Apolipoprotein c3 (APOC3) irna compositions and methods of use thereof

Abstract

To provide modulators of C3 expression for treating apolipoprotein APOC3 associated disorders, such as hypertriglyceridemia.SOLUTION: To provide apolipoprotein C3 (APOC3) gene-targeting double-stranded RNA (dsRNA) agents. Also provided are methods of inhibiting APOC3 gene expression and methods of preventing and treating APOC3 associated disorders, such as hypertriglyceridemia, non-alcoholic fatty liver disease, non-alcoholic diabetic hepatitis, polycystic ovarian syndrome, kidney disease, obesity-type 2 fat (insulin-resistance), high-blood pressure, atherosclerosis, and pancrease using such dsRNA agents.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 144,516, filed February 2, 2021, and U.S. Provisional Patent Application No. 62 / 977,875, filed February 18, 2020, the entire contents of each of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on February 10, 2021, is named 121301-10420_SL.txt and is 249,455 bytes in size. [Background technology]

[0003] Apolipoprotein C3 (APOC3) is a very low-density lipoprotein (VLDL) and a key regulator of lipoprotein metabolism. In humans, APOC3 is encoded by the APOC3 gene, which is located in a gene cluster on the long arm of chromosome 11 together with the APOA1 and APOA4 genes. APOC3 is expressed as a small 99-amino acid protein in the liver and, to a lesser extent, in the small intestine. After removal of the 20-amino acid signal peptide in the endoplasmic reticulum, the 79-amino acid mature ApoC3 protein is formed, which can exist as either a non-glycosylated or glycosylated isoform.

[0004] The primary role of APOC3 is as a regulator of lipolysis through noncompetitive inhibition of endothelial-bound lipoprotein lipase (LPL). LPL hydrolyzes triacylglycerol in triacylglycerol-rich lipoproteins (TRL), releasing fatty acids into plasma and converting large triacylglycerol-rich particles into small triacylglycerol-depleted remnant lipoproteins. APOC3-deficient individuals have low levels of TRL, which is coupled with highly efficient lipolysis of triacylglycerol. Furthermore, mice lacking the APOC3 gene have been shown to have low plasma triacylglycerol levels and efficient TRL catabolism. APOC3 also inhibits hepatic lipase (HL), a lipolytic enzyme synthesized in the liver that possesses triacylglycerol lipase and phospholipase A1 activities. The inhibitory effect of APOC3 on HL further reduces hepatic lipolysis and uptake of TRL remnants. APOC3 has also been shown to stimulate the synthesis of very low-density lipoproteins (VLDL). The underlying mechanism associated with this action of APOC3 may be related to the inhibition of proteasome-mediated degradation of APOB, which results in increased synthesis and secretion of APOB and increased synthesis of VLDL triacylglycerol. Therefore, APOC3 may play a key role in regulating hepatic VLDL output.

[0005] Cellular studies have reported that APOC3 can interfere with the binding of TRLs and remnants to hepatic lipoprotein receptors. APOC3 can abolish APOB- and ApoE-mediated binding of lipoproteins to the low-density lipoprotein receptor (LDLR) by masking or altering the conformation of APOB and APOE. Binding of chylomicron particles and VLDL particles to the lipolysis-stimulated lipoprotein receptor (LSR) is also significantly inhibited by APOC3.

[0006] Elevated APOC3 levels lead to the development of hypertriglyceridemia, or elevated blood triglyceride levels (hypertriglyceridemia). Elevated triglyceride levels are associated with a variety of diseases, including cardiovascular disease, atherosclerosis, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, polycystic ovary syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance), hypertension, and skin lesions (xanthomas). Extremely high triglyceride levels also increase the risk of acute pancreatitis. Therefore, modulation of APOC3 metabolism is an important therapeutic approach for hypertriglyceridemia and related diseases. Summary of the Invention [Problem to be solved by the invention]

[0007] Thus, there is a need in the art for modulators of APOC3 expression to treat apolipoprotein C3-related disorders, such as hypertriglyceridemia. [Means for solving the problem]

[0008] The present invention provides iRNA compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of genes encoding apolipoprotein C3 (APOC3). The apolipoprotein C3 (APOC3) can be APOC3 in a cell, for example, in a cell within a subject, such as a human subject.

[0009] In one aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 1 by no more than 0, 1, 2, or 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from the nucleotide sequence of SEQ ID NO: 2 by no more than 1, 2, or 3 nucleotides. In one embodiment, the dsRNA agent comprises at least one thermolabile nucleotide modification, such as an abasic modification; a mismatch with the opposite nucleotide in the duplex; and a labile sugar modification, a 2'-deoxy modification, an acyclic nucleotide, an unlocked nucleic acid (UNA), or a glycerol nucleic acid (GNA), for example, the antisense strand comprises at least one thermolabile nucleotide modification.

[0010] In another aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding apolipoprotein C3, and the region of complementarity comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-5, 14, and 15.

[0011] In one aspect, the present invention relates to a double-stranded region comprising a sense strand and an antisense strand, wherein the sense strand is a sequence of nucleotides 232-254; 233-255; 238-260; 239-261; 242-264; 243-265; 244-266; 264-286; 268-290; 426-448; 431-453; 432-454; 433-455; 435-457; 436-458; 499-521; 500-522 of the nucleotide sequence of SEQ ID NO: 1. and 511-533, and the antisense strand comprises at least 19 consecutive nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:2.

[0012] In one embodiment, the antisense strand is AD-959917.1;AD-959918.1;AD-960096.1;AD-960064.1;AD-959914.1;AD-959941.1;AD-960031.1;AD-960063.1;AD-960293.1;AD-960288.1;AD-960445.1;AD-960292.1;AD-960475.1;AD-960442.1;AD-960470.1;AD-960436.1; It comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides or less from any one of the nucleotide sequences of the antisense strand of a duplex selected from the group consisting of AD-960446.1; AD-960474.1; AD-960294.1; AD-960471.1; AD-960314.1; AD-960443.1; AD-960282.1; AD-960283.1; AD-80794.7; AD-960478.1; AD-960481.1 and AD-960482.1.

[0013] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 235-257; 238-260; 242-264; 243-265; 244-266; 426-448; 430-450; 431-453; 432-454; 433-455; 435-457; 436-458; 499-521; 503-525; and 504-526 of SEQ ID NO:1, and the antisense strand comprises at least 19 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:2.

[0014] In one embodiment, the antisense strand comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the nucleotide sequences of the antisense strand of a duplex selected from the group consisting of AD-959917.1; AD-960064.1; AD-960031.1; AD-960063.1; AD-960293.1; AD-960288.1; AD-960445.1; AD-960292.1; AD-960443.1; AD-80794.7; and AD-959910.1.

[0015] In another aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 232-254; 239-261; 242-264; 244-266; 258-280; 264-286; 268-290, 429-451; 430-450; 430-452; 433-455; 434-456; 435-457; 500-522; 503-525; 507-529; and 510-532 of SEQ ID NO:1, and the antisense strand comprises at least 19 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:2.

[0016] In one embodiment, the antisense strand comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the antisense strand nucleotide sequences of the duplex selected from the group consisting of AD-80794.8; AD-959907.2; AD-959914.2; AD-959916.2; AD-959932.2; AD-960314.2; AD-959941.2; AD-960030.2; AD-960062.2; AD-960064.2; AD-960065.2; AD-960066.2; AD-960294.2; AD-960471.2; AD-960474.2; AD-960478.2; and AD-960481.2.

[0017] In one aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 429 to 455 or 504 to 532 of SEQ ID NO:1, and the antisense strand comprises at least 19 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:2.

[0018] In another aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 429-451; 430-452; 431-451; 432-452; 433-455; 434-452; 504-526; and 506-526 of SEQ ID NO:1, and the antisense strand comprises at least 19 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:2.

[0019] In one embodiment, the antisense strand comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the nucleotide sequences of the antisense strand of a duplex selected from the group consisting of AD-960030; AD-960064; AD-1143243; AD-1143245; AD-1143247; AD-1143249; AD-1143256; AD-1143260; AD-1143278; AD-1143287; AD-1143295; AD-1143299; AD-1143302; and AD-1143305.

[0020] In one embodiment, the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence of the antisense strand of the duplex, AD-1143278 or AD-960064.

[0021] In one embodiment, the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of nucleotides 429 to 456 of SEQ ID NO:1 by 0, 1, 2, or no more than 3 nucleotides.

[0022] In one embodiment, the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of nucleotides 433-455 of SEQ ID NO:1 by 0, 1, 2, or no more than 3 nucleotides.

[0023] In one embodiment, the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of nucleotides 434 to 452 of SEQ ID NO:1 by 0, 1, 2, or no more than 3 nucleotides.

[0024] In one embodiment, the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence of the antisense strand of the duplex AD-1143243.

[0025] In one embodiment, the dsRNA agent includes at least one modified nucleotide.

[0026] In one embodiment, substantially all of the nucleotides in the sense strand include a modification; substantially all of the nucleotides in the antisense strand include a modification; or substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand include a modification.

[0027] In one embodiment, all of the nucleotides in the sense strand include a modification; all of the nucleotides in the antisense strand include a modification; or all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand include a modification.

[0028] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally fixed nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino modified nucleotide, a 2'-O-allyl modified nucleotide, a 2'-C-alkyl modified nucleotide, a 2'-hydroxyl (hydroxly) modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-O-alkyl modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide comprising a non-natural base, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexynyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a nucleotide comprising a 5'-phosphate, a nucleotide comprising a 5'-phosphate mimic, a thermolabile nucleotide, a glycol-modified nucleotide (GNA), and a 2-O-(N-methylacetamido) modified nucleotide; and combinations thereof.

[0029] In one embodiment, the modification on the nucleotide is selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and glycol; and combinations thereof.

[0030] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of deoxynucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, glycol modified nucleotides (GNAs), such as Ggn, Cgn, Tgn, or Agn, and vinylphosphonate nucleotides; and combinations thereof.

[0031] In another embodiment, at least one of the modifications on the nucleotide is a thermolabile nucleotide modification.

[0032] In one embodiment, the thermolabile nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in a duplex; and a labile sugar modification, a 2'-deoxy modification, an acyclic nucleotide, an unlocked nucleic acid (UNA), and a glycerol nucleic acid (GNA).

[0033] The double-stranded region can be 19 to 30 nucleotide pairs in length; 19 to 25 nucleotide pairs in length; 19 to 23 nucleotide pairs in length; 23 to 27 nucleotide pairs in length; or 21 to 23 nucleotide pairs in length.

[0034] In one embodiment, each strand is independently 30 nucleotides or less in length.

[0035] In one embodiment, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

[0036] The region of complementarity can be at least 17 nucleotides in length; between 19 and 23 nucleotides in length; or 19 nucleotides in length.

[0037] In one embodiment, at least one strand comprises a 3' overhang of at least 1 nucleotide, hi another embodiment, at least one strand comprises a 3' overhang of at least 2 nucleotides.

[0038] In one embodiment, the dsRNA agent further comprises a ligand.

[0039] In one embodiment, the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent.

[0040] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0041] In one embodiment, the ligand is one or more GalNAc derivatives conjugated via a monovalent, divalent, or trivalent branched linker.

[0042] In one embodiment, the ligand is

[0043] [ka] is.

[0044] In one embodiment, the dsRNA agent has the following structure:

[0045] [ka] wherein X is O or S.

[0046] In one embodiment, X is O.

[0047] In one embodiment, the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

[0048] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3' end of one strand, eg, the antisense strand or the sense strand.

[0049] In another embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5' end of one strand, eg, the antisense strand or the sense strand.

[0050] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkages are at both the 5'-end and the 3'-end of one strand. In one embodiment, the strand is the antisense strand.

[0051] In one embodiment, the base pair at position 1 of the 5' end of the antisense strand of the duplex is an AU base pair.

[0052] In one aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from the nucleotide sequence of nucleotides 434-452 of SEQ ID NO:1, and the antisense strand comprises at least 19 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:2, wherein substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand comprise modifications selected from the group consisting of 2'-O-methyl, 2'-fluoro, and deoxy modifications, and both the sense strand and the antisense strand independently further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage, and wherein at least one strand is conjugated to a ligand.

[0053] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand include a modification selected from the group consisting of a 2'-O-methyl modification, a 2'-fluoro modification, and a 2'-deoxy modification.

[0054] In one embodiment, the sense strand comprises two to six, e.g., two, three, four, five, or six, 2'-fluoro modified nucleotides. In another embodiment, the sense strand comprises six or fewer, e.g., zero, one, two, three, four, five, or six, 2'-fluoro modified nucleotides.

[0055] In one embodiment, the sense strand includes no more than two, eg, 0, 1, or 2, 2'-deoxy modified nucleotides.

[0056] In one embodiment, the antisense strand includes four or fewer 2'-fluoro modified nucleotides, for example, 0, 1, 2, 3, or 4.

[0057] In one embodiment, the antisense strand contains five or fewer 2'-deoxy modified nucleotides, e.g., 0, 1, 2, 3, 4, or 5. In another embodiment, the antisense strand contains one to five, e.g., 1, 2, 3, 4, or 5, deoxy-nucleotides.

[0058] In one embodiment, the sense strand contains four 2'-fluoro modified nucleotides, e.g., nucleotides 7 and 9-11, counting from the 5' end, and the antisense strand contains two 2'-fluoro modified nucleotides, e.g., nucleotides 14 and 16, counting from the 5' end, and three 2'-deoxy modified nucleotides, e.g., nucleotides 2, 5, and 7, counting from the 5' end.

[0059] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3' end of one strand, eg, the antisense strand or the sense strand.

[0060] In another embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5' end of one strand, eg, the antisense strand or the sense strand.

[0061] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkages are at both the 5'-end and the 3'-end of one strand. In one embodiment, the strand is the antisense strand.

[0062] In one embodiment, the sense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at the 5' end.

[0063] In one embodiment, the antisense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at the 5' end.

[0064] In another embodiment, the antisense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at both the 5' and 3' ends.

[0065] In one embodiment, the sense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at the 5' end, and the antisense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at both the 5' and 3' ends.

[0066] In one embodiment, the ligand is conjugated to the sense strand.

[0067] In one embodiment, the ligand is conjugated to the 3' end of the sense strand.

[0068] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative of n.

[0069] In one embodiment, the ligand is one or more GalNAc derivatives conjugated via a monovalent, divalent, or trivalent branched linker.

[0070] In one embodiment, the ligand is

[0071] [ka] is.

[0072] In one embodiment, the dsRNA agent has the following structure:

[0073] [ka] wherein X is O or S.

[0074] In one embodiment, X is O.

[0075] In one embodiment, the sense strand comprises at least 17 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-CUUAAAAGGGACAGUAUUCUA-3' (SEQ ID NO: 13).

[0076] In one embodiment, the sense strand comprises at least 19 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-CUUAAAAGGGACAGUAUUCUA-3' (SEQ ID NO: 13).

[0077] In one embodiment, the sense strand comprises the nucleotide sequence 5'-CUUAAAAGGGACAGUAUUCUA-3' (SEQ ID NO: 13).

[0078] In one embodiment, the antisense strand comprises at least 17 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-UAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 14).

[0079] In one embodiment, the antisense strand comprises at least 19 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-UAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 14).

[0080] In one embodiment, the antisense strand comprises at least 21 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-UAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 14).

[0081] In one embodiment, the antisense strand comprises the nucleotide sequence 5'-UAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 14).

[0082] In one embodiment, the sense strand comprises the nucleotide sequence 5'-CUUAAAAGGGACAGUAUUCUA-3' (SEQ ID NO: 13) and the antisense strand comprises the nucleotide sequence 5'-UAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 14).

[0083] In one embodiment, the sense strand differs from the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15) by three or fewer modified nucleotides, e.g., zero, one, two, or three; a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; and s is a phosphorothioate linkage.

[0084] In one embodiment, the antisense strand differs from the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16) by three or fewer modified nucleotides, e.g., zero, one, two, or three; a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; and s is a phosphorothioate linkage.

[0085] In one embodiment, the sense strand comprises the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15), and the antisense strand comprises the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16), where a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; and s is a phosphorothioate linkage.

[0086] In one embodiment, the sense strand comprises the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucuaL96-3' (SEQ ID NO: 17), and the antisense strand comprises the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16), where a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage, and L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol.

[0087] In one embodiment, the sense strand comprises the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15), the antisense strand comprises the nucleotide sequence of 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16), where a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage, and the 3' end of the sense strand has the following scheme:

[0088] [ka] wherein X is O.

[0089] In one embodiment, the sense strand comprises at least 17 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-CUUAAAAGGGACAGUAUUCUU-3' (SEQ ID NO: 48).

[0090] In one embodiment, the sense strand comprises at least 19 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-CUUAAAAGGGACAGUAUUCUU-3' (SEQ ID NO: 48).

[0091] In one embodiment, the sense strand comprises the nucleotide sequence 5'-CUUAAAAGGGACAGUAUUCUU-3' (SEQ ID NO: 48).

[0092] In one embodiment, the antisense strand comprises at least 17 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-AAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 315).

[0093] In one embodiment, the antisense strand comprises at least 19 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-AAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 315).

[0094] In one embodiment, the antisense strand comprises at least 21 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-AAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 315).

[0095] In one embodiment, the antisense strand comprises the nucleotide sequence 5'-AAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 315).

[0096] In one embodiment, the sense strand comprises the nucleotide sequence of 5'-CUUAAAAGGGACAGUAUUCUU-3' (SEQ ID NO: 48) and the antisense strand comprises the nucleotide sequence of 5'-AAGAAUACUGUCCCUUUUAAGCC-3' (SEQ ID NO: 315).

[0097] In one embodiment, the sense strand differs from the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucuu-3' (SEQ ID NO: 377) by three or fewer modified nucleotides, e.g., zero, one, two, or three; a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; and s is a phosphorothioate linkage.

[0098] In one embodiment, the antisense strand differs from the nucleotide sequence 5'-asdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 866) by three or fewer modified nucleotides, e.g., zero, one, two, or three; a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; and s is a phosphorothioate linkage.

[0099] In one embodiment, the sense strand comprises the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucuu-3' (SEQ ID NO: 377); the antisense strand comprises the nucleotide sequence of 5'-asdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 866); a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; and s is a phosphorothioate linkage.

[0100] In one embodiment, the sense strand comprises the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucuuL96-3' (SEQ ID NO: 377); the antisense strand comprises the nucleotide sequence of 5'-asdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 866); a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage, and L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol.

[0101] In one embodiment, the sense strand comprises the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucuu-3' (SEQ ID NO: 377); the antisense strand comprises the nucleotide sequence of 5'-asdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 866); a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage, and the 3' end of the sense strand has the following scheme:

[0102] [ka] wherein X is O.

[0103] In one embodiment, the sense strand comprises at least 17 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-AAAAGGGACAGUAUUCUCAGU-3' (SEQ ID NO: 30).

[0104] In one embodiment, the sense strand comprises at least 19 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-AAAAGGGACAGUAUUCUCAGU-3' (SEQ ID NO: 30).

[0105] In one embodiment, the sense strand comprises the nucleotide sequence 5'-AAAAGGGACAGUAUUCUCAGU-3' (SEQ ID NO: 30).

[0106] In one embodiment, the antisense strand comprises at least 17 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-ACUGAGAAUACUGUCCCUUUUAA-3' (SEQ ID NO: 31).

[0107] In one embodiment, the antisense strand comprises at least 19 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-ACUGAGAAUACUGUCCCUUUUAA-3' (SEQ ID NO: 31).

[0108] In one embodiment, the antisense strand comprises at least 21 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence 5'-ACUGAGAAUACUGUCCCUUUUAA-3' (SEQ ID NO: 31).

[0109] In one embodiment, the antisense strand comprises the nucleotide sequence 5'-ACUGAGAAUACUGUCCCUUUUAA-3' (SEQ ID NO: 31).

[0110] In one embodiment, the sense strand comprises the nucleotide sequence of 5'-AAAAGGGACAGUAUUCUCAGU-3' (SEQ ID NO: 30) and the antisense strand comprises the nucleotide sequence of 5'-ACUGAGAAUACUGUCCCUUUUAA-3' (SEQ ID NO: 31).

[0111] In one embodiment, the sense strand differs from the nucleotide sequence 5'-asasaaggGfaCfAfGfuauucucagu-3' (SEQ ID NO: 350) by three or fewer modified nucleotides, e.g., zero, one, two, or three; a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; and s is a phosphorothioate linkage.

[0112] In one embodiment, the antisense strand differs from the nucleotide sequence 5'-asCfsugaGfaAfUfacugUfcCfcuuuusasa-3' (SEQ ID NO: 351) by three or fewer modified nucleotides, e.g., zero, one, two, or three; a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; and s is a phosphorothioate linkage.

[0113] In one embodiment, the sense strand comprises the nucleotide sequence 5'-asasaaggGfaCfAfGfuauucucagu-3' (SEQ ID NO: 350), and the antisense strand comprises the nucleotide sequence 5'-asCfsugaGfaAfUfacugUfcCfcuuuusasa-3' (SEQ ID NO: 351), where a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; and s is a phosphorothioate linkage.

[0114] In one embodiment, the sense strand comprises the nucleotide sequence 5'-asasaaggGfaCfAfGfuauucucaguL96-3' (SEQ ID NO: 350), and the antisense strand comprises the nucleotide sequence 5'-asCfsugaGfaAfUfacugUfcCfcuuuusasa-3' (SEQ ID NO: 351), wherein a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; s is a phosphorothioate linkage, and L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol.

[0115] In one embodiment, the sense strand comprises the nucleotide sequence of 5'-asasaaggGfaCfAfGfuauucucagu-3' (SEQ ID NO: 350), the antisense strand comprises the nucleotide sequence of 5'-asCfsugaGfaAfUfacugUfcCfcuuuusasa-3' (SEQ ID NO: 351), wherein a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; s is a phosphorothioate linkage, and the 3' end of the sense strand has the following structure:

[0116] [ka] wherein X is O.

[0117] In one embodiment, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell, wherein the dsRNA comprises a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from the nucleotide sequence of nucleotides 429-456 of SEQ ID NO:1, and the antisense strand comprises at least 19 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:2, wherein substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand comprise modifications selected from the group consisting of 2'-O-methyl, 2'-fluoro, and deoxy modifications, and both the sense strand and the antisense strand independently further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage, and wherein at least one strand is conjugated to a ligand.

[0118] In one embodiment, the sense strand comprises between two and six 2'-fluoro modified nucleotides.

[0119] In one embodiment, the antisense strand comprises no more than four 2'-fluoro modified nucleotides.

[0120] In one embodiment, the antisense strand comprises 1 to 5 deoxy-modified nucleotides.

[0121] In one aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences from nucleotides 429 to 456 of SEQ ID NO:1, and the antisense strand comprises at least 19 contiguous nucleotides from the corresponding nucleotide sequence of SEQ ID NO:2, wherein all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand comprise modifications selected from the group consisting of 2'-O-methyl, 2'-fluoro, and deoxy modifications, and both the sense strand and the antisense strand independently further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage, and wherein at least one strand is conjugated to a ligand.

[0122] In one embodiment, the sense strand comprises between two and six 2'-fluoro modified nucleotides.

[0123] In one embodiment, the sense strand comprises four 2'-fluoro modified nucleotides.

[0124] In one embodiment, the antisense strand comprises two to four 2'-fluoro modified nucleotides.

[0125] In one embodiment, the antisense strand comprises two 2'-fluoro modified nucleotides.

[0126] In one embodiment, the antisense strand comprises 1 to 5 2'-deoxy modified nucleotides.

[0127] In one embodiment, the antisense strand comprises three 2'-deoxy modified nucleotides.

[0128] In one embodiment, the sense strand contains four 2'-fluoro modified nucleotides at nucleotides 7 and 9-11, counting from the 5' end, and the antisense strand contains two 2'-fluoro modified nucleotides at nucleotides 14 and 16, counting from the 5' end, and three 2'-deoxy modified nucleotides at nucleotides 2, 5, and 7, counting from the 5' end.

[0129] In one embodiment, the sense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at the 5' end.

[0130] In one embodiment, the antisense strand contains two phosphorothioate or methylphosphonate internucleotide linkages at both the 5' and 3' ends.

[0131] In one embodiment, the sense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at the 5' end, and the antisense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at both the 5' and 3' ends.

[0132] In one embodiment, the ligand is conjugated to the 3' end of the sense strand.

[0133] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0134] In one embodiment, the ligand is one or more GalNAc derivatives conjugated via a monovalent, divalent, or trivalent branched linker.

[0135] In one embodiment, the ligand is

[0136] [ka] is.

[0137] In one embodiment, the dsRNA agent has the following structure:

[0138] [ka] wherein X is O.

[0139] In one aspect, the invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand differs from the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15) by no more than three modified nucleotides, and the antisense strand differs from the nucleotide sequence of 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16) by no more than three modified nucleotides, wherein a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; and s is a phosphorothioate linkage.

[0140] In one embodiment, the sense strand differs from the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15) by no more than two modified nucleotides, and the antisense strand differs from the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16) by no more than two modified nucleotides.

[0141] In one embodiment, the sense strand differs from the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15) by no more than one modified nucleotide, and the antisense strand differs from the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16) by no more than one modified nucleotide.

[0142] In one embodiment, the dsRNA agent has the following structure:

[0143] [ka] wherein X is O.

[0144] In one aspect, the present invention provides a double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in cells, the agent comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15), and the antisense strand comprises the nucleotide sequence of 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3'*SEQ ID NO: 16), wherein a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; and s is a phosphorothioate linkage.

[0145] In one embodiment, the present invention provides a nucleic acid fragment comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucuaL96-3' (SEQ ID NO: 17), and the antisense strand comprises the nucleotide sequence of 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16), wherein a, g, c, and u are 2'-O-methyl (2'-OMe)A, A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell is provided, wherein Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage; and L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol.

[0146] In another embodiment, the present invention comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15), the antisense strand comprises the nucleotide sequence of 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16), wherein a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage; and the 3' end of the sense strand has a structure represented by the following scheme:

[0147] [ka] and X is O.

[0148] In one embodiment, the present invention provides a nucleic acid sequence encoding a double-stranded nucleic acid comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand consists of the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15), the antisense strand consists of the nucleotide sequence of 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16), wherein a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage; and the 3' end of the sense strand has a structure represented by the following scheme:

[0149] [ka] and X is O.

[0150] The invention also provides cells containing any of the dsRNA agents of the invention, and pharmaceutical compositions comprising any of the dsRNA agents of the invention.

[0151] Pharmaceutical compositions of the invention can also contain dsRNA agents in a non-buffered solution, e.g., saline or water; pharmaceutical compositions of the invention can also contain dsRNA agents in a buffered solution, e.g., a buffer comprising acetate, citrate, procuramine, carbonate, or phosphate, or any combination thereof; or phosphate buffered saline (PBS).

[0152] In one aspect, the present invention provides a method for inhibiting the expression of the apolipoprotein C3 (APOC3) gene in a cell, comprising contacting the cell with either a dsRNA of the present invention or a pharmaceutical composition of the present invention, thereby inhibiting the expression of the APOC3 gene in the cell.

[0153] In one embodiment, the cell is a cell within a subject, e.g., a human subject, e.g., a subject having an apolipoprotein C3-related disorder, such as an apolipoprotein C3-related disorder selected from the group consisting of hypertriglyceridemia, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, polycystic ovary syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance), high blood pressure, atherosclerosis, and pancreatitis.

[0154] In one embodiment, contacting the cell with the dsRNA agent inhibits expression of APOC3 by at least 50%, 60%, 70%, 80%, 90%, or 95%.

[0155] In one embodiment, inhibiting the expression of apolipoprotein C3 reduces APOC3 protein levels in the subject's serum by at least 50%, 60%, 70%, 80%, 90%, or 95%.

[0156] In one aspect, the present invention provides a method for treating the subject with the disorder that will benefit from reducing apolipoprotein C3 (APOC3) expression.The method comprises administering to the subject a therapeutically effective amount of the dsRNA of the present invention or the pharmaceutical composition of the present invention, thereby treating the subject with the disorder that will benefit from reducing APOC3 expression.

[0157] In another aspect, the present invention provides a method for preventing at least one symptom in the subject with the disorder that will benefit from reducing apolipoprotein C3 (APOC3) expression.The method comprises administering to the subject a prophylactically effective amount of the dsRNA of the present invention or any of the pharmaceutical compositions of the present invention, thereby preventing at least one symptom in the subject with the disorder that will benefit from reducing APOC3 expression.

[0158] In one embodiment, the disorder is an apolipoprotein C3-associated disorder, for example, the apolipoprotein C3-associated disorder is selected from the group consisting of hypertriglyceridemia, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, polycystic ovary syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance), hypertension, atherosclerosis, and pancreatitis.

[0159] In one embodiment, the apolipoprotein C3-related disorder is hypertriglyceridemia.

[0160] In one embodiment, the subject is a human.

[0161] In one embodiment, the dsRNA agent is administered to a subject at a dose of about 0.01 mg / kg to about 50 mg / kg.

[0162] In one embodiment, the dsRNA agent is administered subcutaneously to the subject.

[0163] In one embodiment, the method of the invention further comprises determining the level of apolipoprotein C3 in a sample from the subject.

[0164] In one embodiment, the level of apolipoprotein C3 in the subject's sample is the protein level of apolipoprotein C3 in a blood or serum sample.

[0165] In certain embodiments, the method of the present invention further comprises administering an additional therapeutic agent to the subject. In one embodiment, the additional therapeutic agent is a dsRNA agent that targets PCSK9, such as inclisiran. In one embodiment, the additional therapeutic agent is a PCSK9 inhibitor. In one embodiment, the PCSK9 inhibitor is an anti-PCSK9 monoclonal antibody, such as evolocumab (Repatha®) and alirocumab (Praluent®). In another embodiment, the PCSK9 inhibitor is a dsRNA agent that targets PCSK9, such as inclisiran. In further embodiments, the additional therapeutic agent is selected from the group consisting of an HMG-CoA reductase inhibitor, a fibrate, a bile acid sequestrant, niacin, an antiplatelet agent, an angiotensin-converting enzyme inhibitor, an angiotensin II receptor antagonist, an acyl-CoA cholesterol acetyltransferase (ACAT) inhibitor, a cholesterol absorption inhibitor, a cholesterol ester transfer protein (CETP) inhibitor, a microsomal triglyceride transfer protein (MTTP) inhibitor, a cholesterol modulator, a bile acid modulator, a peroxisome proliferator-activated receptor (PPAR) agonist, a gene-based therapy, a combined vasoprotectant, a glycoprotein Ilb / IIIa inhibitor, aspirin or an aspirin-like compound, an IBAT inhibitor, a squalene synthase inhibitor, a monocyte chemoattractant protein (MCP) I inhibitor, or a fish oil.

[0166] The present invention also provides kits comprising either a dsRNA of the invention, or a pharmaceutical composition of the invention, and, where appropriate, instructions for use. [Brief explanation of the drawings]

[0167] [Figure 1] Figure 1 is a graph showing human APOC3 mRNA levels in mice (n=3 per group) 14 days after subcutaneous administration of a single 3 mg / kg dose of the indicated dsRNA duplex. Human APOC3 mRNA levels are shown relative to control levels detected by PBS treatment. [Figure 2] Figure 2 is a graph showing human APOC3 mRNA levels in mice (n=3 per group) 14 days after subcutaneous administration of a single 3 mg / kg dose of the indicated dsRNA duplex. Human APOC3 mRNA levels are shown relative to control levels detected by PBS treatment. [Figure 3] 3 is a graph showing human APOC3 mRNA levels in mice (n=3 per group) 14 days after subcutaneous administration of a single 3 mg / kg dose of the indicated dsRNA duplex. Human APOC3 mRNA levels are shown relative to control levels detected by PBS treatment. DETAILED DESCRIPTION OF THE INVENTION

[0168] The present invention provides iRNA compositions that effect RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the apolipoprotein C3 (APO3) gene. The gene can be a gene in a cell, for example, a cell within a subject, such as a human subject. The use of these iRNAs allows for targeted degradation of the mRNA of the corresponding gene (apolipoprotein C3 gene) in a mammal.

[0169] The iRNAs of the present invention are designed to target the human apolipoprotein C3 gene, including portions of the gene that are conserved among apolipoprotein C3 orthologs of other mammalian species. Without intending to be limited by theory, it is believed that the combination or subcombination of the above-mentioned properties and specific target sites or specific modifications in these iRNAs confers improved efficacy, stability, potency, durability, and safety to the iRNAs of the present invention.

[0170] Thus, the present invention provides methods for treating and preventing apolipoprotein C3-related disorders, such as hypertriglyceridemia, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, polycystic ovary syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance), hypertension, atherosclerosis, and pancreatitis, using iRNA compositions that result in RNA-induced silencing complex (RISC)-mediated cleavage of the RNA transcript of the apolipoprotein C3 gene.

[0171] The iRNA of the present invention is at most about 30 nucleotides in length or less, for example, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, and comprises an RNA strand (antisense strand) having a region that is substantially complementary to at least a portion of an mRNA transcript of the APOC3 gene.

[0172] In certain embodiments, one or both strands of a double-stranded RNAi agent of the invention are up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a portion of an mRNA transcript of the APOC3 gene. In some embodiments, such iRNA agents with long antisense strands can include a second RNA strand (sense strand), preferably 20-60 nucleotides in length, where the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.

[0173] The use of iRNA of the present invention allows the targeting degradation of the mRNA of corresponding gene (apolipoprotein C3 gene) in mammals.Using in vitro assay, the inventors have confirmed that iRNA targeting APOC3 gene can strongly mediate RNAi, resulting in significant inhibition of APOC3 gene expression.Therefore, the method and composition comprising these iRNA are useful for treating subjects with apolipoprotein C3-related disorders, such as hypertriglyceridemia, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, polycystic ovarian syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance), hypertension, atherosclerosis and pancreatitis.

[0174] Thus, the present invention provides methods and combination therapies for treating subjects with disorders that would benefit from inhibiting or reducing expression of the APOC3 gene, e.g., apolipoprotein C3-related diseases such as hypertriglyceridemia, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, polycystic ovary syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance), hypertension, atherosclerosis, and pancreatitis, using iRNA compositions that affect RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the APOC3 gene.

[0175] The present invention also provides a method for preventing at least one symptom in the subject with disorders that benefit from the inhibition or reduction of the expression of APOC3 gene, such as hypertriglyceridemia, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, polycystic ovarian syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance), high blood pressure, atherosclerosis and pancreatitis.For example, in the subject with hypertriglyceridemia, the method of the present invention can reduce at least one symptom in the subject, for example, reduce triglyceride level.

[0176] The "Detailed Description of the Invention" below discloses how to make and use compositions containing iRNA to inhibit expression of the APOC3 gene, as well as compositions, uses, and methods for treating subjects who would benefit from inhibiting and / or reducing expression of the APOC3 gene, e.g., subjects susceptible to or diagnosed with an apolipoprotein C3-related disorder.

[0177] I. Definition In order that the present invention may be more readily understood, certain terms are first defined. Additionally, it should be noted that whenever a value or range of values ​​for a parameter is recited, all values ​​and ranges intermediate to the recited values ​​are also intended to be part of the invention.

[0178] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality of elements.

[0179] As used herein, the term "including" is used interchangeably with the phrase "including but not limited to."

[0180] As used herein, the term "or" is used to mean, and is used interchangeably with, the term "and / or," unless the context clearly indicates otherwise. For example, "the sense strand or the antisense strand" is understood to mean "the sense strand or the antisense strand, or the sense strand and the antisense strand."

[0181] The term "about" is used herein to mean within typical tolerances in the art. For example, "about" can be understood to be about two standard deviations from the mean. In certain embodiments, "about" means ±10%. In certain embodiments, "about" means ±5%. When "about" is present before a series of numbers or ranges, it is understood that "about" can modify each of the series of numbers or ranges of numbers.

[0182] The term "at least" before a number or series of numbers is understood to include the number adjacent to the term "at least," and all subsequent numbers or integers that can be logically included, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 19 nucleotides of a 21-nucleotide nucleic acid molecule" means that 19, 20, or 21 nucleotides have the indicated property. When "at least" is present before a series of numbers or ranges, it is understood that "at least" can modify each of the series of numbers or ranges of numbers.

[0183] As used herein, "less than" or "less than" is understood to refer to the value adjacent to this phrase and to values ​​or integers logically below it, up to zero, as is logical from the context. For example, a duplex with an overhang of "2 nucleotides or less" has an overhang of 2, 1, or 0 nucleotides. When "less than" appears after a series of numbers or ranges, it is understood that "less than" can modify each of the series of numbers or ranges of numbers. As used herein, a range includes both the upper and lower limits.

[0184] As used herein, a detection method may include determining that the amount of analyte present is below the detection level of the method.

[0185] In the event of a discrepancy between the indicated target site and the nucleotide sequence of the sense or antisense strand, the indicated sequence takes precedence.

[0186] In the event of a discrepancy between the sequence and its site indicated on the transcript or other sequences, the nucleotide sequence listed herein takes precedence.

[0187] As used herein, the term "APOC3" refers to the well-known gene encoding apolipoprotein C3, as well as its protein product, also known in the art as HALP2 or APOCIII.

[0188] The term "APOC3" refers to human APOC3, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:4557322 (NM_000040.3; SEQ ID NO:1; reverse complement: SEQ ID NO:2); cynomolgus monkey (Macaca fascicularis) APOC3, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:544489959 (XM_05579730.1; SEQ ID NO:3; reverse complement: SEQ ID NO:4); rhesus monkey (Macaca mulatta) APOC3, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:297269260 (XM_001090312.4; SEQ ID NO:5; reverse complement: SEQ ID NO:6). mulatta) APOC3; mouse (Mus musculus) APOC3, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:577019555 (NM_023114.4, SEQ ID NO:7; reverse complement: SEQ ID NO:8); rat (Rattus norvegicus) APOC3, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:402534545 (NM_012501.2, SEQ ID NO:9; reverse complement: SEQ ID NOs:2-10); and rabbit (Oryctolagus cuniculus) APOC3, the amino acid sequence and complete coding sequence of which can be found, for example, in GenBank Accession No. GI:655601498 (XM_002708371.3, SEQ ID NO:11; reverse complement: SEQ ID NO:12).

[0189] Further information about APOC3 can be found, for example, at www.ncbi.nlm.nih.gov / gene / 345.

[0190] Further examples of APOC3 mRNA sequences are readily available through public databases such as GenBank, UniProt, OMIM, and the Macaca Genome Project website.

[0191] As used herein, the term "APOC3" also refers to the naturally occurring DNA sequence variation of APOC3 gene, such as single nucleotide polymorphism (SNP) in APOC3 gene.The SNP in exemplary APOC3 DNA sequence can be found through the dbSNP database available at www.ncbi.nlm.nih.gov / projects / SNP / .Non-limiting examples of sequence variation in APOC3 gene include, for example, rs2854116 and rs2854117, two variations described in Petersen, KF et al., (2010), N. Engl. J. Med. 362(12):1082-1089, the entire contents of which are incorporated herein by reference.

[0192] Exemplary APOC3 nucleotide sequences can also be found in SEQ ID NOs: 1-12. SEQ ID NOs: 2, 4, 6, 8, 10, and 12 are the reverse complement sequences of SEQ ID NOs: 1, 3, 5, 7, 9, and 11, respectively.

[0193] The entire contents of each of the foregoing GenBank Accession Numbers and Gene Database Numbers as of the filing date of this application are incorporated herein by reference. As used herein, "target sequence" refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed upon transcription of the apolipoprotein C3 gene, including mRNA that is the product of RNA processing of the primary transcript. The target portion of the sequence will be at least sufficiently long to serve as a substrate for iRNA-guided cleavage at or near this portion of the nucleotide sequence of the mRNA molecule formed upon transcription of the APOC3 gene. In one embodiment, the target sequence is within the protein-coding region of APOC3.

[0194] The target sequence can be about 19-36 nucleotides in length, for example, preferably about 19-30 nucleotides in length. For example, the target sequence can be about 19-30, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In certain embodiments, the target sequence is 19 to 23 nucleotides in length, and may be 21 to 23 nucleotides in length. Ranges and lengths intermediate to the above-listed ranges and lengths are also contemplated as part of this disclosure.

[0195] As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a chain of nucleotides described by a sequence referenced using standard nucleotide nomenclature.

[0196] "G", "C", "A", "T" and "U" each generally represent the nucleotide that contains guanine, cytosine, adenine, thymidine and uracil as a base, respectively.However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to the modified nucleotide or surrogate replacement portion (see, for example, Table 1), which will be further detailed below.Those skilled in the art will be well aware that guanine, cytosine, adenine and uracil can be replaced by other portions without substantially changing the base pairing properties of the oligonucleotide that contains the nucleotide that carries such a replacement portion.For example, and without limitation, a nucleotide that contains inosine as its base can base pair with a nucleotide that contains adenine, cytosine or uracil.Therefore, a nucleotide that contains uracil, guanine or adenine can be replaced by a nucleotide that contains inosine, for example, in the nucleotide sequence of the dsRNA featured in the present invention. In another example, adenine and cytosine at any position within an oligonucleotide can be replaced with guanine and uracil, respectively, to form a GU wobble base pair with the target mRNA. Sequences containing such replacements are suitable for the compositions and methods featured in this invention.

[0197] The terms "iRNA," "RNAi agent," "iRNA agent," and "RNA interference agent," as used interchangeably herein, refer to agents that contain RNA and mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway, as defined herein. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNA modulates, for example, inhibits, the expression of apolipoprotein C3 gene in cells, for example, cells within a subject, such as a mammalian subject.

[0198] In one embodiment, the RNAi agent of the present invention comprises a single-stranded RNA that interacts with a target RNA sequence, such as a target mRNA sequence of apolipoprotein C3, and directs the cleavage of the target RNA. Without wishing to be bound by theory, it is believed that long double-stranded RNA introduced into cells is degraded into siRNA by a type III endonuclease known as Dicer [Sharp et al. (2001) Genes Dev. 15:485]. Dicer, a ribonuclease III-like enzyme, processes dsRNA into 19-23 base pair short interfering RNAs with characteristic two-base 3' overhangs [Bernstein, et al., (2001) Nature 409:363]. Then, siRNA is incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to guide target recognition [Nykanen, et al., (2001) Cell 107:309]. When bound to the appropriate target mRNA, one or more endonucleases in RISC cleave the target, inducing silencing [Elbashir, et al., (2001) Genes Dev. 15:188]. Thus, in one aspect, the present invention relates to a single-stranded RNA (siRNA) that is produced in cells and promotes the formation of a RISC complex that performs the silencing of a target gene, i.e., the apolipoprotein C3 (APOC3) gene. Therefore, in this specification, the term "siRNA" is also used to refer to the iRNA described above.

[0199] In certain embodiments, RNAi agents can be single-stranded siRNA (ssRNAi) introduced into cells or organisms to inhibit target mRNA. Single-stranded RNAi agents bind to RISC endonuclease Argonaute 2, which then cleaves target mRNA. Single-stranded siRNAs are generally 15-30 nucleotides and chemically modified. The design and testing of single-stranded siRNAs are described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as single-stranded siRNAs, chemically modified by the method described herein or Lima et al., (2012) Cell 150:883-894.

[0200] In certain embodiments, the "iRNA" for use in the compositions, uses, and methods of the present invention is double-stranded RNA, and is referred to herein as a "double-stranded RNA agent," a "double-stranded RNA (dsRNA) molecule," a "dsRNA agent," or a "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel, substantially complementary nucleic acid strands, and is referred to as having a "sense" and "antisense" orientation relative to the target RNA, i.e., the apolipoprotein C3 (APOC3)3 gene. In some embodiments of the present invention, double-stranded RNA (dsRNA) induces the degradation of target RNA, for example, mRNA, through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

[0201] Generally, the majority of nucleotides in each strand of a dsRNA molecule are ribonucleotides; however, as described in detail herein, each strand or both strands may also contain one or more non-ribonucleotides, such as deoxyribonucleotides or modified nucleotides.In addition, as used herein, "iRNA" may contain ribonucleotides with chemical modifications; iRNA may contain substantial modifications in multiple nucleotides.As used herein, the term "modified nucleotide" refers independently to a nucleotide having a modified sugar moiety, a modified internucleotide linkage, or a modified nucleobase, or any combination thereof.Thus, the term modified nucleotide includes, for example, the substitution, addition, or removal of functional groups or atoms from the internucleoside linkage, sugar moiety, or nucleobase.Modifications suitable for use in the agents of the present invention include all types of modifications disclosed herein or known in the art.Any such modifications used in siRNA-type molecules are encompassed by "iRNA" or "RNAi agent" for the purposes of this specification and claims.

[0202] In certain embodiments of the present disclosure, incorporation of deoxynucleotides when present in an RNAi agent is considered to constitute modified nucleotides.

[0203] The duplex region can be of any length that allows for specific degradation of the desired target RNA via the RISC pathway, and can be about 19-36 base pairs in length, e.g., about 19-30 base pairs in length, e.g., about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, e.g., about 19-30, 1 The length can range from 9 to 29, 19 to 28, 19 to 27, 19 to 26, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 base pairs. In certain embodiments, the duplex region is 19 to 21 base pairs in length, e.g., 21 base pairs in length. Ranges and lengths intermediate to the above-listed ranges and lengths are also contemplated as part of this disclosure.

[0204] The two strands forming the duplex structure may be different portions of a single larger RNA molecule or may be separate RNA molecules. When the two strands are part of a single larger molecule and are therefore connected by an uninterrupted chain of nucleotides that forms a duplex structure between the 3' end of one strand and the 5' end of the other strand, the connecting RNA strands are referred to as "hairpin loops." A hairpin loop may contain at least one unpaired nucleotide. In some embodiments, a hairpin loop may contain at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 23, or more unpaired nucleotides. In some embodiments, a hairpin loop may be 10 nucleotides or less. In some embodiments, a hairpin loop may be 8 unpaired nucleotides or less. In some embodiments, a hairpin loop may be 4 to 10 unpaired nucleotides. In some embodiments, a hairpin loop may be 4 to 8 nucleotides.

[0205] When two substantially complementary strands of dsRNA are contained in separate RNA molecules, these molecules do not necessarily have to be covalently connected, but may be. When the two strands are covalently connected by means other than an uninterrupted chain of nucleotides that forms a duplex structure between the 3' end of one strand and the 5' end of the other strand, the connecting structure is called a "linker." The RNA strands may have the same number of nucleotides or different numbers of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest dsRNA strand minus any overhangs present in the duplex. In addition to the duplex structure, the RNAi may contain one or more nucleotide overhangs. In one embodiment of an RNAi agent, at least one strand contains a 3' overhang of at least one nucleotide. In another embodiment, at least one strand contains a 3' overhang of at least two nucleotides, for example, a 3' overhang of 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5' overhang of at least one nucleotide. In certain embodiments, at least one strand comprises a 5' overhang of at least two nucleotides, for example, a 5' overhang of 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In still other embodiments, both the 3' end and the 5' end of one strand of the RNAi agent comprise an overhang of at least one nucleotide.

[0206] In certain embodiments, an iRNA agent of the invention is a dsRNA, each strand of which contains 19-23 nucleotides, that interacts with a target RNA sequence, e.g., the apolipoprotein C3 (APOC3) gene, to direct cleavage of the target RNA.

[0207] In some embodiments, an iRNA of the present disclosure is a 24-30 nucleotide dsRNA that interacts with a target RNA sequence, for example, a target mRNA sequence of APOC3, and directs cleavage of the target RNA.

[0208] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the duplex structure of a double-stranded iRNA. For example, a nucleotide overhang exists when the 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa. A dsRNA can include an overhang of at least one nucleotide; alternatively, the overhang can include at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides, or more nucleotides. The nucleotide overhang can include or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleotide overhang(s) can be present at the 5'-end, the 3'-end, or both ends of the antisense or sense strand of a dsRNA.

[0209] In one embodiment, the antisense strand of the dsRNA has an overhang of 1 to 10 nucleotides, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, at the 3' or 5' end. In one embodiment, the sense strand of the dsRNA has an overhang of 1 to 10 nucleotides, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, at the 3' or 5' end. In another embodiment, one or more of the nucleotides in the overhang are replaced by a thiophosphate nucleoside.

[0210] In certain embodiments, the antisense strand of the dsRNA has an overhang of 1 to 10 nucleotides at the 3' or 5' end, for example, 0 to 3, 1 to 3, 2 to 4, 2 to 5, 4 to 10, 5 to 10, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the sense strand of the dsRNA has an overhang of 1 to 10 nucleotides at the 3' or 5' end, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In another embodiment, one or more of the nucleotides in the overhang are replaced by a thiophosphate nucleoside.

[0211] In certain embodiments, the antisense strand of the dsRNA has an overhang of 1 to 10 nucleotides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, at the 3' or 5' end. In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include a length extending beyond 10 nucleotides, e.g., 1 to 30 nucleotides, 2 to 30 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, 10 to 20 nucleotides, or 10 to 15 nucleotides. In certain embodiments, the overhang is present on the sense strand of the duplex. In certain embodiments, the overhang is present on the 3' end of the sense strand of the duplex. In certain embodiments, the overhang is present on the 5' end of the sense strand of the duplex. In certain embodiments, the overhang is present on the antisense strand of the duplex. In certain embodiments, the overhang is present on the 3' end of the antisense strand of the duplex. In certain embodiments, the extended overhang is present on the 5'-end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang are replaced by thiophosphate nucleosides. In certain embodiments, the overhang comprises a self-complementary portion so that the overhang can form a hairpin structure that is stable under physiological conditions.

[0212] " Blunt " or " blunt end " means that there are no unpaired nucleotides at this end of the double-stranded RNA agent, i.e., there are no nucleotide overhangs. A "blunt-ended" double-stranded RNA agent is double-stranded throughout its entire length, i.e., there are no nucleotide overhangs at either end of the molecule. The RNAi agent of the present invention includes an RNAi agent without nucleotide overhangs at one end (i.e., an agent with one overhang and one blunt end), or an RNAi agent without nucleotide overhangs at either end. Such molecules will most likely be double-stranded throughout their entire length.

[0213] The term "antisense strand" or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, that includes a region that is substantially complementary to a target sequence, e.g., APOC3 mRNA.

[0214] As used herein, the term "region of complementarity" refers to a region on the antisense strand that is substantially complementary to a sequence, e.g., a target sequence, e.g., an apolipoprotein C3 nucleotide sequence as defined herein. If the region of complementarity is not perfectly complementary to the target sequence, mismatches may occur within the internal or terminal regions of the molecule. Generally, the most tolerable mismatches are found within the terminal regions, e.g., within 5, 4, or 3 nucleotides from the 5' or 3' end of the iRNA. In some embodiments, double-stranded RNA agents of the present invention contain nucleotide mismatches within the antisense strand. In some embodiments, the antisense strand of a double-stranded RNA agent of the present invention contains four or fewer mismatches with the target mRNA, e.g., the antisense strand contains four, three, two, one, or zero mismatches with the target mRNA. In some embodiments, the antisense strand of a double-stranded RNA agent of the invention contains four or fewer mismatches with the sense strand, e.g., the antisense strand contains four, three, two, one, or zero mismatches with the sense strand. In some embodiments, a double-stranded RNA agent of the invention contains a nucleotide mismatch within the sense strand. In some embodiments, the sense strand of a double-stranded RNA agent of the invention contains four or fewer mismatches with the antisense strand, e.g., the sense strand contains four, three, two, one, or zero mismatches with the antisense strand. In some embodiments, the nucleotide mismatch is within, e.g., 5, 4, or 3 nucleotides from the 3' end of the iRNA. In another embodiment, the nucleotide mismatch is within, e.g., the 3' terminal nucleotide of the iRNA agent. In some embodiments, the mismatch(es) is not within the seed region.

[0215] Thus, the RNAi agents described herein may contain one or more mismatches with the target sequence. In one embodiment, the RNAi agents described herein contain three or fewer mismatches (i.e., three, two, one, or zero mismatches). In one embodiment, the RNAi agents described herein contain two or fewer mismatches. In one embodiment, the RNAi agents described herein contain one or fewer mismatches. In one embodiment, the RNAi agents described herein contain zero mismatches. In certain embodiments, when the antisense strand of an RNAi agent contains a mismatch with the target sequence, the mismatch may be restricted to within the last five nucleotides from the 5' or 3' end of the complementary region. For example, in such an embodiment, for a 23-nucleotide RNAi agent, the strand complementary to a region of the APOC3 gene generally does not contain any mismatches within the central 13 nucleotides. Methods described herein or known in the art can be used to determine whether an RNAi agent containing a mismatch with the target sequence is effective in inhibiting expression of the APOC3 gene. Examining the effectiveness of mismatched RNAi agents in inhibiting APOC3 gene expression is important, especially when specific complementary regions within the APOC3 gene are known to have polymorphic sequence variation within the population.

[0216] As used herein, the term "sense strand" or "passenger strand," as that term is defined herein, refers to an iRNA strand that includes a region that is substantially complementary to a region of the antisense strand.

[0217] As used herein, "substantially all of the nucleotides are modified" means that the majority, but not all, of the nucleotides are modified and may contain no more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0218] As used herein, the term "cleavage region" refers to the region located immediately adjacent to the cleavage site. The cleavage site is the site on the target where cleavage occurs. In some embodiments, the cleavage region is located on either end of the cleavage site and comprises three bases immediately adjacent to the cleavage site. In some embodiments, the cleavage region is located on either end of the cleavage site and comprises two bases immediately adjacent to the cleavage site. In some embodiments, the cleavage site specifically occurs at the site where nucleotides 10 and 11 of the antisense strand bind, and the cleavage region comprises nucleotides 11, 12, and 13.

[0219] As used herein, and unless otherwise indicated, the term "complementarity," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions, as understood by those skilled in the art. Such conditions may be stringent conditions, for example, 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA at 50°C or 70°C for 12-16 minutes, followed by a wash (see, e.g., "Molecular Cloning: A Laboratory Manual," Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions encountered inside an organism, may also be applicable. Those skilled in the art will be able to determine the most appropriate set of conditions for testing the complementarity of two sequences depending on the ultimate application of the nucleotides to be hybridized.

[0220] A complementary sequence in an iRNA, for example, a complementary sequence in a dsRNA described herein, comprises base pairing of an oligonucleotide or polynucleotide comprising a first nucleotide sequence with an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both of the nucleotide sequences. Herein, such sequences can be referred to as "fully complementary" with respect to each other. However, herein, when a first sequence is referred to as "substantially complementary" with respect to a second sequence, the two sequences may be completely complementary, or may form one or more mismatched base pairs, generally not more than five, four, three, or two, during hybridization for a duplex of up to 30 base pairs, while retaining the ability to hybridize under conditions most relevant to their ultimate application, for example, inhibiting gene expression via the RISC pathway. However, if two oligonucleotides are designed to form one or more single-stranded overhangs during hybridization, such overhangs shall not be considered mismatches in determining complementarity. For example, a dsRNA containing a 21-nucleotide sequence comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, where the longer oligonucleotide is perfectly complementary to the shorter oligonucleotide, may also be referred to as "fully complementary" for the purposes described herein.

[0221] As used herein, "complementary" sequences can also include or be formed entirely of non-Watson-Crick base pairs, or base pairs formed from non-natural and modified nucleotides, so long as the above requirements regarding their ability to hybridize are met. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairing or Hoogstein base pairing.

[0222] As used herein, the terms "complementary," "fully complementary," and "substantially complementary" may be used in reference to base matching between the sense strand and antisense strand of a dsRNA, or between the antisense strand of a double-stranded RNA agent and a target sequence, as understood from the context of their use.

[0223] As used herein, a polynucleotide that is "substantially complementary to at least a portion of" a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a continuous portion of an mRNA of interest (e.g., an mRNA encoding the apolipoprotein C3 gene). For example, a polynucleotide is complementary to at least a portion of an apolipoprotein C3 mRNA if the sequence is substantially complementary to a non-interrupted portion of the mRNA encoding the apolipoprotein C3 gene.

[0224] Thus, in some embodiments, the antisense polynucleotides disclosed herein are fully complementary to the target APOC3 sequence. In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to the target APOC3 sequence, and comprise a contiguous nucleotide sequence that is at least 80% complementary, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs: 1, 3, 5, 7, 9, or 11, or a fragment of any one of SEQ ID NOs: 1-1, 3, 5, 7, 9, or 11, over its entire length.

[0225] In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a fragment of the target APOC3 sequence, spanning the entire length of nucleotides 232-254; 233-255; 238-260; 239-261; 242-264; 243-265; 244-266; 264-286; 268-290; 426-448; 431-453; 432-454; 433-455; 434-456; 435-457; 436-458; 437-459; 438-460; 439-461; 442-464; 443-459; 444-459; 445-459; 446-459; 459-460; 459-461; 459-462; 459-462; 462-463; 462-464; 462-465; 462-466; 462-467; 462-468; 462-469; 470-471; 471-472; 471-473; 471-474; 471-475; 471-476; 471-477; 471-478; 471-479; 471-479; 471-472; 471-473; 471-474; 471-475; 471-476; 471-477; 471-478; 471-479; 503-525; 504-526; 507-529; 510-532; or 511-533, the fragment of SEQ ID NO: 1 comprising a contiguous nucleotide sequence that is at least 80% complementary, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary, to a fragment of SEQ ID NO: 1 selected from the group consisting of:

[0226] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target APOC3 sequence and comprise a contiguous nucleotide sequence that is at least 80% complementary, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary over its entire length to a fragment of SEQ ID NO: 1 selected from the group consisting of nucleotides 235-257; 238-260; 242-264; 243-265; 244-266; 426-448; 430-450; 431-453; 432-454; 433-455; 435-457; 436-458; 499-521; 503-525; and 504-526 of SEQ ID NO: 1. In some embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a fragment of the target APOC3 sequence, spanning the entire length of nucleotides 232-254; 239-261; 242-264; 244-266; 258-280; 264-286; 268-290, 429-451; 430-450; 430-452; 433-455; 434-456; 435-457; 436-458; 437-459; 438-450; 439-461; 440-462; 441-441; 442-443; 443-444; 444-445; 445-446; 446-447; 447-448; 448-449; 449-450; 451-451; 451-452; 451-452; 452-453; 451-454; 451-452 ... and 504-526, which comprises a contiguous nucleotide sequence that is at least 80% complementary, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary to a fragment of SEQ ID NO:1 selected from the group consisting of: 434-456; 435-457; 500-522; 503-525; 507-529; and 510-532; and 504-526.

[0227] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target APOC3 sequence and comprise a contiguous nucleotide sequence that is at least 80% complementary, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary over its entire length to a fragment of SEQ ID NO:1 selected from the group of nucleotides 429-451; 430-452; 431-451; 432-452; 433-455; 504-526; and 506-526 of SEQ ID NO:1.

[0228] In other embodiments, the antisense polynucleotides disclosed herein are substantially complementary to a fragment of a target APOC3 sequence and comprise a contiguous nucleotide sequence that is at least 80% complementary, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary over its entire length to any one of the sense strand nucleotide sequences in any one of Tables 2-5, 14, and 15, or a fragment of any one of the sense strand nucleotide sequences in any one of Tables 2-5, 14, and 15.

[0229] In one embodiment, an RNAi agent of the present disclosure comprises an antisense polynucleotide and a sense strand that is substantially complementary, wherein the antisense polynucleotide is the same as the target APOC3 sequence, wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence over its entire length that is at least about 80% complementary, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary to the equivalent region of the nucleotide sequence of SEQ ID NO: 2, 4, 6, 8, 10, or 12, or a fragment of any one of SEQ ID NO: 2, 4, 6, 8, 10, or 12.

[0230] In some embodiments, an iRNA of the present disclosure comprises a sense strand that is substantially complementary to an antisense polynucleotide, wherein the antisense polynucleotide is complementary to a target apolipoprotein C3 sequence, wherein the sense strand polynucleotide comprises a contiguous nucleotide sequence over its entire length that is at least about 80% complementary, such as about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary, to any one of the antisense strand nucleotide sequences in any one of Tables 2-5, 14, and 15, or a fragment of any one of the antisense strand nucleotide sequences in any one of Tables 2-5, 14, and 15.

[0231] In certain embodiments, the sense and antisense strands are duplexed, AD-959917.1; AD-959918.1; AD-960096.1; AD-960064.1; AD-959914.1; AD-959941.1; AD-960031.1; AD-960063.1; AD-960293.1; AD-960288.1; AD-960445.1; AD-960292.1; AD-960475.1; AD- 960442.1;AD-960470.1;AD-960436.1;AD-960446.1;AD-960474.1;AD-960294.1;AD-960471.1;AD-960314.1;AD-960443.1;AD-960282.1;AD-960283.1;AD-80794.7;AD-960478.1;AD-960481.1; or AD-960482.1.

[0232] In other embodiments, the sense and antisense strands are duplexed and selected from any one of AD-959917.1; AD-960064.1; AD-960031.1; AD-960063.1; AD-960293.1; AD-960288.1; AD-960445.1; AD-960292.1; AD-960475.1; AD-960442.1; AD-960470.1; AD-960436.1; AD-960446.1; AD-960474.1; AD-960294.1; AD-960443.1; AD-80794.7; and AD-959910.1.

[0233] In some embodiments, the sense and antisense strands are duplexed and selected from any one of AD-80794.8; AD-959907.2; AD-959914.2; AD-959916.2; AD-959932.2; AD-960314.2; AD-959941.2; AD-960030.2; AD-960062.2; AD-960064.2; AD-960065.2; AD-960066.2; AD-960294.2; AD-960471.2; AD-960474.2; AD-960478.2; and AD-960481.2.

[0234] In other embodiments, the sense and antisense strands are duplexed and selected from any one of AD-960030; AD-1143243; AD-1143245; AD-1143247; AD-1143249; AD-1143256; AD-1143260; AD-1143278; AD-1143287; AD-1143295; AD-1143299; AD-1143302; and AD-1143305.

[0235] In one embodiment, the sense and antisense strands are the sense and antisense strands of the duplex AD-1143243.

[0236] Generally, "iRNA" comprises ribonucleotides with chemical modifications. Such modifications can include all types of modifications disclosed herein or known in the art. Any such modifications used in dsRNA molecules are encompassed by "iRNA" for the purposes of this specification and claims.

[0237] In certain embodiments of the present disclosure, incorporation of deoxynucleotides when present in an RNAi agent is considered to constitute modified nucleotides.

[0238] In some embodiments of the present invention, the agents for use in the methods and compositions of the present invention are single-stranded antisense oligonucleotide molecules that inhibit target mRNAs via an antisense inhibition mechanism. The single-stranded antisense oligonucleotide molecules are complementary to a sequence within the target mRNA. Single-stranded antisense oligonucleotides can inhibit translation stoichiometrically by base pairing with the mRNA, or by physically interfering with the translation machinery; see Dias, N. et al., (2002) Mol Cancer Ther 1:347-355. The single-stranded antisense oligonucleotide molecules can be about 14 to about 30 nucleotides in length and can have a sequence complementary to the target sequence. For example, the single-stranded antisense oligonucleotide molecule can contain a sequence of at least about 14, 15, 16, 17, 18, 19, 20, or more consecutive nucleotides derived from any one of the antisense sequences described herein.

[0239] As used herein, the phrase "contacting cells with iRNA" such as dsRNA includes contacting cells by any possible means.Contacting cells with iRNA includes contacting cells with iRNA in vitro or contacting cells with iRNA in vivo.Contacting can be direct or indirect.Therefore, for example, iRNA can be physically contacted with cells by the person who carries out the method, or alternatively, iRNA can be placed in a situation that allows it to contact cells or that allows it to contact cells.

[0240] In vitro contact of cells can be achieved, for example, by incubating cells with iRNA.In vivo contact of cells can be achieved, for example, by injecting iRNA into the tissue where cells are located or in the vicinity thereof, or by injecting iRNA into another region, for example, into the bloodstream or subcutaneous cavity, so that the agent then reaches the tissue where the contacted cells are located.For example, iRNA can contain or be coupled with a ligand, such as GalNAc, that directs iRNA to the target site, for example, the liver.The combination of in vitro contacting method and in vivo contacting method is also possible.For example, cells can also be contacted with iRNA in vitro and then transplanted into a subject.

[0241] In certain embodiments, contacting a cell with an iRNA includes "introducing an iRNA into a cell" or "delivering an iRNA into a cell" by facilitating or resulting in uptake or absorption into the cell. Absorption or uptake of the iRNA can occur via spontaneous diffusion or active intracellular processes, or by the use of auxiliary agents or devices. Introduction of the iRNA into a cell can be in vitro or in vivo. For example, for in vivo introduction, the iRNA can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art, such as electroporation and lipofection. Additional techniques are described herein below or known in the art.

[0242] The term "lipid nanoparticle" or "LNP" refers to a vesicle containing a lipid layer that encapsulates a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an iRNA, or a plasmid into which the iRNA is transcribed. LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.

[0243] As used herein, a "subject" refers to an animal, such as a mammal, including a primate (human, non-human primate, such as monkey and chimpanzee), a non-primate (such as cow, pig, horse, goat, rabbit, sheep, hamster, guinea pig, cat, dog, rat, or mouse), or a bird, that endogenously or heterologously expresses a target gene. In some embodiments, the subject is a human, such as a human being treated for or evaluated for a disease or disorder that would benefit from reduced APOC3 expression as described herein; a human being at risk for a disease or disorder that would benefit from reduced APOC3 expression; a human being with a disease or disorder that would benefit from reduced APOC3 expression; or a human being treated for a disease or disorder that would benefit from reduced APOC3 expression. In some embodiments, the subject is a female human being. In other embodiments, the subject is a male human being. In one embodiment, the subject is an adult subject. In another embodiment, the subject is a pediatric subject.

[0244] As used herein, the term "treating" or "treatment" refers to a beneficial or desired result, such as a reduction in at least one sign or symptom of an APOC3-related disorder in a subject. Treatment also includes alleviating one or more signs or symptoms associated with undesired APOC3 expression; reducing the degree of undesired APOC3 activation or stabilization; or improving or alleviating undesired APOC3 activation or stabilization. "Treatment" can also mean prolonging survival compared to expected survival in the absence of treatment. The term "reduction" in the context of APOC3 or disease marker levels or symptoms in a subject refers to a statistically significant reduction in such levels. A reduction can be, for example, at least 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In certain embodiments, the reduction is at least 20%. In certain embodiments, the reduction is at least 50% reduction in disease marker, for example, protein level or gene expression level.In the context of APOC3 level in a subject, "reduction" preferably refers to a reduction to a level that is considered to be within the normal range for individuals without such disorders.In certain embodiments, "reduction" refers to a reduction in the difference between the level of marker or symptom for a subject with a disease and the level that is considered to be within the normal range for an individual, for example, the reduction in the level of weight between an obese individual and an individual whose weight is considered to be within the normal range.

[0245] As used herein, " prevention " or " preventing " refers to diseases, disorders, or their conditions that can be treated or improved by reducing the expression of APOC3 gene, and refers to the reduction in the likelihood that a subject will develop symptoms associated with such diseases, disorders, or conditions, such as hypertriglyceridemia, which are undesirable or excessive symptoms of APOC3 expression.For example, the likelihood of developing hypertriglyceridemia is reduced when, for example, an individual with one or more risk factors for hypertriglyceridemia does not develop hypertriglyceridemia, or develops hypertriglyceridemia with less severity than a group of people with the same risk factors and who are not treated as described herein.The absence of disease, disorder, or condition, or the reduction in the occurrence of symptoms associated with such disease, disorder, or condition (for example, by at least about 10% on a clinically accepted scale for this disease or disorder), or the delayed appearance of symptoms (for example, by days, weeks, months, or years) is considered to be effective prevention.

[0246] As used herein, the term "apolipoprotein C3-related disease" or "APOC3-related disease" refers to a disease, disorder, or condition caused by or associated with unwanted or excessive APOC3 expression. The term "APOC3-related disease" includes diseases, disorders, or conditions that can be treated or ameliorated by reducing APOC3 expression. The term "APOC3-related disease" includes hypertriglyceridemia or high triglyceride levels.

[0247] Triglyceride levels in the serum of a subject, e.g., a human subject, that may exhibit hypertriglyceridemia are described in Oh, RC et al., (2007) American Family Physician, 75(9):1366-1371. Specifically, hypertriglyceridemia may be associated with "borderline high serum triglyceride levels" (i.e., 150-199 mg per deciliter, or 1.70-2.25 mmol per liter); "high serum triglyceride levels" (i.e., 200-499 mg per deciliter, or 2.26-5.64 mmol per liter); or "very high triglyceride levels" (i.e., 500 mg per deciliter or greater (or 5.65 mmol per liter or greater)).

[0248] In one embodiment, the APOC3-related disease is primary hypertriglyceridemia. "Primary triglyceridemia" results from environmental or genetic causes (e.g., is not the result of an obvious underlying medical cause). Exemplary diseases characterized as primary hypertriglyceridemia include, but are not limited to, familial chyloproteinemia (type 1 hyperlipoproteinemia), primary mixed hyperlipidemia (type 5), familial hypertriglyceridemia (type 4 hyperlipoproteinemia), familial combined hyperlipoproteinemia (type 2B), and familial dysbetalipoproteinemia (type 3 hyperlipoproteinemia).

[0249] In another embodiment, the APOC3-related disease is secondary hypertriglyceridemia. "Secondary triglyceridemia" is caused by or associated with other underlying disorders and conditions. Such disorders and / or conditions include, for example, obesity, metabolic syndrome, diabetes, fatty liver, alcohol use, kidney disease, pregnancy, non-alcoholic fatty liver disease, hypothyroidism, dysproteinemia (such as hypergammaglobulinemia in macroglobulinemia, myeloma, lymphoma, and lymphocytic leukemia), autoimmune disorders (such as systemic lupus erythematosus), and taking medications (such as antiretroviral drugs including ritonavir and lopinavir, and antipsychotic drugs including clozapine and olanzapine), see G. Yuan et al., (2007) Canadian Medical Association Journal, 176(8):1113-1120.

[0250] The term "APOC3-related disease" encompasses any disorder that may be the cause of hypertriglyceridemia (e.g., secondary hypertriglyceridemia) or the result of hypertriglyceridemia (e.g., primary hypertriglyceridemia or secondary hypertriglyceridemia). Non-limiting examples of APOC3-related diseases include metabolic disorders such as non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, polycystic ovary syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance); hypertension; cardiovascular disorders such as atherosclerosis; and pancreatitis, e.g., acute pancreatitis.

[0251] As used herein, a "therapeutically effective amount" is intended to include an amount of an RNAi agent that, when administered to a subject with an APOC3-related disease, is sufficient to treat the disease (e.g., by reducing, ameliorating, or maintaining the existing disease or one or more symptoms of the disease). A "therapeutically effective amount" can vary depending on the RNAi agent, how the agent is administered, the disease and its severity and medical history, age, weight, family history, genetic makeup, type of prior or concurrent treatment, if any, and other individual characteristics of the subject being treated.

[0252] As used herein, " preventively effective amount " is intended to include the amount of RNAi agent that is sufficient to prevent or improve disease or one or more symptoms of disease when administered to the subject with APOC3-related disorder.Improving disease includes slowing down the course of disease or reducing the severity of late-onset disease.The " preventively effective amount " can vary depending on the RNAi agent, how the agent is administered, the degree of risk and medical history of disease, age, weight, family history, genetic composition, if any, the type of previous treatment or concurrent treatment, and other individual characteristics of the subject being treated.

[0253] A "therapeutically effective amount" or a "prophylactically effective amount" also includes that amount of an RNAi agent that produces some desired effect, at a reasonable benefit / risk ratio applicable to any treatment. The iRNAs utilized in the methods of the invention can be administered in amounts sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0254] As used herein, the phrase "pharmaceutically acceptable" is used to refer to compounds, materials, compositions, or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0255] As used herein, the phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc, magnesium stearate, calcium stearate, zinc stearate, or steric acid), or a solvent encapsulating material involved in the transport or transportation of a target compound from one organ or body part to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the subject being treated. Such carriers are known in the art. Pharmaceutically acceptable carriers include carriers for administration by injection.

[0256] As used herein, the term "sample" includes collections of bodily fluids, cells, or tissues present within a subject, as well as similar bodily fluids, cells, or tissues isolated from a subject. Examples of bodily fluids include blood, serum and serous fluid, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, saliva, etc. Tissue samples can include samples derived from tissues, organs, or localized regions. For example, samples can be derived from specific organs, parts of organs, or bodily fluids or cells within these organs. In certain embodiments, samples can be derived from the liver (e.g., the whole liver or a specific segment of the liver, or a specific type of cell within the liver, e.g., hepatocytes). In some embodiments, a "sample derived from a subject" refers to urine obtained from a subject. A "sample derived from a subject" can refer to blood from a subject, or serum or plasma derived from blood.

[0257] II. iRNAs of the Invention The present invention provides iRNAs that inhibit expression of the apolipoprotein C3 gene. In a preferred embodiment, the iRNA comprises a double-stranded ribonucleic acid (dsRNA) molecule for inhibiting expression of the APOC3 gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human, susceptible to an apolipoprotein C3-related disorder, e.g., hypertriglyceridemia. The dsRNAi agent comprises an antisense strand having a complementary region that is complementary to at least a portion of the mRNA formed during expression of the APOC3 gene. The complementary region is approximately 19 to 30 nucleotides in length (e.g., approximately 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, or 19 nucleotides in length). When contacted with cells expressing the APOC3 gene, the iRNA inhibits the expression of the APOC3 gene (e.g., human, primate, non-primate, or rat APOC3 gene) by at least about 50%, as assayed by, for example, PCR or branched DNA (bDNA)-based methods, or protein-based methods, such as immunofluorescence analysis using Western blotting or flow cytometry. In a preferred embodiment, the inhibition of expression is determined by the qPCR method presented in the Examples herein, for example, for an siRNA at a concentration of 10 nM in a suitable biological cell system prepared in this Example. In a preferred embodiment, the inhibition of expression in vivo is determined by knocking down the human gene at the lowest level of RNA expression in rodents expressing the human gene, for example, mice expressing a human target gene or AAV-infected mice, when administered, for example, as a single dose, for example, at 3 mg / kg.

[0258] dsRNA comprises two RNA strands that are complementary and hybridize to form a duplex structure under the conditions that dsRNA is used.One strand (antisense strand) of dsRNA comprises a complementary region that is substantially complementary to target sequence, and generally is completely complementary.Target sequence can be derived from the sequence of mRNA that is formed during the expression of APOC3 gene.The other strand (sense strand) comprises a region that is complementary to antisense strand, so that when combined under appropriate conditions, the two strands hybridize and form a duplex structure.As described elsewhere herein and known in the art, the complementary sequence of dsRNA can also be contained as a self-complementary region of a single nucleic acid molecule, as opposed to the complementary sequence on a separate oligonucleotide.

[0259] Generally, the duplex structure is 15-30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-22, 19-23, 19-24, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 19-31, 19-32, 19-33, 19-34, 19-35, 19-36, 19-37, 19-38, 19-39, 19-40, 19-41, 19-42, 19-43, 19-44, 19-45, 19-46, 19-47, 19-48, 19-49, 19-50, 19-51, 19-52, 19-53, 19-54, 19-55, 19-56, 19-57, 19-58, 19-59, 19-60, 19-61, 19-62, 19-63, 19-64, 19-65, 19-6 9, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain preferred embodiments, the duplex structure is 18 to 25 base pairs in length, e.g., 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 25, 21 to 24, 21 to 23, 21 to 22, 22 to 25, 22 to 24, 22 to 23, 23 to 25, 23 to 24, or 24 to 25 base pairs in length, e.g., 19 to 21 base pairs in length. Ranges and lengths intermediate to the above-listed ranges and lengths are also contemplated as part of this disclosure.

[0260] Similarly, the region complementary to the target sequence may be 15-30 nucleotides in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-30, 19-29, 19-28, 19-27, 19-30, 19-31, 19-32, 19-33, 19-34, 19-35, 19-36, 19-37, 19-38, 19-39, 19-40, 19-41, 19-42, 19-43, 19-44, 19-45, 19-46, 19-47, 19-48, 19-49, 19-50, 19-51, 19-52, 19-53, 19-54, 19-55, 19-56, 19-57, 19-58, 19-59, 19-60, 19-61, 19-62, 19-63, 19-64, 19-65, 19-66, 21-23, or 21-22 nucleotides in length, e.g., 19-23 nucleotides in length or 21-23 nucleotides in length. Ranges and lengths intermediate to the above-listed ranges and lengths are also contemplated as part of this disclosure.

[0261] In some embodiments, the duplex structure is 19 to 30 base pairs in length. Similarly, the region complementary to the target sequence is 19 to 30 nucleotides in length.

[0262] In some embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 25 to about 30 nucleotides in length. Generally, the dsRNA is long enough to be used as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21 to 23 nucleotides in length can be used as substrates for Dicer. As those skilled in the art will also recognize, the region of RNA targeted for cleavage is often a portion of a larger RNA molecule, often an mRNA molecule. Where applicable, a "portion" of an mRNA target is a contiguous sequence of the mRNA target that is long enough to allow it to be a substrate for RNAi-guided cleavage (i.e., cleavage via the RISC pathway).

[0263] Those skilled in the art will also recognize that the duplex region is the major functional portion of a dsRNA, e.g., a duplex region of about 19 to about 30 base pairs, e.g., about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment, an RNA molecule or complex of RNA molecules having a duplex region of more than 30 base pairs is a dsRNA, so long as it targets the desired RNA for cleavage, e.g., is processed into a functional duplex of 15-30 base pairs. Thus, those skilled in the art will recognize that, in one embodiment, an miRNA is a dsRNA. In another embodiment, the dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful for targeting expression of the apolipoprotein C3 gene is not generated by cleavage of a larger dsRNA in the target cell.

[0264] The dsRNA described herein may further comprise one or more single-stranded nucleotide overhangs, for example, 1-4, 2-4, 1-3, 2-3, 1, 2, 3, or 4 nucleotides. dsRNAs with at least one nucleotide overhang may have superior inhibitory properties compared to their blunt-ended counterparts. The nucleotide overhang may comprise or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. The overhang(s) may be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleotide(s) overhang(s) may be present on the 5'-end, the 3'-end, or both ends of the antisense or sense strand of the dsRNA.

[0265] dsRNA can be synthesized by standard methods known in the art.Double-stranded RNAi compounds of the present invention can be prepared using a two-step procedure.First, each strand of double-stranded RNA molecules is prepared separately.Then, the strand components are annealed.The individual strands of siRNA compounds can be prepared using liquid-phase organic synthesis or solid-phase organic synthesis, or both.Organic synthesis has the advantage that the oligonucleotide chain containing non-natural nucleotide or modified nucleotide can be easily prepared.Similarly, single-stranded oligonucleotides of the present invention can be prepared using liquid-phase organic synthesis or solid-phase organic synthesis, or both.

[0266] In some embodiments, the dsRNA of the present invention comprises at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand is selected from the sequences listed in any one of Tables 2-5, 14, and 15, and the corresponding antisense strand of the sense strand is selected from the sequences listed in any one of Tables 2-5, 14, and 15. In this embodiment, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to the sequence of mRNA produced upon expression of the apolipoprotein C3 gene. Thus, in this embodiment, the dsRNA will comprise two oligonucleotides, one oligonucleotide being listed as the sense strand in any one of Tables 2-5, 14, and 15, and the second oligonucleotide being listed as the corresponding antisense strand of the sense strand in any one of Tables 2-5, 14, and 15.

[0267] In certain embodiments, the substantially complementary sequences of the dsRNA are contained in separate oligonucleotides, while in other embodiments, the substantially complementary sequences of the dsRNA are contained in a single oligonucleotide.

[0268] In certain embodiments, the sense strand or the antisense strand is double-stranded, AD-959917.1; AD-959918.1; AD-960096.1; AD-960064.1; AD-959914.1; AD-959941.1; AD-960031.1; AD-960063.1; AD-960293.1; AD-960288.1; AD-960445.1; AD-960292.1; AD-960475.1; AD-960442.1 ;AD-960470.1;AD-960436.1;AD-960446.1;AD-960474.1;AD-960294.1;AD-960471.1;AD-960314.1;AD-960443.1;AD-960282.1;AD-960283.1;AD-80794.7;AD-960478.1;AD-960481.1; or AD-960482.1.

[0269] In other embodiments, the sense or antisense strand is selected from the sense or antisense strand of any one of the following double-stranded sequences: AD-959917.1; AD-960064.1; AD-960031.1; AD-960063.1; AD-960293.1; AD-960288.1; AD-960445.1; AD-960292.1; AD-960475.1; AD-960442.1; AD-960470.1; AD-960436.1; AD-960446.1; AD-960474.1; AD-960294.1; AD-960443.1; AD-80794.7; and AD-959910.1.

[0270] In some embodiments, the sense or antisense strand is selected from the sense or antisense strand of any one of the following double-stranded sequences: AD-80794.8; AD-959907.2; AD-959914.2; AD-959916.2; AD-959932.2; AD-960314.2; AD-959941.2; AD-960030.2; AD-960062.2; AD-960064.2; AD-960065.2; AD-960066.2; AD-960294.2; AD-960471.2; AD-960474.2; AD-960478.2; and AD-960481.2.

[0271] In some embodiments, the sense strand or antisense strand is selected from the sense strand or antisense strand of any one of the following double-stranded sequences: AD-960030; AD-1143243; AD-1143245; AD-1143247; AD-1143249; AD-1143256; AD-1143260; AD-1143278; AD-1143287; AD-1143295; AD-1143299; AD-1143302; and AD-1143305.

[0272] In some embodiments, the sense or antisense strand is selected from the sense or antisense strand of the duplex AD-1143243.

[0273] Although the sequences in Tables 2, 4, and 14 are not described as modified or conjugated sequences, it will be understood that the RNA of the present disclosure, e.g., the dsRNA of the present invention, can comprise any one of the sequences set forth in any one of Tables 2-5, 14, and 15, unmodified, unconjugated, or modified or conjugated in a manner different from that described therein. In other words, the present invention encompasses the dsRNAs of Tables 2-5, 14, and 15, unmodified, unconjugated, or modified or conjugated as described herein.

[0274] Those skilled in the art are aware that dsRNAs with duplex structures of about 20-23 base pairs, for example, 21 base pairs, are said to be particularly effective in inducing RNA interference [Elbashir et al., EMBO 2001, 20:6877-6888]. However, other researchers have found that shorter duplex structures or longer RNA duplex structures can also be effective [Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226]. In the above-described embodiments, due to the nature of the oligonucleotide sequences listed in any one of Tables 2-5, 14 and 15, the dsRNAs described herein can contain at least one strand with a minimum length of 21 nucleotides. It can be reasonably expected that shorter duplexes having any one of the sequences in any one of Tables 2-5, 14, and 15, minus only a few nucleotides at one or both ends, may be similarly effective compared to the dsRNAs described above. Thus, dsRNAs having a sequence of at least 19, 20, or more contiguous nucleotides derived from any one of the sequences in any one of Tables 2-5, 14, and 15 that differ in their ability to inhibit expression of the apolipoprotein C3 gene by no more than about 5, 10, 15, 20, 25, or 30% of the inhibition of a dsRNA containing the full-length sequence are contemplated to be within the scope of the present invention.

[0275] Additionally, the RNAs presented in Tables 2-5, 14, and 15 identify a site(s) in the apolipoprotein C3 transcript that is susceptible to RISC-mediated cleavage. Thus, the present invention further features iRNAs that target within one of these sites. As used herein, an iRNA is said to target within a specific site of an RNA transcript if the iRNA promotes cleavage of the transcript at any position within this specific site. Such iRNAs generally comprise at least about 19 contiguous nucleotides from any one of the sequences presented in any one of Tables 2-5, 14, and 15 coupled to additional nucleotide sequences taken from regions adjacent to the selected sequence within the apolipoprotein C3 gene.

[0276] III. Modified iRNAs of the Invention In certain embodiments, the RNA of the present disclosure, such as dsRNA, is unmodified, and does not contain, for example, chemical modifications or conjugations known in the art and described herein.In other embodiments, the RNA of the present disclosure, such as dsRNA, is chemically modified to enhance stability or other beneficial characteristics.In certain embodiments of the present invention, substantially all of the nucleotides of the RNAi of the present disclosure are modified.In other embodiments of the present invention, all of the nucleotides of the iRNA, or substantially all of the nucleotides of the iRNA, are modified, that is, no more than 5, 4, 3, 2, or 1 unmodified nucleotides are present in the iRNA strand.

[0277] Nucleic acids featured in the present invention can be synthesized or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, reverse ligation) or 3'-end modifications (conjugation, DNA nucleotides, reverse ligation, etc.); base modifications, such as replacement with a stabilizing base, an unstable base, or a base that base-pairs with an expanded repertoire of partners, removal of a base (abasic nucleotide), or a conjugated base; sugar modifications (e.g., at the 2' or 4' position) or sugar replacement; or backbone modifications, including modification or replacement of a phosphodiester linkage. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or RNAs that do not contain natural internucleoside linkages. RNAs with modified backbones include, inter alia, RNAs that do not have a phosphorus atom in the backbone. For purposes of this specification, and as sometimes referred to in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, modified iRNAs will have a phosphorus atom in their internucleoside backbone.

[0278] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates, their 2'-5' linked analogs, and analogs with reverse polarity, in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.Various salt forms, mixed salt forms, and free acid forms are also included.In some embodiments of the present invention, the dsRNA agent of the present invention is in free acid form.In other embodiments of the present invention, the dsRNA agent of the present invention is in salt form. In one embodiment of the present invention, dsRNA agent is in sodium salt form.In certain embodiments, when the dsRNA agent of the present invention is in sodium salt form, sodium ion exists in the agent as counterion to substantially all of the phosphodiester group and / or phosphorothioate group present in the agent.The agent in which substantially all of the phosphodiester linkage and / or phosphorothioate linkage have sodium counterion comprises no more than 5, 4, 3, 2 or 1 phosphodiester linkage and / or phosphorothioate linkage without sodium counterion.In some embodiments, when the dsRNA agent of the present invention is in sodium salt form, sodium ion exists in the agent as counterion to all of the phosphodiester group and / or phosphorothioate group present in the agent.

[0279] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,276,019; and 5,280,282, the entire contents of each of which are incorporated herein by reference. No. 78,302; No. 5,286,717; No. 5,321,131; No. 5,399,676; No. 5,405,939; No. 5,453,496; No. 5,455,233; Same No. 5,466,677; Same No. 5,476,925; Same No. 5,519,126; Same No. 5,536,821; Same No. 5,541,316; Same No. 5,550,111; Same No. 5,563,2 No. 53; No. 5,571,799; No. 5,587,361; No. 5,625,050; No. 6,028,188; No. 6,124,445; No. 6,160,109; No. 6, 169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423 ;6,531,590;6,534,639;6,608,035;6,683,167;6,858,715;6,867,294;6,878,805;7,015,315;7,041,816;7,273,933;7,321,029; and U.S. Reissue Patent No. 39464, among others.

[0280] Modified RNA backbones that do not contain phosphorus atoms include those formed by short alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or internucleoside linkages with one or more short heteroatoms or heterocycles. Modified RNA backbones include those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and backbones with mixed N, O, S, and CH2 moieties.

[0281] Representative United States patents which teach the preparation of the above oligonucleosides include U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466, 677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439.

[0282] RNA mimics suitable for use in the iRNAs presented herein are envisioned, in which both the sugar and internucleoside linkages, i.e., the backbone, of nucleotide units are replaced with novel groups. The base units are maintained for hybridization with appropriate nucleic acid targeting compounds. One such oligomeric compound, in which RNA mimics have been shown to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly bound to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are incorporated herein by reference. Additional PNA compounds suitable for use in the iRNA of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0283] Some embodiments featured in the present invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, particularly -CH-NH-CH-, -CH-N(CH)-O-CH- (known as the methylene(methylimino) backbone or MMI backbone), -CH-ON(CH)-CH-, -CH-N(CH)-N(CH)-CH-, and -N(CH)-CH-CH- (wherein the natural phosphodiester backbone is represented as -OPO-CH-) of the above-referenced U.S. Patent No. 5,489,677, and the amide backbones of the above-referenced U.S. Patent No. 5,602,240. In some embodiments, the RNAs featured herein have the morpholino backbone structure of the above-referenced U.S. Patent No. 5,034,506.

[0284] Modified RNAs can also contain one or more substituted sugar moieties. iRNAs, such as the dsRNAs featured herein, can contain at the 2' position: OH; F; O-alkyl, S-alkyl, or N-alkyl; O-alkenyl, S-alkenyl, or N-alkenyl; O-alkynyl, S-alkynyl, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted, C1-C6. 10 Alkyl, or C2-C 10 An exemplary suitable modification is O[(CH2) n O] m CH3, O(CH2) n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) n In other embodiments, the dsRNA comprises at the 2' position one of the following: C1 to C 10lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, CF, OCF, SOCH, SOCH, ONO, NO, N, NH, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, reporter group, intercalating agent, group for improving the pharmacokinetic properties of iRNA, or group for improving the pharmacodynamic properties of iRNA, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy [2'-O-CHCHOCH, also known as 2'-O-(2-methoxyethyl) or 2'-MOE] (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is the O(CH)ON(CH) group, also known as 2'-dimethylaminooxyethoxy, i.e., 2'-DMAOE, as described in the Examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH-O-CH-N(CH). Further exemplary modifications include 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides (both R and S isomers within these three families); 2'-alkoxyalkyl; and 2'-NMA (N-methylacetamide).

[0285] Other modifications include 2'-methoxy (2'-OCH), 2'-aminopropoxy (2'-OCHCHCHNH), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3'-terminal nucleotide, or in 2'-5'-linked dsRNAs and at the 5' position of the 5'-terminal nucleotide. iRNAs can also have sugar mimetics, such as cyclobutyl moieties, in place of the pentofuranosyl sugar. Representative United States patents that teach such modified sugar structures are U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785 ... Nos. 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, the entire contents of each of which are incorporated herein by reference.

[0286] iRNAs may also contain modified or substituted nucleobases (often referred to in the art simply as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include deoxythymine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine, and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-haloadenine and guanine, 8-aminoadenine and guanine, 8-thioladenine and 8-thiol and other synthetic and natural nucleobases such as -thiolguanine, 8-thioalkyladenines and guanines, 8-hydroxyl adenine analogs (anal) and analogs, other 8-substituted adenines and guanines, 5-halouracils and cytosines, particularly 5-bromouracil and cytosine, 5-trifluoromethyluracil and cytosine, 7-methylguanine and adenine, 8-azaguanine and adenine, 7-deazaguanine and adenine, and 3-deazaguanine and adenine.Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808; those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, J. L., ed. John Wiley & Sons, 1990; those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2-substituted purines, N-6-substituted purines, and 0-6-substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitution has been shown to increase nucleic acid duplex stability by 0.6 to 1.2°C (Sanghvi, YS, Crooke, ST, and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and is an exemplary base substitution, especially when combined with a 2'-O-methoxyethyl sugar modification.

[0287] Representative United States patents that teach the preparation of certain of the above-referenced modified nucleobases, as well as other modified nucleobases, include the above-referenced U.S. Pat. Nos. 3,687,808; 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,708; and the like, the entire contents of each of which are incorporated herein by reference. No. 11; No. 5,552,540; No. 5,587,469; No. 5,594,121; No. 5,596,091; No. 5,614,617 No. 5,681,941; No. 5,750,692; No. 6,015,886; No. 6,147,200; No. 6,166,197; Including, but not limited to, US Pat. Nos. 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088.

[0288] The RNA of an iRNA can also be modified to contain one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide with a modified ribose moiety that contains an additional bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose into a 3' internal structural conformation. The addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects [Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193].

[0289] In some embodiments, the RNA of an iRNA may also be modified to include one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanosyl ring modified with a two-atom bridge. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety containing a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4' and 2' carbons of the sugar ring. Thus, in some embodiments, an agent of the present invention may include one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide with a modified ribose moiety that contains an additional bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide containing a bicyclic sugar moiety that includes a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose into a 3' internal structural conformation. The addition of a locked nucleic acid to siRNA has been shown to increase the stability of siRNA in serum and reduce off-target effects [Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193]. Examples of bicyclic nucleosides for use in the polynucleotides of the present invention include, but are not limited to, nucleosides containing a bridge between the 4' and 2' atoms of the ribosyl ring. In certain embodiments, the antisense polynucleotide agents of the present invention contain one or more bicyclic nucleosides containing a 4'-2' bridge.Examples of such 4'-2' bridged bicyclic nucleosides include 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (also known as "constrained ethyl" or "cEt"), and 4'-CH(CHOCH3)-O-2' (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH3)(CH3)-O-2' (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,283). 4'-CH-N(OCH)-2' (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,425); 4'-CH-ON(CH)-2' (see, e.g., U.S. Pat. Publication No. 2004 / 0171570); 4'-CH-N(R)-O-2', where R is H, C-C alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4'-CH-C(H)(CH)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH-C(=CH)-2' (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are incorporated herein by reference.

[0290] Additional representative U.S. patents and publications that teach the preparation of locked nucleic acid nucleotides include the following, the entire contents of each of which are incorporated herein by reference: U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034, 133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US2008 / 0039618; and US2009 / 0012281.

[0291] For example, any of the foregoing bicyclic nucleosides can be prepared with one or more sugar stereochemical configurations (see WO 99 / 14226), including α-L-ribofuranose and β-D-ribofuranose.

[0292] The RNA of an iRNA can also be modified to contain one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid containing a bicyclic sugar moiety containing a 4'-CH(CH3)-O-2' bridge. In one embodiment, the constrained ethyl nucleotide is in the S conformation, referred to herein as an "S-cEt."

[0293] The iRNA of the present disclosure may also contain one or more "conformationally locked nucleotides" ("CRNs"). A CRN is a nucleotide analog with a linker connecting the C2' and C4' carbons of ribose or the C3 and C5' carbons of ribose. The CRN locks the ribose ring into a stable conformation, increasing hybridization affinity to mRNA. The linker is long enough to position the oxygen in an optimal position for stability and affinity, resulting in reduced puckering of the ribose ring.

[0294] Representative publications that teach the preparation of certain of the CRNs mentioned above include, but are not limited to, U.S. Patent Publication No. 2013 / 0190383; and PCT Publication No. WO2013 / 036868, the entire contents of each of which are incorporated herein by reference.

[0295] In some embodiments, the iRNA of the present disclosure includes one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNAs are unlocked acyclic nucleic acids in which one of the sugar linkages has been removed to form an unlocked "sugar" residue. In one example, UNAs also encompass monomers in which the C1'-C4' bond (i.e., the covalent carbon-oxygen-carbon bond between the C1' and C4' carbons) has been removed. In another example, the C2'-C3' bond (i.e., the covalent carbon-carbon bond between the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which are incorporated herein by reference).

[0296] Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227; and U.S. Patent Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.

[0297] Potential stabilizing modifications to the ends of RNA molecules can include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3''-phosphate, the inverted base dT (idT), and other stabilizing modifications. Disclosure of this modification can be found in PCT Publication No. WO2011 / 005861.

[0298] Other modifications to the nucleotides of the iRNAs of the present disclosure include a 5' phosphate or 5' phosphate mimic, such as a 5' terminal phosphate or phosphate mimic, on the antisense iRNA strand. Suitable phosphate mimics are disclosed, for example, in U.S. Patent Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.

[0299] A. Modified iRNAs Containing Motifs of the Invention In certain aspects of the present invention, the double-stranded RNA agent of the present invention comprises the agent with chemical modification, for example, as disclosed in WO2013 / 075035, the entire contents of each of which are incorporated herein by reference.WO2013 / 075035 proposes introducing a motif of three identical modifications on three consecutive nucleotides at or near the cleavage site into the sense strand or antisense strand of dsRNAi agent.In some embodiments, the sense strand and antisense strand of dsRNAi agent can be completely modified in other ways.The introduction of these motifs, if present, interrupts the modification pattern of the sense strand or antisense strand.For example, dsRNAi agent can be conjugated with GalNAc derivative ligand on the sense strand.

[0300] More specifically, gene silencing activity of a dsRNAi agent was observed when the sense and antisense strands of the double-stranded RNA agent were fully modified to have one or more motifs with three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of the dsRNAi agent.

[0301] Thus, the present invention provides double-stranded RNA agents capable of inhibiting expression of a target gene (i.e., the APOC3 gene) in vivo. The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent can be, for example, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.

[0302] The sense strand and the antisense strand typically form a double-stranded, double-stranded RNA ("dsRNA"), also referred to herein as a "dsRNAi agent." The duplex region of a dsRNAi agent can be, for example, 27-30 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from the group consisting of 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0303] In certain embodiments, a dsRNAi agent may contain one or more overhanging regions or capping groups at the 3'-end, 5'-end, or both ends of one or both strands. The overhangs may independently be 1 to 6 nucleotides in length, e.g., 2 to 6 nucleotides in length, 1 to 5 nucleotides in length, 2 to 5 nucleotides in length, 1 to 4 nucleotides in length, 2 to 4 nucleotides in length, 1 to 3 nucleotides in length, 2 to 3 nucleotides in length, or 1 to 2 nucleotides in length. In certain embodiments, the overhanging region may include the extended overhang region set forth above. The overhang may be the result of one strand being longer than the other strand, or may be the result of two strands of the same length being cohesive-ended strands. The overhang may form a mismatch with the target mRNA, be complementary to the targeted gene sequence, or be a different sequence. The first and second strands may also be connected by additional bases, e.g., to form a hairpin, or by other abasic linkers.

[0304] In certain embodiments, the nucleotides in the overhang region of a dsRNAi agent can each independently be modified or unmodified nucleotides, including, but not limited to, 2' sugar-modified nucleotides such as 2'-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof.

[0305] For example, TT can be an overhang sequence for either end on either strand. The overhang may form a mismatch with the target mRNA, may be complementary to the targeted gene sequence, or may be a different sequence.

[0306] The 5'-overhang or 3'-overhang on the sense strand, antisense strand, or both strands of the dsRNAi agent can be phosphorylated.In some embodiments, the overhang region(s) contain two nucleotides with phosphorothioate between them, and in this case, the two nucleotides can be the same or different.In some embodiments, the overhang is present at the 3'-end of the sense strand, antisense strand, or both strands.In some embodiments, the 3'-overhang is present in the antisense strand.In some embodiments, the 3'-overhang is present in the sense strand.

[0307] dsRNAi agent can contain only one overhang, which can enhance the interference activity of RNAi without affecting its overall stability.For example, single-stranded overhang can be located at the 3' end of sense strand, or alternatively, at the 3' end of antisense strand.RNAi can also have a blunt end located at the 5' end of antisense strand (or the 3' end of sense strand), or vice versa.Generally, the antisense strand of dsRNAi agent has a nucleotide overhang at the 3' end, and the 5' end is blunt.Without wishing to be bound by theory, the asymmetry between the blunt end at the 5' end of antisense strand and the 3' end overhang of antisense strand is suitable for the loading of guide strand into RISC process.

[0308] In certain embodiments, the dsRNAi agent is a double-ended bluntmer 19 nucleotides in length, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7, 8, and 9 of the 5' end. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 of the 5' end.

[0309] In other embodiments, the dsRNAi agent is a double-ended bluntmer 20 nucleotides in length, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 8, 9, and 10 of the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 of the 5' end.

[0310] In yet another embodiment, the dsRNAi agent is a double-ended bluntmer 21 nucleotides in length, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, and 11 of the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 of the 5' end.

[0311] In certain embodiments, dsRNAi agent comprises a sense strand of 21 nucleotides and an antisense strand of 23 nucleotides, wherein sense strand comprises at least one of the following motifs: three 2'-F modification on three consecutive nucleotides at the 9th, 10th, and 11th positions of 5'-end; antisense strand comprises at least one of the following motifs: three 2'-O-methyl modification on three consecutive nucleotides at the 11th, 12th, and 13th positions of 5'-end; one end of RNAi agent is blunt-ended, while the other end comprises 2-nucleotide overhang.Preferably, 2-nucleotide overhang is at the 3'-end of antisense strand.

[0312] When a 2-nucleotide overhang is at the 3'-end of antisense strand, there may be two phosphorothioate internucleotide linkages between the three nucleotides at the end, two of which are overhanging nucleotides, and the third nucleotide is the paired nucleotide adjacent to the overhanging nucleotide.In one embodiment, the RNAi agent also has two phosphorothioate internucleotide linkages between the three nucleotides at the 5'-end of sense strand and the 5'-end of antisense strand.In certain embodiments, all nucleotides in the sense strand and antisense strand of dsRNAi agent, including the nucleotide that is part of a motif, are modified nucleotides.In certain embodiments, each residue is independently modified by 2'-O-methyl or 3'-fluoro, for example, in an alternating motif.The dsRNAi agent may further comprise a ligand (preferably GalNAc3).

[0313] In certain embodiments, the dsRNAi agent comprises a sense strand and an antisense strand, wherein the sense strand is 25 to 30 nucleotide residues in length, starting from the 5'-terminal nucleotide (position 1), and positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36 to 66 nucleotide residues in length, starting from the 3'-terminal nucleotide, and comprises at least 8 ribonucleotides at positions 1 to 23 of the sense strand to form a duplex; in this case, at least the 3'-terminal nucleotide of the antisense strand is unpaired from the sense strand, and up to 6 consecutive nucleotides at the 3' end are unpaired from the sense strand, thereby forming a single-stranded 3' overhang of 1 to 6 nucleotides; and the 5'-end of the antisense strand is unpaired from the sense strand, and comprises 10 to 30 consecutive ribonucleotides. The sense strand comprises consecutive nucleotides, thereby forming a single-stranded 5'-overhang of 10 to 30 nucleotides; at least the 5'- and 3'-terminal nucleotides of the sense strand base-pair with nucleotides of the antisense strand when the sense strand and the antisense strand are aligned for maximum complementarity, thereby forming a substantially duplexed region between the sense strand and the antisense strand; the antisense strand is sufficiently complementary to the target RNA over a length of at least 19 ribonucleotides of the antisense strand so that the double-stranded nucleic acid reduces expression of the target gene when introduced into a mammalian cell; the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides, where at least one of the motifs is located at or near the cleavage site. The antisense strand contains at least one motif of 2'-O-methyl modifications on three consecutive nucleotides at or near the cleavage site of the strand.

[0314] In certain embodiments, the dsRNAi agent comprises a sense strand and an antisense strand, the dsRNAi agent comprising a first strand at least 25 nucleotides and a maximum of 29 nucleotides in length, and a second strand at most 30 nucleotides in length with at least one of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 of the 5' end; the 3' end of the first strand and the 5' end of the second strand form a blunt end, and the second strand has a duplex region at its 3' end that is 1 to 4 nucleotides longer than the first strand and is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA over a length of at least 19 nucleotides of the second strand such that the RNAi agent reduces expression of the target gene when introduced into a mammalian cell, wherein cleavage of the dsRNAi agent by Dicer preferentially results in an siRNA comprising the 3' end of the second strand, thereby reducing expression of the target gene in a mammal. The dsRNAi agent may further comprise a ligand.

[0315] In certain embodiments, the sense strand of the dsRNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs is at the cleavage site in the sense strand.

[0316] In certain embodiments, the antisense strand of a dsRNAi agent may also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs is at or near the cleavage site in the antisense strand.

[0317] For dsRNAi agents having a duplex region 19-23 nucleotides in length, the cleavage sites in the antisense strand are typically near positions 10, 11, and 12 from the 5' end. Thus, the three identically modified motifs can be located at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, counting from the first nucleotide at the 5' end of the antisense strand or from the first paired nucleotide within the duplex region at the 5' end of the antisense strand. The cleavage site within the antisense strand can also vary according to the length of the duplex region from the 5' end of the dsRNAi agent.

[0318] The sense strand of dsRNAi agent can contain at least one motif of three identical modifications on three consecutive nucleotides at the breakpoint of strand; antisense strand can have at least one motif of three identical modifications on three consecutive nucleotides at or near the breakpoint of strand.When sense strand and antisense strand form dsRNA duplex, sense strand and antisense strand can be aligned so that one motif of three nucleotides on sense strand and one motif of three nucleotides on antisense strand have at least one nucleotide overlap, that is, at least one of the three nucleotides of the motif in sense strand and at least one of the three nucleotides of the motif in antisense strand form base pair.Alternatively, at least two nucleotides can overlap, or all three nucleotides can overlap.

[0319] In some embodiments, the sense strand of a dsRNAi agent may contain more than one motif, consisting of three identical modifications on three consecutive nucleotides. The first motif may be present at or near the cleavage site of the strand, and the other motif may be a wing modification. In this specification, the term "wing modification" refers to a motif that exists in another part of the strand, separated from the motif at or near the cleavage site of the same strand. The wing modification is adjacent to the first motif or separated by at least one or more nucleotides. When the motifs are directly adjacent to each other, the chemical properties of the motifs are significantly different from each other, and when the motifs are separated by one or more nucleotides, the chemical properties may be the same or different. There may be two or more wing modifications. For example, when there are two wing modifications, each wing modification may be present at one end of the first motif, which is present at or near the cleavage site, or on either side of the lead motif.

[0320] Similar to sense strand, the antisense strand of dsRNAi agent can contain more than one motif by three identical modifications on three consecutive nucleotides, and at least one of the motifs is present at or near the break site of strand.This antisense strand can also contain one or more wing modifications in alignment, which are the same as the wing modifications that can be present on sense strand.

[0321] In some embodiments, wing modifications on the sense or antisense strand of a dsRNAi agent typically do not include the first one or two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.

[0322] In other embodiments, wing modifications on the sense or antisense strand of a dsRNAi agent typically do not include the first one or two paired nucleotides in the duplex region at the 3' end, 5' end, or both ends of the strand.

[0323] When the sense and antisense strands of a dsRNAi agent each contain at least one wing modification, the wing modifications can be located at the same end of the duplex region and can have an overlap of 1, 2, or 3 nucleotides.

[0324] When the sense and antisense strands of a dsRNAi agent each contain at least two wing modifications, the sense and antisense strands can be aligned such that: two modifications from each strand are located at one end of the duplex region and overlap by one, two, or three nucleotides; two modifications from each strand are located at the other end of the duplex region and overlap by one, two, or three nucleotides; or two modifications from each strand are located on either side of the lead motif and overlap by one, two, or three nucleotides within the duplex region.

[0325] In some embodiments, all nucleotides in the sense strand and antisense strand of dsRNAi agent, including the nucleotide that is part of motif, can be modified.Each nucleotide can be modified by the same or different modifications, which can include one or more of the following: one or both of non-linked phosphate oxygen or one or more of linking phosphate oxygen; modification of ribose sugar component, for example, 2'-hydroxyl on ribose sugar; total replacement of phosphate moiety with " dephosphorylation " linker; modification or replacement of naturally occurring base; and replacement or modification of ribose-phosphate backbone.

[0326] Because nucleic acids are polymers of subunits, many modifications, such as modifications of bases, phosphate moieties, or non-linked O of phosphate moieties, occur at positions that are repeated within nucleic acids. In some cases, modifications will occur at all target positions within nucleic acids, but in many cases, this will not be the case. For example, modifications may occur only at the 3'-end or 5'-end positions, or only within terminal regions, such as at terminal nucleotide positions, or at the last 2, 3, 4, 5, or 10 nucleotides of the chain. Modifications may occur in double-stranded regions, single-stranded regions, or both. Modifications may occur only in double-stranded regions of RNA, or only in single-stranded regions of RNA. For example, phosphorothioate modifications at non-linked O positions can occur at only one or both termini, only in the terminal regions, e.g., at the terminal nucleotide positions or in the last 2, 3, 4, 5, or 10 nucleotides of the strand, and within double-stranded and single-stranded regions, particularly at the termini. The 5' terminus or both termini can be phosphorylated.

[0327] For example, to enhance stability, it may be possible to include specific bases within the overhang, or to include modified nucleotides or nucleotide surrogates within the single-stranded overhang, for example, within the 5'-overhang or 3'-overhang, or both. For example, it may be desirable to include purine nucleotides within the overhang. In some embodiments, all or some of the bases within the 3'-overhang or 5'-overhang can be modified, for example, with the modifications described herein. Modifications can include, for example, the use of modifications at the 2' position of the ribose sugar, e.g., the use of 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl modified deoxyribonucleotides rather than ribosugars within the nucleobase, and modifications within the phosphate group, e.g., phosphorothioate modifications, with modifications known in the art. The overhang need not be homologous to the target sequence.

[0328] In some embodiments, each residue of the sense strand and the antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. A strand may contain more than one modification. In one embodiment, each residue of the sense strand and the antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

[0329] At least two different modifications are typically present on the sense and antisense strands, and these two modifications may be 2'-O-methyl, 2'-fluoro, or other modifications.

[0330] In certain embodiments, N a or N b includes modifications in an alternating pattern. As used herein, the term "alternating motif" refers to a motif having one or more modifications, with each modification occurring on alternating nucleotides in a strand. The alternating nucleotides may refer to one every two nucleotides, or one every three nucleotides, or a similar pattern. For example, if A, B, and C each represent one type of modification to a nucleotide, the alternating motif could be "ABABABABABAB...", "AABBAABBAABB...", "AABAABAABAAB...", "AAABAAABAAAB...", "AAABBBAAABBB...", or "ABCABCABCABC...", etc.

[0331] The types of modifications contained within the alternating motif can be the same or different. For example, if A, B, C, and D each represent one type of modification on a nucleotide, the alternation pattern, i.e., the modifications on every other nucleotide, can be the same, but each of the sense or antisense strands can be selected from several possibilities for modifications within the alternating motif, such as "ABABAB...", "ACACAC...", "BDBDBD...", or "CDCDCD...".

[0332] In some embodiments, the dsRNA agent of the present invention comprises a modification pattern for the alternating motif on the sense strand that is shifted compared to the modification pattern for the alternating motif on the antisense strand. The shift can be such that the modified nucleotides of the sense strand correspond to different modified nucleotides of the antisense strand, and vice versa. For example, when the sense strand is paired with the antisense strand in a dsRNA duplex, the alternating motif in the sense strand may begin with "ABABAB" from the 5' to the 3' of the strand, and the alternating motif in the antisense strand may begin with "BABABA" from the 5' to the 3' of the strand, within the duplex region. As another example, the alternating motif in the sense strand may begin with "AABBAABB" from the 5' to the 3' of the strand, and the alternating motif in the antisense strand may begin with "BBAABBAA" from the 5' to the 3' of the strand, within the duplex region, such that a complete or partial shift in the modification pattern is made between the sense strand and the antisense strand.

[0333] In some embodiments, dsRNAi agent comprises the alternating motif pattern of 2'-O-methyl modification and 2'-F modification on the initial sense strand, which has shifted compared with the alternating motif pattern of 2'-O-methyl modification and 2'-F modification on the initial antisense strand, that is, the 2'-O-modified nucleotide on the sense strand base pairs with the 2'-F modified nucleotide on the antisense strand, and vice versa.The 1st position of the sense strand can start with 2'-F modification, and the 1st position of the antisense strand can start with 2'-O-methyl modification.

[0334] The introduction of one or more motifs with three identical modifications on three consecutive nucleotides into sense strand or antisense strand will interrupt the initial modification pattern that exists in sense strand or antisense strand.The introduction of one or more motifs with three identical modifications on three consecutive nucleotides into sense strand or antisense strand will interrupt the modification pattern of sense strand or antisense strand, and this interruption can enhance the gene silencing activity of target gene.

[0335] In some embodiments, when a motif of three identical modifications on three consecutive nucleotides is introduced into either strand, the modifications of the nucleotides adjacent to the motif are different from the modification of the motif. For example, a portion of a sequence containing a motif may be "...N a YYYN b ..." [where "Y" represents a modification of the motif with three identical modifications on three consecutive nucleotides, and "N a " and "N b " represents a modification to the nucleotide adjacent to the motif "YYY" that is different from the modification of Y, in this case N a and N b may be the same or different modifications. Alternatively, if wing modifications are present, N a or N b may or may not exist.

[0336] The iRNA may further comprise at least one phosphorothioate internucleotide linkage or methylphosphonate internucleotide linkage. The phosphorothioate internucleotide linkage or methylphosphonate internucleotide linkage modification may occur at any nucleotide at any position in the strand of the sense strand, the antisense strand, or both strands. For example, an internucleotide linkage modification may occur at every nucleotide on the sense strand or the antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or the antisense strand; or the sense strand or the antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of internucleotide linkage modifications on the sense strand may be the same as or different from that of the antisense strand, and the alternating pattern of internucleotide linkage modifications on the sense strand may have a shift compared to the alternating pattern of internucleotide linkage modifications on the antisense strand. In one embodiment, the double-stranded RNAi agent comprises six to eight phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5' end and two phosphorothioate internucleotide linkages at the 3' end, and the sense strand comprises at least two phosphorothioate internucleotide linkages at the 5' end or the 3' end.

[0337] In some embodiments, dsRNAi agent comprises the modification of phosphorothioate internucleotide linkage or methylphosphonate internucleotide linkage in the protruding region.For example, protruding region can contain two nucleotides, between which two nucleotides have phosphorothioate internucleotide linkage or methylphosphonate internucleotide linkage.The modification of internucleotide linkage can also be made so that protruding nucleotide is connected to the terminal paired nucleotide in the double-stranded region.For example, at least two, three, four or all protruding nucleotides can be connected via phosphorothioate internucleotide linkage or methylphosphonate internucleotide linkage, but the protruding nucleotide can also be connected to the paired nucleotide adjacent to the protruding nucleotide with additional phosphorothioate internucleotide linkage or methylphosphonate internucleotide linkage.For example, there can be at least two phosphorothioate internucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are protruding nucleotides, and the third nucleotide is the paired nucleotide adjacent to the protruding nucleotide. These terminal three nucleotides may be at the 3' end of the antisense strand, the 3' end of the sense strand, the 5' end of the antisense strand, or the 5' end of the antisense strand.

[0338] In some embodiments, the overhang of 2 nucleotides is at the 3 ' end of antisense strand, and there are two phosphorothioate internucleotide linkages between the three nucleotides at the end, and in this case, two of the three nucleotides are overhanging nucleotides, and the third nucleotide is the paired nucleotide adjacent to overhanging nucleotide.In addition, dsRNAi agent can have two phosphorothioate internucleotide linkages between the three nucleotides at the 5 ' end of sense strand and the 5 ' end of antisense strand.

[0339] In one embodiment, the dsRNAi agent comprises mismatch(es) with the target in the duplex, or a combination thereof. Mismatches may occur in the overhang region or in the duplex region. Base pairs can be ranked based on their tendency to promote dissociation or melting (for example, for the free energy of association or dissociation of a particular pairing, the simplest method is to consider the pairing at each base pair, but next-neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; I:C is preferred over G:C (I=inosine). Mismatches, such as non-canonical or non-canonical pairings (described elsewhere herein), are preferred over canonical (A:T, A:U, G:C) pairings; pairings involving universal bases are preferred over canonical pairings.

[0340] In certain embodiments, the dsRNAi agent comprises at least one of the first one, two, three, four, or five base pairs in the duplex region at the 5' end of the antisense strand independently selected from the group of A:U, G:U, I:C, and mismatch pairs, e.g., non-canonical or other than canonical pairs, or pairings containing universal bases, so as to promote dissociation of the antisense strand at the 5' end of the duplex.

[0341] In certain embodiments, the nucleotide at position 1 in the double-stranded region at the 5' end of antisense strand is selected from A, dA, dU, U and dT. Alternatively, at least one of the first one, two or three base pairs in the double-stranded region at the 5' end of antisense strand is AU base pair.For example, the first base pair in the double-stranded region at the 5' end of antisense strand is AU base pair.

[0342] In other embodiments, the nucleotide at the 3' end of the sense strand is deoxythymine (dT), or the nucleotide at the 3' end of the antisense strand is deoxythymine (dT). For example, there is a short sequence of deoxythymine nucleotides, e.g., two dT nucleotides, at the 3' end of the sense strand, the antisense strand, or both strands.

[0343] In certain embodiments, the sense strand sequence has formula (I): 5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3'(I) [In formula: i and j are each independently 0 or 1; p and q are each independently 0 to 6; each N a represents oligonucleotide sequences that independently contain 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b independently represent an oligonucleotide sequence containing 0 to 10 modified nucleotides; each n p and each n q independently represent overhanging nucleotides; where N b and Y do not have the same modification; XXX, YYY, and ZZZ each independently represent a motif with three identical modifications on three consecutive nucleotides. Preferably, all YYY are 2'-F modified nucleotides. It can be represented by:

[0344] In some embodiments, N a or N b includes modifications with alternating patterns.

[0345] In some embodiments, YYY motif is present at or near the cleavage site of sense strand.For example, when dsRNAi agent has a double-stranded region of 17-23 nucleotides in length, YYY motif can be present at or near the cleavage site (for example, can be present at 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13 positions) of sense strand, counting from the first nucleotide of 5'-end; or counting from the first paired nucleotide in the double-stranded region of 5'-end.

[0346] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Thus, the sense strand has the following formula: 5'n p -N a -YYY-N b -ZZZ-N a -n q 3'(Ib); 5'n p -N a -XXX-N b -YYY-N a -n q 3'(Ic); or 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3'(Id) It can be represented by:

[0347] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0348] When the sense strand is represented by formula (Ic), Nb represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0349] When the sense strand is represented as formula (Id), each N b represents an oligonucleotide sequence containing, independently, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. b is 0, 1, 2, 3, 4, 5, or 6. Each N a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0350] Each of X, Y, and Z may be the same as or different from the others.

[0351] In other embodiments, i is 0, j is 0, and the sense strand has the formula: 5'n p -N a -YYY-N a -n q 3'(Ia) It can be represented by:

[0352] When the sense strand is represented by formula (Ia), each N a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0353] In one embodiment, the antisense strand sequence of the RNAi has formula (II): 5'n q’ -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -np '3'(II) [In formula: k and l are each independently 0 or 1; p' and q' are each independently 0 to 6; each N a ' independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b ' independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; each n p ' and each n q ' independently represent an overhanging nucleotide; where N b ' and Y' do not have the same modification; X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent a motif with three identical modifications on three consecutive nucleotides. It can be represented by:

[0354] In some embodiments, N a ' or N b ' includes modifications with alternating patterns.

[0355] The Y'Y'Y' motif is present at or near the cleavage site of the antisense strand.For example, when the dsRNAi agent has a double-stranded region of 17 to 23 nucleotides in length, the Y'Y'Y' motif can be present at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, counting from the first nucleotide at the 5' end; or counting from the first paired nucleotide within the double-stranded region at the 5' end.Preferably, the Y'Y'Y' motif is present at positions 11, 12, 13.

[0356] In certain embodiments, the Y'Y'Y' motif is all 2'-OMe modified nucleotides.

[0357] In certain embodiments, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0358] Thus, the antisense strand has the following formula: 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p’ 3'(IIb); 5'n q’ -N a '-Y'Y'Y'-N b '-X'X'X'-n p’ 3'(IIc); or 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p’ 3'(IId) It can be represented by:

[0359] When the antisense strand is represented by formula (IIb), N b ' represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. a ' represents an oligonucleotide sequence that independently contains 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0360] When the antisense strand is represented by formula (IIc), N b ' represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides. a ' represents an oligonucleotide sequence that independently contains 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.

[0361] When the antisense strand is represented by formula (IId), each N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. b is 0, 1, 2, 3, 4, 5, or 6.

[0362] In other embodiments, k is 0, l is 0, and the antisense strand has the formula: 5'n p’ -N a’ -Y'Y'Y'-N a’ -n q’ 3'(Ia) It can be represented by:

[0363] When the antisense strand is represented by formula (IIa), each N a X', Y', and Z' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. Each of X', Y', and Z' can be the same or different from each other.

[0364] Each nucleotide of the sense strand and the antisense strand can be independently modified with LNA, CRN, UNA, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl or 2'-fluoro.For example, each nucleotide of the sense strand and the antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.Each X, Y, Z, X', Y' and Z' can specifically represent 2'-O-methyl modification or 2'-fluoro modification.

[0365] In some embodiments, the sense strand of the dsRNAi agent may contain a YYY motif at positions 9, 10, and 11 of the strand, which may be counted from the first nucleotide at the 5' end or counted at the first paired nucleotide within the 5' end duplex region if the duplex region is 21nt; Y represents a 2'-F modification. The sense strand may also contain a XXX motif or a ZZZ motif as a wing modification at the opposite end of the duplex region; XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.

[0366] In some embodiments, the antisense strand may contain a Y'Y'Y' motif occurring at positions 11, 12, 13 of the strand, which may be counted from the first nucleotide at the 5' end or counted at the first paired nucleotide within the 5'-end duplex region; Y' represents a 2'-O-methyl modification. The antisense strand may additionally contain an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the duplex region; X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.

[0367] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with the antisense strand represented by any one of the above formulas (IIa), (IIb), (IIc), and (IId), respectively.

[0368] Thus, a dsRNAi agent for use in the methods of the invention can include a sense strand and an antisense strand, each strand having 14-30 nucleotides, and the iRNA duplex can have the formula (III): Sense:5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -nq 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5' (III) [In formula: i, j, k, and l are each independently 0 or 1; p, p', q, and q' are each independently 0 to 6; each N a and each N a ' independently represent oligonucleotide sequences containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b and each N b ' independently represents an oligonucleotide sequence containing 0 to 10 modified nucleotides; where each of them may or may not be present, and each n p ',n p , n q ', and n q independently represent overhanging nucleotides; XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent a motif with three identical modifications on three consecutive nucleotides. It can be represented by:

[0369] In one embodiment, i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k is 1 and l is 0; or k is 0 and l is 1; or both k and l are 0; or both k and l are 1.

[0370] An exemplary combination of a sense strand and an antisense strand to form an iRNA duplex has the following formula: 5'n p -N a -YYY-N a -n q 3' 3'n p '-N a '-Y'Y'Y'-N a 'n q '5' (IIIa) 5'n p -N a -YYY-N b -ZZZ-N a -n q 3' 3'n p '-N a '-Y'Y'Y'-N b '-Z'Z'Z'-N a 'n q '5' (IIIb) 5'n p -N a -XXX-N b -YYY-N a -n q 3' 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N a '-n q '5' (IIIc) 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3' 3'n p '-N a '-X'X'X'-N b '-Y'Y'Y'-N b '-Z'Z'Z'-N a -n q '5' (IIId) Includes.

[0371] When the dsRNAi agent is represented by formula (IIIa), each N a represents an oligonucleotide sequence that independently contains from 2 to 20, from 2 to 15, or from 2 to 10 modified nucleotides.

[0372] When the dsRNAi agent is represented by formula (IIIb), each N b represents an oligonucleotide sequence containing, independently, 1 to 10, 1 to 7, 1 to 5, or 1 to 4 modified nucleotides. a represents an oligonucleotide sequence that independently contains from 2 to 20, from 2 to 15, or from 2 to 10 modified nucleotides.

[0373] When the dsRNAi agent is represented as formula (IIIc), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a represents an oligonucleotide sequence that independently contains from 2 to 20, from 2 to 15, or from 2 to 10 modified nucleotides.

[0374] When the dsRNAi agent is represented as formula (IIId), each N b , N b Each N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a , N a N' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. a , N a ', N b、 and N b Each of the ' independently includes modifications in an alternating pattern.

[0375] In formulas (III), (IIIa), (IIIb), (IIIc), and (IIId), each of X, Y, and Z may be the same as or different from one another.

[0376] When the dsRNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides can form a base pair with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides form a base pair with the corresponding Y' nucleotide; or all three of the Y nucleotides form a base pair with the corresponding Y' nucleotide.

[0377] When the dsRNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides can form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides form a base pair with the corresponding Z' nucleotide; or all three of the Z nucleotides form a base pair with the corresponding Z' nucleotide.

[0378] When the dsRNAi agent is represented by formula (IIIc) or (IIId), at least one of the X nucleotides can form a base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides form a base pair with the corresponding X' nucleotide; or all three of the X nucleotides form a base pair with the corresponding X' nucleotide.

[0379] In certain embodiments, the modification on a Y nucleotide is different from the modification on a Y' nucleotide, or the modification on a Z nucleotide is different from the modification on a Z' nucleotide, or the modification on an X nucleotide is different from the modification on an X' nucleotide.

[0380] In certain embodiments, when the dsRNAi agent is represented by formula (IIId), N aThe modification is a 2'-O-methyl modification or a 2'-fluoro modification. In another embodiment, when the RNAi agent is represented by formula (IIId), N a The modification is a 2'-O-methyl modification or a 2'-fluoro modification, p '>0 and at least one n p In yet another embodiment, when the RNAi agent is represented by formula (IIId), N' is linked to the adjacent nucleotide via a phosphorothioate linkage. a The modification is a 2'-O-methyl modification or a 2'-fluoro modification, p '>0 and at least one n p In another embodiment, when the RNAi agent is represented by formula (IIId), N' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand is conjugated to one or more GalNAc derivatives joined via a bivalent or trivalent branched linker (described below). a The modification is a 2'-O-methyl modification or a 2'-fluoro modification, p '>0 and at least one n p ' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives joined via a bivalent or trivalent branched linker.

[0381] In some embodiments, when the dsRNAi agent is represented by Formula (IIIa), N a The modification is a 2'-O-methyl modification or a 2'-fluoro modification, p '>0 and at least one n p ' is linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives joined via a bivalent or trivalent branched linker.

[0382] In some embodiments, dsRNAi agent is a multimer that contains at least two double strands represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), and in this case, double strands are connected by linker.Linker can be cleavable or non-cleavable.Multimer can further comprise a ligand.Each double strand can target the same gene, or can target two different genes; each double strand can target the same gene at two different target sites.

[0383] In some embodiments, dsRNAi agent is a multimer that contains 3, 4, 5, 6 or more double strands represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), and in this case, double strands are connected by linker.Linker can be cleavable or not cleavable.Multimer can further comprise a ligand.Each double strand can target the same gene, or can target two different genes; each double strand can target the same gene at two different target sites.

[0384] In one embodiment, two dsRNAi agents represented by at least one of formulas (III), (IIIa), (IIIb), (IIIc) and (IIId) can be linked to each other at one or both of 5'-end and 3'-end, and can be conjugated with ligand.Each agent can target the same gene, or can target two different genes; each agent can target the same gene at two different target sites.

[0385] In certain embodiments, the RNAi agent of the present invention may contain a small number of nucleotides containing 2'-fluoro modifications, for example, 10 or fewer nucleotides containing 2'-fluoro modifications. For example, the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 nucleotides with 2'-fluoro modifications. In a specific embodiment, the RNAi agent of the present invention contains 10 nucleotides with 2'-fluoro modifications, for example, four nucleotides with 2'-fluoro modifications in the sense strand and six nucleotides with 2'-fluoro modifications in the antisense strand. In another specific embodiment, the RNAi agent of the present invention contains six nucleotides with 2'-fluoro modifications in the sense strand, for example, four nucleotides with 2'-fluoro modifications and two nucleotides with 2'-fluoro modifications in the antisense strand.

[0386] In other embodiments, the RNAi agent of the present invention may contain only a small number of nucleotides containing 2'-fluoro modifications, for example, two or fewer nucleotides containing 2'-fluoro modifications.For example, the RNAi agent may contain two, one, or zero nucleotides with 2'-fluoro modifications.In a specific embodiment, the RNAi agent may contain two nucleotides with 2'-fluoro modifications, for example, zero nucleotides with 2-fluoro modifications in the sense strand and two nucleotides with 2'-fluoro modifications in the antisense strand.

[0387] A variety of publications describe multimeric iRNAs that can be used in the methods of the present invention, including WO2007 / 091269, U.S. Patent No. 7,858,769, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887, and WO2011 / 031520, the entire contents of each of which are incorporated herein by reference. Includes.

[0388] In certain embodiments, the compositions and methods of the present disclosure include vinyl phosphonate (VP) modifications of the RNAi agents described herein. In exemplary embodiments, the vinyl phosphonates of the present disclosure have the following structure:

[0389] [ka] The vinyl phosphonate of the present disclosure may be attached to the antisense strand or sense strand of the dsRNA of the present disclosure.In a certain preferred embodiment, the vinyl phosphonate of the present disclosure is attached to the antisense strand of dsRNA, and this may be attached at the 5' end of the antisense strand of dsRNA.

[0390] Vinyl phosphate modifications are also contemplated for the compositions and methods of the present disclosure. An exemplary vinyl phosphate structure is:

[0391] [ka] is.

[0392] As described in more detail below, iRNAs containing one or more carbohydrate moieties conjugated to the iRNA can optimize one or more properties of the iRNA. In many cases, the carbohydrate moiety will be conjugated to a modified subunit of the iRNA. For example, the ribose sugar of one or more ribonucleotide subunits of the iRNA can be replaced with a non-carbohydrate (preferably cyclic) carrier to which another moiety, such as a carbohydrate ligand, is attached. Herein, a ribonucleotide subunit in which the ribose sugar of the subunit has been replaced in this manner is referred to as a ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbocyclic ring system, i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms are heteroatoms, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, e.g., fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds.

[0393] The ligand may be attached to the polynucleotide via a carrier. The carrier comprises (i) at least one "backbone junction," preferably two "backbone junctions," and (ii) at least one "tethering junction." As used herein, a "backbone junction" refers to a functional group, e.g., a hydroxyl group, or generally a bond available and suitable for incorporation of the carrier into the backbone of a ribonucleic acid, e.g., a phosphate backbone or a modified phosphate backbone, e.g., a sulfur-containing backbone. In some embodiments, a "tethering junction" (TAP) refers to a ring atom, e.g., a carbon atom or a heteroatom (an atom significantly different from the atom providing the backbone junction), of a cyclic carrier to which a selected moiety is attached. The moiety may be, for example, a carbohydrate, e.g., a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. The selected moiety may be attached by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often contain a functional group, e.g., an amino group, or generally provide a bond suitable for incorporation or tethering of another chemical entity, e.g., a ligand, to the constituent ring.

[0394] The iRNA may be conjugated to the ligand via a carrier, which may be a cyclic or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuranyl, and decalin; preferably, the acyclic group is a serinol or diethanolamine backbone.

[0395] i. Thermal instability modification In certain embodiments, dsRNA molecules can be optimized for RNA interference by incorporating a thermolabile modification into the seed region of the antisense strand (i.e., at positions 2-9 of the 5' end of the antisense strand) to reduce or inhibit off-target gene silencing. It has been discovered that dsRNAs with antisense strands containing at least one thermolabile modification of the duplex within the first 9 nucleotide positions, counting from the 5' end of the antisense strand, have reduced off-target gene silencing activity. Thus, in some embodiments, the antisense strand contains at least one (e.g., one, two, three, four, five, or more) thermolabile modification of the duplex within the first 9 nucleotide positions of the 5' region of the antisense strand. In some embodiments, one or more thermolabile modification(s) of the duplex are located within positions 2-9, or preferably positions 4-8, from the 5' end of the antisense strand. In some further embodiments, the thermolabile modification(s) of the duplex are positioned at position 6, 7, or 8 from the 5'-end of the antisense strand. In some still further embodiments, the thermolabile modification(s) of the duplex are positioned at position 7 from the 5'-end of the antisense strand. The term "thermolabile modification(s)" includes a dsRNA that lowers the overall melting temperature (Tm) [preferably, a modification(s) that results in a Tm that is 1, 2, 3, or 4 degrees lower than the Tm of a dsRNA lacking such modifications. In some embodiments, the thermolabile modification(s) of the duplex are positioned at position 2, 3, 4, 5, or 9 from the 5'-end of the antisense strand.

[0396] An iRNA agent includes a sense strand and an antisense strand, each strand having 14 to 40 nucleotides. An RNAi agent has the formula (L):

[0397] [ka] [In formula (L), B1, B2, B3, B1', B2', B3', and B4' are each independently a nucleotide containing a modification selected from the group consisting of 2'-O-alkyl, 2'-substituted alkoxy, 2'-substituted alkyl, 2'-halo, ENA, and BNA / LNA. In one embodiment, B1, B2, B3, B1', B2', B3', and B4' each contain a 2'-OMe modification. In one embodiment, B1, B2, B3, B1', B2', B3', and B4' each contain a 2'-OMe or 2'-F modification. In one embodiment, at least one of B1, B2, B3, B1', B2', B3', and B4' contains a 2'-ON-methylacetamide (2'-O-NMA) modification.] It can be represented by:

[0398] C1 is a thermolabile nucleotide located opposite the seed region of the antisense strand (i.e., at positions 2-8 of the 5' end of the antisense strand). For example, C1 is located in the sense strand, pairing with the nucleotide at positions 2-8 of the 5' end of the antisense strand. In one example, C1 is located at position 15 of the 5' end of the sense strand. The C1 nucleotide possesses a thermolabile modification, which may include an abasic modification; a mismatch with the opposing nucleotide in the duplex; and a sugar modification such as a 2'-deoxy modification, or an acyclic nucleotide, e.g., an unlocked nucleic acid (UNA) or a glycerol nucleic acid (GNA). In one embodiment, C1: i) a mismatch with the opposing nucleotide in the antisense strand; ii)

[0399] [ka] an abasic modification selected from the group consisting of:

[0400] [ka] wherein B is a modified or unmodified nucleobase; R 1 and R 2are independently H, halogen, OR3, or alkyl; and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar. In one embodiment, the thermolabile modification in C1 is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T; at least one nucleobase in the mismatch pair may be a 2'-deoxynucleobase. In one example, the thermolabile modification in C1 is GNA or

[0401] [ka] is. T1, T1', T2', and T3 each independently represent a nucleotide containing a modification that provides the nucleotide with steric bulk equal to or less than that of a 2'-OMe modification. Steric bulk refers to the sum of the steric effects of the modifications. Those skilled in the art know methods for determining the steric effect of a nucleotide modification. The modification may be a modification at the 2' position of the ribose sugar of the nucleotide, or a non-ribose nucleotide, acyclic nucleotide, or modification to the backbone of the nucleotide that is similar or equivalent to a modification at the 2' position of the ribose sugar, providing the nucleotide with steric bulk equal to or less than that of a 2'-OMe modification. For example, T1, T1', T2', and T3' are each independently selected from DNA, RNA, LNA, 2'-F, and 2'-F-5'-methyl. In one embodiment, T1 is DNA. In one embodiment, T1' is DNA, RNA, or LNA. In one embodiment, T2' is DNA or RNA. In one embodiment, T3' is DNA or RNA. n 1 , n 3 , and q 1 are independently 4 to 15 nucleotides in length. n 5 , q 3 , and q7 are independently 1 to 6 nucleotide(s) in length. n 4 , q 2 , and q 6 are independently 1 to 3 nucleotide(s) in length; alternatively, n 4 is 0. q 5 are independently 0 to 10 nucleotide(s) in length. n 2 and q 4 are independently 0 to 3 nucleotide(s) in length.

[0402] Alternatively, n 4 is 0 to 3 nucleotides in length.

[0403] In one embodiment, n 4 can be 0. In one example, n 4 is 0, and q 2 and q 6 is 1. In another example, n 4 is 0, and q 2 and q 6 is 1 with modifications of two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0404] In one embodiment, n 4 , q 2 , and q 6 are each 1.

[0405] In one embodiment, n 2 , n 4 , q 2 , q 4 , and q 6 are each 1.

[0406] In one embodiment, C1 is at positions 14-17 of the 5' end of the sense strand when the sense strand is 19-22 nucleotides in length; 4 is 1. In one embodiment, C1 is at position 15 of the 5' end of the sense strand.

[0407] In one embodiment, T3' begins at position 2 of the 5' end of the antisense strand. 6 is equal to 1.

[0408] In one embodiment, T1' begins at position 14 of the 5' end of the antisense strand. 2 is equal to 1.

[0409] In an exemplary embodiment, T3' begins at position 2 of the 5' end of the antisense strand, and T1' begins at position 14 of the 5' end of the antisense strand. In one example, T3' begins at position 2 of the 5' end of the antisense strand, and q 6 is equal to 1, T1' starts from position 14 of the 5' end of the antisense strand, and q 2 is equal to 1.

[0410] In one embodiment, T1' and T3' are separated by a length of 11 nucleotides (ie, not counting the T1' and T3' nucleotides).

[0411] In one embodiment, T1' is at position 14 of the 5' end of the antisense strand. 2 is equal to 1, and modifications at the 2' position, or at non-ribose, acyclic or backbone positions, provide less steric bulk than 2'-OMe ribose.

[0412] In one embodiment, T3' is at position 2 of the 5' end of the antisense strand. 6 is equal to 1, and modifications at the 2' position, or at non-ribose, acyclic or backbone positions, result in steric bulk less than 2'-OMe ribose.

[0413] In one embodiment, T1 is at the cleavage site of the sense strand. In one example, T1 is at position 11 of the 5' end of the sense strand when the sense strand is 19-22 nucleotides in length. 2 is 1. In an exemplary embodiment, T1 is at the cleavage site of the sense strand, at position 11 at the 5' end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1.

[0414] In one embodiment, T2' begins at position 6 of the 5' end of the antisense strand. In one example, T2' is located at positions 6-10 of the 5' end of the antisense strand, and 4 is 1.

[0415] In an exemplary embodiment, T1 is located at the cleavage site of the sense strand, e.g., at position 11 of the 5' end of the sense strand, when the sense strand is 19 to 22 nucleotides in length, and n 2 is 1; T1' is at position 14 of the 5' end of the antisense strand, and q 2 is equal to 1, the modification to T1' is at the 2' position of the ribose sugar or at a non-ribose, acyclic or backbone position that is less sterically bulky than 2'-OMe ribose; T2' is at positions 6-10 of the 5' end of the antisense strand, and q 4 is 1; T3' is at position 2 of the 5' end of the antisense strand, and q 6 is equal to 1, and the modification to T3' is at the 2' position or at a non-ribose, acyclic or backbone position, providing steric bulk less than 2'-OMe ribose.

[0416] In one embodiment, T2' begins at position 8 of the 5' end of the antisense strand. 4 is 2.

[0417] In one embodiment, T2' begins at position 9 of the 5' end of the antisense strand. 4 is 1.

[0418] In one embodiment, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0419] In one embodiment, n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0420] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.

[0421] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0422] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 6, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 7, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.

[0423] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 6, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 7, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0424] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.

[0425] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0426] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 5, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; and may be accompanied by at least two additional TTs at the 3' end of the antisense strand.

[0427] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 5, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1; optionally with at least two additional TTs at the 3' end of the antisense strand; with a modification with two phosphorothioate internucleotide linkages within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with a modification with two phosphorothioate internucleotide linkages within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with a modification with two phosphorothioate internucleotide linkages within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0428] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.

[0429] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modification with two phosphorothioate internucleotide linkages in positions 1 to 5 of the sense strand (counting from the 5' end), with modification with two phosphorothioate internucleotide linkages in positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modification with two phosphorothioate internucleotide linkages in positions 18 to 23 of the antisense strand (counting from the 5' end).

[0430] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1.

[0431] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0432] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1.

[0433] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).

[0434] The RNAi agent may contain a phosphorus-containing group at the 5' end of the sense or antisense strand. The 5'-terminal phosphorus-containing group may be 5'-terminal phosphate (5'-P), 5'-terminal phosphorothioate (5'-PS), 5'-terminal phosphorodithioate (5'-PS2), 5'-terminal vinylphosphonate (5'-VP), 5'-terminal methylphosphonate (MePhos), or 5'-deoxy-5'-C-malonyl (

[0435] [ka] When the 5'-terminal phosphorus-containing group is a 5'-terminal vinyl phosphonate (5'-VP), the 5'-VP may be a 5'-E-VP isomer (i.e., trans-vinyl phosphate,

[0436] [ka] ), 5'-Z-VP isomer (i.e., cis-vinyl phosphate,

[0437] [ka] ), or a mixture thereof.

[0438] In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5'-end of the sense strand.In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5'-end of the antisense strand.

[0439] In one embodiment, the RNAi agent comprises a 5'-P. In one embodiment, the RNAi agent comprises a 5'-P in the antisense strand.

[0440] In one embodiment, the RNAi agent comprises a 5'-PS. In one embodiment, the RNAi agent comprises a 5'-PS in the antisense strand.

[0441] In one embodiment, the RNAi agent comprises a 5'-VP. In one embodiment, the RNAi agent comprises a 5'-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5'-E-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5'-Z-VP in the antisense strand.

[0442] In one embodiment, the RNAi agent comprises a 5'-PS2. In one embodiment, the RNAi agent comprises a 5'-PS2 in the antisense strand.

[0443] In one embodiment, the RNAi agent comprises a 5'-PS2. In one embodiment, the RNAi agent comprises a 5'-deoxy-5'-C-malonyl in the antisense strand.

[0444] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also contains a 5'-PS.

[0445] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also contains a 5'-P.

[0446] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0447] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-PS2.

[0448] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.

[0449] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P.

[0450] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS.

[0451] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP. The 5'-VP can be 5'-E-VP, 5'-Z-VP, or a combination thereof.

[0452] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2.

[0453] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl.

[0454] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also contains a 5'-P.

[0455] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The dsRNA agent also includes a 5'-PS.

[0456] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0457] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-PS2.

[0458] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.

[0459] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 (counting from the 5' end) of the sense strand, with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 (counting from the 5' end of the antisense strand) of the antisense strand, and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-P.

[0460] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 (counting from the 5' end) of the sense strand, with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 (counting from the 5' end of the antisense strand) of the antisense strand, and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS.

[0461] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 (counting from the 5' end) of the sense strand, with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 (counting from the 5' end) of the antisense strand, and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-VP. The 5'-VP can be 5'-E-VP, 5'-Z-VP, or a combination thereof.

[0462] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 (counting from the 5' end) of the sense strand, with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 (counting from the 5' end of the antisense strand) of the antisense strand, and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS2.

[0463] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 (counting from the 5' end) of the sense strand, with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 (counting from the 5' end of the antisense strand) of the antisense strand, and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes 5'-deoxy-5'-C-malonyl.

[0464] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-P.

[0465] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-PS.

[0466] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0467] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The dsRNAi RNA (dsRNAi RNA) also contains a 5'-PS2.

[0468] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.

[0469] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P.

[0470] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS.

[0471] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP. The 5'-VP can be 5'-E-VP, 5'-Z-VP, or a combination thereof.

[0472] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2.

[0473] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl.

[0474] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-P.

[0475] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-PS.

[0476] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.

[0477] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also includes a 5'-PS2.

[0478] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.

[0479] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P.

[0480] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS.

[0481] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP. The 5'-VP can be 5'-E-VP, 5'-Z-VP, or a combination thereof.

[0482] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2.

[0483] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl.

[0484] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0485] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1; with two phosphorothioate internucleotide linkage modifications at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), with two phosphorothioate internucleotide linkage modifications. The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0486] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with modifications by two phosphorothioate internucleotide linkages at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), with modifications by two phosphorothioate internucleotide linkages at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with modifications by two phosphorothioate internucleotide linkages at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP (e.g., 5'-E-VP, 5'-Z-VP, or a combination thereof) and a targeting ligand.

[0487] In one embodiment, the 5'-VP is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.

[0488] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2 and a targeting ligand. In one embodiment, the 5'-PS2 is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0489] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl and a targeting ligand. In one embodiment, the 5'-deoxy-5'-C-malonyl is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0490] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with two phosphorothioate internucleotide linkage modifications at positions 1 to 5 (counting from the 5' end) of the sense strand, with two phosphorothioate internucleotide linkage modifications at positions 1 and 2 (counting from the 5' end) of the antisense strand, and with two phosphorothioate internucleotide linkage modifications at positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0491] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1; with a modification with two phosphorothioate internucleotide linkages at positions 1 to 5 (counting from the 5' end) of the sense strand, with a modification with two phosphorothioate internucleotide linkages at positions 1 and 2 (counting from the 5' end) of the antisense strand, and with a modification with two phosphorothioate internucleotide linkages at positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0492] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1; with two phosphorothioate internucleotide linkages at positions 1 to 5 (counting from the 5' end) of the sense strand, with two phosphorothioate internucleotide linkages at positions 1 and 2 (counting from the 5' end) of the antisense strand, and with two phosphorothioate internucleotide linkages at positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-VP (e.g., 5'-E-VP, 5'-Z-VP, or a combination thereof) and a targeting ligand. In one embodiment, the 5'-VP is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0493] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1; with two phosphorothioate internucleotide linkage modifications at positions 1 to 5 (counting from the 5' end) of the sense strand, with two phosphorothioate internucleotide linkage modifications at positions 1 and 2 (counting from the 5' end) of the antisense strand, and with two phosphorothioate internucleotide linkage modifications at positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS2 and a targeting ligand. In one embodiment, the 5'-PS2 is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0494] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1; with two phosphorothioate internucleotide linkage modifications at positions 1 to 5 (counting from the 5' end) of the sense strand, with two phosphorothioate internucleotide linkage modifications at positions 1 and 2 (counting from the 5' end) of the antisense strand, and with two phosphorothioate internucleotide linkage modifications at positions 18 to 23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes 5'-deoxy-5'-C-malonyl and a targeting ligand. In one embodiment, the 5'-deoxy-5'-C-malonyl is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0495] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0496] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0497] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), there is a modification with two phosphorothioate internucleotide linkages; within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), there is a modification with two phosphorothioate internucleotide linkages; and within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand), there is a modification with two phosphorothioate internucleotide linkages. The RNAi agent also includes a 5'-VP (e.g., 5'-E-VP, 5'-Z-VP, or a combination thereof) and a targeting ligand. In one embodiment, the 5'-VP is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0498] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2 and a targeting ligand. In one embodiment, the 5'-PS2 is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0499] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with two phosphorothioate internucleotide linkage modifications at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl and a targeting ligand. In one embodiment, the 5'-deoxy-5'-C-malonyl is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0500] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0501] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0502] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), there is a modification with two phosphorothioate internucleotide linkages; within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), there is a modification with two phosphorothioate internucleotide linkages; and within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand), there is a modification with two phosphorothioate internucleotide linkages. The RNAi agent also includes a 5'-VP (e.g., 5'-E-VP, 5'-Z-VP, or a combination thereof) and a targeting ligand. In one embodiment, the 5'-VP is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0503] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications within positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2 and a targeting ligand. In one embodiment, the 5'-PS2 is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0504] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7, and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1; with two phosphorothioate internucleotide linkage modifications at positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), with two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand (counting from the 5' end of the antisense strand), and with two phosphorothioate internucleotide linkage modifications at positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl and a targeting ligand. In one embodiment, the 5'-deoxy-5'-C-malonyl is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.

[0505] In certain embodiments, the RNAi agents of the invention include: (a) a sense strand, (i) 21 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; and (iii) 2'-F modifications at positions 1, 3, 5, 7, 9-11, 13, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 12, 14-16, 18, and 20 (counting from the 5' end). a sense strand having: (b) an antisense strand, (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3, 5, 9, 11-13, 15, 17, 19, 21, and 23, and 2'F modifications at positions 2, 4, 6-8, 10, 14, 16, 18, 20, and 22 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 21 and 22 and between nucleotide positions 22 and 23 (counting from the 5' end) and an antisense strand having Includes; In this case, the dsRNA agent has a two nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0506] In another specific embodiment, the RNAi agent of the invention is (a) a sense strand, (i) 21 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; (iii) 2'-F modifications at positions 1, 3, 5, 7, 9-11, 13, 15, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5' end) a sense strand having: (b) an antisense strand, (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3, 5, 7, 9, 11-13, 15, 17, 19, and 21-23, and 2'F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5' end) and an antisense strand having Includes; In this case, the RNAi agent has a two nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0507] In another specific embodiment, the RNAi agent of the invention is (a) a sense strand, (i) 21 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; (iii) 2'-OMe modifications at positions 1 to 6, 8, 10, and 12 to 21, 2'-F modifications at positions 7 and 9, and a deoxynucleotide (e.g., dT) at position 11 (counting from the 5' end); and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5' end) a sense strand having: (b) an antisense strand, (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3, 7, 9, 11, 13, 15, 17, and 19-23, and 2'-F modifications at positions 2, 4-6, 8, 10, 12, 14, 16, and 18 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5' end) and an antisense strand having Includes; In this case, the RNAi agent has a two nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0508] In another specific embodiment, the RNAi agent of the invention is (a) a sense strand, (i) 21 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; (iii) 2'-OMe modifications at positions 1 to 6, 8, 10, 12, 14, and 16 to 21, and 2'-F modifications at positions 7, 9, 11, 13, and 15; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5' end) a sense strand having: (b) an antisense strand, (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 5, 7, 9, 11, 13, 15, 17, 19, and 21-23, and 2'-F modifications at positions 2-4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5' end) and an antisense strand having Includes; In this case, the RNAi agent has a two nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0509] In another specific embodiment, the RNAi agent of the invention is (a) a sense strand, (i) 21 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; (iii) 2'-OMe modifications at positions 1 to 9 and 12 to 21, and 2'-F modifications at positions 10 and 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5' end) a sense strand having: (b) an antisense strand, (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3, 5, 7, 9, 11-13, 15, 17, 19, and 21-23, and 2'-F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5' end) and an antisense strand having Includes; In this case, the RNAi agent has a two nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0510] In another specific embodiment, the RNAi agent of the invention is (a) a sense strand, (i) 21 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; (iii) 2'-F modifications at positions 1, 3, 5, 7, 9-11, and 13, and 2'-OMe modifications at positions 2, 4, 6, 8, 12, and 14-21; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5' end) a sense strand having: (b) an antisense strand, (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3, 5-7, 9, 11-13, 15, 17-19, and 21-23, and 2'-F modifications at positions 2, 4, 8, 10, 14, 16, and 20 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5' end) and an antisense strand having Includes; In this case, the RNAi agent has a two nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0511] In another specific embodiment, the RNAi agent of the invention is (a) a sense strand, (i) 21 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; (iii) 2'-OMe modifications at positions 1, 2, 4, 6, 8, 12, 14, 15, 17, and 19-21, and 2'-F modifications at positions 3, 5, 7, 9-11, 13, 16, and 18; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5' end) a sense strand having: (b) an antisense strand, (i) 25 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 4, 6, 7, 9, 11-13, 15, 17, and 19-23, 2'-F modifications at positions 2, 3, 5, 8, 10, 14, 16, and 18, and deoxy-nucleotides (e.g., dT) at positions 24 and 25 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5' end) and an antisense strand having Includes; In this case, the RNAi agent has a four nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0512] In another specific embodiment, the RNAi agent of the invention is (a) a sense strand, (i) 21 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; (iii) 2'-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2'-F modifications at positions 7, and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5' end) a sense strand having: (b) an antisense strand, (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 8, 10-13, 15, and 17-23, and 2'-F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5' end) and an antisense strand having Includes; In this case, the RNAi agent has a two nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0513] In another specific embodiment, the RNAi agent of the invention is (a) a sense strand, (i) 21 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; (iii) 2'-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2'-F modifications at positions 7, and 9 to 11; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5' end) a sense strand having: (b) an antisense strand, (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 10-13, 15, and 17-23, and 2'-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5' end) and an antisense strand having Includes; In this case, the RNAi agent has a two nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0514] In another specific embodiment, the RNAi agent of the invention is (a) a sense strand, (i) 19 nucleotides in length; (ii) an ASGPR ligand conjugated to the 3' end, the ASGPR ligand comprising three GalNAc derivatives conjugated via a trivalent branched linker; (iii) 2'-OMe modifications at positions 1 to 4, 6, and 10 to 19, and 2'-F modifications at positions 5, and 7 to 9; and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 and between nucleotide positions 2 and 3 (counting from the 5' end) a sense strand having: (b) an antisense strand, (i) 21 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 10-13, 15, and 17-21, and 2'-F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5' end); and (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 19 and 20, and between nucleotide positions 20 and 21 (counting from the 5' end) and an antisense strand having Includes; In this case, the RNAi agent has a two nucleotide overhang at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0515] In certain embodiments, the iRNA for use in the methods of the invention is an agent selected from the agents listed in any one of Tables 2-5, 14, and 15. These agents may further comprise a ligand.

[0516] III. iRNA conjugated to a ligand Another modification of the RNAi RNA of the present disclosure involves chemically linking to the iRNA one or more ligands, moieties, or conjugates that enhance the activity, intracellular distribution, or uptake of the iRNA, for example, into cells. Such moieties include, but are not limited to, lipid moieties such as cholesterol moieties (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556).In other embodiments, the ligand is cholic acid [Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060], a thioether such as beryl-S-tritylthiol [Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770], thiocholesterol [Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538], an aliphatic chain such as dodecanediol or undecyl residue [Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54], phospholipids, such as dihexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate [Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783], polyamine chains or polyethylene glycol chains [Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973], or adamantane acetic acid [Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654], a palmityl moiety [Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237], or an octadecylamine or hexylaminocarbonyloxycholesterol moiety [Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937].

[0517] In certain embodiments, a ligand alters the distribution, targeting, or lifespan of an iRNA agent into which it is incorporated. In preferred embodiments, a ligand provides enhanced affinity for a selected target, e.g., a molecule, a cell or cell type, a compartment, e.g., a cellular or organ compartment, a tissue, an organ, or a region of the body, compared to, for example, a molecular species in the absence of such a ligand. Preferred ligands do not participate in the pairing of the double strand within a double-stranded nucleic acid.

[0518] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protoamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha-helical peptides.

[0519] The ligand can also include targeting groups, such as cell targeting agents or tissue targeting agents, such as lectins, glycoproteins, lipids, or proteins, such as antibodies that bind to specific cell types, such as kidney cells.The targeting group can be thyrotropin, melanotropin, lectins, glycoproteins, surfactant protein A, mucin-based carbohydrates, polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonates, polyglutamate, polyaspartate, lipids, cholesterol, steroids, bile acids, folate, vitamin B12, vitamin A, biotin, or RGD peptide or RGD peptide mimics.In certain embodiments, the ligand is polyvalent galactose, such as N-acetylgalactosamine.

[0520] Other examples of ligands include dyes, intercalating agents (e.g., acridine), crosslinkers (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), heterocyclic aromatic carbohydrates (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules [e.g., cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)isothiazolinone], and the like. cholenoic acid, dimethoxytrityl, or phenoxazine, and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

[0521] A ligand can be a protein, e.g., a glycoprotein, or a peptide, e.g., a molecule with specific affinity for a co-ligand, or an antibody, e.g., an antibody that binds to a specified cell type, such as a hepatocyte. Ligands can also include hormones and hormone receptors. Ligands can also include molecular species other than peptides, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose. Ligands can be, for example, lipopolysaccharides, activators of p38 MAP kinase, or activators of NF-κB.

[0522] The ligand can be a substance, e.g., a drug, that can increase cellular uptake of an iRNA agent, e.g., by disrupting the cytoskeleton, e.g., by disrupting cellular microtubules, microfilaments, or intermediate filaments. The drug can be, e.g., taxol, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

[0523] In some embodiments, the ligands conjugated to the iRNAs described herein act as pharmacokinetic modulators (PK modulators). PK modulators include lipophilic substances, bile acids, steroids, phospholipid analogs, peptides, protein-binding agents, PEG, vitamins, and the like. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglycerides, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, and biotin. Oligonucleotides containing multiple phosphorothioate linkages are also known to bind to serum proteins. Therefore, short oligonucleotides, e.g., about 5-, 10-, 15-, or 20-base oligonucleotides, containing multiple phosphorothioate linkages in the backbone are also suitable for use as ligands (e.g., PK-modulating ligands) in the present invention. In addition, aptamers that bind to serum components (e.g., serum proteins) are also suitable for use as PK-modulating ligands in the embodiments described herein.

[0524] The ligand-conjugated iRNAs of the invention can be synthesized using oligonucleotides bearing a reactive pendant functional group, such as a reactive pendant functional group (described below) resulting from the attachment of a linking molecule to the oligonucleotide. The reactive oligonucleotide can be reacted directly with a commercially available ligand, a synthetic ligand bearing any of a variety of protecting groups, or a ligand to which a linking moiety has been attached.

[0525] The oligonucleotides used in the conjugates of the present invention can be conveniently and routinely produced through well-known solid-phase synthesis methods. Equipment for such synthesis is sold by several vendors, including, for example, Applied Biosystems® (Foster City, Calif.). Additionally or alternatively, any other method for such synthesis known in the art can be utilized. It is also known to use similar techniques to prepare other oligonucleotides, such as phosphorothioate derivatives and alkylated derivatives.

[0526] In the ligand-conjugated iRNAs of the present invention and ligand molecules bearing sequence-specific linked nucleosides, the oligonucleotides and oligonucleosides can be assembled on a suitable DNA synthesizer using standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear a linking moiety, ligand-nucleotide or nucleoside conjugate precursors that already bear a ligand molecule, or ligand-bearing components other than nucleosides.

[0527] When using a nucleotide conjugate precursor that already possesses a linking moiety, typically, synthesis of the sequence-specific linked nucleoside is completed, and then a ligand molecule is reacted with the linking moiety to form the ligand-conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by automated synthesizers using phosphoramidites derived from ligand-nucleoside conjugates, in addition to standard and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.

[0528] A. Lipid Conjugates In certain embodiments, the ligand or conjugate is a lipid or lipid-based molecule.Such lipid or lipid-based molecule preferably binds to serum protein, for example, human serum albumin (HSA).HSA-binding ligand allows the distribution of conjugate to target tissue, for example, target tissue other than the kidney in the body.For example, the target tissue can be liver tissue, including liver parenchymal cells.Other molecules that can bind to HSA can also be used as ligand.For example, naproxen or aspirin can be used.Lipid or lipid-based ligand can (a) increase the resistance of conjugate to degradation, (b) increase targeting or transport to target cell or target cell membrane, or (c) be used to adjust the binding to serum protein, for example, HSA.

[0529] Lipid-based ligand can be used to inhibit, for example, control the binding of conjugate to target tissue.For example, lipid or lipid-based ligand that strongly binds to HSA will be less likely to be targeted to the kidney, and therefore less likely to be cleared from the body.Lipid or lipid-based ligand that weakly binds to HSA can be used to target conjugate to the kidney.

[0530] In certain embodiments, the lipid-based ligand binds to HSA. Preferably, the lipid-based ligand binds to HSA with sufficient affinity so that the conjugate preferably distributes to tissues other than the kidney. However, the affinity is preferably not so strong that the HSA-ligand bond cannot be broken.

[0531] In other embodiments, the lipid-based ligand binds weakly or not at all to HSA, such that the conjugate preferably distributes to the kidney. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid-based ligand.

[0532] In another embodiment, the ligand is a moiety, e.g., a vitamin, that is taken up by target cells, e.g., proliferating cells. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., by malignant or non-malignant cells, e.g., cancer cells. Exemplary vitamins include vitamins A, E, and K. Other exemplary vitamins include B vitamins, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by target cells, such as hepatocytes. Also included are HSA and low-density lipoprotein (LDL).

[0533] B. Cell-penetrating agents In another embodiment, the ligand is a cell-penetrating agent, preferably a helical cell-penetrating agent. Preferably, the agent is amphipathic. Exemplary agents are peptides such as tat or antenopedia. When the agent is a peptide, the agent can be modified, including peptidyl mimetics, invertomers, non-peptide or pseudopeptide linkages, and the use of D-amino acids. The helical agent preferably has a lipophilic phase and a lipophobic phase, and is preferably an alpha-helical agent.

[0534] The ligand can be a peptide or a peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules capable of folding into defined three-dimensional structures similar to natural peptides. Conjugation of peptides and peptidomimetics to iRNA agents can affect the pharmacokinetic distribution of iRNAs, such as by enhancing cellular recognition and uptake. The peptide or peptidomimetic portion can be about 5 to 50 amino acids in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0535] The peptide or peptidomimetic can be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., composed primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimeric peptide, a constrained peptide, or a cross-linked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS-containing peptide is recombinant fibroblast growth factor (RFGF) having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 18). RFGF analogs containing a hydrophobic MTS [e.g., the amino acid sequence AALLPVLLAAP (SEQ ID NO: 19)] can also be targeting moieties. The peptide moiety can be a "delivery" peptide capable of transporting large polar molecules, including peptides, oligonucleotides, and proteins, across cell membranes. For example, sequences derived from the HIV Tat protein [GRKKRRQRRRPPQ (SEQ ID NO: 20)] and the Drosophila Antennapedia protein [RQIKIWFQNRRMKWKK (SEQ ID NO: 21)] have been found to be capable of functioning as delivery peptides. Peptides or peptidomimetics can be encoded by random sequences of DNA, such as peptides identified from phage display libraries or OBOC (one-bead-one-compound) combinatorial libraries (Lam et al., Nature, 354:82-84, 1991). An example of a peptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit for cell targeting purposes is an arginine-glycine-aspartic acid (RGD) peptide or RGD mimic. The peptide portion can range in length from about 5 amino acids to about 40 amino acids. The peptide portion can have structural modifications, such as structural modifications that increase stability or direct conformational properties. Any of the structural modifications described below may be utilized.

[0536] The RGD peptides for use in the compositions and methods of the present invention can be linear or cyclic, and can be modified, for example, glycosylated or methylated, to facilitate targeting to specific tissue(s). RGD-containing peptides and peptidomimetics can include D-amino acids as well as synthetic RGD mimics. In addition to RGD, other moieties that target integrin ligands can also be used. Preferred conjugates of this ligand target PECAM-1 or VEGF.

[0537] A "cell-penetrating peptide" is capable of penetrating cells, e.g., microbial cells such as bacterial or fungal cells, or mammalian cells such as human cells. Microbial cell-penetrating peptides can be, for example, α-helical linear peptides (e.g., LL-37 or cecropin P1), disulfide bond-containing peptides (e.g., α-defensins, β-defensins, or bactenecins), or peptides containing only one or two key amino acids (e.g., PR-39 or indolicidin). Cell-penetrating peptides can also contain a nuclear localization signal (NLS). For example, cell-penetrating peptides can be bipartite amphipathic peptides such as MPG, derived from fusion peptide domains such as the NLS of HIV-1 gp41 and SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31:2717-2724, 2003).

[0538] C. Carbohydrate conjugates In some embodiments of the compositions and methods of the present invention, the iRNA further comprises a carbohydrate. Carbohydrate-conjugated iRNAs are advantageous for in vivo nucleic acid delivery, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, "carbohydrate" refers to a carbohydrate itself, composed of one or more monosaccharide units (which may be linear, branched, or cyclic) having at least six carbon atoms, with an oxygen, nitrogen, or sulfur atom attached to each carbon atom; or a compound having as its component a carbohydrate moiety composed of one or more monosaccharide units (which may be linear, branched, or cyclic), each having at least six carbon atoms (which may be linear, branched, or cyclic) attached to each carbon atom by an oxygen, nitrogen, or sulfur atom. Representative carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing about four, five, six, seven, eight, or nine monosaccharide units), and polysaccharides such as starch, glycogen, cellulose, and polysaccharide gums. Specific monosaccharides include C5 and higher sugars (e.g., C5, C6, C7, or C8); disaccharides and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

[0539] In certain embodiments, carbohydrate conjugates for use in the compositions and methods of the invention are monosaccharides.

[0540] In certain embodiments, the monosaccharide is N-acetylgalactosamine (GalNAc). GalNAc conjugates containing one or more N-acetylgalactosamine (GalNAc) derivatives are described, for example, in US 8,106,022, the entire contents of which are incorporated herein by reference. In some embodiments, GalNAc conjugates are used as ligands to target iRNA to specific cells. In some embodiments, GalNAc conjugates are used, for example, as ligands for the asialoglycoprotein receptor of liver cells (e.g., hepatocytes), thereby targeting iRNA to liver cells.

[0541] In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments, the GalNAc conjugate is conjugated to the 3' end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to an iRNA agent (e.g., to the 3' end of the sense strand) via a linker, e.g., a linker described herein. In some embodiments, the GalNAc conjugate is conjugated to the 5' end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to an iRNA agent (e.g., to the 5' end of the sense strand) via a linker, e.g., a linker described herein.

[0542] In certain embodiments of the invention, GalNAc or GalNAc derivatives are conjugated to iRNA agents of the invention via a monovalent linker. In some embodiments, GalNAc or GalNAc derivatives are conjugated to iRNA agents of the invention via a bivalent linker. In yet other embodiments of the invention, GalNAc or GalNAc derivatives are conjugated to iRNA agents of the invention via a trivalent linker. In other embodiments of the invention, GalNAc or GalNAc derivatives are conjugated to iRNA agents of the invention via a tetravalent linker.

[0543] In certain embodiments, double-stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative conjugated to an iRNA agent. In certain embodiments, double-stranded RNAi agents of the invention comprise multiple (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently conjugated to multiple nucleotides of the double-stranded RNAi agent via multiple monovalent linkers.

[0544] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of a single larger molecule connected by an uninterrupted stretch of nucleotides between the 3' end of one strand and the 5' end of each of the other strands to form a hairpin loop containing multiple unpaired nucleotides, each unpaired nucleotide in the hairpin loop can independently comprise a GalNAc or GalNAc derivative joined via a monovalent linker. Hairpin loops can also be formed by an extended overhang in one strand of the duplex.

[0545] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of a single larger molecule connected by an uninterrupted stretch of nucleotides between the 3' end of one strand and the 5' end of each of the other strands to form a hairpin loop containing multiple unpaired nucleotides, each unpaired nucleotide in the hairpin loop can independently comprise a GalNAc or GalNAc derivative joined via a monovalent linker. Hairpin loops can also be formed by an extended overhang in one strand of the duplex.

[0546] In one embodiment of the present invention, the carbohydrate conjugate for use in the compositions and methods comprises:

[0547] [ka]

[0548] [ka]

[0549] [ka]

[0550] [ka] is selected from the group consisting of:

[0551] In another embodiment, the carbohydrate conjugate for use in the compositions and methods of the present invention is a monosaccharide. In one embodiment, the monosaccharide is

[0552] [ka] and other N-acetylgalactosamines.

[0553] In some embodiments, the RNAi agent has the following structure:

[0554] [ka] The carbohydrate conjugate is attached via a linker shown in

[0555] In some embodiments, the RNAi agent is as defined in Table 1, as follows:

[0556] [ka] It is conjugated to L96 as shown in Figure 1.

[0557] Another exemplary carbohydrate conjugate for use in the embodiments described herein is:

[0558] [ka] (Formula XXXVI) wherein when one of X or Y is an oligonucleotide, the other is hydrogen. Including but not limited to:

[0559] In some embodiments, suitable ligands are those disclosed in WO2019 / 055633, the entire contents of which are incorporated herein by reference. In one embodiment, the ligand has the following structure:

[0560] [ka] Includes.

[0561] In certain embodiments of the invention, GalNAc or GalNAc derivatives are conjugated to iRNA agents of the invention via a monovalent linker. In some embodiments, GalNAc or GalNAc derivatives are conjugated to iRNA agents of the invention via a bivalent linker. In yet other embodiments of the invention, GalNAc or GalNAc derivatives are conjugated to iRNA agents of the invention via a trivalent linker.

[0562] In one embodiment of the present invention, the double-stranded RNAi agent comprises one or more GalNAc or GalNAc derivatives attached to the iRNA agent. GalNAc may be attached to any nucleotide via a linker on the sense strand or antisense strand. GalNAc may be attached to the 5' end of the sense strand, the 3' end of the sense strand, the 5' end of the antisense strand, or the 3' end of the antisense strand. In one embodiment, GalNAc is attached to the 3' end of the sense strand, for example, via a trivalent linker.

[0563] In other embodiments, a double-stranded RNAi agent of the invention comprises multiple (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently joined to multiple nucleotides of the double-stranded RNAi agent via multiple linkers, e.g., monovalent linkers.

[0564] In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of a single larger molecule connected by an uninterrupted stretch of nucleotides between the 3' end of one strand and the 5' end of each of the other strands, forming a hairpin loop containing multiple unpaired nucleotides, each unpaired nucleotide in the hairpin loop can independently comprise a GalNAc or GalNAc derivative joined via a monovalent linker.

[0565] In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands described above, such as, but not limited to, a PK modulator or a cell-penetrating peptide.

[0566] Additional carbohydrate conjugates and linkers suitable for use in the present invention include those described in PCT Publication Nos. WO2014 / 179620 and WO2014 / 179627, the entire contents of each of which are incorporated herein by reference.

[0567] D. Linker In some embodiments, the conjugates or ligands described herein may be joined to the iRNA oligonucleotide by a variety of linkers, which may or may not be cleavable.

[0568] The term "linker" or "linking group" means an organic moiety that connects two parts of a compound, eg, an organic moiety that covalently joins two parts of a compound.A linker is typically a direct bond, or an atom such as oxygen or sulfur, a unit such as NR, C(O), C(O)NH, SO, SO, SONH, or a group consisting of substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted alkynyl or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroaryl Alkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhetero(herero)cyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl , alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl, etc., where one or more methylenes are interrupted or terminated by O, S, S(O), SO, N(R), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocycle, where R is hydrogen, acyl, aliphatic, or substituted aliphatic.In one embodiment, the linker is about 1 to 24 atoms, 2 to 24, 3 to 24, 4 to 24, 5 to 24, 6 to 24, 6 to 18, 7 to 18, 8 to 18, 7 to 17, 8 to 17, 6 to 16, 7 to 17, or 8 to 16 atoms.

[0569] A cleavable linker is a linker that is sufficiently stable outside a cell, but that, once inside a target cell, is cleaved to release the two moieties held together by the linker. In preferred embodiments, the cleavable linker is cleaved at least about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or more, or at least 100-fold faster inside the target cell, or under first reference conditions (e.g., which can be selected to mimic or represent intracellular conditions), than in the subject's blood, or under second reference conditions (e.g., which can be selected to mimic or represent conditions found in blood or serum).

[0570] The cleavable linking group is sensitive to a cleaving agent, such as pH, redox potential, or the presence of a degrading molecule. Generally, cleaving agents are found more frequently, or at higher levels or activity, inside cell...

Claims

1. 1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 (APOC3) in a cell, comprising a sense strand and an antisense strand which form a double-stranded region, wherein the antisense strand comprises a region of complementarity to an mRNA encoding APOC3, and wherein the region of complementarity comprises at least 15 contiguous nucleotides which differ by no more than 3 nucleotides from any one of the antisense nucleotide sequences in any one of Tables 2-5, 14, and 15.

2. The double-stranded region comprises a sense strand and an antisense strand, and the sense strand is nucleotides 232-254; 233-255; 238-260; 239-261; 242-264; 243-265; 244-266; 264-286; 268-290; 426-448; 431-453; 432-454; 433-455; 435-457; 436-458; 499-521; 500-522; 503-525 of SEQ ID NO:

1. 504-526; 507-529; 510-532; or 511-533, wherein the antisense strand comprises at least 15 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:2, for inhibiting expression of apolipoprotein C3 (APOC3) in a cell.

3. The antisense strand was AD-959917.1; AD-959918.1; AD-960096.1; AD-960064.1; AD-959914.1; AD-959941.1; AD-960031.1; AD-960063.1; AD-960293.1; AD-960288.1; AD-960445.1; AD-960292.1; AD-960475.1; AD-960442.1; AD-960470.1; AD-960436.1; 3. The dsRNA agent of claim 1, comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences of the antisense strand of a duplex selected from the group consisting of AD-960446.1; AD-960474.1; AD-960294.1; AD-960471.1; AD-960314.1; AD-960443.1; AD-960282.1; AD-960283.1; AD-80794.7; AD-960478.1; AD-960481.1; and AD-960482.

1.

4. 1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 (APOC3) in a cell, comprising a sense strand and an antisense strand which form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides which differ by no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 235-257; 238-260; 242-264; 243-265; 244-266; 426-448; 430-450; 431-453; 432-454; 433-455; 435-457; 436-458; 499-521; 503-525; and 504-526 of SEQ ID NO:1, and the antisense strand comprises at least 15 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:

2.

5. The antisense strand is AD-959917.1; AD-960064.1; AD-960031.1; AD-960063.1; AD-960293.1; AD-960288.1; AD-960445.1; AD-960292.1; AD-960475.1; AD-960442.1; AD-960470.1; AD-960436.1; AD-96044 3. The dsRNA agent of claim 1 or 2, comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences of the antisense strand of the duplex selected from the group consisting of: AD-960474.1; AD-960294.1; AD-960443.1; AD-80794.7; and AD-959910.

1.

6. 1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 (APOC3) in a cell, comprising a sense strand and an antisense strand which form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides which differ by no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 232-254; 239-261; 242-264; 244-266; 258-280; 264-286; 268-290; 429-451; 430-450; 430-452; 433-455; 434-456; 435-457; 500-522; 503-525; 507-529; and 510-532 of SEQ ID NO:1, and the antisense strand comprises at least 15 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:

2.

7. The antisense strand is AD-80794.8; AD-959907.2; AD-959914.2; AD-959916.2; AD-959932.2; AD-960314.2; AD-959941.2; AD-960030.2; AD-960062.2; AD-960064.2; AD-960065.2; AD-960066.2; AD- 960294.2; AD-960471.2; AD-960474.2; AD-960478.2; and AD-960481.

2. The dsRNA agent of claim 1 or 2, comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences of the antisense strand of the duplex selected from the group consisting of AD-960294.2; AD-960471.2; AD-960474.2; AD-960478.2; and AD-960481.

2.

8. 1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 (APOC3) in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 429-451; 430-452; 431-451; 432-452; 433-455; 504-526; and 506-526 of SEQ ID NO:1, and the antisense strand comprises at least 15 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:

2.

9. 3. The dsRNA agent of claim 1, wherein the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the nucleotide sequences of the antisense strand of the duplex selected from the group consisting of: 960064.2 (960064.2); AD-960065.2; AD-960066.2; AD-960294.2; AD-960471.2; AD-960474.2; AD-960478.2; and AD-960481.

2.

10. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C3 in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 429 to 455 or 504 to 532 of SEQ ID NO:1, and the antisense strand comprises at least 19 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:

2.

11. 1. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting expression of apolipoprotein C in a cell, comprising a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or no more than 3 nucleotides from any one of the nucleotide sequences of nucleotides 429-451; 430-452; 431-451; 432-452; 433-455; 434-452; 504-526; and 506-526 of SEQ ID NO:1, and the antisense strand comprises at least 19 contiguous nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:

2.

12. The dsRNA agent of claim 10 or 11, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of nucleotides 434 to 452 of SEQ ID NO:1 by no more than 0, 1, 2, or 3 nucleotides.

13. 13. The dsRNA agent of any one of claims 10-12, wherein the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from any one of the nucleotide sequences of the antisense strand of the duplex selected from the group consisting of AD-960030; AD-960064; AD-1143243; AD-1143245; AD-1143247; AD-1143249; AD-1143256; AD-1143260; AD-1143278; AD-1143287; AD-1143295; AD-1143299; AD-1143302; and AD-1143305.

14. 14. The dsRNA agent of any one of claims 10 to 13, wherein the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of the antisense strand of the duplex AD-1143243 by no more than 0, 1, 2, or 3 nucleotides.

15. 14. The dsRNA agent of any one of claims 10 to 13, wherein the antisense strand comprises at least 15 contiguous nucleotides that differ from the nucleotide sequence of the antisense strand of the duplex AD-1143278 or AD-960064 by no more than 0, 1, 2, or 3 nucleotides.

16. 16. The dsRNA agent of any one of claims 1 to 15, comprising at least one modified nucleotide.

17. 17. The dsRNA agent of any one of claims 1-16, wherein substantially all of the nucleotides in the sense strand include the modification; substantially all of the nucleotides in the antisense strand include the modification; or substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand include the modification.

18. 18. The dsRNA agent of any one of claims 1 to 17, wherein all of the nucleotides in the sense strand include the modification; all of the nucleotides in the antisense strand include the modification; or all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand include the modification.

19. At least one of the modified nucleotides is a deoxynucleotide, a 3'-terminal deoxythymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally fixed nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino modified nucleotide, a 2'-O-allyl modified nucleotide, a 2'-C-alkyl modified nucleotide, a 2'-hydroxyl modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-O-alkyl modified nucleotide, a morpholino nucleotide, or a nucleotide selected from the group consisting of a nucleotide having a nucleotide sequence similar to that of the nucleotide sequence ...

19. The dsRNA agent of any one of claims 16 to 18, wherein the dsRNA is selected from the group consisting of: a nucleotide comprising a 5'-phosphate, a 5'-phosphate mimic, a 2-O-(N-methylacetamido) modified nucleotide, a 5'-phosphate mimic, a 5'-phosphate nucleotide ...

20. 19. The dsRNA agent of any one of claims 16-18, wherein the modification on the nucleotide is selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxyl, and glycol; and combinations thereof.

21. 19. The dsRNA agent of any one of claims 16-18, wherein at least one of the modified nucleotides is selected from the group consisting of deoxynucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, glycol-modified nucleotides (GNAs), and vinylphosphonate nucleotides; and combinations thereof.

22. 19. The dsRNA agent of any one of claims 16 to 18, wherein at least one of the modified nucleotides is selected from the group consisting of deoxynucleotides, 2'-O-methyl modified nucleotides, and 2'-fluoro modified nucleotides; and combinations thereof.

23. 19. The dsRNA agent of any one of claims 16-18, wherein at least one of the modifications on the nucleotide is a thermolabile nucleotide modification.

24. 24. The dsRNA agent of claim 23, wherein the thermolabile nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex; and a labile sugar modification, a 2'-deoxy modification, an acyclic nucleotide, an unlocked nucleic acid (UNA), and a glycerol nucleic acid (GNA).

25. 25. The dsRNA agent of any one of claims 1 to 24, wherein the double-stranded region is 19 to 30 nucleotide pairs in length.

26. 26. The dsRNA agent of claim 25, wherein the double-stranded region is 19 to 25 nucleotide pairs in length.

27. 26. The dsRNA agent of claim 25, wherein the double-stranded region is 19 to 23 nucleotide pairs in length.

28. 26. The dsRNA agent of claim 25, wherein the double-stranded region is 23 to 27 nucleotide pairs in length.

29. 26. The dsRNA agent of claim 25, wherein the double-stranded region is 21 to 23 nucleotide pairs in length.

30. 30. The dsRNA agent of any one of claims 1-29, wherein each strand is independently 30 nucleotides or less in length.

31. 31. The dsRNA agent of any one of claims 1 to 30, wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

32. 32. The dsRNA agent of any one of claims 1 to 31, wherein the region of complementarity is at least 17 nucleotides in length.

33. 33. The dsRNA agent of any one of claims 1 to 32, wherein the region of complementarity is between 19 and 23 nucleotides in length.

34. 32. The dsRNA agent of any one of claims 1 to 31, wherein the region of complementarity is 19 nucleotides in length.

35. 35. The dsRNA agent of any one of claims 1 to 34, wherein at least one strand comprises a 3' overhang of at least one nucleotide.

36. 35. The dsRNA agent of any one of claims 1 to 34, wherein at least one strand comprises a 3' overhang of at least 2 nucleotides.

37. 37. The dsRNA agent of any one of claims 1 to 36, further comprising a ligand.

38. 38. The dsRNA agent of claim 37, wherein the ligand is conjugated to the 3' end of the sense strand of the dsRNA agent.

39. 39. The dsRNA agent of claim 37 or 38, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

40. 40. The dsRNA agent of any one of claims 37-39, wherein the ligand is one or more GalNAc derivatives conjugated via a monovalent, divalent, or trivalent branched linker.

41. The ligand is 【Chemistry 1】 41. The dsRNA agent of any one of claims 37 to 40, wherein:

42. The following diagram 【Chemistry 2】 and X is O or S.

43. 43. The dsRNA agent of claim 42, wherein X is O.

44. 44. The dsRNA agent of any one of claims 1 to 43, further comprising at least one phosphorothioate or methylphosphonate internucleotide linkage.

45. 45. The dsRNA agent of claim 44, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 3'-end of one strand.

46. 46. ​​The dsRNA agent of claim 45, wherein the strand is the antisense strand.

47. 46. ​​The dsRNA agent of claim 45, wherein the strand is the sense strand.

48. 45. The dsRNA agent of claim 44, wherein the phosphorothioate or methylphosphonate internucleotide linkage is at the 5'-end of one strand.

49. 49. The dsRNA agent of claim 48, wherein the strand is the antisense strand.

50. 49. The dsRNA agent of claim 48, wherein the strand is the sense strand.

51. 45. The dsRNA agent of claim 44, wherein the phosphorothioate or methylphosphonate internucleotide linkages are at both the 5'-end and the 3'-end of one strand.

52. 52. The dsRNA agent of claim 51, wherein the strand is the antisense strand.

53. 53. The dsRNA agent of any one of claims 1 to 52, wherein the base pair at position 1 of the 5' end of the antisense strand of the duplex is an AU base pair.

54. comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand comprises at least 15 consecutive nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence of CUUAAAGGGACAGUAUUCUA (SEQ ID NO: 13), and the antisense strand comprises at least 15 consecutive nucleotides that differ by no more than 0, 1, 2, or 3 nucleotides from the nucleotide sequence of UAGAAUACUGUCCCUUUUAAGCC (SEQ ID NO: 14); substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification, a 2'-fluoro modification, and a deoxy modification; both the sense strand and the antisense strand independently further comprise at least one phosphorothioate internucleotide linkage or methylphosphonate internucleotide linkage; At least one chain is conjugated to a ligand; A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of apolipoprotein C3 in a cell.

55. 55. The dsRNA agent of claim 54, wherein the sense strand comprises from 2 to 6 2'-fluoro modified nucleotides.

56. 56. The dsRNA agent of claim 54 or 55, wherein the antisense strand comprises no more than four 2'-fluoro modified nucleotides.

57. 57. The dsRNA agent of any one of claims 54 to 56, wherein the antisense strand comprises 1 to 5 deoxy-modified nucleotides.

58. comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand comprises at least 15 consecutive nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of nucleotides 429 to 456 of SEQ ID NO:1, and the antisense strand comprises at least 19 consecutive nucleotides derived from the corresponding nucleotide sequence of SEQ ID NO:2; all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a modification selected from the group consisting of a 2'-O-methyl modification, a 2'-fluoro modification, and a deoxy modification; both the sense and antisense strands independently further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage, and at least one strand is conjugated to a ligand; A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of apolipoprotein C3 in a cell.

59. 59. The dsRNA agent of claim 58, wherein the sense strand comprises from 2 to 6 2'-fluoro modified nucleotides.

60. 60. The dsRNA agent of claim 58 or 59, wherein the sense strand comprises four 2'-fluoro modified nucleotides.

61. 61. The dsRNA agent of any one of claims 58-60, wherein the antisense strand comprises two to four 2'-fluoro modified nucleotides.

62. 62. The dsRNA agent of claim 61, wherein the antisense strand comprises two 2'-fluoro modified nucleotides.

63. 63. The dsRNA agent of any one of claims 58 to 62, wherein the antisense strand comprises 1 to 5 2'-deoxy modified nucleotides.

64. 64. The dsRNA agent of claim 63, wherein the antisense strand comprises three 2'-deoxy modified nucleotides.

65. 65. The dsRNA agent of any one of claims 58-64, wherein the sense strand comprises four 2'-fluoro modified nucleotides at nucleotides 7 and 9-11, counting from the 5' end, and the antisense strand comprises two 2'-fluoro modified nucleotides at nucleotides 14 and 16, counting from the 5' end, and three 2'-deoxy modified nucleotides at nucleotides 2, 5, and 7, counting from the 5' end.

66. 66. The dsRNA agent of any one of claims 58-65, wherein the sense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at the 5' end.

67. 67. The dsRNA agent of any one of claims 58-66, wherein the antisense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at both the 5' and 3' ends.

68. 68. The dsRNA agent of any one of claims 58 to 67, wherein the sense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at the 5'-end, and the antisense strand comprises two phosphorothioate or methylphosphonate internucleotide linkages at both the 5'-end and the 3'-end.

69. 69. The dsRNA agent of any one of claims 58-68, wherein the ligand is conjugated to the 3' end of the sense strand.

70. 70. The dsRNA agent of any one of claims 58-69, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

71. 71. The dsRNA agent of claim 70, wherein the ligand is one or more GalNAc derivatives conjugated via a monovalent, divalent, or trivalent branched linker.

72. The ligand is 【Transformation 3】 72. The dsRNA agent of claim 71, wherein:

73. The following diagram 【Chemistry 4】 and X is O.

74. comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand differs by no more than three modified nucleotides from the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15), and the antisense strand differs by no more than three modified nucleotides from the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16); a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; and s is a phosphorothioate linkage. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of apolipoprotein C3 in a cell.

75. 75. The dsRNA agent of claim 74, wherein the sense strand differs from the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15) by no more than two modified nucleotides; and the antisense strand differs from the nucleotide sequence of 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16) by no more than two modified nucleotides.

76. 75. The dsRNA agent of claim 74, wherein the sense strand differs from the nucleotide sequence of 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15) by no more than one modified nucleotide; and the antisense strand differs from the nucleotide sequence of 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16) by no more than one modified nucleotide.

77. The following diagram 【Transformation 5】 and X is O.

78. comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand comprises the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15), and the antisense strand comprises the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16); a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; and s is a phosphorothioate linkage. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of apolipoprotein C3 in a cell.

79. comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand comprises the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucuaL96-3' (SEQ ID NO: 17), and the antisense strand comprises the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16); a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage; and L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol. A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of apolipoprotein C3 in a cell.

80. comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand comprises the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15), and the antisense strand comprises the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16); a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage; and the 3' end of the sense strand has the structure shown in the following diagram: 【Transformation 6】 wherein X is O; A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of apolipoprotein C3 in a cell.

81. comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand consists of the nucleotide sequence 5'-csusuaaaAfgGfGfAfcaguauucua-3' (SEQ ID NO: 15), and the antisense strand consists of the nucleotide sequence 5'-usdAsgadAudAcuguccCfuUfuuaagscsc-3' (SEQ ID NO: 16); a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; dA is a 2'-deoxyadenosine-3'-phosphate nucleotide; s is a phosphorothioate linkage; and the 3' end of the sense strand has the structure shown in the following diagram: 【Transformation 7】 wherein X is O; A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of apolipoprotein C3 in a cell.

82. 82. A cell containing the dsRNA agent of any one of claims 1-81.

83. 82. A pharmaceutical composition for inhibiting expression of a gene encoding apolipoprotein C3 (APOC3), comprising the dsRNA agent of any one of claims 1-81.

84. 84. The pharmaceutical composition of claim 83, wherein the dsRNA agent is in a non-buffered solution.

85. 85. The pharmaceutical composition of claim 84, wherein the non-buffered solution is saline or water.

86. 84. The pharmaceutical composition of claim 83, wherein the dsRNA agent is in a buffer solution.

87. 87. The pharmaceutical composition of claim 86, wherein the buffer comprises acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof.

88. 88. The pharmaceutical composition of claim 87, wherein the buffer is phosphate buffered saline (PBS).

89. 87. A method for inhibiting expression of the apolipoprotein C3 (APOC3) gene in a cell, comprising contacting the cell with a dsRNA agent of any one of claims 1-81 or a pharmaceutical composition of any one of claims 83-88, thereby inhibiting expression of the APOC3 gene in the cell.

90. 90. The method of claim 89, wherein the cell is a cell within the subject.

91. 91. The method of claim 90, wherein the subject is a human.

92. 92. The method of claim 91, wherein the subject has an apolipoprotein C3-associated disorder.

93. 93. The method of claim 92, wherein the apolipoprotein C3-related disorder is selected from the group consisting of hypertriglyceridemia, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, polycystic ovary syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance), hypertension, atherosclerosis, and pancreatitis.

94. 94. The method of any one of claims 89 to 93, wherein contacting a cell with a dsRNA agent inhibits expression of apolipoprotein C3 by at least 50%, 60%, 70%, 80%, 90%, or 95%.

95. 95. The method of any one of claims 89 to 94, wherein inhibiting the expression of apolipoprotein C3 reduces apolipoprotein C3 protein levels in the subject's serum by at least 50%, 60%, 70%, 80%, 90%, or 95%.

96. A method of treating a subject having a disorder that would benefit from reduced apolipoprotein C3 expression, comprising administering to the subject a therapeutically effective amount of a dsRNA agent of any one of claims 1-81, or a pharmaceutical composition of any one of claims 83-88, thereby treating the subject having a disorder that would benefit from reduced apolipoprotein C3 expression.

97. A method of preventing at least one symptom in a subject having a disorder that would benefit from reduced apolipoprotein C3 expression, comprising administering to the subject a prophylactically effective amount of a dsRNA agent of any one of claims 1-81, or a pharmaceutical composition of any one of claims 83-88, thereby preventing at least one symptom in the subject having a disorder that would benefit from reduced apolipoprotein C3 expression.

98. 98. The method of claim 96 or 97, wherein the disorder is an apolipoprotein C3-associated disorder.

99. 99. The method of claim 98, wherein the apolipoprotein C3-related disorder is selected from the group consisting of hypertriglyceridemia, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, polycystic ovary syndrome, kidney disease, obesity, type 2 diabetes (insulin resistance), hypertension, atherosclerosis, and pancreatitis.

100. 99. The method of claim 98, wherein the apolipoprotein C3-related disorder is hypertriglyceridemia.

101. 101. The method of any one of claims 96 to 100, wherein the subject is a human.

102. 102. The method of any one of claims 96 to 101, wherein administration of the agent to the subject results in a reduction in hypertriglyceridemia and / or a reduction in APOC3 protein accumulation.

103. 103. The method of any one of claims 96-102, wherein the dsRNA agent is administered to the subject at a dose of from about 0.01 mg / kg to about 50 mg / kg.

104. 104. The method of any one of claims 96-103, wherein the dsRNA agent is administered subcutaneously to the subject.

105. 105. The method of any one of claims 96 to 104, further comprising determining apolipoprotein C3 levels in a sample(s) from the subject.

106. 106. The method of claim 105, wherein the apolipoprotein C3 level in the subject sample(s) is the apolipoprotein C3 protein level in a blood sample(s) or a serum sample(s).

107. 107. The method of any one of claims 96 to 106, further comprising administering to the subject an additional therapeutic agent for the treatment of hemolysis.

108. 89. A kit comprising the dsRNA agent of any one of claims 1-81 or the pharmaceutical composition of any one of claims 83-88.

109. 89. A vial comprising the dsRNA agent of any one of claims 1-81, or the pharmaceutical composition of any one of claims 83-88.

110. 89. A syringe comprising the dsRNA agent of any one of claims 1-81, or the pharmaceutical composition of any one of claims 83-88.

Images