Optimized flt1 oligonucleotide compounds for the treatment of pre-eclampsia and other angiogenic disorders

Abstract

To provide a therapeutic pharmaceutical composition in the treatment or management of a disease or disorder in a subject.SOLUTION: A double-stranded RNA (dsRNA) comprising an antisense strand and a sense strand, wherein each strand has a 5' end and a 3' end; (1) the antisense strand comprises a sequence that is substantially complementary to the nucleic acid sequence of 5' CTCTCGGAATTCTCCATAACAAATATTT3 ' (SEQ ID NO: 1); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modification; (4) the nucleotides at any one or more of positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; And the like. Therapeutic pharmaceutical compositions are provided.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 214,224, filed June 23, 2021, the entire disclosure of which is incorporated herein by reference.

[0002] Technical Field The present disclosure relates to novel angiogenic targets and novel oligonucleotide compounds for treating angiogenic disorders (eg, pre-eclampsia). [Background technology]

[0003] Preeclampsia (PE) is a severe, progressive, and fatal complication that occurs in 5-8% of pregnancies worldwide, resulting in preterm birth and increased maternal and fetal morbidity and mortality. Characterized by hypertension and proteinuria, PE can cause extensive kidney and liver damage, hemolysis, thrombocytopenia, and death.

[0004] Maternal symptoms of PE are primarily caused by high levels of placenta-secreted soluble fms-like tyrosine kinase-1 (sFLT1), which is both a diagnostic and prognostic marker for the disease. Studies have shown that sFLT1 is a promising therapeutic target for the treatment of PE.

[0005] Previous studies have identified siRNAs targeting the major isoform of sFLT1 to reduce both placental and circulatory levels of sFLT1 in pregnant mice and non-human primates (Turanov et.al. Nat Biotechnol. 2018 Nov 19:10.1038 / nbt.4297). However, there is still a need to develop siRNAs optimized for therapeutic use in pregnant women. Summary of the Invention

[0006] The present invention is based, in part, on the discovery of optimized oligonucleotides that target mRNA isoforms encoding sFLT1 protein but not full-length FLT1 (fl-FLT1) protein. The novel oligonucleotides of the present invention can be used to treat PE, postpartum PE, eclampsia, and / or HELLP syndrome. The novel oligonucleotide sequences of the present invention (e.g., small interfering RNAs (siRNAs)) are engineered to selectively reduce sFLT1 levels without affecting fl-FLT1 by binding to one or more sequences not present in fl-FLT1, e.g., one or more intronic regions of mRNA encoding one or more sFLT1 proteins. The novel optimized oligonucleotides (e.g., siRNAs) described herein can be preferentially delivered to placental trophoblast cells (the cell type responsible for excess sFLT1 production) using systemic (i.e., intravenous or subcutaneous) delivery to the mother without delivery to the fetus. In certain embodiments, the optimized oligonucleotides described herein retain high levels of silencing efficacy, have increased placental tissue accumulation, decreased off-target tissue accumulation, reduced siRNA degradation, reduced toxicity, and a broader therapeutic index.

[0007] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; and (3) the antisense strand is at least 20 nucleotides in length. (4) any one or more of the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) the nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0008] In another aspect, the disclosure provides a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modifications; and (4) any one or more of nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand is (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains at least 65% 2'-O-methyl modifications; (9) one or more of the nucleotides 4, 6, 8, 10, and 14 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; and (10) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0009] In certain embodiments, the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides.

[0010] In some aspects, the disclosure provides double-stranded RNA (dsRNA), the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (3) the nucleotides at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (4) the nucleotides at positions 1-2 through 1-7 from the 3' end of the antisense strand are joined to each other via phosphorothioate internucleotide linkages; and (5) a portion of the antisense strand is complementary to a portion of the sense strand.

[0011] In another aspect, the disclosure provides a double-stranded RNA (dsRNA), the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; and (3) the 2'-end from the 5' end of the antisense strand. (4) the nucleotides at positions 1-2 through 1-7 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (5) a portion of the antisense strand is complementary to a portion of the sense strand; (6) the sense strand contains alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; and (7) the nucleotides at positions 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0012] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; and (3) the antisense strand is at least 20 nucleotides in length. (4) any one or more of the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) the nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0013] In another aspect, the disclosure provides a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modifications; and (4) any one or more of nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 from the 5' end of the antisense strand. (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains at least 80% 2'-O-methyl modifications; (9) one or more of the nucleotides 7, 9, and 11 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; and (10) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0014] In certain embodiments, the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides.

[0015] In certain embodiments, the nucleotides at positions 7, 9, and 11 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides.

[0016] In some aspects, the present disclosure provides double-stranded RNA (dsRNA) molecules, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 70% 2'-O-methyl modifications; (4) any one or more of nucleotides at positions 2, 4, 5, 6, 8, and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are joined to each other via phosphorothioate internucleotide linkages; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0017] In another aspect, the disclosure provides a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 70% 2'-O-methyl modifications; and (4) positions 2, 4, and 5 from the 5' end of the antisense strand are (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains 100% 2'-O-methyl modifications; and (9) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0018] In certain embodiments, the nucleotides at positions 2, 4, 5, 6, 8, and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides.

[0019] In some aspects, the present disclosure provides double-stranded RNA (dsRNA) molecules, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 75% 2'-O-methyl modifications; (4) any one or more of nucleotides at positions 2, 4, 5, 6, and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are joined to each other via phosphorothioate internucleotide linkages; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0020] In another aspect, the disclosure provides a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 75% 2'-O-methyl modifications; (4) positions 2, 4, and 5' from the 5' end of the antisense strand are substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (5) any one or more nucleotides at positions 5, 6, and 14 are not 2'-methoxy-ribonucleotides; (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains 100% 2'-O-methyl modifications; and (9) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0021] In some aspects, the present disclosure provides double-stranded RNA (dsRNA) molecules, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 85% 2'-O-methyl modifications; (4) any one or more nucleotides at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are joined to each other via phosphorothioate internucleotide linkages; and (6) a portion of the antisense strand is complementary to a portion of the sense strand.

[0022] In another aspect, the disclosure provides a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 85% 2'-O-methyl modifications; and (4) the 2' end from the 5' end of the antisense strand. (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains 100% 2'-O-methyl modifications; and (9) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0023] In certain embodiments, the antisense strand is 20 nucleotides in length. In certain embodiments, the antisense strand is 21 nucleotides in length. In certain embodiments, the antisense strand is 22 nucleotides in length.

[0024] In certain embodiments, the sense strand is 15 nucleotides in length. In certain embodiments, the sense strand is 16 nucleotides in length. In certain embodiments, the sense strand is 18 nucleotides in length. In certain embodiments, the sense strand is 20 nucleotides in length.

[0025] In certain embodiments, the dsRNA comprises a double-stranded region of 15 to 20 base pairs. In certain embodiments, the dsRNA comprises a double-stranded region of 15 base pairs. In certain embodiments, the dsRNA comprises a double-stranded region of 16 base pairs. In certain embodiments, the dsRNA comprises a double-stranded region of 18 base pairs. In certain embodiments, the dsRNA comprises a double-stranded region of 20 base pairs.

[0026] In certain embodiments, the dsRNA comprises blunt ends.

[0027] In certain embodiments, the dsRNA comprises at least one single-stranded nucleotide overhang.

[0028] In certain embodiments, the dsRNA comprises a single-stranded nucleotide overhang of about 2 to 5 nucleotides.

[0029] In certain embodiments, the dsRNA comprises between 4 and 16 phosphorothioate internucleotide linkages. In certain embodiments, the dsRNA comprises between 8 and 13 phosphorothioate internucleotide linkages.

[0030] In certain embodiments, the sense strand contains one or more nucleotide mismatches between the antisense strand and the sense strand.

[0031] In certain embodiments, the antisense strand comprises a 5' phosphate, a 5'-alkyl phosphonate, a 5' alkylene phosphonate, or a 5' alkenyl phosphonate.

[0032] In certain embodiments, the antisense strand comprises a 5' vinyl phosphonate.

[0033] In certain embodiments, the functional moiety is linked to the 3' end of the sense strand.

[0034] In certain embodiments, the functional moiety comprises a hydrophobic moiety.

[0035] In certain embodiments, the hydrophobic moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides, nucleoside analogs, endocannabinoids, vitamins, and mixtures thereof.

[0036] In certain embodiments, the steroid is selected from the group consisting of cholesterol and lithocholic acid (LCA).

[0037] In certain embodiments, the fatty acid is selected from the group consisting of eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and docosanoic acid (DCA). In some embodiments, the fatty acid is EPA. In some embodiments, the fatty acid is DHA. In some embodiments, the fatty acid is DCA. In some embodiments, the fatty acid is PC-DCA.

[0038] In certain embodiments, the vitamin is selected from the group consisting of choline, vitamin A, vitamin E, and derivatives or metabolites thereof.

[0039] In certain embodiments, the functional moiety is linked to the sense strand by a linker.

[0040] In certain embodiments, the linker is a cleavable linker.

[0041] In certain embodiments, the cleavable linker comprises a phosphodiester linkage, a disulfide linkage, an acid-labile linkage, or a photocleavable linkage.

[0042] In certain embodiments, the cleavable linker comprises a dTdT dinucleotide with a phosphodiester internucleotide linkage.

[0043] In certain embodiments, the acid-labile linkage comprises a β-thiopropionate linkage or a carboxydimethylmaleic anhydride (CDM) linkage.

[0044] In certain embodiments, the linker comprises a bivalent or trivalent linker.

[0045] In certain embodiments, the bivalent or trivalent linker is [ka] wherein n is 1, 2, 3, 4, or 5.

[0046] In certain embodiments, the linker comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a phosphorothioate, a phosphoramidate, an amide, a carbamate, or a combination thereof.

[0047] In certain embodiments, when the linker is a trivalent linker, the linker further connects phosphodiesters or phosphodiester derivatives.

[0048] In certain embodiments, the linker further links a phosphodiester or phosphodiester derivative.

[0049] In certain embodiments, the phosphodiester or phosphodiester derivative is selected from the group consisting of: [ka] where X is O, S or BH3.

[0050] In certain embodiments, the nucleotides 1 and 2 from the 3' end of the sense strand and the nucleotides 1 and 2 from the 5' end of the antisense strand are linked to adjacent ribonucleotides via phosphorothioate linkages.

[0051] In certain embodiments, the region of complementarity is complementary to at least 15, 16, 17, or 18 contiguous nucleotides of SEQ ID NO:1 or SEQ ID NO:2.

[0052] In certain embodiments, the region of complementarity contains no more than three mismatches with SEQ ID NO:1 or SEQ ID NO:2.

[0053] In certain embodiments, the region of complementarity is fully complementary to SEQ ID NO:1 or SEQ ID NO:2.

[0054] In certain embodiments, the antisense strand comprises or consists of the nucleic acid sequence of 5'UAAAUUUGGAGAUCCGAGAGA3' and the sense strand comprises or consists of the nucleic acid sequence of 5'CGGAUCUCCAAAUUUA3'.

[0055] In a specific embodiment, the antisense strand comprises or consists of the nucleic acid sequence 5'UAUAAAUGGUAGCUAUGAUGA3' and the sense strand comprises or consists of the nucleic acid sequence 5'AUAGCUACCAUUUAUA3'.

[0056] In some embodiments, the present disclosure provides the salt of dsRNA molecule.In some embodiments, the salt comprises sodium salt or potassium salt.In some embodiments, the salt comprises pharmaceutically acceptable salt.

[0057] In certain embodiments, expression of sFLT1 protein in a cell or organism is reduced by at least about 20%.

[0058] In one aspect, the present disclosure provides a method for treating or managing PE, postpartum PE, eclampsia, or HELLP syndrome, the method comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the above-described dsRNA.

[0059] In some aspects, the present disclosure provides methods for treating or managing PE, the methods comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the above-described dsRNA.

[0060] In some aspects, the present disclosure provides methods of treating or managing postpartum PE, the methods comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the above-described dsRNA.

[0061] In some aspects, the present disclosure provides methods of treating or managing eclampsia, the methods comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the above-described dsRNA.

[0062] In some aspects, the present disclosure provides methods for treating or managing HELLP syndrome, the methods comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the above-described dsRNA.

[0063] In certain embodiments, the pharmaceutical composition is administered intravenously or subcutaneously.

[0064] In certain embodiments, expression of sFLT1 protein is reduced in the subject by at least about 20%.

[0065] In one aspect, the present disclosure provides a method of treating one or more symptoms of PE, postpartum PE, eclampsia, or HELLP syndrome in a subject in need thereof, the method comprising administering to the subject a dsRNA as described above.

[0066] In one aspect, the disclosure provides a method of treating one or more symptoms of an angiogenic disorder in a subject in need thereof, the method comprising administering to the subject a dsRNA described above.

[0067] In certain embodiments, the angiogenic disorder is selected from the group consisting of PE, postpartum PE, eclampsia, and HELLP syndrome.

[0068] In one aspect, the present disclosure provides a pharmaceutical composition comprising a first dsRNA, a second dsRNA, and a pharmaceutically acceptable carrier, wherein the first dsRNA comprises a first sense strand and a first antisense strand, wherein the first antisense strand comprises a region of complementarity substantially complementary to SEQ ID NO: 1, and wherein the first dsRNA comprises the dsRNA described above; and the second dsRNA comprises a second sense strand and a second antisense strand, wherein the second antisense strand comprises a region of complementarity substantially complementary to SEQ ID NO: 2, and wherein the second dsRNA comprises the dsRNA described above.

[0069] In one aspect, the present disclosure provides a pharmaceutical composition comprising a first dsRNA, a second dsRNA, and a pharmaceutically acceptable carrier, wherein the first dsRNA comprises a first sense strand and a first antisense strand, each strand having a 5' end and a 3' end, and the second dsRNA comprises a second sense strand and a second antisense strand, each strand having a 5' end and a 3' end, wherein the first antisense strand comprises a region of complementarity substantially complementary to SEQ ID NO: 1; the second antisense strand comprises a region of complementarity substantially complementary to SEQ ID NO: 2; and wherein, for each of the first dsRNA and the second dsRNA: (1) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modifications; (4) positions 2, 4, and 6 from the 5' end of the antisense strand are 5'-O-methyl modified. (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains at least 65% 2'-O-methyl modifications; (9) one or more nucleotides 4-14 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; (10) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0070] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand is (mU)#(fA)#(mA)(fA)(fU)(fU)(mU)(fG)(mG)(fA)(mG)(fA)(mU)(fC)#(mC)#(fG)#(mA)#(mG)#(mA (2) the sense strand comprises (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA), where "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, and "#" corresponds to a phosphorothioate internucleotide linkage.

[0071] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein the antisense strand comprises (mU)#(fA)#(mA)(fA)(fU)(fU)(mU)(fG)(mG)(fA)(mG)(fA)(mU)(fC)#(mC)#(fG)#(mA)#(mG)#(mA)#(fG)#(mA); where "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, and "#" corresponds to a phosphorothioate internucleotide linkage.

[0072] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein the sense strand comprises (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA), where "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, and "#" corresponds to a phosphorothioate internucleotide linkage.

[0073] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand is: (mU)#(fA)#(mU)(fA)(fA)(fA)(mU)(fG)(mG)(fU)(mA)(fG)(mC)(fU)#(mA)#(fU)#(mG)#(mA)#(mU)# (2) the sense strand comprises (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA), where "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, and "#" corresponds to a phosphorothioate internucleotide linkage.

[0074] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein the antisense strand comprises (mU)#(fA)#(mU)(fA)(fA)(fA)(mU)(fG)(mG)(fU)(mA)(fG)(mC)(fU)#(mA)#(fU)#(mG)#(mA)#(mU)#(fG)#(mA); where "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, and "#" corresponds to a phosphorothioate internucleotide linkage.

[0075] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein the sense strand comprises (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA), where "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, and "#" corresponds to a phosphorothioate internucleotide linkage.

[0076] In some embodiments, the antisense strand comprises a 5' vinyl phosphonate.

[0077] In some embodiments, the dsRNA comprises a docosanoic acid (DCA) conjugate linked to the 3' end of the sense strand.

[0078] In some embodiments, the DCA is linked to the sense strand by a linker.

[0079] In some embodiments, the linker is a cleavable linker.

[0080] In some embodiments, the cleavable linker comprises a phosphodiester linkage, a disulfide linkage, an acid-labile linkage, or a photocleavable linkage.

[0081] In some embodiments, the cleavable linker comprises a dTdT dinucleotide with a phosphodiester internucleotide linkage.

[0082] In some embodiments, the linker comprises a bivalent or trivalent linker.

[0083] In some embodiments, the bivalent or trivalent linker is [ka] wherein n is 1, 2, 3, 4, or 5.

[0084] In some embodiments, when the linker is a trivalent linker, the linker further connects phosphodiesters or phosphodiester derivatives.

[0085] In some embodiments, the phosphodiester or phosphodiester derivative is selected from the group consisting of: [ka] where X is O, S or BH3.

[0086] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises V(mU)#(fA)#(mA)(fA)(fU)(fU)(mU)(fG)(mG)(fA)(mG)(fA)(mU)(fC)#(mC)#(fG)#(mA)#(mG)#(mA)#(fG)#(mA); (2) the sense strand comprises V(mC)#(mG)#(mG)(fA)(mU)(fC)(mU )(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA)(T)(T)-PCDCA, where "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, "T" corresponds to a thymidine DNA nucleotide, "#" corresponds to a phosphorothioate internucleotide linkage, "V" corresponds to a 5'-vinylphosphonate, and "PCDCA" corresponds to a 3'-C7-phosphocholine-docosanoic acid conjugate via a phosphate linker.

[0087] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises V(mU)#(fA)#(mU)(fA)(fA)(fA)(mU)(fG)(mG)(fU)(mA)(fG)(mC)(fU)#(mA)#(fU)#(mG)#(mA)#(mU)#(fG)#(mA); (2) the sense strand comprises V(mA)#(mU)#(mA)(fG)(mC)(fU)(mA)( fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA)(T)(T)-PCDCA, where "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, "T" corresponds to a thymidine DNA nucleotide, "#" corresponds to a phosphorothioate internucleotide linkage, "V" corresponds to a 5'-vinylphosphonate, and "PCDCA" corresponds to a 3'-C7-phosphocholine-docosanoic acid conjugate via a phosphate linker.

[0088] In some embodiments, the present disclosure provides the salt of dsRNA molecule.In some embodiments, the salt comprises sodium salt or potassium salt.In some embodiments, the salt comprises pharmaceutically acceptable salt.

[0089] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end; (1) The antisense strand comprises Formula I or a salt thereof: [ka] (2) The sense strand comprises Formula II or a salt thereof: [ka]

[0090] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end; (1) The antisense strand comprises Formula III or a salt thereof: [ka] (2) The sense strand comprises Formula IV or a salt thereof: [ka]

[0091] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein the antisense strand comprises Formula I or a salt thereof: [ka]

[0092] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein the sense strand comprises Formula II or a salt thereof: [ka]

[0093] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein the antisense strand comprises Formula III or a salt thereof: [ka]

[0094] In some aspects, the disclosure provides double-stranded RNA (dsRNA) molecules comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein the sense strand comprises Formula IV or a salt thereof: [ka]

[0095] In some embodiments, the salt comprises a pharmaceutically acceptable salt, hi some embodiments, the salt comprises a sodium salt or a potassium salt.

[0096] In some aspects, the present disclosure provides methods for treating or managing PE, postpartum PE, eclampsia, or HELLP syndrome, the methods comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the above-described dsRNA.

[0097] In some aspects, the disclosure provides pharmaceutical compositions comprising a first dsRNA and a second dsRNA, wherein the first dsRNA comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, and (1) the antisense strand has a V(mU)#(fA)#(mA)(fA)(fU)(fU)(mU)(fG)(mG)(fA)(mG)(fA)(mU)(fC)#(mC)#(fG) (2) the sense strand comprises (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA)(T)(T)-PCDCA, and the second dsRNA comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end, and (1) the antisense strand comprises V (mU)#(fA)#(mU)(fA)(fA)(fA)(mU)(fG)(mG)(fU)(mA)(fG)(mC)(fU)#(mA)#(fU)#(mG)#(mA)#(mU)#(fG)# (mA); (2) the sense strand contains (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA)(T)( T)-PCDCA, where "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, "T" corresponds to a thymidine DNA nucleotide, "#" corresponds to a phosphorothioate internucleotide linkage, "V" corresponds to a 5'-vinylphosphonate, and "PCDCA" corresponds to a 3'-C7-phosphocholine-docosanoic acid conjugate via a phosphate linker.

[0098] In some aspects, the present disclosure provides pharmaceutical compositions comprising a first dsRNA and a second dsRNA, wherein the first dsRNA comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end; (1) The antisense strand comprises Formula I or a salt thereof: [ka] (2) the sense strand comprises Formula II or a salt thereof: [ka] the second dsRNA comprises a sense strand and an antisense strand, each strand having a 5' end and a 3' end; (1) The antisense strand comprises Formula III or a salt thereof: [ka] (2) The sense strand comprises Formula IV or a salt thereof: [ka]

[0099] In some embodiments, the salt comprises a pharmaceutically acceptable salt, hi some embodiments, the salt comprises a sodium salt or a potassium salt.

[0100] In some embodiments, the present disclosure provides methods for treating or managing PE, postpartum PE, eclampsia, or HELLP syndrome, comprising administering a therapeutically effective amount of the pharmaceutical composition described above to a subject in need of such treatment or management. In some embodiments, the present disclosure provides methods for treating or managing PE, comprising administering a therapeutically effective amount of the pharmaceutical composition described above to a subject in need of such treatment or management. In some embodiments, the present disclosure provides methods for treating or managing postpartum PE, comprising administering a therapeutically effective amount of the pharmaceutical composition described above to a subject in need of such treatment or management. In some embodiments, the present disclosure provides methods for treating or managing eclampsia, comprising administering a therapeutically effective amount of the pharmaceutical composition described above to a subject in need of such treatment or management. In some embodiments, the present disclosure provides methods for treating or managing HELLP syndrome, comprising administering a therapeutically effective amount of the pharmaceutical composition described above to a subject in need of such treatment or management.

[0101] These and other features and advantages of the present invention will be more fully understood from the following detailed description of illustrative embodiments, taken in conjunction with the accompanying drawings. This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee. [Brief explanation of the drawings]

[0102] [Figure 1A] Figure 1 shows the silencing effects of several 2'OMe-rich siRNA chemical modification patterns.Figure 2 shows a schematic diagram of 2'OMe-rich siRNA chemical modification patterns. [Figure 1B] The silencing effect of several 2'OMe-rich siRNA chemical modification patterns is shown. A dose-response curve and summary table for siRNA targeting human flt1 are shown. HeLa cells were treated with siRNA at the indicated concentrations for 72 hours. mRNA levels were measured using the Dual-Glo® Luciferase Assay System and calculated as a percentage of the untreated control (C). Table in Figure 1B - Maximum KD (%) - maximum rate of target mRNA knockdown by the maximal therapeutic dose of siRNA; IC50 - half-maximum inhibitory concentration; AUC - area under the dose-response curve; p-value - significance. [Figure 2A] Figure 1 shows tissue fluorescence images and the accumulation of guide strands in the aforementioned tissues.Figure 2 shows tissue fluorescence images of Cy3-labeled siRNA conjugated with various functional moieties in liver, kidney and placenta tissues. [Figure 2B]Figure 1 shows fluorescent images of tissues and guide strand accumulation in the tissues. Guide strand accumulation was quantified after 48 hours by PNA hybridization assay (n=3). p-values ​​indicate statistical significance between each compound and the cholesterol-conjugated compound (one-way ANOVA, **p<0.01, ***p<0.001; non-significant differences are not marked). NOC-No conjugate, Chol-cholesterol, DCA-docosanoic acid, PC-DCA-phosphocholine-docosanoic acid, DHA-docosahexanoic acid, PC-DHA-phosphocholine-docosahexanoic acid, and DIO-biantennary oligonucleotide. [Figure 3A] Figure 3B-D shows bone marrow tissue accumulation of the tested siRNAs. FACS analysis was performed on bone marrow cells from CD-1 mice injected with Cy3-labeled sFLT1_2283 siRNA variants. The gating scheme used to quantify Cy3 intensity of specific cell populations in the bone marrow is shown. [Figure 3B] Figure 1 shows bone marrow tissue accumulation of the tested siRNAs. FACS analysis was performed on bone marrow cells from CD-1 mice injected with Cy3-labeled sFLT1_2283 siRNA variants. A frequency distribution histogram (left) of Cy3 fluorescence intensity and a bar graph (right) of Cy3 median fluorescence intensity of bone marrow neutrophils 24 hours after siRNA variant injection are shown. [Figure 3C] Figure 1 shows bone marrow tissue accumulation of the tested siRNAs. FACS analysis was performed on bone marrow cells from CD-1 mice injected with Cy3-labeled sFLT1_2283 siRNA variants. A frequency distribution histogram (left) of Cy3 fluorescence intensity and a bar graph (right) of median Cy3 fluorescence intensity of bone marrow granulocytes 24 hours after siRNA variant injection are shown. [Figure 3D]Figure 1 shows bone marrow tissue accumulation of the tested siRNAs. FACS analysis was performed on bone marrow cells from CD-1 mice injected with Cy3-labeled sFLT1_2283 siRNA variants. A frequency distribution histogram (left) of Cy3 fluorescence intensity and a bar graph (right) of median Cy3 fluorescence intensity of bone marrow monocytes 24 hours after siRNA variant injection are shown (n=3, mean ± SD). p values ​​indicate statistically significant differences between compounds (one-way ANOVA; *p<0.05; non-significant differences are not marked). [Figure 4A] Figure 1 shows the effect of various 5' antisense modifications on siRNA silencing efficacy. Pregnant CD-1 mice were injected with a 20 mg / kg equimolar mixture of 2283 and 2519 siRNA variants on embryonic days (E) 13 and E14. A schematic diagram of the chemical patterns of the injected siRNA compounds and the chemical structures of the 5' moieties tested is shown. [Figure 4B] Figure 1 shows the effect of various 5' antisense modifications on siRNA silencing efficacy. Pregnant CD-1 mice were injected with a 20 mg / kg equimolar mixture of 2283 and 2519 siRNA variants on embryonic days (E) 13 and E14. sFlt1-i13 mRNA levels in placentas at E18 were measured using Quantigene 2.0 RNA Assay. Levels were normalized to Flt1 and expressed as a percentage of the PBS control (n = 5, mean ± SD). [Figure 4C] Figure 1 shows the effect of various 5' antisense modifications on siRNA silencing efficacy. Pregnant CD-1 mice were injected with a 20 mg / kg equimolar mixture of 2283 and 2519 siRNA variants on embryonic days (E) 13 and E14. The amount of siRNA accumulation in the placenta at E18, measured using a PNA hybridization assay, is shown (n=5). p values ​​represent statistically significant differences between compounds (one-way ANOVA; **p<0.01; ****p<0.0001; non-significant differences are unmarked). [Figure 4D]Figure 1 shows the effect of various 5' antisense modifications on siRNA silencing efficacy. Pregnant CD-1 mice were injected with a 20 mg / kg equimolar mixture of 2283 and 2519 siRNA variants on embryonic days (E) 13 and E14. sFlt1-i13 mRNA levels in placentas at E18 were measured using Quantigene 2.0 RNA Assay. Levels were normalized to Flt1 and presented as a percentage of PBS control (n=6, mean ± SD). [Figure 4E] Figure 1 shows the effect of various 5' antisense modifications on siRNA silencing efficacy. Pregnant CD-1 mice were injected with a 20 mg / kg equimolar mixture of 2283 and 2519 siRNA variants on embryonic days (E) 13 and E14. The amount of siRNA accumulation in the placenta at E18, measured using a PNA hybridization assay, is shown (n=6). p-values ​​represent statistically significant differences between compounds (one-way ANOVA; **p<0.01; ****p<0.0001; non-significant differences are unmarked; unpaired t-test; #p<0.05; ####p<0.0001). [Figure 4F] Figure 1 shows the effect of various 5' antisense modifications on siRNA silencing efficacy. Pregnant CD-1 mice were injected with 20 mg / kg equimolar mixtures of 2283 and 2519 siRNA variants on embryonic days (E) 13 and E14. The mean pup number, pup weight, and placental weight of control and treated pregnant mice are shown. [Figure 5] The effect of optimized siRNA on serum cytokine production was shown. Serum cytokine concentrations were measured in CD-1 mice 24 hours after injection of 75 mg / kg of sFLT1_2283 siRNA variants (n=3, mean ± SD). p values ​​represent statistically significant differences between compounds (one-way ANOVA; *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; non-significant differences are unmarked). [Figure 6] Schematic diagram of exemplary siRNA targeting sFLT1 2283 or 2519. [Figure 7]Dose-response curves for siRNA-2238 and siRNA-2519 silencing sFLT1-i13 and sFLT1-e15a (respectively), or a combination of the two siRNAs (1:1 siRNA-2238: siRNA-2519) are shown. sFLT1-i13 and sFLT1-e15a mRNA expression levels and sFLT1 protein levels were measured at each siRNA concentration tested. [Figure 8A] 1 shows an in vivo experiment performed in a reduced uteroplacental perfusion model (RUPP) in pregnant rats. The treatment scheme for the RUPP rat model is shown, in which a combination of two siRNAs (a 1:1 mixture of siRNA-2283 (targeting sFlt1-il3) and siRNA-2519 (targeting sFlt1-e15a)) is administered. [Figure 8B] 1 shows an in vivo experiment performed in a reduced uteroplacental perfusion model (RUPP) in pregnant rats, showing maternal blood pressure and placental weight in treated and control rats. [Figure 8C] 1 shows an in vivo experiment performed in a reduced uteroplacental perfusion model (RUPP) in pregnant rats, showing fetal resorptions and fetal weights in treated and control rats. [Figure 9] The chemical structures of the optimized siRNA molecules sFLT1 2283 and sFLT1 2519 are shown. [Figure 10A-1] 1 shows the chemical structure of the optimized siRNA molecule sFLT1 2283. The antisense strand is shown. [Figure 10A-2] 1 shows the chemical structure of the optimized siRNA molecule sFLT1 2283. The antisense strand is shown. [Figure 10B-1] 1 shows the chemical structure of the optimized siRNA molecule sFLT1 2283. The sense strand is shown. [Figure 10B-2] 1 shows the chemical structure of the optimized siRNA molecule sFLT1 2283. The sense strand is shown. [Figure 11A-1] 1 shows the chemical structure of the optimized siRNA molecule sFLT1 2519. The antisense strand is shown. [Figure 11A-2]1 shows the chemical structure of the optimized siRNA molecule sFLT1 2519. The antisense strand is shown. [Figure 11B-1] 1 shows the chemical structure of the optimized siRNA molecule sFLT1 2519. The sense strand is shown. [Figure 11B-2] 1 shows the chemical structure of the optimized siRNA molecule sFLT1 2519. The sense strand is shown. DETAILED DESCRIPTION OF THE INVENTION

[0103] Novel angiogenic targets (e.g., PE target sequences, e.g., intronic sequences of sFlt1 mRNA) are provided. Also provided are novel siRNAs that selectively target intronic regions of mRNA encoding angiogenic targets (e.g., sFLT1 protein). Methods of treating angiogenic disorders, e.g., PE, postpartum PE, eclampsia, and / or HELLP, are also provided.

[0104] Generally, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein is well known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout the specification, unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art, or as described herein. The terminology used in connection with analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry described herein, as well as the laboratory procedures and techniques therefor, are well known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

[0105] Unless otherwise defined herein, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or extrinsic definitions. Unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless otherwise indicated. The use of the term "including" and other forms such as "include" and "included" is not limiting.

[0106] So that the present invention may be more readily understood, certain terms are first defined.

[0107] "Alteration" refers to a change (increase or decrease) in the expression level of a gene, mRNA, or polypeptide, as detected by standard known methods, such as those described herein. As used herein, an increase or decrease includes a 10% change in expression level, a 25% change, a 40% change, or a 50% or greater change in expression level. In certain embodiments, the increase or decrease is a change in expression level of about 30% to about 50% or about 30% to about 40%. "Alteration" can also refer to a change (increase or decrease) in the biological activity of any of the mRNAs or polypeptides of the invention, e.g., sFlt1 (e.g., abbreviated sFlt1-i13 short, sFlt1-i13 long, and / or sFlt1-i15a) (also known as sFlt1-e15a). Examples of the biological activity of sFlt-1 include one or more clinical symptoms of PE or eclampsia. As used herein, an increase or decrease includes a 10% change in biological activity, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in biological activity. In certain preferred embodiments, the increase or decrease is a change in expression level of about 30% to about 50%, or about 30% to about 40%.

[0108] Certain embodiments of the present invention relate to the treatment of one or more angiogenic disorders. "Treatment of angiogenic disorders" refers to the use of the oligonucleotides (e.g., siRNA) of the present invention in pharmaceutical compositions for the treatment of diseases involving the physiological and pathological processes of neovascularization, vasculogenesis, and / or angiogenesis. Accordingly, these pharmaceutical compositions are useful for treating diseases, conditions, and disorders requiring the inhibition of neovascularization, vasculogenesis, or angiogenesis, including, but not limited to, cancer tumor growth and metastasis, neoplasms, ocular angiogenesis (e.g., macular degeneration, diabetic retinopathy, ischemic retinopathy, retinopathy of prematurity, choroidal neovascularization), rheumatoid arthritis, osteoarthritis, chronic asthma, septic shock, inflammatory diseases, synovitis, bone and cartilage destruction, pannus growth, osteophyte formation, osteomyelitis, psoriasis, obesity, hemangioma, Kaposi's sarcoma, atherosclerosis, and the like. The compounds are useful for treating atherosclerosis (e.g., rupture of atherosclerotic plaques), endometriosis, warts, excessive hair growth, scar keloids, allergic edema, dysfunctional uterine bleeding, follicular cysts, ovarian hyperstimulation, endometriosis, osteomyelitis, inflammatory and infectious processes (hepatitis, pneumonia, glomerulonephritis), asthma, nasal polyps, transplantation, liver regeneration, leukomalacia, thyroiditis, thyroid hyperplasia, lymphoproliferative disorders, hematological malignancies, vascular malformations, pre-eclampsia, eclampsia, and / or HELLP syndrome. In some embodiments, the disease or disorder is pre-eclampsia. In some embodiments, the disease or disorder is postpartum pre-eclampsia. In some embodiments, the disease or disorder is eclampsia. In some embodiments, the disease or disorder is HELLP syndrome.

[0109] "Preeclampsia" ("PE") refers to a multisystem disorder characterized by hypertension accompanied by proteinuria or edema, or both, and one or more of the following glomerular dysfunction, cerebral edema, hepatic edema, or coagulation abnormalities during or following a recent pregnancy. PE typically occurs after 20 weeks of gestation. PE is generally defined as a combination of two or more of the following symptoms: (1) a systolic blood pressure (BP) >140 mmHg and a diastolic BP >90 mmHg (typically measured twice, 4–168 hours apart) after 20 weeks of gestation; (2) new onset of proteinuria (1+ by dipstick test on urinalysis, >300 mg of protein in a 24-hour urine collection, or one random urine sample with a protein / creatinine ratio >0.3); and (3) resolution of hypertension and proteinuria by 12 weeks postpartum.

[0110] Severe PE is generally defined as (1) a diastolic blood pressure >110 mmHg (typically measured twice, 4 to 168 hours apart) or (2) proteinuria characterized by measurements of ≥3.5 g of protein in a 24-hour urine collection or two random urine samples containing at least 3+ protein by dipstick. In PE, hypertension and proteinuria generally occur within 7 days of each other. In severe PE, severe hypertension, severe proteinuria, and HELLP syndrome (hemolysis, elevated liver enzymes, thrombocytopenia) or eclampsia may occur simultaneously, or only one symptom may occur at a time.

[0111] Severe PE can result in seizures. A severe form of this syndrome is called "eclampsia." Eclampsia can also involve dysfunction or damage to multiple organs or tissues, such as the liver (e.g., hepatocellular injury, periportal necrosis) and the central nervous system (e.g., cerebral edema and cerebral hemorrhage). The etiology of seizures is thought to be secondary to the development of cerebral edema and focal spasms of small blood vessels in the kidneys.

[0112] "HELLP" syndrome refers to a group of symptoms occurring in pregnant women characterized by hemolysis, elevated liver enzymes, and low platelet counts. HELLP syndrome is considered a variant of PE, but can be its own entity.

[0113] In certain embodiments, PE includes postpartum PE. Postpartum PE is a rare condition that occurs when high blood pressure and excess protein are found in a woman's urine immediately after delivery. Postpartum PE typically occurs within 48 hours after delivery. However, postpartum PE can occur up to six weeks after delivery, which is known as late postpartum PE. The signs and symptoms of postpartum PE and late postpartum PE are typically similar to those of PE that occurs during pregnancy and may include one or any combination of the following: high blood pressure (i.e., 140 / 90 mmHg or higher); proteinuria; severe headache; changes in vision, such as temporary loss of vision, blurred vision, or photosensitivity; swelling of the face and extremities; epigastric pain (usually below the ribs on the right side); nausea or vomiting; decreased urination; and rapid weight gain (typically more than 2 pounds (0.9 kilograms) per week).

[0114] "Intrauterine growth retardation (IUGR)" refers to a syndrome resulting in a birth weight that is less than 10% of the predicted fetal weight for the fetus's gestational age. The current World Health Organization low birth weight standard is a weight less than 2,500 grams (5 lbs. 8 oz.) or less than the 10th percentile for gestational age according to the United States Birth Weight for Gestational Age Tables for race, parity, and infant sex (Zhang and Bowes, Obstet. Gynecol. 86:200-208, 1995). These low birth weight infants are also referred to as "small for gestational age (SGA)." PE is a condition known to be associated with IUGR or SGA.

[0115] Certain embodiments of the present invention relate to the treatment of one or more kidney disorders. "Treatment of kidney disorder" refers to the use of an oligonucleotide (e.g., siRNA) of the present invention in a pharmaceutical composition for treating a kidney-related disease, condition, or disorder. Kidney-related diseases, conditions, or disorders include, but are not limited to, chronic kidney disease (CKD) (stages 1-5, with stage 1 being the mildest and usually with few symptoms, and stage 5 being a severe disease with poor life expectancy if untreated (stage 5 CKD is often referred to as end-stage renal disease, end-stage renal failure, or end-stage renal disease, chronic kidney failure, or chronic renal failure) and acute renal failure (ARF) (caused by trauma with blood loss, a sudden reduction in blood flow to the kidney, kidney damage due to sepsis, obstruction of urine flow, damage due to certain drugs or toxins, pregnancy complications (e.g., eclampsia, PE, and / or HELLP syndrome), etc.).

[0116] Certain embodiments of the present invention relate to the treatment of one or more liver disorders. "Treatment of liver disorders" refers to the use of the oligonucleotides (e.g., siRNAs) of the present invention in pharmaceutical compositions for the treatment of liver-related diseases, conditions, or disorders. Liver-related diseases, conditions, or disorders include, but are not limited to, fascioliasis, hepatitis (e.g., viral hepatitis, alcoholic hepatitis, autoimmune hepatitis, hereditary hepatitis, etc.), alcoholic liver disease (e.g., alcoholic fatty liver disease, alcoholic hepatitis, and alcoholic cirrhosis), nonalcoholic fatty liver disease, fatty liver, nonalcoholic cirrhosis, primary liver cancer (e.g., hepatocellular carcinoma, cholangiocarcinoma, angiosarcoma, angiosarcoma, etc.), primary biliary cirrhosis, primary sclerosing centrilobular necrosis, Budd-Chiari syndrome, hemochromatosis, Wilson's disease, alpha-1-antitrypsin deficiency, glycogen storage disease type II, transthyretin-associated hereditary amyloidosis, Gilbert's syndrome, biliary atresia, alpha-1 antitrypsin deficiency, Alagille syndrome, and progressive familial intrahepatic cholestasis.

[0117] A "therapeutic amount" refers to an amount sufficient, when administered to a patient with PE or eclampsia, to qualitatively or quantitatively reduce the symptoms of PE or eclampsia as described herein. A "therapeutic amount" can also refer to an amount sufficient, when administered to a patient or subject with PE or eclampsia, to cause a decrease in the expression level of one or more sFLT1 proteins (e.g., one or more of sFLT1-i13 short, sFLT1-i13 long, and sFLT1-i15a) as measured by one or more of the assays described herein.

[0118] "Subject" means, without limitation, a human or non-human mammal, e.g., a non-human primate, or other mammal, e.g., a cow, horse, dog, sheep, ovine, cat, mouse, etc. This definition includes pregnant, postpartum, and non-pregnant mammals.

[0119] "Soluble FLT1 (sFLT1)" (also known as sVEGF-R1) refers to a soluble form of the FLT1 receptor (e.g., sFLT1-i13 short, sFLT1-i13 long, and / or sFLT1-i15a (also known as sFLT1-e15a)) that has sFLT1 biological activity. The biological activity of the sFLT1 polypeptide can be assayed using any standard method, for example, by assaying for one or more clinical symptoms of PE, postpartum PE, eclampsia, and / or HELLP, by assaying sFLT1 mRNA and / or protein levels, or by assaying for sFLT1 protein binding to VEGF or the like. The sFLT1 protein lacks the transmembrane and cytoplasmic tyrosine kinase domains of the FLT1 receptor. The sFLT1 protein is functionally distinct from the FLT1 receptor and KDR receptor because it can bind VEGF and PlGF with high affinity, but is unable to induce proliferation or angiogenesis. sFLT1 was first purified from human umbilical endothelial cells and subsequently shown to be produced by trophoblast cells in vivo. As used herein, sFLT1 includes any sFLT1 family member or isoform, such as sFLT1-i13 (e.g., sFLT1-i13 short and / or sFLT1-i13 long (sFLT1_v1), sFLT1-i15a (sFLT1_v2), sFLT1-e15a, sFLT1_v3, sFLT1_v4, etc.

[0120] The sequence of the sFLT1-i13 short isoform is as follows: GTGAGCACTGCAACAAAAAGGCTGTTTTCTCTCGGATCTCCAAATTTAAAAGCACAAGGAATGATTGTACCACACAAAGTAATGTAAAACATTAAAGGACTCATTAAAAAGTAA (SEQ ID NO: 5).

[0121] The sequence of the sFLT1-i13 long isoform is: GAAGAAAGAAATTACAATCAGAGGTGAGCACTGCAACAAAAAGGCTGTTTTCTCTCGGATCTCCAAATTTAAAAGCACAAGGAATGATTGTACCACACAAAGTAATGTAAAACATTAAAGGACTCATTAAAAAGTAACAGTTGTCTCATATCATCTTGATTTATTGTCACTGTTGCTAACTTTCAGGCTCGGAGGAGATGCTCCTCCCAAAATGAGTTCGGAGATGATAGCAGTAATAATGAGACCCCCGGGCTCCAGCTCTGGGCCCCCCATTCAGGCCGAGGGGGCTGCTCCGGGGGGCCGACTTGGTGCACGTTTGGATTTGGAGGATCCCTGCACTGCCTTCTCTGTGTTTGTTGCTCTTGCTGTTTTCTCCTGCCTGATAAACAACAACTTGGGATGATCCTTTCCATTTTGATGCCAACCTCTTTTTATTTTTAAGCGGCGCCCTATAGT (SEQ ID NO: 6).

[0122] The sequence of the sFLT1-i15a (also known as sFLT1-e15a) isoform is as follows (SEQ ID NO: 7):

[0123] sFLT1 protein levels can be measured by measuring the amount of free, bound (i.e., bound to growth factors), or total sFLT1 (bound + free). VEGF or PlGF levels are determined by measuring the amount of free PlGF or free VEGF (i.e., not bound to sFLT1). One exemplary metric is [sFLT1 / (VEGF + PlGF)], also known as the PE antiangiogenic index (PAAI).

[0124] "Preeclampsia Antiangiogenic Index (PAAI)" means the ratio of sFLT1 / VEGF+PlGF, which is used as an indicator of antiangiogenic activity. A PAAI of greater than 20 is considered to indicate PE or risk of PE.

[0125] "Vascular endothelial growth factor (VEGF)" refers to a mammalian growth factor that is homologous to the growth factors defined in U.S. Patent Nos. 5,332,671; 5,240,848; 5,194,596; and Charnock-Jones et al. (Biol. Reproduction, 48:1120-1128, 1993) and has VEGF biological activity. VEGF exists as a glycosylated homodimer and includes at least four different alternatively spliced ​​isoforms. The biological activities of native VEGF include promoting the selective growth of vascular endothelial cells or umbilical vein endothelial cells and inducing angiogenesis. As used herein, VEGF includes any VEGF family member or isoform (e.g., VEGF-A, VEGF-B, VEGF-C, VEGF-D, VEGF-E, VEGF189, VEGF165, or VEGF121). In certain embodiments, the VEGF is a VEGF121 or VEGF165 isoform (Tischer et al., J. Biol. Chem. 266, 11947-11954, 1991; Neufed et al. Cancer Metastasis 15:153-158, 1996), which are described in U.S. Patent Nos. 6,447,768; 5,219,739; and 5,194,596, which are incorporated herein by reference. Also included are mutant forms of VEGF, such as KDR-selective VEGF and Flt-selective VEGF, as described by Gille et al. (J. Biol. Chem. 276:3222-3230, 2001). VEGF includes human forms and may also include other animal forms of VEGF (e.g., mouse, rat, dog, chicken, etc.).

[0126] "Placental growth factor (PlGF)" refers to a mammalian growth factor that is homologous to the protein defined by GenBank Accession No. P49763 and has PlGF biological activity. PlGF is a glycosylated homodimer that belongs to the VEGF family and is found in two distinct isoforms via alternative splicing mechanisms. PlGF is expressed in the cytotrophoblast and syncytiotrophoblast layers of the placenta, and its biological activities include the induction of proliferation, migration, and activation of endothelial cells, particularly trophoblast cells.

[0127] "Trophiblast" refers to the mesectodermal cell layer that covers the blastocyst that invades the uterine mucosa and through which the embryo receives nutrients from the mother. Trophiblast cells contribute to the formation of the placenta.

[0128] The term "nucleoside" refers to a molecule having a purine or pyrimidine base covalently linked to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine, and thymidine. Further exemplary nucleosides include inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine, and 2,2N,N-dimethylguanosine (also called "rare" nucleosides). The term "nucleotide" refers to a nucleoside having one or more phosphate groups attached to the sugar moiety in an ester linkage. Exemplary nucleotides include nucleoside monophosphate, diphosphate, and triphosphate. The terms "polynucleotide" and "nucleic acid molecule" are used interchangeably herein and refer to a polymer of nucleotides linked together by phosphodiester linkages between the 5' and 3' carbon atoms.

[0129] The terms "RNA" or "RNA molecule" or "ribonucleic acid molecule" refer to a polymer of ribonucleotides (e.g., 2, 3, 4, 5, 10, 15, 20, 25, 30, or more ribonucleotides). The terms "DNA" or "DNA molecule" or "deoxyribonucleic acid molecule" refer to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally (e.g., by DNA replication or DNA transcription, respectively). RNA can be modified post-transcriptionally. DNA and RNA can also be chemically synthesized. DNA and RNA can be single-stranded (i.e., ssRNA and ssDNA, respectively) or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). "mRNA" or "messenger RNA" is single-stranded RNA that specifies the amino acid sequence of one or more polypeptide chains. This information is translated during protein synthesis when ribosomes bind to the mRNA.

[0130] As used herein, the term "small interfering RNA" ("siRNA") (also referred to in the art as "short interfering RNA") refers to an RNA (or RNA analog) comprising about 10-50 nucleotides (or nucleotide analogs) and capable of directing or mediating RNA interference. Preferably, an siRNA comprises about 15-30 nucleotides or nucleotide analogs, more preferably about 16-25 nucleotides (or nucleotide analogs), even more preferably about 18-23 nucleotides (or nucleotide analogs), and even more preferably about 19-22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21, or 22 nucleotides or nucleotide analogs). The term "short" siRNA refers to an siRNA comprising about 21 nucleotides (or nucleotide analogs), e.g., 19, 20, 21, or 22 nucleotides. The term "long" siRNA refers to an siRNA comprising about 24-25 nucleotides, e.g., 23, 24, 25, or 26 nucleotides. Short siRNA can comprise less than 19 nucleotides, for example, 16, 17 or 18 nucleotides, provided that short siRNA maintains the ability to mediate RNAi in some cases.Similarly, long siRNA can comprise more than 26 nucleotides, provided that longer siRNA maintains the ability to mediate RNAi without further processing, for example, enzymatic processing, into short siRNA in some cases.

[0131] The term "nucleotide analog" or "altered nucleotide" or "modified nucleotide" refers to a non-standard nucleotide, such as a non-naturally occurring ribonucleotide or deoxyribonucleotide. Exemplary nucleotide analogs are modified at any position to alter certain chemical properties of the nucleotide but retain the ability of the nucleotide analog to perform its intended function. Examples of nucleotide positions that can be derivatized include the 5-position, e.g., 5-(2-amino)propyluridine, 5-bromouridine, 5-propyneuridine, 5-propenyluridine; the 6-position, e.g., 6-(2-amino)propyluridine; and the 8-position of adenosine and / or guanosine, e.g., 8-bromoguanosine, 8-chloroguanosine, 8-fluoroguanosine. Nucleotide analogs also include deazanucleotides, such as 7-deaza-adenosine, O- and N-modified (e.g., alkylated, e.g., N6-methyladenosine, or others known in the art) nucleotides, and other heterocyclic-modified nucleotide analogs, such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.

[0132] Nucleotide analogs may also include modifications to the sugar portion of the nucleotide. For example, the 2'OH group may be replaced with a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH, NHR, NR, COOR, or OR, where R is a substituted or unsubstituted C-C alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications include those described in U.S. Patent Nos. 5,858,988 and 6,291,438.

[0133] The phosphate group of a nucleotide can also be modified, for example, by substituting one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioate) or by other substitutions that allow the nucleotide to perform its intended function. For example, see Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2):117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5):317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, and U.S. Patent No. 5,684,143. Certain of the above-referenced modifications (e.g., phosphate group modifications) preferably reduce the hydrolysis rate of polynucleotides containing the analogs, for example, in vivo or in vitro.

[0134] The term "oligonucleotide" refers to a short polymer of nucleotides and / or nucleotide analogs. The term "RNA analog" refers to a polynucleotide (e.g., a chemically synthesized polynucleotide) that has at least one modified or altered nucleotide compared to the corresponding unmodified or unmodified RNA, but retains the same or similar properties or functions as the corresponding unmodified or unmodified RNA. As described above, oligonucleotides can be linked by linkages that result in a reduced hydrolysis rate of the RNA analog compared to RNA molecules with phosphodiester linkages. For example, the nucleotides of the analog can contain methylenediol, ethylenediol, oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphorodiamidate, phosphoroamidate, and / or phosphorothioate linkages. Preferred RNA analogs include sugar- and / or backbone-modified ribonucleotides and / or deoxyribonucleotides. Such alterations or modifications can further include the addition of non-nucleotide material, such as to the end(s) or internal (one or more nucleotides of the RNA) of the RNA. The RNA analog need only be sufficiently similar to natural RNA to have the ability to mediate RNA interference.

[0135] The term "RNA interference" ("RNAi") used herein refers to the selective intracellular degradation of RNA.RNAi occurs naturally in cells and removes foreign RNA (such as viral RNA).Natural RNAi proceeds through fragments cut from free dsRNA, and directs the degradation mechanism to other similar RNA sequences.Alternatively, RNAi can be initiated by human hands, for example, to silence the expression of target genes.

[0136] An RNAi agent, e.g., an RNA silencing agent, having a strand that is "sufficiently complementary to a target mRNA sequence to direct target-specific RNA interference (RNAi)" means that the strand has sufficient sequence to cause destruction of the target mRNA by the RNAi machinery or process.

[0137] As used herein, "isolated RNA" (e.g., "isolated siRNA" or "isolated siRNA precursor") refers to an RNA molecule that, when produced by recombinant techniques, is substantially free of other cellular material or culture medium, and, when chemically synthesized, is substantially free of chemical precursors or other chemicals.

[0138] As used herein, the term "RNA silencing" refers to a group of sequence-specific regulatory mechanisms mediated by RNA molecules (e.g., RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression), which result in the inhibition or "silencing" of expression of corresponding protein-coding genes. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.

[0139] The term "discriminatory RNA silencing" refers to the ability of an RNA molecule to substantially inhibit the expression of a "first" or "target" polynucleotide sequence while not substantially inhibiting the expression of a "second" or "non-target" polynucleotide sequence, for example, when both polynucleotide sequences are present in the same cell. In certain embodiments, the target polynucleotide sequence corresponds to a target gene, and the non-target polynucleotide sequence corresponds to a non-target gene. In other embodiments, the target polynucleotide sequence corresponds to a target allele, and the non-target polynucleotide sequence corresponds to a non-target allele. In certain embodiments, the target polynucleotide sequence is a DNA sequence encoding a regulatory region (e.g., a promoter or enhancer element) of the target gene. In other embodiments, the target polynucleotide sequence is a target mRNA encoded by the target gene.

[0140] The term "in vitro" has its art-recognized meaning, including, for example, purified reagents or extracts, e.g., cellular extracts. The term "in vivo" also has its art-recognized meaning, including, for example, living cells, e.g., immortalized cells, primary cells, cell lines, and / or cells within an organism.

[0141] As used herein, the term "transgene" refers to any nucleic acid molecule that is artificially inserted into a cell and becomes part of the genome of the organism that develops from the cell. Such transgenes may contain genes that are partially or completely heterologous (i.e., foreign) to the transgenic organism, or may represent genes that are homologous to endogenous genes of the organism. "Transgene" also refers to a nucleic acid molecule containing one or more selected nucleic acid sequences, e.g., DNA, that encode one or more engineered RNA precursors to be expressed in a transgenic organism, e.g., an animal, that are partially or completely heterologous (i.e., foreign) to the transgenic animal, or homologous to an endogenous gene of the transgenic animal, but that are designed to be inserted into the animal's genome at a location different from the native gene. A transgene includes one or more promoters and any other DNA, e.g., introns, necessary for expression of the selected nucleic acid sequence, all operably linked to the selected sequence, and may include enhancer sequences.

[0142] A gene "involved in" a disease or disorder includes a gene, the normal or abnormal expression or function of which affects or causes the disease or disorder, or at least one symptom of the disease or disorder.

[0143] As used herein, the term "gain-of-function mutation" refers to any mutation in a gene in which the protein encoded by the gene (i.e., mutant protein) gains a function not normally associated with that protein (i.e., wild-type protein) and causes or contributes to a disease or disorder. A gain-of-function mutation can be a deletion, addition, or substitution of nucleotide(s) in a gene that causes a change in the function of the encoded protein. In one embodiment, a gain-of-function mutation alters the function of the mutant protein (e.g., causes the production of one or more sFLT1 proteins) or causes interaction with other proteins. In another embodiment, a gain-of-function mutation causes a reduction or elimination of normal wild-type protein, for example, by interaction of the modified mutant protein with the normal wild-type protein.

[0144] As used herein, the term "target gene" refers to a gene whose expression is substantially inhibited or "silenced." This silencing can be achieved, for example, by cleaving the target gene's mRNA or silencing RNA by translational repression of the target gene. The term "non-target gene" refers to a gene whose expression is not substantially silenced. In one embodiment, the polynucleotide sequences of the target gene and the non-target gene (e.g., mRNAs encoded by the target (sFLT1) gene and the non-target (flFLT1) gene) may differ by one or more nucleotides, for example, in an intron region. In another embodiment, the target and non-target genes may differ by one or more polymorphisms (e.g., single nucleotide polymorphisms or SNPs). In another embodiment, the target and non-target genes may share less than 100% sequence identity. In another embodiment, the non-target gene may be a homolog (e.g., an ortholog or paralog) of the target gene.

[0145] A "target allele" is an allele (e.g., an SNP allele) whose expression is to be selectively inhibited or "silenced." This silencing can be achieved by RNA silencing, e.g., by cleaving the mRNA of the target gene or target allele with an siRNA. The term "non-target allele" refers to an allele whose expression is not substantially silenced. In certain embodiments, the target allele and the non-target allele can correspond to the same target gene. In other embodiments, the target allele corresponds to or is related to the target gene, and the non-target allele corresponds to or is related to the non-target gene. In one embodiment, the polynucleotide sequences of the target allele and the non-target allele can differ by one or more nucleotides. In another embodiment, the target allele and the non-target allele can differ by one or more allelic polymorphisms (e.g., one or more SNPs). In another embodiment, the target allele and the non-target allele can share less than 100% sequence identity.

[0146] The term "polymorphism" as used herein refers to a variation (e.g., one or more deletions, insertions, or substitutions) in a gene sequence that can be identified or detected when comparing the same gene sequence from different sources or subjects (but the same organism). For example, when comparing the same gene sequence from different subjects, polymorphisms can be identified. Identification of such polymorphisms is routine in the art, and the methodology is similar to that used to detect point mutations in breast cancer, for example. Identification can be performed, for example, from DNA extracted from a subject's lymphocytes, and then the polymorphic region can be amplified using specific primers for the polymorphic region. Alternatively, polymorphisms can be identified when comparing two alleles of the same gene. In certain embodiments, the polymorphism is a single nucleotide polymorphism (SNP).

[0147] Variation in sequence between two alleles of the same gene within an organism is referred to herein as an "allelic polymorphism." In certain embodiments, an allelic polymorphism corresponds to a SNP allele. For example, an allelic polymorphism can include a single nucleotide variation between two alleles of a SNP. A polymorphism can be at a nucleotide within a coding region, but due to the degeneracy of the genetic code, no change in amino acid sequence is encoded. Alternatively, a polymorphic sequence can encode a different amino acid at a specific position, but the amino acid change does not affect protein function. Polymorphic regions are also found in non-coding regions of genes. In exemplary embodiments, a polymorphism is found in the coding region of a gene or in the untranslated region of a gene (e.g., the 5'UTR or 3'UTR).

[0148] As used herein, the term "allele frequency" is a measure (e.g., proportion or percentage) of the relative frequency of an allele (e.g., a SNP allele) at a single locus in a population of individuals. For example, if a population of individuals possesses n loci of a particular chromosomal locus (and the gene occupying that locus) in each of their somatic cells, the allele frequency of an allele is the proportion or percentage of loci that the allele occupies in the population. In certain embodiments, the allele frequency of an allele (e.g., a SNP allele) is at least 10% (e.g., at least 15%, 20%, 25%, 30%, 35%, 40% or more) in a sample population.

[0149] As used herein, the term "sample population" refers to a group of individuals that includes a statistically significant number of individuals. For example, a sample population may include 50, 75, 100, 200, 500, 1000 or more individuals. In certain embodiments, a sample population may include individuals that share at least a common disease phenotype (e.g., a gain-of-function disorder) or mutation (e.g., a gain-of-function mutation).

[0150] As used herein, the term "heterozygosity" refers to the proportion of individuals in any given population who are heterozygous (e.g., contain two or more different alleles) at a particular genetic locus (e.g., SNP). Heterozygosity can be calculated for a sample population using methods well known to those skilled in the art.

[0151] The phrase "examining the function of a gene in a cell or organism" refers to examining or studying the expression, activity, function or phenotype resulting therefrom.

[0152] The term "RNA silencing agent" as used herein refers to an RNA that can inhibit or "silence" the expression of a target gene. In certain embodiments, an RNA silencing agent can prevent complete processing (e.g., complete translation and / or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include small (<50 b.p.), non-coding RNA molecules, such as RNA duplexes containing paired strands, as well as precursor RNAs that can generate such small non-coding RNAs. Exemplary RNA silencing agents include siRNAs, miRNAs, siRNA-like duplexes, and dual-function oligonucleotides, as well as their precursors. In one embodiment, an RNA silencing agent can induce RNA interference. In another embodiment, an RNA silencing agent can mediate translational repression.

[0153] As used herein, the term "rare nucleotide" refers to a naturally occurring nucleotide that occurs infrequently, e.g., a naturally occurring deoxyribonucleotide or ribonucleotide that occurs infrequently, e.g., a naturally occurring ribonucleotide that is not guanosine, adenosine, cytosine, or uridine. Examples of rare nucleotides include, but are not limited to, inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2 N-methylguanosine and 2,2 N,N-dimethylguanosine is an example.

[0154] The term "engineered" indicates that the precursor or molecule is not found in nature, in that all or part of the nucleic acid sequence of the precursor or molecule is created or selected by humans, such as an engineered RNA precursor or engineered nucleic acid molecule. Once created or selected, the sequence is replicated, translated, transcribed, or otherwise processed by machinery within the cell. Thus, an RNA precursor produced within a cell from a transgene containing an engineered nucleic acid molecule is an engineered RNA precursor.

[0155] As used herein, the term "microRNA" ("miRNA"), also referred to in the art as "small temporal RNA" ("stRNA"), refers to small (e.g., 10-50 nucleotide) RNAs that are genetically encoded (e.g., by viral, mammalian, or plant genomes) and can direct or mediate RNA silencing. "miRNA disorder" refers to a disease or disorder characterized by aberrant expression or activity of a miRNA.

[0156] As used herein, the term "bifunctional oligonucleotide" refers to an RNA silencing agent having the formula TL-μ, where T is the mRNA targeting moiety, L is the linking moiety, and μ is the miRNA recruitment moiety. As used herein, the terms "mRNA targeting moiety," "targeting moiety," "mRNA targeting moiety," or "targeting moiety" refer to a domain, portion, or region of a bifunctional oligonucleotide that has sufficient size and complementarity to a portion or region of an mRNA selected or targeted for silencing (i.e., the portion has sufficient sequence to capture the target mRNA). As used herein, the term "linking moiety" or "linking portion" refers to a domain, portion, or region of an RNA silencing agent that covalently joins or links the mRNA.

[0157] As used herein, the term "antisense strand" of an RNA silencing agent, e.g., an siRNA or RNA silencing agent, refers to the strand that is substantially complementary to a section of about 10-50 nucleotides, e.g., about 15-30, 16-25, 18-23, or 19-22 nucleotides, of the mRNA of a gene targeted for silencing. The antisense strand, or first strand, has a sequence that is sufficiently complementary to the desired target mRNA sequence to direct target-specific silencing, e.g., sufficiently complementary to cause destruction of the desired target mRNA by the RNAi mechanism or process (RNAi interference) or sufficiently complementary to cause translational repression of the desired target mRNA.

[0158] The term "sense strand" or "second strand" of an RNA silencing agent, such as an siRNA or RNA silencing agent, refers to the strand complementary to the antisense strand or first strand. The antisense strand and the sense strand can also be referred to as the first strand or second strand, where the first strand or second strand is complementary to the target sequence, and the second strand or first strand, respectively, is complementary to the first strand or second strand. The miRNA duplex intermediate or siRNA-like duplex includes an miRNA strand that is sufficiently complementary to a section of approximately 10-50 nucleotides of the mRNA of the gene targeted for silencing, and an miRNA* strand that is sufficiently complementary to form a duplex with the miRNA strand.

[0159] The term "guide strand" as used herein refers to the strand of an RNA silencing agent, e.g., the antisense strand of an siRNA duplex or siRNA sequence, that enters the RISC complex and directs cleavage of the target mRNA.

[0160] The term " asymmetry " used herein refers to the unequal binding strength or base pairing strength between the ends of an RNA silencing agent (for example, between the terminal nucleotide on the first strand or stem portion and the terminal nucleotide on the opposite second strand or stem portion), such as in the asymmetry of the double-stranded region of an RNA silencing agent (for example, the stem of shRNA).This causes the 5'-end of one strand of the double strand to be in a transient unpaired state, for example, a single-stranded state, more frequently than the 5'-end of the complementary strand.This structural difference determines that one strand of the double strand will be preferentially incorporated into RISC complex.The strand whose 5'-end is less tightly paired with the complementary strand will be preferentially incorporated into RISC and mediate RNAi.

[0161] As used herein, the term "binding strength" or "base pair strength" refers primarily to the strength of interactions between pairs of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide duplex (e.g., an siRNA duplex) and between these nucleotides (or nucleotide analogs) through H-bonding, van der Waals interactions, etc.

[0162] As used herein, "5' end" refers to the 5'-terminal nucleotide, e.g., between 1 and about 5 nucleotides from the 5' end of the antisense strand, as in the 5' end of the antisense strand. As used herein, "3' end" refers to the region complementary to the 5'-terminal nucleotide of the complementary antisense strand, as in the 3' end of the sense strand, as in the 1' end of the sense strand, as in the 5' end of the sense strand.

[0163] As used herein, the term "destabilizing nucleotide" refers to a first nucleotide or nucleotide analog that can base pair with a second nucleotide or nucleotide analog such that the base pair has a lower binding strength than conventional base pairs (i.e., Watson-Crick base pairs). In certain embodiments, the destabilizing nucleotide can form a mismatch base pair with the second nucleotide. In other embodiments, the destabilizing nucleotide can form a wobble base pair with the second nucleotide. In still other embodiments, the destabilizing nucleotide can form an ambiguous base pair with the second nucleotide.

[0164] As used herein, the term "base pair" refers to an interaction between a pair of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide duplex (e.g., a duplex formed by a strand of an RNA silencing agent and a target mRNA sequence), primarily through H-bonding, van der Waals interactions, etc. between the nucleotides (or nucleotide analogs). As used herein, the term "bond strength" or "base pair strength" refers to the strength of the base pair.

[0165] As used herein, the term "mismatch base pair" refers to a base pair consisting of a non-complementary or non-Watson-Crick base pair, e.g., not a normal complementary G:C, A:T, A:U base pair. As used herein, the term "ambiguous base pair" (also known as a non-discriminating base pair) refers to a base pair formed by universal nucleotides.

[0166] As used herein, the term "universal nucleotide" (also known as "neutral nucleotide") includes nucleotides (e.g., certain destabilizing nucleotides) that have bases ("universal bases" or "neutral bases") that do not significantly discriminate between bases on a complementary polynucleotide when base-pairing. Universal nucleotides are primarily hydrophobic molecules that can efficiently pack into antiparallel double-stranded nucleic acids (e.g., double-stranded DNA or RNA) through stacking interactions. The base portion of a universal nucleotide typically contains a nitrogen-containing aromatic heterocyclic moiety.

[0167] As used herein, the term "sufficient complementarity" or "sufficient degree of complementarity" means that the RNA silencing agent has sufficient sequence (e.g., in the antisense strand, mRNA targeting portion, or miRNA recruitment portion) to bind to the desired target RNA and induce RNA silencing of the target mRNA, respectively.

[0168] The term " translational repression " used herein refers to the selective inhibition of mRNA translation.Natural translational repression proceeds through miRNA cleaved from shRNA precursor.Both RNAi and translational repression are mediated by RISC.Both RNAi and translational repression can occur naturally or can be initiated by human hands, for example, to silence the expression of target genes.

[0169] Various methodologies of the present invention include a step that involves comparing a value, level, characteristic, property, or the like to a "suitable control," referred to interchangeably herein as a "suitable control." A "suitable control" or "suitable control" is any control or standard useful for comparison purposes and familiar to those of skill in the art. In one embodiment, a "suitable control" or "suitable control" is a value, level, characteristic, property, or the like that is determined before performing an RNAi methodology, as described herein. For example, transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic or property, genotype, phenotype, or the like, can be determined before introducing an RNA silencing agent of the present invention into a cell or organism. In another embodiment, a "suitable control" or "suitable control" is a value, level, characteristic, property, or the like that is determined in a cell or organism, e.g., a control or, e.g., a normal cell or organism exhibiting normal traits. In yet another embodiment, a "suitable control" or "suitable control" is a predefined value, level, characteristic, property, or the like.

[0170] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0171] In some embodiments, RNA silencing agents of the present invention are designed to target intronic regions in mRNA molecules encoding one or more sFLT1 proteins.

[0172] The present invention targets one or more sFLT1 mRNAs and their corresponding proteins. One strand of a double-stranded RNA (siRNA) is complementary to a target sequence within the sFLT1 mRNA. After introducing the siRNA into a subject or cell, the siRNA is partially unfolded and site-specifically binds to an intronic target region within the sFLT1 mRNA, activating an mRNA nuclease. This nuclease cleaves the sFLT1 mRNA, thereby terminating translation of the sFLT1 protein. The cell either removes the partially digested mRNA, preventing translation, or digests the partially translated protein. In certain embodiments, sFLT1 protein expression is reduced by about 30% to 50%, or about 30% to 40%, in the subject or cell.

[0173] In an embodiment of the present invention, the RNA silencing agent of the present invention can target the human flt1 gene, which can be found at position 2283 (5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1)) or position 2519 (5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2)).

[0174] Various aspects of the invention are described in further detail in the following subsections.

[0175] I. siRNA Design In some embodiments, siRNAs are designed as follows: First, a portion of a target gene (e.g., the flt1 gene), e.g., one or more target sequences, e.g., one or any combination of sFLT1-i13-2283, sFLT1-i15a-2519, sFLT1-i13-2318, and sFLT1-i15a-2585, is selected from the intron region of the target gene. Cleavage of mRNA at these sites eliminates translation of the corresponding soluble protein. A sense strand is designed based on the target sequence. Preferably, the portion (and the corresponding sense strand) contains approximately 30 to 35 nucleotides, e.g., 30, 31, 32, 33, 34, or 35 nucleotides. More preferably, the portion (and the corresponding sense strand) contains 21, 22, or 23 nucleotides. However, those skilled in the art will understand that siRNAs having a length of less than 19 nucleotides or more than 25 nucleotides can also function to mediate RNAi. Therefore, as long as siRNA of this length maintains the ability to mediate RNAi, it also falls within the scope of the present invention.Although it has been demonstrated that longer RNAi agents induce interferon or PKR response in certain mammalian cells, this may not be desirable.Preferably, the RNAi agents of the present invention do not induce PKR response (i.e., are sufficiently short in length).However, longer RNAi agents may be useful, for example, in the cell type that cannot produce PRK response, or in the situation where PKR response is downregulated or suppressed by alternative means.

[0176] The sense strand sequence is designed so that target sequence is essentially in the center of strand.By moving target sequence to a position that is off-center, in some cases, the efficiency of cleavage by siRNA can be reduced.This composition, that is, the composition with low efficiency, may be desirable to use when detecting the off-silencing of wild-type mRNA.

[0177] The antisense strand is typically the same length as the sense strand and contains complementary nucleotides. In one embodiment, the strands are fully complementary; i.e., the strands are blunt-ended when aligned or annealed. In another embodiment, the strands are aligned or annealed to generate a 1-, 2-, or 3-nucleotide overhang; i.e., the 3'-end of the sense strand extends 1-, 2-, or 3-nucleotides beyond the 5'-end of the antisense strand, and / or the 3'-end of the antisense strand extends 1-, 2-, or 3-nucleotides beyond the 5'-end of the sense strand. The overhang can comprise (or consist of) nucleotides corresponding to the target gene sequence (or its complement). Alternatively, the overhang can comprise (or consist of) deoxyribonucleotides, such as dT, or nucleotide analogs, or other suitable non-nucleotide material.

[0178] In order to facilitate the entry of the antisense strand into RISC (and thus increase or improve the efficiency of target cleavage and silencing), the base pair strength between the 5' end of the sense strand and the 3' end of the antisense strand can be modified (reduced or decreased). These are described in detail below, and U.S. Patent Nos. 7,459,547, 7,772,203 and 7,732,593, entitled "Methods and Compositions for Controlling Efficacy of RNA Silencing" (filed June 2, 2003) and U.S. Patent Nos. 8,309,704, 7,750,144, 8,304,530, 8,329,892 and 8,309,705, entitled "Methods and Compositions for Enhancing the Efficacy and Specificity of RNAi" (filed June 2, 2003), the entire contents of which are incorporated herein by reference. In one embodiment of these aspects of the invention, base pairing intensity is low because there are fewer G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the second or sense strand than between the 3' end of the first or antisense strand and the 5' end of the second or sense strand. In another embodiment, base pairing intensity is low due to at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the second or sense strand. In certain exemplary embodiments, the mismatched base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C, and U:U. In another embodiment, base pairing intensity is low due to at least one wobble base pair, e.g., G:U, between the 5' end of the first or antisense strand and the 3' end of the second or sense strand. In another embodiment, base pairing intensity is low due to at least one base pair containing a rare nucleotide, e.g., inosine (I). In certain exemplary embodiments, the base pair is selected from the group consisting of I:A, I:U, and I:C. In yet other embodiments, the base pair strength is lower due to at least one base pair comprising a modified nucleotide.In certain exemplary embodiments, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G, and 2,6-diamino-A.

[0179] The design of siRNA that is suitable for targeting sFLT1 target sequence is described in detail below. siRNA can be designed according to the above exemplary teachings for any other target sequence found in flt1 gene. Furthermore, this technology can be applied to target any other target sequence, for example, the target sequence that does not cause disease.

[0180] To verify the effectiveness of siRNA in disrupting mRNA (e.g., sFLT1 mRNA), siRNA can be incubated with cDNA (e.g., FLT1 cDNA) in a Drosophila melanogaster-based in vitro mRNA expression system. 32 Newly synthesized mRNA (e.g., FLT1 mRNA) radioactively labeled with P is detected by autoradiography on an agarose gel. The presence of cleaved mRNA indicates mRNA nuclease activity. Suitable controls include omitting the siRNA. Alternatively, a control siRNA is selected that has the same nucleotide composition as the selected siRNA but does not have significant sequence complementarity to the appropriate target gene. Such a negative control can be designed by randomly scrambling the nucleotide sequence of the selected siRNA. A homology search can be performed to confirm that the negative control lacks homology with any other genes in the appropriate genome. Furthermore, a negative control siRNA can be designed by introducing one or more base mismatches into the sequence.

[0181] The siRNA-mRNA complementary site that results in optimal mRNA specificity and maximal mRNA cleavage is selected.

[0182] II. RNAi Agents The present invention includes, for example, the siRNA molecule designed as above.The siRNA molecule of the present invention can be chemically synthesized, or can be transcribed from DNA template in vitro, or for example from shRNA in vivo, or can be transcribed from dsRNA template in vitro using recombinant human DICER enzyme to cut into a pool of 20, 21 or 23bp double-stranded RNA mediated RNAi.The siRNA molecule can be designed using any method known in the art.

[0183] In one embodiment, instead of the RNAi agent being an interfering ribonucleic acid, such as the above-mentioned siRNA or shRNA, the RNAi agent can encode an interfering ribonucleic acid, such as the above-mentioned shRNA.In other words, the RNAi agent can be a transcription template for an interfering ribonucleic acid.Therefore, the RNAi agent of the present invention can also include small hairpin RNA (shRNA) and an expression construct engineered to express shRNA.It is believed that the transcription of shRNA begins at the polymerase III (pol III) promoter and terminates at position 2 of the 4-5-thymine transcription termination site. Upon expression, shRNAs are thought to fold into stem-loop structures with 3' UU overhangs, after which the ends of these shRNAs are processed, converting the shRNAs into siRNA-like molecules of approximately 21-23 nucleotides (Brummelkamp et al., 2002; Lee et al., 2002, supra; Miyagishi et al., 2002; Paddison et al., 2002, supra; Paul et al., 2002, supra; Sui et al., 2002, supra; Yu et al., 2002, supra. Further information regarding the design and use of shRNAs can be found on the Internet at the following addresses: katandin.cshl.org:9331 / RNAi / docs / BseRI-BamHI_Strategy.pdf and katandin.cshl.org:9331 / RNAi / docs / Web_version_of_PCR_strategy1.pdf).

[0184] Expression constructs of the present invention include any construct suitable for use in an appropriate expression system, including, but not limited to, retroviral vectors, linear expression cassettes, plasmids, and viral or virus-derived vectors, as known in the art. Such expression constructs can include one or more inducible promoters, RNA Pol III promoter systems, such as the U6 snRNA promoter or the H1 RNA polymerase III promoter, or other promoters known in the art. The construct can contain one or both strands of the siRNA. Expression constructs that express both strands can also include a loop structure connecting both strands, or each strand can be transcribed separately from a separate promoter within the same construct. Each strand can be transcribed from a separate expression construct (Tuschl, T., 2002, supra).

[0185] Synthetic siRNA can be delivered to cells by methods known in the art, such as cationic liposome transfection and electroporation. To achieve long-term suppression of a target gene (i.e., the flt1 gene) and to facilitate delivery under certain circumstances, one or more siRNAs can be expressed intracellularly from a recombinant DNA construct. Methods for expressing siRNA duplexes intracellularly from recombinant DNA constructs to enable longer-term target gene suppression in cells are known in the art, such as mammalian Pol III promoter systems (e.g., H1 or U6 / snRNA promoter systems (Tuschl, T., 2002, supra) that can express functional double-stranded siRNAs (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002, supra; Sui et al., 2002, supra). Transcription termination by RNA PolIII occurs at a series of four consecutive T residues within the DNA template, providing a mechanism for terminating siRNA transcripts at specific sequences. The siRNA is complementary to the target gene sequence in the 5'-3' and 3'-5' directions, and the two strands of the siRNA can be expressed in the same or separate constructs. Hairpin siRNAs expressed intracellularly and driven by the H1 or U6 snRNA promoter can inhibit target gene expression (Bagella et al., 1998; Lee et al., 2002, supra; Miyagishi et al., 2002, supra; Paul et al., 2002, supra; Yu et al., 2002, supra; Sui et al., 2002, supra). Constructs containing siRNA sequences under the control of the T7 promoter also generate functional siRNAs when co-transfected into cells with a vector expressing T7 RNA polymerase (Jacque et al., 2002, supra).A single construct may contain multiple siRNA-encoding sequences, such as multiple regions of the sFlt1-encoding gene targeting the same gene or multiple genes, and may be driven, for example, by separate PolIII promoter sites.

[0186] Animal cells express a series of approximately 22-nucleotide non-coding RNAs called microRNAs (miRNAs), which can regulate gene expression at the post-transcriptional or translational level during animal development. One common feature of miRNAs is that they are all excised from a ~70-nucleotide precursor RNA stem-loop, presumably by the RNase III enzyme Dicer or its homologs. By replacing the stem sequence of the miRNA precursor with a sequence complementary to the target mRNA, vector constructs expressing the engineered precursor can be used to produce siRNAs and initiate RNAi against specific mRNA targets in mammalian cells (Zeng et al., supra, 2002). When expressed by a DNA vector containing a polymerase III promoter, microRNA-designed hairpins can silence gene expression (McManus et al., 2002, supra). MicroRNAs targeting polymorphisms can also be useful for blocking translation of mutant proteins in the absence of siRNA-mediated gene silencing. Such applications may be useful, for example, in situations where the designed siRNA causes off-target silencing of a wild-type protein.

[0187] Viral-mediated delivery mechanisms can also be used to induce specific silencing of targeted genes through the expression of siRNA, for example, by generating recombinant adenoviruses carrying siRNA under the transcriptional control of an RNA Pol II promoter (Xia et al., 2002, supra). Infection of HeLa cells with these recombinant adenoviruses can reduce the expression of endogenous target genes. Injection of recombinant adenoviral vectors into transgenic mice expressing the siRNA target gene results in in vivo reduction of target gene expression. Ibid. In animal models, whole embryo electroporation can efficiently deliver synthetic siRNA to postimplantation mouse embryos (Calegari et al., 2002). In adult mice, efficient delivery of siRNA can be achieved by "high pressure" delivery techniques, rapidly injecting (within 5 seconds) a large volume of siRNA-containing solution into the animal's tail vein (Liu et al., 1999, supra; McCaffrey et al., 2002, supra; Lewis et al., 2002). Nanoparticles and liposomes can also be used to deliver siRNA to animals. In certain exemplary embodiments, recombinant adeno-associated viruses (rAAVs) and their related vectors can be used to deliver one or more siRNAs to cells, such as neuronal cells (e.g., brain cells) (U.S. Patent Application Nos. 2014 / 0296486, 2010 / 0186103, 2008 / 0269149, 2006 / 0078542, and 2005 / 0220766).

[0188] The nucleic acid compositions of the present invention include both unmodified siRNAs and modified siRNAs known in the art, such as crosslinked siRNA derivatives or derivatives having non-nucleotide moieties linked to their 3'-end or 5'-end.By modifying siRNA derivatives in this way, compared with the corresponding siRNAs, it is possible to improve the uptake into cells or improve the cell targeting activity of the resulting siRNA derivatives, and it is useful for tracking siRNA derivatives in cells or improving the stability of siRNA derivatives compared with the corresponding siRNAs.

[0189] As described herein, engineered RNA precursors introduced into cells or whole organisms result in the production of desired siRNA molecules.Then, these siRNA molecules associate with the endogenous protein components of the RNAi pathway to bind to specific mRNA sequences, and target them for cleavage and destruction.In this way, the mRNA targeted by the siRNA produced from engineered RNA precursors is depleted from cells or organisms, thereby reducing the concentration of the protein coded by that mRNA in cells or organisms.RNA precursors are typically nucleic acid molecules that either individually code one strand of dsRNA or code the entire nucleotide sequence of RNA hairpin loop structure.

[0190] The nucleic acid compositions of the invention may be unconjugated or may be conjugated to another moiety, such as a nanoparticle, to improve the properties of the composition, e.g., absorption, efficacy, bioavailability, and / or pharmacokinetic parameters such as half-life, etc. Conjugation can be achieved using methods known in the art, for example, the following methods. Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describing nucleic acids attached to polyalkylcyanoacrylate (PACA) nanoparticles), Fattal et al., J. Control Release 53(1-3): 137-43 (1998) (describing nucleic acids bound to nanoparticles), Schwab et al., Ann. Oncol. 5 Suppl. 4: 55-8 (1994) (describing nucleic acids linked to intercalating agents, hydrophobic groups, polycations or PACA nanoparticles), and Godard et al., Eur. J. Biochem. 232(2): 404-10 (1995) (describing nucleic acids linked to nanoparticles).

[0191] The nucleic acid molecule of the present invention can also be labeled using any method known in the art.For example, the nucleic acid composition can be labeled with a fluorophore, such as Cy3, fluorescein, or rhodamine.Labeling can be carried out using a kit, such as SILENCER™ siRNA labeling kit (Ambion).In addition, siRNA can be, for example, 3 H, 32 It may be radiolabeled using P or other suitable isotopes.

[0192] Furthermore, because RNAi is believed to proceed through at least one single-stranded RNA intermediate, those skilled in the art will understand that ss-siRNAs (e.g., the antisense strand of a ds-siRNA) can also be designed (e.g., for chemical synthesis), generated (e.g., enzymatically generated), or expressed (e.g., from a vector or plasmid) and utilized in accordance with the claimed methodologies as described herein. Furthermore, in invertebrates, RNAi can be effectively induced by long dsRNAs (e.g., dsRNAs of about 100-1000 nucleotides in length, preferably about 200-500, e.g., about 250, 300, 350, 400, or 450 nucleotides in length) that act as effectors of RNAi (Brondani et al., Proc Natl Acad Sci USA. 2001 Dec. 4;98(25):14428-33. Epub 2001 Nov. 27.).

[0193] III. Anti-sFlt1 RNA Silencing Agents The present invention features anti-sFLT1 RNA silencing agents (e.g., siRNAs and shRNAs), methods of making such RNA silencing agents, and methods (e.g., research and / or therapeutic methods) for using the improved RNA silencing agents (or portions thereof) for RNA silencing of one or more sFLT1 proteins. The RNA silencing agents include an antisense strand (or portion thereof), where the antisense strand has sufficient complementarity to a heterozygous single nucleotide polymorphism to mediate an RNA-mediated silencing mechanism (e.g., RNAi).

[0194] a) Design of anti-sFlt1 siRNA molecules The siRNA molecules of the present invention are duplexes consisting of a sense strand and a complementary antisense strand, the antisense strand being sufficiently complementary to sFLT1 mRNA to mediate RNAi. Preferably, the siRNA molecules are about 10-50 or more nucleotides in length, i.e., each strand contains 10-50 nucleotides (or nucleotide analogs). More preferably, the siRNA molecules have each strand about 16-30 nucleotides in length, e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, where one of the strands is sufficiently complementary to the target region. Preferably, the strands are sequenced so that at least one, two, or three bases are present at the end of the strand that is not aligned (i.e., no complementary base occurs in the opposing strand). This results in an overhang of one, two, or three residues at one or both ends of the duplex when the strands are annealed. Preferably, the siRNA molecule has a length of about 10 to 50 or more nucleotides, i.e., each strand contains 10 to 50 nucleotides (or nucleotide analogs). More preferably, the siRNA molecule has a length of about 16 to 30, e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, nucleotides in each strand, wherein one strand is substantially complementary to the target sequence and the other strand is identical or substantially identical to the first strand.

[0195] Generally, siRNAs can be designed using any method known in the art, for example, using the following protocol: 1. The siRNA should be specific for a target sequence, e.g., a target sequence. In one embodiment, the target sequence is found in soluble Flt1 mRNA but not in full-length Flt mRNA. In another embodiment, the target sequence is found in both soluble Flt1 mRNA and full-length Flt mRNA. In another embodiment, the target sequence is found in full-length Flt mRNA. The first strand should be complementary to the target sequence, and the other strand is substantially complementary to the first strand. In one embodiment, the target sequence is encoded in an intron region of one or more soluble Flt mRNA sequences. Exemplary target sequences correspond to one or more intron regions of the target gene. Cleavage of the mRNA at these sites should eliminate translation of the corresponding soluble protein, but not of the full-length protein. Target sequences from other regions of the flt gene are also suitable for targeting. The sense strand is designed based on the target sequence. Furthermore, siRNAs with lower G / C content (35-55%) may be more active than siRNAs with a G / C content higher than 55%. Thus, in one embodiment, the present invention includes nucleic acid molecules with a G / C content of 35-55%.

[0196] 2. The sense strand of the siRNA is designed based on the sequence of the selected target site. Preferably, the sense strand contains approximately 19 to 25 nucleotides, e.g., 19, 20, 21, 22, 23, 24, or 25 nucleotides. More preferably, the sense strand contains 21, 22, or 23 nucleotides. In some embodiments, the sense strand contains 16 nucleotides. In some embodiments, the sense strand contains 17 nucleotides. In some embodiments, the sense strand contains 18 nucleotides. In some embodiments, the sense strand contains 19 nucleotides. In some embodiments, the sense strand contains 20 nucleotides. In some embodiments, the sense strand contains 21 nucleotides. In some embodiments, the sense strand contains 22 nucleotides. In some embodiments, the sense strand contains 23 nucleotides. However, those skilled in the art will understand that siRNAs less than 19 nucleotides or more than 25 nucleotides in length can also function to mediate RNAi. Therefore, siRNAs of such lengths are also within the scope of the present invention as long as they retain the ability to mediate RNAi. Although it has been demonstrated that longer RNA silencing agents induce interferon or protein kinase R (PKR) response in certain mammalian cells, this may be undesirable.Preferably, the RNA silencing agent of the present invention does not induce PKR response (i.e., it is of sufficiently short length).However, longer RNA silencing agents may be useful, for example, in the cell type that cannot generate PRK response, or in the situation where PKR response is downregulated or suppressed by alternative means.

[0197] The siRNA molecule of the present invention has sufficient complementarity with the target sequence so that the siRNA can mediate RNAi. Generally, it is preferred that the siRNA containing a nucleotide sequence that is sufficiently identical to the target sequence portion of the target gene can cause RISC-mediated cleavage of the target gene. Therefore, in a preferred embodiment, the sense strand of the siRNA is designed to have a sequence that is sufficiently identical to a portion of the target. For example, the sense strand can have 100% identity to the target site. However, it does not need to be 100% identical. Between the sense strand and the target RNA sequence, more than 80% identity is preferred, for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or even 100% identity. The present disclosure has the advantage that it can tolerate certain sequence modifications to increase the efficiency and specificity of RNAi. In one embodiment, the sense strand has 4, 3, 2, 1, or 0 mismatched nucleotides with the target region, such as a target region that differs by at least one base pair between soluble flt1 and full-length flt1 alleles. For example, the target region contains a gain-of-function mutation, and the other strand is identical or substantially identical to the first strand. Furthermore, siRNA sequences with small insertions or deletions of 1 or 2 nucleotides can also be effective in mediating RNAi. Alternatively, siRNA sequences with substitutions or insertions of nucleotide analogs can be effective in inhibiting.

[0198] Sequence identity can be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences (or two amino acid sequences), the sequences are aligned for optimal comparison (e.g., gaps can be introduced into the first or second sequence for optimal alignment). The nucleotides (or amino acid residues) at corresponding nucleotide (or amino acid) positions are then compared. If a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences corresponds to the number of identical positions shared by the sequences (i.e., % homology = number of identical positions / total number of positions x 100), optionally penalizing the score for the number of gaps introduced and / or the length of the introduced gaps.

[0199] Comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, alignment is generated for specific portions of the aligned sequences that have sufficient identity, but not for portions with a lower degree of identity (i.e., local alignment). A preferred, non-limiting example of a local alignment algorithm utilized for sequence comparison is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, revised Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the BLAST program (version 2.0), Altschul, et al. (1990) J. Mol. Biol. 215:403-10.

[0200] In another embodiment, the alignment is optimized by introducing appropriate gaps, and percent identity is determined over the length of the aligned sequences (i.e., a gapped alignment). To obtain gapped alignments for comparison purposes, Gapped BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402. In another embodiment, the alignment is optimized by introducing appropriate gaps, and percent identity is determined over the entire length of the aligned sequences (i.e., a global alignment). A preferred, non-limiting example of a mathematical algorithm utilized for global comparison of sequences is the Myers and Miller algorithm, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program to compare amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0201] 3. The antisense or guide strand of an siRNA is routinely the same length as the sense strand and contains complementary nucleotides. In some embodiments, the antisense or guide strand is longer than the sense strand. In some embodiments, the antisense or guide strand is shorter than the sense strand. In some embodiments, the antisense or guide strand contains about 19-25 nucleotides, e.g., 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the antisense or guide strand contains 21, 22, or 23 nucleotides. In some embodiments, the antisense or guide strand contains 16 nucleotides in length. In some embodiments, the antisense or guide strand contains 17 nucleotides in length. In some embodiments, the antisense or guide strand contains 18 nucleotides in length. In some embodiments, the antisense or guide strand contains 19 nucleotides in length. In some embodiments, the antisense or guide strand contains 20 nucleotides in length. In some embodiments, the antisense or guide strand contains 21 nucleotides in length. In some embodiments, the antisense or guide strand contains 22 nucleotides in length. In some embodiments, the antisense strand or guide strand comprises 23 nucleotides in length.

[0202] In one embodiment, the guide strand and the sense strand are perfectly complementary. That is, the strands are blunt-ended when aligned or annealed. In another embodiment, the strands of the siRNA can be paired to have a 3' overhang of 1 to 4, e.g., 2, nucleotides. In some embodiments, the 3' overhang is 1 nucleotide. In some embodiments, the 3' overhang is 2 nucleotides. In some embodiments, the 3' overhang is 3 nucleotides. In some embodiments, the 3' overhang is 4 nucleotides. In some embodiments, the 3' overhang is 5 nucleotides. The overhang can comprise (or consist of) nucleotides corresponding to the target gene sequence (or its complement). Alternatively, the overhang can comprise (or consist of) deoxyribonucleotides, such as dT, or nucleotide analogs, or other suitable non-nucleotide material. Thus, in another embodiment, the nucleic acid molecule can have a 2-nucleotide 3' overhang, such as TT. The overhang nucleotides can be either RNA or DNA. As noted above, it is desirable to select a target region in which the mutant:wild-type mismatch is a purine:purine mismatch.

[0203] 4. Using any method known in the art, compare potential targets to an appropriate genome database (human, mouse, rat, etc.) to eliminate the need to consider any target sequences that have significant homology to other coding sequences. One such method of sequence homology searching is known as BLAST and is available on the National Center for Biotechnology Information website.

[0204] 5. Select one or more sequences that meet the evaluation criteria. General information regarding the design and use of siRNAs can be found in "The siRNA User Guide," available on the website of The Max-Plank-Institut fur Biophysikalishe Chemie.

[0205] Alternatively, siRNA can be functionally defined as a nucleotide sequence (or oligonucleotide sequence) capable of hybridizing with a target sequence (e.g., hybridizing with 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA at 50°C or 70°C for 12-16 hours, followed by washing). Additional preferred hybridization conditions include hybridization at 1x SSC at 70°C or 1x SSC at 50°C and 50% formamide, followed by washing at 0.3x SSC at 70°C, or hybridization at 4x SSC at 70°C or 4x SSC at 50°C and 50% formamide, followed by washing at 1x SSC at 67°C. The hybridization temperature for hybrids predicted to be less than 50 base pairs in length should be 5-10°C lower than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following formula: For hybrids less than 18 base pairs in length, Tm (°C) = 2(# A+T bases) + 4(# G+C bases). For hybrids 18-49 base pairs in length, Tm (°C) = 81.5 + 16.6(log10[Na+]) + 0.41(% G+C) - (600 / N), where N is the number of bases in the hybrid and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] = 0.165M in 1x SSC). Additional examples of stringency conditions for polynucleotide hybridization are described in Sambrook, J., E.F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, chapters 9 and 11, and Current Protocols in Molecular Biology, 1995, F.M.Ausubel et al., eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4, which are incorporated herein by reference.

[0206] Negative control siRNA shall have the same nucleotide composition as selected siRNA, but there is no significant sequence complementarity with suitable genome.Such negative control can be designed by randomly scrambling the nucleotide sequence of selected siRNA.Homology search can be carried out to confirm that negative control lacks the homology with any other gene in suitable genome.In addition, negative control siRNA can be designed by introducing one or more base mismatches into sequence.

[0207] 6. To verify the effectiveness of siRNA in disrupting target mRNA (e.g., sFLT1 mRNA corresponding to soluble FLT1), siRNA can be incubated with target cDNA (e.g., flt1 cDNA) in a Drosophila-based in vitro mRNA expression system. 32 Newly synthesized target mRNA (e.g., sFlt1 mRNA) radioactively labeled with P is detected by autoradiography on an agarose gel. The presence of cleaved target mRNA indicates mRNA nuclease activity. Suitable controls include omitting the siRNA and using a non-targeting cDNA. Alternatively, a control siRNA is selected that has the same nucleotide composition as the selected siRNA but does not have significant sequence complementarity to the appropriate target gene. Such a negative control can be designed by randomly scrambling the nucleotide sequence of the selected siRNA. A homology search can be performed to confirm that the negative control lacks homology with any other genes in the appropriate genome. Furthermore, a negative control siRNA can be designed by introducing one or more base mismatches into the sequence.

[0208] Anti-sflt1 siRNA can be designed to target any of the above-mentioned target sequences.The siRNA comprises the antisense strand that is sufficiently complementary with the target sequence to mediate the silencing of the target sequence.In certain embodiments, the RNA silencing agent is siRNA.

[0209] The siRNA-mRNA complementary site that results in optimal mRNA specificity and maximal mRNA cleavage is selected.

[0210] b) siRNA-like molecules The siRNA-like molecules of the present invention have a sequence that is "sufficiently complementary" to the target sequence of sflt1 mRNA (i.e., have a strand with a sequence) to direct gene silencing by RNAi or translational repression. siRNA-like molecules are designed in the same manner as siRNA molecules, but the degree of sequence identity between the sense strand and the target RNA approximates that observed between the miRNA and its target. Generally, as the degree of sequence identity between the miRNA sequence and the corresponding target gene sequence decreases, the likelihood of post-transcriptional gene silencing being mediated by translational repression rather than RNAi increases. Therefore, in another embodiment where post-transcriptional gene silencing by translational repression of the target gene is desired, the miRNA sequence has partial complementarity with the target gene sequence. In certain embodiments, the miRNA sequence has partial complementarity with one or more short sequences (complementary sites) dispersed within the target mRNA (e.g., within the 3'UTR of the target mRNA) (Hutvagner and Zamore, Science, 2002; Zeng et al., Mol. Cell, 2002; Zeng et al., RNA, 2003; Doench et al., Genes & Dev., 2003). Because the mechanism of translational repression is cooperative, certain embodiments may target multiple complementary sites (e.g., 2, 3, 4, 5, or 6).

[0211] The ability of an siRNA-like duplex to mediate RNAi or translational repression can be predicted by the distribution of non-identical nucleotides between the target gene sequence and the nucleotide sequence of the silencing agent at the complementary site. In one embodiment where gene silencing by translational repression is desired, at least one non-identical nucleotide is present in the central portion of the complementary site so that the duplex formed by the miRNA guide strand and the target mRNA contains a central "bulge" (Doench JG et al., Genes & Dev., 2003). In another embodiment, 2, 3, 4, 5, or 6 consecutive or non-consecutive non-identical nucleotides are introduced. The non-identical nucleotides can be selected to form wobble base pairs (e.g., G:U) or mismatch base pairs (G:A, C:A, C:U, G:G, A:A, C:C, U:U). In a more preferred embodiment, the "bulge" is centered at nucleotides 12 and 13 from the 5' end of the miRNA molecule.

[0212] c) Short hairpin RNA (shRNA) molecules In a particular characteristic embodiment, the present invention provides shRNA that can mediate the RNA silencing of sFlt1 target sequence with high selectivity.In contrast to siRNA, shRNA mimics the natural precursor of microRNA (miRNA) and enters the top of gene silencing pathway.Therefore, shRNA is believed to mediate gene silencing more efficiently by being delivered through the entire natural gene silencing pathway.

[0213] miRNAs are approximately 22-nucleotide non-coding RNAs that can regulate gene expression at the post-transcriptional or translational level during plant and animal development. One common feature of miRNAs is that they are all excised from a precursor RNA stem-loop of approximately 70 nucleotides, referred to as the pre-miRNA, presumably by the RNase III enzyme Dicer or its homologs. Naturally occurring miRNA precursors (pre-miRNAs) generally have a single strand that forms a double-stranded stem containing two complementary portions and a loop connecting the two portions of the stem. In a typical pre-miRNA, the stem contains one or more bulges, e.g., extra nucleotides that create a single-nucleotide "loop" within a portion of the stem, and / or one or more unpaired nucleotides that create a gap in the hybridization of the two portions of the stem to each other. The short hairpin RNAs or engineered RNA precursors of the present invention are artificial constructs based on these naturally occurring pre-miRNAs but are engineered to deliver a desired RNA silencing agent (e.g., an siRNA of the present invention). By replacing the stem sequence of the pre-miRNA with a sequence complementary to the target mRNA, an shRNA is formed, which is processed through the entire cellular gene silencing pathway, thereby efficiently mediating RNAi.

[0214] The necessary elements of an shRNA molecule include a first and a second portion that are sufficiently complementary to anneal or hybridize to form a duplex or double-stranded stem portion. The two portions do not need to be completely or perfectly complementary. The first and second "stem" portions are connected by a portion whose sequence does not have sufficient sequence complementarity to anneal or hybridize to other portions of the shRNA. This latter portion is referred to as the "loop" portion within the shRNA molecule. The shRNA molecule is processed to generate siRNA. The shRNA can also contain one or more bulges, i.e., extra nucleotides that create small nucleotide "loops" in a portion of the stem, e.g., a 1-, 2-, or 3-nucleotide loop. The stem portions can be the same length, or some can include overhangs, e.g., 1- to 5-nucleotide overhangs. The overhanging nucleotides can include, for example, uracils (U), e.g., all Us. Such Us are specifically encoded by thymidines (T) within the shRNA-encoding DNA, which signal the termination of transcription.

[0215] In the shRNA (or engineered precursor RNA) of the present invention, a portion of the double-stranded stem is a nucleic acid sequence complementary (or antisense) to the sFlt1 target sequence. Preferably, one strand of the stem portion of the shRNA is sufficiently complementary (e.g., antisense) to the target RNA (e.g., mRNA) sequence to mediate degradation or cleavage of the target RNA via RNA interference (RNAi). Thus, the engineered RNA precursor comprises a two-part double stem and a loop connecting the two stem portions. The antisense portion can be at the 5' or 3' end of the stem. The stem portion of the shRNA is preferably about 15 to about 50 nucleotides in length. Preferably, the two stem portions are about 18 or 19 to about 21, 22, 23, 24, 25, 30, 35, 37, 38, 39, or 40 or more nucleotides in length. In a preferred embodiment, the length of the stem portion is 21 nucleotides or more. When used in mammalian cells, the length of the stem portion should be less than about 30 nucleotides to avoid eliciting non-specific responses such as the interferon pathway. In non-mammalian cells, the stem may be longer than 30 nucleotides. In fact, the stem may include a much larger section (up to and including the entire mRNA) that is complementary to the target mRNA. In fact, the stem portion may include a much larger section (up to and including the entire mRNA) that is complementary to the target mRNA.

[0216] The two portions of the double stem must be sufficiently complementary to hybridize and form a double stem. Thus, the two portions can be, but do not need to be, completely or perfectly complementary. Furthermore, the two stem portions can be the same length, or one portion can include an overhang of 1, 2, 3, or 4 nucleotides. The overhanging nucleotides can include, for example, uracil (U), e.g., all U. The loop in the shRNA or engineered RNA precursor can differ from the natural pre-miRNA sequence by modifying the loop sequence to increase or decrease the number of paired nucleotides, or by replacing all or part of the loop sequence with a tetraloop or other loop sequence. Thus, the loop in the shRNA or engineered RNA precursor can be 2, 3, 4, 5, 6, 7, 8, 9, or more nucleotides long, for example, 15 or 20 or more nucleotides long.

[0217] The loop in an shRNA or engineered RNA precursor can differ from the native pre-miRNA sequence by modifying the loop sequence to increase or decrease the number of paired nucleotides, or by replacing all or part of the loop sequence with a tetraloop or other loop sequence. Thus, the loop portion in an shRNA can be about 2 to about 20 nucleotides in length, i.e., about 2, 3, 4, 5, 6, 7, 8, 9, or more nucleotides, e.g., 15 or 20 nucleotides or more. One preferred loop consists of or includes a "tetraloop" sequence. Exemplary tetraloop sequences include, but are not limited to, the sequences GNRA (where N is any nucleotide and R is a purine nucleotide), GGGG, and UUUU.

[0218] In certain embodiments, the shRNA of the present invention comprises the sequence of the desired siRNA molecule described above. In other embodiments, the sequence of the antisense portion of the shRNA can be designed essentially as described above, or generally by selecting an 18, 19, 20, 21, or longer sequence from within the target RNA (e.g., sflt1 mRNA), for example, from a region 100 to 200 or 300 nucleotides upstream or downstream of the translation start point. Generally, the sequence can be selected from any portion of the target RNA (e.g., mRNA), such as an intron region, 5' untranslated region (UTR), coding sequence, or 3' UTR, provided that the portion is distant from the site of a gain-of-function mutation. This sequence can optionally immediately follow a region of the target gene containing two adjacent AA nucleotides. The last two nucleotides of the nucleotide sequence can be selected to be UU. This approximately 21-nucleotide sequence is used to generate a portion of the double-stranded stem of the shRNA. This sequence can replace the stem portion of the wild-type pre-miRNA sequence, e.g., enzymatically, or be included in the complete sequence that is synthesized. For example, an engineered RNA precursor construct can be constructed, e.g., from the wild-type pre-miRNA, by synthesizing a DNA oligonucleotide that encodes the entire stem-loop engineered RNA precursor or only the portion to be inserted into the double-stranded stem of the precursor, and using restriction enzymes.

[0219] The engineered RNA precursor contains, in its duplex stem, approximately 21–22 nucleotides of the siRNA or siRNA-like duplex desired to be produced in vivo. Thus, the stem portion of the engineered RNA precursor contains at least 18 or 19 nucleotide pairs corresponding to the sequence of an exon of the gene whose expression is to be reduced or inhibited. The two 3′ nucleotides flanking this region of the stem are selected to maximize siRNA production from the engineered RNA precursor and to maximize the efficacy of the resulting siRNA in targeting the corresponding mRNA for translational repression or disruption by RNAi in vivo and in vitro.

[0220] In certain embodiments, the shRNA of the present invention comprises an miRNA sequence, optionally a terminally modified miRNA sequence, to enhance entry into RISC. The miRNA sequence can be similar or identical to the sequence of any naturally occurring miRNA (e.g., The miRNA Registry; Griffiths-Jones S, Nuc. Acids Res., 2004). To date, more than 1,000 naturally occurring miRNAs have been identified, which together are thought to comprise approximately 1% of all predicted genes in the genome. Many natural miRNAs are clustered together within the introns of pre-mRNAs and can be identified in silico using homology-based searches (Pasquinelli et al., 2000; Lagos-Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001) or computer algorithms that predict the ability of candidate miRNA genes to form stem-loop structures in pre-mRNAs (e.g., MiRScan, MiRSeeker) (Grad et al., Mol. Cell., 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003; Lai EC et al., Genome Bio., 2003). Online registries provide searchable databases of all publicly available miRNA sequences (The miRNA Registry, Sanger Institute website; Griffiths-Jones S, Nuc. Acids Res., 2004).Exemplary naturally occurring miRNAs include lin-4, let-7, miR-10, miR-15, miR-16, miR-168, miR-175, miR-196 and their homologs, as well as other naturally occurring miRNAs from humans and certain model organisms, such as Drosophila melanogaster, Caenorhabditis elegans, zebrafish, Arabidopsis thalania, Mus musculus, and Rattus norvegicus (described in PCT International Publication No. WO 03 / 029459).

[0221] Naturally occurring miRNAs are expressed by endogenous genes in vivo and processed by Dicer or other RNAses from hairpin or stem-loop precursors (pre-miRNAs or pri-miRNAs) (Lagos-Quintana et al., Science, 2001; Lau et al., Science, 2001; Lee and Ambros, Science, 2001; Lagos-Quintana et al., Curr. Biol., 2002; Mourelatos et al., Genes Dev., 2002; Reinhart et al., Science, 2002; Ambros et al., Curr. Biol., 2003; Brennecke et al., 2003; Lagos-Quintana et al., RNA, 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003). Although miRNAs can exist transiently in vivo as double-stranded duplexes, only one strand is incorporated into the RISC complex to direct gene silencing. Certain miRNAs, such as plant miRNAs, have perfect or near-perfect complementarity to their target mRNAs, directly cleaving the target mRNA. Other miRNAs have less-than-perfect complementarity to their target mRNAs, directly suppressing the translation of the target mRNA. The degree of complementarity between a miRNA and its target mRNA is thought to determine its mechanism of action. For example, perfect or near-perfect complementarity between a miRNA and its target mRNA predicts a cleavage mechanism (Yekta et al., Science, 2004), while less-than-perfect complementarity predicts a translational repression mechanism. In certain embodiments, the miRNA sequence is that of a naturally occurring miRNA whose abnormal expression or activity is correlated with a miRNA disorder.

[0222] d) Dual-functional oligonucleotide anchoring factors In another embodiment, the RNA silencing agent of the present invention comprises a bifunctional oligonucleotide tethering factor useful for intercellular recruitment of miRNA. Animal cells express a series of miRNAs, approximately 22-nucleotide non-coding RNAs that can regulate gene expression at the post-transcriptional or translational level. The bifunctional oligonucleotide tethering factor can bind RISC-bound miRNAs and recruit them to target mRNAs, thereby suppressing the expression of genes involved in, for example, the atherosclerotic process. The use of oligonucleotide tethering factors offers several advantages over existing techniques for suppressing the expression of specific genes. First, the methods described herein enable endogenous molecules (often abundant), such as miRNAs, to mediate RNA silencing. Thus, the methods described herein eliminate the need to introduce exogenous molecules (e.g., siRNAs) to mediate RNA silencing. Second, the RNA silencing agent, and in particular the linking moiety (e.g., oligonucleotides, e.g., 2'-O-methyl oligonucleotides), can be stabilized and resistant to nuclease activity. As a result, the tethering factors of the present invention can be designed for direct delivery, eliminating the need for indirect delivery (e.g., viral) of precursor molecules or plasmids designed to produce the desired agent within cells. Third, the tethering factors and their respective moieties can be designed to match specific mRNA sites and specific miRNAs. The design can be specific to the cell and gene product. Fourth, the methods disclosed herein leave mRNA intact, allowing those skilled in the art to use the cell's own machinery to block protein synthesis in short pulses. As a result, these RNA silencing methods are highly tunable.

[0223] The dual-functional oligonucleotide tethering agents ("tethering agents") of the present invention are designed to recruit miRNAs (e.g., endogenous cellular miRNAs) to target mRNAs, leading to regulation of a gene of interest. In a preferred embodiment, the tethering agent has the formula TL-μ, where T is the mRNA-targeting moiety, L is the linking moiety, and μ is the miRNA-recruiting moiety. Any one or more of the moieties can be double-stranded. Preferably, however, each moiety is single-stranded.

[0224] The moieties within the tethering element can be positioned or linked (5' to 3' direction) as shown in the formula TL-μ (i.e., the 3' end of the targeting moiety linked to the 5' end of the linking moiety and the 3' end of the linking moiety linked to the 5' end of the miRNA recruitment moiety). Alternatively, the moieties can be positioned or linked within the tethering element as follows: μ-TL (i.e., the 3' end of the miRNA recruitment moiety is linked to the 5' end of the linking moiety, and the 3' end of the linking moiety is linked to the 5' end of the targeting moiety).

[0225] The mRNA targeting moieties described above are capable of capturing a specific target mRNA. According to the present invention, expression of the target mRNA is undesirable, and therefore translational repression of the mRNA is desired. The mRNA targeting moiety should be of a size sufficient to effectively bind to the target mRNA. The length of the targeting moiety can vary widely, depending in part on the length of the target mRNA and the degree of complementarity between the target mRNA and the targeting moiety. In various embodiments, the targeting moiety is less than about 200, 100, 50, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 nucleotides in length. In certain embodiments, the targeting moiety is about 15 to about 25 nucleotides in length.

[0226] As described above, the miRNA recruitment portion can associate with miRNA. According to the present invention, the miRNA can be any miRNA that can suppress target mRNA (for example, one or more sflt1 mRNAs). It has been reported that mammals have more than 250 endogenous miRNAs (Lagos-Quintana et al. (2002) Current Biol. 12:735-739; Lagos-Quintana et al. (2001) Science 294:858-862; and Lim et al. (2003) Science 299:1540). In various embodiments, the miRNA can be any miRNA recognized in the art.

[0227] Linking moiety is any agent that can link targeting moiety so that the activity of targeting moiety is maintained.Linking moiety is preferably an oligonucleotide moiety that contains a sufficient number of nucleotides so that targeting agent can sufficiently interact with each target.Linking moiety has little or no sequence homology with cellular mRNA or miRNA sequence.Exemplary linking moiety includes one or more 2'-O-methyl nucleotides, such as 2'-β-methyl adenosine, 2'-O-methyl thymidine, 2'-O-methyl guanosine or 2'-O-methyl uridine.

[0228] e) Gene Silencing Oligonucleotides In certain exemplary embodiments, gene expression (i.e., sflt1 gene expression) can be regulated using an oligonucleotide-based compound comprising two or more single-stranded antisense oligonucleotides linked via their 5' ends, allowing for the presence of two or more accessible 3' ends, to effectively inhibit or reduce sflt1 gene expression. Such linked oligonucleotides are also known as gene silencing oligonucleotides (GSOs). (See, e.g., U.S. Patent No. 8,431,544, assigned to Idera Pharmaceuticals, Inc., which is incorporated herein by reference in its entirety for all purposes.)

[0229] The linkage at the 5' end of the GSO is independent of other oligonucleotide linkages and can be direct via the 5', 3', or 2' hydroxyl group, or indirect via a non-nucleotide linker or nucleoside, using either the 2' or 3' hydroxyl position of the nucleoside. Linkage can also utilize a functionalized sugar or nucleobase on the 5'-terminal nucleotide.

[0230] GSOs can contain two identical or different sequences conjugated at their 5'-5' ends via phosphodiester, phosphorothioate, or non-nucleoside linkers. Such compounds can contain 15-27 nucleotides complementary to a specific portion of an mRNA target of interest for antisense downregulation of gene products. GSOs containing identical sequences can bind to specific mRNAs through Watson-Crick hydrogen bonding interactions and inhibit protein expression. GSOs containing different sequences can bind to two or more distinct regions of one or more mRNA targets and inhibit protein expression. Such compounds are composed of heteronucleotide sequences complementary to the target mRNA, forming a stable duplex structure through Watson-Crick hydrogen bonding. Under certain conditions, GSOs containing two free 3' ends (5'-5' attached antisense) can be more potent inhibitors of gene expression than those with a single free 3' end or no free 3' ends.

[0231] In some embodiments, the non-nucleotidic linker is glycerol or a group of formula HO—(CH) o --CH(OH)--(CH2) p --OH, where o and p are independently integers from 1 to about 6, from 1 to about 4, or from 1 to about 3. In some other embodiments, the non-nucleotidic linker is a derivative of 1,3-diamino-2-hydroxypropane. Some such derivatives have the formula HO--(CH2)m--C(O)NH--CH2--CH(OH)--CH2--NHC(O)--(CH2) m --OH, where m is an integer from 0 to about 10, 0 to about 6, 2 to about 6, or 2 to about 4.

[0232] Some non-nucleotide linkers allow for the attachment of three or more GSO moieties.For example, the non-nucleotide linker glycerol has three hydroxyl groups to which GSO moieties can be covalently attached.Therefore, some oligonucleotide-based compounds of the present invention comprise two or more oligonucleotides linked to nucleotide or non-nucleotide linkers.Such oligonucleotides according to the present invention are called "branched".

[0233] In certain embodiments, the GSO is at least 14 nucleotides in length. In certain exemplary embodiments, the GSO is 15-40 nucleotides in length or 20-30 nucleotides in length. Thus, the component oligonucleotides of the GSO can independently be 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length.

[0234] These oligonucleotides can be prepared by art-recognized methods, such as phosphoramidate or H-phosphonate chemistry, which can be performed manually or by an automated synthesizer. These oligonucleotides can also be modified in multiple ways without impairing their ability to hybridize to mRNA. Such modifications can include at least one internucleotide linkage between the 5'-end of one nucleotide and the 3'-end of another nucleotide that is alkyl phosphonate, phosphorothioate, phosphorodithioate, methyl phosphonate, phosphate ester, alkyl phosphonothioate, phosphoramidate, carbamate, carbonate, phosphate hydroxyl, acetamidate, or carboxymethyl ester, or a combination of these and other internucleotide linkages, where the phosphodiester linkage of the 5'-nucleotide is replaced with any number of chemical groups.

[0235] IV. Modified anti-sFlt1 RNA silencing agents In certain embodiments of the present invention, the RNA silencing agent of the present invention (or any part thereof) can be modified as described above to further improve the activity of the agent. For example, the RNA silencing agent described herein can be modified with any of the modifications described below. Modifications can act, in part, to further improve target discrimination, improve the stability of the agent (e.g., to prevent degradation), promote cellular uptake, improve targeting efficiency, improve binding (e.g., to the target) effectiveness, improve patient tolerance to the agent, and / or reduce toxicity.

[0236] In certain embodiments, siRNA compounds are provided that have one or any combination of the following properties: (1) are fully chemically stabilized (i.e., have no unmodified 2'-OH residues); (2) are asymmetric; (3) are 11-16 base pair duplexes; (4) have an alternating pattern of chemically modified nucleotides (e.g., 2'-fluoro and 2'-methoxy modifications) or a 2'-methoxy-rich pattern (greater than 50% 2'-methoxy in the antisense strand and greater than 65% 2'-methoxy in the sense strand); or (5) have a 5-8 base single-stranded, fully phosphorothioated tail. The number of phosphorothioate modifications varies in different embodiments, from 6 to 17 total.

[0237] Certain compounds of the present invention having the structural characteristics described above and herein may be referred to as "hsiRNA-ASP" (hydrophobically modified small interfering RNA characterized by a highly stabilizing pattern). Furthermore, this hsiRNA-ASP pattern has shown dramatically improved distribution via delivery from the brain and spinal cord to the liver, placenta, kidney, spleen, and several other tissues, making it available for therapeutic intervention.

[0238] The specific delivery of hsiRNA-ASP in the liver to endothelial and Kupffer cells, but not to hepatocytes, makes this chemical modification pattern a complementary, rather than competitive, technique to GalNac conjugates.

[0239] The compounds of the present disclosure can be described in the following aspects and embodiments.

[0240] In a first aspect, the present specification provides a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modifications; and (4) any one or more of nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains at least 65% 2'-O-methyl modifications; (9) one or more of the nucleotides 4, 6, 8, 10, and 14 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; (10) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0241] In an embodiment of the first aspect of the present disclosure, the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides, and the nucleotides at positions 4, 6, 8, 10, and 14 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides.

[0242] In an embodiment of the first aspect of the present disclosure, the antisense strand is 21 nucleotides in length and the sense strand is 16 nucleotides in length.

[0243] In an embodiment of the first aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAAAUUUGGAGAUCCGAGAGA3', and the sense strand comprises the nucleic acid sequence of 5'CGGAUCUCCAAAUUUA3'.

[0244] In an embodiment of the first aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAUAAAUGGUAGCUAUGAUGA3', and the sense strand comprises the nucleic acid sequence of 5'AUAGCUACCAUUUAUA3'.

[0245] In an embodiment of the first aspect of the present disclosure, the antisense strand comprises a 5' vinyl phosphonate.

[0246] In a second aspect, the present specification provides a double-stranded RNA (dsRNA), the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; and (3) the 5' end of the antisense strand is (4) the nucleotides at positions 1-2 through 1-7 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (5) a portion of the antisense strand is complementary to a portion of the sense strand; (6) the sense strand contains alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; and (7) the nucleotides at positions 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0247] In an embodiment of the second aspect of the present disclosure, the antisense strand is 21 nucleotides in length and the sense strand is 16 nucleotides in length.

[0248] In an embodiment of the second aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAAAUUUGGAGAUCCGAGAGA3', and the sense strand comprises the nucleic acid sequence of 5'CGGAUCUCCAAAUUUA3'.

[0249] In an embodiment of the second aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAUAAAUGGUAGCUAUGAUGA3', and the sense strand comprises the nucleic acid sequence of 5'AUAGCUACCAUUUAUA3'.

[0250] In an embodiment of the second aspect of the present disclosure, the antisense strand comprises a 5' vinyl phosphonate.

[0251] In a third aspect, provided herein is a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modifications; and (4) any one or more nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 from the 5' end of the antisense strand. (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains at least 80% 2'-O-methyl modifications; (9) one or more of the nucleotides 7, 9, and 11 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; and (10) the nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0252] In an embodiment of the third aspect of the present disclosure, the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides, and the nucleotides at positions 7, 9, and 11 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides.

[0253] In an embodiment of the third aspect of the present disclosure, the antisense strand is 21 nucleotides in length and the sense strand is 16 nucleotides in length.

[0254] In an embodiment of the third aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAAAUUUGGAGAUCCGAGAGA3', and the sense strand comprises the nucleic acid sequence of 5'CGGAUCUCCAAAUUUA3'.

[0255] In an embodiment of the third aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAUAAAUGGUAGCUAUGAUGA3', and the sense strand comprises the nucleic acid sequence of 5'AUAGCUACCAUUUAUA3'.

[0256] In an embodiment of the third aspect of the present disclosure, the antisense strand comprises a 5' vinyl phosphonate.

[0257] In a fourth aspect, provided herein is a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 70% 2'-O-methyl modifications; (4) positions 2, 4, and 5' from the 5' end of the antisense strand are at least 20 nucleotides in length; (5) any one or more nucleotides at positions 5, 6, 8, and 14 are not 2'-methoxy-ribonucleotides; (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains 100% 2'-O-methyl modifications; and (9) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0258] In an embodiment of the fourth aspect of the present disclosure, the nucleotides at positions 2, 4, 5, 6, 8, and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides.

[0259] In an embodiment of the fourth aspect of the present disclosure, the antisense strand is 21 nucleotides in length and the sense strand is 16 nucleotides in length.

[0260] In an embodiment of the fourth aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAAAUUUGGAGAUCCGAGAGA3', and the sense strand comprises the nucleic acid sequence of 5'CGGAUCUCCAAAUUUA3'.

[0261] In an embodiment of the fourth aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAUAAAUGGUAGCUAUGAUGA3', and the sense strand comprises the nucleic acid sequence of 5'AUAGCUACCAUUUAUA3'.

[0262] In an embodiment of the fourth aspect of the present disclosure, the antisense strand comprises a 5' vinyl phosphonate.

[0263] In a fifth aspect, provided herein is a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 75% 2'-O-methyl modifications; and (4) positions 2, 4, and 6 from the 5' end of the antisense strand are substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2). (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains 100% 2'-O-methyl modifications; and (9) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0264] In an embodiment of the fifth aspect of the present disclosure, the nucleotides at positions 2, 4, 5, 6, and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides.

[0265] In an embodiment of the fifth aspect of the present disclosure, the antisense strand is 21 nucleotides in length and the sense strand is 16 nucleotides in length.

[0266] In an embodiment of the fifth aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAAAUUUGGAGAUCCGAGAGA3', and the sense strand comprises the nucleic acid sequence of 5'CGGAUCUCCAAAUUUA3'.

[0267] In an embodiment of the fifth aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAUAAAUGGUAGCUAUGAUGA3', and the sense strand comprises the nucleic acid sequence of 5'AUAGCUACCAUUUAUA3'.

[0268] In an embodiment of the fifth aspect of the present disclosure, the antisense strand comprises a 5' vinyl phosphonate.

[0269] In a sixth aspect, provided herein is a double-stranded RNA (dsRNA) molecule, the dsRNA comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein: (1) the antisense strand comprises a sequence substantially complementary to a nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 85% 2'-O-methyl modifications; and (4) from the 5' end of the antisense strand to (5) nucleotides 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains 100% 2'-O-methyl modifications; and (9) nucleotides 1-2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

[0270] In an embodiment of the sixth aspect of the present disclosure, the nucleotides at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides.

[0271] In an embodiment of the sixth aspect of the present disclosure, the antisense strand is 21 nucleotides in length and the sense strand is 16 nucleotides in length.

[0272] In an embodiment of the sixth aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAAAUUUGGAGAUCCGAGAGA3', and the sense strand comprises the nucleic acid sequence of 5'CGGAUCUCCAAAUUUA3'.

[0273] In an embodiment of the sixth aspect of the present disclosure, the antisense strand comprises the nucleic acid sequence of 5'UAUAAAUGGUAGCUAUGAUGA3', and the sense strand comprises the nucleic acid sequence of 5'AUAGCUACCAUUUAUA3'.

[0274] In an embodiment of the sixth aspect of the present disclosure, the antisense strand comprises a 5' vinyl phosphonate.

[0275] In an embodiment of any of the first to sixth aspects of the present disclosure, the 3' end of the sense strand is linked to PC-DCA (phosphocholine-docosanoic acid) via a C7 amino linker and a dTdT-cleavable linker.

[0276] 1) Modifications to improve target discrimination In certain embodiments, the RNA silencing agents of the present invention may be substituted with destabilizing nucleotides to improve single-nucleotide target discrimination (see U.S. Application No. 11 / 698,689, filed January 25, 2007, and U.S. Provisional Application No. 60 / 762,225, filed January 25, 2006, both of which are incorporated herein by reference). Such modifications may be sufficient to abolish the specificity of the RNA silencing agent for non-target mRNAs (e.g., wild-type mRNAs) without appreciably affecting the specificity of the RNA silencing agent for target mRNAs (e.g., gain-of-function mutant mRNAs).

[0277] In a preferred embodiment, the RNA silencing agent of the present invention is modified by introducing at least one universal nucleotide into its antisense strand. A universal nucleotide contains a base moiety that can indiscriminately base pair with any of the four conventional nucleotide bases (e.g., A, G, C, and U). Universal nucleotides are preferred because they have a relatively small effect on the stability of the RNA duplex or the duplex formed by the guide strand of the RNA silencing agent and the target mRNA. Exemplary universal nucleotides include those having an inosine or inosine-like base moiety selected from the group consisting of deoxyinosine (e.g., 2'-deoxyinosine), 7-deaza-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In certain preferred embodiments, the universal nucleotide is an inosine residue or a naturally occurring analogue thereof.

[0278] In certain embodiments, the RNA silencing agent of the present invention is modified by introducing at least one destabilizing nucleotide within 5 nucleotides of the specificity-determining nucleotide (i.e., the nucleotide that recognizes the disease-associated polymorphism). For example, the destabilizing nucleotide can be introduced within 5, 4, 3, 2, or 1 nucleotide of the specificity-determining nucleotide. In an exemplary embodiment, the destabilizing nucleotide is introduced three nucleotides away from the specificity-determining nucleotide (i.e., so that there are two stabilizing nucleotides between the destabilizing nucleotide and the specificity-determining nucleotide). In RNA silencing agents having two strands or strand portions (e.g., siRNA and shRNA), the destabilizing nucleotide can be introduced into the strand or strand portion that does not contain the specificity-determining nucleotide. In a preferred embodiment, the destabilizing nucleotide is introduced into the same strand or strand portion that contains the specificity-determining nucleotide.

[0279] 2) Modifications to increase efficacy and specificity In certain embodiments, the RNA silencing agent of the present invention can be modified according to asymmetric design rules to easily improve the effectiveness and specificity of mediating RNAi (see U.S. Patent Nos. 8,309,704, 7,750,144, 8,304,530, 8,329,892 and 8,309,705).This modification facilitates the antisense strand of siRNA (for example, the siRNA designed using the method of the present invention, or the siRNA produced from shRNA) to enter RISC in favor of the sense strand.This allows the antisense strand to preferentially induce the cleavage or translational suppression of target mRNA, thereby increasing or improving the efficiency of target cleavage and silencing. Preferably, the asymmetry of the RNA silencing agent is improved by decreasing the base pairing strength between the 5' end of the antisense strand (AS5') and the 3' end of the sense strand (S3') of the RNA silencing agent relative to the binding strength or base pairing strength between the 3' end of the antisense strand (AS3') and the 5' end of the sense strand (S'5) of the RNA silencing agent.

[0280] In one embodiment, the asymmetry of the RNA silencing agent of the present invention can be improved so that there are fewer G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the sense strand portion than there are G:C base pairs between the 3' end of the first or antisense strand and the 5' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present invention can be improved so that there is at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. Preferably, the mismatched base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C, and U:U. In another embodiment, the asymmetry of the RNA silencing agent of the present invention can be improved so that there is at least one wobble base pair, for example, G:U, between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. In another embodiment, the asymmetry of the RNA silencing agent of the present invention can be improved by the presence of at least one base pair containing a rare nucleotide, such as inosine (I). Preferably, the base pair is selected from the group consisting of I:A, I:U, and I:C. In yet another embodiment, the asymmetry of the RNA silencing agent of the present invention can be improved by the presence of at least one base pair containing a modified nucleotide. In a preferred embodiment, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G, and 2,6-diamino-A.

[0281] 3) RNA silencing agents with improved stability The RNA silencing agent of the present invention can be modified to improve stability in serum or cell culture medium.To improve stability, 3'-residue can be stabilized against degradation, and can be selected to be composed of purine nucleotides, such as adenosine or guanosine nucleotides.Alternatively, the substitution of pyrimidine nucleotides with modified analogs, for example, the substitution of uridine with 2'-deoxythymidine, can be tolerated and does not affect the efficiency of RNA interference.

[0282] In a preferred aspect, the present invention features an RNA silencing agent comprising a first and a second strand, wherein the second strand and / or the first strand is modified by substituting an internal nucleotide with a modified nucleotide to enhance in vivo stability compared to the corresponding unmodified RNA silencing agent. As defined herein, an "internal" nucleotide is one that is present at any position other than the 5' or 3' end of a nucleic acid molecule, polynucleotide, or oligonucleotide. The internal nucleotide may be within a single-stranded molecule or within a strand of a double-stranded or duplex molecule. In one embodiment, the sense strand and / or antisense strand is modified by substituting at least one internal nucleotide. In another embodiment, the sense strand and / or antisense strand is modified by substituting at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more internal nucleotides. In another embodiment, the sense and / or antisense strands are modified by substitution of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of their internal nucleotides, hi yet another embodiment, the sense and / or antisense strands are modified by substitution of all of their internal nucleotides.

[0283] In some embodiments, the sense strand is modified by substitution of at least 50% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 55% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 60% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 65% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 70% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 75% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 80% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 85% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 90% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 95% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 96% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 97% of internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 98% of the internal nucleotides. In some embodiments, the sense strand is modified by substitution of at least 99% of the internal nucleotides. In some embodiments, the sense strand is modified by substitution of 100% of the internal nucleotides.

[0284] In some embodiments, the antisense strand is modified by substitution of at least 50% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 55% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 60% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 65% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 70% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 75% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 80% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 85% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 90% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 95% of internal nucleotides. In some embodiments, the antisense strand is modified by substitution of at least 96% of internal nucleotides. In some embodiments, the antisense strand is modified by substituting at least 97% of its internal nucleotides. In some embodiments, the antisense strand is modified by substituting at least 98% of its internal nucleotides. In some embodiments, the antisense strand is modified by substituting at least 99% of its internal nucleotides. In some embodiments, the antisense strand is modified by substituting 100% of its internal nucleotides.

[0285] In a preferred embodiment of the present invention, RNA silencing agent can comprise at least one modified nucleotide analogue.One or more nucleotide analogues can be located at the position where target-specific silencing activity, such as RNAi-mediated activity or translational repression activity, does not substantially occur, for example, at the 5'-end and / or 3'-end of siRNA molecule.In particular, by incorporating modified nucleotide analogues, end can be stabilized.

[0286] Exemplary nucleotide analogs include sugar- and / or backbone-modified ribonucleotides (i.e., modifications to the phosphate sugar backbone). For example, the phosphodiester linkages of natural RNA can be modified to include at least one nitrogen or sulfur heteroatom. In exemplary backbone-modified ribonucleotides, the phosphate ester group linked to adjacent ribonucleotides is replaced with a modified group, such as a phosphothioate group. In exemplary sugar-modified ribonucleotides, the 2'OH-group is replaced with a group selected from H, OR, R, halo, SH, SR, NH, NHR, NR, or ON, where R is C-C alkyl, alkenyl, or alkynyl, and halo is F, Cl, Br, or I.

[0287] In certain embodiments, the modifications are 2'-fluoro, 2'-amino, and / or 2'-thio modifications. Particularly preferred modifications include 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine, and / or 5-amino-allyl-uridine. In certain embodiments, 2'-fluoro ribonucleotides are all uridines and cytidines. Additional exemplary modifications include 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine, and 5-fluorouridine. 2'-deoxy-nucleotide and 2'-Ome nucleotide can also be used in the modified RNA silencing agent of the present invention.Additional modified residues include deoxyabasic, inosine, N3-methyl-uridine, N6,N6-dimethyl-adenosine, pseudouridine, purine ribonucleoside, and ribavirin.In certain preferred embodiments, the 2' moiety is a methyl group, so that the linking moiety is a 2'-O-methyl oligonucleotide.

[0288] In an exemplary embodiment, the RNA silencing agent of the present invention comprises a locked nucleic acid (LNA). LNAs contain sugar-modified nucleotides that are resistant to nuclease activity (highly stable) and have single-nucleotide discrimination against mRNA (Elmen et al., Nucleic Acids Res., (2005), 33(1):439-447; Braasch et al. (2003) Biochemistry 42:7967-7975, Petersen et al. (2003) Trends Biotechnol 21:74-81). These molecules contain 2'-O, 4'-C-ethylene-bridged nucleic acids that can be modified, such as 2'-deoxy-2''-fluorouridine. Furthermore, LNAs increase the specificity of oligonucleotides by constraining the sugar moiety to a 3'-endo conformation, thereby pre-organizing the nucleotide for base pairing and increasing the melting temperature of the oligonucleotide by approximately 10°C per base.

[0289] In another exemplary embodiment, the RNA silencing agent of the present invention comprises a peptide nucleic acid (PNA), which contains modified nucleotides in which the sugar-phosphate moiety of the nucleotide is replaced with a neutral 2-aminoethylglycine moiety that can form a polyamide backbone, making the molecule highly resistant to nuclease digestion and conferring improved binding specificity (Nielsen, et al., Science, (2001), 254:1497-1500).

[0290] Also preferred are nucleobase-modified ribonucleotides, i.e., ribonucleotides, which contain at least one non-naturally occurring nucleobase instead of naturally occurring nucleobases.The base can be modified to block the activity of adenosine deaminase.Examples of modified nucleobases include, but are not limited to, uridine and / or cytidine modified at 5-position, such as 5-(2-amino)propyluridine, 5-bromouridine, adenosine and / or guanosine modified at 8-position, such as 8-bromoguanosine, deazanucleotides, such as 7-deaza-adenosine, O- and N-alkylated nucleotides, such as N6-methyladenosine, and are preferred.It should be noted that the above modifications can also be combined.

[0291] In other embodiments, crosslinking can be used to change the pharmacokinetics of the RNA silencing agent, for example, to extend its half-life in the body. Thus, the present invention includes an RNA silencing agent having two complementary strands of nucleic acid, where the two strands are crosslinked. The present invention also includes an RNA silencing agent that is conjugated (for example, at its 3' end) to another moiety (for example, a non-nucleic acid moiety such as a peptide) or an organic compound (for example, a dye), or the like, or is not conjugated. By modifying the siRNA derivative in this way, it can improve the cellular uptake or the cellular targeting activity of the resulting siRNA derivative compared to the corresponding siRNA, and is useful for tracking the siRNA derivative in cells or improving the stability of the siRNA derivative compared to the corresponding siRNA.

[0292] Other exemplary modifications include: (a) 2' modifications, e.g., a 2'OMe moiety on a U in the sense or antisense strand, particularly in the sense strand, and / or a 2'F moiety on a U in the sense or antisense strand, particularly in the sense strand, and / or the provision of a 2'OMe moiety in the 3' overhang, e.g., at the 3' end (3' end means the 3' atom or the 3'-most part of the molecule, e.g., the 3'-most P or 2' position, as indicated by the context) and / or a 2'F moiety; (b) the provision of phosphorothioate modifications to U or A or both, e.g., by substituting S for O in the phosphate backbone, e.g., by substituting S for P; backbone modifications, e.g., by substituting S for P; (c) substitution of U with a C5 amino linker; (d) substitution of G for A (the sequence change may preferably be located in the sense strand rather than the antisense strand); and (d) modifications at the 2', 6', 7', or 8' position. Exemplary embodiments are those in which one or more of these modifications are present on the sense strand but not on the antisense strand, or those in which the antisense strand has almost no such modifications. Still other exemplary modifications include the use of methylated P in the 3' overhang, for example at the 3' end, a combination of 2' modifications, for example providing a 2'OMe moiety and backbone modification, for example substituting P with S, for example providing a phosphorothioate modification, or the use of methylated P in the 3' overhang, for example at the 3' end, modification with 3' alkyl, modification with abasic pyrrolidone in the 3' overhang, for example at the 3' end, modification with naproxen, ibuprofen, or other moieties that inhibit degradation at the 3' end.

[0293] Highly modified RNA silencing agents In certain embodiments, the RNA silencing agent comprises at least 80% chemically modified nucleotides. In certain embodiments, the RNA silencing agent is fully chemically modified, i.e., 100% of the nucleotides are chemically modified.

[0294] In certain embodiments, the RNA silencing agent is 2'-O-methyl rich, i.e., contains more than 50% 2'-O-methyl content. In certain embodiments, the RNA silencing agent contains at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% 2'-O-methyl nucleotide content. In certain embodiments, the RNA silencing agent contains at least about 70% 2'-O-methyl nucleotide modifications. In certain embodiments, the RNA silencing agent contains about 70% to about 90% 2'-O-methyl nucleotide modifications.

[0295] In certain embodiments, the RNA silencing agent is a dsRNA comprising an antisense strand and a sense strand. In some embodiments, the antisense strand comprises at least about 50% 2'-O-methyl nucleotide modification. In some embodiments, the antisense strand comprises more than about 50% 2'-O-methyl nucleotide modification (for example, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% or 90% 2'-O-methyl nucleotide modification). In some embodiments, the antisense strand comprises greater than 50% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises greater than 60% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 50% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 55% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 60% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 65% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 70% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 75% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 80% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 85% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 90% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 95% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 99% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 100% 2'-O-methyl nucleotide modifications.In certain embodiments, the antisense strand comprises at least about 70% 2'-O-methyl nucleotide modifications. In certain embodiments, the antisense strand comprises about 70% to about 90% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 70% to about 90% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 50% to about 100% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 50% to about 90% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 50% to about 80% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 50% to about 75% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 50% to about 70% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 50% to about 65% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 50% to about 60% 2'-O-methyl nucleotide modifications. In some embodiments, the antisense strand comprises about 50% to about 55% 2'-O-methyl nucleotide modifications.

[0296] In some embodiments, the sense strand comprises at least about 60% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand comprises more than 60% 2'-O-methyl nucleotide modifications. In certain embodiments, the sense strand comprises at least about 70% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 60% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 65% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 70% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 75% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 80% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 85% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 90% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 99% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 100% 2'-O-methyl nucleotide modifications. In certain embodiments, the sense strand contains about 70% to about 90% 2'-O-methyl nucleotide modifications. In certain embodiments, the sense strand contains 100% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 70% to about 90% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand comprises about 60% to about 100% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand comprises about 60% to about 95% 2'-O-methyl nucleotide modifications.In some embodiments, the sense strand contains about 60% to about 90% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 60% to about 85% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 60% to about 80% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 60% to about 75% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 60% to about 70% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 65% to about 90% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 65% to about 85% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 65% to about 80% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand contains about 65% to about 75% 2'-O-methyl nucleotide modifications. In some embodiments, the sense strand comprises about 65% to about 70% 2'-O-methyl nucleotide modifications.

[0297] 2'-O-methyl-rich RNA silencing agents and specific chemical modification patterns are further described in U.S. Patent No. 11,279,930 B2 and US 2021 / 0115442 A1, each of which is incorporated herein by reference.

[0298] Internucleotide linkage modifications In certain embodiments, at least one internucleotide linkage, intersubunit linkage, or nucleotide backbone is modified in the RNA silencing agent. In certain embodiments, all of the internucleotide linkages in the RNA silencing agent are modified. In certain embodiments, the modified internucleotide linkage comprises a phosphorothioate internucleotide linkage. In certain embodiments, the RNA silencing agent comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 phosphorothioate internucleotide linkages. In certain embodiments, the RNA silencing agent comprises 4 to 16 phosphorothioate internucleotide linkages. In certain embodiments, the RNA silencing agent comprises 8 to 13 phosphorothioate internucleotide linkages. In certain embodiments, the RNA silencing agent is a dsRNA comprising an antisense strand and a sense strand, each comprising a 5' end and a 3' end. In certain embodiments, the nucleotides at positions 1 and 2 from the 5'-end of the sense strand are linked to adjacent ribonucleotides via phosphorothioate internucleotide linkages. In certain embodiments, the nucleotides at positions 1 and 2 from the 3'-end of the sense strand are linked to adjacent ribonucleotides via phosphorothioate internucleotide linkages. In certain embodiments, the nucleotides at positions 1 and 2 from the 5'-end of the antisense strand are linked to adjacent ribonucleotides via phosphorothioate internucleotide linkages. In certain embodiments, the nucleotides at positions 1-2 through 1-8 from the 3'-end of the antisense strand are linked to adjacent ribonucleotides via phosphorothioate internucleotide linkages. In certain embodiments, the nucleotides at positions 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, or 1-8 from the 3'-end of the antisense strand are linked to adjacent ribonucleotides via phosphorothioate internucleotide linkages. In certain embodiments, nucleotides 1-2 through 1-7 from the 3' end of the antisense strand are linked to adjacent ribonucleotides via phosphorothioate internucleotide linkages.

[0299] 4) Modifications that enhance cellular uptake In other embodiments, RNA silencing agents may be modified with chemical moieties, for example, to enhance cellular uptake by target cells (e.g., neural cells).Therefore, the present invention includes RNA silencing agents that are conjugated (e.g., at their 3' end) to other moieties (e.g., non-nucleic acid moieties such as peptides) or organic compounds (e.g., dyes), or the like.Conjugation can be achieved, for example, by using methods known in the art, such as the following method. Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describing nucleic acids attached to polyalkylcyanoacrylate (PACA) nanoparticles), Fattal et al., J. Control Release 53(1-3): 137-43 (1998) (describing nucleic acids bound to nanoparticles), Schwab et al., Ann. Oncol. 5 Suppl. 4: 55-8 (1994) (describing nucleic acids linked to intercalating agents, hydrophobic groups, polycations or PACA nanoparticles), and Godard et al., Eur. J. Biochem. 232(2): 404-10 (1995) (describing nucleic acids linked to nanoparticles).

[0300] In certain embodiments, the RNA silencing agent of the present invention is conjugated to a lipophilic moiety. In one embodiment, the lipophilic moiety is a ligand containing a cationic group. In another embodiment, the lipophilic moiety is attached to one or both strands of the siRNA. In an exemplary embodiment, the lipophilic moiety is attached to one end of the sense strand of the siRNA. In another exemplary embodiment, the lipophilic moiety is attached to the 3' end of the sense strand. In certain embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, or a cationic dye (e.g., Cy3). In an exemplary embodiment, the lipophilic moiety is cholesterol. Other lipophilic moieties include cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.

[0301] 5) Tethered Ligand Other entities can be tethered to the RNA silencing agents of the present invention. For example, ligands can be tethered to RNA silencing agents to improve stability, hybridization thermodynamics with the target nucleic acid, targeting to specific tissues or cell types, or cell permeability, e.g., by endocytosis-dependent or -independent mechanisms. Ligands and associated modifications can also increase sequence specificity and thereby reduce off-site targeting. The tethering factor ligand can contain one or more modified bases or sugars that can function as intercalators. These are preferably located within an internal region, such as within a bulge, of the RNA silencing agent / target duplex. The intercalator can be aromatic, e.g., a polycyclic aromatic or heterocyclic aromatic compound. Polycyclic intercalators can have stacking capabilities and can include systems with two, three, or four fused rings. The universal bases described herein can be included in the ligand. In one embodiment, the ligand can contain a cleavage group that contributes to target gene inhibition by cleaving the target nucleic acid. The cleavage group can be, for example, bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), polyamine, tripeptide (e.g., lys-tyr-lys tripeptide), or a metal ion chelating group. Metal ion chelating groups can include, for example, Lu(III) or EU(III) macrocyclic complexes, Zn(II) 2,9-dimethylphenanthroline derivatives, Cu(II) terpyridine, or acridine, which can promote selective cleavage of target RNA at the bulge site by free metal ions such as Lu(III). In some embodiments, a peptide ligand can be tethered to the RNA silencing agent to promote cleavage of the target RNA, for example, at the bulge region. For example, 1,8-dimethyl-1,3,6,8,10,13-hexaazacyclotetradecane (cyclam) can be conjugated to a peptide (e.g., via an amino acid derivative) to facilitate target RNA cleavage.The tethered ligand can be an aminoglycoside ligand, which can provide the RNA silencing agent with improved hybridization properties or improved sequence specificity. Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as Neo-N-acridine, Neo-S-acridine, Neo-C-acridine, Tobra-N-acridine, and KanaA-N-acridine. The use of an acridine analog can enhance sequence specificity. For example, neomycin B has a higher affinity for RNA compared to DNA, but lower sequence specificity. The acridine analog neo-5-acridine has a higher affinity for the HIV Rev-response element (RRE). In some embodiments, a guanidine analog (guanidinoglycoside) of the aminoglycoside ligand is tethered to the RNA silencing agent. In guanidinoglycosides, the amine group on the amino acid is replaced with a guanidine group. The attachment of a guanidine analogue can increase the cell permeability of RNA silencing agents. The anchoring ligand can be a polyarginine peptide, peptoid, or peptidomimetic, which can increase the cellular uptake of oligonucleotide agents.

[0302] Exemplary ligands are preferably covalently coupled to the ligand-conjugated carrier, either directly or indirectly via an intervening tether.In exemplary embodiments, the ligand is attached to the carrier via an intervening tether.In exemplary embodiments, the ligand changes the distribution, targeting or life span of the RNA silencing agent that it is incorporated into.In exemplary embodiments, the ligand provides, for example, a higher affinity to selected targets, such as molecules, cells or cell types, compartments, such as cell or organ compartments, tissues, organs or regions of the body, compared to species that do not have such ligands.

[0303] Exemplary ligands can improve transport, hybridization, and specificity properties, and may also improve nuclease resistance of the resulting natural or modified RNA silencing agent, or polymer molecule comprising any combination of the monomers described herein and / or natural or modified ribonucleotides. Ligands generally can include therapeutic modifiers, e.g., to increase uptake, diagnostic compounds or reporter groups, e.g., to monitor distribution, crosslinkers, nuclease-resistance-conferring moieties, and natural or unusual nucleobases. Common examples include lipophilic substances, lipids, steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friedelin, epifriedelanol-derivatized lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein-binding agents, integrin-targeting molecules, polycations, peptides, polyamines, and peptidomimetics. Ligands can include naturally occurring substances (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), amino acids, or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, e.g., synthetic polyamino acids. Examples of polyamino acids include polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolized) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazine.Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha helical peptides.

[0304] The ligand can also include a targeting group, e.g., a cell or tissue targeting agent, such as a lectin, glycoprotein, lipid, or protein, e.g., an antibody, that binds to a specific cell type, such as a placental cell, a kidney cell, and / or a liver cell. The targeting group can also be thyroid-stimulating hormone, melanotropin, lectin, glycoprotein, surfactant protein A, a mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetylglucosamine, multivalent mannose, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphonate, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, biotin, or an RGD peptide or RGD peptidomimetic. Other examples of ligands include dyes, intercalating agents (e.g., acridine and substituted acridines), crosslinkers (e.g., psoralens, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrene), lys-tyr-lys tripeptides, aminoglycosides, guanidium aminoglycodies, artificial endonucleases (e.g., EDTA), lipophilic molecules such as cholesterol (and its thio analogs), cholic acid, cholanic acid, lithocholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono-, bis-, or tris-fatty acid esters, e.g., C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C17 , C 18 , C 19 or C 20 fatty acids) and their ethers, e.g., C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 , or C 20 Alkyl groups, e.g., 1,3-bis-O(hexadecyl)glycerol, 1,3-bis-O(octadecyl)glycerol, geranyloxyhexyl groups, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl groups, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., Antennapedia peptide, Tat peptides), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled marker, enzyme, hapten (e.g., biotin), transport / absorption enhancers (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole cluster, acridine-imidazole conjugate, Eu complex of tetraazamacrocycle), dinitrophenyl, HRP, or AP.

[0305] Ligands can be proteins, such as glycoproteins, or peptides, such as molecules with specific affinity for co-ligands, or antibodies, such as antibodies that bind to specific cell types, such as cancer cells, endothelial cells, or bone cells. Ligands can also include hormones and hormone receptors. They can also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent mannose, or multivalent fucose. Ligands can be, for example, lipopolysaccharides, activators of p38 MAP kinase, or activators of NF-kB.

[0306] The ligand can be a substance, such as a drug, that can increase the uptake of the RNA silencing agent into cells, for example, by disrupting the cytoskeleton of the cell, for example, by disrupting the microtubules, microfilaments, and / or intermediate filaments of the cell. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin. The ligand can increase the uptake of the RNA silencing agent into cells, for example, by activating an inflammatory response. Exemplary ligands with such effects include tumor necrosis factor alpha (TNFα), interleukin-1 beta, or gamma interferon. In one embodiment, the ligand is a lipid or lipid-based molecule. Such lipid or lipid-based molecule preferably binds to serum proteins, such as human serum albumin (HSA). HSA-binding ligands allow the conjugate to be distributed to target tissues. For example, the target tissue can be the placenta, kidney, or liver. Other molecules capable of binding to HSA can also be used as ligands. For example, naproxen or aspirin can be used. Lipid or lipid-based ligands can be used to (a) improve the degradation resistance of the conjugate, (b) increase targeting or transport to target cells or cell membranes, and / or (c) regulate binding to serum proteins, such as HSA. Lipid-based ligands can be used to regulate, for example, control, the binding of the conjugate to the target tissue. For example, lipid or lipid-based ligands that bind more tightly to HSA are less likely to target the placenta, liver, and / or kidney, and therefore less likely to be excreted from the body. Lipid or lipid-based ligands that bind less tightly to HSA can be used to target the conjugate to the placenta, liver, and / or kidney. Instead of or in addition to lipid-based ligands, other moieties that target placenta, liver, and / or kidney cells can also be used.

[0307] In another embodiment, the ligand is a moiety, such as a vitamin, that is taken up by target cells, e.g., proliferating cells. These are particularly useful for treating disorders characterized by unwanted cell proliferation, e.g., malignant or non-malignant, e.g., cancer cells. Representative vitamins include vitamins A, E, and K. Other examples of vitamins include B vitamins, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low-density lipoprotein (LDL).

[0308] In another embodiment, the ligand is preferably a cell-penetrating agent, such as a helical cell-penetrating agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide, such as tat or antennopedia. If the agent is a peptide, it may be modified, including peptidyl mimics, invertomers, non-peptide or pseudopeptide bonds, and the use of D-amino acids. The helical agent is preferably an alpha helical agent, and preferably has a lipophilic phase and a lipophobic phase. The ligand can be a peptide or peptidomimetic. Peptidomimetics (also referred to herein as oligopeptidomimetics) are molecules capable of folding into a defined three-dimensional structure similar to natural peptides. Attachment of peptides and peptidomimetics to oligonucleotide agents can affect the pharmacokinetic distribution of RNA silencing agents, such as by improving cellular recognition and uptake. The peptide or peptidomimetic moiety can be about 5 to 50 amino acids in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length. The peptide or peptidomimetic can be, for example, a cell-penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (e.g., composed primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimeric peptide, a constrained peptide, or a cross-linked peptide. The peptide moiety can be an L-peptide or a D-peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). Peptides or peptidomimetics can be coded by random DNA sequences, such as peptides identified from phage display libraries or one-bead-one-compound (OBOC) combinatorial libraries (Lam et al., Nature 354:82-84, 1991). In an exemplary embodiment, the peptide or peptidomimetic tethered to the RNA silencing agent via the incorporated monomer unit is a cell-targeting peptide, such as arginine-glycine-aspartic acid (RGD)-peptide or RGD mimic. Some peptide moieties can range in length from about 5 amino acids to about 40 amino acids. The peptide moiety can have structural modifications, such as those that improve stability or direct conformation.

[0309] In certain embodiments, the functional moiety is linked to the 5'-end and / or 3'-end of the RNA silencing agent of the present disclosure. In certain embodiments, the functional moiety is linked to the 5'-end and / or 3'-end of the antisense strand of the RNA silencing agent of the present disclosure. In certain embodiments, the functional moiety is linked to the 5'-end and / or 3'-end of the sense strand of the RNA silencing agent of the present disclosure. In certain embodiments, the functional moiety is linked to the 3'-end of the sense strand of the RNA silencing agent of the present disclosure.

[0310] In certain embodiments, the functional moiety is linked to the RNA silencing agent by a linker. In certain embodiments, the functional moiety is linked to the antisense strand and / or the sense strand by a linker. In certain embodiments, the functional moiety is linked to the 3' end of the sense strand by a linker. In certain embodiments, the linker comprises a bivalent or trivalent linker. In certain embodiments, the linker comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a phosphorothioate, a phosphoramidate, an amide, a carbamate, or a combination thereof. In certain embodiments, the bivalent or trivalent linker is selected from the following: [ka] wherein n is 1, 2, 3, 4 or 5.

[0311] In certain embodiments, the linker further comprises a phosphodiester or phosphodiester derivative, in certain embodiments, the phosphodiester or phosphodiester derivative is selected from the group consisting of: [ka] where X is O, S or BH3.

[0312] Various functional moieties of the present disclosure and means for conjugating them to RNA silencing agents are described in further detail in WO2017 / 030973A1 and WO2018 / 031933A2, which are incorporated herein by reference.

[0313] In certain embodiments, the linker is a cleavable linker.

[0314] In certain embodiments, the cleavable linker comprises a phosphodiester linkage, a disulfide linkage, an acid-labile linkage, or a photocleavable linkage.

[0315] In certain embodiments, the cleavable linker comprises a dTdT dinucleotide with a phosphodiester internucleotide linkage.

[0316] In certain embodiments, the acid-labile linkage comprises a β-thiopropionate linkage or a carboxydimethylmaleic anhydride (CDM) linkage.

[0317] In certain embodiments, the functional moiety PC-DCA having a C7 amino linker is [ka] where "siRNA" corresponds to the 3' end of the sense strand.

[0318] V. Nucleic Acids, Vectors, and Methods for Introduction of Host Cells The RNA silencing agent of the present invention can be directly introduced into cells (e.g., nerve cells) (i.e., intracellularly). Or it can be introduced extracellularly into cavities, interstitial spaces, or the circulation of organisms, or it can be introduced orally, or it can be introduced by immersing cells or organisms in a solution containing nucleic acid. Vascular or extravascular circulation, blood or lymphatic system, and cerebrospinal fluid are the sites where nucleic acid can be introduced.

[0319] The RNA silencing agent of the present invention can be introduced using nucleic acid delivery methods known in the art, such as injection of a solution containing nucleic acid, bombardment with particles covered with nucleic acid, immersion of cells or organisms in a solution of nucleic acid, or electroporation of cell membrane in the presence of nucleic acid.Other methods known in the art for introducing nucleic acid into cells can also be used, such as lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection such as calcium phosphate.Nucleic acid can be introduced with other components that perform one or more of the following activities: enhance the uptake of nucleic acid by cells, or otherwise increase the inhibition of target genes.

[0320] Physical methods for introducing nucleic acids include injecting a solution containing RNA, bombarding with particles coated with RNA, immersing cells or organisms in a solution of RNA, or electroporating cell membranes in the presence of RNA. Viral constructs packaged in viral particles achieve both efficient introduction of expression constructs into cells and transcription of the RNA encoded by the expression construct. Other methods known in the art for introducing nucleic acids into cells, such as lipid-mediated carrier transport, chemical-mediated transport, e.g., calcium phosphate, may also be used. Thus, RNA can be introduced with components that perform one or more of the following activities: enhancing RNA uptake by cells, inhibiting single-strand annealing, stabilizing single strands, or otherwise increasing inhibition of target genes.

[0321] RNA can be introduced directly into cells (i.e., intracellularly), or it can be introduced extracellularly into cavities, interstitial spaces, or the circulation of an organism, orally, or by bathing a cell or organism in a solution containing RNA. Vascular or extravascular circulation, the blood or lymphatic system, and cerebrospinal fluid are sites where RNA can be introduced.

[0322] The cell carrying the target gene may be derived from a germline or somatic cell, totipotent or pluripotent, dividing or non-dividing, parenchymal or epithelial, immortalized or transformed, etc. The cell may be a stem cell or a differentiated cell. Differentiated cell types include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelial cells, neurons, glial cells, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of endocrine or exocrine glands.

[0323] Depending on the specific target gene and the dose of double-stranded RNA material delivered, this process can result in partial or complete loss of function of the target gene. A reduction or loss of gene expression in at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more of the target cells is typical. Inhibition of gene expression refers to the absence (or observable reduction) of protein and / or mRNA product levels from the target gene. Specificity refers to the ability to inhibit the target gene without appreciably affecting other genes in the cell. Inhibition results can be confirmed by examining the external characteristics of the cell or organism (as demonstrated in the examples below) or by biochemical techniques, such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring by microarray, antibody binding, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence-activated cell sorting (FACS).

[0324] For RNA-mediated inhibition in cell lines or whole organisms, gene expression is conveniently assayed by using reporter or drug resistance genes whose protein products are easily assayed. Such reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta-galactosidase (LacZ), beta-glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and their derivatives. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracycline. Depending on the assay, quantification of gene expression levels can determine inhibition of greater than 10%, 33%, 50%, 90%, 95%, or 99% compared to cells not treated with the present invention. If the dose of injected material is low and the time after administration of the RNAi agent is long, a smaller percentage of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of target cells) may be inhibited. Quantification of intracellular gene expression can show similar amounts of inhibition at the level of target mRNA accumulation or target protein translation. As an example, the efficiency of inhibition may be determined by assessing the amount of intracellular gene product. mRNA can be detected by hybridization probes with nucleotide sequences outside the region used for the inhibitory double-stranded RNA, or translated polypeptides can be detected with antibodies raised against the polypeptide sequence of that region.

[0325] RNA can be introduced in an amount that allows delivery of at least one copy per cell. Higher doses of material (e.g., at least 5, 10, 100, 500, or 1000 copies / cell) can result in more effective inhibition, while lower doses can be useful for certain applications.

[0326] In exemplary embodiments, the efficacy of RNAi agents of the invention (e.g., siRNAs targeting flt1 intronic target sequences) is tested for their ability to specifically degrade mutant mRNA (e.g., sflt1 mRNA and / or sFlt1 protein production) in cells, particularly placental cells (e.g., labyrinth cells, trophoblast cells (e.g., syncytiotrophoblast and / or cytotrophoblast), mesenchymal cells, mesenchymal macrophages (Hofbauer cells), fibroblasts, fetal vascular cells (e.g., smooth muscle cells, perivascular cells (pericytes), and endothelial cells)), hepatocytes, and / or kidney cells. Also suitable for cell-based validation assays are other easily transfectable cells, such as trophoblasts, HeLa cells, or COS cells. Cells are transfected with human wild-type or mutant cDNA (e.g., human wild-type or secreted flt1 cDNA). Standard siRNA, modified siRNA, or a vector capable of generating siRNA from U-loop mRNA is co-transfected. Selective reduction of target mRNA (e.g., sflt1 mRNA) and / or target protein (e.g., sFlt1 protein) is measured. The reduction of target mRNA or protein can be compared to the level of target mRNA or protein in the absence of an RNAi agent or in the presence of an RNAi agent that does not target sFlt1 mRNA. Exogenously introduced mRNA or protein (or endogenous mRNA or protein) can be assayed for comparison purposes. When using neural cells, which are known to be somewhat resistant to standard transfection techniques, it may be desirable to introduce the RNAi agent (e.g., siRNA) by passive uptake.

[0327] VI. Treatment method The present invention provides both prophylactic and therapeutic methods of treating a subject at risk for (or susceptible to) a disease or disorder caused in whole or in part by secreted Flt1 protein. In one embodiment, the disease or disorder is a liver disease or disorder. In another embodiment, the disease or disorder is a kidney disease or disorder. In one embodiment, the disease or disorder is a placental disease or disorder. In one embodiment, the disease or disorder is a pregnancy-related disease or disorder. In preferred embodiments, the disease or disorder is associated with the expression of soluble Flt1 protein, and amplification of the expression of soluble Flt1 protein results in the clinical symptoms of PE, postpartum PE, eclampsia, and / or HELLP. In some embodiments, the disease or disorder is PE. In some embodiments, the disease or disorder is postpartum PE. In some embodiments, the disease or disorder is eclampsia. In some embodiments, the disease or disorder is HELLP.

[0328] As used herein, "treatment" or "treating" is defined as the application or administration of a therapeutic agent (e.g., an RNA agent or vector or transgene encoding same) to a patient, or to a tissue or cell line isolated from a patient, having a disease or disorder, a symptom of the disease or disorder, or a predisposition to a disease or disorder, in order to cure, cure, alleviate, relieve, alter, repair, ameliorate, improve or affect the disease or disorder, the symptom of the disease or disorder, or the predisposition to a disease.

[0329] In one aspect, the present invention provides a method for preventing the above-mentioned disease or disorder in a subject by administering a therapeutic agent (e.g., an RNAi agent or vector or a transgene encoding the same) to the subject.Subjects at risk of the disease can be identified, for example, by any one or a combination of the diagnostic or prognostic assays described herein.Administration of the prophylactic agent can be performed before the onset of symptoms characteristic of the disease or disorder, thereby preventing or slowing the progression of the disease or disorder.

[0330] Another aspect of the present invention relates to methods of therapeutically treating a subject, i.e., methods of altering the onset of symptoms of a disease or disorder. In exemplary embodiments, the modulatory methods of the present invention comprise contacting cells expressing a gain-of-function mutant with a therapeutic agent (e.g., an RNAi agent or a vector or transgene encoding the same) specific for one or more target sequences in the gene (e.g., SEQ ID NO: 1 or 2, or any combination thereof), thereby achieving sequence-specific interference with the gene. These methods can be carried out in vitro (e.g., by culturing cells with the agent) or in vivo (e.g., by administering the agent to a subject).

[0331] With regard to both preventative and therapeutic methods of treatment, such treatments can be specifically tailored or modified based on knowledge gained from the field of pharmacogenomics. As used herein, "pharmacogenomics" refers to the application of genomics technologies, such as gene sequencing, statistical genetics, and gene expression analysis, to drugs in clinical development and on the market. More specifically, the term refers to the study of how a patient's genes determine their response to a drug (e.g., their "drug response phenotype" or "drug response genotype"). Accordingly, another aspect of the present invention provides methods for tailoring an individual's preventative or therapeutic treatment using either the target gene molecules or target gene regulators of the present invention according to the individual's drug response genotype. Pharmacogenomics allows clinicians or physicians to target preventative or therapeutic treatments to patients who will most benefit from treatment and to avoid treating patients who experience toxic drug-related side effects.

[0332] Therapeutic agents can be tested in suitable animal models.For example, the RNAi agent described herein (or the expression vector or transgene encoding it) can be used in animal models to determine the efficacy, toxicity or side effects of treatment with the RNAi agent.Alternatively, therapeutic agents can be used in animal models to determine the mechanism of action of such agents.For example, agents can be used in animal models to determine the efficacy, toxicity or side effects of treatment with such agents.Alternatively, agents can be used in animal models to determine the mechanism of action of such agents.

[0333] The pharmaceutical composition comprising the RNA silencing agent of the present invention can be administered to any patient who has been diagnosed with or is at risk of developing pregnancy-related disorders, such as PE and / or eclampsia, liver disease and / or kidney disease-related disorders.In one embodiment, the patient is diagnosed with PE and / or eclampsia, and otherwise the patient is generally in good health.For example, the patient is not terminally ill and is likely to survive at least 2, 3, 5, or more years after diagnosis.The patient can be treated immediately after diagnosis, or can be delayed until the patient experiences further debilitating symptoms, such as two or more symptoms of PE or one or more symptoms of eclampsia.In another embodiment, the patient has not yet reached an advanced stage of the disease.

[0334] Delivery of an RNA silencing agent directly to an organ (e.g., directly to the placenta, liver, and / or kidney) can be an effective dose for treating or preventing liver-related, kidney-related, or pregnancy-related diseases or disorders, such as PE, postpartum PE, eclampsia, and / or HELLP.

[0335] The concentration of the RNA silencing agent composition is sufficient to be effective in treating or preventing a disorder or to regulate a physiological condition in humans. The concentration or amount of the RNA silencing agent administered depends on the parameters determined for the agent and the method of administration, for example, nasal, buccal, or pulmonary administration.

[0336] VI. Pharmaceutical Compositions and Methods of Administration The present invention relates to the use of the above-mentioned agents for preventive and / or therapeutic treatments as described below. Therefore, the modulators of the present invention (e.g., RNAi agents) can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically contain a nucleic acid molecule, protein, antibody, or modulatory compound and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0337] Pharmaceutical compositions comprising an RNAi agent (e.g., dsRNA) provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters. Thus, for example, the present disclosure is also directed to pharmaceutically acceptable salts of RNAi agents, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the present disclosure provides salts of RNAi agents (e.g., dsRNA). In some embodiments, the present disclosure provides salts of dsRNA agents. In some embodiments, the present disclosure provides salts of siRNA agents. In some embodiments, the salt is a sodium salt. In some embodiments, the salt is a potassium salt. In some embodiments, the salt is a pharmaceutically acceptable salt. In some embodiments, the salt of an RNAi agent is a pharmaceutically acceptable salt. In some embodiments, the salt of a dsRNA agent is a pharmaceutically acceptable salt. In some embodiments, the salt of an siRNA agent is a pharmaceutically acceptable salt.

[0338] Pharmaceutical compositions of the present invention are formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous (IV), intradermal, subcutaneous (SC or SQ), intraperitoneal, intramuscular, oral (e.g., inhalation), transdermal (topical), and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may include the following components: a sterile diluent, e.g., water for injection, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; an antibacterial agent, e.g., benzyl alcohol or methylparaben; an antioxidant, e.g., ascorbic acid or sodium bisulfite; a chelating agent, e.g., ethylenediaminetetraacetic acid; a buffer, e.g., acetate, citrate, or phosphate, and an agent for adjusting tonicity, e.g., sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in glass or plastic ampoules, disposable syringes, or multiple-dose vials.

[0339] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and fluid to the extent that easy syringability exists. The composition must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols (mannitol, sorbitol, sodium chloride, and the like) in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0340] Sterile injectable solution can be prepared by incorporating the required amount of active compound into suitable solvent with one or combination of the above-listed components as needed, and then sterilize by filtration.Generally, dispersion is prepared by incorporating active compound into a sterile vehicle that contains basic dispersion medium and other components required from the above-listed components.For the preparation of sterile powder for preparing sterile injectable solution, the preferred method of preparation is vacuum drying and freeze-drying, which can obtain the powder of active ingredient and any desired additional components from the solution that has been previously sterilized and filtered.

[0341] Oral compositions generally contain an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, lozenges, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, in which the compound in the fluid carrier is orally applied, swished in the mouth, expectorated, or swallowed. Pharmaceutically compatible binders and / or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; a filler such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

[0342] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, eg, a gas such as carbon dioxide, or a nebulizer.

[0343] Systemic administration can also be via transmucosal or transdermal means. For transmucosal or transdermal administration, a penetrant appropriate to the barrier to be permeated is used in the formulation. Such penetrants are generally known in the art, and include, for example, surfactants, bile salts, and fusidic acid derivatives for transmucosal administration. Transmucosal administration can be carried out using nasal sprays or suppositories. For transdermal administration, the active compound is formulated into ointments, salves, gels, or creams as generally known in the art.

[0344] The compounds can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0345] RNA silencing agents can also be administered by transfection or infection using methods known in the art, such as those described in McCaffrey et al. (2002), Nature, 418 (6893), 38-9 (hydrodynamic transfection); Xia et al. (2002), Nature Biotechnol., 20 (10), 1006-10 (viral-mediated delivery); or Putnam (1996), Am.J.Health Syst.Pharm. 53 (2), 151-160, erratum at Am.J.Health Syst.Pharm. 53 (3), 325 (1996).

[0346] RNA silencing agents can also be administered by any method suitable for administering nucleic acid agents, such as DNA vaccines. These methods include gene guns, bioinjectors, skin patches, and needle-free methods such as the microparticle DNA vaccine technology disclosed in U.S. Patent No. 6,194,389, and transdermal needle-free vaccination of mammals using powder vaccines disclosed in U.S. Patent No. 6,168,587. Intranasal delivery is also possible, as described, inter alia, in Hamajima et al. (1998), Clin. Immunol. Immunopathol., 88(2), 205-10. Liposomes (e.g., as described in U.S. Patent No. 6,472,375) and microencapsulation can also be used. Biodegradable, targetable microparticle delivery systems can also be used (e.g., as described in U.S. Patent No. 6,471,996).

[0347] In one embodiment, the active compound is prepared with a carrier that will protect the compound against rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. These materials are commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, the methods described in U.S. Pat. No. 4,522,811.

[0348] For ease of administration and uniformity of dosage, it is particularly advantageous to formulate oral or parenteral compositions in dosage unit form.Dosage unit form as used herein refers to a physically separate unit suitable as a unit dose for treating a subject, and each unit contains a predetermined amount of active compound calculated to produce desired therapeutic effect together with required pharmaceutical carrier.The specification of dosage unit form of the present invention is determined and directly depends on the inherent characteristics of active compound and the specific therapeutic effect to be achieved, and the inherent limitations of the technical field of compounding such active compound for treating individuals.

[0349] The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, which can be expressed as the ratio LD50 / ED50. Compounds that exhibit large therapeutic indices are preferred. Compounds that exhibit toxic side effects may be used, but care must be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to non-infected cells, thereby reducing side effects.

[0350] Data obtained from cell culture assays and animal studies can be used to formulate a dosage range for use in humans. The dosage of such compounds preferably lies within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending on the dosage form used and the route of administration utilized. For any compound used in the methods of the invention, the therapeutically effective dose can be initially estimated from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the EC50 (i.e., the concentration of the test compound that achieves a half-maximal response) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Plasma levels can be measured, for example, by high-performance liquid chromatography.

[0351] The pharmaceutical compositions can be included in a container, pack, or dispenser together with any instructions for administration.

[0352] The delivery route may depend on the patient's disorder. In certain exemplary embodiments, a subject diagnosed with PE, postpartum PE, eclampsia, and / or HELLP may receive an anti-sFlt1 RNA silencing agent of the present invention via IV or SC administration. In addition to the RNA silencing agent of the present invention, the patient may receive a second therapy, such as a palliative therapy and / or a disease-specific therapy. The second therapy may be, for example, a symptomatic therapy (e.g., to alleviate symptoms), a protective therapy (e.g., to slow or stop disease progression), or a restorative therapy (e.g., to reverse the disease process). For the treatment of PE, postpartum PE, eclampsia, and / or HELLP, for example, the symptomatic therapy may further include drugs such as atenolol, hydralazine, labetalol, magnesium sulfate, methyldopa, nicardipine, nifedipine, sodium nitroprusside, etc.

[0353] Generally, the RNA silencing agent of the present invention can be administered by any suitable method. As used herein, local delivery can refer to the direct application of the RNA silencing agent to any surface or any internal surface of the body, such as the eye, mucous membrane, or the surface of a body cavity. Preparations for local administration can include transdermal patches, ointments, lotions, creams, gels, drops, sprays, and liquids. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, etc. may be necessary or desirable. Topical administration can also be used as a means of selectively delivering the RNA silencing agent to the epidermis or dermis of a subject, or specific layers thereof, or underlying tissues.

[0354] Formulations for parenteral administration may include sterile aqueous solutions which may contain buffers, diluents and other suitable additives. Intraventricular injection may be facilitated, for example, by an intraventricular catheter attached to a reservoir. For intravenous use, the total concentration of solutes should be controlled in order to render the preparation isotonic.

[0355] As used herein, the terms "stereochemically isomeric form," "stereomorph," "stereoisoform," "stereoisomer," and the like refer to different compounds composed of the same atoms bonded in the same order but with different three-dimensional structures that are not interchangeable. In some embodiments of the present disclosure, pharmaceutical compositions containing RNAi agents (e.g., dsRNA) may be or contain pure preparations of individual stereochemically isomeric forms of the RNAi agent. In some embodiments, pharmaceutical compositions may be or contain mixtures of two or more stereochemically isomeric forms of the RNAi agent.

[0356] VII. Kit In certain other aspects, the present invention provides kits comprising a suitable container containing a pharmaceutical formulation of an RNA silencing agent, e.g., a double-stranded RNA silencing agent, or sRNA agent (e.g., a precursor, e.g., a larger RNA silencing agent that can be processed into an sRNA agent, or a DNA encoding an RNA silencing agent, e.g., a double-stranded RNA silencing agent, or sRNA agent, or precursor thereof). In certain embodiments, the individual components of the pharmaceutical formulation may be provided in a single container. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation separately in two or more containers, e.g., one container for the RNA silencing agent preparation and at least another container for a carrier compound. The kit may be packaged in a number of different configurations, such as one or more containers in a single box. For example, the different components can be combined according to instructions provided in the kit. The components can be combined according to the methods described herein, e.g., to prepare and administer a pharmaceutical composition. The kit may also include a delivery device.

[0357] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein can be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. While certain embodiments have been described in detail above, the embodiments will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting. [Example]

[0358] Example 1. Background and Significance of Pre-eclampsia (PE) Overwhelming evidence from epidemiological and experimental studies now indicates that PE is caused by elevated levels of a "soluble decoy" protein (soluble FLT1 (sFLT1)) from the Flt1 gene (VEGFR1) in the maternal bloodstream (Young, B.C., Levine, R.J. & Karumanchi, S.A. Pathogenesis of preeclampsia. Annual review of pathology 5, 173-192 (2010); Maynard, S.E. et al. Excess placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. The Journal of clinical investigation 111, 649-658 (2003); Levine, R.J. et al. Circulating angiogenic factors and the risk of preeclampsia. The New England Journal of Medicine 350, 672-683 (2004); Heydarian, M. et al. Novel splice variants of sFlt1 are upregulated in preeclampsia. Placenta 30, 250-255 (2009)). FLT1 is a receptor tyrosine kinase (RTK) primarily expressed in the placenta. A common mechanism for RTK regulation is the production of a truncated, secreted form of the receptor that acts as a dominant negative regulator of the entire signaling pathway. Ligand sequestration by such a soluble decoy inhibits intracellular signaling by the full-length receptor, thereby desensitizing the system to ligand concentrations (Vorlova, S. et al. Induction of antagonistic soluble decoy receptor tyrosine kinases by intronic polyA activation. Molecular cell 43, 927-939 (2011)).In the case of FLT1, the soluble decoy is expressed from a truncated mRNA generated by polyadenylation within two introns (i13 and i15) upstream of the exons encoding the fl-FLT1 transmembrane (TM) and kinase domains.

[0359] In mammals, FLT1 is primarily expressed in the placenta, with human placental Flt1 mRNA levels being 10-100 times higher than those observed in other adult tissues (Cerdeira, AS & Karumanchi, SA, Angiogenic factors in preeclampsia and related disorders. Cold Spring Harbor perspectives in medicine 2 (2012)). While the full-length isoform predominates in all tissues in non-pregnant adult humans (see above), placental expression is dominated by three truncated isoforms: sFlt1-i13 short, sFlt1-i13 long, and sFlt1-i15a, all of which encode the sFLT1 protein. This same pattern of high Flt1 expression in the placenta and low expression in other non-pregnant adult tissues is observed in rodents. However, rodents lack the polyadenylation site in intron 14 and therefore express only one soluble decoy form: sFlt1-i13. During PE, both full-length (fl-Flt1) and truncated Flt1 mRNA accumulate to higher levels in the placenta than during normal pregnancy, with the truncated isoform becoming more prominent. These changes in mRNA levels may explain the significant increase in sFLT1 protein in the maternal bloodstream during PE.

[0360] Applicability of siRNA for the treatment of PE Previous studies have demonstrated the applicability of siRNA-based therapeutics for the treatment of PE (US Pat. No. 9,862,952, incorporated herein by reference).

[0361] Example 2. Optimization of siRNA targeting sFLT1 The previously described siRNA was optimized to enhance placental tissue accumulation, minimize siRNA degradation, reduce toxicity, and enhance silencing. This optimization was achieved by incorporating a 2'-OMe-rich scaffold for improved stability and a PC-DCA-conjugated sense strand for improved placental delivery. The optimized siRNA demonstrated increased accumulation, efficacy, and safety compared to previously developed chemistries.

[0362] Optimization of 2'OMe content As shown in Figure 1A, various amounts of 2'OMe modifications were used in the antisense and sense strands of siRNA. As shown in Figure 1B, dose-response results (n = 3, mean ± SD) of siRNA were generated targeting the sequence of the human flt1 gene at position 2283 (5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1)). siRNA targeting position 2519 (5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2)) was also tested with similar results. HeLa cells were treated with siRNA at the indicated concentrations for 72 hours. mRNA levels were measured using the Dual-Glo® Luciferase Assay System. The KD (%) was determined and calculated as a percentage of the untreated control (C). Table in Figure 1B - Maximum KD (%) - maximum rate of target mRNA knockdown by the maximal therapeutic dose of siRNA, IC50 - half-maximum inhibitory concentration, AUC - area under the dose-response curve, p-value - significance. The results demonstrate that increasing the amount of 2'OMe modification in siRNA does not substantially reduce the silencing potency of siRNA. 2'OMe modification is less toxic than 2'F modification. Therefore, 2'OMe-rich siRNA may be more suitable for therapeutic use.

[0363] Sense strand conjugate optimization siRNA conjugates play an important role in targeting siRNA to the appropriate tissues and cells. As shown in Figure 2A, Cy3-labeled siRNA was conjugated with various functional moieties, and delivery to liver, kidney, and placenta tissues was monitored by tissue fluorescence imaging. In this study, pregnant CD1 mice were injected with 20 mg / kg of Cy3-labeled siRNA variants. Histofluorescence imaging was performed using a Leica DMi8 inverted tilt microscope with 10x tiled array images. Scale bar = 2 mm. All images were acquired at the same laser intensity. As shown in Figure 2B, guide strand accumulation was quantified 48 hours later by PNA hybridization assay (n = 3). p values ​​indicate statistically significant differences between each compound and the cholesterol-conjugated compound (one-way ANOVA, **p < 0.01, ***p < 0.001; non-significant differences are not marked). NOC-no conjugate, Chol-cholesterol, DCA-docosanoic acid, PC-DCA-phosphocholine-docosanoic acid, DHA-docosahexanoic acid, PC-DHA-phosphocholine-docosahexanoic acid, DIO-biantennary oligonucleotide. The results demonstrate that PC-DCA siRNA conjugates enhance placental accumulation.

[0364] The PC-DCA siRNA conjugate was further characterized to demonstrate reduced accumulation in the bone marrow. FACS analysis of bone marrow cells from CD-1 mice injected with Cy3-labeled sFLT1_2283 siRNA variants was performed. Figure 3A shows the gating scheme used to quantify Cy3 intensity of specific cell populations in the bone marrow in Figures 3B-3D. Figure 3B shows a frequency distribution histogram (left) of Cy3 fluorescence intensity for bone marrow neutrophils 24 h after siRNA variant injection and a bar graph (right) of Cy3 median fluorescence intensity. Figure 3C shows a frequency distribution histogram (left) of Cy3 fluorescence intensity for bone marrow granulocytes 24 h after siRNA variant injection and a bar graph (right) of Cy3 median fluorescence intensity. Figure 3D shows a frequency distribution histogram (left) of Cy3 fluorescence intensity for bone marrow monocytes 24 h after siRNA variant injection and a bar graph (right) of Cy3 median fluorescence intensity. (n=3, mean±SD) p-values ​​represent statistically significant differences between compounds (one-way ANOVA; *p<0.05; non-significant differences are not marked). The results showed that PC-DCA conjugated siRNAs accumulated less in bone marrow monocytes, granulocytes, and neutrophils, demonstrating that PC-DCA conjugates are useful for placental delivery with minimal off-target accumulation.

[0365] Antisense strand 5' end optimization The antisense strand can be sensitive to the action of 5' exonucleases. Therefore, it is advantageous to protect the 5' end with a modification that reduces degradation. These siRNAs were further optimized by testing the effects of three different antisense 5' end modifications: 5' vinylphosphonate (VP), 5' phosphorothioate (PS), and 5'-hydroxyl (OH). Schematic diagram of siRNA chemical modification patterns.

[0366] On embryonic days (E) 13 and E14, pregnant CD-1 mice were injected with a 20 mg / kg equimolar mixture of 2283 and 2519 siRNA variants. Figure 4A shows a schematic diagram of the chemical patterns of the injected siRNA compounds and the chemical structures of the 5' moieties tested. As shown in Figure 4B, sflt1-i13 mRNA levels in E18 placentas were measured using Quantigene 2.0 RNA Assay. Levels were normalized to Flt1 and presented as a percentage of the PBS control (n = 5, mean ± SD).

[0367] Optimization of the 5' moiety, 2' modification pattern, and conjugate resulted in increased in vivo tissue accumulation and potency. Figure 4C shows the amount of siRNA accumulation in E18 placenta measured using a PNA hybridization assay (n = 5). p values ​​represent statistically significant differences between compounds (one-way ANOVA; **p < 0.01; ****p < 0.0001; non-significant differences are not marked). As shown in Figure 4D, sflt1-i13 mRNA levels in E18 placenta were measured using Quantigene 2.0 RNA Assay. Levels were normalized to Flt1 and presented as a percentage of the PBS control (n = 6, mean ± SD). Figure 4E shows the amount of siRNA accumulation in E18 placenta measured using a PNA hybridization assay (n = 6). p-values ​​represent statistically significant differences between compounds (one-way ANOVA; **p<0.01; ****p<0.0001; non-significant differences are unmarked; unpaired t-test; #p<0.05; ####p<0.0001). As shown in Figure 4F, the mean number of pups, mean pup weight, and mean placental weight were similar between control and treated pregnant mice, indicating that the mixture of 2283 and 2519 siRNAs had no adverse effects on these metrics.

[0368] Decreased serum cytokine production The optimized siRNA was tested for its effect on serum cytokine production. The optimized siRNA was generated to partially reduce toxicity and extend the therapeutic index. The reduction in serum cytokine production would indicate reduced toxicity and an extended therapeutic index.

[0369] As shown in Figure 5, serum cytokine concentrations were measured in CD-1 mice 24 hours after injection of 75 mg / kg of sFLT1_2283 siRNA variants (n = 3, mean ± SD). p values ​​represent statistically significant differences between compounds (one-way ANOVA; *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001; non-significant differences are not marked). Numerous interleukin, colony-stimulating factor, and chemokine levels were measured and found to be lower with the second-generation optimized siRNA compared to the first-generation siRNA. A wide therapeutic index means that siRNA can be administered at high concentrations without risk of toxicity issues. This may result in less frequent administration and / or better silencing of sFLT-1.

[0370] The overall results of Example 2 show that optimized siRNAs targeting the sFlt-1 2283 and 2519 target sites have similar silencing efficacy as compared to first-generation siRNAs, as well as superior placental tissue accumulation, reduced off-target tissue accumulation, reduced degradation, reduced toxicity, and a broader therapeutic index.

[0371] Existing assay systems for evaluating lead compounds. The assays and models developed to date are as follows:

[0372] Fluorescence microscopy assessment of in situ tissue distribution We synthesized hsiRNA variants containing Cy3 or Cy5.5 (low autofluorescence) dyes attached to the 5' end of the sense (passenger) strand via a non-degradable linker. These compounds were biologically stable with no detectable Cy3 cleavage within 24 hours. Animals were administered fluorescent sense strands hybridized to complementary guide strands (thus forming double-stranded hsiRNAs), and the distribution patterns of the oligonucleotides were examined in 4 µm tissue sections stained with DAPI or / and cell-type-selective antibodies. Parallel sections could be stained with standard histological markers, allowing for detailed histological mapping. Because hsiRNAs are already significantly hydrophobically modified, the addition of dyes has little effect on their overall hydrophobicity and therefore minimal impact on oligonucleotide distribution. This assay enabled rapid assessment of tissue and cell-type distribution and was complemented by a PNA-based quantitative assay for direct guide strand detection.

[0373] PNA hybridization for quantitative guide strand detection in tissue lysates To enable direct quantification of intact guide strands in tissues, we developed and implemented a novel assay in which guide strands were hybridized to perfectly complementary Cy3-labeled PNA (peptide nucleic acid) oligonucleotides and the corresponding double strands were separated from excess single-stranded PNA by HPLC. Because PNAs are uncharged and bind very tightly to the guide strand, they outcompete both the hsiRNA sense strand and any endogenous target sequences. Fluorescent detection of Cy3-PNA:guide hybrids directly measures the abundance of guide strands in tissue lysates. Coupled with an automated HPLC injector, this assay enabled overnight quantification of guide strands in hundreds of samples. This assay was also highly sensitive, with a detection limit of less than 10 fmol / gram. Hybrids containing full-length, partially degraded, 5'-phosphorylated, and 5'-dephosphorylated guide strands could all be quantified as separate peaks or shoulders in the HPLC trace. This assay is capable of detecting both labeled and unlabeled compounds and can therefore be directly transferred to a downstream CRO for clinical sample analysis.

[0374] QuantiGene® (Affymetrix) assay for direct detection of Flt1 mRNA variants in cells and tissues QuantiGene® is a highly sensitive 96-well assay that detects mRNA directly from tissue and / or cell lysates via signal amplification. By coupling this direct detection assay to a 192-well automated TissueLyser, a high-throughput version was developed, enabling the processing of dozens of samples per animal. Thus, quantitative data on the expression of target and housekeeping genes was generated in many animals at once. In pilot studies, an n=8 assay was sufficient to detect a 40% modulation of sFlt1 mRNA isoform expression with 80% confidence. The bDNA assay is described in Coles et al. Nucleic Acid Ther. (2015) Nov 23. PMID: 26595721.

[0375] ELISA for detection of sFLT1 protein in conditioned medium and blood (#MVR100, R&D Systems) This 96-well-based assay required only 10 μL of biological fluid per sample. The assay has been optimized over many years for both in vitro and in vivo studies. It is clinically compatible and allows for the assessment of circulating sFLT1 protein levels without animal sacrifice, making it particularly useful for non-human primate studies.

[0376] Normal mouse pregnancy model The sFlt1-i13 variant is expressed during mouse pregnancy, and i13 levels increase exponentially from days 14 to 19. The complete homology of the sFLT1-i13-2283 compound to the i13 mouse variant allows for both efficacy and safety testing in this simple rodent model.

[0377] Preeclampsia model As further described below, the reduced uterine perfusion pressure (RUPP) model of placental ischemia and the hypoxic model of pre-eclampsia are used.

[0378] Wild-type baboon pregnancy model Because the sFlt1-i15a variant is not expressed in pregnant rodents, the overall efficacy and safety of the combination will be evaluated in wild-type pregnant baboons using ELISA, a non-invasive assay, as a readout of efficacy.

[0379] Example 3. Optimized siRNA targeting sFlt-1 in vitro and in the RUPP rat model of preeclampsia Optimized siRNAs targeting sFlt-1 were tested in vitro using human cell lines and in the RUPP rat model of preeclampsia. In this example, the following siRNAs were used: [Table 1]

[0380] Figures 9, 10A-10B, and 11A-11B show optimized sFlt-1 targeting siRNAs (sFLT-2283 and sFLT-2519).

[0381] The optimized siRNAs were tested in the human WM-115 cell line to analyze the ability of siRNA-2283 and siRNA-2519 to silence their targets. siRNA-2283 (targeting sFLT1-i13) and siRNA-2519 (targeting sFLT1-e15a) were tested alone or in combination at a 1:1 ratio. As shown in Figure 7, each siRNA alone can silence the targeted sFLT1 mRNA isoform and reduce total sFLT1 protein levels, while the combination showed further silencing of the individual isoforms and a reduction in total protein.

[0382] The same siRNAs were tested in combination in the RUPP (reduced uteroplacental perfusion in pregnant rat) rat model of preeclampsia. RUPP treatment induces placental ischemia and is a well-characterized model of preeclampsia. RUPP rats exhibit characteristic symptoms of preeclampsia, including elevated maternal mean arterial blood pressure (MAP) and reduced glomerular filtration rate (GFR), accompanied by elevated sFLT1 levels.

[0383] To evaluate the optimized siRNA targeting sFlt1 in the RUPP model, rats were subcutaneously injected with 10 mg / kg body weight of a combination siRNA therapy (a 1:1 mixture of sFLT1 siRNA:(siRNA-2283 (targeting sFLT1-i13) and siRNA-2519 (targeting sFLT1-e15a)) or PBS control on gestational days 13 and 14 (see Figure 8A).

[0384] To generate the RUPP model, silver clips were surgically placed around the abdominal aorta and ovarian artery in the uterus of pregnant Sprague-Dawley rats on gestational day 14. Sham surgery (abdominal incision and suture without clip placement) served as a control.

[0385] Blood and tissues were collected and pregnancy biometrics were analyzed on gestational day 19. Blood pressure was measured in conscious rats on gestational day 19, and animals were then anesthetized with isoflurane to measure sFLT-1 and collect tissues for histological analysis.

[0386] The following assays were performed: Maternal blood pressure measurement: gestational day 18. On day 19, a jugular catheter was implanted to measure arterial blood pressure and heart rate in conscious mothers. Fetal and placental weights: Fetal and placental weights were measured at the time of sacrifice on gestational day 19. The total and average fetal and placental weights per rat were calculated. Fetal resorption: Visually determine the number of fetuses resorbed by the mother.

[0387] As shown in Figure 8B, maternal blood pressure decreased in the RUPP combination therapy group, bringing blood pressure to control levels (Sham). Furthermore, placental weight was preserved in the RUPP combination therapy group (Figure 8B). There were no adverse fetal effects and a trend toward improved fetal growth, as measured by fetal resorption rate and fetal weight (shown in Figure 8C).

[0388] equivalent The present disclosure may be embodied in other specific forms without departing from its spirit or essential characteristics. Accordingly, the foregoing embodiments are to be considered in all respects as illustrative and not limiting of the present disclosure. The scope of the present disclosure is, therefore, indicated by the appended claims, rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

1. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modifications; (4) any one or more of the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) the nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains at least 65% 2'-O-methyl modifications; (9) any one or more of the nucleotides at positions 4, 6, 8, 10, and 14 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; (10) The dsRNA molecule, wherein the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

2. a double-stranded RNA (dsRNA) comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end; wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (3) the nucleotides at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (4) the nucleotides at positions 1-2 through 1-7 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (5) a portion of the antisense strand is complementary to a portion of the sense strand; (6) the sense strand comprises alternating 2'-methoxy-ribonucleotides and 2'-fluoro-ribonucleotides; (7) The dsRNA, wherein the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

3. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modifications; (4) any one or more of the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 18 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) the nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains at least 80% 2'-O-methyl modifications; (9) any one or more of the nucleotides at positions 7, 9, and 11 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; (10) The dsRNA molecule, wherein the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

4. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 70% 2'-O-methyl modifications; (4) any one or more of the nucleotides at positions 2, 4, 5, 6, 8, and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) the nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains 100% 2'-O-methyl modifications; (9) The dsRNA molecule, wherein the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

5. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 75% 2'-O-methyl modifications; (4) any one or more of the nucleotides at positions 2, 4, 5, 6, and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) the nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains 100% 2'-O-methyl modifications; (9) The dsRNA molecule, wherein the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

6. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, wherein (1) the antisense strand comprises a sequence substantially complementary to the nucleic acid sequence of 5'CTCTCGGATCTCCAAATTTA3' (SEQ ID NO: 1) or 5'CATCATAGCTACCATTTATT3' (SEQ ID NO: 2); (2) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 85% 2'-O-methyl modifications; (4) any one or more of the nucleotides at positions 2 and 14 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) the nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains 100% 2'-O-methyl modifications; (9) The dsRNA molecule, wherein the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

7. The dsRNA of any one of claims 1 to 6, wherein the antisense strand is 20 nucleotides in length.

8. The dsRNA of any one of claims 1 to 6, wherein the antisense strand is 21 nucleotides in length.

9. The dsRNA of any one of claims 1 to 6, wherein the antisense strand is 22 nucleotides in length.

10. The dsRNA of any one of claims 1 to 6, wherein the sense strand is 15 nucleotides in length.

11. The dsRNA of any one of claims 1 to 6, wherein the sense strand is 16 nucleotides in length.

12. The dsRNA of any one of claims 1 to 6, wherein the sense strand is 18 nucleotides in length.

13. The dsRNA of any one of claims 1 to 6, wherein the sense strand is 20 nucleotides in length.

14. The dsRNA of any one of claims 1 to 6, comprising a double-stranded region of 15 to 20 base pairs.

15. The dsRNA of any one of claims 1 to 6, comprising a double-stranded region of 15 base pairs.

16. The dsRNA of any one of claims 1 to 6, comprising a double-stranded region of 16 base pairs.

17. The dsRNA of any one of claims 1 to 6, comprising a double-stranded region of 18 base pairs.

18. The dsRNA of any one of claims 1 to 6, comprising a 20 base pair double-stranded region.

19. The dsRNA of any one of claims 1 to 18, wherein the dsRNA comprises blunt ends.

20. The dsRNA of any one of claims 1 to 19, wherein the dsRNA comprises at least one single-stranded nucleotide overhang.

21. 21. The dsRNA of claim 20, wherein the dsRNA comprises a single-stranded nucleotide overhang of about 2 to 5 nucleotides.

22. 22. The dsRNA of any one of claims 1 to 21, comprising 4 to 16 phosphorothioate internucleotide linkages.

23. 22. The dsRNA of any one of claims 1 to 21, comprising 8 to 13 phosphorothioate internucleotide linkages.

24. The dsRNA of any one of claims 1 to 23, wherein the sense strand comprises one or more nucleotide mismatches between the antisense strand and the sense strand.

25. The dsRNA of any one of claims 1 to 24, wherein the antisense strand comprises a 5' phosphate, a 5'-alkyl phosphonate, a 5' alkylene phosphonate, or a 5' alkenyl phosphonate.

26. 26. The dsRNA of claim 25, wherein the antisense strand comprises a 5' vinyl phosphonate.

27. The dsRNA of any one of claims 1 to 26, wherein a functional moiety is linked to the 3' end of the sense strand.

28. 28. The dsRNA of claim 27, wherein the functional moiety comprises a hydrophobic moiety.

29. 29. The dsRNA of claim 28, wherein the hydrophobic moiety is selected from the group consisting of a fatty acid, a steroid, a secosteroid, a lipid, a ganglioside, a nucleoside analog, an endocannabinoid, a vitamin, and mixtures thereof.

30. 30. The dsRNA of claim 29, wherein the steroid is selected from the group consisting of cholesterol and lithocholic acid (LCA).

31. 30. The dsRNA of claim 29, wherein the fatty acid is selected from the group consisting of eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and docosanoic acid (DCA).

32. 30. The dsRNA of claim 29, wherein the vitamin is selected from the group consisting of choline, vitamin A, vitamin E, and derivatives or metabolites thereof.

33. The dsRNA according to any one of claims 27 to 32, wherein the functional moiety is linked to the sense strand by a linker.

34. 34. The dsRNA of claim 33, wherein the linker is a cleavable linker.

35. 35. The dsRNA of claim 34, wherein the cleavable linker comprises a phosphodiester linkage, a disulfide linkage, an acid-labile linkage, or a photocleavable linkage.

36. 36. The dsRNA of Claim 34 or 35, wherein the cleavable linker comprises a dTdT dinucleotide having a phosphodiester internucleotide linkage.

37. 36. The dsRNA of claim 35, wherein the acid-labile linkage comprises a β-thiopropionate linkage or a carboxydimethylmaleic anhydride (CDM) linkage.

38. The dsRNA of any one of claims 33 to 37, wherein the linker comprises a bivalent or trivalent linker.

39. The bivalent or trivalent linker is 【Chemistry 1】 39. The dsRNA of claim 38, selected from the group consisting of: wherein n is 1, 2, 3, 4, or 5.

40. The dsRNA of any one of claims 33 to 39, wherein the linker comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a phosphorothioate, a phosphoramidate, an amide, a carbamate, or a combination thereof.

41. The dsRNA of any one of claims 38 to 40, wherein when the linker is a trivalent linker, the linker further links a phosphodiester or phosphodiester derivative.

42. 42. The dsRNA of claim 41, wherein the phosphodiester or phosphodiester derivative is selected from the group consisting of: 【Chemistry 2】 (wherein X is O, S or BH ３ (It is).

43. The dsRNA of any one of claims 1 to 42, wherein the nucleotides at positions 1 and 2 from the 3' end of the sense strand and the nucleotides at positions 1 and 2 from the 5' end of the antisense strand are linked to adjacent ribonucleotides via phosphorothioate linkages.

44. 44. The dsRNA of any one of claims 1 to 43, wherein the region of complementarity is complementary to at least 15, 16, 17 or 18 consecutive nucleotides of SEQ ID NO:1 or SEQ ID NO:

2.

45. The region of complementarity has no more than three mismatches with SEQ ID NO: 1 or SEQ ID NO:

2. The dsRNA according to any one of claims 1 to 43, which does not contain

46. The dsRNA of any one of claims 1 to 43, wherein the region of complementarity is perfectly complementary to SEQ ID NO: 1 or SEQ ID NO:

2.

47. The dsRNA of any one of claims 1 to 46, wherein the antisense strand comprises the nucleic acid sequence of 5'UAAAUUUGGAGAUCCGAGAGA 3', and the sense strand comprises the nucleic acid sequence of 5'CGGAUCUCCAAAUUUA 3'.

48. The dsRNA of any one of claims 1 to 46, wherein the antisense strand comprises the nucleic acid sequence of 5'UAUAAAUGGUAGCUAUGAUGA3', and the sense strand comprises the nucleic acid sequence of 5'AUAGCUACCAUUUAUA3'.

49. The dsRNA of any one of claims 1 to 46, wherein the expression of sFLT1 protein in a cell or organism is reduced by at least about 20%.

50. 100. A method of treating or managing PE, postpartum PE, eclampsia, or HELLP syndrome, comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the dsRNA of any one of claims 1-48.

51. 51. The method of claim 50, wherein the pharmaceutical composition is administered intravenously or subcutaneously.

52. 51. The method of claim 50, wherein the expression of sFLT1 protein is reduced in the subject by at least about 20%.

53. 49. A method of treating one or more symptoms of PE, postpartum PE, eclampsia, or HELLP syndrome in a subject in need thereof, comprising administering to the subject a dsRNA of any one of claims 1-48.

54. 49. A method of treating one or more symptoms of an angiogenic disorder in a subject in need thereof, comprising administering to said subject a dsRNA of any one of claims 1 to 48.

55. 55. The method of claim 54, wherein the angiogenic disorder is selected from the group consisting of PE, postpartum PE, eclampsia, and HELLP syndrome.

56. A pharmaceutical composition comprising a first dsRNA, a second dsRNA, and a pharmaceutically acceptable carrier: The first dsRNA comprises a first sense strand and a first antisense strand, the first antisense strand comprises a complementary region substantially complementary to SEQ ID NO: 1, and the first dsRNA comprises the dsRNA of any one of claims 1 to 46; the second dsRNA comprises a second sense strand and a second antisense strand, the second antisense strand comprises a complementary region substantially complementary to SEQ ID NO: 2, and the second dsRNA comprises the dsRNA of any one of claims 1 to 46; The pharmaceutical composition.

57. A pharmaceutical composition comprising a first dsRNA, a second dsRNA, and a pharmaceutically acceptable carrier: the first dsRNA comprises a first sense strand and a first antisense strand, each strand having a 5' end and a 3' end, and the first antisense strand comprises a region of complementarity that is substantially complementary to SEQ ID NO: 1; the second dsRNA comprises a second sense strand and a second antisense strand, each strand having a 5' end and a 3' end, and the second antisense strand comprises a region of complementarity that is substantially complementary to SEQ ID NO:2; For each of the first dsRNA and the second dsRNA, (1) the antisense strand is at least 20 nucleotides in length; (3) the antisense strand comprises at least 50% 2'-O-methyl modifications; (4) any one or more of the nucleotides at positions 2, 4, 5, 6, 8, 10, 12, 14, 16, and 20 from the 5' end of the antisense strand are not 2'-methoxy-ribonucleotides; (5) the nucleotides at positions 1-2 through 1-8 from the 3' end of the antisense strand are linked to each other via phosphorothioate internucleotide linkages; (6) a portion of the antisense strand is complementary to a portion of the sense strand; (7) the sense strand is at least 15 nucleotides in length; (8) the sense strand contains at least 65% 2'-O-methyl modifications; (9) any one or more of the nucleotides at positions 4, 6, 8, 10, and 14 from the 5' end of the sense strand are not 2'-methoxy-ribonucleotides; (10) The pharmaceutical composition, wherein the nucleotides at positions 1 and 2 from the 5' end of the sense strand are linked to each other via phosphorothioate internucleotide linkages.

58. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, (1) the antisense strand comprises (mU)#(fA)#(mA)(fA)(fU)(fU)(mU)(fG)(mG)(fA)(mG)(fA)(mU)(fC)#(mC)#(fG)#(mA)#(mG)#(mA)#(fG)#(mA); (2) the sense strand comprises (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA); wherein "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, and "#" corresponds to a phosphorothioate internucleotide linkage.

59. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, (1) the antisense strand comprises (mU)#(fA)#(mU)(fA)(fA)(mU)(fG)(mG)(fU)(mA)(fG)(mC)(fU)#(mA)#(fU)#(mG)#(mA)#(mU)#(fG)#(mA); (2) the sense strand comprises (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA); wherein "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, and "#" corresponds to a phosphorothioate internucleotide linkage.

60. 60. The dsRNA of claim 58 or 59, wherein the antisense strand comprises a 5' vinyl phosphonate.

61. 61. The dsRNA of any one of claims 58 to 60, comprising a docosanoic acid (DCA) conjugate linked to the 3' end of the sense strand.

62. 62. The dsRNA of claim 61, wherein the DCA is linked to the sense strand by a linker.

63. 63. The dsRNA of claim 62, wherein the linker is a cleavable linker.

64. 64. The dsRNA of claim 63, wherein the cleavable linker comprises a phosphodiester linkage, a disulfide linkage, an acid-labile linkage, or a photocleavable linkage.

65. 65. The dsRNA of Claim 63 or 64, wherein the cleavable linker comprises a dTdT dinucleotide having a phosphodiester internucleotide linkage.

66. 66. The dsRNA of any one of claims 62 to 65, wherein the linker comprises a bivalent or trivalent linker.

67. The bivalent or trivalent linker is 【Transformation 3】 67. The dsRNA of claim 66, selected from the group consisting of: wherein n is 1, 2, 3, 4, or 5.

68. 68. The dsRNA of any one of claims 62 to 67, wherein when the linker is a trivalent linker, the linker further links a phosphodiester or phosphodiester derivative.

69. 69. The dsRNA of claim 68, wherein the phosphodiester or phosphodiester derivative is selected from the group consisting of: 【Chemistry 4】 (wherein X is O, S or BH ３ (It is).

70. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, (1) the antisense strand comprises V(mU)#(fA)#(mA)(fA)(fU)(fU)(mU)(fG)(mG)(fA)(mG)(fA)(mU)(fC)#(mC)#(fG)#(mA)#(mG)#(mA)#(fG)#(mA); (2) the sense strand comprises (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA)(T)(T)-PCDCA; wherein "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, "T" corresponds to a thymidine DNA nucleotide, "#" corresponds to a phosphorothioate internucleotide linkage, "V" corresponds to a 5'-vinyl phosphonate, and "PCDCA" corresponds to a 3'-C7-phosphocholine-docosanoic acid conjugate via a phosphate linker.

71. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, (1) the antisense strand comprises V(mU)#(fA)#(mU)(fA)(fA)(mU)(fG)(mG)(fU)(mA)(fG)(mC)(fU)#(mA)#(fU)#(mG)#(mA)#(mU)#(fG)#(mA); (2) the sense strand comprises (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA)(T)(T)-PCDCA; wherein "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, "T" corresponds to a thymidine DNA nucleotide, "#" corresponds to a phosphorothioate internucleotide linkage, "V" corresponds to a 5'-vinyl phosphonate, and "PCDCA" corresponds to a 3'-C7-phosphocholine-docosanoic acid conjugate via a phosphate linker.

72. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, (1) The antisense strand comprises Formula I or a salt thereof: 【Transformation 5】 (2) The sense strand is represented by Formula II or a salt thereof: 【Transformation 6】 The dsRNA molecule comprising:

73. A double-stranded RNA (dsRNA) molecule comprising an antisense strand and a sense strand, each strand having a 5' end and a 3' end, (1) The antisense strand comprises Formula III or a salt thereof: 【Transformation 7】 (2) The sense strand is represented by Formula IV or a salt thereof: 【Transformation 8】 The dsRNA molecule comprising:

74. 74. The dsRNA of claim 72 or 73, wherein the salt comprises a sodium salt or a potassium salt.

75. 10. A method of treating or managing PE, postpartum PE, eclampsia, or HELLP syndrome, comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the dsRNA of any one of claims 58-74.

76. 75. A method of treating one or more symptoms of an angiogenic disorder in a subject in need thereof, comprising administering to said subject a dsRNA of any one of claims 58-74.

77. A pharmaceutical composition comprising a first dsRNA and a second dsRNA: the first dsRNA comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end; (1) the antisense strand comprises V(mU)#(fA)#(mA)(fA)(fU)(fU)(mU)(fG)(mG)(fA)(mG)(fA)(mU)(fC)#(mC)#(fG)#(mA)#(mG)#(mA)#(fG)#(mA); (2) the sense strand comprises (mC)#(mG)#(mG)(fA)(mU)(fC)(mU)(fC)(mC)(fA)(mA)(mA)(mU)(fU)#(mU)#(mA)(T)(T)-PCDCA; the second dsRNA comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end; (1) the antisense strand comprises V(mU)#(fA)#(mU)(fA)(fA)(mU)(fG)(mG)(fU)(mA)(fG)(mC)(fU)#(mA)#(fU)#(mG)#(mA)#(mU)#(fG)#(mA); (2) the sense strand comprises (mA)#(mU)#(mA)(fG)(mC)(fU)(mA)(fC)(mC)(fA)(mU)(mU)(mU)(fA)#(mU)#(mA)(T)(T)-PCDCA; wherein "m" corresponds to a 2'-O-methyl modification, "f" corresponds to a 2'-fluoro modification, "T" corresponds to a thymidine DNA nucleotide, "#" corresponds to a phosphorothioate internucleotide linkage, "V" corresponds to a 5'-vinylphosphonate, and "PCDCA" corresponds to a 3'-C7-phosphocholine-docosanoic acid conjugate via a phosphate linker.

78. A pharmaceutical composition comprising a first dsRNA and a second dsRNA: the first dsRNA comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end; (1) The antisense strand comprises Formula I or a salt thereof: 【Chemistry 9】 (2) The sense strand comprises Formula II or a salt thereof: 【Chemistry 10】 the second dsRNA comprises an antisense strand and a sense strand, each strand having a 5' end and a 3' end; (1) The antisense strand comprises Formula III or a salt thereof: 【Chemistry 11】 (2) The sense strand is represented by Formula IV or a salt thereof: 【Chemistry 12】 The pharmaceutical composition comprising:

79. 79. The pharmaceutical composition of claim 78, wherein the salt comprises a sodium salt or a potassium salt.

80. A method for treating or managing PE, postpartum PE, eclampsia or HELLP syndrome, comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition of claim 77 or 78.

81. 80. A method of treating one or more symptoms of an angiogenic disorder in a subject in need thereof, comprising administering to said subject a pharmaceutical composition of claim 77 or 78.

Images