Adeno-associated virus vectors for proper packaging of repetitive elements

Abstract

The present invention discloses improved vectors for packaging and / or expressing multiple non-coding RNA or protein-encoding transgenes, each driven by a distinct promoter sequence. For example, the present invention provides a recombinant adeno-associated virus (rAAV) vector comprising a first inverted terminal repeat (ITR) sequence, a first promoter sequence, a first nucleic acid element, a second promoter sequence, a second nucleic acid element, and a second ITR sequence, wherein the first promoter sequence and the second promoter sequence are distinct promoter sequences.

Description

[Technical Field]

[0001] Field of Disclosure FIELD OF THE DISCLOSURE This disclosure relates to molecular biology, gene therapy, and compositions and methods for modifying the expression and activity of RNA molecules.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 385,759, filed December 1, 2022, the entire contents of which are incorporated herein by reference.

[0003] Electronic Sequence Listing Reference The contents of the electronic sequence listing (LOCN_023_001WO_SeqList_ST26.xml; size: 123,085 bytes; and creation date: November 30, 2023) are incorporated herein by reference in their entirety. [Background technology]

[0004] background There is a long-recognized, yet unmet, need in the art to provide effective treatments to correct dysfunctional messenger RNA.

[0005] Recombinant AAV is one of the delivery vehicles of choice for gene therapy. New programmable technology has now become small enough that it is possible to target multiple genes at the DNA or RNA level in a single AAV vector by packaging multiple targeting nucleic acid molecules, such as guide RNA (gRNA) or small nuclear RNA (snRNA). However, these targeting molecules often share the same regulatory sequence. Homology between the shared regulatory sequences causes undesirable truncations and deletions in the recombinant AAV genome. Reducing and / or eliminating this sequence homology eliminates these truncations / deletions, allowing complete genome packaging and resulting in higher vector production levels (i.e., higher titers) of the packaged targeting nucleic acid molecules.

[0006] Thus, the present disclosure provides compositions and methods comprising a novel therapeutic RNA targeting platform composed of engineered snRNAs. Summary of the Invention [Means for solving the problem]

[0007] overview The present disclosure provides a recombinant adeno-associated virus (rAAV) vector comprising a first AAV inverted terminal repeat (ITR) sequence, a first promoter sequence, a first nucleic acid element, a second promoter sequence, a second nucleic acid element, and a second ITR sequence, wherein the first promoter sequence and the second promoter sequence are separate promoter sequences.

[0008] In some embodiments, the first nucleic acid element and the second nucleic acid element comprise a nucleic acid encoding a non-coding RNA or a transgene.

[0009] In some embodiments, the non-coding RNA is a small nuclear RNA (snRNA) molecule, a single guide RNA molecule (sgRNA), a microRNA, a short hairpin RNA (shRNA), an enhancer RNA (eRNA), a small nucleolar RNA (snoRNA), or a long non-coding RNA (lncRNA).

[0010] In some embodiments, the rAAV vector further comprises one or more additional promoter sequences.

[0011] In some embodiments, the one or more additional promoter sequences are different from the first promoter sequence and the second promoter sequence.

[0012] In some embodiments, the rAAV vector further comprises one or more additional nucleic acid elements.

[0013] In some embodiments, the first promoter sequence has less than 75% sequence identity to the second promoter sequence and to the one or more additional promoter sequences.

[0014] In some embodiments, there are from about 50 to about 5,000 nucleotides between the 3' end of the first promoter and the 5' start of the second promoter.

[0015] In some embodiments, the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 50 and 5,000 nucleotides.

[0016] In some embodiments, the first nucleic acid element, the second nucleic acid element, and / or the one or more additional nucleic acid elements comprise one snRNA molecule.

[0017] In some embodiments, the first nucleic acid element, the second nucleic acid element, and / or the one or more additional nucleic acid elements comprise two snRNA molecules.

[0018] In some embodiments, the two snRNA molecules are separated by a spacer sequence portion. In some embodiments, the snRNA molecules are modified snRNA molecules.

[0019] In some embodiments, the snRNA molecule comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:34 through SEQ ID NO:40.

[0020] In some embodiments, the promoter is selected from a U1, U2, U4, U5, U6, U7, H1, 7SK, or tRNA promoter.

[0021] In some embodiments, the promoter regulates expression of an mRNA encoding a gene.

[0022] In some embodiments, the U1 promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:11.

[0023] In some embodiments, the U4 promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:6.

[0024] In some embodiments, the U5 promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:7.

[0025] In some embodiments, the U7 promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:12, or SEQ ID NO:13.

[0026] In some embodiments, the first ITR sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:50 through SEQ ID NO:55.

[0027] In some embodiments, the second ITR sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:50 through SEQ ID NO:55.

[0028] In some embodiments, the rAAV vector further comprises one or more terminator sequences. In some embodiments, the terminator sequences are U1, U2, U4, U5, U6, or U7 terminator sequences. In some embodiments, the terminator sequences are polyA sequences or Pol III termination sequences.

[0029] In some embodiments, the U1 terminator sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:21 or SEQ ID NO:28.

[0030] In some embodiments, the U4 terminator sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:23.

[0031] In some embodiments, the U5 terminator sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:24 or SEQ ID NO:32.

[0032] In some embodiments, the U7 terminator sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:20, SEQ ID NO:29, or SEQ ID NO:30.

[0033] In some embodiments, the rAAV vector is a single-stranded AAV vector (ssAAV). In some embodiments, the rAAV vector is a self-complementary AAV vector (scAAV).

[0034] The present disclosure provides an AAV viral vector comprising the rAAV vector of any one of the preceding embodiments, wherein the viral vector comprises AAV capsid proteins.

[0035] In some embodiments, the AAV capsid protein is an AAV1 capsid protein, an AAV2 capsid protein, an AAV3 capsid protein, an AAV3B capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV9 capsid protein, an AAV10 capsid protein, an AAV11 capsid protein, an AAV12 capsid protein, an AAV13 capsid protein, an AAVPHP.B capsid protein, an AAVrh74 capsid protein, an AAVrh10 capsid protein, or a modified AAV capsid protein.

[0036] In some embodiments, the AAV viral vectors exhibit higher expression in a subject or cell compared to AAV viral vectors comprising rAAV vectors comprising a single non-coding RNA or transgene or rAAV vectors comprising repeated promoter sequences operably linked to a non-coding RNA molecule or transgene sequence.

[0037] The present disclosure provides pharmaceutical compositions comprising the AAV viral vector of any embodiment disclosed herein.

[0038] The present disclosure provides a cell comprising the rAAV vector or AAV viral vector of any embodiment disclosed herein.

[0039] The present disclosure provides a method of treating a disease or disorder in a subject in need thereof, comprising administering a therapeutically effective amount of an AAV viral vector of claim 29 or a pharmaceutical composition of any embodiment disclosed herein. [Brief explanation of the drawings]

[0040] [Figure 1A] Figure 1A is a schematic diagram showing various snRNA expression cassettes composed of various permutations of promoters and snRNA molecules. A02888 shows a single-stranded AAV (ssAAV) snRNA expression cassette containing a single CUG repeat-targeting snRNA regulated by a U7 promoter. A02896 shows a ssAAV snRNA expression cassette containing three CUG repeat-targeting snRNA molecules, each under the regulation of a U7 promoter. A03624 shows a self-complementary AAV (scAAV) snRNA expression cassette containing, in the 5' to 3' direction: a U7 promoter driving the expression of snRNA38, a U7 promoter driving the expression of snRNA42, a U7 promoter driving the expression of snRNA42, and a U7 promoter driving the expression of snRNA38. A03081 refers to an scAAV snRNA expression cassette comprising, in 5' to 3' direction: a U7 promoter driving expression of a CAG-targeting snRNA, a U7 promoter driving expression of a CAG-targeting snRNA, a U7 promoter driving expression of a CAG-targeting snRNA, and a U7 promoter driving expression of a CAG-targeting snRNA.

[0041] [Figure 1B]Figure 1B is a series of tapestry images showing rAAV vectors containing the snRNA expression cassettes of Figure 1A. 1x refers to an AAV vector with one expression cassette (i.e., one promoter operably linked to one snRNA). 2x refers to an AAV vector with two expression cassettes. 3x refers to an AAV vector with three expression cassettes. 4x refers to an AAV vector with four expression cassettes.

[0042] [Figure 1C] Figure 1C is a graph showing full-length sequencing of an AAV9 viral vector containing the A03624 snRNA expression cassette. The y-axis shows the number of downsampled reads, and the x-axis shows the read length.

[0043] [Figure 2] Figure 2 is a schematic diagram of a series of rAAV vectors containing snRNA expression cassettes with three identical promoter repeats. The interaction and / or annealing of complementary regions (e.g., repeated U7 promoters) of two rAAV vectors is shown. ssAAV and scAAV vectors are shown.

[0044] [Figure 3]Figure 3 is a schematic diagram showing various snRNA expression cassettes composed of various permutations of promoters and snRNA molecules. Two ssAAV snRNA expression cassettes are shown, one showing the 38 / 42 snRNA molecule under the control of a U7 promoter and the second showing the 38 / 42 snRNA under the control of a U1 promoter. A second expression cassette is shown, which further includes a stuffer sequence. Two scAAV snRNA expression cassettes are shown, one showing the snRNA molecule, 38 / 42, under the control of a U7 promoter and the second showing the snRNA 38 / 42 under the control of a U1 promoter. The second scAAV expression cassette shows, from 5' to 3', the following: a U1 promoter driving expression of the 38 / 42 snRNA molecule, a U7 promoter driving expression of the 38 / 42 snRNA molecule, a U4 promoter driving expression of the 38 / 42 snRNA molecule, and a U5 promoter driving expression of the 38 / 42 snRNA molecule.

[0045] [Figure 4A] Figure 4A is a schematic diagram showing ssAAV snRNA expression cassettes A03981 and A04184. A03981 contains snRNA molecule 38 under the control of a U7 promoter and snRNA 42 under the control of a U1 promoter. A04184 contains a 38 / 42 snRNA molecule under the control of a U7 promoter and a second 38 / 42 snRNA molecule under the control of a U1 promoter, as well as a stuffer sequence.

[0046] [Figure 4B] Figure 4B is a series of tapestation images of AAV vectors containing A03981 and A04184.

[0047] [Figure 4C] Figure 4C shows full-length sequencing of the AAV9 viral vector containing the A03981 snRNA expression cassette. The y-axis shows the number of downsampled reads, and the x-axis shows the read length. Single-stranded and dimer / self-complementary (SC) peaks are annotated.

[0048] [Figure 4D] Figure 4D is a graph showing full-length sequencing of an AAV9 viral vector containing the A04184 snRNA expression cassette. The y-axis shows the number of downsampled reads, and the x-axis shows the read length.

[0049] [Figure 4E] Figure 4E visualizes the sequencing coverage of the plasmid (pAAV vector) containing the genome of A04184. Sequencing reads map almost perfectly to the intended genomic ITRs / expression cassettes.

[0050] [Figure 5A] Figure 5A is a schematic diagram showing scAAV snRNA expression cassettes A04232 and A04234. A04232 contains a 38 / 42 snRNA molecule under the control of a U7 promoter and a 38 / 42 snRNA molecule under the control of a U1 promoter. A04234 contains an snRNA molecule targeting the CUG repeat under the control of a U7 promoter and a second pair of snRNAs targeting the CUG repeat under the control of a U1 promoter.

[0051] [Figure 5B] Figure 5B is a series of tapestation images of AAV vectors containing A04232 and A04234.

[0052] [Figure 5C] Figure 5C shows full-length sequencing of the AAV9 viral vector containing the A04232 snRNA expression cassette. The y-axis shows the number of downsampled reads, and the x-axis shows the read length. Single-stranded and self-complementary (SC) peaks are annotated.

[0053] [Figure 5D]Figure 5D visualizes the sequencing coverage of the plasmid (pAAV vector) containing the genome of A04232. Sequencing reads in the shorter "ssAAV bin" map almost perfectly to the intended genomic ITRs / expression cassettes, indicating that these are full-length ssAAV genomes and not unintended partial genomes or truncations.

[0054] [Figure 5E] Figure 5E visualizes the sequencing coverage of the plasmid (pAAV vector) containing the genome of A04232. Sequencing reads in the shorter "ssAAV bin" map almost perfectly to the intended genomic ITR / expression cassette.

[0055] [Figure 6A] Figure 6A is a schematic diagram showing scAAV snRNA expression cassettes A03624 and A04226. A03624 shows a self-complementary AAV (scAAV) snRNA expression cassette that includes, from 5' to 3', a U7 promoter driving expression of snRNA38, a U7 promoter driving expression of snRNA42, a U7 promoter driving expression of snRNA42, and a U7 promoter driving expression of snRNA38. A04226 shows, from 5' to 3', a U1 promoter driving expression of snRNA38 / 42, a U7 promoter driving expression of snRNA38 / 42, a U4 promoter driving expression of snRNA38 / 42, and a U5 promoter driving expression of snRNA38 / 42.

[0056] [Figure 6B] Figure 6B is a series of tapestry images of AAV vectors containing A03624 and A04226.

[0057] [Figure 6C] FIG. 6C is a tapestation sample trace of A03624 shown in FIG. 6B.

[0058] [Figure 6D] FIG. 6D is a tapestation sample trace of A04226 shown in FIG. 6B.

[0059] [Figure 7A] Figure 7A is a series of tapestry images showing AAV vectors containing snRNA expression cassettes with various promoter permutations. "U7" refers to an snRNA expression cassette in which a single U7 promoter drives the expression of at least one snRNA molecule. "U7 U7 U7" refers to an snRNA expression cassette in which three U7 promoters each drive the expression of at least one snRNA molecule. "U1 U7" refers to an snRNA expression cassette in which one U1 promoter drives the expression of at least one snRNA molecule and one U7 promoter drives the expression of at least one snRNA molecule.

[0060] [Figure 7B] Figure 7B is a series of graphs showing full-length sequencing of AAV9 viral vectors containing snRNA expression cassettes from Figure 7A. The y-axis shows downsampled read number and the x-axis shows read length.

[0061] [Figure 8A]Figure 8A is a series of tapestry images showing AAV vectors containing snRNA expression cassettes with various promoter permutations. "U7 U7 U7 U7" refers to an snRNA expression cassette in which four U7 promoters each drive the expression of at least one snRNA molecule. "U1 U7 U4 U5 identical snRNA" refers to an snRNA expression cassette in which the U1 promoter, U7 promoter, U4 promoter, and U5 promoter each drive the expression of an individual copy of the snRNA molecule so that four copies of the snRNA molecule are present in the cassette. "U1 U7 U4 U5 different snRNA" refers to an snRNA expression cassette in which the U1 promoter, U7 promoter, U4 promoter, and U5 promoter each drive the expression of a different snRNA molecule so that the expression cassette contains four snRNA molecules with distinct sequences.

[0062] [Figure 8B-1] FIG. 8B is a tapestation sample trace and quantification of the sample shown in FIG. 8A. [Figure 8B-2] FIG. 8B is a tapestation sample trace and quantification of the sample shown in FIG. 8A. [Figure 8B-3] FIG. 8B is a tapestation sample trace and quantification of the sample shown in FIG. 8A.

[0063] [Figure 8C] Figure 8C is a series of graphs showing full-length sequencing of AAV9 viral vectors containing the "U1 U7 U4 U5 same snRNA" and "U1 U7 U4 U5 different snRNA" snRNA expression cassettes from Figure 8A. The y-axis shows downsampled read number, and the x-axis shows read length.

[0064] [Figure 9]9 is a graph showing AAV vector copies per ng of RNA for various AAV viral vectors containing snRNA expression cassettes. The snRNA expression cassettes evaluated included: a) 4xU7 (four U7 promoters, each driving expression of the same snRNA molecule at two different MOIs of 3e5 and 1e6; b) U1 and U7 promoters, each driving expression of snRNA molecules at three MOIs of 1e5, 5e5, and 1e6; and c) U1, U7, U4, and U5 promoters, each driving expression of snRNA molecules at three MOIs of 1e5, 5e5, and 1e6.

[0065] [Figure 10A] Figure 10A is a schematic diagram showing various snRNA expression cassettes constructed from various permutations of promoters and snRNA molecules. A04384 shows an scAAV snRNA expression cassette containing snRNA38 regulated by the mouse U7 promoter and snRNA42 regulated by the human U7 promoter.

[0066] [Figure 10B] FIG. 10B is a tapestry image showing the rAAV vector containing the snRNA expression cassette of FIG. 10A.

[0067] [Figure 10C] FIG. 10C is a tapestation trace of the tapestation image of FIG. 10B.

[0068] [Figure 10D] FIG. 10D is an alignment of the mouse and human U7 promoters showing 57.3% sequence similarity and 57.3% sequence identity.

[0069] [Figure 11A]Figure 11A is a schematic diagram showing various snRNA expression cassettes constructed from various permutations of promoters and snRNA molecules. A04526 shows an scAAV snRNA expression cassette containing snRNA38 / 42 regulated by the mouse U7 promoter and snRNA38 / 42 regulated by the human U7 promoter.

[0070] [Figure 11B] FIG. 11B is a tapestation image showing the rAAV vector containing the snRNA expression cassette of FIG. 11A.

[0071] [Figure 11C] FIG. 11C is a tapestation trace of the tapestation image of FIG. 10B. DETAILED DESCRIPTION OF THE INVENTION

[0072] Detailed Description Traditional designs for the expression of multiple snRNAs or sgRNAs use the same promoter (often U7 or U6) several times in the AAV genome. Genome extraction and sequencing analysis have shown that these repeated sequences undergo significant shortening or deletion during AAV packaging. Reducing the repeated sequences in the genome by using different promoters and / or snRNA sequences can correct AAV genome abnormalities, leading to improved AAV packaging and increased snRNA expression.

[0073] The present disclosure provides expression vectors, including recombinant adeno-associated virus (rAAV) vectors, each comprising one or more nucleic acid elements operably linked to a promoter, wherein the two promoters are separate promoter sequences. In some embodiments, the vector comprises a first AAV inverted terminal repeat (ITR) sequence, a first promoter sequence, a first nucleic acid element, a second RNA promoter sequence, a second nucleic acid element, and a second ITR sequence, wherein the first promoter sequence and the second promoter sequence are separate promoter sequences.

[0074] The vectors of the present disclosure can further comprise one or more additional nucleic acid elements.

[0075] In some embodiments, vectors of the disclosure comprise a total of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleic acid elements. In some embodiments, vectors of the disclosure comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleic acid elements.

[0076] In some embodiments, a vector of the disclosure comprises a total of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 non-coding RNA molecules. In some embodiments, a vector of the disclosure comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-coding RNA molecules.

[0077] In some embodiments, a vector of the disclosure comprises a total of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 snRNA molecules. In some embodiments, a vector of the disclosure comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 snRNA molecules.

[0078] In some embodiments, vectors of the disclosure comprise a total of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 sgRNA molecules. In some embodiments, vectors of the disclosure comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 sgRNA molecules.

[0079] In some embodiments, a vector of the disclosure comprises a total of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 protein-encoding transgenes. In some embodiments, a vector of the disclosure comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 protein-encoding transgenes.

[0080] In some embodiments, each nucleic acid element (such as a non-coding RNA, snRNA molecule, sgRNA molecule, or transgene) is operably linked to a promoter sequence. In some embodiments, a single promoter regulates the expression of two or more nucleic acid elements. In some embodiments, when a single promoter is operably linked to two or more nucleic acid elements (such as a non-coding RNA molecule or transgene), a spacer sequence separates the elements.

[0081] In some embodiments, a vector of the present disclosure comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 promoter sequences.

[0082] In some embodiments, vectors of the present disclosure that include two or more promoter sequences include promoters that are distinct from other promoters in the vector.

[0083] In some embodiments, each promoter sequence in a vector lacks significant sequence identity to other sequences in the vector, including other promoter sequences in the vector. In some embodiments, the promoter sequence of a vector has about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 5%, less than about 1%, or about 0% sequence identity to other sequences in the vector, including other promoter sequences. In some embodiments, the promoter sequence of a vector has less than about 75% sequence identity to other sequences in the vector, including other promoter sequences. In some embodiments, the promoter sequence of a vector has less than about 50% sequence identity to other sequences in the vector, including other promoter sequences. In some embodiments, the promoter sequence of a vector has less than about 45% sequence identity to other sequences in the vector, including other promoter sequences. In some embodiments, the promoter sequence of the vector has less than about 40% sequence identity to other sequences of the vector that include other promoter sequences. In some embodiments, the promoter sequence of the vector has less than about 35% sequence identity to other sequences of the vector that include other promoter sequences. In some embodiments, the promoter sequence of the vector has less than about 30% sequence identity to other sequences of the vector that include other promoter sequences.

[0084] The terms "homology" or "identity" or "similarity" refer to sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing positions in each sequence, which can be aligned for comparison. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions the sequences share. An "unrelated" or "non-homologous" sequence shares less than about 40% to 70% identity with another sequence, or alternatively less than about 60%, about 50%, about 30%, or about 25% identity.

[0085] Without wishing to be bound by theory, vectors, including AAV vectors and rAAV vectors of the present disclosure, having repeat sequences (including promoter sequences) can form complementary interactions between the repeat sequences. Such complementary interactions include base pairing and hybridization interactions. The interactions form loops and inter- and intra-molecular interactions. The self-complementary interactions result in poor packaging efficiency and shortening of the final packaged vector (such as the packaged rAAV vector in an AAV viral vector).

[0086] Therefore, by eliminating the sequences with high sequence identity and / or similarity within a single vector, these self-complementary interactions are eliminated, thereby improving packaging efficiency.This improved packaging efficiency produces purer virus particles with fewer undesired vector species (i.e., truncated vector species).Therefore, the resulting virus particles (such as AAV virus particles) can improve expression and efficacy in in vivo, ex vivo, and clinical therapeutic situations.

[0087] Furthermore, the vectors described herein (including rAAV vectors) allow for more reproducible viral packaging and production. By reducing the likelihood of truncated genome species, the relationship between viral titer and expression can be determined more accurately. Because the amount of truncated events can vary from one viral production run to another, the relationship between titer and expression (efficacy / safety) must be determined for each production run. Eliminating truncated events reduces variability between production batches.

[0088] Because the vectors of the present disclosure contain fewer repeat elements that may be capable of self-complementary interactions within the vector, the vectors of the present disclosure exhibit greater expression than vectors that contain self-complementary interactions, for example, due to the use of repetitive promoter sequences. Furthermore, vectors of the present disclosure that contain fewer repeat elements are much less likely to exhibit truncations and / or deletions within the vector sequence. Therefore, vectors such as the rAAV vectors of the present disclosure packaged as AAV viral vectors produce accurate rAAV vectors with higher efficiency (i.e., do not have truncations or deletions of the desired rAAV vectors containing nucleic acid elements of the present disclosure, such as snRNAs or transgenes).

[0089] In some embodiments, the AAV viral vectors exhibit higher expression in a subject or cell compared to AAV viral vectors comprising rAAV vectors comprising a single non-coding RNA or transgene or rAAV vectors comprising repeated promoter sequences operably linked to a non-coding RNA molecule or transgene sequence.

[0090] The term "hybridization" refers to the reaction of one or more polynucleotides to form a complex stabilized by hydrogen bonds between the bases of the nucleotide residues. The hydrogen bonds can occur through Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. The complex can contain two strands forming a duplex structure, three or more strands forming a multistranded complex, a single self-hybridizing strand, or any combination thereof. A hybridization reaction can constitute a step in a more extensive process, such as the initiation of a PC reaction or the enzymatic cleavage of a polynucleotide by a ribozyme.

[0091] Nucleic Acid Elements The present disclosure provides vectors (including rAAV vectors) comprising one or more nucleic acid elements operably linked to a promoter sequence. The nucleic acid elements can be any nucleic acid sequence, including transgene sequences encoding proteins and / or peptides. The proteins of the present disclosure can be any protein known in the art. In some embodiments, the protein is a therapeutic protein. In some embodiments, the protein is a synthetic or non-naturally occurring protein.

[0092] In some embodiments, the nucleic acid element is a non-coding RNA. In some embodiments, the non-coding RNA is an RNA-binding non-coding RNA. In some embodiments, the non-coding RNA is a small nuclear RNA (snRNA) molecule, a single guide RNA molecule (sgRNA), a microRNA, a short hairpin RNA (shRNA), an enhancer RNA (eRNA), a small nucleolar RNA (snoRNA), or a long non-coding RNA (lncRNA). In some embodiments, the sgRNA is used in conjunction with a CRISPR / Cas system to target, bind to, and / or cleave nucleic acids, including DNA and RNA sequences. In some embodiments, the non-coding RNA is an snRNA molecule. The short nuclear RNA molecules of the present disclosure can be non-natural, modified, and / or engineered snRNA molecules. In some embodiments, the snRNA molecules of the present disclosure bind to and target RNA molecules.

[0093] In some embodiments, the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 10 and 5,000 nucleotides. In some embodiments, the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 50 and 5,000 nucleotides. In some embodiments, the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 10 and 2,500 nucleotides. In some embodiments, the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 50 and 2,500 nucleotides. In some embodiments, the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 10 and 1,000 nucleotides. In some embodiments, the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 10 and 750 nucleotides. In some embodiments, the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 10 and 500 nucleotides. In some embodiments, the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 10 and 250 nucleotides.

[0094] In some embodiments, there are about 10 to about 5,000 nucleotides between the 3' end of the first promoter and the 5' start of the second promoter. In some embodiments, there are about 50 to about 5,000 nucleotides between the 3' end of the first promoter and the 5' start of the second promoter. In some embodiments, there are about 10 to about 2,500 nucleotides between the 3' end of the first promoter and the 5' start of the second promoter. In some embodiments, there are about 10 to about 1,000 nucleotides between the 3' end of the first promoter and the 5' start of the second promoter. In some embodiments, there are about 10 to about 500 nucleotides between the 3' end of the first promoter and the 5' start of the second promoter. In some embodiments, there are about 10 to about 250 nucleotides between the 3' end of the first promoter and the 5' start of the second promoter.

[0095] snRNA molecule The present disclosure provides improved rAAV vectors for packaging snRNA molecules.

[0096] Small nuclear RNAs (snRNAs) are one of the smallest types of RNA, with an average size of approximately 150 nucleotides. snRNAs are functional non-coding RNAs. Eukaryotic genomes encode various non-coding RNAs, including snRNAs, a highly abundant class of RNA localized in the nucleus that plays important functions in intron splicing and RNA processing. snRNAs can form ribonucleoprotein particles (snRNPs) with other proteins in the pre-mRNA splicing process. These snRNPs and additional proteins form large particle complexes (spliceosomes) bound to unspliced ​​pre-mRNA transcripts. In addition to splicing, snRNAs function in the nuclear maturation of nascent transcripts, in the control of gene expression, as splice donors in non-canonical systems, and in the 3'-end processing of replication-dependent histone mRNAs. While U7 snRNA can be programmed to bind and regulate mRNAs without exogenous protein expression, there remains a need for the development of highly specific mRNA-targeting therapeutics that minimize the risk of immunogenicity. Furthermore, the small size of these programmed snRNAs creates an opportunity to develop highly specific (allele-specific), single-target and multi-targeted gene therapy approaches with a single vector.

[0097] In some aspects, the present disclosure provides gene therapy compositions comprising an engineered snRNA (esnRNA) comprising an engineered snRNA stem loop (eSL).

[0098] Small nuclear ribonucleic acids (snRNAs) are essential components of small nuclear ribonucleoprotein complexes (snRNPs), which, when assembled with additional proteins, form a large ribonucleoprotein complex known as the spliceosome, a cellular mechanism designated to mediate the entire mRNA maturation process. The spliceosome is responsible for precursor mRNA splicing, the process of removing introns from RNA transcripts before protein production. Individual snRNAs are generally approximately 250 nucleotides or less in size. For example, the U1 snRNA is 164 nucleotides long and is encoded by genes that occur in several copies in the human genome. U1 snRNAs represent the ribonucleic acid component of the nuclear particle U1 snRNP. U1 snRNAs have a three-dimensional stem-and-loop structure, and within the 5' region there is a single-stranded sequence, generally approximately 9 nucleotides long, that can bind to splicing donors on pre-mRNA molecules by complementary base pairing. (Horowitz et al., 1994, Trends Genet., 10(3):100-6.) The various spliceosomal snRNAs are designated U1, U2, U4, U5, U6, U4ATAC, U6ATAC, U7, U11, and U12, based on their abundant uridylic acid content (Mattaj et al., 1993, FASEB J, 15, 7:47-53.).

[0099] The snRNA system can be used to treat toxic mutations: for example, antisense oligonucleotides that interfere with splice sites and regulatory elements within exons containing toxic mutations induce skipping of specific exons at the pre-RNA level.

[0100] Such antisense sequences can be delivered using viral vectors carrying genes capable of transcribing antisense sequences via snRNA. U7 snRNA is endogenously involved in histone pre-mRNA 3'-end processing, but can be converted into a versatile tool for splicing regulation by making small modifications to the binding site of Sm / Lsm proteins. One such therapeutic strategy for treating DMD (Duchenne muscular dystrophy) is to use modified U7 snRNA to convert out-of-frame mutations into in-frame mutations, thereby generating toxic RNA with internal deletions, but allowing dystrophin to still function. (Goyenvalle et al., 2009, 17(7):1234-1240.)

[0101] Most U-rich snRNPs mediate pre-mRNA splicing. The U7 snRNP is an exception. U7 is not involved in splicing but, rather, is a key factor in the intrinsic 3'-end processing of replication-dependent histone mRNAs. By modifying the U7 snRNA histone-binding sequence and Sm motif, U7 can no longer participate in histone pre-mRNA processing and instead targets pre-mRNAs or smRNAs for blocking or splicing modulation. In this manner, U7 snRNA can be used as an effective gene therapy platform. The U7 snRNA platform also has the added advantages of being compact, capable of accumulating in the nucleus without causing cytotoxicity, and exhibiting little or no immunoreactivity. (Gadgil et al., 2021, J Gene Med, 23(4):e3321.)

[0102] 1) Disclosed herein are novel engineered and redesigned snRNA platforms (or esnRNA platforms) containing engineered stem-loops (eSLs). Compensatory modifications made to the native stem-loop sequence create engineered stem-loops (eSLs) that more effectively communicate (fold and anneal) with the snRNA interaction stabilization domain (ISD), resulting in an snRNA platform with increased stability. See Figure 1. U7 snRNA has previously been shown to be programmable to regulate mRNA. Disclosed herein are improved programmed engineered snRNAs that can be used as gene therapy tools. These engineered snRNA systems have been shown herein to lead to blockage of microsatellite repeat expansion (as shown herein for the treatment of myotonic dystrophy (DM1) or Huntington's disease (HD)) and splicing modulation (as shown herein for the treatment of USH2A (Usher syndrome type 2)). In one embodiment, these snRNAs are human snRNAs. In one embodiment, U7 is human U7. In another embodiment disclosed herein, the engineered snRNA comprises multiple types of snRNA (e.g., U1-U12) by combining domains of endogenous snRNAs to fine-tune platform stabilization and / or reduce off-target effects. For example, in one embodiment, the engineered snRNA system comprises a combination of a human U7 snRNA component and a human U1 snRNA component. Additional elements can be further engineered into esnRNAs, including eSLs, that can coordinate RNA processing and abundance. See Figure 1C. In one embodiment, the 5' or 3' end of the esnRNA can be further engineered with additional elements that can coordinate esnRNA processing, stability, and abundance. In another embodiment, such elements can include, but are not limited to, stem loops, hairpins, GC clamps, kissing loops, triplexes, quadruplexes, and protein binding sites.

[0103] The snRNAs of the present disclosure can be programmed to contain targeting sequences (TSs) that target one or more RNAs of interest. In one example, U7 snRNA can be programmed by replacing the histone mRNA binding sequence with a sequence complementary to the target of interest. Exemplary esnRNAs shown herein lead to blocking microsatellite repeat expansion (for the treatment of myotonic dystrophy (DM1) or Huntington's disease (HD)) and splicing modulation (for the treatment of USH2A (Usher syndrome type 2)). In one embodiment, the target RNA of interest is a microsatellite repeat RNA or a non-repeat RNA. In another embodiment, the microsatellite repeat RNA of interest is selected from the group consisting of CUG, CAG, GGGGCC, and CCCCGG. In one embodiment, the esnRNA contains targeting sequences that target two target RNAs of interest that are GGGGCC and CCCCGG. In another embodiment, the two target RNAs of interest are a microsatellite repeat RNA and a non-repeat RNA. In another embodiment, the non-repetitive RNA is a flanking sequence to a microsatellite repeat RNA. In another embodiment, the esnRNA comprises a targeting sequence that targets two or more RNAs of interest. In another embodiment, the esnRNA comprises two or more targeting sequences (TS) that target two or more RNAs of interest. In one embodiment, the targeting sequence(s) (TS) can be located at the 5' (5'TS) position in the snRNA construct. In another embodiment, particularly if the snRNA construct is not a U7-based snRNA, the targeting sequence(s) (TS) can be located at the 3' (3'TS) position in the snRNA construct.

[0104] Engineered stem-loop The snRNA and engineered snRNA (esnRNA) systems disclosed herein can include engineered stem-loop (eSL) sequences containing compensatory modifications to the native snRNA stem-loop. These modifications increase the stability of the esnRNP compared to snRNPs containing unmodified stem-loop sequences. The eSL sequences disclosed herein can be derived from any snRNP U1-U12. In one embodiment, the eSL sequence is a U7 eSL sequence. In one embodiment, the eSL sequence is a human or mouse U7 eSL sequence. In one embodiment, the eSL sequence is a human eSL sequence. In one embodiment, the eSL sequence is a mouse eSL sequence. In some embodiments, the eSL sequence is a human or mouse eSL sequence. In some embodiments, the eSL sequence is a non-human eSL sequence (e.g., mouse eSL, porcine eSL, ovine eSL, caprine eSL, bovine eSL, canine eSL, feline eSL, equine eSL, or a combination thereof). In some embodiments, the eSL sequence is not a native stem-loop sequence. In some embodiments, the nucleic acid sequence of eSL is at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) not a native stem-loop sequence. Engineered stem-loops are described in WO2023168458 (the entire contents of which are incorporated herein by reference) as examples of eSL sequences that can be used in the constructs described herein.

[0105] In another embodiment, the eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to one or more of the following nucleotide sequences: [ka] In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 57. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 58. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 59. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 60. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 61. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 62. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 63. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 64. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 65. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 66. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 67. In some embodiments, human eSL comprises the sequence set forth in SEQ ID NO: 68.

[0106] In some embodiments, the mouse eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to one or more of the following nucleotide sequences: [ka]

[0107] In some embodiments, mouse eSL comprises the sequence set forth in SEQ ID NO: 69. In some embodiments, mouse eSL comprises the sequence set forth in SEQ ID NO: 70. In some embodiments, mouse eSL comprises the sequence set forth in SEQ ID NO: 71. In some embodiments, mouse eSL comprises the sequence set forth in SEQ ID NO: 72. In some embodiments, mouse eSL comprises the sequence set forth in SEQ ID NO: 73. In some embodiments, mouse eSL comprises the sequence set forth in SEQ ID NO: 74. In some embodiments, mouse eSL comprises the sequence set forth in SEQ ID NO: 75.

[0108] In some embodiments, the human or mouse eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to one or more of the following nucleotide sequences: [ka] [ka]

[0109] In some embodiments, the human or mouse eSL comprises the sequence set forth in SEQ ID NO: 76. In some embodiments, the human or mouse eSL comprises the sequence set forth in SEQ ID NO: 10477. In some embodiments, the human or mouse eSL comprises the sequence set forth in SEQ ID NO: 78.

[0110] In some embodiments, the canine or feline eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to the nucleotide sequence GGTTTTCCGGTCTCCACCGGAAAGCCCCC (SEQ ID NO: 79).

[0111] In some embodiments, the bovine, ovine, or caprine eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to one or more of the following nucleotide sequences: [ka]

[0112] In some embodiments, the bovine, ovine, or caprine eSL comprises the sequence set forth in SEQ ID NO: 80. In some embodiments, the bovine, ovine, or caprine eSL comprises the sequence set forth in SEQ ID NO:81.

[0113] In some embodiments, the porcine eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to one or more of the following nucleotide sequences: [ka]

[0114] In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO: 82. In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO: 83. In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO: 84. In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO: 85. In some embodiments, the porcine eSL comprises the sequence set forth in SEQ ID NO: 86.

[0115] In some embodiments, the equine eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to one or more of the following nucleotide sequences: [ka]

[0116] In some embodiments, the equine eSL comprises the sequence set forth in SEQ ID NO: 87. In some embodiments, the equine eSL comprises the sequence set forth in SEQ ID NO:88.

[0117] In some embodiments, the ovine eSL comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to one or more of the following nucleotide sequences: [ka]

[0118] In some embodiments, the ovine eSL comprises the sequence set forth in SEQ ID NO: 89. In some embodiments, the ovine eSL comprises the sequence set forth in SEQ ID NO: 90. In some embodiments, the ovine eSL comprises the sequence set forth in SEQ ID NO: 91.

[0119] In some embodiments, the engineered stem loop improves the stability of the snRNA compared to a snRNA comprising a native stem loop. In some embodiments, a native snRNA stem loop comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to one or more of the following nucleotide sequences: [ka] [ka]

[0120] In some embodiments, the native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 92. In some embodiments, the native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 93. In some embodiments, the native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 94. In some embodiments, the native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 95. In some embodiments, the native snRNA stem loop comprises the sequence set forth in SEQ ID NO: 96.

[0121] 5' interacting stability domain The eSLs disclosed herein have more efficient folding and annealing properties due to the 5' interacting stability domain (5'ISD), which in turn increases the stability of the esnRNA compared to non-engineered snRNAs. The 5'ISD has nucleotides complementary to nucleotides in the engineered SL, and without wishing to be bound by theory, it is predicted that the interaction between the 5'ISD and the eSL forms a secondary structure that protects the 5' end of the snRNA. In some embodiments, the 5'ISD anneals and / or hybridizes to the eSLs of the present disclosure. In some embodiments, the 5'ISD is a sequence that is complementary and / or reverse complementary to a sequence present in the eSLs of the present disclosure. In some embodiments, the 5'ISD disclosed herein can comprise or consist of one of the following nucleotide sequences:

[0122] ggagt,

[0123] cctct,

[0124] ggaggt,

[0125] cctcct,

[0126] agccag,

[0127] ggaag,

[0128] gaagaag,

[0129] gttg,

[0130] ccgaa,

[0131] taaggag,

[0132] gaag, or

[0133] ggctt.

[0134] Sm-binding domain The snRNA system disclosed herein utilizes an Sm-binding domain (SmBD). The Sm protein ring that assembles around the SmBD to form the snRNP includes SmB / B', SmD1, SmD2, SmD3, SmE, SmF, and SmG. The U7 Sm-binding site recruits endogenous RNA-binding factors and can be replaced with a non-U7 SmBD to make the snRNA more stable. In one embodiment, the SmBD is selected from the group consisting of U1, U2, U4, and U5 snRNAs. In another embodiment, the SmBD is derived from a pseudo-snRNA. In another embodiment, the SmBD is a nucleotide sequence comprising SEQ ID NO: 78 (ATTTTT). In another embodiment, the SmBD comprises a nucleotide sequence selected from the group consisting of AATTTTTGG, AATTTGTGG, AATTTGTGG, AATTTCTGG, GATTTTTGG, AATTTTTGA, AATTTTTTG, AATTTTTGGAGCA (SEQ ID NO: 105), or AATTTTTGGAGTA (SEQ ID NO: 106).

[0135] Promoter sequence A "promoter" is a regulatory sequence that is a region of a polynucleotide sequence at which the initiation and rate of transcription are regulated. A promoter can contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind.

[0136] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors, or non-viral vectors provided herein include, but are not limited to, expression regulatory elements. As used herein, "expression regulatory elements" refers to any sequence that controls the expression of a coding sequence, such as a gene. Exemplary expression regulatory elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional control elements, polyadenylation signal sequences, and introns. Expression regulatory elements can be, for example, constitutive, inducible, repressible, or tissue-specific. A "promoter" is a regulatory sequence that is a region of a polynucleotide sequence where the initiation and rate of transcription are regulated. A promoter can contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. An "enhancer" is a region of DNA to which activating proteins can bind to increase the likelihood or frequency of transcription.

[0137] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors, or non-viral vectors provided herein contain vector elements such as, but not limited to, buffer sequences derived from human genomic sequences downstream of the snRNA, thus providing the ability to encode multiple snRNAs from a single construct.

[0138] In some embodiments, by incorporating coding sequences into the compositions disclosed herein, multicistronic vectors can simultaneously express two or more separate proteins from the same mRNA. The two most widely used strategies for constructing multicistronic configurations are through the use of an IRES or a 2A self-cleaving site. "IRES" refers to an internal ribosome entry site, or portion thereof, of viral, prokaryotic, or eukaryotic origin used in polycistronic vector constructs. In some embodiments, an IRES is an RNA element that enables translation initiation in a cap-independent manner. The terms "self-cleaving peptide" or "sequence encoding a self-cleaving peptide," or "2A self-cleaving site," refer to a linking sequence used in a vector construct to incorporate a site that promotes ribosome skipping, thereby generating two polypeptides from a single promoter. Such self-cleaving peptides include, but are not limited to, T2A and P2A peptides, or other sequences encoding self-cleaving peptides.

[0139] Non-coding RNA promoter sequences The non-coding RNA promoters of the rAAV vectors disclosed herein can include snRNA promoters derived from any of U1 through U12. In some embodiments, the U1 through U12 promoters are derived from any species, including human and mouse. In one embodiment, the snRNA promoter is a U7 promoter. In another embodiment, the U7 promoter is a human U7 promoter (hU7) or a mouse U7 promoter (mU7). In another embodiment, the U1 promoter is a human U1 promoter (hU1) or a mouse U1 promoter (mU1). In another embodiment, the U4 promoter is a human U4 promoter (hU4) or a mouse U4 promoter (mU4). In another embodiment, the U5 promoter is a human U5 promoter (hU5) or a mouse U5 promoter (mU5).

[0140] In some embodiments, the non-coding RNA promoter is a snoRNA promoter. In one embodiment, the snoRNA promoter is a human snoRNA promoter. In another embodiment, the snoRNA promoter is a U3 snoRNA promoter.

[0141] In other embodiments, the snRNA promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to a promoter and / or promoter sequence listed in the exemplary promoter table below: [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0142] In some embodiments, the human U7 promoter can comprise SEQ ID NO: 1. In some embodiments, the human U7 promoter can comprise SEQ ID NO: 2. In some embodiments, the human U1 promoter can comprise SEQ ID NO: 3. In some embodiments, the human U1 promoter can comprise SEQ ID NO: 3. In some embodiments, the human U1 promoter can comprise SEQ ID NO: 4. In some embodiments, the human U2 promoter can comprise SEQ ID NO: 5. In some embodiments, the human U4 promoter can comprise SEQ ID NO: 6. In some embodiments, the human U5 promoter can comprise SEQ ID NO: 7. In some embodiments, the human U6 promoter can comprise SEQ ID NO: 8. In some embodiments, the h7sk promoter can comprise SEQ ID NO: 9. In some embodiments, the tRNA(val) promoter can comprise SEQ ID NO: 10.

[0143] In some embodiments, the mouse U1 promoter can comprise SEQ ID NO: 11. In some embodiments, the mouse U7 promoter can comprise SEQ ID NO: 12. In some embodiments, the mouse U7 promoter can comprise SEQ ID NO: 13. In some embodiments, the mouse U5 promoter can comprise SEQ ID NO: 14. In some embodiments, the mouse U2 promoter can comprise SEQ ID NO: 15. In some embodiments, the mouse U6 promoter can comprise SEQ ID NO: 16. In some embodiments, the mouse H1 promoter can comprise SEQ ID NO: 17.

[0144] Protein-coding promoter sequences In some aspects, the rAAV vectors of the present disclosure can be used to express one or more transgenes encoding proteins. In these aspects, the promoter is a promoter suitable for Pol II or Pol III recruitment. In some aspects, any promoter capable of controlling the expression of a protein-encoding transgene can be used. In some embodiments, promoters can include, but are not limited to, the phosphoglycerate kinase (PKG) promoter, CAG (a complex of the CMV enhancer, chicken beta-actin promoter (CBA), and rabbit beta-globin intron), NSE (neuron-specific enolase), synapsin, or NeuN promoter, the SV40 early promoter, the mouse mammary tumor virus LTR promoter; the adenovirus major late promoter (Ad MLP); the herpes simplex virus (HSV) promoter, the cytomegalovirus (CMV) promoter (such as the CMV immediate early promoter region (CMVIE)), the SFFV promoter, the Rous sarcoma virus (RSV) promoter, synthetic promoters, and hybrid promoters. Other promoters can be of human origin or derived from other species, including murine. Common promoters include, for example, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, [beta]-actin, the rat insulin promoter, the phosphoglycerate kinase promoter, the human alpha-1 antitrypsin (hAAT) promoter, the transthyretin promoter, the TBG promoter and other liver-specific promoters, the desmin promoter and similar muscle-specific promoters, the EF1-alpha promoter, the CAG promoter and other constitutive promoters, hybrid promoters with multiple tissue specificity, promoters specific for neuronal-like synapsins, and the glyceraldehyde-3-phosphate dehydrogenase promoter.

[0145] In some embodiments, an exemplary promoter sequence is a cytomegalovirus (CMV) promoter. In some embodiments, the CMV promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to SEQ ID NO: 18.

[0146] Terminator sequence The rAAV vectors disclosed herein comprise a downstream terminator (DT). The downstream terminator defines the end of a transcription unit such as an esnRNA, snRNA, sgRNA, or transgene. In some embodiments, the terminator is an snRNA terminator. In some embodiments, the terminator is a non-coding RNA terminator. In some embodiments, the terminator is a polyadenylation (polyA) sequence.

[0147] In one embodiment, the rAAV vector of the present disclosure comprises one or more snRNAs, one or more promoters, and one or more DTs. In one aspect, the promoter and DT sequences provided herein can be mixed and matched in any combination.

[0148] In some embodiments, the DT comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to a DT sequence listed in the table below:

[0149] [Table 2-1] [Table 2-2]

[0150] In some embodiments, human U7 DT comprises the sequence set forth in SEQ ID NO:20. In some embodiments, human U1 DT comprises the sequence set forth in SEQ ID NO:21. In some embodiments, human U2 DT comprises the sequence set forth in SEQ ID NO:22. In some embodiments, human U4 DT comprises the sequence set forth in SEQ ID NO:23. In some embodiments, human U5 DT comprises the sequence set forth in SEQ ID NO:24. In some embodiments, human U6 DT comprises the sequence set forth in SEQ ID NO:25. In some embodiments, human h7sk DT comprises the sequence set forth in SEQ ID NO:26. In some embodiments, human tRNA(val)DT comprises the sequence set forth in SEQ ID NO:27. In some embodiments, mouse U1 DT comprises the sequence set forth in SEQ ID NO:28. In some embodiments, mouse U7 DT comprises the sequence set forth in SEQ ID NO:29. In some embodiments, mouse U7 DT comprises the sequence set forth in SEQ ID NO:30. In some embodiments, human U7 DT comprises the sequence set forth in SEQ ID NO:31. In some embodiments, mouse U5 DT comprises the sequence set forth in SEQ ID NO:32. In some embodiments, mouse U2 DT comprises the sequence set forth in SEQ ID NO:33. In some embodiments, the mouse U6 DT comprises TTTTTT. In some embodiments, the mouse UH1 DT comprises TTTTTT.

[0151] Buffer sequence of recombinant AAV vector

[0152] In some embodiments, the rAAV vector comprises multiple nucleic acid elements, such as snRNAs, sgRNAs, or transgenes. In some embodiments, the multiple nucleic acid elements are multiple copies of the same nucleic acid sequence. In some embodiments, the multiple copies of snRNA comprise different snRNA molecules. In some embodiments, the multiple nucleic acid elements comprise 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies (2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, or 10x) of a nucleic acid element. In some embodiments, the multiple nucleic acid elements are 4 or more copies of a nucleic acid element. In some aspects, one or more nucleic acid elements are identical. In some aspects, one or more nucleic acid elements are different.

[0153] In some embodiments, the rAAV vector comprises multiple transgenes. In embodiments, the multiple transgenes are the same transgene. In some embodiments, the transgenes comprise different transgenes. In some embodiments, the multiple transgenes are 2, 3, 4, 5, 6, 7, 8, 9, or 10 (2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, or 10x) transgenes. In some embodiments, the transgene is 4 or more copies of a transgene. In some aspects, one or more transgenes are the same. In some aspects, one or more transgenes are different.

[0154] In some embodiments, the rAAV vector comprises multiple copies of snRNA. In embodiments, the multiple copies are the same snRNA. In some embodiments, the multiple copies of snRNA comprise different snRNA molecules. In some embodiments, the multiple copies of snRNA are 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the snRNA (2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, or 10x). In some embodiments, the multiple copies of snRNA are 4 or more copies of the snRNA. In some aspects, one or more snRNAs are identical. In some aspects, one or more snRNAs are different.

[0155] In some embodiments, each nucleic acid element of the nucleic acid elements is separated by a nucleic acid buffer sequence derived from a human non-coding genomic sequence. In some embodiments, each snRNA of the multiple copies of snRNA is separated by a nucleic acid buffer sequence derived from a human non-coding genomic sequence downstream of the snRNA. In one embodiment, the buffer sequence is derived from a human genomic sequence downstream of U7.

[0156] In one embodiment, the buffer sequence is one of the following nucleic acid sequences:

[0157] Buffer 1 (30 bp) CAAACTACAGAGCCAAGTGCTATCCACAGA (SEQ ID NO: 98),

[0158] Buffer 2 (30bp) GAGCTTTCTGGGTTGCCATCTCAAGCAGAC (SEQ ID NO: 99),

[0159] Buffer 3 (30 bp) TACAAGGCCATCAGCTCATACTCACAATTG (SEQ ID NO: 100), or combinations thereof.

[0160] In another embodiment, the buffer sequence is one of the following nucleic acid sequences:

[0161] Buffer 1 (100bp) [ka]

[0162] Buffer 2 (100bp) [ka] Or a combination of these.

[0163] In another embodiment, the buffer sequence is one of the following nucleic acid sequences:

[0164] Buffer 1 (500bp) [ka] [ka]

[0165] Buffer 2 (500bp) [ka] Or a combination of these.

[0166] The 100-bp and 500-bp buffer sequences are derived from sequences starting 100 bp downstream of Mus musculus U7 pseudogene 8 (chromosome 14: 4,409,359–4,409,421 reverse strand; GRCm39:CM001007.3). The 100-bp and 500-bp buffer 2 are derived from sequences starting 130 bp downstream of human U7 pseudogene 5 (chromosome X: 140,451,148–140,451,208 forward strand; GRCm39:CM000685.2). Both 100-bp buffers are the first 100 bp of the corresponding 500-bp buffers. The 30-bp buffers 1, 2, and 3 are contiguous 30-bp sequences within "100-bp buffer 1" downstream of Mus musculus U7 pseudogene 8. These downstream sequences were selected due to their lack of repetitive sequences, 40–60% GC content in the entire buffer, 40–60% GC content in the 20-bp regions on both ends of the buffer, and minimal sequence complexity, as well as the lack of any known regulatory sites or genes within or near the sequence (using Gencode / Ensembl).

[0167] snRNA sequence Exemplary snRNA sequences of the present disclosure can include any combination of snRNA features, including engineered snRNA feature sequences described herein. In some embodiments, the snRNA (or esnRNA) comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to the snRNA set forth in any one of SEQ ID NOs: 34 through 40.

[0168] In some embodiments, the snRNA of this disclosure comprises SEQ ID NO: 34. In some embodiments, the snRNA of this disclosure comprises SEQ ID NO: 35. In some embodiments, the snRNA of this disclosure comprises SEQ ID NO: 36. In some embodiments, the snRNA of this disclosure comprises SEQ ID NO: 37. In some embodiments, the snRNA of this disclosure comprises SEQ ID NO: 38. In some embodiments, the snRNA of this disclosure comprises SEQ ID NO: 39. In some embodiments, the snRNA of this disclosure comprises SEQ ID NO: 40.

[0169] vector Within the context of a recombinant expression vector, the term "operably linked" is intended to mean that a promoter is linked to a nucleotide sequence of interest (NOI), such as a nucleic acid element described herein, including an sgRNA or transgene, in a manner that allows for expression of the nucleotide sequence in a host cell when the vector is introduced into (or contacted with) a host cell.

[0170] In some embodiments of the compositions and methods of the present disclosure, the vector comprises one or more promoters, each controlling expression of one or more nucleic acid sequences, such as non-coding RNA or protein-encoding transgenes. In some embodiments, the vector is a single or integrated vector.

[0171] In some embodiments of the compositions and methods of the present disclosure, non-coding RNAs such as snRNAs or sgRNAs can target toxic CAG, CUG, GGCCCC, CCGGG, or GGCCC+CCGGGG RNA repeats (or their adjacent sequences) and are present in a single vector. In some embodiments of the compositions and methods of the present disclosure, the RNA targeting system can target a non-repetitive RNA of interest. In some aspects, the vectors of the present disclosure can target multiple (i.e., two or more) RNAs of interest. In some aspects, the vectors of the present disclosure can target multiple sequences within a single target RNA of interest.

[0172] One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, in which a viral-derived DNA or RNA sequence is present in the vector for packaging into a virus (e.g., retrovirus, replication-deficient retrovirus, adenovirus, replication-deficient adenovirus, and adeno-associated virus). Viral vectors also contain a polynucleotide carried by the virus for transfection into host cells. In some embodiments, the vector is a lentiviral vector (such as an integration-deficient lentiviral vector) or an adeno-associated viral (AAV) vector. Vectors may be capable of autonomous replication in the host cell into which they are introduced, such as bacterial vectors and episomal mammalian vectors having a bacterial origin of replication, and other vectors, such as non-episomal mammalian vectors, are integrated into the genome of the host cell upon introduction into the host cell, thereby replicating along with the host genome. In some embodiments, a vector, such as an expression vector, can direct the expression of a gene operably linked to the vector. Common expression vectors are often in the form of a plasmid. In some embodiments, a recombinant expression vector comprises a nucleic acid provided herein (e.g., an snRNA in a form suitable for expression in a host cell). A recombinant expression vector comprises one or more control elements operably linked to the nucleic acid sequence to be expressed, which can be selected based on the host cell to be used for expression. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to a control element(s) in a manner that allows for expression of the nucleotide sequence, for example, in an in vitro transcription / translation system or in a host cell when the vector is introduced into the host cell. In some embodiments, the control element is a promoter as described herein. In some embodiments, the control element is a terminator as provided herein.

[0173] Certain embodiments of vectors depend on factors such as the choice of host cell to be transformed and the desired expression level. The vector can be introduced into a host cell to produce transcripts, proteins, or peptides (including fusion proteins or peptides) encoded by the nucleic acids described herein, such as snRNAs, CRISPR transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.

[0174] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors, or non-viral vectors provided herein include, but are not limited to, expression regulatory elements. As used herein, "expression regulatory elements" refers to any sequence that controls the expression of a coding sequence, such as a gene. Exemplary expression regulatory elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional control elements, polyadenylation signal sequences, and introns. Expression regulatory elements can be, for example, constitutive, inducible, repressible, or tissue-specific. A "promoter" is a regulatory sequence that is a region of a polynucleotide sequence where the initiation and rate of transcription are regulated. A promoter can contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. An "enhancer" is a region of DNA to which activating proteins can bind to increase the likelihood or frequency of transcription.

[0175] In some embodiments of the compositions and methods of the present disclosure, the expression vectors, viral vectors, or non-viral vectors provided herein contain vector elements such as, but not limited to, buffer sequences derived from human genomic sequences downstream of the snRNA, thus providing the ability to encode multiple snRNAs from a single construct.

[0176] In some embodiments, the snRNA constructs disclosed herein comprise a bidirectional snRNA promoter for expressing the snRNA.

[0177] In another embodiment, the vector construct may include linker(s), signal sequence(s), and / or tag(s).

[0178] viral vectors In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenoviral vector, an adeno-associated virus (AAV) vector, or a lentiviral vector. In some embodiments, the vector is a retroviral vector, an adenoviral / retroviral chimeric vector, a herpes simplex virus I or II vector, a parvoviral vector, a reticuloendotheliosis virus vector, a poliovirus vector, a papillomavirus vector, a vaccinia virus vector, or any hybrid or chimeric vector that incorporates the preferred aspects of two or more viral vectors.

[0179] In some embodiments, the vector further comprises one or more expression control elements operably linked to the polynucleotide. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the AAV vector has low toxicity. In some embodiments, the AAV vector does not integrate into the host genome, thereby reducing the likelihood of insertional mutagenesis.

[0180] In some embodiments, the viral vector comprises sequences isolated or derived from a retrovirus. In some embodiments, the viral vector comprises sequences isolated or derived from a lentivirus. In some embodiments, the viral vector comprises sequences isolated or derived from an adenovirus. In some embodiments, the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV). In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.

[0181] Lentiviral vectors Lentiviral vectors are well known in the art (see, e.g., Trono D. (2002) Lentiviral vectors, New York: Spring-Verlag Berlin Heidelberg and Durand et al. (2011) Viruses 3(2):132-159 doi:10.3390 / v3020132). In some embodiments, exemplary lentiviral vectors that may be used in any of the compositions, systems, methods, and kits described herein include human immunodeficiency virus (HIV) 1 vectors, modified human immunodeficiency virus (HIV) 1 vectors, human immunodeficiency virus (HIV) 2 vectors, modified human immunodeficiency virus (HIV) 2 vectors, sooty mangabey monkey immunodeficiency virus (SIVSM) vectors, modified sooty mangabey monkey immunodeficiency virus (SIVSM) vectors, simian immunodeficiency virus of African green monkeys (SIVAGM) vectors, modified African The vector may include a Simian Immunodeficiency Virus of Green Macaques (SIVAGM) vector, an Equine Infectious Anemia Virus (EIAV) vector, a Modified Equine Infectious Anemia Virus (EIAV) vector, a Feline Immunodeficiency Virus (FIV) vector, a Modified Feline Immunodeficiency Virus (FIV) vector, a Visna / Maedi Virus (VNV / VMV) vector, a Modified Visna / Maedi Virus (VNV / VMV) vector, a Caprine Arthritis Encephalitis Virus (CAEV) vector, a Modified Caprine Arthritis Encephalitis Virus (CAEV) vector, a Bovine Immunodeficiency Virus (BIV), or a Modified Bovine Immunodeficiency Virus (BIV).

[0182] Adeno-associated virus vector In some embodiments, the vectors described herein are AAV viral vectors. As used herein, the term "adeno-associated virus" or "AAV" refers to a member of the class of viruses related to this name, belonging to the genus Dependoparvovirus and the family Parvoviridae. Adeno-associated viruses are single-stranded DNA viruses that grow in cells with certain functions provided by a coinfecting helper virus. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, New York. Because it is well known that various serotypes are closely related both structurally and functionally, and even at the genetic level, it is fully expected that the same principles described in these reviews will be applicable to additional AAV serotypes characterized after the publication date of these reviews. (See, e.g., Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J.R.P.Tattison, ed.; and Rose, Comprehensive Virology 3:1-61 (1974)). For example, all AAV serotypes clearly exhibit very similar replication properties mediated by homologous rep genes; all possess three related capsid proteins (such as those expressed in AAV2). The degree of relatedness is further suggested by heteroduplex analysis, which reveals extensive cross-hybridization between serotypes along the length of the genome; and the presence of similar self-annealing segments at the termini corresponding to "inverted terminal repeats" (ITRs). Furthermore, similar infectivity patterns suggest that the replication functions in each serotype are under similar regulatory control. Multiple serotypes of this virus are known to be suitable for gene delivery; all known serotypes are capable of infecting cells from a variety of tissue types.

[0183] AAV is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb in length and contains two 145-nucleotide inverted terminal repeats (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV-1 is provided under Genbank accession number NC_002077; the complete genome of AAV-2 is provided under Genbank accession number NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983); the complete genome of AAV-3 is provided under Genbank accession number NC_1829; the complete genome of AAV-4 is provided under Genbank accession number NC_001829; the AAV-5 genome is provided under Genbank accession number AF085716; the complete genome of AAV-6 is provided under Genbank accession number NC_001862; at least portions of the AAV-7 and AAV-8 genomes are provided under Genbank accession numbers AX753246 and AX753249, respectively; and the AAV-9 genome is described in Gao et al. al., J. Virol., 78:6381-6388 (2004); the AAV-10 genome is provided in Mol. Ther., 13(1):67-76 (2006); and the AAV-11 genome is provided in Virology, 330(2):375-383 (2004). The sequence of the AAV rh.74 genome is provided in U.S. Pat. No. 9,434,928. U.S. Pat. No. 9,434,928 also provides the sequences of capsid proteins and self-complementary genomes. In one embodiment, the AAV genome is a self-complementary genome. Cis-acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and host cell chromosomal integration are contained within the AAV ITRs. Three AAV promoters (designated p5, p19, and p40 for their relative map locations) drive expression of two AAV internal open reading frames encoding the rep and cap genes.The two rep promoters (p5 and p19), coupled with differential splicing of a single AAV intron (nucleotides 2107 and 2227), drive the rep gene to produce four rep proteins (rep78, rep68, rep52, and rep40), which possess multiple enzymatic properties that ultimately drive viral genome replication.

[0184] The cap gene is expressed from the p40 promoter and encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are responsible for the production of the three related capsid proteins. More specifically, after transcription of a single mRNA from which each of the VP1, VP2, and VP3 proteins is translated, the single mRNA can be spliced ​​in two different ways: either a longer or shorter intron can be excised, resulting in the formation of two mRNA pools: a 2.3 kb-long and a 2.6 kb-long mRNA pool. The longer intron is often preferred; therefore, the 2.3 kb-long mRNA can be referred to as the major splice variant. This form lacks the first AUG codon that initiates VP1 protein synthesis, resulting in a lower overall level of VP1 protein synthesis. The remaining first AUG codon in the major splice variant is the initiation codon for the VP3 protein. However, upstream of this codon in the same open reading frame is an ACG sequence (encoding threonine) surrounded by an optimal Kozak (translation initiation) context.This contributes to low-level synthesis of VP2 protein, which, like VP1, is actually a VP3 protein with additional N-terminal residues. This is discussed in detail in Becerra SP et al. (December 1985): "Direct mapping of adeno-associated virus capsid proteins B and C: a possible ACG initiation codon." Proceedings of the National Academy of Sciences of the United States of America. 82(23):7919-23; Cassinotti P et al. (November 1988): "Organization of the adeno-associated virus (AAV) capsid gene: mapping of a minor spliced ​​mRNA coding for viral capsid protein 1." Virology. 167(1):176-84; Muralidhar S et al. (January 1994): "Site-directed mutagenesis of adeno-associated virus type 2 structural protein initiation." "Codons: effects on regulation of synthesis and biological activity", Journal of Virology. 68(1):170-6, and Trempe JP, Carter BJ (September 1988) "Alternate mRNA splicing is required for synthesis of adeno-associated virus VP1 capsid protein", Journal of Virology. 62(9):3356-63, each of which is incorporated herein by reference. A single consensus polyA site is located at map position 95 of the AAV genome.The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0185] Each VP1 protein contains a VP1 portion, a VP2 portion, and a VP3 portion. The VP1 portion is the N-terminal portion of the VP1 protein that is unique to the VP1 protein. The VP2 portion is an amino acid sequence present in the VP1 protein that is also found in the N-terminal portion of the VP2 protein. The VP3 portion and the VP3 protein have the same sequence. The VP3 portion is the C-terminal portion of the VP1 protein that is shared by the VP1 protein and the VP2 protein.

[0186] The VP3 protein can be further divided into individual variable surface regions I through IX (VRI through IX, also referred to as VR1 through VR8). Each variable surface region (VR) can comprise or contain specific amino acid sequences that, alone or in combination with the specific amino acid sequences of each of the other VRs, can confer a unique infection phenotype to a particular serotype (e.g., reduced antigenicity, improved transduction, and / or tissue-specific tropism compared to other AAV serotypes), as described in DiMatta et al., "Structural Insight into the Unique Properties of Adeno-Associated Virus Serotype 9," J. Virol., Vol. 86(12):6947-6958, June 2012, the contents of which are incorporated herein by reference.

[0187] AAV possesses unique characteristics that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection in cultured cells is noncytopathic, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV can infect a large number of mammalian cells, enabling it to target a large number of different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and persist as a transcriptionally active nuclear episome (extrachromosomal element) essentially for the life of those cells. The AAV proviral genome can be inserted as cloned DNA into a plasmid, making the construction of recombinant genomes feasible. Furthermore, because signals directing AAV replication and genome encapsidation are contained within the ITRs of the AAV genome, part or all of the internal approximately 4.3 kb genome (encoding replication and structural capsid proteins, rep-cap) can be replaced with foreign DNA to generate AAV vectors. The rep and cap proteins can be provided in trans. Another significant feature of AAV is that it is an extremely stable and robust virus. It easily withstands the conditions used to inactivate adenovirus (56-65°C for several hours), making cryopreservation of AAV less important. AAV can even be lyophilized. Finally, AAV-infected cells do not tolerate superinfection.

[0188] Recombinant AAV vectors As used herein, "rAAV vector" refers to a vector that comprises, consists essentially of, or consists of one or more nucleic acid elements described herein and one or more AAV inverted terminal repeats (ITRs). When present in a host cell that provides the functionality of the rep and cap gene products, such an AAV vector can replicate and package into infectious viral particles containing the AAV capsid proteins of the present disclosure, e.g., by transfection of the host cell. In some embodiments, the AAV vector contains a promoter, at least one nucleic acid capable of encoding at least one protein or RNA, and / or an enhancer and / or terminator within the flanking ITRs, and is packaged into infectious AAV particles. The encapsidated nucleic acid portion may be referred to as the AAV vector genome. Plasmids containing rAAV vectors may also contain elements of manufacturing interest (e.g., antibiotic resistance genes, origin of replication sequences, etc.), but these are not encapsidated and therefore do not form part of the AAV particle.

[0189] In some embodiments, the rAAV vector can comprise at least two promoter sequences operably linked to a nucleic acid element such as a non-coding RNA or a transgene. In some embodiments, the rAAV vector can comprise at least one AAV inverted terminal repeat (ITR) sequence. In some embodiments, the rAAV vector can comprise at least one promoter sequence. In some embodiments, the rAAV vector can comprise at least one enhancer sequence. In some embodiments, the rAAV vector can comprise at least one polyA sequence. In some embodiments, the rAAV vector can comprise at least one reporter protein.

[0190] In some embodiments, the rAAV vector can contain more than one nucleic acid element, such as a transgene nucleic acid molecule or more than one non-coding RNA molecule. In some embodiments, the rAAV vector can contain at least two transgene nucleic acid molecules or at least two non-coding RNA molecules, such that the rAAV vector contains a first transgene nucleic acid molecule or non-coding RNA molecule and at least a second transgene nucleic acid molecule or non-coding RNA molecule. In some embodiments, the first and at least second transgene nucleic acid molecules or non-coding RNA molecules can contain the same nucleic acid sequence. In some embodiments, the first and at least second transgene nucleic acid molecules or non-coding RNA molecules can contain different nucleic acid sequences. In some embodiments, the rAAV vector contains at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or more nucleic acid elements (including non-coding RNAs or transgenes), wherein each nucleic acid element is operably linked to a promoter. In some embodiments, the promoter operably linked to each nucleic acid element is unique and / or has low sequence homology compared to other promoters in the vector.

[0191] In some embodiments, the rAAV vector can contain more than one promoter sequence. In some embodiments, the rAAV vector can contain at least two promoter sequences, such that the rAAV vector contains a first promoter sequence and at least a second promoter sequence. In some embodiments, the first and at least a second promoter sequence can contain the same sequence. In some embodiments, the first and at least a second promoter sequence can contain different sequences. In some embodiments, the first and at least a second promoter sequence can be adjacent to each other. In some embodiments in which the rAAV vector also comprises a first transgene nucleic acid molecule or non-coding RNA molecule and at least a second transgene nucleic acid molecule or non-coding RNA molecule, a first promoter can be positioned upstream (5') of the first transgene nucleic acid molecule, and at least a second promoter can be positioned between the first transgene nucleic acid molecule or non-coding RNA molecule and the at least second transgene nucleic acid molecule or non-coding RNA molecule such that the at least second promoter is downstream (3') of the first transgene nucleic acid molecule or non-coding RNA molecule and upstream (5') of the at least second transgene nucleic acid molecule or non-coding RNA molecule.

[0192] Any of the preceding rAAV vectors can further comprise at least one enhancer. The at least one enhancer can be located anywhere in the rAAV vector. In some embodiments, the at least one enhancer can be located immediately upstream (5') of the promoter.

[0193] The rAAV vectors of the present disclosure can contain any nucleic acid element of the present disclosure, including, but not limited to, transgene sequences encoding proteins and / or peptides, non-coding RNA, RNA-binding non-coding RNA, small nuclear RNA (snRNA) molecules, single guide RNA molecules (sgRNA), microRNA, short hairpin RNA (shRNA), enhancer RNA (eRNA), small nucleolar RNA (snoRNA), or long non-coding RNA (lncRNA). In some embodiments, sgRNAs are used in conjunction with CRISPR / Cas systems to target, bind to, and / or cleave nucleic acids, including DNA and RNA sequences. In some embodiments, transgene nucleic acid molecules are interchangeably referred to as nucleotide sequences of interest (NOIs). NOIs include, but are not limited to, any nucleotide sequence or transgene that can be delivered by a vector. NOIs can be synthetic, derived from naturally occurring DNA or RNA, codon-optimized, recombinant RNA / DNA, cDNA, partial genomic DNA, and / or combinations thereof. The NOI may be a coding region or a partial coding region, but need not be a coding region. The NOI may be RNA / DNA in sense or antisense orientation. The NOI is also referred to herein as, but not limited to, a transgene, heterologous sequence, gene, or therapeutic gene. The NOI may also encode a POI (protein of interest), a partial POI, or a mutated version or variant of a POI. The POI may be similar to or correspond to a wild-type protein. The POI may also be a fusion protein or a nucleoprotein complex, such as a CRISPR / Cas nucleoprotein complex. The POI may also be a PUF protein or a PUMBY protein. In some embodiments, the POI may be an RNA-targeting protein or an RNA-binding protein or a nucleoprotein complex. In some embodiments, the NOI is a non-coding RNA molecule, such as an snRNA or sgRNA.

[0194] The recombinant AAV (rAAV) genome of the present invention can comprise, consist essentially of, or consist of one or more nucleic acid elements and one or more AAV ITRs flanking the nucleic acid molecule. The production of pseudotyped rAAV is disclosed, for example, in WO2001083692. Other types of rAAV variants (e.g., rAAVs with capsid mutations) are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0195] The AAV vectors described herein may comprise, consist essentially of, or consist of one or more nucleic acid molecules and one or more AAV ITRs. In some embodiments, the nucleic acid molecules encode the snRNAs of the present disclosure. Such AAV vectors can replicate and package into infectious viral particles when present in a host cell that provides the functionality of the rep and cap gene products, for example, by transfection of the host cell. In some embodiments, the AAV vector contains a promoter, at least one nucleic acid capable of encoding at least one protein or RNA, and / or an enhancer and / or terminator within the flanking ITRs, and is packaged into infectious AAV particles. The encapsidated nucleic acid portion may be referred to as the AAV vector genome. Additionally, plasmids containing AAV vectors may contain elements for manufacturing purposes (e.g., antibiotic resistance genes, origin of replication sequences, etc.), but these are not encapsidated and therefore do not form part of the AAV particle.

[0196] In some embodiments, an AAV vector can comprise at least one nucleic acid element of the present disclosure. In some embodiments, an AAV vector can comprise at least one regulatory sequence. In some embodiments, an AAV vector can comprise at least one AAV inverted terminal repeat (ITR) sequence. In some embodiments, an AAV vector can comprise a first ITR sequence and a second ITR sequence. In some embodiments, an AAV vector can comprise at least one promoter sequence. In some embodiments, an AAV vector can comprise at least one enhancer sequence. In some embodiments, an AAV vector can comprise at least one terminator sequence. In some embodiments, an AAV vector can comprise at least one polyA sequence. In some embodiments, an AAV vector can comprise at least one linker sequence. In some embodiments, an AAV vector can comprise at least one buffer sequence. In some embodiments, an AAV vector of the present disclosure can comprise at least one nuclear localization signal, nuclear export signal, and / or both.

[0197] In some embodiments, the AAV vector can comprise a first AAV ITR sequence, a promoter sequence, an snRNA sequence, a terminator sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector can comprise, in the 5' to 3' direction, a first AAV ITR sequence, a promoter sequence, an snRNA sequence, a terminator sequence, and a second AAV ITR sequence.

[0198] In some embodiments, an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first nucleic acid element sequence, a termination sequence, a second promoter sequence, a second nucleic acid element sequence, a second termination sequence, and a second AAV ITR sequence. In some embodiments, an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first nucleic acid element sequence, a termination sequence, a second promoter sequence, a second nucleic acid element sequence, a second termination sequence, a third promoter sequence, a third nucleic acid element sequence, a third termination sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first nucleic acid element sequence, a termination, a second promoter sequence, a second nucleic acid element sequence, a second termination sequence, a third promoter sequence, a third nucleic acid element sequence, a third termination sequence, a fourth promoter sequence, a fourth nucleic acid element sequence, a fourth termination sequence, and a second AAV ITR sequence.

[0199] In some embodiments, an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, and a second AAV ITR sequence. In some embodiments, an AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination sequence, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, and a second AAV ITR sequence. In some embodiments, the AAV vector can comprise a first AAV ITR sequence, a first promoter sequence, a first snRNA sequence, a termination, a second promoter sequence, a second snRNA sequence, a second termination sequence, a third promoter sequence, a third snRNA sequence, a third termination sequence, a fourth promoter sequence, a fourth snRNA sequence, a fourth termination sequence, and a second AAV ITR sequence.

[0200] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises sequences isolated or derived from adeno-associated virus (AAV). In some embodiments, the viral vector comprises ITR sequences or capsid sequences isolated or derived from AAV of serotype AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVPO1, AAVPHP.B, AAVrh74, or AAVrh.10. In some embodiments, the AAV serotype is AAVrh.74. In one embodiment, the AAV vector comprises a modified capsid. In one embodiment, the AAV vector is an AAV2-Tyr mutant vector. In one embodiment, the AAV vector comprises a capsid with a non-tyrosine amino acid at a position corresponding to the surface-exposed tyrosine residue at Tyr252, Tyr272, Tyr275, Tyr281, Tyr508, Tyr612, Tyr704, Tyr720, Tyr730, or Tyr673 of wild-type AAV2. See also WO2008 / 124724 (incorporated herein in its entirety). In some embodiments, the AAV vector comprises an engineered capsid. AAV vectors comprising engineered capsids include, but are not limited to, AAV2.7m8, AAV9.7m8, AAV2 2tYF, and AAV8 Y733F. In some embodiments, the capsid is a ubiquitination-resistant capsid. In another embodiment, the ubiquitinated capsid is an AAV2 capsid containing tyrosine (Y) and serine (S) mutations. In another embodiment, the AAV2 capsid contains Y, S, and threonine (T) mutations. In another embodiment, the AAV2 capsid includes AAV2 capsid mutants such as, but not limited to, T455V, T491V, T550V, T659V, Y444+500+730F, and Y444+500+730F+T491V. In some embodiments, the viral vector is replication-incompetent. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (scAAV).In some embodiments, the viral vector is single-stranded (ssAAV).

[0201] In some embodiments, the snRNAs provided herein are contained within single-stranded AAV (ssAAV). In some embodiments, the snRNAs provided herein are contained within self-complementary AAV (scAAV). The single-stranded nature of the parvoviral genome requires the use of cellular machinery to provide the complementary strand for gene expression. This cellular recruitment activity is thought to be a rate-limiting factor in the efficiency of transduction and gene expression in parvoviruses and parvoviral particles. The use of scAAV, as opposed to ssAAV, solves this well-known problem by packaging both strands as a single double-stranded DNA molecule (or inverted repeat genome) that can fold into dsDNA as a result of the self-complementary viral genomic sequence. In this regard, the need for DNA synthesis or base pairing between multiple viral genomes is eliminated.

[0202] AAV ITR sequences In some embodiments of the disclosed compositions and methods, the AAV inverted terminal repeat sequence can comprise any AAV ITR sequence known in the art. In some aspects, the AAV ITR sequence can comprise, or consist of, an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrhlO, AAVll, AAV12, AAV13, or AAVrhl74 ITR sequence.

[0203] In some embodiments, the ITR sequences can comprise modified AAV ITR sequences.

[0204] In some embodiments, the AAV ITR sequences can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to SEQ ID NO: 50, 51, 52, 53, 54, or 55.

[0205] In some embodiments, the AAV vectors provided herein comprise first and second AAV ITR sequences. In some aspects, the first AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:50, 51, 52, 53, 54, or 55, and the second AAV ITR sequence can comprise, consist essentially of, or consist of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:50, 51, 52, 53, 54, or 55. In some embodiments, the first AAV ITR sequence is positioned 5' of the AAV vector. In some embodiments, the second AAV ITR sequence is positioned 3' of the AAV vector.

[0206] In some embodiments of the compositions and methods of the present disclosure, the viral vector comprises sequences isolated or derived from an adeno-associated virus (AAV).

[0207] In some embodiments of the compositions and methods of the present disclosure, the vector of the present disclosure is a non-viral vector. In some embodiments, the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex, or a dendrimer. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct for the expression of certain genetic material formed by recombinant means.

[0208] Exemplary snRNA Constructs of the Disclosure Exemplary snRNA rAAV vectors of the present disclosure can comprise one or more snRNA sequences of the present disclosure, each controlled by a distinct promoter sequence as described herein. In some embodiments, the rAAV vector comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (or any percentage in between) to an snRNA rAAV vector listed in the snRNA rAAV Vector Table below: [Table 3]

[0209] The ssAAV U7 CMV GFP vector is an ssAAV vector encoding a snRNA molecule operably linked to a U7 promoter. The vector further encodes a GFP protein operably linked to a CMV promoter. In some embodiments, the ssAAV U7 CMV GFP comprises SEQ ID NO: 41. In some embodiments, the vector comprises, in the 5' to 3' direction, a first ITR sequence, a U7 promoter sequence, a nucleic acid sequence encoding the snRNA molecule, a CMV promoter, a nucleic acid sequence encoding GFP, and a second ITR sequence.

[0210] The ssAAV U7 U7 U7 CMV GFP vector is an ssAAV vector encoding three snRNA molecules, each operably linked to a separate copy of the U7 promoter. The vector further encodes a GFP protein operably linked to a CMV promoter. In some embodiments, the ssAAV U7 U7 U7 CMV GFP vector comprises SEQ ID NO: 42. In some embodiments, the vector comprises, in the 5' to 3' direction, a first ITR sequence, a first U7 promoter sequence, a nucleic acid sequence encoding the first snRNA molecule, a second U7 promoter sequence, a nucleic acid sequence encoding the second snRNA molecule, a third U7 promoter sequence, a nucleic acid sequence encoding the third snRNA molecule, a CMV promoter, a nucleic acid sequence encoding GFP, and a second ITR sequence.

[0211] The ssAAV U7 U1 vector is an ssAAV vector encoding two snRNA molecules, each operably linked to an snRNA promoter. In some embodiments, the ssAAV U7 U1 vector comprises SEQ ID NO: 43. In some embodiments, the vector comprises, in the 5' to 3' direction, a first ITR sequence, a U7 promoter sequence, a nucleic acid sequence encoding the first snRNA molecule, a U1 promoter sequence, a nucleic acid sequence encoding the second snRNA molecule, and a second ITR sequence.

[0212] The scAAV U7 U7 U7 vector is an scAAV vector encoding four snRNA molecules, each operably linked to an snRNA promoter. In some embodiments, the ssAAV U7 U7 U7 U7 vector comprises SEQ ID NO: 44. In some embodiments, the vector comprises, in the 5' to 3' direction, a first ITR sequence, a first U7 promoter sequence, a nucleic acid sequence encoding the first snRNA molecule, a second U7 promoter sequence, a nucleic acid sequence encoding the second snRNA molecule, a third U7 promoter sequence, a nucleic acid sequence encoding the third snRNA molecule, a fourth U7 promoter sequence, a nucleic acid sequence encoding the fourth snRNA molecule, and a second ITR sequence.

[0213] The scAAV U1 U7 U4 U5 vector is an scAAV vector that encodes four copies of a snRNA molecule, each copy operably linked to a snRNA promoter. In some embodiments, the ssAAV U1 U7 U4 U5 vector comprises SEQ ID NO: 45. In some embodiments, the vector comprises, in the 5' to 3' direction, a first ITR sequence, a U1 promoter sequence, a nucleic acid sequence encoding a first snRNA molecule, a U7 promoter sequence, a nucleic acid sequence encoding a second snRNA molecule, a U4 promoter sequence, a nucleic acid sequence encoding a third snRNA molecule, a U5 promoter sequence, a nucleic acid sequence encoding a fourth snRNA molecule, and a second ITR sequence.

[0214] The scAAV U1 U7 U4 U5 vector is an scAAV vector encoding two copies of a first snRNA molecule and two copies of a second snRNA molecule, each copy operably linked to an snRNA promoter. In some embodiments, the ssAAV U1 U7 U4 U5 vector comprises SEQ ID NO: 46. In some embodiments, the vector comprises, in the 5' to 3' direction, a first ITR sequence, a U1 promoter sequence, a nucleic acid sequence encoding the first copy of the first snRNA molecule, a U7 promoter sequence, a nucleic acid sequence encoding the first copy of the second snRNA molecule, a U4 promoter sequence, a nucleic acid sequence encoding the second copy of the second snRNA molecule, a U5 promoter sequence, a nucleic acid sequence encoding the second copy of the first snRNA molecule, and a second ITR sequence.

[0215] Vector A04384 represents an scAAV snRNA vector comprising snRNA 38 regulated by a mouse U7 promoter and snRNA 42 regulated by a human U7 promoter. In some embodiments, the A04384 vector comprises SEQ ID NO:48.

[0216] Vector A04526 represents an scAAV snRNA expression cassette comprising snRNA38 / 42 regulated by a mouse U7 promoter and snRNA38 / 42 regulated by a human U7 promoter. In some embodiments, vector A04384 comprises SEQ ID NO:49.

[0217] nucleic acid A NOI (nucleotide sequence of interest), also referred to as a nucleic acid element, includes, but is not limited to, any nucleotide sequence or transgene that can be delivered by a vector. The NOI can be synthetic, derived from naturally occurring DNA or RNA, codon-optimized, recombinant RNA / DNA, cDNA, partial genomic DNA, and / or combinations thereof. The NOI can be a coding region or a partial coding region, but does not have to be a coding region. The NOI can be RNA / DNA in sense or antisense orientation. The NOI can be snRNA or sgRNA. NOIs are also referred to herein as, but are not limited to, transgenes, heterologous sequences, genes, or therapeutic genes. The NOI can also encode an RNA (ribonucleoprotein complex), a POI (protein of interest), a partial POI, or a mutated version or variant of a POI. The POI can be similar to or correspond to a wild-type protein. The POI can also be a fusion protein or a ribonucleoprotein complex (such as a snRNP).

[0218] cell Also provided herein are cells comprising the RNA targeting systems, snRNA molecules, and expression constructs described herein. In some embodiments, the present disclosure provides cells comprising the vectors, viral vectors, rAAV vectors, or AAV viral vectors of the present disclosure.

[0219] In some embodiments of the compositions and methods of the present disclosure, the cells of the present disclosure are prokaryotic cells.

[0220] In some embodiments of the compositions and methods of the present disclosure, the cells of the present disclosure are eukaryotic cells. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are bovine, murine, feline, equine, porcine, canine, simian, or human cells. In some embodiments, the cells are non-human mammalian cells, such as non-human primate cells.

[0221] In some embodiments, the cells of the present disclosure are somatic cells. In some embodiments, the cells of the present disclosure are germline cells. In some embodiments, the germline cells of the present disclosure are not human cells.

[0222] In some embodiments of the compositions and methods of the present disclosure, the cells of the present disclosure are stem cells. In some embodiments, the cells of the present disclosure are embryonic stem cells. In some embodiments, the embryonic stem cells of the present disclosure are not human cells. In some embodiments, the cells of the present disclosure are multipotent stem cells or pluripotent stem cells. In some embodiments, the cells of the present disclosure are adult stem cells. In some embodiments, the cells of the present disclosure are induced pluripotent stem cells (iPSCs). In some embodiments, the cells of the present disclosure are hematopoietic stem cells (HSCs).

[0223] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are neuronal cells.In one embodiment, the patient's cells or cells that are treated with the compositions disclosed herein include but are not limited to central nervous system (neurons), peripheral nervous system (neurons), peripheral motor neurons, and / or sensory neurons.In one embodiment, the neuronal cells are glial cells.

[0224] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are fibroblasts or epithelial cells. In some embodiments, the epithelial cells of the present disclosure form squamous epithelial cells, cuboidal epithelial cells, columnar epithelial cells, stratified epithelial cells, pseudostratified columnar epithelial cells, or transitional epithelial cells. In some embodiments, the epithelial cells of the present disclosure form glands, including, but not limited to, the pineal gland, thymus, pituitary gland, thyroid gland, adrenal gland, apocrine gland, holocrine gland, merocrine gland, serous gland, mucous gland, and sebaceous gland. In some embodiments, the epithelial cells of the present disclosure are in contact with the outer surface of an organ, including, but not limited to, the lung, spleen, stomach, pancreas, bladder, intestine, kidney, gallbladder, liver, larynx, or pharynx. In some embodiments, the epithelial cells of the present disclosure are in contact with the outer surface of a blood vessel or vein.

[0225] In some embodiments of the present disclosure, the somatic cells are ocular cells. Ocular cells include, but are not limited to, corneal epithelial cells, keratocytes, retinal pigment epithelial (RPE) cells, lens epithelial cells, iris pigment epithelial cells, conjunctival fibroblasts, non-pigmented ciliary epithelial cells, trabecular meshwork cells, ocular choroid fibroblasts, and conjunctival epithelial cells. In some embodiments, the ocular cells are retinal cells or corneal cells. In one embodiment, the retinal cells are photoreceptor cells or retinal pigment epithelial cells. In another embodiment, the retinal cells are ganglion cells, amacrine cells, bipolar cells, horizontal cells, Müller glial cells, rod cells, or cone cells. In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are primary cells.

[0226] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are cultured cells.

[0227] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are in vivo, in vitro, ex vivo, or in situ.

[0228] In some embodiments of the compositions and methods of the present disclosure, the somatic cells of the present disclosure are autologous or allogeneic.

[0229] Pharmaceutical Compositions of the Present Disclosure The present disclosure provides pharmaceutical compositions comprising the vectors, viral vectors, or AAV viral vectors of the present disclosure. In some embodiments, the vectors, viral vectors, or AAV viral vectors comprise the rAAV viral vectors of the present disclosure.

[0230] How to use The present disclosure provides a method of treating a disease or disorder in a subject in need thereof, comprising administering a therapeutically effective amount of a viral vector or pharmaceutical composition of the present disclosure.

[0231] The present disclosure provides methods of encoding an RNA or expressing an NOI in a cell using the vectors and / or rAAV vectors disclosed herein. In one embodiment, the present disclosure provides a method of modifying the activity of an RNA or a protein encoded by an RNA molecule, comprising contacting a composition of the present disclosure and a target RNA molecule under conditions suitable for binding to the RNA molecule.

[0232] The present disclosure provides a method for modifying the expression level of an RNA molecule of the present disclosure or a protein encoded by the RNA molecule, comprising contacting a cell containing the composition of the present disclosure and the RNA molecule under conditions suitable for binding to the RNA molecule. In some embodiments, the cell is in vivo, in vitro, ex vivo, or in situ. In some embodiments, the composition of the present disclosure comprises a vector containing an snRNA sequence. In some embodiments, the vector is AAV.

[0233] The present disclosure provides a method for modifying the expression level of an RNA molecule of the present disclosure or a protein encoded by the RNA molecule, comprising contacting a composition of the present disclosure and an RNA molecule under conditions suitable for knocking down, blocking, splicing, multi-targeting, or editing of a target RNA. In some embodiments, the vector is AAV.

[0234] The present disclosure provides a method for modifying the activity of a target RNA molecule or a protein encoded by the RNA molecule, comprising contacting a composition and a cell containing the RNA molecule under conditions suitable for knockdown, blocking, splicing, multi-targeting, or editing of the target RNA. In some embodiments, the cell is in vivo, in vitro, ex vivo, or in situ. In some embodiments, the composition comprises a vector comprising the snRNA sequence disclosed herein. In some embodiments, the vector is AAV.

[0235] The present disclosure provides methods of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of an snRNA composition of the present disclosure.

[0236] The present disclosure provides a method of treating a disease in a patient in need of such treatment, comprising administering to the patient a therapeutically effective amount of a non-coding RNA sequence or transgene composition of the present disclosure, wherein the composition comprises a vector containing a non-coding RNA sequence or transgene disclosed herein, and wherein the composition modifies, reduces, disrupts, knocks down, or eliminates the expression level of a toxic repeat RNA (compared to the expression level of a toxic repeat RNA treated with a non-targeting (NT) control or compared to no treatment). In another embodiment, the level of reduction is 1-fold or more. In another embodiment, the level of reduction is 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, or 10-fold. In another embodiment, the level of reduction is 10-fold or more. In another embodiment, the level of reduction is between 10-fold and 20-fold. In another embodiment, the level of reduction is 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold. In another embodiment, the gene therapy compositions disclosed herein destroy 20% to 100% of toxic repetitive RNA when administered to a patient. In one embodiment, the % elimination of toxic repetitive RNA is 20% to 99%, 25% to 99%, 50% to 99%, 80% to 99%, 90% to 99%, or 95% to 99%. In one embodiment, the elimination rate is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In another embodiment, the elimination rate is complete or 100% elimination of toxic repetitive RNA.

[0237] In some embodiments of the disclosed method, the subject of the present disclosure has been diagnosed with a disease to be treated. In some embodiments, the subject of the present disclosure exhibits at least one sign or symptom of the disorder or disease to be treated. In some embodiments, the subject of the present disclosure exhibits at least one sign or symptom of the disease.

[0238] In some embodiments of the method of the present disclosure, the subject of the present disclosure is female.In some embodiments of the method of the present disclosure, the subject of the present disclosure is male.In some embodiments, the subject of the present disclosure has two XX chromosomes or XY chromosomes.In some embodiments, the subject of the present disclosure has two XX chromosomes or XY chromosomes and a third chromosome (either X or Y).

[0239] In some embodiments of the disclosed methods, the subject of the present disclosure is a newborn, infant, child, adult, elderly, or elderly person. In some embodiments of the disclosed methods, the subject of the present disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 days old. In some embodiments of the disclosed methods, the subject of the present disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months old. In some embodiments of the methods of the present disclosure, the subject of the present disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 years old, or any year or fraction thereof in between.

[0240] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a mammal. In some embodiments, the subject of the present disclosure is a non-human mammal.

[0241] In some embodiments of the methods of the present disclosure, the subject of the present disclosure is a human.

[0242] In some embodiments of the disclosed methods, the therapeutically effective amount comprises a single dose of the disclosed composition. In some embodiments, the therapeutically effective amount comprises at least one dose of the disclosed composition. In some embodiments, the therapeutically effective amount comprises one or more doses of the disclosed composition.

[0243] In some embodiments of the disclosed methods, the therapeutically effective amount eliminates a sign or symptom of the disease or disorder. In some embodiments, the therapeutically effective amount reduces the severity of a sign or symptom of the disease or disorder.

[0244] In some embodiments of the disclosed methods, the therapeutically effective amount eliminates the disease or disorder.

[0245] In some embodiments of the disclosed methods, the therapeutically effective amount prevents the onset of a disease or disorder. In some embodiments, the therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, the therapeutically effective amount reduces the severity of a sign or symptom of a disease or disorder. In some embodiments, the therapeutically effective amount improves the prognosis of a subject.

[0246] In some embodiments of the method of the present disclosure, the composition of the present disclosure is administered to the subject by intracerebral administration. In some embodiments, the composition of the present disclosure is administered to the subject by intrastriatal route. In some embodiments, the composition of the present disclosure is administered to the subject by stereotactic injection or infusion. In some embodiments, the composition is administered to the brain. In some embodiments of the method of the present disclosure, the composition of the present disclosure is administered to the subject locally.

[0247] In some embodiments, the compositions disclosed herein are formulated as pharmaceutical compositions.In brief, the pharmaceutical compositions for use disclosed herein can comprise the protein(s) or polynucleotides encoding the protein(s) optionally contained in AAV, which are also optionally immuno-orthogonal, combined with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients.Such compositions can include buffers (such as neutral buffered saline, phosphate buffered saline, etc.); carbohydrates (such as glucose, mannose, sucrose, or dextran, mannitol, etc.); proteins; polypeptides or amino acids (such as glycine); antioxidants; chelating agents (such as EDTA or glutathione); adjuvants (such as aluminum hydroxide); and preservatives. The compositions of the present disclosure can be formulated for administration via routes such as oral, enteral, topical, transdermal, intranasal, and / or inhalation; as well as via injection or infusion, such as intravenous, intramuscular, subpial, intrathecal, intraparenchymal, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and / or parenteral administration. In certain embodiments, the compositions of the present disclosure are formulated for intracerebral or intrastriatal administration. [Example]

[0248] Example Example 1: Improved snRNA-expressing AAV vectors snRNA expression cassettes with repeated promoter sequences AAV viral vectors containing snRNA expression cassettes were constructed, and the expression of the packaged snRNA molecules was evaluated. Initially, vectors with one or more snRNA molecules, each under the control of a U7 promoter, were evaluated (Figure 1A). A02888 represents a single-stranded AAV (ssAAV) snRNA expression cassette containing a single CUG repeat-targeting snRNA regulated by a U7 promoter. A02896 represents a ssAAV snRNA expression cassette containing three CUG repeat-targeting snRNA molecules, each under the control of a U7 promoter. A03624 represents a self-complementary AAV (scAAV) snRNA expression cassette containing, in the 5' to 3' direction: a U7 promoter driving the expression of snRNA38, a U7 promoter driving the expression of snRNA42, a U7 promoter driving the expression of snRNA42, and a U7 promoter driving the expression of snRNA38. A03081 refers to an scAAV snRNA expression cassette comprising, in 5' to 3' direction: a U7 promoter driving expression of a CAG-targeting snRNA, a U7 promoter driving expression of a CAG-targeting snRNA, a U7 promoter driving expression of a CAG-targeting snRNA, and a U7 promoter driving expression of a CAG-targeting snRNA.

[0249] The packaging integrity of the U7 vector was assessed using an Agilent Tapestation. Packaging integrity (i.e., genome integrity) measures the extent to which the intact rAAV vector is present in the AAV viral vector after encapsidation and purification, and can assess the presence of any truncation products derived from homologs between individual regions of the AAV vector, such as repetitive snRNA promoters or promoters with high sequence homology. For the vectors shown in Figure 1A, the monotypic and self-complementary vectors A029888 and A03624 contained a 1x band, indicating a nucleic acid sequence with a single snRNA (Figure 1B). For vectors A02896 and A03081, which each contain three or four snRNA sequences, a mixture of species related to one (1x), two (2x), three (3x), and four (4x) snRNA molecules was observed (Figure 1B). The 3x or 4x band was the expected species, while the 1x, 2x, and 3x species indicated truncation events. Full-length sequencing of the scAAV A03624 vector reveals multiple species corresponding to 1x, 2x, and 3x truncations (Figure 1C). The above data demonstrate that rAAV vectors containing snRNA expression cassettes with identical promoter repeats can form self-complementary intramolecular or intermolecular reactions at the promoter repeat sites, leading to truncation and / or other packaging issues, such as conversion of the double-stranded genome to a single-stranded genome (Figure 2).

[0250] Next, we evaluated AAV viral vectors carrying snRNA expression cassettes with various snRNA promoters (Figure 3). Two ssAAV snRNA expression cassettes are shown: one showing snRNA molecules 38 and 42 under the control of the U7 promoter, and the second showing the pair of snRNAs 38 and 42 under the control of the U1 promoter. A second expression cassette is shown, which additionally contains a stuffer sequence. Two scAAV snRNA expression cassettes are shown: one showing snRNAs 38 / 42 under the control of the U7 promoter, and the second showing snRNAs 38 / 42 under the control of the U1 promoter. The second scAAV expression cassette shows, from 5' to 3', the U1 promoter driving snRNA 38 / 42 expression, the U7 promoter driving snRNA 38 / 42 expression, the U4 promoter driving snRNA 38 / 42 expression, and the U5 promoter driving snRNA 38 / 42 expression.

[0251] A03981 contains snRNA molecule 38 under the control of the U7 promoter and snRNA 42 under the control of the U1 promoter (Figure 4A). A04184 not only contains snRNA 38 / 42 under the control of the U7 promoter and a second snRNA 38 / 42 under the control of the U1 promoter, but also a stuffer sequence (Figure 4A).

[0252] After packaging and purification of AAV viral vectors containing A03981 and A04184, Tapestation images revealed a single predominant species of each (Figure 4B). Sequencing of the AAV viral vector containing A03981 (Figure 4C) revealed a single-stranded species and a dimeric / self-complementary species. Sequencing of the AAV viral vector containing A04184 (Figure 4D) revealed a single species that did not exhibit self-complementarity-induced shortening, thus demonstrating an AAV viral vector with a single intended rAAV vector. This finding is supported by Figure 4E, which visualizes the sequencing coverage of the plasmid (pAAV vector) containing the A04184 genome. Sequencing reads map almost perfectly to the intended genomic ITR / expression cassette.

[0253] Evaluation of scAAVs with promoter repeats A04232 contains snRNA38 / 42 under the control of the U7 promoter and snRNA38 / 42 under the control of the U1 promoter (Figure 5A). A04234 shows an snRNA molecule targeting the CUG repeat under the control of the U7 promoter and a second snRNA targeting the CUG repeat under the control of the U1 promoter (Figure 5A).

[0254] After packaging and purification of AAV viral vectors containing A04232 and A04234, Tapestation imaging revealed a predominant single species of each vector (Figure 5B). Sequencing of AAV viral vectors containing A04232 revealed a predominant species of scAAV rAAV vector and a smaller population of single-stranded rAAV vectors (Figure 5C).

[0255] The sequencing coverage of the plasmid (pAAV vector) containing the genome of A04232 was visualized (Figures 5D and 5E). Sequencing reads in the shorter "ssAAV bin" map almost perfectly to the intended single-stranded genomic ITR / expression cassette, indicating that these are full-length ssAAV genomes and not unintended partial genomes or truncations (Figure 5D). Sequencing reads in the longer "scAAV bin" map almost perfectly to the intended genomic ITR / expression cassette (Figure 5E).

[0256] Evaluation of rAAV vectors with four different snRNA promoters A03624 shows a self-complementary AAV (scAAV) snRNA expression cassette containing, from 5' to 3', the following: a U7 promoter driving expression of snRNA38, a U7 promoter driving expression of snRNA42, a U7 promoter driving expression of snRNA42, and a U7 promoter driving expression of snRNA38 (Figure 6A). A04226 shows, from 5' to 3', the following: a U1 promoter driving expression of snRNA38 / 42, a U7 promoter driving expression of snRNA38 / 42, a U4 promoter driving expression of snRNA38 / 42, and a U5 promoter driving expression of snRNA38 / 42 (Figure 6A).

[0257] After packaging and purification of AAV viral vectors including A03624 and A04226, the packaging integrity of each was assessed via Tapestation. Tapestation sample traces of A03624 and A04226, revealing multiple species, are also shown (Figures 6C and 6D). Vector A04226 represents the predominant species.

[0258] snRNA expression cassettes with repeated and diverse promoter sequences AAV viral vectors containing snRNA expression cassettes were constructed, and the expression of the packaged snRNA molecules was evaluated. Vectors with one or more snRNA molecules, each under the control of a U7 promoter, were evaluated (Figure 7A). Tapestation imaging revealed that a single U7 promoter driving the expression of a single snRNA produced a single visible band. Triple snRNAs controlled by U7 promoters produced multiple species, evidenced by multiple bands. Dual U1 U7 promoters, each controlling the expression of an snRNA molecule, produced a single band visible by Tapestation. Sequencing of each vector from Figure 7A confirmed the tapestation findings (Figure 7B).

[0259] Additional vectors were evaluated by Tapestation in Figure 8A. "U7 U7 U7 U7" refers to an snRNA expression cassette in which four U7 promoters each drive the expression of at least one snRNA molecule. "U1 U7 U4 U5 identical snRNA" refers to an snRNA expression cassette in which the U1, U7, U4, and U5 promoters each drive the expression of an individual copy of an snRNA molecule such that four copies of the snRNA molecule are present in the cassette. "U1 U7 U4 U5 different snRNA" refers to an snRNA expression cassette in which the U1, U7, U4, and U5 promoters each drive the expression of a different snRNA molecule such that the expression cassette contains four snRNA molecules with distinct sequences. The tapestation images and tapestation traces in Figures 8A and 8B demonstrate that vectors lacking repeated promoter sequences produce significantly purer vector products with fewer truncated products (i.e., with higher genomic integrity). This finding is supported by sequencing of the AAV viral vector genome (Fig. 8C).

[0260] The expression levels of snRNAs across various multiplicities of infection (MOIs) were evaluated for various rAAV vectors carrying snRNA expression cassettes (Figure 9). The snRNA expression cassettes evaluated included: a) 4xU7 (four U7 promoters each driving the expression of the same snRNA molecule at two different MOIs of 3e5 and 1e6; b) U1 and U7 promoters each driving the expression of snRNA molecules at three MOIs of 1e5, 5e5, and 1e6; and c) U1, U7, U4, and U5 promoters each driving the expression of snRNA molecules at three MOIs of 1e5, 5e5, and 1e6. Cassettes with diverse promoter sequences produced significantly more copies per ng of RNA.

[0261] snRNA expression cassettes with human and mouse promoter sequences The use of related promoters, human U7 and mouse U7, was evaluated. The evaluated promoters have 57.3% identity and 57.3% similarity (Figure 10D). A04384 shows an scAAV snRNA expression cassette containing snRNA 38 regulated by the mouse U7 promoter and snRNA 42 regulated by the human U7 promoter (Figure 10A). Figure 10B is a tapestation image showing an rAAV vector containing the snRNA expression cassette of Figure 10A. Figure 10C is a tapestation trace of the tapestation image of Figure 10B.

[0262] A04526 shows an scAAV snRNA expression cassette containing snRNA38 / 42 regulated by the mouse U7 promoter and snRNA38 / 42 regulated by the human U7 promoter (Figure 11A). Figure 11B is a tapestation image showing an rAAV vector containing the snRNA expression cassette of Figure 11A. Figure 11C is a tapestation trace of the tapestation image of Figure 10B.

[0263] Analysis of tapestation images and traces from A04526 and A04384 reveals that the desired rAAV vector is the predominant species, indicating that the mouse and human U7 promoters do not share a high enough identity to allow for self-complementary-based truncation.

[0264] Incorporation by Reference All documents cited herein (including any cross-referenced or related patents or applications) are incorporated herein by reference in their entirety, unless expressly excluded or otherwise limited. The citation of any document is not an admission that it is prior art with respect to any invention disclosed or embodied herein, or that it alone, or in any combination with any other reference, teaches, suggests, or discloses any such invention. Furthermore, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to said term in this document shall control.

[0265] Other embodiments While particular embodiments of the present disclosure have been illustrated and described, various other changes and modifications can be made without departing from the spirit and scope of the present disclosure, and the appended claims encompass within their scope all such changes and modifications within the scope of the present disclosure.

Claims

1. A recombinant adeno-associated virus (rAAV) vector comprising: a first inverted terminal repeat (ITR) sequence, a first promoter sequence, a first nucleic acid element, a second promoter sequence, a second nucleic acid element, and Second ITR sequence Including, A recombinant adeno-associated virus (rAAV) vector, wherein the first promoter sequence and the second promoter sequence are separate promoter sequences.

2. 2. The rAAV vector of claim 1, wherein the first and second nucleic acid elements comprise a nucleic acid encoding a non-coding RNA or a transgene.

3. 2. The rAAV vector of claim 1, wherein the non-coding RNA is a small nuclear RNA (snRNA) molecule, a single guide RNA molecule (sgRNA), a microRNA, a short hairpin RNA (shRNA), an enhancer RNA (eRNA), a small nucleolar RNA (snoRNA), or a long non-coding RNA (lncRNA).

4. 10. The rAAV vector of any one of the preceding claims, further comprising one or more additional promoter sequences.

5. 10. The rAAV vector of any one of the preceding claims, wherein the one or more additional promoter sequences are different from the first promoter sequence and the second promoter sequence.

6. 10. The rAAAV vector of any one of the preceding claims, further comprising one or more additional nucleic acid elements.

7. 10. The rAAV vector of any one of the preceding claims, wherein the first promoter sequence has less than about 75% sequence identity to the second promoter sequence and the one or more additional promoter sequences.

8. 10. The rAAV vector of any one of the preceding claims, wherein there are from about 50 to about 5,000 nucleotides between the 3' end of the first promoter and the 5' start of the second promoter.

9. 10. The rAAV vector of any one of the preceding claims, wherein the length of each of the first nucleic acid element, the second nucleic acid element, and the one or more additional nucleic acid elements is between about 50 and 5,000 nucleotides.

10. 10. The rAAV vector of any one of the preceding claims, wherein the first nucleic acid element, the second nucleic acid element, and / or the one or more additional nucleic acid elements comprise one snRNA molecule.

11. 10. The rAAV vector of any one of the preceding claims, wherein the first nucleic acid element, the second nucleic acid element, and / or the one or more additional nucleic acid elements comprise two snRNA molecules.

12. 10. The rAAV vector of any one of the preceding claims, wherein the two snRNA molecules are separated by a spacer sequence region.

13. 10. The rAAV vector of any one of the preceding claims, wherein the snRNA molecule is a modified snRNA molecule.

14. 10. The rAAV vector of any one of the preceding claims, wherein the snRNA molecule comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NOs:34 to 40.

15. 10. The rAAV vector of any one of the preceding claims, wherein the promoter is selected from a U1, U2, U4, U5, U6, U7, H1, 7SK, or tRNA promoter.

16. 10. The rAAV vector of any one of the preceding claims, wherein the promoter regulates expression of an mRNA-encoding gene.

17. 10. The rAAV vector of any one of the preceding claims, wherein the U1 promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:

11.

18. 10. The rAAV vector of any one of the preceding claims, wherein the U4 promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO:

6.

19. 10. The rAAV vector of any one of the preceding claims, wherein the U5 promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:7 or SEQ ID NO:

14.

20. 10. The rAAV vector of any one of the preceding claims, wherein the U7 promoter comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:12, or SEQ ID NO:

13.

21. 10. The rAAV vector of any one of the preceding claims, wherein the first ITR sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:50-55.

22. 10. The rAAV vector of any one of the preceding claims, wherein the second ITR sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:50-55.

23. 10. The rAAV vector of any one of the preceding claims, further comprising one or more terminator sequences.

24. 10. The rAAV vector of any one of the preceding claims, wherein the terminator sequence is a U1, U2, U4, U5, U6, or U7 terminator sequence.

25. 10. The rAAV vector of any one of the preceding claims, wherein the terminator sequence is a polyA sequence or a Pol III termination sequence.

26. 10. The rAAV vector of any one of the preceding claims, wherein the U1 terminator sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO:

21.

27. 10. The rAAV vector of any one of the preceding claims, wherein the U4 terminator sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:

23.

28. 10. The rAAV vector of any one of the preceding claims, wherein the U5 terminator sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage in between) identical to SEQ ID NO:

24.

29. 10. The rAAV vector of any one of the preceding claims, wherein the U7 terminator sequence comprises, consists essentially of, or consists of a nucleic acid sequence at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% (or any percentage therebetween) identical to SEQ ID NO:

20.

30. 10. The rAAV vector of any one of the preceding claims, wherein the rAAV vector is a single-stranded AAV vector (ssAAV).

31. 10. The rAAV vector of any one of the preceding claims, wherein the rAAV vector is a self-complementary AAV vector (scAAV).

32. 10. An AAV viral vector comprising the rAAV vector of any one of the preceding claims, wherein the viral vector comprises AAV capsid proteins.

33. 33. The AAV viral vector of claim 32, wherein the AAV capsid protein is an AAV1 capsid protein, an AAV2 capsid protein, an AAV3 capsid protein, an AAV3B capsid protein, an AAV4 capsid protein, an AAV5 capsid protein, an AAV6 capsid protein, an AAV7 capsid protein, an AAV8 capsid protein, an AAV9 capsid protein, an AAV10 capsid protein, an AAV11 capsid protein, an AAV12 capsid protein, an AAV13 capsid protein, an AAVPHP.B capsid protein, an AAVrh74 capsid protein, an AAVrhlO capsid protein, or a modified AAV capsid protein.

34. The AAV viral vector of claim 32, wherein the AAV viral vector exhibits higher expression in a subject or cell compared to an AAV viral vector comprising an rAAV vector comprising a single non-coding RNA or transgene or an rAAV vector comprising a repeated promoter sequence operably linked to a non-coding RNA molecule or transgene sequence.

35. A pharmaceutical composition comprising the AAV viral vector of claim 32.

36. A cell comprising the rAAV vector of claim 1 or the AAV viral vector of claim 32.

37. A method for treating a disease or disorder in a subject in need thereof, comprising administering a therapeutically effective amount of an AAV viral vector described in claim 29 or a pharmaceutical composition described in claim 32.

Images