises RNA. In some embodiments, the oligonucleotide comprises both RNA and DNA. In some embodiments, the oligonucleotide is 5-100 nucleotides in length. In some embodiments, the oligonucleotide is 5-90 nucleotides in length. In some embodiments, the oligonucleotide is 5-80 nucleotides in length. In some embodiments, the oligonucleotide is 5-70 nucleotides in length. In some embodiments, the oligonucleotide is 5-60 nucleotides in length. In some embodiments, the oligonucleotide is 5-50 nucleotides in length. In some embodiments, the oligonucleotide is 5-40 nucleotides in length. In some embodiments, the oligonucleotide is 5-30 nucleotides in length. In some embodiments, the oligonucleotide is 5-25 nucleotides in length. In some embodiments, the oligonucleotide is 5-20 nucleotides in length. In some embodiments, the oligonucleotide is 5-15 nucleotides in length. In some embodiments, the oligonucleotide is 5-10 nucleotides in length. In some embodiments, the oligonucleotide is 10-100 nucleotides in length. In some embodiments, the oligonucleotide is 15-100 nucleotides in length. In some embodiments, the oligonucleotide is 20-100 nucleotides in length. In some embodiments, the oligonucleotide is 25-100 nucleotides in length. In some embodiments, the oligonucleotide is 30-100 nucleotides in length. In some embodiments, the oligonucleotide is 40-100 nucleotides in length. In some embodiments, the oligonucleotide is 50-100 nucleotides in length. In some embodiments, the oligonucleotide is 60-100 nucleotides in length. In some embodiments, the oligonucleotide is 70-100 nucleotides in length. In some embodiments, the oligonucleotide is 90-100 nucleotides in length.In some embodiments, the oligonucleotide is 8-30 nucleotides in length. In some embodiments, the oligonucleotide is 15-25 nucleotides in length. In some embodiments, the oligonucleotide is 16-22 nucleotides in length. In some embodiments, the oligonucleotide is 18-20 nucleotides in length. In some embodiments, the oligonucleotide is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the oligonucleotide is 18 nucleotides in length. In some embodiments, the oligonucleotide is 20 nucleotides in length. In some embodiments, the oligonucleotide is 19 nucleotides in length.

[0126] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14, 27-45, 71-147, 205-298, and 587-655. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14, 27-45, 71-147, 205-298, and 587-655. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14, 27-45, 71-147, 205-298, and 587-655. In some embodiments, the oligonucleotide comprises a sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14, 27-45, 71-147, 205-298, and 587-655. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 3-14, 27-45, 71-147, 205-298, and 587-655.

[0127] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, and 728-740. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, and 728-740. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, and 728-740. In some embodiments, the oligonucleotide comprises a sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, and 728-740. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, and 728-740.

[0128] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to SEQ ID NO: 11. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to SEQ ID NO: 11. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to SEQ ID NO: 11. In some embodiments, the oligonucleotide comprises a sequence having at least 95% identity to SEQ ID NO: 11. In some embodiments, the oligonucleotide comprises SEQ ID NO: 11.

[0129] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to SEQ ID NO: 12. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to SEQ ID NO: 12. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to SEQ ID NO: 12. In some embodiments, the oligonucleotide comprises a sequence having at least 95% identity to SEQ ID NO: 12. In some embodiments, the oligonucleotide comprises SEQ ID NO: 12.

[0130] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to SEQ ID NO: 594. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to SEQ ID NO: 594. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to SEQ ID NO: 594. In some embodiments, the oligonucleotide comprises a sequence having at least 95% identity to SEQ ID NO: 594. In some embodiments, the oligonucleotide comprises SEQ ID NO: 594.

[0131] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to SEQ ID NO: 612. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to SEQ ID NO: 612. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to SEQ ID NO: 612. In some embodiments, the oligonucleotide comprises a sequence having at least 95% identity to SEQ ID NO: 612. In some embodiments, the oligonucleotide comprises SEQ ID NO: 612.

[0132] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to SEQ ID NO: 632. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to SEQ ID NO: 632. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to SEQ ID NO: 632. In some embodiments, the oligonucleotide comprises a sequence having at least 95% identity to SEQ ID NO: 632. In some embodiments, the oligonucleotide comprises SEQ ID NO: 632.

[0133] In some embodiments, the oligonucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to any one of SEQ ID NOs: 3-14, 27-45, 71-147, 205-298, and 587-655 in Table 1 below.

[0134] In some embodiments, the oligonucleotide comprises a sequence that differs by no more than one, no more than two, no more than three, or no more than four nucleotides from any one of the sequences set forth below in Table 1. Table 1 includes exemplary POLRMT oligonucleotide sequences, target regions of complementarity in POLRMT mRNA transcripts, and corresponding coordinates of the target regions within the POLRMT gene sequence shown in SEQ ID NO:1. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8]

[0135] In some embodiments, the oligonucleotide targets a region of the murine POLRMT transcript. In some embodiments, the oligonucleotide targets a region of the mouse POLRMT transcript. The mouse POLRMT gene encoding amino acid and nucleotide sequences are known in the art and can be found in publicly available databases. For example, the mouse POLRMT gene sequence is identified in a sequence spanning mouse chromosome 10 corresponding to coordinate GRCm39 10_79571957_79582415, and the POLRMT transcript is represented, for example, by reference number ENSMUST00000161765. In some embodiments, the oligonucleotide targets an exon region within the mouse POLRMT transcript (e.g., the longest exon in the mouse POLRMT transcript represented by reference number ENSMUST00000161765, SEQ ID NO: 582).

[0136] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 393-486, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 393-486, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 393-486, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 393-486, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634. In some embodiments, the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 393-486, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

[0137] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to SEQ ID NO: 434. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to SEQ ID NO: 434. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to SEQ ID NO: 434. In some embodiments, the oligonucleotide comprises a sequence having at least 95% identity to SEQ ID NO: 434. In some embodiments, the oligonucleotide comprises SEQ ID NO: 434.

[0138] In some embodiments, the oligonucleotide comprises a sequence having at least 80% identity to SEQ ID NO: 442. In some embodiments, the oligonucleotide comprises a sequence having at least 85% identity to SEQ ID NO: 442. In some embodiments, the oligonucleotide comprises a sequence having at least 90% identity to SEQ ID NO: 442. In some embodiments, the oligonucleotide comprises a sequence having at least 95% identity to SEQ ID NO: 442. In some embodiments, the oligonucleotide comprises SEQ ID NO: 442.

[0139] In some embodiments, the oligonucleotide comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to any one of SEQ ID NOs: 393-486 in Table 2 below.

[0140] In some embodiments, the oligonucleotide comprises a sequence that differs by no more than one, no more than two, no more than three, or no more than four nucleotides from any one of the sequences set forth below in Table 2. Table 2 includes exemplary mouse POLRMT oligonucleotide sequences, target regions of complementarity in mouse POLRMT mRNA transcripts, and corresponding coordinates of the target region within the mouse POLRMT gene sequence set forth in SEQ ID NO:581. [Table 2-1] [Table 2-2] [Table 2-3]

[0141] In some embodiments, oligonucleotides of the present disclosure are complementary (e.g., substantially complementary or fully complementary) to a region of a POLRMT RNA transcript (e.g., SEQ ID NO: 205). In some embodiments, oligonucleotides are complementary to a region of the 5' untranslated region (UTR) of a POLRMT RNA transcript. In some embodiments, oligonucleotides are complementary to a region within or including an exon region (e.g., within SEQ ID NO: 205) of a POLRMT RNA transcript. In some embodiments, oligonucleotides are complementary to a region within or including an intron region of a POLRMT pre-mRNA transcript. In some embodiments, oligonucleotides are complementary to a region of a POLRMT pre-mRNA transcript that spans an exon / intron junction. In some embodiments, oligonucleotides are complementary to a region including or within the 3' UTR region of a POLRMT RNA transcript. In some embodiments, oligonucleotides are complementary to a region of a POLRMT RNA transcript illustrated in Figure 2, Figure 12, and Table 3. In some embodiments, the oligonucleotide sequence is complementary to a region within the POLRMT gene sequence (SEQ ID NO: 1).

[0142] In some embodiments, the oligonucleotide is substantially complementary to 8-30 contiguous nucleotides of the POLRMT exon sequence identified in Ensemble ID ENSE00000655271. In some embodiments, the oligonucleotide is fully complementary to 8-30 contiguous nucleotides of the POLRMT exon sequence identified in Ensemble ID ENSE00000655271. In some embodiments, the oligonucleotide is complementary to 8-22 contiguous nucleotides of the POLRMT exon sequence identified in Ensemble ID ENSE00000655271. In some embodiments, the oligonucleotide is complementary to 8-19 contiguous nucleotides of SEQ ID NO:725 (CAACGCCGTGATGCTTGGCTGGGCGCGGC), which corresponds to nucleotides 817-845 of the POLRMT transcript (SEQ ID NO:205) and 8999-9027 of the POLRMT gene sequence (SEQ ID NO:1). In some embodiments, the oligonucleotide is complementary to a sequence comprising SEQ ID NO:681 or 682. In some embodiments, the oligonucleotide targets a region within a POLRMT exon identified in Ensemble ID ENSE00000655271 and comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to SEQ ID NO: 612 or 613.

[0143] In some embodiments, the oligonucleotide is substantially complementary to 8 to 30 contiguous nucleotides of the POLRMT exon sequence identified in Ensemble ID ENSE00000655279. In some embodiments, the oligonucleotide is fully complementary to 8 to 30 contiguous nucleotides of the POLRMT exon sequence identified in Ensemble ID ENSE00000655279. In some embodiments, the oligonucleotide is complementary to 8 to 22 contiguous nucleotides of the POLRMT exon sequence identified in Ensemble ID ENSE00000655279. In some embodiments, the oligonucleotide is complementary to 8 to 22 contiguous nucleotides of SEQ ID NO:726 (CGCACAACATGGACTTCCGCGGCCGCACCTAC), which corresponds to nucleotides 2415 to 2446 of the POLRMT transcript (SEQ ID NO:205) and nucleotides 117261 to 17292 of the POLRMT gene sequence (SEQ ID NO:1). In some embodiments, the oligonucleotide is complementary to a sequence comprising SEQ ID NO: 661, 663, 692, 693, 694, or 695. In some embodiments, the oligonucleotide targets a region within a POLRMT exon identified in Ensemble ID ENSE00000655279 and comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to SEQ ID NO: 592, 594, 623, 624, 625, or 626.

[0144] In some embodiments, the oligonucleotide is substantially complementary to 8 to 30 contiguous nucleotides of the POLRMT exon sequence identified in Ensemble ID ENSE00000655283. In some embodiments, the oligonucleotide is complementary to 8 to 30 contiguous nucleotides of the POLRMT exon sequence identified in Ensemble ID ENSE00000655283. In some embodiments, the oligonucleotide is complementary to 8 to 22 contiguous nucleotides of the POLRMT exon sequence identified in Ensemble ID ENSE00000655283. In some embodiments, the oligonucleotide is complementary to a sequence spanning 8 to 22 contiguous nucleotides of SEQ ID NO:727 (ATCACCCGCAAGGTGGTGAAGCAGACGGTGA), which corresponds to nucleotides 2978 to 3008 of the POLRMT transcript (SEQ ID NO:205) and nucleotides 18870 to 18900 of the POLRMT gene sequence (SEQ ID NO:1). In some embodiments, the oligonucleotide is complementary to a sequence comprising SEQ ID NO: 661, 663, 692, 693, 694, or 695. In some embodiments, the oligonucleotide targets a region within a POLRMT exon identified in Ensemble ENSE00000655283 and comprises a sequence at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 592, 594, 623, 624, 625, or 626.

[0145] In some embodiments, the oligonucleotide comprises a sequence complementary (e.g., substantially complementary or fully complementary) to a region within a POLRMT transcript (e.g., a POLRMT mRNA or pre-mRNA transcript) (e.g., a sequence complementary to a nucleotide sequence at least 80%, 85%, 90%, 95%, or 100% identical to the target sequence of SEQ ID NO: 205). In some embodiments, the oligonucleotide is complementary to 8 to 30 contiguous nucleotides (i.e., the target region) of a POLRMT RNA transcript, the contiguous nucleotides being, for example, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, although shorter and longer target regions are also contemplated.

[0146] In some embodiments, 8 to 30 contiguous nucleotides on the POLRMT RNA transcript (i.e., the target region) comprise a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to any one of the sequences set forth in Table 3 below.

[0147] In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript comprising a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 15-26, 46-64, 299-392, and 656-724. In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript comprising a sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 15-26, 46-64, 299-392, and 656-724. In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript comprising a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 15-26, 46-64, 299-392, and 656-724. In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript that comprises a sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 15-26, 46-64, 299-392, and 656-724. In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript that comprises a sequence selected from the group consisting of SEQ ID NOs: 15-26, 46-64, 299-392, and 656-724.

[0148] In some embodiments, the target region comprises a sequence having at least 80% identity to SEQ ID NO: 23. In some embodiments, the target region comprises a sequence having at least 85% identity to SEQ ID NO: 23. In some embodiments, the target region comprises a sequence having at least 90% identity to SEQ ID NO: 23. In some embodiments, the target region comprises a sequence having at least 95% identity to SEQ ID NO: 23. In some embodiments, the target region comprises SEQ ID NO: 23.

[0149] In some embodiments, the target region comprises a sequence having at least 80% identity to SEQ ID NO:24. In some embodiments, the target region comprises a sequence having at least 85% identity to SEQ ID NO:24. In some embodiments, the target region comprises a sequence having at least 90% identity to SEQ ID NO:24. In some embodiments, the target region comprises a sequence having at least 95% identity to SEQ ID NO:24. In some embodiments, the target region comprises SEQ ID NO:24.

[0150] In some embodiments, the target region comprises a sequence having at least 80% identity to SEQ ID NO: 663. In some embodiments, the target region comprises a sequence having at least 85% identity to SEQ ID NO: 663. In some embodiments, the target region comprises a sequence having at least 90% identity to SEQ ID NO: 663. In some embodiments, the target region comprises a sequence having at least 95% identity to SEQ ID NO: 663. In some embodiments, the target region comprises SEQ ID NO: 663.

[0151] In some embodiments, the target region comprises a sequence having at least 80% identity to SEQ ID NO: 681. In some embodiments, the target region comprises a sequence having at least 85% identity to SEQ ID NO: 681. In some embodiments, the target region comprises a sequence having at least 90% identity to SEQ ID NO: 681. In some embodiments, the target region comprises a sequence having at least 95% identity to SEQ ID NO: 681. In some embodiments, the target region comprises SEQ ID NO: 681.

[0152] In some embodiments, the target region comprises a sequence having at least 80% identity to SEQ ID NO: 701. In some embodiments, the target region comprises a sequence having at least 85% identity to SEQ ID NO: 701. In some embodiments, the target region comprises a sequence having at least 90% identity to SEQ ID NO: 701. In some embodiments, the target region comprises a sequence having at least 95% identity to SEQ ID NO: 701. In some embodiments, the target region comprises SEQ ID NO: 701.

[0153] In some embodiments, the oligonucleotide comprises a sequence that is complementary (e.g., substantially complementary or perfectly complementary and / or contains no more than 1, no more than 2, no more than 3, or no more than 4 nucleotide mismatches) to 8-30 contiguous nucleotides of a POLRMT transcript (e.g., SEQ ID NO: 205 and corresponding to a region within the gene sequence of SEQ ID NO: 1). In some embodiments, the oligonucleotide comprises a sequence complementary to any one of the sequences set forth in Table 3 below.

[0154] In some embodiments, the target region on the POLRMT RNA transcript is selected from the group consisting of nucleotides 5696-5715, 8808-8827, 8809-8828, 8811-8830, 16221-16240, 17159-17178, 17314-17333, 17315-17334, 18082-18101, 18083-18102, 18084-18103, 18130-18149, 5680-5699, 8491-8510, 8529-8548, 8569-8588, 8570-8589, 8571-8590, 8572-8591, 8573-8592, 8574-8593, 8575-8576, 8577-8578, 8579-8580, 8581-8582, 8582-8583, 8584-8585, 8586-8587, 8588-8589, 8591-8590, 8592-8593, 8594-8595, 8596-8597, 8598-8599, 8599-8600, 8601-8602, 8603-8604, 8605-8606, 8607-8608, 8609-8610, 8611-8612, 8613-8614, 8615-86 574~8593, 13322~13341, 13719~13738, 14999~15018, 15092~15111, 15093~15112, 17304~17323, 19309~19328, 20041~20060, 20042~20061, 21102~21121, 5032~5051, 5034~5053, 5036~5055, 5059~5078, 5691~5710, 5692~5711, 5696~5715, 5703~5722, 8450~8469, 8452~8471, 8456~8475, 8520~ 8539, 8647-8666, 8650-8669, 8705-8724, 8706-8725, 8708-8727, 8716-8735, 8717-8736, 8803-8822, 8813-8832, 8986-9005, 8993-9012, 8994-9013, 8995-9014, 13435-13447, 13666-13672, 13705-13724, 13706-13725, 13710-13729, 13743-13762, 13753-13772, 13842-13850, and 14966-14976 , 13846~13850 and 14966~14980, 13847~13850 and 14966~14981, 13849~13850 and 14966~14983, 13850~13850 and 14966~14984, 15087~15106, 15603~15622, 15607~15626, 15615~15634, 15904~15923, 16215~16234, 16334~16353, 16786~16805, 16787~16806, 16788~16807, 16789~16808, 16792~16811,16829~16848, 16832~16851, 16833~16852, 16834~16853, 16836~16855, 16838~16857, 16998~17017, 16999~17018, 17140~17159, 17141~17160, 17147~17166, 17153~17172, 17155~17174, 17157~17176, 17164~17183, 17 231~17250, 17259~17278, 17261~17280, 17309~17328, 17311~17330, 17313~17332, 17319~17338, 17321~17340, 17345~17364, 17506~17512 and 18083~18095, 18090~18109, 18091~18110, 18093~18112, 18095~18114, 1811 1~18130, 18562~18581, 18583~18602, 18584~18603, 18585~18604, 18586~18605, 18591~18610, 18805~18824, 18844~18863, 19273~19292, 19274~19293, 19809~19828, 20717~20736, 20720~20739, 20721~20740, 20722~ Includes areas corresponding to 20741, 20738-20757, 17266-17285, 17268-17287, 18875-18894, 18876-18895, 9004-9021, 9005-9022, 17267-17284, 17268-17285, 17269-17286, 17270-17287, 18876-18893, 18877-18894, or 18878-18895. In some embodiments, the target region on the POLRMT RNA transcript includes a region corresponding to nucleotides 2420-2439, 2422-2441, 2983-3002, 2984-3003, 822-839, 823-840, 2421-2438, 2422-2439, 2423-2440, 2424-2441, 2984-3001, 2985-3002, or 2986-3003 of the POLRMT transcript sequence (SEQ ID NO: 205). [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7]

[0155] In some embodiments, the oligonucleotide comprises a sequence complementary to a nucleotide sequence that differs by no more than one, no more than two, no more than three, or no more than four nucleotides from any one of SEQ ID NOs: 3-14, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740, and / or differs by no more than one, no more than two, no more than three, or no more than four nucleotides from any one of SEQ ID NOs: 15-26, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, or 703.

[0156] In some embodiments, the oligonucleotide contains one or more (e.g., 1, 2, 3, 4, or 5) mismatch(es) with the target region (i.e., nucleotides that are not complementary to corresponding nucleotides in the target region sequence).

[0157] In some embodiments, the oligonucleotide is complementary to a target region in a mouse POLRMT RNA transcript (e.g., as set forth in SEQ ID NO: 582). In some embodiments, the oligonucleotide is complementary to a target region in a mouse POLRMT transcript (e.g., as set forth in SEQ ID NO: 582) and also to a corresponding target region in a human POLRMT transcript (e.g., as set forth in SEQ ID NO: 205), particularly if the target region corresponds to a region conserved between the mouse and human POLRMT sequences. In some embodiments, the oligonucleotide is complementary to a specific target region in a mouse POLRMT RNA transcript that corresponds to a region in the mouse POLRMT gene sequence (e.g., as set forth in SEQ ID NO: 581).

[0158] In some embodiments, the oligonucleotides of the present disclosure are complementary to 8 to 30 contiguous nucleotides (i.e., the target region) of a mouse POLRMT RNA transcript. In some embodiments, the oligonucleotides are complementary to a target region of a mouse POLRMT RNA transcript and comprise any one of the sequences shown in Table 4.

[0159] In some embodiments, the oligonucleotide comprises a sequence complementary (e.g., substantially complementary or fully complementary) to a region of a mouse POLRMT transcript (e.g., a mouse POLRMT mRNA or pre-mRNA RNA transcript) (e.g., a sequence complementary to a nucleotide sequence at least 80%, 85%, 90%, 95%, or 100% identical to the target sequence of SEQ ID NO: 582). In some embodiments, the oligonucleotide is complementary to 8 to 30 contiguous nucleotides (i.e., the target region) of the mouse POLRMT transcript, e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, although shorter and longer target regions are also contemplated. In some embodiments, such oligonucleotide sequences also target the corresponding region in the human POLRMT transcript.

[0160] In some embodiments, 8 to 30 contiguous nucleotides on the POLRMT RNA transcript (i.e., the target region) comprise a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to any one of the sequences set forth in Table 4 below.

[0161] In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript that comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 487-580, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703. In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript that comprises a sequence having at least 85% identity to a sequence selected from the group consisting of SEQ ID NOs: 487-580, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703. In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript comprising a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 487-580, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703. In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript comprising a sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 487-580, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703. In some embodiments, the oligonucleotide is complementary to a target region on a POLRMT RNA transcript comprising a sequence selected from the group consisting of SEQ ID NOs: 487-580, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

[0162] In some embodiments, the target region comprises a sequence having at least 80% identity to SEQ ID NO: 528. In some embodiments, the target region comprises a sequence having at least 85% identity to SEQ ID NO: 528. In some embodiments, the target region comprises a sequence having at least 90% identity to SEQ ID NO: 528. In some embodiments, the target region comprises a sequence having at least 95% identity to SEQ ID NO: 528. In some embodiments, the target region comprises SEQ ID NO: 528.

[0163] In some embodiments, the target region comprises a sequence having at least 80% identity to SEQ ID NO: 536. In some embodiments, the target region comprises a sequence having at least 85% identity to SEQ ID NO: 536. In some embodiments, the target region comprises a sequence having at least 90% identity to SEQ ID NO: 536. In some embodiments, the target region comprises a sequence having at least 95% identity to SEQ ID NO: 536. In some embodiments, the target region comprises SEQ ID NO: 536.

[0164] In some embodiments, the oligonucleotide is complementary to (e.g., substantially complementary or fully complementary and / or contains no more than one, two, three, or four nucleotide mismatches) 8 to 30 contiguous nucleotides of the mouse POLRMT transcript (e.g., SEQ ID NO: 582) and contains a sequence corresponding to a region within the mouse gene sequence (e.g., SEQ ID NO: 581). In some embodiments, the oligonucleotide contains a sequence complementary to any one of the sequences set forth in Table 4 below. In some embodiments, the oligonucleotide can be complementary to any one of the sequences set forth in Table 4 below, but differs by one or more nucleotides such that it is complementary to the corresponding human POLRMT target region (e.g., that in SEQ ID NO: 205, which corresponds to the region within the human gene sequence SEQ ID NO: 1).

[0165] SEQ ID NO: 581. In some embodiments, the target region on the mouse POLRMT RNA transcript is selected from the group consisting of nucleotides 7077-7096, 7075-7094, 7074-7093, 3342-3361, 3341-3360, 3340-3359, 3297-3316, 3258-3277, 3202-3221, 2663-2682, 2621-2640, 2620-2639, 2619-2638, 2618-2637, 2617-2636, 2005-2024, 2003-2022, 7107-7126, 7105-7124, 7103-7122, 7082-7101, 7104-7105, 7106-7107, 7108-7109, 7110-7111, 7112-7113, 7114-7115, 7116-7117, 7118-7119, 7119-7120, 7118-7119, 7119-7121, 7119-7122, 7119-7123, 7119-7124, 7119-7125, 7119-7126, 7119-7127, 7119-7128, 7119-7129, 7120-7121, 7120-7122, 7120-7123, 7 7079~7098, 5712~5731, 5707~5726, 5705~5724, 4732~4751, 4731~4750, 4730~4749, 4568~4587, 4178~4197, 4136~4155, 4135~4154, 4133~4152, 4132~4151, 4131~4150, 4130~4149, 4129~4148, 4128~4147, 3597~3616, 3545~3564, 3544~3563, 3348~3367, 3339~3358, 3338~3357, 3337~3356 , 3336~3355, 3335~3354, 3252~3271, 3250~3269, 3198~3217, 3197~3216, 3196~3215, 3168~3187, 2662~2681, 2660~2679, 2659~2678, 2658~2677, 2657~2676, 2656~2675, 2655~2674, 2654~2673, 2652~2671, 2651~2670, 2616~2635, 2615~2634, 2614~2633, 2613~2632, 2612~2631, 2611~263 0, 2540~2559, 2537~2556, 2532~2551, 2380~2399, 2271~2290, 2270~2289, 2209~2228, 2207~2226, 2206~2225, 2195~2214, 1536~1555, 1534~1553, 1532~1551, 1377~1396, 1376~1395, 1375~1394, 1313~1332, 1312~1331, 1311~1330, 1308~1327, 1287~1306, 1286~1305, 1283~1302, 637~656,or a region corresponding to sequences 19 to 38, or the corresponding target region within the human POLRMT sequence (shown in SEQ ID NO: 1).

[0166] In some embodiments, the target region on the POLRMT RNA transcript includes a region corresponding to nucleotides 2329-2348, 2331-2350, 3240-3259, 3241-3260, 734-751, 735-752, 2330-2347, 2331-2348, 2332-2349, 2333-2350, 3241-3258, 3242-3259, or 3243-3260 of the mouse PORLMT transcript (SEQ ID NO: 582), or a corresponding region within a human POLRMT transcript sequence (e.g., as set forth in SEQ ID NO: 205). [Table 4-1] [Table 4-2] [Table 4-3]

[0167] qualification In some embodiments, the oligonucleotides of the present disclosure comprise a phosphodiester backbone-based sequence (i.e., an unmodified oligonucleotide sequence). In some embodiments, the oligonucleotides of the present disclosure comprise one or more modified nucleotides.

[0168] The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited by their susceptibility to, for example, endonucleases and exonucleases. Therefore, to circumvent these weaknesses, various synthetic counterparts have been developed. These include synthetic oligonucleotides containing chemical modifications (e.g., base modifications, sugar modifications, backbone modifications, etc.), which, among other things, reduce the decomposition susceptibility of these molecules and improve other properties of the oligonucleotides. Chemical modifications can also lead to certain undesirable effects (e.g., increased toxicity).

[0169] Base sequence, chemical modifications (e.g., sugar, base, and / or internucleotide linkage modifications and their patterns), and / or stereochemistry (e.g., backbone chiral center (chiral internucleotide linkage) stereochemistry and / or their patterns), etc., can have a significant impact on properties (e.g., stability, splicing selectivity, etc.). In some embodiments, oligonucleotide properties can be adjusted by optimizing chemical modifications (base, sugar, and / or internucleotide linkage modifications) and / or stereochemistry (backbone chiral center pattern).

[0170] In some embodiments, the modified nucleotide comprises a base modification, a sugar or sugar phosphate modification, an internucleotide linkage modification, or a combination thereof.

[0171] In some embodiments, the oligonucleotides of the present disclosure comprise one or more naturally occurring nucleobases and / or one or more modified nucleobases derived from naturally occurring nucleobases. Examples include, but are not limited to, uracil, thymine, adenine, cytosine, and guanine, each having its amino group protected by an acyl protecting group, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs (such as pseudoisocytosine and pseudouracil), and other modified nucleobases (such as 8-substituted purines, xanthines, or hypoxanthines, the latter two of which are natural degradation products).

[0172] Modified nucleobases also include extended size nucleobases to which one or more aryl rings (such as phenyl rings) have been added.

[0173] In some embodiments, a modified nucleobase comprises any one of the following substituents, each of which is optionally substituted: [ka]

[0174] For example, the pyrene-modified guanine base can have the structure: [ka]

[0175] Those skilled in the art will understand how and where a nucleobase can be modified with any of the aforementioned groups.

[0176] In some embodiments, the modified nucleobase is unsubstituted. In some embodiments, the modified nucleobase is substituted. In some embodiments, the modified nucleobase is substituted, for example, to contain a heteroatom, an alkyl group, or a linking moiety that is connected to a fluorescent moiety, a biotin moiety, an avidin moiety, or another protein or peptide. In some embodiments, the modified nucleobase is not a nucleobase in the most classical sense, but is a "universal base" that functions similarly to a nucleobase. One representative example of such a universal base is 3-nitropyrrole.

[0177] In some embodiments, the oligonucleotides described herein comprise nucleosides incorporating modified nucleobases and / or nucleobases covalently linked to modified sugars (i.e., "base modifications"). Some examples of nucleosides incorporating modified nucleobases include 4-acetylcytidine; 5-(carboxyhydroxymethyl)uridine; 2'-O-methylcytidine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyluridine; dihydrouridine; 2'-O-methylpseudouridine; beta,D-galactosylketosine; 2'-O-methylguanosine; N-acetylcytidine ... 6 -Isopentenyl adenosine; 1-methyl adenosine; 1-methyl pseudouridine; 1-methyl guanosine; l-methyl inosine; 2,2-dimethyl guanosine; 2-methyl adenosine; 2-methyl guanosine; N 7-methylguanosine; 3-methylcytidine; 5-methylcytidine; 5-hydroxymethylcytidine; 5-methylcytosine, 5-formylcytosine; 5-carboxylcytosine; N 6 -Methyladenosine;7-Methylguanosine;5-Methylaminoethyluridine;5-Methoxyaminomethyl-2-thiouridine;Beta,D-mannosylkeuosine;5-Methoxycarbonylmethyluridine;5-Methoxyuridine;2-Methylthio-N 6 -isopentenyladenosine; N-((9-beta,D-ribofuranosyl-2-methylthiopurin-6-yl)carbamoyl)threonine; N-((9-beta,D-ribofuranosylpurin-6-yl)-N-methylcarbamoyl)threonine; uridine-5-oxyacetic acid methyl ester; uridine-5-oxyacetic acid; pseudouridine; queuosine; 2-thiocytidine; 5-methyl-2-thiouridine; 2-thiouridine; 4-thiouridine; 5-methyluridine; 2'-O-methyl-5-methyluridine; and 2'-O-methyluridine. In some embodiments, the oligonucleotides described herein comprise at least one G-clamp modification.

[0178] In some embodiments, the nucleoside includes a 6'-modified bicyclic nucleoside analog having either (R)- or (S)-chirality at the 6'-position, including analogs described in U.S. Patent No. 7,399,845. In other embodiments, the nucleoside includes a 5'-modified bicyclic nucleoside analog having either (R)- or (S)-chirality at the 5'-position, including analogs described in U.S. Publication No. 20070287831. In some embodiments, the nucleobase or modified nucleobase is 5-bromouracil, 5-iodouracil, or 2,6-diaminopurine. In some embodiments, the nucleobase or modified nucleobase is modified by substitution with a fluorescent moiety.

[0179] In some embodiments, the oligonucleotides described herein contain one or more modified nucleotides, in which the phosphate group or linked phosphorus in the nucleotide is linked to various positions on the sugar or modified sugar. As a non-limiting example, the phosphate group or linked phosphorus can be linked to the 2', 3', 4', or 5' hydroxyl moiety of the sugar or modified sugar. Nucleotides incorporating modified nucleobases described herein are also contemplated in this context. In some embodiments, the sugar or sugar phosphate modification includes a 2'-O-methoxyethyl (2'-MOE) modification, a 2'-fluoro (2'-F) modification, a 2'-O-methyl (2'-O-Me) modification, a phosphorodiamidate morpholino (PMO) modification, a peptide nucleic acid (PNA) modification, a glycol nucleic acid (GNA), an unlocked nucleic acid (UNA), or a locked nucleic acid (LNA).

[0180] Other modified sugars can also be incorporated into oligonucleotide molecules. In some embodiments, the modified sugar contains one or more groups at the 2' position selected from -F, -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or N(R')2, where each R' is independently hydrogen or an optionally substituted C1-C 10 In some embodiments, the modified sugar is -F, -CF, -CN, -N, -NO, -NO, -O-(C-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 alkyl), -N(C1-C 10 alkyl)2, -O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl), -N(C2-C 10 alkenyl)2, -O-(C2-C 10 alkynyl), -S-(C2-C 10 alkynyl), -NH-(C2-C 10 alkynyl), -N(C2-C 10 alkynyl)2, -O-(C1-C 10 alkylene)-O-(C1-C 10alkyl), -O-(C1-C 10 Alkylene)-NH-(C1-C 10 alkyl), -O-(C1-C 10 Alkylene)-N(C1-C 10 alkyl)2, -NH-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), or -N(C1-C 10 Alkyl)-(C1-C 10 alkylene)-O-(C1-C 10 In some embodiments, the alkyl, alkenyl, or alkynyl group contains one or more groups at the 2' position selected from -O(CH) n OCH3 or -O(CH2) n substituted with a group selected from NH2 (wherein n is from 1 to about 10), MOE, DMAOE, and DMAEOE.

[0181] In some embodiments, the 2'-OH of the ribose is replaced by a group selected from -H, -F, -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2, where each R' is independently hydrogen or an optionally substituted C1-C 10 In some embodiments, the modified sugar is -F, -CF, -CN, -N, -NO, -NO, -O-(C-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 alkyl), -N(C1-C 10 alkyl)2, -O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl), -N(C2-C 10 alkenyl)2, -O-(C2-C 10 alkynyl), -S-(C2-C 10 alkynyl), -NH-(C2-C 10alkynyl), -N(C2-C 10 alkynyl)2, -O-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), -O-(C1-C 10 Alkylene)-NH-(C1-C 10 alkyl), -O-(C1-C 10 Alkylene)-N(C1-C 10 alkyl)2, -NH-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), or -N(C1-C 10 Alkyl)-(C1-C 10 alkylene)-O-(C1-C 10 In some embodiments, the 2'-OH is replaced by -H (i.e., deoxyribose). In some embodiments, the 2'-OH is replaced by -F. In some embodiments, the 2'-OH is replaced by -OR'. In some embodiments, the 2'-OH is replaced by -OMe. In some embodiments, the 2'-OH is replaced by -OCHCHOMe (i.e., MOE).

[0182] Modified sugars also include locked nucleic acids (LNAs). In some embodiments, locked nucleic acids have the structure shown below. In some embodiments, locked nucleic acids comprise the structure: 2s is -OCH2C4'-. [ka]

[0183] Modified sugars also include unlocked nucleic acids (UNAs). In some embodiments, unlocked nucleic acids have the structure shown below (see, e.g., Fluiter, Kees, et al., Molecular BioSystems 5.8 (2009): 838-843, which is incorporated herein by reference in its entirety). In some embodiments, locked nucleic acids comprise the structure: [ka]

[0184] In some embodiments, the oligonucleotides described herein comprise at least one modified internucleotide linkage. In some embodiments, the internucleotide linkage modification comprises a phosphorothioate linkage modification or a phosphodithioate linkage modification.

[0185] In some embodiments, the present invention provides a compound of formula I: [ka]

[0186] (I)

[0187] and providing an oligonucleotide comprising one or more modified internucleotide linkages independently having the structure:

[0188] In the formula, P * is the chiral phosphorus atom, either Rp or Sp,

[0189] W is O, S, or Se;

[0190] X, Y, and Z each independently represent -O-, -S-, -N(-LR 1 )-, or L,

[0191] L is a covalent bond or an optionally substituted straight or branched chain saturated or unsaturated C1-C 10is aliphatic and one or more methylene units of L are independently optionally replaced by -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R'), -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-;

[0192] R 1 is a halogen, R, or an optionally substituted straight or branched chain saturated or unsaturated C1-C 50 is aliphatic and one or more methylene units are independently optionally replaced by -C(R')2-, -Cy-, -O-, -S-, -SS-, -N(R')-, -C(O)-, -C(S)-, -C(NR')-, -C(O)N(R')-, -N(R')C(O)N(R'), -N(R')C(O)-, -N(R')C(O)O-, -OC(O)N(R')-, -S(O)-, -S(O)2-, -S(O)2N(R')-, -N(R')S(O)2-, -SC(O)-, -C(O)S-, -OC(O)-, or -C(O)O-;

[0193] each R' is independently -R, C(O)R, CO2R, or -SO2R;

[0194] two R' on the same nitrogen, together with their intervening atoms, form an optionally substituted heterocyclic or heteroaryl ring; or

[0195] two R' on the same carbon together with their intervening atoms form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring;

[0196] -Cy- is an optionally substituted divalent ring selected from carbocyclylene, arylene, heteroarylene, or heterocyclylene;

[0197] each R is independently hydrogen or an optionally substituted group selected from C1-C6 aliphatic, carbocyclyl, aryl, heteroaryl, or heterocyclyl;

[0198] each [ka] independently represents the linkage to a nucleoside.

[0199] In some embodiments, the internucleotide linkage having the structure of Formula I is [ka] is.

[0200] In particular, the present disclosure provides oligonucleotides of various designs, which may contain various nucleobases and their patterns, sugars and their patterns, internucleotide linkages and their patterns, and / or additional chemical moieties and their patterns, as described herein. In some embodiments, the provided oligonucleotides may reduce the level of POLRMT protein, POLRMT mRNA expression, and / or POLRMT activity in a subject's cells. In some embodiments, such oligonucleotides have a base sequence consisting of, including, or containing a portion of the base sequence of an oligonucleotide disclosed herein (e.g., a stretch of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more consecutive bases), wherein each T can be independently replaced by U, and vice versa, and the oligonucleotide contains at least one non-naturally occurring modification of the base, sugar, and / or internucleotide linkage.

[0201] According to certain embodiments, any of the oligonucleotides described herein may have a variety of nucleotide modifications or patterns of nucleotide modifications.

[0202] In some embodiments, an oligonucleotide comprises two or more chemically distinct regions, which confer different properties to the compound. In some embodiments, at least one region is modified to confer increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity to a target nucleic acid to the oligonucleotide, and at least one additional region of the oligonucleotide can serve as a substrate for an enzyme capable of cleaving RNA:DNA or RNA:RNA hybrids (e.g., RNase H). In some embodiments, at least one region of the oligonucleotide can serve as a substrate for an enzyme capable of cleaving RNA:DNA or RNA:RNA hybrids (e.g., RNase H), and at least one region can inhibit translation by steric blocking.

[0203] In some embodiments, the oligonucleotide comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) phosphorothioate (PS) internucleotide linkage. In some embodiments, the oligonucleotide comprises a sequence in which each internucleotide linkage comprises a phosphorothioate (PS) internucleotide linkage. In some embodiments, the oligonucleotide comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) phosphodithioate linkage. In some embodiments, the oligonucleotide comprises a sequence in which each internucleotide linkage comprises a phosphodithioate linkage.

[0204] In some embodiments, the oligonucleotide comprises at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) 2'-MOE.

[0205] In some embodiments, the oligonucleotide comprises five nucleotides at the 5' end and five at the 3' end that contain 2'-MOE modifications.

[0206] In some embodiments, the oligonucleotide is modified such that each nucleotide contains a 2'-MOE modification.

[0207] In some embodiments, the oligonucleotide comprises one or a subset of the following modification patterns: X MS X MS X MS X MS X S X S X S X S X S X S X S X S X MS X MS X MS X MS ("4-8-4" 16mar) X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS ("3-10-3" 16mar) X MS X MS X MS X MS X MS X S XS X S X S X S X S X S X S X MS X MS X MS X MS X MS (「5-8-5」18マー) X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS (「5-9-4」18マー) X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS (「4-9-5」18マー) X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS XMS X MS ("5-10-5" 20 marks) X MS X MS X MS X MS X Ms X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS

[0208] In the formula, "X" represents any nucleotide, "M" represents a 2'-O-MOE group, and "S" represents a phosphorothioate bond.

[0209] When a DNA-based antisense oligonucleotide (ASO) binds to its corresponding mRNA transcript, the endogenous RNase H enzyme, RNASEH1, recognizes the resulting RNA-DNA heteroduplex substrate and further cleaves the target RNA at the ASO binding site, leading to its degradation and thereby silencing target gene expression. Gapmer antisense oligonucleotides (ASOs), consisting of a DNA-based internal "gap" and RNA-like flanking regions (often consisting of 2'-O-methyl (2'-OMe)- or 2'-O-methoxyethyl (2'-MOE)-modified bases), bind to target transcripts with high affinity. In some embodiments, the oligonucleotide contains a gapmer modification pattern.

[0210] In some embodiments, the oligonucleotide comprises any one of the sequences set forth in Table 1 or Table 2, or a sequence at least 80%, at least 85%, at least 90%, or at least 95% identical to any one of the sequences set forth in Table 1 or Table 2, and comprises the following modification patterns: X MS XMS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS

[0211] In the formula, "X" represents any nucleotide, "M" represents a 2'-O-MOE group, and "S" represents a phosphorothioate bond.

[0212] In some embodiments, the oligonucleotide comprises any one of the sequences set forth in Table 1 or Table 2, or a sequence at least 80%, at least 85%, at least 90%, at least 95% identical to any one of the sequences set forth in Table 1 or Table 2, and comprises the following modification patterns: X MS X MS X MS X MS X MS X S X S X S X S X S X S X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X MS X MS X MSX MS X MS X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS X MS X MS X MS X MS X Ms X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS or X MS X MS X MS X MS X Ms X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS

[0213] In the formula, "X" represents any nucleotide, "M" represents a 2'-O-MOE group, and "S" represents a phosphorothioate bond.

[0214] In some embodiments, oligonucleotides are provided and / or utilized in salt form. In some embodiments, oligonucleotides are provided as salts that contain negatively charged internucleotide linkages (e.g., phosphorothioate internucleotide linkages, natural phosphate linkages, etc.) present in their salt form. In some embodiments, oligonucleotides are provided as pharmaceutically acceptable salts. In some embodiments, oligonucleotides are provided as metal salts. In some embodiments, metal salts derived from appropriate bases include alkali metal salts, alkaline earth metal salts, ammonium salts, and N + (C 1~4 Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using suitable hydroxide or amine bases. In some embodiments, the oligonucleotide is provided as a sodium salt. In some embodiments, the oligonucleotide is provided as a metal salt (e.g., a sodium salt) and each negatively charged internucleotide linkage is independently in salt form (e.g., -OP(O)(SNa)-O- for a phosphorothioate internucleotide linkage, -OP(O)(ONa)-O- for a natural phosphate linkage, etc., in the case of a sodium salt). In some embodiments, the oligonucleotide is provided as an ammonium salt.

[0215] In some embodiments, the oligonucleotide can be modified according to any one of the modifications and modification patterns described herein, and can also be conjugated to a ligand, e.g., as described herein. In some such embodiments, the ligand can be added to either the 3' or 5' end of the oligonucleotide sequence.

[0216] In some embodiments, the ligand targets the nucleic acid molecule to hepatocytes. For example, in some embodiments, the ligand binds to the hepatocyte-specific asialoglycoprotein receptor (ASGPR). In some embodiments, the ligand comprises a galactose derivative (e.g., GalNAc).

[0217] In some embodiments, the oligonucleotide is conjugated to or otherwise physically associated with one or more moieties that modulate (e.g., enhance) the activity, stability, cellular distribution, and / or cellular uptake of the oligonucleotide and / or alter one or more physical properties of the oligonucleotide (such as charge or solubility). In some embodiments, the moiety may comprise an antibody or a ligand. The ligand may be a carbohydrate, lectin, protein, glycoprotein, lipid, cholesterol, steroid, bile acid, nucleic acid hormone, growth factor, or receptor. In some embodiments, biologically inactive variants of naturally occurring hormones, growth factors, or other ligands may be used. In some embodiments, the moiety comprises a targeting moiety that targets the oligonucleotide to a specific cell type (e.g., hepatocytes). In some embodiments, the targeting moiety binds to the hepatocyte-specific asialoglycoprotein receptor (ASGPR).

[0218] In some embodiments, the moiety is attached to the oligonucleotide via a reversible bond. A "reversible linkage" is a bond that includes a reversible bond. A "reversible bond" (also called a labile or cleavable bond) is a covalent bond, other than a covalent bond to a hydrogen atom, that can be selectively broken or cleaved under selected conditions more quickly than other bonds in the molecule, and the bond can be selectively broken or cleaved under conditions that do not substantially break or cleave other covalent bonds in the same molecule. Bond cleavage or instability can be measured by the half-life (t 1 / 2 ) (the time it takes to break half of the bonds).

[0219] In some embodiments, the moiety added to the oligonucleotide comprises a carbohydrate. Exemplary carbohydrates include monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units. In certain embodiments, the carbohydrate comprises galactose or a galactose derivative (such as galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-iso-butanoylgalactosamine). In certain embodiments of particular interest, the galactose derivative comprises N-acetylgalactosamine (GalNAc). In certain embodiments, the moiety comprises multiple occurrences of galactose or a galactose derivative, for example, multiple N-acetylgalactosamine moieties (e.g., three GalNAc moieties (i.e., tri-antennary GalNAc)). A terminal galactose derivative can be attached to another moiety via the C-1 carbon of the galactose derivative. In some embodiments, two or more (e.g., three) galactose derivatives are attached to a moiety that serves as a branch point and can be attached to an oligonucleotide. In some embodiments, the galactose derivatives are linked to the moiety that serves as the branch point via a linker or spacer. In some embodiments, the moiety that serves as the branch point can be attached to the oligonucleotide via a linker or spacer. For example, in some embodiments, the galactose derivative is attached to the branch point via a linker or spacer comprising an amide, carbonyl, alkyl, oligoethylene glycol moiety, or a combination thereof. In some embodiments, at least three nucleoside-GalNAc monomers or at least three non-nucleoside-GalNAc monomers are site-specifically incorporated into the oligonucleotide. In some embodiments, such incorporation can be achieved during solid-phase synthesis using phosphoramidite chemistry or via post-synthesis conjugation. In some embodiments, the galactose derivative-containing monomer units are linked to each other and / or to nucleosides of the oligonucleotide that do not have a galactose derivative attached via phosphodiester bonds.Those skilled in the art will appreciate that the structure of the linking moiety connecting each GalNAc to the branch point can vary.

[0220] An exemplary galactose cluster is shown below. [ka]

[0221] In some embodiments, a GalNAc moiety (e.g., a GalNAc moiety represented by Formulas I-III) is conjugated to the 5' end of an oligonucleotide described herein (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740).

[0222] In some embodiments, a GalNAc moiety (e.g., a GalNAc moiety represented by Formulas I-III) is conjugated to the 3' end of an oligonucleotide described herein (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740).

[0223] Methods for conjugating oligonucleotides to GalNAc moieties are known in the art, and exemplary methods are disclosed in Ostergaard, Michael E., et al., "Efficient synthesis and biological evaluation of 5'-GalNAc conjugated antisense oligonucleotides." Bioconjugate chemistry 26.8(2015):1451-1455, which is incorporated herein by reference in its entirety.

[0224] In some embodiments, 2' deoxyadenosine phosphodiester is inserted between oligonucleotide and GalNAc conjugate to facilitate metabolic cleavage.Thus, in some embodiments, the oligonucleotide sequence contains an additional adenine (A) nucleotide residue at the 5' or 3' end where GalNAc moiety is conjugated (see, for example, Ostergaard, Michael E., et al., 2015), and the additional A contains a phosphate bond between A and the 5' or 3' nucleotide of the oligonucleotide.The following shows exemplary modification patterns: A O X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS A O A O X MS X MS X MS X MS X MS XMS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS A O A O X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS A O

[0225] In the formula, "A" represents adenine, "X" represents any nucleotide, "M" represents a 2'-O-MOE group, "S" represents a phosphorothioate bond, and "O" represents a phosphate bond.

[0226] In some embodiments, the oligonucleotide comprises any one of the sequences set forth in Table 1 or Table 2, or a sequence at least 80%, at least 85%, at least 90%, at least 95% identical to any one of the sequences set forth in Table 1 or Table 2, and comprises the following modification patterns: A O X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS A O A O X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS XMS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS A O A O X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS X MS A O

[0227] In the formula, "A" represents adenine, "X" represents any nucleotide, "M" represents a 2'-O-MOE group, "S" represents a phosphorothioate bond, and "O" represents a phosphate bond.

[0228] In some embodiments, the linking moiety connects an oligonucleotide described herein (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) to a GalNAc moiety (e.g., those shown in Formulas I-III). In some embodiments, the oligonucleotides described herein are conjugated to GalNAc as shown below. [ka]

[0229] In some embodiments, the linking moiety comprises the structure shown below: [ka]

[0230] In some embodiments, an oligonucleotide (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) is conjugated at its 5' end to a GalNAc moiety represented by formula I via a linker shown in formula A. In some embodiments, an oligonucleotide (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) is conjugated at its 3' end to a GalNAc moiety represented by formula I via a linker shown in formula A. In some embodiments, the oligonucleotide (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) additionally comprises a 2' deoxyadenosine phosphodiester inserted between the oligonucleotide and the GalNAc / linker moiety.

[0231] In some embodiments, an oligonucleotide (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) is conjugated at its 5' end to a GalNAc moiety represented by Formula II via a linker shown in Formula A. In some embodiments, an oligonucleotide (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) is conjugated at its 3' end to a GalNAc moiety represented by Formula II via a linker shown in Formula A. In some embodiments, the oligonucleotide (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) additionally comprises a 2' deoxyadenosine phosphodiester inserted between the oligonucleotide and the GalNAc / linker moiety.

[0232] In some embodiments, an oligonucleotide (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) is conjugated at its 5' end to a GalNAc moiety represented by Formula III via a linker shown in Formula A. In some embodiments, an oligonucleotide (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) is conjugated at its 3' end to a GalNAc moiety represented by Formula III via a linker shown in Formula A. In some embodiments, the oligonucleotide (e.g., an oligonucleotide represented by any one of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, 634, or 728-740) additionally comprises a 2' deoxyadenosine phosphodiester inserted between the oligonucleotide and the GalNAc / linker moiety.

[0233] In certain embodiments, the moiety comprises a lipophilic moiety. In some embodiments, the lipophilic moiety comprises a tocopherol (e.g., alpha-tocopherol). In some embodiments, the lipophilic moiety comprises cholesterol. In some embodiments, the lipophilic compound comprises an alkyl or heteroalkyl group. In some embodiments, the lipophilic compound is palmitoyl, hexadec-8-enoyl, oleyl, (9E,12E)-octadeca-9,12-dienoyl, dioctanoyl, or C 16 ~C 20 In some embodiments, the lipophilic moiety comprises at least 16 carbon atoms. In some embodiments, the lipophilic moiety comprises -(CH y ) n -NH-(C=O)-(CH x ) m-CH3, where m and n are each independently 0 to 20, and x and y are each independently 0 to 2. In some embodiments, n and m are each independently an integer from 1 to 20. In some embodiments, n+m is at least 10, 12, 14, or 16.

[0234] Unless otherwise stated, structures depicted herein are also intended to include all isomeric forms (e.g., enantiomeric, diastereomeric, and geometric (or conformational) forms) of the structure; e.g., for each asymmetric center, the R and S configurations are intended to be included. Thus, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the present compounds are within the scope of the invention. Furthermore, unless otherwise stated, structures depicted herein are also intended to include compounds that differ only in the presence of one or more isotopically enriched atoms; for example, the replacement of hydrogen by deuterium or tritium, or 13 C-enriched carbon or 14 Compounds having the present structures containing a carbon replacement with a C-enriched carbon are within the scope of the present invention. Such compounds are useful according to the present invention, for example, as analytical tools, probes in biological assays, or as therapeutic agents.

[0235] Compositions and Administration In some embodiments, one or more of the oligonucleotides described herein may be formulated in an oligonucleotide composition. In some embodiments, the oligonucleotide composition may include oligonucleotides containing the same nucleotide sequence (e.g., any one of the sequences provided in Table 1 or Table 2). In some embodiments, the oligonucleotide composition may include oligonucleotides containing multiple nucleotide sequences (e.g., multiple of the sequences provided in Table 1 or Table 2).

[0236] In some embodiments, provided oligonucleotide compositions may be or comprise pure preparations of individual stereochemically isomeric forms of a compound (e.g., including chirally pure oligonucleotides). In some embodiments, provided oligonucleotide compositions may be or comprise mixtures of two or more stereochemically isomeric forms of a compound. In some embodiments, such mixtures contain equal amounts of different stereochemically isomeric forms. In some embodiments, such mixtures contain unequal amounts of at least two different stereochemically isomeric forms. In some embodiments, an oligonucleotide composition may contain all diastereomers and / or enantiomers of a compound. In some embodiments, an oligonucleotide composition may contain less than all diastereomers and / or enantiomers of a compound. In some embodiments, if a specific enantiomer of an oligonucleotide is desired, it may be prepared, for example, by asymmetric synthesis or derivatization with a chiral auxiliary; the resulting diastereomeric mixture is separated; and the auxiliary is cleaved to yield the pure desired enantiomer. Alternatively, if the molecule contains a basic functional group (such as amino), diastereomeric salts are formed with an appropriate optically active acid and resolved, for example, by fractional crystallization.

[0237] Pharmaceutical Composition In some embodiments, the present disclosure provides a pharmaceutical composition comprising one or more oligonucleotides. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable carrier.

[0238] In some embodiments, the pharmaceutical composition is formulated for systemic or local administration, hi some embodiments, the pharmaceutical composition is administered via a delivery route selected from intrathecal administration, oral administration, intramuscular administration, or intravenous administration.

[0239] The pharmaceutically acceptable compositions of the present disclosure can also be administered by nasal aerosol or inhalation. Such compositions can be prepared according to techniques well known in the art of pharmaceutical formulations, and can be prepared as a solution in saline using benzyl alcohol or other suitable preservatives, absorption enhancers to enhance bioavailability, fluorocarbons, and / or other conventional solubilizers or dispersants. In some embodiments, the intranasal composition is a liquid form (e.g., solution, emulsion, or suspension) of intranasal drops or a spray (fine mist).

[0240] The pharmaceutically acceptable compositions of the present disclosure may also be suitable for pulmonary administration, such as inhalation compositions to be inhaled by the patient. The inhalation compositions may be in the form of a dry powder inhalation composition, a pressurized aerosol inhalation composition, or a nebulized inhalation composition (e.g., an aqueous suspension or solution).

[0241] In some embodiments, the oligonucleotide is associated with a delivery agent. A "delivery agent" refers to a substance or entity non-covalently or covalently associated with an oligonucleotide, or a substance or entity co-administered with an oligonucleotide that performs one or more functions to increase the stability and / or efficacy of a biologically active agent over that which would occur if the biologically active agent were delivered (e.g., administered to a subject) in the absence of the delivery agent. For example, the delivery agent may protect the oligonucleotide from degradation, facilitate entry of the oligonucleotide into a cell or into a cellular compartment of interest (e.g., the cytoplasm or mitochondria), and / or enhance association with a specific cell containing the molecular target to be modulated. Those skilled in the art are aware of numerous delivery agents that can be used to deliver oligonucleotides. For a review of some of these technologies, see Dhuri, Karishma, et al., "Antisense oligonucleotides: an emerging area in drug discovery and development." Journal of clinical medicine 9.6 (2020). In some embodiments, for example, to administer oligonucleotides systemically, the oligonucleotides may be associated with a delivery agent such as a nanoparticle, a dendrimer, a polymer, a liposome, or a cationic delivery system. A lipid (e.g., a cationic or neutral lipid), a dendrimer, or a polymer may be attached to the oligonucleotide or may form a vesicle or micelle that encapsulates the oligonucleotide.

[0242] In some embodiments, oligonucleotides are administered in association with lipids or lipid-containing particles (e.g., lipid nanoparticles (LNPs)). In some embodiments, oligonucleotides are administered in association with cationic polymers (which may be polypeptide or non-polypeptide polymers), lipids, peptides, PEG, cyclodextrins, or combinations thereof, which may be in the form of nanoparticles or microparticles. The lipids or peptides may be cationic. "Nanoparticle" refers to a particle having a length in two or three dimensions greater than 1 nanometer (nm) and less than about 150 nm (e.g., 20 nm to 50 nm or 50 nm to 100 nm). "Microparticle" refers to a particle having a length in two or three dimensions greater than 150 nm and less than about 1000 nm. Nanoparticles can have targeting moieties and / or cell-penetrating or membrane-active moieties covalently or noncovalently attached thereto. Nanoparticles (such as lipid nanoparticles) are described, for example, in Tatiparti et al., Nanomaterials 7:77 (2017).

[0243] In some embodiments, the delivery agent comprises one or more amino acid lipids. Amino acid lipids are molecules containing amino acid residues (e.g., arginine, homoarginine, norarginine, nor-norarginine, ornithine, lysine, homolysine, histidine, 1-methylhistidine, pyridylalanine, asparagine, N-ethylasparagine, glutamine, 4-aminophenylalanine, their N-methylated versions, and their side chain modified derivatives) and one or more lipophilic tails. In some embodiments, the delivery agent comprises a lipopeptide compound comprising a central peptide and having a lipophilic group attached to each end. In some embodiments, the lipophilic group can be derived from a naturally occurring lipid. In some embodiments, the lipophilic group can comprise a C(1-22) alkyl, a C(6-12) cycloalkyl, a C(6-12) cycloalkyl-alkyl, a C(3-18) alkenyl, a C(3-18) alkynyl, a C(1-5) alkoxy-C(1-5) alkyl, or sphinganine, or (2R,3R)-2-amino-1,3-octadecanediol, icosasphinganine, sphingosine, phytosphingosine, or cis-4-sphingenine. The central peptide can comprise a cationic or amphiphilic amino acid sequence. Examples of such lipopeptides and their use for nucleic acid delivery are described, for example, in U.S. Patent No. 9,220,785.

[0244] In some embodiments, the oligonucleotide is conjugated to a delivery agent that is a polymer. Useful delivery polymers include, for example, poly(acrylate) polymers (see, e.g., U.S. Patent Publication No. 20150104408), poly(vinyl ester) polymers (see, e.g., U.S. Patent Publication No. 20150110732), and certain polypeptides.

[0245] In some embodiments, the oligonucleotide may be administered in "naked" form, i.e., in the absence of a delivery agent. The naked oligonucleotide may be present in a suitable buffer. The buffer may contain, for example, acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In some embodiments, the buffer is phosphate-buffered saline (PBS). The pH and osmolality of the buffer may be adjusted so that it is suitable for administration to a subject. In some embodiments, the oligonucleotide is administered without being physically associated with a lipid or lipid-containing particle. In some embodiments, the oligonucleotide is administered without being physically associated with a nanoparticle or microparticle. In some embodiments, the oligonucleotide is administered without being physically associated with a cationic polymer.

[0246] The oligonucleotides described herein can be incorporated into pharmaceutical compositions. Such pharmaceutical compositions are useful, inter alia, for administration and delivery to a subject in vivo or ex vivo. In some embodiments, the pharmaceutical composition also contains a pharmaceutically acceptable carrier or excipient. Such excipients include any pharmaceutical agent (e.g., a pharmaceutical agent that does not itself induce a harmful immune response in the individual to whom the composition is administered and that can be administered without undue toxicity). As used herein, the terms "pharmaceutically acceptable" and "physiologically acceptable" refer to a biologically acceptable formulation, gas, liquid, or solid, or mixture thereof, suitable for one or more routes of administration, delivery, or contact in vivo. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, sugars, and ethanol. Pharmaceutically acceptable salts may also be included, such as mineral acid salts (such as hydrochloride, hydrobromide, phosphate, sulfate, and the like) and organic acid salts (such as acetate, propionate, malonate, benzoate, and the like). Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.

[0247] The pharmaceutical compositions may be provided as salts, which can be formed with a number of acids, including but not limited to, hydrochloric acid, sulfuric acid, acetic acid, lactic acid, tartaric acid, malic acid, succinic acid, etc. Salts tend to be more soluble in aqueous or other protic solvents than are the corresponding free base forms. In some embodiments, the pharmaceutical composition may be a lyophilized powder.

[0248] Pharmaceutical compositions may contain solvents (aqueous or non-aqueous), solutions (aqueous or non-aqueous), emulsions (e.g., oil-in-water or water-in-oil), suspensions, syrups, elixirs, dispersion and suspension media, coatings, isotonicity and absorption enhancers or delayers that are compatible with pharmaceutical administration or in vivo contact or delivery. Aqueous and non-aqueous solvents, solutions, and suspensions may contain suspending agents and thickening agents. Such pharmaceutically acceptable carriers include tablets (coated or uncoated), capsules (hard or soft), microbeads, powders, granules, and crystals. Supplementary active compounds (e.g., preservatives, antibacterial agents, antiviral agents, and antifungal agents) can also be incorporated into the compositions.

[0249] Pharmaceutical compositions can be formulated to be compatible with a particular route of administration or delivery, as described herein or as known to those skilled in the art. Thus, pharmaceutical compositions include carriers, diluents, or excipients suitable for administration by various routes.

[0250] Compositions suitable for parenteral administration may include aqueous and non-aqueous solutions, suspensions, or emulsions of the active compound; these preparations are typically sterile and may be isotonic with the blood of the intended recipient. Non-limiting, illustrative examples include water, buffered saline, Hank's solution, Ringer's solution, dextrose, fructose, ethanol, animal oils, vegetable oils, or synthetic oils. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension (such as sodium carboxymethylcellulose, sorbitol, or dextran). Additionally, suspensions of the active compound may be prepared as appropriate oil injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils (such as sesame oil), or synthetic fatty acid esters (such as ethyl oleate or triglycerides), or liposomes. Optionally, the suspension may also contain suitable stabilizers or agents that increase solubility, allowing for the preparation of highly concentrated solutions.

[0251] Cosolvents and adjuvants may be added to the formulation. Non-limiting examples of cosolvents include those containing hydroxyl groups or other polar groups (e.g., alcohols (such as isopropyl alcohol), glycols (such as propylene glycol, polyethylene glycol, polypropylene glycol, glycol ethers), glycerol, polyoxyethylene alcohols, and polyoxyethylene fatty acid esters). Adjuvants include, for example, surfactants (such as soybean lecithin and oleic acid), sorbitan esters (such as sorbitan trioleate), and polyvinylpyrrolidone.

[0252] After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for therapeutic use, such as by administration of a particular amount, frequency, and method.

[0253] Pharmaceutical compositions and delivery systems suitable for use with the compositions, methods, and methods of the present disclosure are known in the art (see, e.g., Remington: The Science and Practice of Pharmacy. 21st Edition. Philadelphia, PA. Lippincott Williams & Wilkins, 2005).

[0254] Medication and Administration The oligonucleotides described herein or vectors comprising nucleotide sequences encoding the oligonucleotides described herein can be used to treat cancer or metabolic diseases or disorders, for example, to treat subjects suffering from or susceptible to the cancers or metabolic diseases or disorders described herein. The administration mode of the pharmaceutical compositions described herein can vary depending on the desired results. Those skilled in the art, i.e., physicians, will recognize that they can adjust the administration regimen to obtain the desired response (e.g., therapeutic response).

[0255] Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intrathecal (e.g., intracisternal or via lumbar puncture), intravaginal, transdermal, rectal, by inhalation, or topical (e.g., to the ear, nose, eye, or skin). In some embodiments, the oligonucleotide composition is delivered to the central nervous system (CNS), for example, via intraventricular administration.

[0256] In some embodiments, the pharmaceutical compositions described herein are delivered to the liver. In some embodiments, the pharmaceutical compositions described herein are delivered to the muscle. In some embodiments, the pharmaceutical compositions described herein are delivered to the CNS (e.g., via intrathecal administration). In some embodiments, the pharmaceutical compositions described herein are delivered to the cerebrospinal fluid.

[0257] Delivery of oligonucleotides to cells can be achieved in several different ways: In vivo delivery can be carried out by administering a composition containing the oligonucleotide to a subject, for example, by a parenteral route of administration (e.g., subcutaneous administration, intravenous administration, or intramuscular administration).

[0258] The present disclosure also provides methods for administering an oligonucleotide or a vector comprising a nucleotide sequence encoding an oligonucleotide described herein to a cell or animal. In some embodiments, such methods include contacting a subject (e.g., a cell or tissue of a subject) with an oligonucleotide described herein (or a vector comprising a nucleotide sequence encoding an oligonucleotide described herein) or administering an oligonucleotide described herein (or a vector comprising a nucleotide sequence encoding an oligonucleotide described herein) to a subject (e.g., a subject such as a mammal), such that the oligonucleotide is expressed in the subject (e.g., a cell or tissue of the subject).

[0259] The oligonucleotide compositions described herein (or vectors containing nucleotide sequences encoding the oligonucleotides described herein) can be administered in sufficient or effective amounts to subjects in need thereof. Dosages can vary and depend on the type, onset, progression, severity, frequency, duration, or likelihood of the disease being treated, the desired clinical endpoint, previous or concurrent treatments, the subject's overall health, age, sex, race, or immunocompetence, and other factors that would be understood by one of skill in the art. The amount, number, frequency, or duration of administration can be proportionally increased or decreased depending on any adverse side effects, complications, or other risk factors of the treatment or therapy, and the condition of the subject. One of skill in the art will understand factors that can affect the dosage and timing necessary to provide an amount sufficient to provide therapeutic or prophylactic benefit.

[0260] In some embodiments, the oligonucleotide composition is administered to a subject in an amount of 0.01 mg / kg to 50 mg / kg. In some embodiments, the oligonucleotide composition is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 15 mg / kg. In some embodiments, the oligonucleotide composition is administered at a dose of about 10 mg / kg to about 30 mg / kg. In some embodiments, the oligonucleotide composition is administered at a dose of about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2.0 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 3.5 mg / kg, about 4 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, or about 50 mg / kg. In some embodiments, the oligonucleotide composition is administered at a dose of 0.01 mg / kg to 0.1 mg / kg, 0.01 mg / kg to 0.1 mg / kg, 0.1 mg / kg to 1.0 mg / kg, 1.0 mg / kg to 2.5 mg / kg, 2.5 mg / kg to 5.0 mg / kg, 5.0 mg / kg to 10 mg / kg, 10 mg / kg to 20 mg / kg, 20 mg / kg to 30 mg / kg, 30 mg / kg to 40 mg / kg, or 40 mg / kg to 50 mg / kg. In some embodiments, a fixed dose is administered. In some embodiments, the oligonucleotide composition is administered at a dose of 5 mg to 1.0 g (e.g., 5 mg to 10 mg, 10 mg to 20 mg, 20 mg to 40 mg, 40 mg to 80 mg, 80 mg to 160 mg, 160 mg to 320 mg, 320 mg to 640 mg, 640 mg to 1 g). In some embodiments, the dose is about 1 mg, 5 mg, 10 mg, 25 mg, 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, or 1000 mg.

[0261] In some embodiments, the dose is a daily dose. In some embodiments, the dose is administered according to a dosing regimen with a dosing interval of at least 2 days, for example, at least 7 days, for example, about 2, 3, 4, 6, or 8 weeks. For example, in some embodiments, the oligonucleotide composition is administered according to a dosing regimen with a dosing interval of at least 7 days. In some embodiments, the oligonucleotide composition is administered daily, weekly, monthly, or every 2, 3, 4, 5, or 6 months or more. In some embodiments, any of the doses and / or dosing regimens described herein are administered subcutaneously. In some embodiments, the oligonucleotide composition is administered once, and then the level of inhibition is measured, and when the level of inhibition has decreased to a certain level, a subsequent dose of the inhibitory composition is administered.

[0262] In some embodiments, the subject exhibits sustained POLRMT inhibition, as measured by POLRMT mRNA expression (e.g., in a biological sample) for a period of at least 2 days, e.g., at least 7 days, e.g., about 2, 3, 4, 6, 8, 10, 12, 16, or 20 weeks, after administration.

[0263] An effective or sufficient amount can be (but need not be) given in a single administration, but may require multiple administrations, and can be (but need not be) administered alone or in combination with another composition. For example, the amount may be increased proportionally depending on the needs of the subject, the type, condition, and severity of the disease being treated, or the side effects of the treatment (if any). An amount considered effective also includes an amount that reduces the use of another treatment, therapeutic regimen, or protocol (such as the administration of another therapeutic agent described herein).

[0264] Thus, the pharmaceutical compositions of the present disclosure include compositions containing the active ingredient in an amount effective to achieve the intended therapeutic goal. Determining a therapeutically effective dose is well within the capabilities of a skilled physician using the techniques and guidelines provided in this disclosure. The therapeutic dose may depend, among other factors, on the subject's age and general condition, the severity of the cancer or metabolic disease or disorder, and the strength of the regulatory sequences regulating the expression level of the oligonucleotide. Thus, the therapeutically effective amount in humans will fall within a relatively broad range that can be determined by a physician based on an individual patient's response to vector-based therapy. The pharmaceutical compositions can be delivered to a subject via gene-based and / or cell-based therapy, or by ex vivo modification of patient or donor cells to enable in vivo production of the oligonucleotides described herein.

[0265] The methods and uses of the present disclosure include systemic delivery and administration, local or regional delivery and administration, or delivery and administration by any route (e.g., injection or infusion). In vivo delivery of pharmaceutical compositions can generally be achieved via injection using a conventional syringe, although other delivery methods, such as convection-enhanced delivery, can also be used (see, e.g., U.S. Pat. No. 5,720,720). For example, compositions can be delivered subcutaneously, epidermally, intradermally, intrathecally, intraorbitally, intramucosally, intraperitoneally, intravenously, intrapleurally, intraarterially, orally, intrahepatically, intracerebroventricularly (e.g., via intraventricular injection), via the portal vein, or intramuscularly. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal application. A clinician specializing in the treatment of patients with cancer or metabolic diseases or disorders can determine the optimal route of administration for an oligonucleotide composition or a vector comprising a nucleotide sequence encoding the oligonucleotide described herein.

[0266] In some embodiments, the oligonucleotide composition can be administered to a subject once daily, weekly, every 2, 3, or 4 weeks, or at longer intervals. In some embodiments, the oligonucleotide composition described herein can be administered according to a dosing regimen that includes (i) an initial administration once daily, weekly, every 2, 3, or 4 weeks, or at longer intervals, followed by (ii) a treatment-free period of, for example, 1, 2, 3, 4, 5, 6, 8, or 10 months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some embodiments, the subject is monitored for POLRMT mRNA expression and / or activity levels or POLRMT protein levels before and / or after treatment. In some embodiments, the subject is monitored for mtDNA levels, mRNA expression of other mitochondrial genes, or levels of other mitochondrial proteins (e.g., those indicating reduced mitochondrial transcription) before and / or after treatment. In some embodiments, a subject is treated or re-treated if the measured level of POLRMT mRNA expression and / or POLRMT activity or POLRMT protein level is greater than 10%, 20%, 30%, 40%, 50%, 100%, 200% or more compared to the measured level in a control subject.

[0267] Diseases, Disorders, and Conditions The present disclosure provides, inter alia, oligonucleotides and compositions comprising the same. In some embodiments, such compositions are used to treat cancer and metabolic diseases through inhibition of POLRMT.

[0268] cancer In some embodiments, the oligonucleotides described herein can be used to treat cancer. Those skilled in the art are aware of various types of cancer, including, for example, adrenal gland cancer, anal cancer, adenocarcinoma, adrenocortical carcinoma, astrocytoma, angiosarcoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, blastic plasmacytoid dendritic cell neoplasm, bone cancer, brain cancer, breast cancer, bronchial carcinoma, central nervous system (CNS) cancer, cervical cancer, carcinoid, heart cancer, bile duct carcinoma, chordoma, chronic myeloproliferative neoplasm, craniopharyngioma, bile duct carcinoma, chondrosarcoma, colon cancer, choriocarcinoma, colorectal cancer, cancer of connective tissue, esophageal cancer, ductal carcinoma in situ, ependymoma, embryonal carcinoma, fibrosarcoma, gallbladder cancer, gastric cancer, glioblastoma, gastrointestinal carcinoma, and the like. Noid tumor, gastrointestinal stromal tumor (GIST), gestational trophoblastic disease, glioma, head and neck cancer, blood cancer, histiocytosis, renal cancer, intraocular melanoma, leukemia (e.g., acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), hairy cell leukemia, myeloid leukemia, acute leukemia, acute lymphocytic leukemia, acute myeloid leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic Myeloid leukemia, chronic lymphocytic leukemia), liposarcoma, liver cancer, lung cancer, lymphoma (e.g., Burkitt's lymphoma [non-Hodgkin's lymphoma], cutaneous T-cell lymphoma, Hodgkin's lymphoma, mycosis fungoides, Sézary syndrome, AIDS-related lymphoma, follicular lymphoma, diffuse large B-cell lymphoma), melanoma, Merkel cell carcinoma, mesothelioma, myeloma (e.g., multiple myeloma), muscle cancer, myxosarcoma, myelodysplastic syndrome, papilloma, paraganglioma, pheochromocytoma, pleuropulmonary blastoma, retinoblastoma, sarcoma (e.g., Ewing's sarcoma, Kaposi's sarcoma, osteosarcoma, sarcoma, striated muscle cancers of the adrenal cortex, anus, appendix, bile duct, bladder, bone, brain, breast, bronchus, central nervous system, cervix, colon, endometrium, esophagus, eye, fallopian tube, gallbladder, gastrointestinal tract, germ cell, head and neck, heart, intestine, kidney (e.g., Wilms tumor), larynx, liver, lung (e.g., non-small cell lung cancer, small cell lung cancer), mouth, nasal cavity, oral cavity, ovary, pancreas, rectum, skin, stomach, testicle, throat, thyroid gland, penis, pharynx, peritoneum, pituitary gland, prostate, rectum, salivary gland, ureter, urethra, uterus, vagina, or vulva.

[0269] In some embodiments, the oligonucleotide compositions described herein can be used to treat tumors in a subject. In some embodiments, the tumor is or comprises a hematopoietic malignancy, including but not limited to acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, hairy cell leukemia, AIDS-related lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, Langerhans cell histiocytosis, multiple myeloma, or myeloproliferative neoplasms.

[0270] In some embodiments, the tumor is or comprises a solid tumor, including, but not limited to, breast cancer, squamous cell carcinoma, colon cancer, head and neck cancer, ovarian cancer, lung cancer, mesothelioma, genitourinary cancer, bladder cancer, rectal cancer, gastric cancer, or esophageal cancer.

[0271] In some specific embodiments, the tumor is or comprises an aggressive and / or refractory tumor. In some embodiments, a tumor is characterized as aggressive if certain pathologies are found in the tumor (e.g., in a tissue sample, such as a biopsy sample, obtained from the tumor) and / or if cancer patients having such tumors are typically not considered candidates for conventional chemotherapy. In some embodiments, pathologies that characterize a tumor as aggressive may include tumor size, changes in expression of genetic markers, and invasion of adjacent organs and / or lymph nodes by tumor cells. In some embodiments, a tumor is characterized as refractory if patients having such tumors are resistant to one or more known treatment modalities (e.g., one or more conventional chemotherapy regimens) and / or if a particular patient exhibits resistance (e.g., lack of response) to one or more such known treatment modalities.

[0272] In some embodiments, compositions comprising one or more oligonucleotides described herein can be administered in combination with cancer treatment.The present disclosure is not limited to any particular cancer treatment, and any known or developed cancer treatment is encompassed by the present disclosure.Known cancer treatments include, for example, therapeutic cancer vaccines, chemotherapeutic agents, radiation therapy, surgical resection, chemotherapy after surgical resection of tumor, adjuvant therapy, localized hypothermia or hyperthermia, anti-tumor antibodies, and administration of anti-angiogenic agents. In some embodiments, the cancer treatment and / or adjunctive therapy includes a TLR agonist (e.g., CpG, poly I:C, etc., see, e.g., Wittig et al., Crit. Rev. Oncol. Hematol. 94:31-44 (2015); Huen et al., Curr. Opin. Oncol. 26:237-44 (2014); Kaczanowska et al., J. Leukoc. Biol. 93:847-863 (2013)), a STING agonist (e.g., US20160362441, US20140329889, Fu et al., al., Sci. Transl. Med. 7:283ra52 (2015), and WO2014189805), non-specific stimulation of innate immune and / or dendritic cells, or administration of GM-CSF, interleukin-12, interleukin-7, Flt-3, or other cytokines. In some embodiments, the cancer treatment is or includes oncolytic virus therapy (e.g., talimogene leherparepvec). (See, e.g., Fukuhara et al., Cancer Sci. 107:1373-1379 (2016)). In some embodiments, the cancer treatment is or includes bispecific antibody therapy (e.g., Choi et al., 2011 Expert Opin Biol Ther; Huehls et al., 2015, Immunol and Cell Biol).In some embodiments, the cancer treatment is or includes a cell therapy such as chimeric antigen receptor T (CAR-T) cells, TCR-transduced T cells, dendritic cells, tumor-infiltrating lymphocytes (TILs), or natural killer (NK) cells (e.g., those reviewed in Sharpe and Mount, 2015, Dis Model Mech 8:337-50).

[0273] In some embodiments, cancer treatments may include chemotherapeutic agents. A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer, regardless of mechanism of action. Classes of chemotherapeutic agents include, but are not limited to, alkylating agents, antimetabolites, spindle poison plant alkaloids, cytotoxic / antitumor antibiotics, topoisomerase inhibitors, antibodies, photosensitizers, and kinase inhibitors. Non-limiting examples of chemotherapeutic agents include erlotinib (TARCEVA®, Genentech / OSI Pharm.), docetaxel (TAXOTER®, Sanofi-Aventis), 5-FU (fluorouracil, 5-fluorouracil, CAS number 51-21-8), gemcitabine (GEMZAR®, Lilly), PD-0325901 (CAS number 391210-10-9, Pfizer), cisplatin (cis-diammine, dichloroplatinum(II), CAS number 15663-27-1), carboplatin (CAS number 41575-94-4), paclitaxel (TAXOL®, Bristol-Myers Squibb), and others. Oncology, Princeton, NJ), temozolomide (4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo[4.3.0]nona-2,7,9-triene-9-carboxamide, CAS number 85622-93-1, TEMODAR®, TEMODAL®, Schering Plough), tamoxifen ((Z)-2-[4-(1,2-diphenylbut-1-enyl)phenoxy]-N,N-dimethyl-ethanamine, NOLVADEX®, ISTUBAL®, VALODEX®), and doxorubicin (ADRIAMYCIN®), Akti-1 / 2, HPPD, and rapamycin.

[0274] Further examples of chemotherapeutic agents include oxaliplatin (ELOXATIN®, Sanofi), bortezomib (VELCADE®, Millennium Pharm.), Sutent (SUNITINIB®, SU11248, Pfizer), letrozole (FEMARA®, Novartis), imatinib mesylate (GLEEVEC®, Novartis), XL-518 (MEK inhibitor, Exelixis, WO2007 / 044515), ARRY-886 (Mek inhibitor, AZD6244, Array BioPharma, Astra Zeneca), SF-1126 (PI3K inhibitor, Semafore Pharmaceuticals), BEZ-235 (PI3K inhibitor, Novartis), XL-147 (PI3K inhibitor, Exelixis), PTK787 / ZK 222584 (Novartis), fulvestrant (FASLODEX®, AstraZeneca), leucovorin (folinic acid), rapamycin (sirolimus, RAPAMUNE®, Wyeth), lapatinib (TYKERB®, GSK572016, GlaxoSmithKline), lonafarnib (SARASAR™, SCH66336, Schering Plough), sorafenib (NEXAVAR®, BAY43-9006, Bayer Labs), gefitinib (IRESSA®, AstraZeneca), irinotecan (CAMPTOSAR®, CPT-11, Pfizer), tipifarnib (ZARNESTRA™, Johnson & Johnson), Johnson), ABRAXANE™ (Cremophor-free), an albumin-engineered nanoparticle formulation of paclitaxel (American Pharmaceutical Partners, Schaumberg, Ill.), vandetanib (rINN, ZD6474, ZACTIMA®, AstraZeneca), chlorambucil, AG1478, AG1571 (SU5271;Sugen), temsirolimus (TORISEL®, Wyeth), pazopanib (GlaxoSmithKline), canfosfamide (TELCYTA®, Telik), thiotepa and cyclosphosphamide (CYTOXAN®, NEOSAR®); alkyl sulfonates (such as busulfan, improsulfan, and piposulfan); aziridines (benzodopa, carboquone, mesuredopa (m eturedopa, and uredopa; ethyleneimines and methylamelamines (including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimethylomelamine); acetogenins (especially bullatacin and bullatacinone); camptothecins (including the synthetic analog topotecan); bryostatin; kallistatin; CC-1065 (including its synthetic analogs adozelesin, carzelesin, and biceresin); cryptophycins (specifically, cryptophycin 1 and cryptophycin 8); dolastatins; duocarmycins (including synthetic analogs KW-2189 and CB1-TM1); eleutherobin; pancratistatin; sarcodictyin; spongistatin; nitrogen mustards (chlorambucil, chlornaphazine, chlorophosphamide) , estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novoenbiquine, fenesterine, prednimustine, trofosfamide, uracil mustard, etc.; nitrosoureas (such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine); antibiotics (enediyne antibiotics (e.g., calicheamicin, calicheamicin gamma 1I, calicheamicin omega 1I (Angew Chem. Intl. Ed. Engl. (1994) 33:183-186)), etc.); dynemicin, dynemicin A; bisphosphonates (such as clodronate); esperamicin;and neocarzinostatin chromophores and related chromoprotein enediyne antibiotic chromophores), aclacinomycins, actinomycin, autramycin, azaserine, bleomycin, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycin, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins (such as mitomycin C), mycophenolic acid, nogalamycin, olivomycin, peplomycin, porfiromycin, puromycin, queramycin quelamycin, lodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; antimetabolites (such as methotrexate and 5-fluorouracil (5-FU)); folic acid analogs (such as denopterin, methotrexate, pteropterin, trimetrexate); purine analogs (such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine); pyrimidin Amidine analogues (ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, etc.); androgens (calsterone, dromostanolone propionate, epithiostanol, mepitiostane, testolactone, etc.); antiadrenal agents (aminoglutethimide, mitotane, trilostane, etc.); folic acid supplements (folic acid acid, etc.); aceglatone; aldophosphamide glycosides; aminolevulinic acid; eniluracil; amsacrine; bestravcil; bisantrene; edatraxate; defofamine; demecolcine; diaziconazole; elfornithine; elliptinium acetate; epothilone; etoglucide; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids (such as maytansine and ansamitocin);Mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllic acid; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; schizophyllan; spirogermanium; tenuazonic acid; triazicon; 2,2',2''-trichlorotriethylamine; trichothecene (T-2 toxin, verracrin A) A), Roridin A, and Anguidine); Urethane; Vindesine; Dacarbazine; Mannomustine; Mitobronitol; Mitolactol; Pipobroman; Gacytosine; Arabinoside (Ara-C); Cyclophosphamide; Thiotepa; 6-Thioguanine; Mercaptopurine; Methotrexate; Platinum analogues (such as cisplatin and carboplatin); Vinblastine; Etoposide (VP-16); Ifosfamide; Mitoxantrone; Vincristine vinorelbine (NAVELBINE®); novantrone; teniposide; edatrexate; daunomycin; aminopterin; capecitabine (XELODA®, Roche); ibandronate; CPT-11; the topoisomerase inhibitor RFS2000; difluoromethylornithine (DMFO); retinoids (such as retinoic acid); and pharmaceutically acceptable salts, acids, and derivatives of any of the foregoing.

[0275] metabolic disorders In some embodiments, the oligonucleotides described herein can be used to treat metabolic diseases associated with mitochondrial dysfunction, including obesity, diabetes, nonalcoholic steatohepatitis (NASH), and related metabolic syndromes, such as nonalcoholic fatty liver disease (NAFLD), familial hypercholesterolemia, Hunter syndrome, metachromatic leukodystrophy, mitochondrial encephalopathy, lactic acidosis, and porphyria.

[0276] In some embodiments, the metabolic disorder comprises syndromic obesity (such as Prader-Willi (PWS) syndrome and Bardet-Biedl (BBS) syndrome). In some embodiments, the metabolic disorder comprises oligogenic obesity (such as melanocortin 4 receptor (MC4R)-linked obesity) (see Rodriguez-Lopez, Raquel, et al., Current Genomics 23.3(2022):147, which is incorporated herein by reference).

[0277] In some embodiments, the metabolic disorder comprises a disorder of amino acid metabolism (amino acidemia) (such as maple syrup urine disease (MSUD), tyrosinemia, and homocystinuria).

[0278] In some embodiments, metabolic disorders include disorders of organic acid metabolism (organic acidurias, organic acidemias) (such as methylmalonic aciduria, 3-methylglutaconic aciduria-Barth syndrome, glutaric aciduria, 2-hydroxyglutaric aciduria-D and L types, and propionic acidemia).

[0279] In some embodiments, the metabolic disorder comprises a disorder of fatty acid beta-oxidation (such as MCAD deficiency, LCHAD, and VLCAD deficiency).

[0280] In some embodiments, metabolic disorders include disorders of lipid metabolism (lipid storage disorders), such as gangliosidosis (e.g., GM1 gangliosidosis, Tay-Sachs disease, Sandhoff disease), sphingolipidoses (e.g., Fabry disease, Gaucher disease, Niemann-Pick disease, and Krabbe disease), mucolipidoses, and mucopolysaccharidoses.

[0281] In some embodiments, the metabolic disease comprises a mitochondrial disorder, which in some cases leads to muscle damage or muscle wasting. Examples of mitochondrial disorders include mitochondrial cardiomyopathy, Leigh's disease, stroke-like episodes (MELAS), MERRF, NARP, and Barth syndrome.

[0282] In some embodiments, the metabolic disorder comprises a lysosomal storage disorder, in which lysosomal enzymes that break down metabolic waste products are deficient or dysfunctional, leading to the accumulation of toxic substances and resulting in a variety of diseases, such as Hurler syndrome (bone structure abnormalities and developmental delay).

[0283] In some embodiments, the metabolic disease comprises a peroxisomal disease. Similar to lysosomes, peroxisomes are small intracellular spaces filled with enzymes. Functional defects in peroxisome enzymes can lead to the accumulation of toxic metabolic products. Exemplary peroxisomal diseases include Zellweger syndrome (which manifests in infants as abnormal facial features, liver enlargement, and nerve damage), adrenoleukodystrophy (characterized by symptoms of nerve damage that can occur in childhood or early adulthood depending on the form), and Refsum disease.

[0284] In some embodiments, the metabolic disease comprises galactosemia, which results from impaired breakdown of the sugar galactose, leading to jaundice, vomiting, and hepatomegaly by newborns after breastfeeding or formula feeding.

[0285] In some embodiments, the metabolic disease comprises phenylketonuria (PKU), which is caused by a deficiency in the PAH enzyme, resulting in high levels of phenylalanine in the blood, a condition that, if unrecognized and untreated, can result in intellectual disability.

[0286] In some embodiments, metabolic disorders include glycogen storage diseases caused by problems with sugar storage, which leads to low blood sugar levels, muscle pain, and weakness.

[0287] In some embodiments, the metabolic disease includes Friedreich's ataxia, which results from problems with a protein called frataxin, which causes nerve damage and often heart problems. Such diseases usually result in the inability to walk by young adulthood.

[0288] In some embodiments, the metabolic disease comprises a metal metabolism disorder. In the blood, trace metal levels are controlled by special proteins. Inherited metabolic disorders can lead to protein dysfunction and toxic metal accumulation in the body. Examples of metal metabolism disorders include Wilson's disease, in which toxic copper levels accumulate in the liver, brain, and other organs, and hemochromatosis, in which the intestine absorbs excess iron, which accumulates and causes damage to the liver, pancreas, joints, and heart.

[0289] In some embodiments, the metabolic disease comprises a urea cycle disorder (such as ornithine transcarbamylase deficiency and citrullinemia).

[0290] All publications, patent applications, patents, and other references mentioned herein, including GenBank accession numbers, are incorporated by reference in their entirety. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein.

[0291] The present disclosure is further illustrated by the following examples, which are provided for illustrative purposes only and should not be construed as limiting the scope or content of the present disclosure in any way.

[0292] Numbered Embodiments Embodiment 1. An oligonucleotide comprising a sequence complementary to a sequence that differs by no more than one, no more than two, no more than three, or no more than four nucleotides from a target region spanning 8 to 30 contiguous nucleotides of the POLRMT nucleotide sequence.

[0293] Embodiment 2. The oligonucleotide of embodiment 1, wherein the oligonucleotide comprises a sequence complementary to a region spanning 8 to 30 consecutive nucleotides of the POLRMT nucleotide sequence.

[0294] Embodiment 3. The oligonucleotide of embodiment 1 or embodiment 2, wherein the target region spans 15 to 25 contiguous nucleotides of the POLRMT nucleotide sequence.

[0295] Embodiment 4. The oligonucleotide sequence of any one of embodiments 1 to 3, wherein the target region spans 20 consecutive nucleotides of the POLRMT nucleotide sequence.

[0296] Embodiment 5. The oligonucleotide sequence of any one of embodiments 1 to 4, wherein the target region comprises an exon region of the POLRMT nucleotide sequence.

[0297] Embodiment 6. The target region is selected from the group consisting of nucleotides 5696-5715, 8808-8827, 8809-8828, 8811-8830, 16221-16240, 17159-17178, 17314-17333, 17315-17334, 18082-18101, 18083-18102, 18084-18103, 18130-18149, 5680-5699, 8491-8510, 8529-8548, 8569-8588, and 8570 of SEQ ID NO: 1. 6. The oligonucleotide of any one of embodiments 1 to 5, comprising a sequence corresponding to:

[0298] Embodiment 7. An oligonucleotide comprising a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

[0299] Embodiment 8. The oligonucleotide of embodiment 7, wherein the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 3-14, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

[0300] Embodiment 9. The oligonucleotide of embodiment 7 or embodiment 8, wherein the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 3-14, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

[0301] Embodiment 10. The oligonucleotide of any one of embodiments 7 to 9, wherein the oligonucleotide comprises SEQ ID NO: 11.

[0302] Embodiment 11. The oligonucleotide of any one of embodiments 7 to 9, wherein the oligonucleotide comprises SEQ ID NO: 12.

[0303] Embodiment 12. The oligonucleotide of any one of embodiments 7 to 9, wherein the oligonucleotide comprises SEQ ID NO: 594.

[0304] Embodiment 13. The oligonucleotide of any one of embodiments 7 to 9, wherein the oligonucleotide comprises SEQ ID NO: 612.

[0305] Embodiment 14. The oligonucleotide of any one of embodiments 7 to 9, wherein the oligonucleotide comprises SEQ ID NO: 632.

[0306] Embodiment 15. An oligonucleotide comprising a sequence complementary to a sequence at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 15-26, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

[0307] Embodiment 16. The oligonucleotide of embodiment 15, wherein the oligonucleotide comprises a sequence that is at least 90% identical to or complementary to any one of SEQ ID NOs: 15-26, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

[0308] Embodiment 17. The oligonucleotide of embodiment 15 or embodiment 16, wherein the oligonucleotide comprises a sequence complementary to a sequence selected from the group consisting of SEQ ID NOs: 15-26, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

[0309] Embodiment 18. The oligonucleotide of any one of embodiments 15 to 17, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 23.

[0310] Embodiment 19. The oligonucleotide of any one of embodiments 15 to 17, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 24.

[0311] Embodiment 20. The oligonucleotide of any one of embodiments 15 to 17, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 663.

[0312] Embodiment 21. The oligonucleotide of any one of embodiments 15 to 17, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 681.

[0313] Embodiment 22. The oligonucleotide of any one of embodiments 15 to 17, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 701.

[0314] Embodiment 23. An oligonucleotide comprising a sequence complementary to a nucleotide sequence that differs by no more than one, no more than two, no more than three, or no more than four nucleotides from any one of SEQ ID NOs: 3-14, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634, and / or differs by no more than one, no more than two, no more than three, or no more than four nucleotides from any one of SEQ ID NOs: 15-26, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

[0315] Embodiment 24. An oligonucleotide comprising a sequence complementary to a target region spanning 8 to 30 contiguous nucleotides of the mouse POLRMT nucleotide sequence, said sequence differing by no more than 1, no more than 2, no more than 3, or no more than 4 nucleotides.

[0316] Embodiment 25. The oligonucleotide of embodiment 24, wherein the oligonucleotide comprises a sequence complementary to a target region spanning 8 to 30 consecutive nucleotides of the mouse POLRMT nucleotide sequence.

[0317] Embodiment 26 The oligonucleotide of embodiment 24 or embodiment 25, wherein the target region spans 15 to 25 consecutive nucleotides of the mouse POLRMT nucleotide sequence.

[0318] Embodiment 27. The oligonucleotide sequence of any one of embodiments 24 to 26, wherein the target region spans 20 consecutive nucleotides of the mouse POLRMT nucleotide sequence.

[0319] Embodiment 28. The oligonucleotide sequence of any one of embodiments 24 to 27, wherein the target region comprises an exon region of the POLRMT nucleotide sequence.

[0320] Embodiment 29. The oligonucleotide of any one of embodiments 24 to 28, wherein the target region comprises a sequence corresponding to nucleotides 3348 to 3367 or 3198 to 3217 of SEQ ID NO: 581.

[0321] Embodiment 30. An oligonucleotide comprising a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 393-486, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

[0322] Embodiment 31. The oligonucleotide of embodiment 30, wherein the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 393-486, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

[0323] Embodiment 32. The oligonucleotide of embodiment 30 or embodiment 31, wherein the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 393-486, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

[0324] Embodiment 33. The oligonucleotide of any one of embodiments 30 to 32, wherein the oligonucleotide comprises SEQ ID NO: 434.

[0325] Embodiment 34. The oligonucleotide of any one of embodiments 30 to 32, wherein the oligonucleotide comprises SEQ ID NO: 442.

[0326] Embodiment 35. The oligonucleotide of any one of embodiments 30 to 32, wherein the oligonucleotide comprises SEQ ID NO: 594.

[0327] Embodiment 36. The oligonucleotide of any one of embodiments 30 to 32, wherein the oligonucleotide comprises SEQ ID NO: 612.

[0328] Embodiment 37. The oligonucleotide of any one of embodiments 30 to 32, wherein the oligonucleotide comprises SEQ ID NO: 632.

[0329] Embodiment 38. An oligonucleotide comprising a sequence complementary to a sequence at least 80% identical to a sequence selected from the group consisting of SEQ ID NOs: 487-580, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

[0330] Embodiment 39. The oligonucleotide of embodiment 38, wherein the oligonucleotide comprises a sequence that is at least 90% identical to or complementary to any one of SEQ ID NOs: 487-580, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

[0331] Embodiment 40. The oligonucleotide of embodiment 38 or embodiment 39, wherein the oligonucleotide comprises a sequence complementary to a sequence selected from the group consisting of SEQ ID NOs: 487-580, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

[0332] Embodiment 41. The oligonucleotide of any one of embodiments 38 to 40, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 528.

[0333] Embodiment 42. The oligonucleotide of any one of embodiments 38 to 40, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 536.

[0334] Embodiment 43. The oligonucleotide of any one of embodiments 38 to 40, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 663.

[0335] Embodiment 44. The oligonucleotide of any one of embodiments 38 to 40, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 681.

[0336] Embodiment 45. The oligonucleotide of any one of embodiments 38 to 40, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 701.

[0337] Embodiment 46. An oligonucleotide comprising a sequence complementary to a nucleotide sequence that differs by no more than one, no more than two, no more than three, or no more than four nucleotides from any one of SEQ ID NOs: 393-486, 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634, and / or differs by no more than one, no more than two, no more than three, or no more than four nucleotides from any one of SEQ ID NOs: 487-580, 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

[0338] Embodiment 47. The oligonucleotide of any one of embodiments 1 to 46, wherein the oligonucleotide is a chirally pure oligonucleotide.

[0339] Embodiment 48. The oligonucleotide of any one of embodiments 1 to 47, wherein the oligonucleotide comprises at least one modified nucleotide.

[0340] Embodiment 49. The oligonucleotide of embodiment 48, wherein the modified nucleotide comprises a base modification, a sugar modification or a sugar phosphate modification, an internucleotide linkage modification, or a combination thereof.

[0341] Embodiment 50. The oligonucleotide of embodiment 49, wherein the internucleotide linkage modification comprises a phosphorothioate or phosphodithioate linkage modification.

[0342] Embodiment 51. The oligonucleotide of embodiment 49, wherein the sugar modification or the sugar phosphate modification comprises a 2'-O-methoxyethyl (2'-MOE) modification, a 2'-fluoro (2'-F) modification, a 2'-O-methyl (2'-O-Me) modification, a phosphorodiamidate morpholino (PMO) modification, a peptide nucleic acid (PNA) modification, an unlocked nucleic acid (UNA), or a locked nucleic acid (LNA).

[0343] Embodiment 52. The oligonucleotide of embodiment 49, wherein the base modification comprises a 5'-methylcytosine modification or a G-clamp modification.

[0344] Embodiment 53. The oligonucleotide of any one of embodiments 48 to 52, wherein each nucleotide comprises a phosphorothioate (PS) internucleotide linkage.

[0345] Embodiment 54. The oligonucleotide of any one of embodiments 48 to 53, wherein the oligonucleotide comprises five nucleotides at the 5' end and five at the 3' end of the oligonucleotide sequence containing 2'-MOE modifications.

[0346] Embodiment 55. The oligonucleotide of any one of embodiments 48 to 53, wherein each nucleotide contains a 2'-MOE modification.

[0347] Embodiment 56. The oligonucleotide of any one of embodiments 1 to 55, further comprising at least one ligand attached to the 5' end and / or the 3' end.

[0348] Embodiment 57. The oligonucleotide of embodiment 56, wherein the ligand comprises at least one lipid, peptide, and / or sugar.

[0349] Embodiment 58. The oligonucleotide of embodiment 57, wherein the sugar comprises an N-acetylgalactosamine (GalNAc) moiety.

[0350] Embodiment 59. A composition comprising an oligonucleotide according to any one of embodiments 1 to 58, and a carrier and / or pharmaceutical excipient.

[0351] Embodiment 60. An expression vector comprising one or more sequences encoding one or more oligonucleotides according to any one of embodiments 1 to 58.

[0352] Embodiment 61. A method of treating a subject having or at risk of cancer or a metabolic disease, said method comprising administering to said subject a composition comprising an effective amount of an oligonucleotide of any one of embodiments 1 to 58.

[0353] Embodiment 62. The method of embodiment 61, wherein the level of mitochondrial RNA polymerase (POLRMT) mRNA expression or POLRMT protein in the subject or in a biological sample derived from the subject after administration of the composition is reduced compared to the level before administration of the composition.

[0354] Embodiment 63. The method of embodiment 62, wherein the level of POLRMT mRNA expression or the level of POLRMT protein is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% compared to the level before administration.

[0355] Embodiment 64. The method of any one of embodiments 61-63, wherein the composition is administered to the subject intravenously, intrathecally, intramuscularly, orally, intranasally, or subcutaneously.

[0356] Embodiment 65. The method of any one of embodiments 61 to 64, wherein the subject is a human.

[0357] Embodiment 66. A method for treating and / or preventing cancer or a metabolic disease in a subject, comprising administering to the subject an oligonucleotide complementary to a target region of a nucleic acid sequence encoding POLRMT.

[0358] Embodiment 67. A method of reducing mitochondrial transcription in a subject susceptible to or suffering from cancer or a metabolic disease, said method comprising administering to said subject an oligonucleotide complementary to a target region of a nucleic acid sequence encoding POLRMT.

[0359] Embodiment 68. The method of embodiment 66 or embodiment 67, wherein the nucleic acid sequence encoding POLRMT comprises SEQ ID NO: 205.

[0360] Embodiment 69. The method of any one of embodiments 66 to 68, wherein the target region comprises a region spanning 8 to 30 consecutive nucleotides within SEQ ID NO: 205.

[0361] Embodiment 70. The target region is selected from the group consisting of nucleotides 5696 to 5715, 8808 to 8827, 8809 to 8828, 8811 to 8830, 16221 to 16240, 17159 to 17178, 17314 to 17333, 17315 to 17334, 18082 to 18101, 18083 to 18102, 18084 to 18103, 18130 to 18149, 5680 to 5699, 8491 to 8510, 8529 to 8548, 8569 to 8588, 8591 to 8599, 8601 to 8602, 8603 to 8604, 8605 to 8606, 8607 to 8608, 8609 to 8610, 8611 to 8612, 8613 to 8614, 8615 to 8616, 8617 to 8618, 8619 to 8620, 8621 to 8622, 8623 to 8624, 8625 to 8626, 8627 to 8628, 8629 to 8630, 8631 to 8632, 8633 to 8634, 8635 to 8636, 8637 to 8638, 8639 to 8640, 8641 to 8642, 8643 to 8644, 8645 to 86 70. The method of any one of embodiments 66-69, comprising a sequence corresponding to 570-8589, 8571-8590, 8572-8591, 8573-8592, 8574-8593, 13322-13341, 13719-13738, 14999-15018, 15092-15111, 15093-15112, 17304-17323, 19309-19328, 20041-20060, 20042-20061, or 21102-21121.

[0362] Embodiment 71. The method of any one of embodiments 66 to 70, wherein the oligonucleotide comprises a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 3 to 14.

[0363] Embodiment 72. The method of any one of embodiments 66 to 71, wherein the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 3 to 14.

[0364] Embodiment 73. The method of any one of embodiments 66 to 72, wherein the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 3 to 14.

[0365] Embodiment 74. The method of any one of embodiments 66 to 73, wherein upon administration of the oligonucleotide to the subject, the level of POLRMT mRNA expression in the subject is reduced.

[0366] Embodiment 75. The method of any one of embodiments 66 to 74, wherein upon administration of the oligonucleotide to the subject, the level of POLRMT protein or POLRMT activity in the subject is reduced.

[0367] Embodiment 76. The method of embodiment 74 or embodiment 75, wherein the level of POLRMT mRNA expression, the level of POLRMT protein, or the level of POLRMT activity is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% compared to the level before administration.

[0368] Embodiment 77. The method of any one of embodiments 66 to 76, wherein the subject is a human.

[0369] Embodiment 78. The method of any one of embodiments 66-77, wherein the metabolic disease comprises obesity, diabetes, nonalcoholic steatohepatitis (NASH), a disorder of amino acid metabolism (amino acidemia), a disorder of organic acid metabolism (organic aciduria, organic acidemia), a disorder of lipid metabolism (lipid storage disorder), a lysosomal storage disorder, a peroxisomal disease, phenylketonuria (PKU), a glycogen storage disease, or a urea cycle disorder.

[0370] Embodiment 79. The method of any one of embodiments 66 to 78, wherein the composition is delivered to the liver.

[0371] Embodiment 80. The method of any one of embodiments 66 to 78, wherein the composition is delivered to a muscle.

[0372] Embodiment 81. The method of any one of embodiments 66 to 78, wherein the composition is delivered to the CNS.

[0373] Embodiment 82. The method of any one of embodiments 66 to 78, wherein the composition is delivered to the cerebrospinal fluid.

[0374] Embodiment 83. A pharmaceutical composition comprising an oligonucleotide according to any one of embodiments 1 to 58.

[0375] Embodiment 84. The pharmaceutical composition of embodiment 83, wherein the pharmaceutical composition comprises a pharmaceutically acceptable carrier.

[0376] Embodiment 85. The pharmaceutical composition of embodiment 83 or embodiment 84, wherein the oligonucleotide is formulated in a nanocarrier.

[0377] Embodiment 86. The pharmaceutical composition of any one of embodiments 83 to 85, wherein the oligonucleotide is formulated in a lipid nanoparticle (LNP).

[0378] Embodiment 87. A pharmaceutical composition according to any one of embodiments 83 to 86, wherein the oligonucleotide is conjugated to at least one GalNAc moiety.

[0379] Embodiment 88. The pharmaceutical composition of any one of embodiments 83 to 87, wherein the composition is formulated for systemic or local administration.

[0380] Embodiment 89. The pharmaceutical composition of any one of embodiments 83 to 88, wherein the composition is formulated for a delivery route selected from intrathecal administration, intramuscular administration, or intravenous administration.

[0381] Embodiment 90. A method of reducing or inhibiting POLRMT expression in a cell, said method comprising contacting said cell with an oligonucleotide of any one of embodiments 1 to 58.

[0382] Embodiment 91. The method of embodiment 90, wherein the level of POLRMT mRNA expression, the level of POLRMT protein, or the level of POLRMT activity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the level before the cells were contacted with the oligonucleotide.

[0383] Embodiment 92 The method of embodiment 90 or embodiment 91, wherein the cell is present in a subject.

[0384] Embodiment 93 The method of embodiment 92, wherein the subject is a human.

[0385] Embodiment 94 The method of embodiment 93, wherein the human is suffering from or susceptible to cancer or a metabolic disorder. [Example]

[0386] Example 1: Knockdown of POLRMT and CytB expression in HeLa cells This example illustrates the design and generation of exemplary antisense oligonucleotides (ASOs) that target POLRMT RNA transcripts and are capable of altering POLRMT mRNA expression in HeLa cells.

[0387] POLRMT is a mitochondrial DNA-dependent RNA polymerase essential for the transcription of circular mammalian mitochondrial DNA (mtDNA).

[0388] To determine whether the ASOs described in this example could attenuate mtDNA transcription (via knockdown of POLRMT expression), we also measured the expression of the mitochondrial protein cytochrome B (CytB).

[0389] ASO ASOs were designed and synthesized to target different regions of the POLRMT RNA transcript. These ASOs are characterized by the corresponding regions of the POLRMT gene sequence (reference number NG_023049.1 and represented in SEQ ID NO: 1). The ASOs were designed using two different strategies.

[0390] In the first strategy, ASOs were designed using the software program LNCASO (https: / / iomics.ugent.be / pjdev / design) by analyzing the longest POLRMT transcript (represented by sequence reference number ENST00000588649.7 and SEQ ID NO: 205). The length of the oligonucleotides was set to 19 nucleotides. In the second strategy, additional ASOs were designed using the software program PFRED (https: / / github.com / pfred / pfred-gui / releases / tag / v1.0). For the PFRED program, the length of the oligonucleotides was set to 20 nucleotides, and the number of mismatches was set to 1. Genes based on ENSG IDs were searched, and the longest POLRMT transcript (represented by sequence reference number ENST00000588649.7 and SEQ ID NO: 205) was selected as the primary target. Oligos with more than one mismatch in both the cDNA and unspliced ​​mRNA were filtered out. SVMpred was set to >0.5 and PLSpred_optimized was set to >0.8.

[0391] Table 5 below provides an exemplary ASO sequence, the targeted POLRMT sequence (target region), a description of the target region, and the coordinates of the target region within the POLRMT gene sequence (SEQ ID NO: 1). [Table 5-1] [Table 5-2]

[0392] Synthesis of ASO An exemplary ASO was synthesized using a phosphoramidite synthesis method that begins with the 3'-most nucleotide and proceeds through multiple cycles of the following steps: deprotection (removal of the trityl group from the 5' carbon with trichloroacetic acid (TCA) to provide a reactive hydroxyl group for the next base to be added), coupling (tetrazole activation is used to generate an intermediate that reacts with the hydroxyl group), capping (acetylation reagent is added to react with the free hydroxyl group of the unsuccessfully coupled oligonucleotide), and stabilization (iodine and water are added to oxidize the phosphite to a phosphate, resulting in a stabilized phosphotriester linkage) until the 5'-most nucleotide is added. When phosphorothioate linkages are generated in exemplary ASOs, a sulfurizing agent is used in place of iodine / water in the stabilization step, such as dibenzyl tetrasulfide, Beaucage reagent (3H-1,2-benzodithiol-3-one 1,1-dioxide), 3-ethoxy-1,2,4-dithiazolidin-5-one (EDITH), 1,2,4-dithiazolidine-3,5-dione (DtsNH), or 3-amino-1,2,4-dithiazole-5-thione.

[0393] The trityl group was removed from the completed synthesis, liberating it from the CPG and leaving hydroxyl groups at both the 3' and 5' ends. The oligos were deprotected using ammonium hydroxide to promote base hydrolysis. Residual contaminants were removed via desalting. The oligonucleotides were purified via PAGE or HPLC. Quality was confirmed using mass spectrometry (using either matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) or electrospray ionization (ESI)) (see https: / / eu.idtdna.com / pages / products / functional-genomics / antisense-oligos).

[0394] In this experiment, modifications were included in the ASO, including the following modification patterns:

[0395] X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS

[0396] where "X" represents any nucleotide, "M" represents a 2'-O-MOE group, and "S" represents a phosphorothioate bond. Figure 3 shows an exemplary ASO with such a modification pattern.

[0397] ASO transfection Human HeLa cells (ATCC CCL-2) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C under 5% (v / v) CO .

[0398] To 8 μL of DharmaFECT1 (horizondiscovery, T-2001-02) and 1 ml of Opti-MEM medium (Thermo Fisher Scientific, catalog number 11058021), 6 or 12 μl of each ASO (100 μM) was added and mixed well. ASOs were tested at two final concentrations (100 nM and 200 nM). The mixture was incubated at room temperature for 15 minutes. 5 × 10 4 5 mL of HeLa cells (cells / mL) were added to the mixture and mixed well. The cell and ASO mixture was seeded into 6-well plates (2 mL per well) and grown for 3 days.

[0399] RT-PCR protocol The following RT-PCR protocol was performed. 1. Transfer the cells to an Eppendorf tube and pellet the cells by centrifugation at 500g for 5 minutes, removing any remaining medium. Wash the cell pellet with 1x phosphate-buffered saline (PBS). Add 1 mL of Trizol solution (Thermo Fisher Scientific, catalog number 15596026) to the HeLa cell pellet. Resuspend the cells thoroughly by vortexing. 2. Incubate the tube at room temperature for 5 minutes. 3. Add 200 μl of chloroform. Vortex for 10 seconds. 4. Incubate at room temperature for 5 minutes to dissociate nuclear proteins. 5. Centrifuge the tube at 2,000 x g and 4 °C for 15 minutes. 6. Transfer the upper phase to a new microcentrifuge tube without disturbing the intermediate phase. 7. Add 500 μL of isopropanol to the sample, mix by inverting 5 times, and incubate at -20°C for 30 minutes. 8. Centrifuge at least 12,000 x g for 15 minutes at 4°C and remove the supernatant. The RNA will appear in the tube as a white pellet. 9. Wash the pellet with 500 μL of ice-cold 75% ethanol (prepared with deionized, diethylpyrocarbonate (DEPC)-treated, 0.22 μm membrane-filtered H2O). 10. Remove the ethanol, air dry at room temperature for 5 minutes (do not dry the RNA completely), and resuspend the RNA in 100 μL of DEPC-H2O. Incubate 5 μg of RNA with 11.1 units of turbo DNase (TURBO DNA-free Kit, Thermo Fisher Scientific, Cat. No. AM1907) for 15 minutes at room temperature and terminate the reaction according to the manufacturer's instructions. 12. Purify RNA using Quick-RNA miniprep kit (ZYMO, Cat. No. R1055). Reverse transcription is performed using 13.1 μg of RNA and the iScript cDNA synthesis kit (Biorad, 170-8891). 14. Dilute 20 μl of cDNA with H2O to a final volume of 200 μl. At this point, the cDNA is ready for PCR quantification.

[0400] Expression of the POLRMT, CytB, and 18S rRNA genes was detected using iTaq Universal SYBR Green Supermix (Bio-Rad, catalog number 1725121) with primers ordered from Eurofins genomics (shown in Table 6 below). Quantification was performed using a Biorad CFX96 PCR system. The reaction mixture in each well contained 1 μL of forward primer (concentration 5 μM) and 1 μL of reverse primer (concentration 5 μM), 2 μL of cDNA, 9.5 μL of HO, and 12.5 μL of SYBR supermix. [Table 6]

[0401] Results - POLRMT expression Figure 4 shows POLRMT expression in HeLa cells transfected with exemplary ASOs. A scrambled ASO (with no perfect match to any human transcript) was used as a control. POLRMT siRNA (Horizon Discovery catalog ID: L-012004-01-0005, smartpool format) was used as a positive control. All results were normalized by 18S expression.

[0402] Of the ASOs tested at a concentration of 100 nM (i.e., ASOs represented by SEQ ID NOS: 3-14), all ASO sequences except SEQ ID NOS: 5 showed a relative decrease in POLRMT expression at 100 nM (data not shown). SEQ ID NOS: 9 and 10 showed cytotoxic activity, so no data were obtained.

[0403] The results in Figure 4 show that the ASOs represented by SEQ ID NOS: 3-8, 13-14, 28-30, 32-37, and 39-43 showed some inhibition of POLRMT expression (reduced expression compared to the control). The ASOs represented by SEQ ID NOS: 11 and 12 showed excellent inhibition of POLRMT expression at 200 nM. The ASOs represented by SEQ ID NOS: 9, 10, and 27 showed no cytotoxic activity, and therefore no data were obtained.

[0404] These results indicate that the inhibitory activity of ASOs depends on the region of the POLRMT transcript that they target.

[0405] Results – CytB expression In addition to knocking down POLRMT expression, we also measured the expression of CytB in transfected HeLa cells.

[0406] POLRMT is a mitochondrial DNA-dependent RNA polymerase essential for transcription of circular mammalian mitochondrial DNA (mtDNA). To determine whether the ASO described in this example can attenuate mtDNA transcription (via knockdown of POLRMT expression), we measured the expression of the mitochondrial protein cytochrome B (CytB) in ASO-transfected HeLa cells.

[0407] Figure 5 shows CytB expression in HeLa cells transfected with exemplary ASOs. The same controls were used in this screen. All results were normalized by 18S expression.

[0408] The results in Figure 5 show that POLRMT-targeting ASOs that were able to knock down POLRMT mRNA expression also reduced CytB expression in all ASOs except for the ASO represented by SEQ ID NO: 14, which caused a slight increase. These results indicate that knocking down POLRMT expression leads to a decrease in POLRMT activity (i.e., transcription of CytB mtDNA). No data were obtained from the ASOs represented by SEQ ID NOs: 9 and 10 due to cytotoxicity.

[0409] Example 2: Design and modification of additional POLRMT ASO sequences This example illustrates the design of additional exemplary antisense oligonucleotides (ASOs) that target POLRMT RNA.

[0410] ASOs were designed using two different strategies. In the first strategy, the software program LNCASO (https: / / iomics.ugent.be / pjdev / design) was used to design ASOs by analyzing the longest POLRMT transcript (reference number ENST00000588649 and represented by SEQ ID NO: 205). The length of the oligos was set to 19 nucleotides. Table 7 below shows the ASOs designed using this strategy.

[0411] In the second strategy, additional ASOs were designed using the software program PFRED (https: / / github.com / pfred / pfred-gui / releases / tag / v1.0). For the PFRED program, the oligo length was set to 20 nucleotides and the number of mismatches was set to 1. Genes based on ENSG ID were searched to obtain the longest POLRMT transcript (reference number ENST00000588649 and represented by SEQ ID NO: 205). Oligos with more than one mismatch in both the cDNA and unspliced ​​mRNA were filtered out. SVMpred was set to >0.5, and PLSpred_optimized was set to >0.7 or >0.8. Table 8 below shows the ASOs designed using this strategy. [Table 7] [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6] [Table 8-7] [Table 8-8]

[0412] Synthesis of ASO Synthesize an exemplary ASO according to the methods described in Example 1 (see https: / / eu.idtdna.com / pages / products / functional-genomics / antisense-oligos).

[0413] The ASO contains the following modification patterns:

[0414] X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS

[0415] In the formula, "X" represents any nucleotide, "M" represents a 2'-O-MOE group, and "S" represents a phosphorothioate bond.

[0416] ASO transfection Human HeLa cells (ATCC CCL-2) are grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C under 5% (v / v) CO .

[0417] Add 6 or 12 μl of each ASO (100 μM) to 8 μL of DharmaFECT 1 (horizondiscovery, T-2001-02) and 1 ml of Opti-MEM medium (Thermo Fisher Scientific, Catalog No. 11058021) and mix thoroughly (to achieve final ASO concentrations of 100 nM and 200 nM). Incubate the mixture at room temperature for 15 minutes. 5 × 10 4 5 mL of HeLa cells at 100 / mL are added to the mixture and mixed well. The cell and ASO mixture is seeded into 6-well plates (2 mL per well) and grown for 3 days.

[0418] RT-PCR protocol The RT-PCR protocol is carried out according to Example 1 to measure the relative POLRMT mRNA expression levels.

[0419] Example 3: Design and modification of additional POLRMT ASO sequences This example illustrates the design of additional exemplary mouse antisense oligonucleotides (ASOs) that target mouse POLRMT RNA.

[0420] ASOs were designed using the software program PFRED (https: / / github.com / pfred / pfred-gui / releases / tag / v1.0). For the PFRED program, the oligo length was set to 20 nucleotides and the number of mismatches was set to 1. Genes based on ENSG ID were searched to obtain the longest mouse POLRMT transcript (represented by reference number ENSMUST00000161765; SEQ ID NO: 582). Oligos with more than one mismatch in both the cDNA and unspliced ​​mRNA were filtered out. SVMpred was set to >0.6, and PLSpred_optimized was set to >0.8.

[0421] Table 9 below shows an exemplary mouse ASO sequence, the targeted POLRMT sequence (target region), a description of the target region, and the coordinates of the target region within the mouse POLRMT gene sequence (sequence number 581). [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5] [Table 9-6]

[0422] Synthesis of ASO Exemplary ASOs were synthesized according to the methods described in Example 1 (see https: / / eu.idtdna.com / pages / products / functional-genomics / antisense-oligos).

[0423] The ASO contained the following modification patterns:

[0424] X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS

[0425] In the formula, "X" represents any nucleotide, "M" represents a 2'-O-MOE group, and "S" represents a phosphorothioate bond.

[0426] ASO transfection Mouse 3T3 cells (ATCC CRL-1658) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C under 5% (v / v) CO .

[0427] To 8 μL of DharmaFECT1 (horizondiscovery, T-2001-02) and 1 ml of Opti-MEM medium (Thermo Fisher Scientific, catalog number 11058021), 1.8 or 6 μl of each ASO (100 μM) was added and mixed well. ASOs were tested at two final concentrations (100 nM and 30 nM). The mixture was incubated at room temperature for 15 minutes. 5 × 10 4 5 mL of 3T3 cells / mL was added to the mixture and mixed well. The cell and ASO mixture was seeded into 6-well plates (2 mL per well) and grown for 1 day.

[0428] RT-PCR protocol The following RT-PCR protocol was performed. 1. Transfer the 3T3 cells to an Eppendorf tube and pellet the cells by centrifugation at 500g for 5 minutes, then remove any remaining medium. Wash the cell pellet with 1x phosphate-buffered saline (PBS). Add 1 mL of Trizol solution (Thermo Fisher Scientific, catalog number 15596026) to the 3T3 cell pellet. Vortex to thoroughly resuspend the cells. 2. Incubate the tube at room temperature for 5 minutes. 3. Add 200 μl of chloroform. Vortex for 10 seconds. 4. Incubate at room temperature for 5 minutes to dissociate nuclear proteins. 5. Centrifuge the tube at 2,000 x g and 4 °C for 15 minutes. 6. Transfer the upper phase to a new microcentrifuge tube without disturbing the intermediate phase. 7. Add 500 μL of isopropanol to the sample, mix by inverting 5 times, and incubate at -20°C for 30 minutes. 8. Centrifuge at least 12,000 x g for 15 minutes at 4°C and remove the supernatant. The RNA will appear in the tube as a white pellet. 9. Wash the pellet with 500 μL of ice-cold 75% ethanol (prepared with deionized, diethylpyrocarbonate (DEPC)-treated, 0.22 μm membrane-filtered H2O). 10. Remove the ethanol, air dry at room temperature for 5 minutes (do not dry the RNA completely), and resuspend the RNA in 100 μL of DEPC-H2O. Incubate 5 μg of RNA with 11.1 units of turbo DNase (TURBO DNA-free Kit, Thermo Fisher Scientific, Cat. No. AM1907) for 15 minutes at room temperature and terminate the reaction according to the manufacturer's instructions. 12. Purify RNA using Quick-RNA miniprep kit (ZYMO, Cat. No. R1055). Reverse transcription is performed using 13.1 μg of RNA and the iScript cDNA synthesis kit (Biorad, 170-8891). 14. Dilute 20 μl of cDNA with H2O to a final volume of 200 μl. At this point, the cDNA is ready for PCR quantification.

[0429] Expression of mouse POLRMT and mouse 18S rRNA genes was detected using iTaq Universal SYBR Green Supermix (Bio-Rad, catalog number 1725121) with primers ordered from Eurofins genomics (shown in Table 10 below). Quantification was performed using a Biorad CFX96 PCR system. The reaction mixture in each well contained 1 μL of forward primer (concentration 5 μM) and 1 μL of reverse primer (concentration 5 μM), 2 μL of cDNA, 9.5 μL of HO, and 12.5 μL of SYBR supermix. [Table 10]

[0430] Results - POLRMT expression Figures 6-9 and 10-11 show POLRMT expression in 3T3 cells transfected with 100 nM and 30 nM of the exemplary ASO, respectively. A scrambled ASO (with no perfect match to any mouse transcript) was used as a control in each PCR plate. All results were normalized by 18S expression.

[0431] Of the ASOs tested at a concentration of 100 nM (i.e., ASOs represented by SEQ ID NOs: 393-486), all ASOs showed some inhibition of POLRMT expression (i.e., decreased expression compared to the control). The ASOs represented by SEQ ID NOs: 396, 398, 400, 402, 404-407, 418, 419, 424, 430, 434, 442, 449, 462, 472, 480, and 481 showed strong inhibition of POLRMT expression at 100 nM.

[0432] Of the ASOs tested at a concentration of 30 nM (i.e., ASOs represented by SEQ ID NOs: 422-479), all ASOs showed some inhibition of POLRMT expression (i.e., decreased expression compared to the control). ASOs represented by SEQ ID NOs: 422, 425, 432-434, 442-444, 446, 458-461, 464, 466, 468, 470, 471, and 477 showed strong inhibition of POLRMT expression at 30 nM. ASOs represented by SEQ ID NOs: 434 and 442 showed strong inhibition of POLRMT expression at both 100 nM and 30 nM concentrations.

[0433] These results indicate that targeting specific regions of mouse POLRMT with ASOs leads to different inhibitory activities.

[0434] Example 4: Design and testing of exemplary cross-reactive oligonucleotides in humans and mice This example demonstrates exemplary oligonucleotides capable of inhibiting POLRMT expression in mouse and human cells and identifies regions within the POLRMT transcript that are effective in inhibiting POLRMT expression when targeted by the oligonucleotides described herein.

[0435] Oligonucleotides Oligonucleotides were designed and synthesized to target different regions of the POLRMT RNA transcript (SEQ ID NO: 205). Target regions on the POLRMT mRNA transcript are characterized by corresponding regions within the POLRMT gene sequence (reference number NG_023049.1 and represented by SEQ ID NO: 1). Oligonucleotides were designed by selecting 16-mers, 18-mers, and 20-mers that target various regions of human POLRMT.

[0436] Table 11 below shows exemplary oligonucleotide sequences, POLRMT target region sequences within the POLRMT RNA transcript. [Table 11-1] [Table 11-2]

[0437] A subset of oligonucleotides with target region sequences identical to the corresponding regions on the mouse POLRMT transcript were selected for testing in human 143B cells and mouse 3T3 cells. Figure 12 and Table 12 below show a schematic diagram of the 13 selected oligonucleotide sequences and their respective target regions on the POLRMT transcript. [Table 12]

[0438] Oligonucleotide synthesis Exemplary oligonucleotides were synthesized according to the methods described in Example 1 (see https: / / eu.idtdna.com / pages / products / functional-genomics / antisense-oligos).

[0439] The oligonucleotides contain the following modification patterns: X MS X MS X MS X MS X MS X S X S X S X S X S X S X S X S X S X S X MS X MS X MS X MS X MS (for 20-mer) and X MS X MS X MS X MS X MS X S X S XS X S X S X S X S X S X MS X MS X MS X MS X MS (for 18-month olds)

[0440] In the formula, "X" represents any nucleotide, "M" represents a 2'-O-MOE group, and "S" represents a phosphorothioate bond. Table 13: Exemplary modified oligonucleotides (where "s" represents a phosphorothioate linkage and "M" represents a 2'-O-MOE group) [Table 13]

[0441] (i) Dose response in human 143B and mouse 3T3 cells Oligonucleotide transfection Human 143B cells (ATCC No. 8303) and mouse 3T3 cells (ATCC No. 1658) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C under 5% (v / v) CO .

[0442] Each modified oligonucleotide was added to DharmaFECT 1 (horizondiscovery, T-2001-02) and Opti-MEM medium (Thermo Fisher Scientific, catalog number 11058021) and mixed thoroughly to a final ASO concentration of 100 nM. A serial dilution (1:2) was performed for each oligonucleotide, resulting in a total of seven concentrations of each oligonucleotide to be tested in each cell type (100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM, and 1.5625 nM). The mixture was incubated at room temperature for 15 minutes. 143B cells at 5 x 104 cells / mL or 3T3 cells at 4 x 104 cells / mL were added to the oligo / DharmaFECT / medium mixture and mixed thoroughly.

[0443] Cells were then seeded into 6-well plates and grown for 1 day. Cells were harvested for RT-PCR to assess POLRMT expression and cell viability using Celltiter fluor (Promega catalog number G6080).

[0444] RT-PCR protocol The RT-PCR protocol is performed to measure relative POLRMT mRNA expression levels according to Example 1. Expression is shown relative to vehicle control.

[0445] result Figure 13 (for modified oligonucleotides having unmodified base sequences represented by SEQ ID NOs: 612, 613, 623, 624, 632, 633, and 634) and Figure 14 (for modified oligonucleotides having unmodified base sequences represented by SEQ ID NOs: 592, 594, 597, 598, 625, and 626) show POLRMT expression in both mouse 3T3 cells and human 143B cells transfected with each modified oligonucleotide. The results show that for each oligonucleotide tested, POLRMT expression was inhibited in a dose-dependent manner, confirming that the selected oligonucleotides are indeed cross-reactive in human and mouse cells (i.e., can target mouse and human POLRMT transcripts and are capable of POLRMT knockdown in mouse and human cells).

[0446] Furthermore, panels (B) and (D) of Figure 14 and panels (B) and (D) of Figure 15 show that cells transfected with the oligonucleotides remained viable.

[0447] (ii) Toxicity in HepG2 and 3T3 cells Oligonucleotide transfection HepG2 cells (ATCC no. HB-8065) ​​and mouse 3T3 cells (ATCC no. 1658) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C under 5% (v / v) CO .

[0448] The modified oligonucleotide was added to DharmaFECT 1 (horizondiscovery, T-2001-02) and Opti-MEM medium (Thermo Fisher Scientific, catalog number 11058021), mixed well, and incubated at room temperature for 15 minutes. After incubation, the mixture was diluted to 1 × 10 5 cells / mL HepG2 cells or 4 x 10 4 The oligonucleotides were added to 3T3 cells at 100 nM / mL to give a final concentration of 100 nM. Two scrambled ASOs and a vehicle treatment were used as controls.

[0449] Cells were seeded into 96-well plates on day 1, oligonucleotides were transfected into cells on day 2, and cell viability and RT-qPCR were performed on day 3.

[0450] Caspase-Glo3 / 7 assay To assess the in vitro toxicity of exemplary oligonucleotides to HepG2 and 3T3 cells, a caspase-Glo3 / 7 assay was performed (Promega catalog number G8090).

[0451] (iii) Activity in HepG2 cells Transfection of oligonucleotides in HepG2 HepG2 cells (ATCC number HB-8065) ​​were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37°C under 5% (v / v) CO .

[0452] The modified oligonucleotide was added to DharmaFECT 1 (horizondiscovery, T-2001-02) and Opti-MEM medium (Thermo Fisher Scientific, catalog number 11058021), mixed well, and incubated at room temperature for 15 minutes. After incubation, the mixture was diluted to 1 × 10 5 The oligonucleotide was added to HepG2 cells at a final concentration of 100 nM.

[0453] Cells and oligonucleotide mixtures were seeded into 6-well plates and grown for 1 day, after which cells were harvested for RT-PCR to measure PORLMT expression or to assess cell viability as measured using Celltiter fluor (Promega catalog number G6080).

[0454] RT-PCR protocol The RT-PCR protocol is carried out according to Example 1 to measure the relative POLRMT mRNA expression levels.

[0455] result Table 14 below shows the results obtained from the expression and toxicity assays. Exemplary modified oligonucleotides having the nucleotide sequences represented by SEQ ID NOs: 592, 594, 612, 623, 625, 626, and 632 were well tolerated and exhibited low toxicity in HepG2 cells and mouse 3T3 cells (see Figures 15 and 16, panel B). Exemplary modified oligonucleotides having the nucleotide sequences represented by SEQ ID NOs: 594, 612, and 632 exhibited the best inhibition of POLRMT expression in HepG2 cells (see Table 12 and Figure 16, panel A), and also exhibited low toxicity in HepG2 cells and mouse 3T3 cells (see Figures 15 and 16, panel B).

[0456] This data suggested the presence of three potential "hotspot" regions along the POLRMT transcript that could be targeted to inhibit POLRMT expression. These regions were identified within exons represented by Ensemble IDs ENSE00000655271, ENSE00000655279, and ENSE00000655283. The hotspot regions include nucleotide intervals within the PORLMT human and mouse transcripts that contain SEQ ID NO: 725 [CAACGCCGTGATGCTTGGCTGGGCGCGGC] ("hotspot 1"), SEQ ID NO: 726 [CGCACAACATGGACTTCCGCGGCCGCACCTAC] ("hotspot 2"), and SEQ ID NO: 727 [ATCACCCGCAAGGTGGTGAAGCAGACGGTGA] ("hotspot 3"). The first, second, and third hotspot regions correspond to positions 817-845, 2415-2446, and 2978-3008 of the human PORLMT mRNA transcript (SEQ ID NO: 205), and positions 729-756, 2324-2355, and 3235-3265 of the mouse PORLMT transcript (SEQ ID NO: 581), respectively. Furthermore, the most effective oligonucleotides targeting these regions were of various lengths (18 and 20 nucleotides). [Table 14] Exemplary Sequences Wild-type human POLRMT gene sequence (corresponding to the entire POLRMT gene) (NCBI accession number: NG_023049.1) (SEQ ID NO: 1) The protein sequence of wild-type human POLRMT is as follows (1230 amino acids): [ka] Human POLRMT, mRNA; nuclear gene for mitochondrial product. (RefSeq NM_005035) Reference number ENST00000588649.7 (SEQ ID NO: 205) Wild-type mouse POLRMT gene sequence (corresponding to mouse 10 dna_chromosome chromosome_GRCm39_10_79571957_79582415) (SEQ ID NO: 581) Mouse POLRMT transcript ENSMUST00000161765.8 Polrmt-210 cdna (SEQ ID NO: 582) Table 15-1 Table 15-2 Table 15-3 Table 15-4 Table 15-5 Table 15-6 Table 15-7 Table 15-8 Table 15-9 Table 16-1 Table 16-2 Table 16-3 Table 16-4 Table 16-5 Table 16-6 Table 16-7 Table 16-8 [Table 16-9]

[0457] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. It is not intended that the scope of the invention be limited to the above Description, but rather is set forth in the appended claims.

Claims

1. POLRMT An oligonucleotide comprising a sequence substantially complementary to 8 to 30 consecutive nucleotides of an RNA transcript.

2. 2. The oligonucleotide of claim 1, wherein the oligonucleotide comprises a sequence that is at least 85%, at least 90%, or at least 95% complementary to 8 to 30 consecutive nucleotides of a POLRMT RNA transcript.

3. The oligonucleotide of claim 1, wherein the oligonucleotide comprises a sequence that is completely complementary to 8 to 30 consecutive nucleotides of a POLRMT RNA transcript.

4. 2. The oligonucleotide of claim 1, wherein the 8 to 30 consecutive nucleotides is 15 to 25 consecutive nucleotides.

5. The oligonucleotide of claim 1, wherein the oligonucleotide is 8 to 30 nucleotides in length.

6. The oligonucleotide of claim 1, wherein the oligonucleotide is 18 to 22 nucleotides in length.

7. The oligonucleotide of claim 1 , wherein the oligonucleotide is 20 nucleotides in length.

8. The oligonucleotide of claim 1 , wherein the PORLMT RNA transcript is a human PORLMT RNA transcript.

9. The oligonucleotide of claim 8 , wherein the human POLRMT RNA transcript comprises SEQ ID NO:

205.

10. 2. The oligonucleotide of claim 1, wherein the 8 to 30 contiguous nucleotides are within or include an exon region of the POLRMT RNA transcript.

11. 11. The oligonucleotide of claim 10, wherein the exon comprises an exon identified in any one of Ensemble ID numbers: ENSE00000655271, ENSE00000655279, and ENSE00000655283.

12. 12. The oligonucleotide of claim 11, wherein the oligonucleotide is complementary to 16 to 20 consecutive nucleotides of a sequence corresponding to nucleotides 817 to 845, 2415 to 2446, or 2978 to 3008 of SEQ ID NO:205 (i.e., the nucleotide sequence set forth in SEQ ID NO:725, 726, or 727).

13. 2. The oligonucleotide of claim 1, wherein the 8 to 30 contiguous nucleotides comprise a sequence corresponding to nucleotides 2420-2439, 2422-2441, 2983-3002, 2984-3003, 822-839, 823-840, 2421-2438, 2422-2439, 2423-2440, 2424-2441, 2984-3001, 2985-3002, or 2986-3003 of SEQ ID NO:

205.

14. An oligonucleotide comprising a sequence having at least 80% identity to a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

15. 15. The oligonucleotide of claim 14, wherein the oligonucleotide comprises a sequence having at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

16. 15. The oligonucleotide of claim 14, wherein the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 592, 594, 597, 598, 612, 613, 623, 624, 625, 626, 632, 633, and 634.

17. The oligonucleotide of claim 14, wherein the oligonucleotide comprises SEQ ID NO:

594.

18. The oligonucleotide of claim 14, wherein the oligonucleotide comprises SEQ ID NO:

612.

19. The oligonucleotide of claim 14, wherein the oligonucleotide comprises SEQ ID NO:

632.

20. An oligonucleotide comprising a sequence substantially complementary to a sequence selected from the group consisting of SEQ ID NOs: 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

21. 21. The oligonucleotide of claim 20, wherein the oligonucleotide is at least 85%, at least 90%, or at least 95% complementary to a sequence selected from the group consisting of SEQ ID NOs: 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

22. 21. The oligonucleotide of claim 20, wherein the oligonucleotide is perfectly complementary to a sequence selected from the group consisting of SEQ ID NOs: 661, 663, 666, 667, 681, 682, 692, 693, 694, 695, 701, 702, and 703.

23. 23. The oligonucleotide of claim 22, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO:

663.

24. 23. The oligonucleotide of claim 22, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO:

681.

25. 23. The oligonucleotide of claim 22, wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO:

701.

26. The oligonucleotide of claim 1 , wherein the oligonucleotide is a chirally pure oligonucleotide.

27. The oligonucleotide of claim 1 , wherein the oligonucleotide comprises at least one modified nucleotide.

28. 28. The oligonucleotide of claim 27, wherein the modified nucleotide comprises a base modification, a sugar modification, a sugar phosphate modification, an internucleotide linkage modification, or a combination thereof.

29. 29. The oligonucleotide of claim 28, wherein the internucleotide linkage modification comprises a phosphorothioate or phosphodithioate linkage modification.

30. 29. The oligonucleotide of claim 28, wherein the sugar modification comprises a 2'-O-methoxyethyl (2'-MOE) modification, a 2'-fluoro (2'-F) modification, a 2'-O-methyl (2'-O-Me) modification, an unlocked nucleic acid (UNA), or a locked nucleic acid (LNA).

31. 29. The oligonucleotide of claim 28, wherein the sugar phosphate modifications comprise phosphorodiamidate morpholino (PMO) modifications and / or peptide nucleic acid (PNA) modifications.

32. 29. The oligonucleotide of claim 28, wherein the base modification comprises a 5'-methylcytosine modification or a G-clamp modification.

33. 28. The oligonucleotide of claim 27, wherein each nucleotide comprises a phosphorothioate (PS) internucleotide linkage.

34. 28. The oligonucleotide of claim 27, wherein the oligonucleotide comprises five nucleotides at the 5' end and five nucleotides at the 3' end of the oligonucleotide sequence that contain 2'-MOE modifications.

35. The oligonucleotide of claim 34, wherein the oligonucleotide comprises any one of SEQ ID NOs: 728-740.

36. 28. The oligonucleotide of claim 27, wherein each nucleotide contains a 2'-MOE modification.

37. The oligonucleotide of claim 1 , further comprising at least one ligand attached to the 5′ end and / or the 3′ end.

38. 38. The oligonucleotide of claim 37, wherein the ligand comprises at least one lipid, peptide, and / or sugar.

39. 39. The oligonucleotide of claim 38, wherein the sugar comprises one or more N-acetylgalactosamine (GalNAc) moieties.

40. the GalNAc moiety, 【Chemistry 15】 40. The oligonucleotide of claim 39, comprising a structural formula comprising:

41. 41. The oligonucleotide of claim 40, wherein the GalNAc moiety is conjugated to the oligonucleotide via a linker.

42. 42. The oligonucleotide of claim 41 , wherein the linker comprises Formula A: 【Chemistry 16】

43. 43. The oligonucleotide of claim 42, wherein a 2' deoxyadenosine phosphodiester is inserted between the oligonucleotide and the one or more GalNAc moieties.

44. 2. The oligonucleotide of claim 1, wherein the oligonucleotide, when administered to a cell, is capable of reducing the level of POLRMT mRNA expression, POLRMT protein, and / or PORLMT activity in the cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% compared to the level before administration.

45. 45. The oligonucleotide of claim 44, wherein the cell is a human cell.

Images